Docstoc

PSKH-1 Ribozymes - Patent 5856463

Document Sample
PSKH-1 Ribozymes - Patent 5856463 Powered By Docstoc
					


United States Patent: 5856463


































 
( 1 of 1 )



	United States Patent 
	5,856,463



 Prydz
,   et al.

 
January 5, 1999




 PSKH-1 ribozymes



Abstract

Disclosed is a purified full-length cDNA molecule encoding putative serine
     kinase enzyme (PSKH-1), and the expression of the cDNA in a recombinant
     host cell to produce substantially purified PSKH-1, per se. Inactivation
     of PSKH-1 pre-MRNA or PSKH-1 mRNA halts DNA synthesis and cell division.
     Also disclosed are ribozymes capable of cleaving PSKH-1 pre-mRNA or mRNA
     and thus deactivating PSKH-1 translation. Ribozymes of the hammerhead and
     hairpin motifs, and various compositions containing same, are also
     disclosed. The ribozymes compositions are used in the treatment of
     mammalian patients suffering from diseases or medical conditions
     characterized by abnormal cell proliferation or growth such as cancer and
     various non-malignant diseases or medical conditions such as autoimmune
     diseases, allograft rejection and atherosclerosis.


 
Inventors: 
 Prydz; Hans Peter Blankenborg (0376 Oslo, NO), Brede; Gaute (0282 Oslo, NO) 
Appl. No.:
                    
 08/715,568
  
Filed:
                      
  September 18, 1996


Foreign Application Priority Data   
 

Sep 18, 1995
[NO]
953680



 



  
Current U.S. Class:
  536/24.5  ; 435/375; 435/6; 435/91.31; 536/23.1; 536/23.2
  
Current International Class: 
  C12N 15/11&nbsp(20060101); C12N 9/12&nbsp(20060101); A61K 38/00&nbsp(20060101); C07H 021/04&nbsp(); C12Q 001/68&nbsp()
  
Field of Search: 
  
  






 435/6,91.31,199,375 514/44 536/24.5 935/33
  

References Cited  [Referenced By]
U.S. Patent Documents
 
 
 
5144019
September 1992
Rossi et al.

5246921
September 1993
Reddy et al.

5272262
December 1993
Rossi et al.

5436330
July 1995
Taira et al.

5441880
August 1995
Beach et al.

5443962
August 1995
Draetta et al.

5459127
October 1995
Felgner et al.

5496698
March 1996
Draper et al.

5527895
June 1996
Hampel et al.



 Foreign Patent Documents
 
 
 
WO 9524202
Sep., 1995
WO



   
 Other References 

Christoffersen et al. Ribozymes as Human Therapeutic Agents. J. Med. Chem. 38(12): 2023-2037, Jun. 1995.
.
Gewirtz et al. Facilitating Oligonucleotide Delivery: Helping Antisense Deliver on its Promise. Proc. Natl. Acad. Sci. USA 93 3161-3163, Apr. 1996.
.
Gura. Antisense has Growing Pains. Science 270: 575-577, Oct. 1995.
.
Stull et al. Antigens, Ribozyme and Aptamer Nucleic Acid Drugs: Progress and Prospects. 12(4): 465-482, Apr. 1995.
.
Larsen et al., Hum. Mol. Gen. 2(10):1589-1595 (1995).
.
Hanks, Proc. Natl. Acad. Sci. USA 84:388-392 (1987).
.
Kim et al., Proc. Natl. Acad. Sci. USA 84:8788-8792 (1987).
.
Haseloff et al., Nature 334:585-591 (1988).
.
Cech, JAMA 260(20):3030-3034 (1988).
.
Jefferies et al., Nucl. Acad. Res. 1989, 17, 1371.
.
Cech et al., Nature 372:39-40 (1994).
.
Uhlenbeck, Nature 328:596-600 (1987).
.
Forster et al., Cell 50:9-16 (1987).
.
Pley et al., Nature 372:68-74 (1994).
.
Tuschl et al., Science 266:785-789 (1994).
.
Pyle, Science 261:709-714 (1993).
.
Hampel et al., 28 Biochemistry 4929, 1989.
.
Hampel et al., 18 Nucleic Acid research 299, 1990.
.
Felgner et al., Proc. Natl. Acad. Sci. USA 84:7413-7417 (1987).
.
Pachuk et al., Proc. Annu. Meet Am Assoc. Cancer Res. 34:A2313 (1993) (Abstract Only).
.
Leopold et al., Blood (United States)85:2162-70 (1995) (Abstract Only).
.
Vertosick et al., J. Neurooncol (Netherlands) 19(2):97-103 (1994) (Abstract Only).
.
Baier et al., Mol. Immunol. 31(12):923-32 (1994) (Abstract Only)..  
  Primary Examiner:  LeGuyader; John L.


  Assistant Examiner:  Larsen; Thomas G.


  Attorney, Agent or Firm: Lerner, David, Littenberg, Krumholz & Mentlik



Claims  

We claim:

1.  A ribozyme that cleaves PSKH-1 pre-mRNA or PSKH-1 mRNA.


2.  The ribozyme of claim 1, which is a hammerhead ribozyme.


3.  The ribozyme of claim 2, comprising the sequence set forth as SEQ ID NO:3.


4.  The ribozyme of claim 1, which is a hairpin ribozyme.


5.  The ribozyme of claim 4, comprising the sequence set forth as SEQ ID NO:6.


6.  A composition comprising the ribozyme of claim 1, and a carrier.


7.  A composition comprising the ribozyme of claim 3 and a carrier.


8.  The composition of claim 7, which is in the form of a sustained-release device.


9.  The composition of claim 6, which is in the form of an aqueous composition.  Description  

FIELD OF THE INVENTION


The invention relates to the field of catalytic RNAs or ribozymes, and their use to treat diseases and other medical conditions characterized by uncontrolled cell growth.


BACKGROUND OF THE INVENTION


In recent years, some progress has been made in the elucidation of cellular events leading to the development of progression of diseases and other medical conditions characterized by abnormal cell growth.  For instance, a great amount of research
has centered on the identification of genes which are altered or mutated in cancer relative to normal cells.  Nonetheless, current cancer treatment modalities are still inadequate in one or more respects.  In cancer patients, the prominent immune
depression in response to chemotherapy has been widely confirmed.  Accordingly, immunotherapy and immunochemotherapy have drawn much attention as adjuvants to existing cancer treatments.  Immunotherapy has been reported as not only restoring or
potentiating the specific immune responses against cancer, but also improving the general immunological functions of the patient.  However, the immunomodulators used in such therapies tend to act in a non-specific manner against cancer cells and also
exert direct cytocidal affects against neoplastic cells and behave in a manner more akin to chemotherapeutic agents.


A variety of non-malignant disease states are also characterized by abnormal cell growth.  Allograft rejection and autoimmune diseases, for example, involve immune responses characterized by undesirable proliferative bursts of B-lymphocytes or
T-lymphocytes.  Current treatment modalities for these diseases and medical conditions typically involve immunosuppresive protocols.  In the case of allograft rejection, illustrative protocols have featured the administration of drugs such as
azathioprine, cyclosporine, and corticosteroids, all of which cause toxic side-effects to non-lymphoid tissues.  The development of pan-T-lymphocyte-specific monoclonal antibodies was purported to be an important refinement in therapy on the basis that
antibodies targeted only the T-lymphocytes.  However, this therapy has proven to be disadvantageous in that it also destroys T-lymphocytes required for normal immune surveillance.


The phenotype common to cancers and the aforementioned non-malignant diseases is abnormal cell growth.  The life cycle of a cell is traditionally divided into four phases, G1 (Gap 1), S (DNA synthesis), G2 (Gap 2), and M (mitosis).  In the
mitosis phase, chromosomes condense and become visible as discrete bodies.  The two centrosomes of the cell move apart to opposite sides of the nucleus, and arrays of microtubules grow from the centrosomes to form a mitotic spindle.  The centrosomes thus
define the anchoring points for the microtubuli which in turn direct the chromosomes to the proper place in the cell.  Some of these microtubules become attached to the kinetochores of the chromosomes.  The attached chromosomes become aligned on the
metaphase plate, anaphase begins and the chromosomes start moving toward the poles and the poles move apart from each other.  Cytokinesis then occurs, wherein the cell pinches and ultimately becomes two G1 phase daughter cells.  G1 are not synthesizing
DNA, but active in other replication-type activities in order to provide the two daughter cells with the appropriate organelles.  G1 cells then proceed into the S phase where the chromosomal DNA of the cell replicates to produce double DNA content.  At
the boundary of the S and the G2 phases, the replication machinery signals that DNA replication is complete.  The cell then enters the G2 phase and prepares for mitosis.  Thus, cells in the G2 phase have double DNA content.  It is critical that cell
division proceeds in an orderly manner such that each daughter cell receives a correct and complete set of chromosomes.  Most adult, differentiated non-dividing cells are considered to be in a non-cycling state termed G.sub.0.


If the nechanisms that underlie cell division could be disarmed or inactivated, procedures and perhaps even pharmacologic agents could be developed in an attempt to control or inhibit the growth of unwanted, diseased cells in a wide variety of
cancers and non-malignant diseases characterized by abnormal cell growth.  It goes without saying that such discoveries would be of pioneering proportions in clinical medicine.


SUMMARY OF THE INVENTION


Applicant has now succeeded in isolating and purifying a full-length CDNA molecule encoding a putative serine kinase enzyme (PSKH-1).  The substrate for this enzyme and the reaction conditions in vivo still remain unknown.  However, Applicant has
expressed PSKH-1 cDNA in recombinant host cells to prepare substantially purified PSKH-1 protein, and has raised anti-PSKH-1 antibodies.  Intrigued by the results of experiments that pinpointed the cellular localization of PSKH-1 in or on the
centrosomes, Applicant conducted further experiments to determine the fate of the cell life cycle if this enzyme were inactivated.  Applicant has surprisingly and unexpectedly discovered that disarming or inactivating the expression of PSKH-1 in cells
arrests or halts DNA synthesis and cell division.


One aspect of the present invention is directed to an isolated and purified cDNA molecule encoding full-length PSKH-1 protein, as well as PSKH-1, per se.  Also provided are expression constructs, vectors and host cells containing PSKH-1 cDNA, and
methods for preparing substantially purified PSKH-1 via recombinant techniques.


Another aspect of the present invention is directed to ribozymes or enzymatically active RNA molecules, capable of cleaving PSKH-1 pre-mRNA or PSKH-1 mRNA so as to prevent PSKH-1 expression in vivo.  Preferred ribozymes are of the hammerhead or
the hairpin motifs.  The ribozymes are formulated into compositions useful for treating mammalian patients suffering from diseases or medical conditions characterized by abnormal or uncontrolled cell proliferation or growth.  Representative compositions
include slow-release devices such as micropumps, biodegradable vehicles, alginates having defined pore sizes, and target cell-specific liposomes.  In a preferred embodiment wherein the composition contains a hammerhead ribozyme that is sufficiently
hydrophobic so as to be internalized by the target cells on its own, i.e., without a liposome-type vehicle, the composition is provided simply in the form of an aqueous solution in a slow-release device.


A further aspect of the present invention is directed to the use of the ribozyme compositions in methods for treating mammalian patients suffering from such diseases or medical conditions such as cancers and malignancies, as well as a variety of
non-malignant diseases characterized by abnormal or uncontrolled cell proliferation or growth such as autoimmune diseases, allograft rejection, and atherosclerosis. 

BRIEF DESCRIPTION OF THE DRAWINGS


The file of this patent contains at least one drawing executed in color.  Copies of this patent with colored drawings will be provided by the Patent and Trademark Office upon request and payment of the necessary fee.


FIG. 1 is a schematic diagram of the secondary structure of a complex between a preferred hammerhead ribozyme (denoted as SEQ ID NO:3) in accordance with the present invention and a specific sequence of PSKH-1 mRNA(denoted as SEQ ID NO:4), (bases
in bold) wherein the (- - -) represent Watson-Crick hydrogen bonding and "PS" indicates phosphothioate bonds;


FIG. 2 is a schematic diagram of the secondary structure of a complex between a hairpin ribozyme of the present invention (denoted as SEQ ID NO:6)and a specific sequence of PSKH-1 RNA (denoted SEQ ID NO:7) (bases in bold), wherein the (- - -)
represent Watson-Crick hydrogen bonding;


FIG. 3A is a microphotograph that illustrates using red fluorescence the centrosomal location in Cos-1 cells of a monoclonal antibody known to react with centrosomes, and FIG. 3B is a microphotograph that illustrates using green fluorescence the
centrosomal localization of anti-PSKH-1 in the same Cos-1 cells; and


FIGS. 4A, 4B, 4C, and 4D are graphs prepared from results obtained from flow cytometric measurements on the number of HL-60 cells stained with propidium iodide and treated with random oligonucleotide (FIG. 4A), ribozyme specific to amelogenin
(4B), catalytically inactive ribozyme (4C), and ribozyme specific to PSKH-1 (4D), versus the fluorescence intensity. 

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENT


The nucleotide sequence of the full-length PSKH-1 cDNA, i.e., including the 5' untranslated sequence (nucleotides 1-94), protein-encoding sequence, and 3' untranslated sequence (2084 nucleotides in length), and its deduced amino acid sequence,
are set forth below in Table I as SEQ ID NOS:1 and 2, respectively.


 TABLE I  __________________________________________________________________________ ##STR1##  ##STR2##  ##STR3##  ##STR4##  ##STR5##  ##STR6##  ##STR7##  ##STR8##  ##STR9##  ##STR10##  ##STR11##  ##STR12##  ##STR13##  ##STR14##  ##STR15## 
##STR16##  ##STR17##  ##STR18##  ##STR19##  ##STR20##  ##STR21##  ##STR22##  ##STR23##  ##STR24##  ##STR25##  ##STR26##  ##STR27##  ##STR28##  ##STR29##  ##STR30##  ##STR31##  ##STR32##  ##STR33##  ##STR34## 
CGACCCAGCCTGGCCACACACTGTGGTGCCATCTGGGTCCGATGCCCTCTC1447  TGGAGATAGGCCTATGTGGCCCACAGTAGGTGAAGAATGTCTGGCTCCAGC1498  CCTTTCTCTGTCGGTTCACCAGCCCCTGTCCTCACCATGGGCCTGGGCCAG1549  GTGTGACAGAGTAGAGGTAGCACAGGGGGCTGTCCTCACCATGGGCCTGGG1600 
CCAGGTGTGACAGAGTAGAGGTAGCACAGGGGGCTGTGACTCCCCCTGAAC1651  TGGGAGCCTGGCCTGGCAGTGATACCCCTCTTGGTGGGCAGCTGCTCTGGT1702  GGAGTTGGGAAGGGATAGGACCTGGCCTTCACTGTCTCCCTTGCCCTTTGA1753  CTTTTCCCCAATCAAAGGGAACTGCAGTGCTGGGTGGAGTGTCCTGTCGCC1804 
TCAGGACCCTTTGGGACAGTTACTTCTGGGACCCCCTTTCCTCCACAGAGC1855  CCTTCTCCCTCCTTTCACACATTCCCATGCATCCTGATCCTTAAGATTATG1906  CTCCAGTGGGAGACCCTGGTAGGCACAAAGCTTGTGCCTTGACTGGACCCG1957  TAGCCCCTGGCTAGGTCGAAACAGCCCTCCACCTCCCAGCCAAGATCTGTC2008 
TTCCTTCATGGTGCCTCCAGGGAGCCTTCCTGGTCCCAGGACCTCTGGTGG2059  AGGGCCATGGCGTGGACCTTCACCCTTCTGGACTGTGTGGCCATGCTGGTC2110  ATCGGCTTGCCCAGGCTCCAGCCTCTCCAGATTCTGAGGGGTCTCAGCCCA2161  CCGCCCTTGGTGCCTTCTTTGTAGAGCCCACCGCTACCTCCCTCTCCCCGT2212 
TGGATGTCCATTCCATTCCCCAGGTGCCTCCTTCCCAACTGGGGGTGGTTA2263  AAGGGACGCCCACTGCTGCTACCTGGGGAATGGGGCACCTGGGGCCCAAGG2314  CAGAGGGAAGGGGGTCCTCCCGATTAGGGTCGAGTGTCAGCCTGGGTTCTA2365  TCCTTTGGTGCAGCCCCATTGCCTTTTCCCTTCAGGCTCTGTTGCTCCCTC2416 
CTCTGCAGCTGCACGAAGGCGCCATCTGGTGTCTGCATGGGTGTTGGCAGC2467  CTGGGAGTGATCACTGCACGCCCATCCTCCACACCTGCCCATCGTGCACAC2518  CCACCCATGGTGCACACCTGTAGTCCTCCATGAGGACATGGGAAGGTAGGA2569  GTTGCCGCCCTGGGGGAGGGTCCCGGGCTGCTCACCTCTCCCCTTCTGCTG2620 
AGCTTCTGCGCACCCCTCCCTGGAACTTAGCCATACTGTGTGACCTGCCTC2671  TGAAACCAGGGTGCCAGGGGCACTGCCTTCTCACAGCTGGCCTTGCCCCGT2722  CCACCCTGTGCTGCTTCCCTTCACAGCATTAACCTTCCAGTCTGGGTCCCA2773  CTGAGCCTCAAGCTGGAAGGAGCCCCTGCGGGAGGTGGGTGGGGTTGGGTG2824 
GCTGCTTTCCCAGAGGCCTGACGCCAGAACCATCCCCATTTCTTTTGTGGT2875  ATCTCCCCCTACCACAAACCAGGCTGGAACCCAAGCCCCTTCCTCCACAGC2926  TGCCTTCAGTGGGTAGAATGGGGCCAGGGCCCAGCTTTGGCCTTAGCTTGA2977  CGGCAGGGCCCCTGCCATTGCACGAGGGTTTGGTTCCCACTCAGCTTCTCC3028 
GGTCGGCAGCCTGGGCCAGGCCCTTTTCCTGCATGTGCCACCTCCAGTGGG3079  AAACAAAACTAAAGAGACCACTCTGTGCCAAGTCGACTATGCCTTAGACAC3130  ATCCTCCTACCGTCCCCAATGCCCCTGGGCAGGAGGCAGTGGAGAACCAAG3181  CCCCATGGCCTCAGAATTTCCCCCCAGTTCCCCAAGTGTCTCTGGGGACCT3232 
GAAGCCCTGGGGCTTACGTTCTCTCTTGCCCAGGGTGGCCTGGTCCTGAGG3283  GCAGGACAGGGGGTTTGCAGATGTGGGCCTTTGATAGACCCACTTGGGCCT3334  TCATGCCATGGCCTGTGGATGGAGAATGTGCAGTTATTTATTATGCGTATT3385  CAGTTTGTAAACGTATCCTCTGTATTCAGTAAACAGGCTGCCTCTCCAGGG3436 
AGGGCTGCCATTCATTCCAACAAAAAAAAAAAAAA (SEQ ID NO:1)3471  __________________________________________________________________________


The nucleotide sequence 95-3471 was described in the European Molecular Biology Laboratory (EMBL) release referred to in Larsen et al., Hum.  Mol. Gen.  2(10):1589-1595 (1993).  The nucleotide sequence 687-1138 and the deduced amino acid sequence
were reported in Hanks, Proc.  Natl.  Acad.  Sci.  USA 84:388-392 (1987).  However, the Larsen publication fails to disclose nucleotides 1-94, which constitute a 30 nucleotide exon 1 and a 64 nucleotide addition to what was reported in Larsen as the
first coding exon of the gene.  See page 1590 of Larsen.  Even though the present inventor had succeeded in cloning a relatively large portion of the PSKH-1 gene, the elucidation of the 94 nucleotide sequence containing the first exon presented unusual
difficulties, due in large part to the relative size of the first intron (about 10 kb in length) compared to the first exon, and the presence of a CpG island in the region of the 5' regulatory sequence/first exon.


PSKH-1 DNA may be prepared in accordance with standard procedures such as miniprep methods.  A construct for the expression of PSKH-1 protein can be prepared using standard recombinant DNA techniques.  See, e.g., J. Sambrook et. al., "Molecular
Cloning; A Laboratory Manual" (1989); "DNA Cloning", Vols.  I and II (D. N. Glover ed.  1985).  PSKH-1 can be expressed in a variety of hosts, including both prokaryotes and eukaryotes such as bacteria, yeasts, and mammalian cells.  Appropriate 5' and 3'
regulatory sequences and the vector and transformation procedure are chosen on the basis of the given hosts.  Preferred vectors include Bluescript (Stratagene), pcDNA3, pMAL, pGST, and PSFV 1 (Semliki Forest Virus).  A preferred host cell is E. coli. 
More preferred are mammalian immortalized cell lines such as baby hamster kidney (BHK) cells, HeLa.  cells and Chinese hamster ovary (CHO) cells.  These cell lines are available from the ATCC.


Following expression, the PSKH-1 protein can be purified to the extent desired in accordance with standard purification procedures known in the art.  Representative purification schemes include ultrafiltration, gel electrophoresis, gel
filtration, ammonium sulfate precipitation, and chromatographic techniques such as ion exchange chromatography, size exclusion chromatography, HPLC, reverse phase HPLC, hydroxyapatite, affinity chromatography, e.g., immunosorbent chromatography, and the
like..  PSKH-1 protein, or antigenic fragments thereof, are used to prepare anti-PSKH-1 antibodies for use in assays to determine the cellular localization of PSKH-1, as well as to measure the specificity of the ribozymes of the present invention.


Yet another aspect of the present invention is directed to ribozymes that cleave PSKH-1 pre-mRNA or mRNA.  The ribozymes are designed based upon the PSKH-1 DNA sequence.  Until 1981, it had been axiomatic that all enzymes were composed of
proteins.  Investigators discovered that ribosomal RNA precursor of tetrahymena, a protozoan, expels an intron (IVS) unnecessary for the transfer of gene information by self-splicing without the aid of any protein.  See Cech et al., Nature 308:820-825
(1984).  Ribozymes are typically RNA molecules having an enzymatic activity which is able to repeatedly cleave other separate RNA target molecules in a nucleotide base sequence specific manner, blocking their expression and with affecting normal
functions of other genes.  Ribozymes can be targeted to virtually any RNA transcript, and achieve efficient cleavage in vitro.  See Kim et al., Proc.  Natl.  Acad.  Sci.  USA 84:8788-8792 (1987), Haseloff et al., Nature 334:585-591 (1988), Cech, JAMA
260(20):3030-3034 (1988), and Jefferies et al., Nucl.  Acad.  Res.  1989, 17, 1371.  Ribozymes act by first binding to a target RNA.  Such binding occurs through the target RNA binding portion of the ribozyme, which is held in close proximity to an
enzymatic portion of the RNA which acts to cleave the target RNA.  Thus, the ribozyme first recognizes and then binds a target RNA by complementary base-pairing.  Once bound to the correct site, it then acts enzymatically to cut the target RNA. 
Strategic cleavage of the target RNA will destroy its ability to direct synthesis of an encoded protein.  After the ribozyme has bound and cleaved its target RNA, it is released from that target RNA such that it searches other targets and such can
repeatedly bind and cleave different nucleotides of the same target RNAs.


In preferred embodiments, the ribozymes of the present invention may be formed in various motifs, such as the motif of a hammerhead, hairpin, or hepatitis delta virus in association with an RNA guide sequence.  Hammerhead ribozymes, which are
particularly preferred, are members of classes related to the replication cycle of a group of self-replicating RNAs called viroid-like pathogens (VLPs).  The hammerhead ribozymes are made up of three base paired stems and a core of highly conserved,
non-complementary nucleotides essential for catalysis.  See Cech et al., Nature 372:39-40 (1994).  This catalytic motif is commonly referred to as the "hammerhead", and typically consists of about 23 nucleotides.  The three-dimensional structure of
hammerhead ribozymes and their mode of action or requirements for cleavage have been elucidated.  See, e.g., Uhlenbeck, Nature 328:596-600 (1987), Forster et al., Cell 50:9-16 (1987), Pley et al., Nature 372:68-74 (1994), and Tuschl et al., Science
266:785-789 (1994).  See also U.S.  Pat.  Nos.  5,436,330, 5,246,921, 5,496,698, and 5,144,019.  These ribozymes will catalyze cleavage of target RNA in the presence of Mg.sup.2 +. Pyle, Science 261:709-714 (1993).  Commercial application of hammerhead
ribozymes has also been described in WO 90/05852, published Jun.  29, 1989.  Hammerhead ribozyme activity is targeted to a specific mRNA or pre-mRNA.  (i.e., which contains introns) by choosing the sequences flanking the catalytic motif.  Given that
hammerhead ribozymes have a propensity for cleaving target mRNAs after, e.g., the base sequence GUC, hammerhead ribozymes may be customized by including complementary sequences to the 5' and 3' base sequences that flank the cleavage site.  Hammerhead
ribozymes may have specificity for several other RNA triplets, including GUA, GUG, GUU and AUU.


FIG. 1 schematically illustrates the secondary structure of the complex formed between a preferred hammerhead ribozyme of the present invention (denoted as SEQ ID NO:8) and ribonucleotides 136-149 of the PSKH-1 RNA (denoted as SEQ ID NO:4).  The
PSKH-1 ribozyme contains a single strand chain of 35 bases or ribonucleotides, as follows: ##STR35## All of the ribonucleotides except for nos.  10, 11, 13, 27 and 30 (counting from the 5' end) are modified in that they are substituted with an allyl
group in the 2' position.  The three 3' ribonucleotides are linked together via phosphorothioate links instead of phosphodiester links.  The hammerhead portion of the ribozyme consists of bases 8-30.  The ribozyme also comprises a succession of bases at
each end which is complementary to six bases in the sequence of the PSKH-1 mRNA (i.e., bp's 136-141 and 143-148), such that the ribozyme contains twelve bases that are complementary to the PSKH-1 mRNA.  Located between these two six base regions in the
PSKH-1 mRNA is a GUC triplet sequence which is the target for the ribozyme (i.e., the bond between cytosine nucleotides 142 and 143).  The ribozyme cleaves the PSKH-1 pre-mRNA and mRNA at this triplet.  Aside from the most 5' and 3' bases of the ribozyme
which must be complementary to the RNA target, the hammerhead portion of the PSKH-1 ribozyme depicted in FIG. 1 may be represented generically by the following sequence:


wherein N represents A, C, G, or U; N' represents a ribonucleotide, e.g., A, C, G or U, complementary to base (N).sub.x to allow for the formation of Watson-Crick hydrogen bonding; and x=2, 3 or 4.


Ribozymes of the hairpin motif are characterized by a hairpin-like configuration when the target RNA-ribozyme complex is modeled in two dimension for minimum energy folding.  The "hairpin" portion typically is not an absolute hairpin in the sense
that not all bases of the hairpin portion are base-paired.  The catalytic complex is a complex of the minimum, or substantially the minimum, sequence of the catalyst necessary for activity and the minimum, or substantially the minimum, target sequence of
the substrate RNA.  To design a hairpin ribozyme, the bases flanking the cleavage sequence must be identified and the ribozyme engineered so that it does not pair in two-dimensional space with the cleavage sequence, but instead pairs with adequate
numbers of flanking bases upstream and downstream of the cleavage sequence.  Teachings of the design of hairpin ribozymes are disclosed, for example, in Hampel et al., 28 Biochemistry 4929, 1989; Hampel et al., 18 Nucleic Acid Research 299, 1990; and
U.S.  Pat.  No. 5,527,895.  A preferred hairpin ribozyme is depicted schematically in FIG. 2.  A preferred cleavage site is 5' NGUC 3', specifically the bond between ribonucleotides N 40 and G, as illustrated in FIG. 2 with the PSKH-1 RNA sequence
135-148 (denoted in FIG. 2 as SEQ ID NO:7)(the cleavage site being the bond between the uracil and guanine ribonucleotides at positions 139 and 140, respectively).  In general, aside from the most 5' ribonucleotides which must be complementary to the
target site and its 5' and 3' flanking sequences, the ribonucleotides in the stems or helices (i.e., bases 15-50 counting from the 5' end of the ribozyme) may be exchanged provided that complementarity (to allow for the hydrogen bonding) is preserved.


The types of ribozymes discussed above are not limiting in the invention.  All that is necessary is that the ribozyme has a specific substrate binding site which is complementary to one or more of the target PSKH-1 mRNA or pre-mRNA regions, and
that it has nucleotide sequences within or surrounding the PSKH-1 mNA binding site which impart an RNA cleaving activity to the ribozyme.  The ribozymes of the present invention may be prepared by recombinant techniques or chemical synthesis.  The
procedure of choice will depend in part on whether the ribozyme contains modified ribonucleotides as these must be linked to the ribozyme chain via chemical means.  See, e.g., U.S.  Pat.  Nos.  5,272,262, 5,144,019 and 5,246,921.  Chemical synthesis is
preferred.


A further aspect of the present invention is directed to the use of ribozymes that cleave PSKH-1 mRNA or pre-mRNA in the treatment of patients suffering from diseases or medical conditions characterized by uncontrolled cell proliferation or
growth.  Representative diseases and medical conditions include cancers or malignancies, such as carcinomas of the brain, heart, colon, rectum, bladder, kidney, liver, lung, ovary, pancreas and stomach, hematopoietic tumors of lymphoid and myeloid
lineage, as well as non-malignant disease conditions such as autoimmune diseases (i.e., which involve uncontrolled B-or T-cell proliferation), allograft rejection and atherosclerosis development.


The ribozymes of the present invention can be delivered to the target cells, i.e., those that are undergoing abnormal proliferation or growth, in accordance with drug delivery modes known in the art.  For example, disease tissue-specific delivery
may be accomplished by utilizing lipid delivery systems such as targeted liposomes (see, e.g., U.S.  Pat.  Nos.  5,144,019 and 5,459,127, and Felgner et al., Proc.  Natl.  Acad.  Sci.  USA 84:7413-7417 (1987)) or simply by injection of an aqueous
solution of the ribozyme directly into a tumor or disease situs.  Other representative delivery modes include slow-release devices such as micropumps, biodegradable vehicles, and alginates having defined pore sizes.  In a preferred embodiment wherein the
composition contains the hammerhead ribozyme schematically illustrated in FIG. 1 which is sufficiently hydrophobic so as to be internalized by the target cells on its own, i.e., without a liposome-type vehicle, the composition is provided simply in the
form of an aqueous solution in a slow-release device.  One main advantage of the compositions and methods of the present invention is that they do not require the aid of target-specific ligands in which to direct the ribozymes to the target (diseased)
cells and not to non-diseased cells.  While not intending to be bound by any particular theory of operation, the present inventors believe that PSKH-1 is expressed and present in actively dividing cells, and that the enzyme is not present in normal,
differentiated (i.e., G.sub.0 state) cells.


In addition, because of their specific and catalytic mode of action, the ribozymes of the present invention are ideal agents for therapeutic intervention in diseases characterized by uncontrolled cell growth or proliferation.  In addition, the
enzymatic nature of the ribozymes is advantageous over other technologies such as antisense technology (i.e., where a nucleic acid molecule simply binds to a nucleic acid target to block its translation), because the effective concentration of ribozyme
necessary to effect a therapeutic treatment is lower than that of antisense oligonucleotide.  This advantage reflects the ability of the ribozyme to act enzymatically.  Thus, a single ribozyme molecule is able to cleave many molecules of target PSKH-1
MRNA.  The therapeutically effective amount of the ribozyme can be determined in accordance with standard techniques.  See U.S.  Pat.  No. 5,246,921.  In general, the ribozymes of the present invention are administered in doses of about 1 to about 10
mg/kg of body weight per day.


Further, the ribozyme is a highly specific inhibitor, with the specificity of inhibition depending not only on the base pairing mechanism of binding, but also on the mechanism by which the molecule inhibits the expression of the PSKH-1 mRNA. 
That is, the inhibition is caused by the cleavage of the PSKH-1 mRNA and so specificity is defined as the ratio of the rate of cleavage of the PSKH-1 mRNA over the rate of cleavage of non-targeted RNA.  Thus, it is thought that the specificity of action
of the ribozymes of the present invention is greater than that of an antisense oligonucleotide binding the same PSKH-1 mRNA site.


The invention will be further described by reference to the following detailed examples.  These examples are provided for purposes of illustration only, and are not intended to be limiting unless otherwise specified.  Unless otherwise indicated,
all parts are by weight.


EXAMPLE 1


Determination Of The sequence of Full Length PSKR-1 cDNA


The determination of the sequence of the 5' end of PSKH-1 cDNA was conducted using 5' RACE.TM.  technology, as follows.  The first primer, 5' GTGTGCATACTGACTTGCTG 3' (SEQ ID NO:8), was placed 160 bp downstream of the ATG start codon of the PSKH-1
cDNA.  The second primer, 5' TCCACCTCTGTGATGAAGTG 3' (SEQ ID NO:9), was placed 108 bp downstream of the ATG start codon.  The first primer was used for the first strand cDNA synthesis.


The polyA-mRNA template used for the synthesis was isolated from 2.times.10.sup.6 HeLa cells by the direct oligo dT-Dynabead method, in accordance with the manufacturer's instructions.  0.25 ml of Dynabeads.RTM.  Oligo (dT).sub.25 (kit provided
by Dynal, Oslo, Norway) were resuspended and then transferred to an RNase-free Eppendorf tube placed in Dynal MPC (Dynal MPC-E/Dynal MPC-M).  The supernatant was removed when the suspension became clear.  The vial was removed from the Dynal MPC and the
Dynabeads.RTM.  Oligo (dT).sub.25 were prewashed by resuspending them in lysis/binding buffer (0.2 ml), and then placed in the Dynal MPC.  The HeLa cell suspension was washed in phosphate-buffered saline (1.times.PBS), and then centrifuged to prepare a
cell pellet.  1.0 ml of lysis/binding buffer was added to the pellet (1-4.times.10.sup.6).  The viscosity of the thus-obtained crude cell lysate was reduced by a DNA-shear step wherein the lysate was pressed three times through a 21 gauge needle by 1-2
ml syringe using force.


The lysis/binding buffer was removed from the Dynabeads.RTM.  Oligo (dT).sub.25 vial.  The vial was then transferred from the Dynal MPC to another rack in order to add the lysate.  The Dynabeads.RTM.  Oligo (dT).sub.25 were mixed with the lysate
and then annealed by rotating on a roller for 3-5 minutes at room temperature.  The vial was then placed in the Dynal MPC for two minutes, then the supernatant was removed.  The Dynabeads.RTM.  Oligo (dT).sub.25 were washed twice with washing buffer
containing LiDS (0.5-1 ml) at room temperature using the Dynal MPC, and then once with washing buffer alone (0.5 ml).  To elute the mRNA from the Dynabeads.RTM.  Oligo (dT).sub.25, 10-20 .mu.l of the elution solution (in the kit provided by the
manufacturer) were added, and the resulting mixture was maintained for two minutes at 65.degree.  C. The mixture tube was placed in Dynal MPC, and the supernatant containing the mRNA was transferred to a new RNase-free tube.


2 .mu.g of the thus-obtained mRNA were used as a template in the 5' RACE reaction using the 5'-Ampli FINDER.TM.  RACE Kit (Clontech Laboratories, Inc.  Palo Alto, Calif.), in accordance with the manufacturer's instructions.  To synthesize PSKH-1
CDNA, the following reverse transcription master mixture was prepared in a 0.5 ml sterile microcentrifuge tube:


______________________________________ 9.2 .mu.l DEPC-treated H.sub.2 O  9 .mu.l 4X Reverse transcriplase buffer*  *warm by hand until all buffer components  dissolve  1.6 .mu.l RNAse inhibitor (40 units/.mu.l)  3.7 .mu.l Ultrapure dNTP mix (10
mM)  0.5 .mu.l AMV reverse transcriptase (25 units/.mu.l)  24.0 .mu.l Total Volume  ______________________________________


cDNA synthesis was primed by mixing 2 .mu.g poly A.sup.+ RNA, 1 .mu.l cDNA synthesis primer (10 .mu.m), and 2-3 .mu.L DEPC-treated H.sub.2 O (depending on the volume of RNA) to a total volume of 10 .mu.l, in a 0.5 ml microcentrifuge tube, and
preincubating the thus-prepared mixture for five minutes at 65.degree.  C. The reverse transcription reaction was initiated by adding 20 .mu.l of the reverse transcription master mix, to prepare a 30 .mu.l CDNA reaction mixture.  The resultant mixture
was incubated for 30 minutes at 52.degree.  C., and 1 .mu.l of 0.5M EDTA was added, followed by vortexing.


To hydrolyze the RNA, 2 .mu.l of 6M NaOH were added to the 30 .mu.l of the cDNA reaction mixture.  The resultant mixture was vortexed, spun down, and then incubated for 30 minutes in a heat block set at 65.degree.  C., followed by a brief spin
down.  2 .mu.l of 6M acetic acid were added, followed by vortexing, and then 80 .mu.l of the 6M NaI solution were added followed by vigorous vortexing.  The contents were then transferred to a 1.5-ml centrifuge tube.


To purify the cDNA, 8 .mu.l GENO-BIND.TM.  suspension (Clontech, Palo Alto, Calif.) were added to the cDNA reaction mixture.  The contents were vortexed and kept on ice for ten minutes with occasional vortexing.  The tube was then centrifuged at
4.degree.  C. at full speed (i.e., 15,000 rpm or 12,000.times.g) for ten seconds.  The supernatant was carefully removed, and 500 .mu.l of 80% EtOH were added under vigorous vortexing to completely resuspend the GENO-BIND.TM..  The centrifugation and
resuspension steps were repeated, followed by centrifugation at 4.degree.  C. for 30 seconds at full speed.  The supernatant was removed and the pellet was allowed to air dry for five minutes.  15 .mu.l of DEPC-treated H.sub.2 O were added.  The pellet
was completely resuspended and incubated in a heatblock set at 65.degree.  C. for five minutes.  The tube was spun at full speed at room temperature for two minutes.  45 .mu.l of the supernatant containing the cDNA were removed and placed in a fresh
1.5-ml microcentrifuge tube.


To precipitate the cDNA, 2.5 .mu.l glycogen solution (carrier), 5 .mu.l of 2M sodium acetate, and 100 .mu.l of 95% EtOH were added to the cDNA, and the resultant mixture was incubated at -20.degree.  C. for 30 minutes.  The tube was centrifuged
at 13,000 rpm for ten minutes at 4.degree.  C. The supernatant was removed, and the pellet was rinsed with 40 .mu.l of 80% EtOH so as not to disturb the pellet, followed by centrifuging at 15,000 rpm for an additional two minutes.  The supernatant was
removed and the pellet was air-dried for five minutes, and resuspended in 6 .mu.l of DEPC-treated H.sub.2 O.


The following mixture was prepared for each anchor ligation performed: 2.5 .mu.l cDNA; 2 .mu.l Ampli FINDER.TM.  Anchor Sequence 3'NH.sub.3 GGAGACTTCCAAGGTCTTAGCTATCACTTAAGCAC-P 5' (SEQ ID NO:10)(4 pmol); 5 .mu.l 2.times.single-stranded ligation
buffer; and 0.5 .mu.l T4 RNA ligase (20 units/.mu.l, to a total volume of 10 .mu.l.  The solution was mixed well, and incubated at 37.degree.  C. for 6-8 hours.  The thus-ligated CDNA was diluted 10.times., and 1 .mu.l of the diluted CDNA was used for
PCR.


The PCR reactions were carried in a DNA Thermal Cycler (PERKIN-EIMER CETUS) using PCR reaction tubes (Treff AG, Degersheim, Switzerland).  The following components were placed into each PCR reaction tube: ##STR36## In addition to the anchor
primer (1 .mu.l), the above mixture contains 1 .mu.l of the primer 5' TCCACCTCTGTGATGAAGTG 3' (SEQ ID NO:11).  That is, the primer 2 is added to the PCR mix.  The other primer present is the anchor primer sequence ##STR37## provided with the kit that is
complementary to the anchor sequence ligated onto the cDNA.  The reaction mixture was overlaid with mineral oil and caps were placed on the tubes.  The tubes were heated for one minute at 82.degree.  C. The tubes were opened and 0.5 .mu.l (i.e., 2.5
units) of TAQ DNA polymerase were injected under the mineral oil layer overlaying the solutions.  The tubes were quickly capped and thermocycling was commenced immediately using the following parameters:


94.degree.  C. Denature 45 sec;


60.degree.  C. Anneal 45 sec; and


72.degree.  C. Extend 2 min.


A total of 35 cycles were run, with a final extension time of seven minutes for all amplifications with the anchor primer.


The resultant PCR product was subjected to agarose gel electrophoresis and was determined to have about 260 bp.  The product was purified by a 1-step PCR purification package kit (Advanced Genetic Technologies Corp., Gaithersburg, Md.), in
accordance with the manufacturer's instructions.


The PCR product was ligated into the pXT vector and sequenced by the Sanger dideoxy method using fluorescent DATP (Boehrihger) and the ALF (Pharmacia) semiautomated sequencer.  Six identical clones were found, extending the sequence with 94 bp
upstream of the ATG.  Referring again to SEQ ID NO:1, above, the 64 bp immediately upstream of the ATG were identical to a genomic sequence obtained earlier from a plasmid subclone of a cosmid and adds onto the 5' end of exon 2.  The 30 bp sequence most
5' in the cDNA was identical to a sequence in a 900 bp genomic PstI fragment located about 10 kb upstream of exon 2 and constitutes a new exon 1 of the PSKH-1 gene.  The determination of this exon 1 was complicated by the fact that there is an 8 base
sequence at the 3' end of exon I which is directly repeated at the 3' end of intron 1.  Intron 1 ends with the expected AG dinucleotide.


EXAMPLE 2


Expression and Purification of PSKH-1


PSKH-1 CDNA was cloned into PSFV1 (Semliki Forest Virus) plasmid vector (Gibco BRL) which served as a template for the in vitro synthesis of recombinant PSKH-1 RNA.  Cloning and synthesis of recombinant RNA were then carried out.  Recombinant
PSKH-1 RNA was packaged in vivo into infectious virus particles aided by RNA from Helper 1 packaging-defective virus in a cotransfection mode using electroporation as described in Liljestrom & Garoff, BIO/TECHNOLOGY 9:1356-1361 (1991).  The packaged
virus was then used to infect BHK-21 cells (ATCC CRL 8544) that were harvested after 36 hours.  All infections were checked in parallel immunoflurescence experiments to ensure that all cells were infected.


Following incubation for 2 hours at room temperature, the cells were removed from the medium and washed with 10 ml PBS.  1 ml of lysis buffer was added and the reaction mixture was allowed to stand on ice for 10-20 minutes.  The lysis buffer
consisted of 1% (v/v) Nonidet P-40, 50 mM Tris-HCL (pH 7.6), 150 mM NaCl, and a Protease Inhibitor Cocktail containing 50 mM PMSF, 5.5 U/ml aprotinin, 0.5 mg/ml leupeptin, 0.5 mg/ml antipain, 0.5 mg/ml chymostatin, 0.5 mg/ml phosforamidon, and 250 mM
EDTA.  The cells were removed from the medium and washed with 10 ml PBS.  The cells were resuspended and transferred into Eppendorf tubes, and centrifuged at 13,000 rpm for 10 minutes.  The supernatant was collected and aliquots were distributed in
several Eppendorf tubes and stored at -80.degree.  C. 10 ml of PSKH-lysate contained approximately 530 mg total protein.


To purify PSKH-1, the protein-lysate was subjected to the sequential steps of ammonium sulfate precipitation, gel filtration chromatography and hydroxyapatite chromatography.  The saturated ammonium sulfate solution contained 167.33 gm lysate
dissolved in 300 ml of 10 mM Tris, pH 7.5.  The proteins in the cell lysate were precipitated by adding ammonium sulfate at 35% and 60% saturation, in an ice bath with constant stirring.  The precipitates were resuspended with 50 mM ammonium bicarbonate
(pH 7.8) and were tested by SDS/PAGE and Western-blotting.  Both precipitates gave a positive signal in the Western Blot indicating the presence of PSKH-1 protein.  Approximately 158 mg total protein was obtained with the 35% ammonium sulfate saturation,
whereas 4 mg total protein were obtained using 35% ammonium sulfate saturation followed by 60% ammonium sulfate saturation.


The precipitates from the ammonium sulfate fractionation purification step were then subjected to gel filtration using 16 mm.times.60 cm Superdex 75 column (Pharmacia, Sweden).  Between 1 and 5 ml of each precipitate was applied to the gel
filtration column separately at a flow rate of 1-2 ml/min. The precipitates were applied to the column mixed with buffer which was either 50 mM ammonium bicarbonate (pH 7.8) or 10 mM sodium phosphate (pH 6.8).  Each fraction collected was tested by
SDS/PAGE and Western Blot.  Fractions which gave positive signals for PSKH-1 were pooled.  Approximately 3 mg of protein were obtained from the 35% ammonium sulfate saturation and approximately 4 mg PSKH-1 protein were obtained from the fraction derived
from the 60% ammonium sulfate saturation precipitate.  The PSKH-1 protein recovered from this step represented a 100-fold increase in purification.


The pooled fractions from the gel-filtration step were then subject to hydroxyapatite chromatography using a 10 mm.times.64 mm Bio-scale CHT 5-i Hydroxyapatite column (Biorad, Richmond, Calif.) at a bed volume of 5 ml and a maximum operating
column pressure of 750 psi and a maximum protein load of 50 mg.  The pooled fractions were applied to the column with 10 mM sodium phosphate (pH 6.8), and were eluted with a gradient of 0-80% of 500 mM sodium phosphate (pH 6.8) for 20 minutes at a flow
rate of 2 ml/min., and monitored at an optical density of 280 nm.  Total PSKH-1 protein was recovered relatively early in the chromatogram (i.e., elution time less than 5 minutes).


EXAMPLE 3


Cellular Localization of PSKH-1


Having the full-length nucleotide and amino acid sequences of PSKH-1 at hand, only now could the localization of the enzyme in the cell could be determined.  Based on the amino acid sequence of PSKH-1, the following amino acid sequence was
identified as an antigenic peptide sequence:


N-K-S-R-R-V-R-E-R-E-L-R-E-L-N-L-R-Y-Q-Q (SEQ ID NO:12), which corresponds to amino acids 401-420 of PSKH-1 protein in SEQ ID NO:2, above.  The antigenic sequence was chosen on the basis of its high hydrophilicity score using the Kyte-Doolittle
hydropathy plot (Kyte et al., J. Mol. Biol.  157:105 (1982)) and the Jameson-Wolfe algorithm, as described in Comput.  Appl.  Biosci.  4:181 (1988).


The peptides were synthesized on an ABI 430A peptide synthesizer (Applied Biosystems, Inc., CA), linked to the carrier protein keyhole limpet hemocyanine (KLH), and the resultant peptide-carrier complex was injected into rabbits to produce
antibodies specific to the antigenic peptide sequence.


To conduct the cell localization experiment, COS-1 monkey kidney cells (ATCC CRL 1650) were grown on cover slips for ten hours, fixed in methanol for five minutes at -20.degree.  C., and then washed once in PBS.  The cells were then blocked in
20% fetal calf serum for ten minutes at room temperature.  The cells were incubated with the primary antibody, i.e., 30 .mu.l of anti-PSKH-1 antibody, diluted 1/100 in PBS, for 30 minutes at room temperature.  As a positive control, the cells were
incubated with 30 .mu.l of the primary antibody CTR 453 which is directed to a known centrosome structure described in Bornens et al., Cell Motility & Cytoskeleton 8:239-249 (1987).  The thus-incubated cells were washed five.  times in PBS, followed by
incubation with secondary antibodies specific for each of the two primary antibodies.  The secondary antibody specific to anti-PSKH-1 was FITC-labeled SAR (Dakopatts, Denmark, Code F205, lot 030), diluted 1/100 in PBS, which produced a green
fluorescence.  The secondary antibody specific to CTR 453 was TRITC-labeled rabbit anti-mouse IgG, diluted 1/4 in PBS, which produces a red fluorescence.  Following the incubation, which was conducted for 30 minutes, the cells were washed five times in
PBS, air dried for one minute, and mounted with mowiol before immunofluorescence microscopy.  Slides were taken using Fujichrome 400 ASA.


The localization of PSKH-1 in the centrosomes of the COS-1 cells is illustrated in FIGS. 3A and 3B.  These microphotographs demonstrate that the FITC-labeled secondary antibody specific to anti-PSKH-1 has the same location in the cells as
TRITC-Rhodamine-labeled CTR 453 which is known to be specific to centrosomes.


EXAMPLE 4


Inactivation of PSKH-1 MRNA Halts Cell Division


The building blocks used to synthesize the PSKH-1 hammerhead ribozyme depicted in FIG. 1 were 2'-0-allylribonucleotides (Boehringer-Mannheim) and 2'-0-tertbutyldimethylsilyl protected ribonucleotides.  The hammerhead ribozyme was synthesized on
solid phase using phosphoramidite chemistry and neat triethylamine trihydrofluroide deprotection of the partially deprotected oligomer.  The product was purified by HPLC.


50 .mu.g of the PSKH-1 hammerhead ribozyme and 1-2.times.10.sup.6 HL-60 cells (ATCC CCL 240) in a volume of 1 ml were incubated for from 30 minutes to 1 hour at 37.degree.  C. and then stained with propidium iodide to determine DNA content.  As a
first control, an incubation was conducted with HL-60 cells and an enzymatically inactive analogue, 5' ACAGCUGCUaaUgAGGCCGUUAGGCCgAAaCAU.sub.PS C.sub.PS C 3' (SEQ ID NO:14)(wherein the "g" at position 27 of the PSKH-1 ribozyme above was changed to an
"a"), and also with a ribozyme capable of cleaving amelogenin mRNA (Lyngstadaas et al., EMBO J. 14(21):5224-5229 (1995)), and an oligonucleotide with a random RNA sequence.


The incubated cells, including the control cells, were held for six hours and then analyzed in a flow cytometer equipped with a cell sorter (Coulter Counter ZM, Coulter Electronics, Hialeah, Fla.).  The flow-cytometric analysis enabled separation
of the cells according to their DNA content, and more specifically, the absolute and relative number of cells in the entire population that were in the G1 phase, the S phase, and the G2 phase.  Cells in G2 phase have doubled their DNA content.  FIGS.
4A-4D, which are graphs showing the number of cells plotted against the fluorescence intensity for each of the HL-60 cells treated with random oglionucleotide (FIG. 4A), irrelevant (amelogenin) ribozyme (FIG. 4B), enzymatically inactive ribozyme (FIG.
4C) and PSKH-1 RNA hammerhead ribozyme of SEQ ID NO:3 (FIG. 4D).  The doubled DNA content is shown in FIGS. 4A, B and C in which the cells are divided into two populations, i.e., with and without doubled DNA content.  FIG. 4D, on the other hand, shows an
absence of cells in the G2 phase.  The figures also show a distinct population of the cells displays a DNA content significantly below the diploid cell DNA content indicating the presence of apoptotic cells and thus the induction of the apoptotic process
by ribozyme specific to PSKH-1 mRNA.  Accordingly, the proper conclusion is that ribozyme specific to PSKH-1 mRNA was successful in halting or terminating cell division and growth by inactivating PSKH-1 mRNA.


The same effect, i.e., the blocking of the cell cycle, was demonstrated in HeLa-cells (ATCC CCL 2.2) with the PSKH-1 hammerhead ribozyme described in Example 4 (data not shown).


All publications and patent applications mentioned in this specification are indicative of the level of skill of those skilled in the art to which this invention pertains.  All these publications and patent applications are herein incorporated by
reference to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference.  PCT Application Serial No. PCT/NO96/00220 (Attorney docket no. FORSK 3.4-002), filed of
even date herewith in the Norwegian Patent Office is also hereby incorporated by reference in its entirety.


Various modifications of the invention described herein will become apparent to those skilled in the art.  Such modifications are intended to fall within the scope of the appending claims.


__________________________________________________________________________ SEQUENCE LISTING  (1) GENERAL INFORMATION:  (iii) NUMBER OF SEQUENCES: 14  (2) INFORMATION FOR SEQ ID NO:1:  (i) SEQUENCE CHARACTERISTICS:  (A) LENGTH: 424 amino acids 
(B) TYPE: amino acid  (D) TOPOLOGY: linear  (xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:  MetGlyCysGlyThrSerLysValLeuProGluProProLysAspVal  151015  GlnLeuAspLeuValLysLysValGluProPheSerGlyThrLysSer  202530  AspValTyrLysHisPheIleThrGluValAspSerValGlyProVal 
354045  LysAlaGlyPheProAlaAlaSerGlnTyrAlaHisProCysProGly  505560  ProProThrAlaGlyHisThrGluProProSerGluProProArgArg  65707580  AlaArgValAlaLysTyrArgAlaLysPheAspProArgValThrAla  859095  LysTyrAspIleLysGluIleIleGlyArgGlySerPheSerArgVal  100105110 
ValArgValGluHisArgAlaThrArgGlnProTyrAlaIleLysMet  115120125  IleGluThrLysTyrArgGluGlyArgGluValCysGluSerGluLeu  130135140  ArgValLeuArgArgValArgHisAlaAsnIleIleGlnLeuValGlu  145150155160  ValPheGluThrGlnGluArgValTyrMetValMetGluLeuAlaThr  165170175 
GlyGlyGluLeuPheAspArgIleIleAlaLysGlySerPheThrGlu  180185190  ArgAspAlaThrArgValLeuGlnMetValLeuAspGlyValArgTyr  195200205  LeuHisAlaLeuGlyIleThrHisArgAspLeuLysProGluAsnLeu  210215220  LeuTyrTyrHisProGlyThrAspSerLysIleIleIleThrAspPhe  225230235240 
GlyLeuAlaSerAlaArgLysLysGlyAspAspCysLeuMetLysThr  245250255  ThrCysGlyThrProGluTyrIleAlaProGluValLeuValArgLys  260265270  ProTyrThrAsnSerValAspMetTrpAlaLeuGlyValIleAlaTyr  275280285  IleLeuLeuSerGlyThrMetProPheGluAspAspAsnArgThrArg  290295300 
LeuTyrArgGlnIleLeuArgGlyLysTyrSerTyrSerGlyGluPro  305310315320  TrpProSerValSerAsnLeuAlaLysAspPheIleAspArgLeuLeu  325330335  ThrValAspProGlyAlaArgMetThrAlaLeuGlnAlaLeuArgHis  340345350  ProTrpValValSerMetAlaAlaSerSerSerMetLysAsnLeuHis  355360365 
ArgSerIleSerGlnAsnLeuLeuLysArgAlaSerSerArgCysGln  370375380  SerThrLysSerAlaGlnSerThrArgSerSerArgSerThrArgSer  385390395400  AsnLysSerArgArgValArgGluArgGluLeuArgGluLeuAsnLeu  405410415  ArgTyrGlnGlnGlnTyrAsnGly  420  (2) INFORMATION FOR SEQ ID NO:2:  (i)
SEQUENCE CHARACTERISTICS:  (A) LENGTH: 3471 base pairs  (B) TYPE: nucleic acid  (C) STRANDEDNESS: double  (D) TOPOLOGY: linear  (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:  CGAAGAGCCCGCCGCCCGCGCGAGGTGTAGACGGGGCACTGCCTTCAGAGCAGGTCCTGC60 
CAGCCTCGCTGAAGAGGATGCCCTCGTGTCCGTGATGGGCTGTGGGACAAGCAAGGTCCT120  TCCCGAGCCACCCAAGGATGTCCAGCTGGATCTGGTCAAGAAGGTGGAGCCCTTCAGTGG180  CACTAAGAGTGACGTGTACAAGCACTTCATCACAGAGGTGGACAGTGTTGGCCCTGTCAA240 
AGCCGGGTTCCCAGCAGCAAGTCAGTATGCACACCCCTGCCCCGGTCCCCCGACTGCTGG300  CCACACGGAGCCTCCCTCAGAACCACCACGCAGGGCCAGGGTAGCTAAGTACAGGGCCAA360  GTTTGACCCACGTGTTACAGCTAAGTATGACATCAAGGAAATAATTGGCCGAGGCAGCTT420 
CAGCCGAGTGGTACGTGTAGAGCACCGGGCAACCCGGCAGCCGTATGCCATCAAGATGAT480  TGAGACCAAGTACCGGGAGGGGCGGGAGGTGTGTGAGTCGGAGCTGCGTGTGCTGCGTCG540  GGTGCGTCATGCCAACATCATCCAGCTGGTGGAGGTGTTCGAGACACAGGAGCGGGTGTA600 
CATGGTGATGGAGCTGGCCACTGGTGGAGAGCTCTTTGACCGCATCATTGCCAAGGGCTC660  CTTCACCGAGCGTGACGCCACGCGGGTGCTGCAGATGGTGCTGGATGGCGTCCGGTATCT720  GCATGCACTGGGCATCACACACCGAGACCTCAAACCTGAGAATCTGCTCTACTACCATCC780 
GGGCACTGACTCCAAGATCATCATCACCGACTTCGGCCTGGCCAGTGCTCGCAAGAAGGG840  TGATGACTGCTTGATGAAGACCACCTGTGGCACGCCTGAGTACATTGCCCCAGAAGTCCT900  GGTCCGCAAGCCATACACCAACTCAGTGGACATGTGGGCGCTGGGCGTCATTGCCTACAT960 
CCTACTCAGTGGCACCATGCCGTTTGAGGATGACAACCGTACCCGGCTGTACCGGCAGAT1020  CCTCAGGGGCAAGTACAGTTACTCTGGGGAGCCCTGGCCTAGTGTGTCCAACCTGGCCAA1080  GGACTTCATTGACCGCCTGCTGACAGTGGACCCTGGAGCCCGTATGACTGCACTGCAGGC1140 
CCTGAGGCACCCGTGGGTGGTGAGCATGGCTGCCTCTTCATCCATGAAGAACCTGCACCG1200  CTCCATATCCCAGAACCTCCTTAAACGTGCCTCCTCGCGCTGCCAGAGCACCAAATCTGC1260  CCAGTCCACGCGTTCCAGCCGCTCCACACGCTCCAATAAGTCACGCCGTGTGCGGGAACG1320 
GGAGCTGCGGGAGCTCAACCTGCGCTACCAGCAGCAATACAATGGCTGAGCCGAATGGCT1380  GTGCACACATGCAGCACGACCCAGCCTGGCCACACACTGTGGTGCCATCTGGGTCCGATG1440  CCCTCTCTGGAGATAGGCCTATGTGGCCCACAGTAGGTGAAGAATGTCTGGCTCCAGCCC1500 
TTTCTCTGTCGGTTCACCAGCCCCTGTCCTCACCATGGGCCTGGGCCAGGTGTGACAGAG1560  TAGAGGTAGCACAGGGGGCTGTCCTCACCATGGGCCTGGGCCAGGTGTGACAGAGTAGAG1620  GTAGCACAGGGGGCTGTGACTCCCCCTGAACTGGGAGCCTGGCCTGGCAGTGATACCCCT1680 
CTTGGTGGGCAGCTGCTCTGGTGGAGTTGGGAAGGGATAGGACCTGGCCTTCACTGTCTC1740  CCTTGCCCTTTGACTTTTCCCCAATCAAAGGGAACTGCAGTGCTGGGTGGAGTGTCCTGT1800  CGCCTCAGGACCCTTTGGGACAGTTACTTCTGGGACCCCCTTTCCTCCACAGAGCCCTTC1860 
TCCCTCCTTTCACACATTCCCATGCATCCTGATCCTTAAGATTATGCTCCAGTGGGAGAC1920  CCTGGTAGGCACAAAGCTTGTGCCTTGACTGGACCCGTAGCCCCTGGCTAGGTCGAAACA1980  GCCCTCCACCTCCCAGCCAAGATCTGTCTTCCTTCATGGTGCCTCCAGGGAGCCTTCCTG2040 
GTCCCAGGACCTCTGGTGGAGGGCCATGGCGTGGACCTTCACCCTTCTGGACTGTGTGGC2100  CATGCTGGTCATCGGCTTGCCCAGGCTCCAGCCTCTCCAGATTCTGAGGGGTCTCAGCCC2160  ACCGCCCTTGGTGCCTTCTTTGTAGAGCCCACCGCTACCTCCCTCTCCCCGTTGGATGTC2220 
CATTCCATTCCCCAGGTGCCTCCTTCCCAACTGGGGGTGGTTAAAGGGACGCCCACTGCT2280  GCTACCTGGGGAATGGGGCACCTGGGGCCCAAGGCAGAGGGAAGGGGGTCCTCCCGATTA2340  GGGTCGAGTGTCAGCCTGGGTTCTATCCTTTGGTGCAGCCCCATTGCCTTTTCCCTTCAG2400 
GCTCTGTTGCTCCCTCCTCTGCAGCTGCACGAAGGCGCCATCTGGTGTCTGCATGGGTGT2460  TGGCAGCCTGGGAGTGATCACTGCACGCCCATCCTCCACACCTGCCCATCGTGCACACCC2520  ACCCATGGTGCACACCTGTAGTCCTCCATGAGGACATGGGAAGGTAGGAGTTGCCGCCCT2580 
GGGGGAGGGTCCCGGGCTGCTCACCTCTCCCCTTCTGCTGAGCTTCTGCGCACCCCTCCC2640  TGGAACTTAGCCATACTGTGTGACCTGCCTCTGAAACCAGGGTGCCAGGGGCACTGCCTT2700  CTCACAGCTGGCCTTGCCCCGTCCACCCTGTGCTGCTTCCCTTCACAGCATTAACCTTCC2760 
AGTCTGGGTCCCACTGAGCCTCAAGCTGGAAGGAGCCCCTGCGGGAGGTGGGTGGGGTTG2820  GGTGGCTGCTTTCCCAGAGGCCTGACGCCAGAACCATCCCCATTTCTTTTGTGGTATCTC2880  CCCCTACCACAAACCAGGCTGGAACCCAAGCCCCTTCCTCCACAGCTGCCTTCAGTGGGT2940 
AGAATGGGGCCAGGGCCCAGCTTTGGCCTTAGCTTGACGGCAGGGCCCCTGCCATTGCAC3000  GAGGGTTTGGTTCCCACTCAGCTTCTCCGGTCGGCAGCCTGGGCCAGGCCCTTTTCCTGC3060  ATGTGCCACCTCCAGTGGGAAACAAAACTAAAGAGACCACTCTGTGCCAAGTCGACTATG3120 
CCTTAGACACATCCTCCTACCGTCCCCAATGCCCCTGGGCAGGAGGCAGTGGAGAACCAA3180  GCCCCATGGCCTCAGAATTTCCCCCCAGTTCCCCAAGTGTCTCTGGGGACCTGAAGCCCT3240  GGGGCTTACGTTCTCTCTTGCCCAGGGTGGCCTGGTCCTGAGGGCAGGACAGGGGGTTTG3300 
CAGATGTGGGCCTTTGATAGACCCACTTGGGCCTTCATGCCATGGCCTGTGGATGGAGAA3360  TGTGCAGTTATTTATTATGCGTATTCAGTTTGTAAACGTATCCTCTGTATTCAGTAAACA3420  GGCTGCCTCTCCAGGGAGGGCTGCCATTCATTCCAACAAAAAAAAAAAAAA3471  (2) INFORMATION FOR SEQ ID NO:3:  (i) SEQUENCE CHARACTERISTICS: 
(A) LENGTH: 35 base pairs  (B) TYPE: nucleic acid  (C) STRANDEDNESS: single  (D) TOPOLOGY: linear  (xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:  ACAGCUGCUGAUGAGGCCGUUAGGCCGAAACAUCC35  (2) INFORMATION FOR SEQ ID NO:4:  (i) SEQUENCE CHARACTERISTICS:  (A)
LENGTH: 14 base pairs  (B) TYPE: nucleic acid  (C) STRANDEDNESS: single  (D) TOPOLOGY: linear  (xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:  GGAUGUCCAGCUGG14  (2) INFORMATION FOR SEQ ID NO:5:  (i) SEQUENCE CHARACTERISTICS:  (A) LENGTH: 17 base pairs  (B)
TYPE: nucleic acid  (C) STRANDEDNESS: single  (D) TOPOLOGY: linear  (ix) FEATURE:  (A) NAME/KEY: misc.sub.-- feature  (B) LOCATION: 8  (D) OTHER INFORMATION: /note= "N at this position  represents 2,3 or 4 of any base (A,C,G,U)"  (ix) FEATURE:  (A)
NAME/KEY: misc.sub.-- feature  (B) LOCATION: 13  (D) OTHER INFORMATION: /note= "N at this position  represents 2,3 or 4 nucleotides complementary to  nucleotides in position 8 to allow for the  (xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:  CUGANGANNNNNNGAAA17 (2) INFORMATION FOR SEQ ID NO:6:  (i) SEQUENCE CHARACTERISTICS:  (A) LENGTH: 50 base pairs  (B) TYPE: nucleic acid  (C) STRANDEDNESS: single  (D) TOPOLOGY: both  (xi) SEQUENCE DESCRIPTION: SEQ ID NO:6: 
CAGCUGAGAAUCCUACCAGAGAAACACACGUUGUGGUAUAUUACCUGGUA50  (2) INFORMATION FOR SEQ ID NO:7:  (i) SEQUENCE CHARACTERISTICS:  (A) LENGTH: 14 base pairs  (B) TYPE: nucleic acid  (C) STRANDEDNESS: single  (D) TOPOLOGY: linear  (xi) SEQUENCE DESCRIPTION: SEQ ID
NO:7:  AGGAUGUCCAGCUG14  (2) INFORMATION FOR SEQ ID NO:8:  (i) SEQUENCE CHARACTERISTICS:  (A) LENGTH: 20 base pairs  (B) TYPE: nucleic acid  (C) STRANDEDNESS: single  (D) TOPOLOGY: linear  (xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:  GTGTGCATACTGACTTGCTG20 
(2) INFORMATION FOR SEQ ID NO:9:  (i) SEQUENCE CHARACTERISTICS:  (A) LENGTH: 20 base pairs  (B) TYPE: nucleic acid  (C) STRANDEDNESS: single  (D) TOPOLOGY: linear  (xi) SEQUENCE DESCRIPTION: SEQ ID NO:9:  TCCACCTCTGTGATGAAGTG20  (2) INFORMATION FOR SEQ
ID NO:10:  (i) SEQUENCE CHARACTERISTICS:  (A) LENGTH: 35 base pairs  (B) TYPE: nucleic acid  (C) STRANDEDNESS: single  (D) TOPOLOGY: linear  (xi) SEQUENCE DESCRIPTION: SEQ ID NO:10:  CACGAATTCACTATCGATTCTGGAACCTTCAGAGG35  (2) INFORMATION FOR SEQ ID
NO:11:  (i) SEQUENCE CHARACTERISTICS:  (A) LENGTH: 20 base pairs  (B) TYPE: nucleic acid  (C) STRANDEDNESS: single  (D) TOPOLOGY: linear  (xi) SEQUENCE DESCRIPTION: SEQ ID NO:11:  TCCACCTCTGTGATGAAGTG20  (2) INFORMATION FOR SEQ ID NO:12:  (i) SEQUENCE
CHARACTERISTICS:  (A) LENGTH: 38 base pairs  (B) TYPE: nucleic acid  (C) STRANDEDNESS: single  (D) TOPOLOGY: linear  (xi) SEQUENCE DESCRIPTION: SEQ ID NO:12:  CTGGTTCGGCCCACCTCTGAAGGTTCCAGAATCGATAG38  (2) INFORMATION FOR SEQ ID NO:13:  (i) SEQUENCE
CHARACTERISTICS:  (A) LENGTH: 20 amino acids  (B) TYPE: amino acid  (D) TOPOLOGY: linear  (xi) SEQUENCE DESCRIPTION: SEQ ID NO:13:  AsnLysSerArgArgValArgGluArgGluLeuArgGluLeuAsnLeu  151015  ArgTyrGlnGln  20  (2) INFORMATION FOR SEQ ID NO:14:  (i)
SEQUENCE CHARACTERISTICS:  (A) LENGTH: 35 base pairs  (B) TYPE: nucleic acid  (C) STRANDEDNESS: single  (D) TOPOLOGY: linear  (xi) SEQUENCE DESCRIPTION: SEQ ID NO:14:  ACAGCUGCUAAUGAGGCCGUUAGGCCGAAACAUCC35 
__________________________________________________________________________


* * * * *























				
DOCUMENT INFO
Description: The invention relates to the field of catalytic RNAs or ribozymes, and their use to treat diseases and other medical conditions characterized by uncontrolled cell growth.BACKGROUND OF THE INVENTIONIn recent years, some progress has been made in the elucidation of cellular events leading to the development of progression of diseases and other medical conditions characterized by abnormal cell growth. For instance, a great amount of researchhas centered on the identification of genes which are altered or mutated in cancer relative to normal cells. Nonetheless, current cancer treatment modalities are still inadequate in one or more respects. In cancer patients, the prominent immunedepression in response to chemotherapy has been widely confirmed. Accordingly, immunotherapy and immunochemotherapy have drawn much attention as adjuvants to existing cancer treatments. Immunotherapy has been reported as not only restoring orpotentiating the specific immune responses against cancer, but also improving the general immunological functions of the patient. However, the immunomodulators used in such therapies tend to act in a non-specific manner against cancer cells and alsoexert direct cytocidal affects against neoplastic cells and behave in a manner more akin to chemotherapeutic agents.A variety of non-malignant disease states are also characterized by abnormal cell growth. Allograft rejection and autoimmune diseases, for example, involve immune responses characterized by undesirable proliferative bursts of B-lymphocytes orT-lymphocytes. Current treatment modalities for these diseases and medical conditions typically involve immunosuppresive protocols. In the case of allograft rejection, illustrative protocols have featured the administration of drugs such asazathioprine, cyclosporine, and corticosteroids, all of which cause toxic side-effects to non-lymphoid tissues. The development of pan-T-lymphocyte-specific monoclonal antibodies was purported to be an important ref