Docstoc

Animal Experiments and Tissue Collection

Document Sample
Animal Experiments and Tissue Collection Powered By Docstoc
					                                                                                        1



                              Supplementary Methods



Human Endometrial Carcinoma Samples
Flash frozen endometrial tissue from type I endometrioid tumours of patients of ages
30–55 was obtained under sterile conditions after hysterectomy at Peking University
Oncology Hospital. The samples were graded and staged according to the 1988
International Federation of Gynaecology and Obstetrics (FIGO) systems. None of the
patients had received preoperative chemotherapy or radiation. In addition, samples of
normal endometrium that were age-matched to the cancers were obtained from
patients undergoing hysterectomy for benign gynaecological diseases.      All studies
were approved by the Ethics Committee of the Peking University Health Science
Center.


Immunohistochemistry and Image Analysis
Paraffin sections of 5 μm from the uteri were made. A standard immunohistochemical
technique was used to detect the intensity and distribution of PCNA and Ki-67
immunostaining. A mouse anti-PCNA antibody (18-0110, Zymed Laboratories, Inc.,
San Francisco, CA) at a 1:150 dilution and a monoclonal mouse anti-human Ki-67
antibody (08-0156, Zymed Laboratories) were used.       Quantification of PCNA
immunostaining was performed on the digitized images of systematic randomly
selected fields of endometrial stroma, from which non-stromal elements (e.g., luminal
and glandular epithelium) were interactively removed and analyzed separately. A
Leica microscope connected to a computer using Colorvision software (Leica Imaging
System Ltd. Cambridge, England) was used for the image analysis. All luminal and
glandular epithelia as well as 10 fields of stromal cells were measured separately in
each tissue section. By using colour discrimination software, the total area of
positively stained cells (brown reaction product) was measured and expressed as a
ratio of the total area of cell nuclei (brown reaction product + blue haematoxylin).
                                                                                       2



Animal Experiments and Tissue Collection
Adult female CD rats (VAF, Charles River, Beijing, China), ~ 55 days old and
weighing approximately 250 g, were housed in a controlled environment at 20°C on
an illumination schedule of 12 h of light and 12 h of darkness each day. Standard
pellet food and water were provided ad libitum. The rats were anesthetized,
ovariectomized, and housed for 14 days before a 48-hour treatment with either 2.5 μg
17β-estradiol (E2) /day (n = 8), 500 μg tamoxifen (TAM)/day (n = 5) (both substances
purchased from Sigma, St Louis, MO).     The control group (n = 4) received vehicle
only (propylene glycol). The animals received injections in the morning of days 1 and
2, and were sacrificed in the morning of day 3.   Under animal anaesthesia, the uterus
was removed with fat and connective tissues were stripped off. The uteri were
weighed and divided; one half was immediately frozen in liquid nitrogen and stored at
-70°C until analyzed by real time RT PCR. The other half was immersion-fixed in 4%
formaldehyde at 4°C for 12 hours, stored at 4°C in 70% ethanol, and thereafter
embedded in paraffin. All studies were approved by the Animal Care Committee of
Peking University Health Science Center.


Flow Cytometry
Cells were collected and resuspended in PBS with 2% glucose and 3%
paraformaldehyde.    After permeabolization with ethanol, cells were stained with
propidium iodide solution (69 M propidium iodide and 38 mM sodium citrate).
Cell cycle data were collected with FACScan (Becton Dickinson
Immunocytochemistry System) and analyzed with ModFit LT (Verity Software
House, Inc., Topsham, ME).


Real-Time Quantitative RT-PCR Analysis
TaqMan (Perkin-Elmer/Applied Biosystems) RT-PCR analysis was performed with
5'-exonuclease assays using fluorescent nonextendible oligonucleotide probes
(TaqMan PCR detector 7700) as described1.     Rat uteri were weighed, minced, and
homogenized for total RNA extraction using TRIZOL Reagent (Invitrogen Corp.,
                                                                            3



Rockville, MD). Primers and probes used were: human EKLF, forward primer:
5’-CCTGTTTGGTGGTCTCTTCACA-3’, reverse primer:
5’-AGGGTCCATTCGTGGGAAA-3’, probe:
5’-CGCGTGACACAATGCTGGGTGG-3’; rat EKLF, forward primer:
5’-CGCCCCCTTCCTTTTTGA-3’, reverse primer:
5’-CAGTGGCCCCGAGTTCTGT-3’, probe: 5’-TGTCTGGGACCTGGTGCGG-3’;
human PKC, forward primer: 5’-ACAAGCAATGCGTCATCAATG-3’, reverse
primer: 5’-CGCCCCCTCTTCTCAGTGT-3’, probe:
5’-CCCCAGCCTCTGCGGAATGGA-3’; rat PKC, forward primer:
5’-GGCGACTGTCCGTAGAAATCTG-3’, reverse primer:
5’-GGAAAGGGAGCCCATGAAGT-3’, probe:
5’-ACTGGGATCGGACGACACGGAA-3’; human PAX2, forward primer:
5’-CTGGGCAGCAACGTGTCA-3’, reverse primer:
5’-GAGTGGTGCTCGCCATGTC-3’, probe:
5’-ACAGACATACCCCGTTGTGACTGGTCG-3’; rat PAX2, forward primer:
5’-CTGGAAGCTTTGGATCGAGTCT-3’, reverse primer:
5’-TGTGCTCTGATGCTTGGAAGA-3’, probe:
5’-TGAGCGTCCTTCCTATCCCGA-3’; hKID, forward primer:
5’-CCCTCCTGGCCTCACTGAT-3’, reverse primer:
5’-TGCGCCAGGGTCTTGGT-3’, probe: 5’-TACAACTTCGTCCTGTTCCCCG-3’;
rat hKID homolog, forward primer: 5’-GGCCCTGCGGTCATTG-3’, reverse primer:
5’-GTGAGCGGTCCTACCCAGAA-3’, probe:
5’-TGGGAAGTTTGCAGTCCATTGG-3’; human cyclin F, forward primer:
5’-CCAGA GGCGTTCGTATGTGA-3’, reverse primer:
5’-AAAGAATGGCCCAGAAATTCAG-3’, probe:
5’-CCACAGATGGCGTCAATGTGAACA-3’; rat cyclin F, forward primer:
5’-GGAAAGTGACAGAAAGGTGGATATG-3’, reverse primer:
5’-GCGGCGTAGTCCCTGAGTT-3’, probe:
5’-CTGACCCCGGACGATGCCTCC-3’; human RAR1, forward primer:
5’-TGTTCACAAGCCATTAGGGAAA-3’, reverse primer:
                                                                                         4



5’-ACACTAGAGTTACATGGTCCAGTGGTA-3’, probe:
5’-TTCATGGGATAATTAGCAGGCTGG-3’; rat RAR1, forward primer:
5’-GGCCTCTGGGACAAATTCAG-3’, reverse primer:
5’-CTTGGCGAACTCCACGATCT-3’, probe:
5’-AGCTGGCCACCAAGTGCATTATT-3’.


Gene Silencing by Retroviral siRNA System
Recombinant retroviruses carrying specific oligonucleotides for generating siRNAs to
the 35 genes described in this report were prepared using the BD™ Knockout RNAi
System (BD Biosciences) according to the manual provided by the vendor.         The
mRNA sequences representing the 35 genes and their ORF (open reading frame)
information were obtained from RefSeq (http://www.ncbi.nlm.nih.gov/RefSeq/).
Sequences were masked to remove repetitive sequences using RepeatMasker
(http://ftp.genome.washington.edu/cgi-bin/RepeatMasker), and vector contamination
was masked by searching with NCBI BLAST (http://www.ncbi.nlm.nih.gov/BLAST/)
against UniVec (http://www.ncbi.nih.gov/VecScreen/UniVec.html). Three unique
19-mers for each target were selected, where possible (1) to contain no stretches of
four or more consecutive T or A residues (to avoid premature pol III transcription
termination signals); (2) to have 40–70% overall GC content; (3) to lie within the
coding sequence of the target gene; (4) to begin with an AA dimer in the 5' flanking
sequence; (5) to end just prior to a TT, TG or GT doublet in the 3' flanking sequence;
(6) to share minimal sequence identity with other genes; (7) to target all transcript
variants represented by RefSeq mRNAs; and (8) to not overlap with other 19-mers
selected from the same target sequence.    Specific oligonucleotides to the 35 genes
were synthesized and annealed into double strands. After purification and restriction
digestion, the oligonucleotides were ligated into the linearized RNAi-Ready pSIREN
vector (BD Biosciences). The resultant plasmid was transformed into BD
Fusion-Blue™ Competent Cells, purified, and co-transfected with the pVSV-G vector
into the GP2-293 packaging cell line (BD Biosciences) using LipofectAMINE
(Invitrogen). Three days after transfection, cell lysates were obtained from the
                                                                                          5



293 cells. The cell lysates were added to 293 cells again, and when most of the cells
had been killed by virus infection and detached, cell lysates were collected and
filtered through a 0.45 m cellulose acetate filter.   The viral titers were determined
according to the procedure provided by the vendor (BD Biosciences).        For infection,
cells were incubated with viruses at a MOI of 10 for 6 h before fresh media were
added and cultures were continued for another 48 h.      For generation of PAX2
expression-silenced ECC-1 cells to be transplanted into nude mice, infected cells were
grown in the presence of 2 g/ml of puromycin for three weeks. Individual
drug-resistant clones were collected, pooled, and expanded. The oligonucleotide
sequences synthesized for EKLF RNAi were: forward sequence,
5’-GGATCCCGAGGCAGGCAGCGCACACGTTCAAGAGACGTGTGCGCTGCC
TGCCTCTTTTTGGAGA -3’; reverse sequence, 5’-
GAATTCTCCAAAAAGAGGCAGGCAGCGCACACGTCTCTTGAACGTGTGCG
CTGCCTGCCTCGGG-3’.             In synthesizing oligonucleotides for other genes, the
underlined sequences were replaced by the following sequence and its reverse
complement sequence:
NF I/B: GAAGCACCCGTGCTGTGTC
RPIP8: GCCACCATCCTCACCGGAA
EREG1: GGTGCCCTGGGAGACGGAG
MYL7: GGGCCCCATCAACTTCACC
Cadherin-8: GCAAACCTCTGGAGCCTCC
NTAK: CGAGACAGCCAAGTCCTAT
Nebulette: CTTCAACGGGGAACTGCAA
DLC-1: GGAACTGTCCAGCTTCAGC
PKC: CAAGGCTTCCAGTGCCAAG
TRIP9: GATGTGGAGATGGTCCGGC
gb=AL109681: CGTATATGTCTAGTATCCC
SH-PTP3: GAGAAGAATGGAGATGTCA
Flt3 ligand: CCTGCAGGACGAGGAGCTC
Phosphodiesterase I alpha: CTAATGTGGATGATATTAC
                                                                                    6



MEA6: GACTCTGACTGAACGCTTG
Myelin proteolipid protein: CTGCCTCTTTCTTCTTCCT
PAX2: GCACTTGCGAGCTGACACC
IGF II: GTTCTTCCAATATGACACC
gb=AL049390: GAGAAGTGATTTCTGAAGC
Carboxylesterase: CCCAGGCTCTGTGACCATC
hKID: GTTCACAGTCCACTGGGTC
Heme oxygenase: CATTGCCAGTGCCACCAAG
GABA-B R1a receptor: CCGGCAGCGTTTCCCCACT
OPCML: CACCAATGCCAGCATCACA
Cyclin F: GACCTCATTCCCTGCGTCT
AILIM: GTTCTGGTTACCCATAGGA
ENaC: GAATTTAACTATCGCACCA
MYOD1: CCCCAACCCGATATACCAG
KCNQ3: GTACCGGCGCATCCAAACT
RAR1: CTGGCCACCAAGTGCATTA
PRGP2: CCTGGAACGGGAGTGTCTG
BK-2: CATCTTTGTCCTCAGCGTC
gb=3413939: GTGTGCGTGGCCACCTGAA
gb=3882154: CATTCTCAACAATGAGGCC
ER: GCTACTGTTTGCTCCTAAC
ER: CACCTGGGCACCTTTCTCC


Athymic Mouse Model
ECC-1 endometrial tumours were developed according to the procedures described2.
Briefly, about 108 ECC-1 cells/0.1 ml were injected bilaterally into mammary fat
pads of 4-5 week old ovariectomized athymic mice (BALB/c, Charles River, Beijing,
China). E2 was administered via a 1.0 cm silastic capsule implanted subcutaneously
to stimulate tumour growth2. When ECC-1 tumours reached 1.0 cm2, a single tumour
was harvested, and 1.0 mm3 pieces were bitransplanted into the anterior axillary
                                                                                         7



region of 22 athymic mice, which were treated as follows: 0.3 cm E2 capsules (n=8);
0.5 mg of tamoxifen capsules (n=8); or untreated control (n=6). Silastic E2 capsules
(Sigma Chemical Co.) were made as described3; they were implanted subcutaneously
and replaced every 8 weeks. Tamoxifen was dissolved in ethanol and suspended in a
solution of 90% carboxymethylcellulose (1% carboxymethylcellulose in
double-distilled water) and 10% polyethylene glycol 400/Tween 80 (99.5%
polyethylene glycol 400 and 0.5% Tween 80). The ethanol was evaporated under
nitrogen before use. Tamoxifen were administered by gavages at 0.5 mg per mouse
per day, 5 days/week. Tumour measurements were performed weekly using Vernier
callipers. The cross-sectional area was calculated using the formula: length x width/4
x . All studies were approved by the Animal Care Committee of Peking University
Health Science Center.


Dual Immunofluorescent Staining
For ER detection, paraffin-embedded tissue sample sections were incubated with a
mouse anti-human ER monoclonal antibody and with a biotinylated goat anti-mouse
antibody (Biosource International, Camarillo, CA), and FITC-avidin (Vector
Laboratories, Burlingame, CA). For PAX2 detection, sections were incubated with a
mouse monoclonal antibody and with a biotinylated goat anti-mouse antibody and
Texas red-avidin (Biosource International). Sections were mounted with Vecta-shield
mountant for fluorescence (Vector Laboratories) and stored in the dark at 4°C.
Fluorescence staining was examined using an Olympus BX 40 fluorescence
microscope fitted with filters to detect both Texas Red (BP 545–580) and FITC (BP
450–480) fluorescence simultaneously as well as each of the two fluorochromes
separately. Controls (adjacent sections to each tumour sample) were treated and
stained in the same way as the test sections.


Chromatin Immunoprecipitation (ChIP)
ChIP experiments were performed according to the protocol described previously1.
The following primers were used to amplify a 605 bp fragment within the regulatory
                                                                                 8



region of PAX2 gene: forward: 5’-AGAGAGACACACACCGGGAG-3’, and reverse:
5’-GATGAGTGAACGCCCGGCT-3’; and a 331 bp fragment in the promoter region
of EREG1 gene: forward: 5’-CAGTAGGCCACCGAAGAACAC-3’, and reverse:
5’-CCCTAATACCCGCGGTTAGTG-3’.


Reference
1. Shang, Y., Hu, X., DiRenzo, J., Lazar, M. A. & Brown, M. Cofactor dynamics
   and sufficiency in estrogen receptor-regulated transcription. Cell 103, 843-52.
   (2000).
2. Dardes, R. C., Bentrem, D., O'Regan, R. M., Schafer, J. M. & Jordan, V. C.
   Effects of the new selective estrogen receptor modulator LY353381.HCl
   (Arzoxifene) on human endometrial cancer growth in athymic mice. Clin Cancer
   Res 7, 4149-55 (2001).
3. Robinson, S. P. & Jordan, V. C. Antiestrogenic action of toremifene on
   hormone-dependent, -independent, and heterogeneous breast tumor growth in the
   athymic mouse. Cancer Res 49, 1758-62 (1989).

				
DOCUMENT INFO