Powerpoint

Hereditary Colorectal Cancer

You must be logged in to download this document
Reviews
Shared by: sammyc2007
Stats
views:
44
downloads:
2
rating:
not rated
reviews:
0
posted:
4/10/2008
language:
English
pages:
0
What are Microsatellites? D2S123 TAGGCCACACACACACACACA Unique Primer • Mono, di, tri, tetra nucleotide repeats • HNPCC - Expansion/contraction of nl repeats Strand Slippage D2S123 TAGGCCACACACACACACACA 14 bp Unique Primer 13-15 BP 4-40 RPTS 12 bp TAGGCCACACACACACACACA Mis-Match Repair Genes • hMSH2 • hMLH1 • PMS1 • PMS2 • hMSH3 • hMSH6 Click for larger picture Click for larger picture Risk of CRC in Clinical HNPCC Families: Netherlands HNPCC Age Location CI35 CI50 CI75 44 pr: 53% ds: 41% 10% 24% 42% Sporadic 69 pr: 32% ds: 68% .07% .5% 5.3% Voskuil, Int J CA 1997;72:205 Risk of CRC in MSH2/MLH1 HNPCC Families: Netherlands % CRC Lifetime Women 80 83 Men Endometrial 92 50 Vasen, Gastro 1996;110:1020 HNPCC • ~ 90% of tumors show MI • Germline defect in MMR genes • 2nd Hit - Somatic Mutation MSI in Sporadic CRC • 10 - 15% of sporadic CRC • In HNPCC: Germline + somatic = MSI • Sporadic - biallelic somatic mutation via methylation of MLH1 promoter TC = Transcription Complex Click for larger picture Gene Testing for hMLH1 or hMSH2 • DGGE • SSCP • IVSP • Direct Sequencing Gene Testing Sensitivity Sequencing CSGE & Sequencing Screening (SSCP) Screening (PTT) >90% >90% 95 - 100% 50 - 60% Cost ($) 800 - 3,000 1500 800 750 MSI NA 300 Gastro 2001;121:195 Gene Testing for MSH2/MLH1 509 Finnish CRC pts  5/10 Founder mutation  7/10 Amsterdam Criteria 63 MSI  All either young, had fam hx, or previous CA Aaltonen, NEJM 1998;38:1481 10 (2%) MMR mutations Predictive Model for MMR Gene Testing 184 Kindreds: 26% w/ MMR mutations 1) Mean age at diagnosis of affecteds 2) At least 1 member w/ Endometrial CA 3) Amsterdam Criteria Wijnen, NEJM 1998;339:511 Predictive Model for MMR Gene Testing Logistic Model Prob <20% MSI Nothing Prob >20% MMR Analysis + MMR Analysis Wijnen, NEJM 1998;339:511 Bethesda Criteria and MMR Mutation N=125, “high risk”, Frankfurt, GE + BC N MSI 58 (46%) 17 (29%) - BC 67 (54%) 5 (7.5%) Total 125 22 (18%) MMR Mutation 11 (65%) B1 - B4 46 (79%) 0 (0%) 11 (9%) Raedle, Ann Int Med 2001;135:566 Bethesda vs. Amsterdam MMR Mutation MSI status Criteria to predict MSI Sens 27 46 77 Spec 94 90 60 Amsterdam Amsterdam II Bethesda 6/6 8/10 11/17 Raedle, Ann Int Med 2001;135:566 Cost Effectiveness of MSI • Decision tree using MSI (Bethesda guidelines) and MMR mutations • 90% CI for cost-effectiveness of screening patients with cancer & relatives: $4,874 - 21,576 / life year gained • Sensitivity analysis - prevalence HNPCC mutation #1 factor Ramsey, Ann Int Med 2001;135:577 Click for larger picture Mutations in HNPCC Kindreds • 32 Kindreds (N=38) in Buffalo and Vermont • Amsterdam Criteria Incidence of Mutations MSH2/MLH1: 25% Conclusion: • Molecular basis unknown for many subjects Weber, Cancer Res 1997;57:3798 Effectiveness of Screening in HNPCC • 252 subjects, 22 Families (119 Control, 133 screen) • Colon q3yrs, 1984, 15 yr F/U • Not randomized - declined participation Screen CRC Mutation + Deaths to CRC 8 (6%) 18% 0 Control OR 19 (16%) 41% 8% .4 .4 P .01 .02 <.001 Jarvinen, Gastro 2000;118 Click for larger picture Risk of Metachronous CRC 50 40 30 20 10 0 10 y 15 y Population MMR Mutation Colonoscopy in High Risk Individuals 31 HNPCC Families - 232 Individuals 86 (38.6%) underwent colonos-compared to controls Case CA Adenomas TV/V (#) Ad Diam HGD (#) 5 29 11 9.1 9 Control 1 11 1 5.8 3 P .03 .02 Ponz de Leon, CEBP 1998;7:639 Center for Families at Risk for CRC Jan „98 - June „00 Goal: To develop a registry of high risk families To assemble blood/DNA for research Recruitment: Physician referral, Media, UPCI CA Registry High Risk Definition: Young onset, FDR young onset, Multiple cancers Overall: 83 individuals (76 families) UPCI Registry Alive 82 Agreed 26 11 (5.9%) 23 Not Interested Enrolled 33 Unavailable 188 Dead 106 Young onset cancers - <45, 45-55 High Risk Patients 70 Probands - Complete data, exclude FAP 67.1% High Risk 23 Young Onset (<55) 9 Multiple CA‟s 15 Young and Multiple (8 Amsterdam Criteria) Problems With Center • Lab Support • Integrated Recruitment • Coordinated Approach With Other Cancers Gene Testing • www.genetests.org • www.nsgc.org
Related docs
Other docs by sammyc2007