Protein Synthesis - PowerPoint

Document Sample
Protein Synthesis - PowerPoint Powered By Docstoc
					Construction Time: Building Proteins,
 Enzymes, and Hormones According
       to DNA’s Instructions

       Otherwise known as Protein
               Synthesis
 Overview of Protein Synthesis
• I. Proteins, enzymes, and hormones run
  organisms and are produced and/or
  shared by cells.
• II. DNA is the original code that programs
  the assembly of amino acids into proteins,
  but it can’t do it on its own and it relies on
  a lot of other cellular stuff.
• III. How does amino acid sequence
  determine protein function?
   I. Proteins run organisms and are produced
              and/or shared by cells.
 Just a few examples of vital proteins and functions
Name of Protein     Source of Protein,   Function             Consequence of
                    Types of Cell(s)                          absence or
                                                              dysfunction
Insulin             Pancreatic           Puts channel         Type I Diabetes
                                         proteins into
                                         membranes so
                                         glucose can get
                                         into cells
Melanin             Melanocyte (type of Produces pigment      Increased risk of
                    skin cell)          that protects skin    skin cancer or folic
                                        cells from uv light   acid deficiency
Fibroblast growth   Bones, others        Promote growth of    Achondroplasia
factor receptor 3                        skeleton, other      (affects “Mini-me”)
Rhodopsin           Rods of eye          Detect various       Achromotopsia
                                         colors               (color blindness)
     II. DNA is the original code, but it
           can’t do it on its own
• A. DNA information must be
  recoded into RNA information
  in order to build proteins out of
  our food’s amino acids.
    – 1. DNA’s location in the
      nucleus protects it from being
      digested by enzymes in the
      cytoplasm (outside the
      nucleus).
    – 2. The information in DNA is     Note: Protein is not
      recoded into RNA within the      made of RNA as diagram
      nucleus, and the RNA leaves      suggests; it’s made of
      the nucleus to do the rest of    amino acids from the
                                       protein we digest. The
      the work at the “protein         diagram is simply stating
      assembly line” which is          that DNA works through
      outside the nucleus.             RNA to guide the
                                       process of building a new
                                       protein.
The Cell and “Protein Factory”
                                                                   (office door)


                   (assembly line for     (instructions
                   proteins)              kept in office)
The RNA is not
                                                  DNA
as senstitive to
enzymes
outside the
nucleus as
DNA, so it
does the work
                                                             RNA
of building the
                                                             (recoded
proteins.
                                                             message)

                                                                    Nucleus
                                                                    (office)

                       (workers at the assembly line that
                       actually put the proteins together)
 II. DNA is the original code, but it
       can’t do it on its own
• B. Ribonucleic acid
  (RNA): Same message,
  different code
  – 1. Similarities to DNA:
      • Polymer of nucleotides,
        including nitrogenous       Note: In DNA this
        bases Adenine, Guanine,     would be just H, not
        and Cytosine                OH. So
  – 2. Differences from DNA         deoxyribose means
                                    deficiency of O
      • Has only one strand, not    compared to ribose.
        two
      • Has uracil instead of the
        nitrogen base thymine.
      • Contains the sugar ribose
        instead of deoxyribose
        and is therefore called
        ribonucleic acid.
 II. DNA is the original code, but it
       can’t do it on its own
• C. RNA’s Three Forms
  – 1. DNA in the nucleus can be recoded into three
    different types of RNA:
     • ribosomalRNA (rRNA): involved in building ribosomes
       (workers at assembly line)
     • transferRNA (tRNA): RNA that transfers amino acids to the
       ribosome to lengthen the protein (guys that bring fresh
       materials to the workers)
     • messengerRNA: RNA that carry instructions from DNA to
       ribosome to tell it how to put the protein together out of amino
       acids (the assistant to the boss who yells at the workers how
       to put stuff together)
              II. DNA is the original code, but it can’t do it on its own
                                RNA Concept Map

                                                                RNA



                                                               can be



        Messenger RNA                                     Ribosomal RNA                          Transfer RNA




also called         which functions to           also called            which builds   also called      which functions to


                                                                                                              Bring
 mRNA                  Carry instructions          rRNA                                   tRNA           amino acids to
                                                                         ribosomes
                                                                                                           ribosome



                from                        to



              nucleus                ribosome
 II. DNA is the original code, but it
       can’t do it on its own
• D. Protein Synthesis
  begins with transcription
   – 1. DNA is separated into
     two strands and one strand
     (the coding strand) is
     “read” and transcribed or
     “recoded” by RNA
     polymerase into one of the
     three types of RNA
      • The “base-pairing rule” is
        applied using uracil
        instead of thymine.
      • The DNA molecule is not
        consumed or hurt by this
        recoding process because
        the RNA is built from
        additional nucleotides.
Transcription:
Creating mRNA Strand   mRNA                              DNA              RNA
Within the Nucleus     Transcription
                                       A
                        T

                        A              T                        Bases
                        C              G

                        C              G

                                       G
                        C

                        A              T                       Sugars
                        C              G

                                       C
                        G

                        A              T

                        A              T
                                                               Strands
                                       A
                        T

                        A              T

                        A              T

                        C              G                       Location
                        C              G

                        A              T

                        T              A

                        T              A


                                           DNA strands
                            RNA            1 and 2
 II. DNA is the original code, but it
       can’t do it on its own
• D. Protein Synthesis begins with
  transcription, continued
  – 2. When it’s time to build a protein,
    transcription will produce mRNA, which
    carries the main message. tRNA and
    rRNA that will be needed later for help
    will already have been transcribed in
    advance. In other words, tRNA and
    rRNA are waiting for the mRNA.
 II. DNA is the original code, but it
       can’t do it on its own
• E. Getting ready for
  translation (protein
  making):
   – 1. The transcribed
     mRNA leaves the
     nucleus for a ribosome,
     which in eukaryotes is
     usually found on the
     outer surface of the
     roughER.
      • This will be the site of
        translation, where
        amino acids are
        finally put together
        into a polypeptide or
        protein.

                                   = direction mRNA
                                   moves
  II. DNA is the original code, but it
        can’t do it on its own
• E. Getting ready for
  translation (protein making),
  continued
    – 2. Each tRNA involved
      attaches to 1 of the 20
      types of amino acids that
      come from your digested
      proteins.
       • Which type of amino acid
         the tRNA attaches to       C G A
         depends on its
         anticodon (3 letter code
         of RNA at bottom of
         tRNA.)
II. DNA is the original code, but it can’t do it on its own
• F. Translation: Time to Assemble
  the Protein, continued                         1.
   – 1. mRNA begins to move through the
     ribosome. The AUG codon (3 letter
     combo in mRNA) is the “start codon”,
     the first to attract over a tRNA and an
     amino acid. The tRNA that is attracted      2.    3a.
     is the one with an anticodon that would
     match across from the codon according
     to the “base pair rule.”
   – 2. The next codon over in the mRNA
                                                 3b.
     attracts over another tRNA. If this next            4.
     codon is different than the first, then a
     different tRNA will come over and bring
     a different type of amino acid with it.
   – 3. The two AAs bond when next to
     each other, then the first tRNA leaves
     to make room for another tRNA.
   – 4. The process repeats itself until the
     STOP codon, which tells the ribosome
     it’s done building the protein
     (polypeptide).
1.    4.




           3.
 2.
 II. DNA is the original code, but it can’t do it
                  on its own
• G. Mission (mostly) Accomplished!
    – 1. Summary:

DNA in nucleus



                 RNA in nucleus
                                       }    Transcription



  Overview of                     mRNA, rRNA, tRNA leave nucleus
  protein                         and move to roughER to prepare
                                  for translation.
  synthesis

                                {
                                        rRNA in ribosome and tRNA
                                        cooperate to build a chain of AAs
                  Translation           according to the instructions found
                                        in mRNA.
                                    mRNA Translation –
 Original
                              Determining Amino Acid Sequence
  DNA             mRNA
sequence        Translation
            A
            U
            G
            G
            G
            U
            G
            C
            U
            U
            A
            U
            U
            U
            G
            U
            A
            A
     II. DNA is the original code, but it can’t do it
                      on its own
•   G. Mission (mostly) Accomplished!
     – 2. The amino acid sequence of the protein can
       be predicted just by knowing the sequence in
       your DNA. Try it starting with the DNA
       sequence.
         • DNA = TACCCCAAAGGCCATGCAATT
         • So what amino acids would end up in this
           short, imaginary protein?
         • DNA = TACACCCCGACTAAA
         • What’s the sequence this time?

     – 3. Notice that the DNA/RNA code does not
       need to use a special symbol to show
       punctuation. START and STOP is taken care of
       in its “three letter word” symbols.              -5. In reality, most proteins
     – 4. Also notice that a mistake in one N-base or   have 100 -10,000 amino
       letter may mean a different amino acid and       acids, not just a few.
       different final protein.
III. How does amino acid sequence
determine protein function?
• Complete “Amino acids determine protein
  shape” tutorial.

				
DOCUMENT INFO
Shared By:
Categories:
Stats:
views:526
posted:4/11/2008
language:English
pages:20