What are Microsatellites?
D2S123
TAGGCCACACACACACACACA
Unique Primer
• Mono, di, tri, tetra nucleotide repeats • HNPCC - Expansion/contraction of nl repeats
Strand Slippage
D2S123
TAGGCCACACACACACACACA 14 bp
Unique Primer
13-15 BP 4-40 RPTS
12 bp
TAGGCCACACACACACACACA
Mis-Match Repair Genes
• hMSH2
• hMLH1 • PMS1 • PMS2 • hMSH3 • hMSH6
Click for larger picture
Click for larger picture
Risk of CRC in Clinical HNPCC Families: Netherlands
HNPCC Age Location CI35 CI50 CI75 44 pr: 53% ds: 41% 10% 24% 42%
Sporadic
69 pr: 32% ds: 68% .07% .5% 5.3%
Voskuil, Int J CA 1997;72:205
Risk of CRC in MSH2/MLH1 HNPCC Families: Netherlands
%
CRC Lifetime Women 80 83
Men
Endometrial
92
50
Vasen, Gastro 1996;110:1020
HNPCC
• ~ 90% of tumors show MI
• Germline defect in MMR genes
• 2nd Hit - Somatic Mutation
MSI in Sporadic CRC
• 10 - 15% of sporadic CRC
• In HNPCC: Germline + somatic = MSI
• Sporadic - biallelic somatic mutation via methylation of MLH1 promoter
TC = Transcription Complex
Click for larger picture
Gene Testing for hMLH1 or hMSH2
• DGGE • SSCP
• IVSP
• Direct Sequencing
Gene Testing
Sensitivity
Sequencing CSGE & Sequencing Screening (SSCP) Screening (PTT) >90% >90% 95 - 100% 50 - 60%
Cost ($)
800 - 3,000 1500 800 750
MSI
NA
300
Gastro 2001;121:195
Gene Testing for MSH2/MLH1
509 Finnish CRC pts
5/10 Founder mutation 7/10 Amsterdam Criteria
63 MSI
All either young, had fam hx, or previous CA
Aaltonen, NEJM 1998;38:1481
10 (2%) MMR mutations
Predictive Model for MMR Gene Testing
184 Kindreds: 26% w/ MMR mutations 1) Mean age at diagnosis of affecteds
2) At least 1 member w/ Endometrial CA
3) Amsterdam Criteria
Wijnen, NEJM 1998;339:511
Predictive Model for MMR Gene Testing
Logistic Model Prob <20% MSI Nothing
Prob >20%
MMR Analysis
+ MMR Analysis
Wijnen, NEJM 1998;339:511
Bethesda Criteria and MMR Mutation
N=125, “high risk”, Frankfurt, GE
+ BC
N MSI 58 (46%) 17 (29%)
- BC
67 (54%) 5 (7.5%)
Total
125 22 (18%)
MMR Mutation 11 (65%)
B1 - B4 46 (79%)
0 (0%)
11 (9%)
Raedle, Ann Int Med 2001;135:566
Bethesda vs. Amsterdam
MMR Mutation MSI status Criteria to predict MSI
Sens 27 46 77
Spec 94 90 60
Amsterdam Amsterdam II Bethesda
6/6 8/10 11/17
Raedle, Ann Int Med 2001;135:566
Cost Effectiveness of MSI
• Decision tree using MSI (Bethesda guidelines) and MMR mutations
• 90% CI for cost-effectiveness of screening patients with cancer & relatives: $4,874 - 21,576 / life year gained • Sensitivity analysis - prevalence HNPCC mutation #1 factor
Ramsey, Ann Int Med 2001;135:577
Click for larger picture
Mutations in HNPCC Kindreds
• 32 Kindreds (N=38) in Buffalo and Vermont • Amsterdam Criteria
Incidence of Mutations MSH2/MLH1: 25% Conclusion: • Molecular basis unknown for many subjects
Weber, Cancer Res 1997;57:3798
Effectiveness of Screening in HNPCC
• 252 subjects, 22 Families (119 Control, 133 screen) • Colon q3yrs, 1984, 15 yr F/U • Not randomized - declined participation
Screen
CRC Mutation + Deaths to CRC 8 (6%) 18% 0
Control OR
19 (16%) 41% 8% .4 .4
P
.01 .02 <.001
Jarvinen, Gastro 2000;118
Click for larger picture
Risk of Metachronous CRC
50 40 30 20 10 0 10 y 15 y Population MMR Mutation
Colonoscopy in High Risk Individuals
31 HNPCC Families - 232 Individuals 86 (38.6%) underwent colonos-compared to controls
Case
CA Adenomas TV/V (#) Ad Diam HGD (#) 5 29 11 9.1 9
Control
1 11 1 5.8 3
P
.03
.02
Ponz de Leon, CEBP 1998;7:639
Center for Families at Risk for CRC
Jan „98 - June „00 Goal: To develop a registry of high risk families To assemble blood/DNA for research Recruitment: Physician referral, Media, UPCI CA Registry High Risk Definition: Young onset, FDR young onset, Multiple cancers Overall: 83 individuals (76 families)
UPCI Registry
Alive 82 Agreed 26 11 (5.9%) 23 Not Interested Enrolled 33 Unavailable 188 Dead 106
Young onset cancers - <45, 45-55
High Risk Patients
70 Probands - Complete data, exclude FAP 67.1% High Risk
23 Young Onset (<55)
9 Multiple CA‟s 15 Young and Multiple (8 Amsterdam Criteria)
Problems With Center
• Lab Support • Integrated Recruitment • Coordinated Approach With Other Cancers
Gene Testing
• www.genetests.org
• www.nsgc.org