Powerpoint

Protein Synthesis

You must be logged in to download this document
Reviews
Shared by: sammyc2007
Stats
views:
80
downloads:
5
rating:
not rated
reviews:
0
posted:
4/11/2008
language:
English
pages:
0
Construction Time: Building Proteins, Enzymes, and Hormones According to DNA’s Instructions Otherwise known as Protein Synthesis Overview of Protein Synthesis • I. Proteins, enzymes, and hormones run organisms and are produced and/or shared by cells. • II. DNA is the original code that programs the assembly of amino acids into proteins, but it can’t do it on its own and it relies on a lot of other cellular stuff. • III. How does amino acid sequence determine protein function? I. Proteins run organisms and are produced and/or shared by cells. Just a few examples of vital proteins and functions Name of Protein Source of Protein, Types of Cell(s) Pancreatic Function Consequence of absence or dysfunction Type I Diabetes Insulin Puts channel proteins into membranes so glucose can get into cells Melanin Melanocyte (type of Produces pigment skin cell) that protects skin cells from uv light Bones, others Rods of eye Promote growth of skeleton, other Detect various colors Increased risk of skin cancer or folic acid deficiency Achondroplasia (affects “Mini-me”) Achromotopsia (color blindness) Fibroblast growth factor receptor 3 Rhodopsin II. DNA is the original code, but it can’t do it on its own • A. DNA information must be recoded into RNA information in order to build proteins out of our food’s amino acids. – 1. DNA’s location in the nucleus protects it from being digested by enzymes in the cytoplasm (outside the nucleus). – 2. The information in DNA is recoded into RNA within the nucleus, and the RNA leaves the nucleus to do the rest of the work at the “protein assembly line” which is outside the nucleus. Note: Protein is not made of RNA as diagram suggests; it’s made of amino acids from the protein we digest. The diagram is simply stating that DNA works through RNA to guide the process of building a new protein. The Cell and “Protein Factory” (office door) (assembly line for proteins) The RNA is not as senstitive to enzymes outside the nucleus as DNA, so it does the work of building the proteins. (instructions kept in office) DNA RNA (recoded message) Nucleus (office) (workers at the assembly line that actually put the proteins together) II. DNA is the original code, but it can’t do it on its own • B. Ribonucleic acid (RNA): Same message, different code – 1. Similarities to DNA: • Polymer of nucleotides, including nitrogenous bases Adenine, Guanine, and Cytosine Note: In DNA this would be just H, not OH. So deoxyribose means deficiency of O compared to ribose. – 2. Differences from DNA • Has only one strand, not two • Has uracil instead of the nitrogen base thymine. • Contains the sugar ribose instead of deoxyribose and is therefore called ribonucleic acid. II. DNA is the original code, but it can’t do it on its own • C. RNA’s Three Forms – 1. DNA in the nucleus can be recoded into three different types of RNA: • ribosomalRNA (rRNA): involved in building ribosomes (workers at assembly line) • transferRNA (tRNA): RNA that transfers amino acids to the ribosome to lengthen the protein (guys that bring fresh materials to the workers) • messengerRNA: RNA that carry instructions from DNA to ribosome to tell it how to put the protein together out of amino acids (the assistant to the boss who yells at the workers how to put stuff together) II. DNA is the original code, but it can’t do it on its own RNA Concept Map RNA can be Messenger RNA Ribosomal RNA Transfer RNA also called which functions to also called which builds also called which functions to Bring amino acids to ribosome mRNA Carry instructions rRNA ribosomes tRNA from to nucleus ribosome II. DNA is the original code, but it can’t do it on its own • D. Protein Synthesis begins with transcription – 1. DNA is separated into two strands and one strand (the coding strand) is “read” and transcribed or “recoded” by RNA polymerase into one of the three types of RNA • The “base-pairing rule” is applied using uracil instead of thymine. • The DNA molecule is not consumed or hurt by this recoding process because the RNA is built from additional nucleotides. Transcription: Creating mRNA Strand Within the Nucleus mRNA Transcription T A A T DNA RNA Bases C C C G G G A C G A A T G Sugars C T T Strands T A A A T T G G C C A T T Location T A A RNA DNA strands 1 and 2 II. DNA is the original code, but it can’t do it on its own • D. Protein Synthesis begins with transcription, continued – 2. When it’s time to build a protein, transcription will produce mRNA, which carries the main message. tRNA and rRNA that will be needed later for help will already have been transcribed in advance. In other words, tRNA and rRNA are waiting for the mRNA. II. DNA is the original code, but it can’t do it on its own • E. Getting ready for translation (protein making): – 1. The transcribed mRNA leaves the nucleus for a ribosome, which in eukaryotes is usually found on the outer surface of the roughER. • This will be the site of translation, where amino acids are finally put together into a polypeptide or protein. = direction mRNA moves II. DNA is the original code, but it can’t do it on its own • E. Getting ready for translation (protein making), continued – 2. Each tRNA involved attaches to 1 of the 20 types of amino acids that come from your digested proteins. • Which type of amino acid the tRNA attaches to depends on its anticodon (3 letter code of RNA at bottom of tRNA.) C G A II. DNA is the original code, but it can’t do it on its own • F. Translation: Time to Assemble the Protein, continued – 1. mRNA begins to move through the ribosome. The AUG codon (3 letter combo in mRNA) is the “start codon”, the first to attract over a tRNA and an amino acid. The tRNA that is attracted is the one with an anticodon that would match across from the codon according to the “base pair rule.” – 2. The next codon over in the mRNA attracts over another tRNA. If this next codon is different than the first, then a different tRNA will come over and bring a different type of amino acid with it. – 3. The two AAs bond when next to each other, then the first tRNA leaves to make room for another tRNA. – 4. The process repeats itself until the STOP codon, which tells the ribosome it’s done building the protein (polypeptide). 1. 2. 3a. 3b. 4. 1. 4. 2. 3. II. DNA is the original code, but it can’t do it on its own • G. Mission (mostly) Accomplished! – 1. Summary: DNA in nucleus } RNA in nucleus Translation Transcription Overview of protein synthesis { mRNA, rRNA, tRNA leave nucleus and move to roughER to prepare for translation. rRNA in ribosome and tRNA cooperate to build a chain of AAs according to the instructions found in mRNA. Original DNA sequence A mRNA Translation – Determining Amino Acid Sequence mRNA Translation U G G G U G C U U A U U U G U A A II. DNA is the original code, but it can’t do it on its own • G. Mission (mostly) Accomplished! – 2. The amino acid sequence of the protein can be predicted just by knowing the sequence in your DNA. Try it starting with the DNA sequence. • DNA = TACCCCAAAGGCCATGCAATT • So what amino acids would end up in this short, imaginary protein? • DNA = TACACCCCGACTAAA • What’s the sequence this time? – 3. Notice that the DNA/RNA code does not need to use a special symbol to show punctuation. START and STOP is taken care of in its “three letter word” symbols. – 4. Also notice that a mistake in one N-base or letter may mean a different amino acid and different final protein. -5. In reality, most proteins have 100 -10,000 amino acids, not just a few. III. How does amino acid sequence determine protein function? • Complete “Amino acids determine protein shape” tutorial.
Related docs
Other docs by sammyc2007