Docstoc

Apoptosis_ cell growth and differentiation - DOC

Document Sample
Apoptosis_ cell growth and differentiation - DOC Powered By Docstoc
					Supplemental Table 1. Determining the optimal window size for scanning the genome.


        Window size = 300 bp                                             Window size = 500 bp
   k      STAT1 Random %FDR                                      k       STAT1 Random %FDR
   1      84038  90921  108                                      1       82296  90267  110
   2       3971   1235   31                                      2        5373   1885   35
   3        436    11   2.5                                      3         734    26   3.5
   4         73   0.15  0.2                                      4         166    0.3  0.2
   5          6     0     0                                      5          33     0     0


        Window size = 1000 bp                                    Window size = 2000 bp

   k      STAT1 Random %FDR                                  k          STAT1 Random %FDR
   1      79461  88701  111                                  1          75202  85833  114
   2       7829   3433   44                                  2          11418   6291   55
   3       1222    79    2.5                                 3           2002    255   1.5
   4        297     2    0.6                                 4            567    8.4   0.6
   5         81    0.1  0.12                                 5            170    0.3   0.2
   6         27     0     0                                  6             64   0.05  0.08

k is the number of single hit tags found within a window. The false discovery rate (FDR) was
calculated as (random/STAT1)*100.

Supplemental Table 2. RefSeq annotated genes within 20 Kb upstream or downstream to STAT1
binding sites detected in the genome.

Genes                  Description                                                   Position of STAT1 binding site
Immune response
C1S                complement component 1, s subcomponent                             UPS              111
SECTM1             secreted and transmembrane 1                                       UPS              5365
IL18BP             interleukin 18 binding protein                                     EXN              527
STAT3              signal transducer and activator of transcription 3                 UPS              307
BST2               bone marrow stromal cell antigen 2                                 UPS              50
IFI35              interferon-induced protein 35                                      EXN              35
HLA-E              major histocompatibility complex, class I, E                       UPS              168
IRF1               interferon regulatory factor 1                                     UPS              5091, 6761
CD7                CD7 antigen (p41)                                                  DS               19119
IFI16              interferon, gamma-inducible protein 16                             UPS              9910
IL4R               interleukin 4 receptor                                             INT              13152
STAT1              signal transducer and activator of transcription 1                 UPS              611
PLSCR1             phospholipid scramblase 1                                          INT              1135

Lipid metabolism
SMPD1                   sphingomyelin phosphodiesterase 1                                       UPS    376
SULT1A1                 sulfotransferase family, cytosolic, 1A, phenol-preferring, member 1     DS     5222
LRP8                    low density lipoprotein receptor-related protein 8                      DS     1685
SLC27A4                 solute carrier family 27 (fatty acid transporter), member 4             UPS    769, 17881
APOL6                   apolipoprotein L, 6                                                     INT    247

Cell adhesion
ITGB3                   integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61)             UPS    13708
ICAM1                   intercellular adhesion molecule 1 (CD54), human rhinovirus receptor     INT    392
NID2                    nidogen 2 (osteonidogen)                                                UPS    2976
FNBP4                   formin binding protein 4                                                UPS    875
COL5A1                  collagen, type V, alpha 1                                               UPS    15031
ENG                     endoglin (Osler-Rendu-Weber syndrome 1)                                 INT    7660

Cell growth, differentiation and death
NRG1                      neuregulin 1                                                          UPS   15639
TNFAIP2                   tumor necrosis factor, alpha-induced protein 2                        UPS   8019
PHLDA2                    pleckstrin homology-like domain, family A, member 2                   UPS   11153
DAPK3                     death-associated protein kinase 3                                     UPS   14381
DAPK3                     death-associated protein kinase 3                                     INT   777
TNFRSF1A                  tumor necrosis factor receptor superfamily, member 1A                 INT   5733
CDC7                      CDC7 cell division cycle 7 (S. cerevisiae)                            UPS   196
CDK6                      cyclin-dependent kinase 6                                             DS    657
BRCA2                     breast cancer 2, early onset                                          INT   465
RAP1A                     RAP1A, member of RAS oncogene family                                  UPS   527
TREX1                     three prime repair exonuclease 1                                      DS    669
MTHFD2                    methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2           DS    7741

Protein metabolism
TARS                    threonyl-tRNA synthetase                                                UPS   233
DUSP14                  dual specificity phosphatase 14                                         UPS   6197
EEF2                    eukaryotic translation elongation factor 2                              DS    1254, 16412
SURF6                   surfeit 6                                                               UPS   86
MATN1                   matrilin 1, cartilage matrix protein                                    DS    4665
EEF2K                   eukaryotic elongation factor-2 kinase                                   INT   976
PSMB3                   proteasome (prosome, macropain) subunit, beta type, 3                   INT   93
GFM1                    G elongation factor, mitochondrial 1                                    INT   194
USP48                   ubiquitin specific protease 48                                          UPS   831
RPL35                   ribosomal protein L35                                                   UPS   1730
DPP9                    dipeptidylpeptidase 9                                                   DS    10682
SLC9A3R1                solute carrier family 9 (sodium/hydrogen exchanger)                     INT   9291
PARP14                  poly (ADP-ribose) polymerase family, member 14                          UPS   19283
PTP4A2                  protein tyrosine phosphatase type IVA, member 2                         UPS   1310
                        a disintegrin and metalloproteinase domain 17 (tumor necrosis factor,
ADAM17                  alpha, converting enzyme)                                               INT   342
VRK3                    vaccinia related kinase 3                                               UPS   123
HSPB1                   heat shock 27kDa protein 1                                              UPS   7760
PTK6                    PTK6 protein tyrosine kinase 6                                          UPS   651
TRIO                    triple functional domain (PTPRF interacting)                            INT   13363
CARS                    cysteinyl-tRNA synthetase                                               INT   7483
DTX3L                   deltex 3-like (Drosophila)                                              UPS   195
HS6ST1                  heparan sulfate 6-O-sulfotransferase 1                                   INT   13493

Signal transduction
SNX27                   sorting nexin family member 27                                           UPS   5560
IPO8                    importin 8                                                               UPS   367
RAB36                   RAB36, member RAS oncogene family                                        DS    7340
GPR37L1                 G-protein coupled receptor 37 like 1                                     UPS   15711
CXXC5                   CXXC finger 5                                                            UPS   12166
PITPNC1                 phosphatidylinositol transfer protein, cytoplasmic 1                     INT   12593
RHOF                    ras homolog gene family, member F (in filopodia)                         UPS   1131
ITPK1                   inositol 1,3,4-triphosphate 5/6 kinase                                   UPS   5305
GUCA1B                  guanylate cyclase activator 1B (retina)                                  INT   3969
RASSF5                  Ras association (RalGDS/AF-6) domain family 5                            INT   6210, 7336

Transport
ABCC11                  ATP-binding cassette, sub-family C (CFTR/MRP), member 11                 EXN   321
SCNN1A                  sodium channel, nonvoltage-gated 1 alpha                                 DS    4824
VMD2L3                  vitelliform macular dystrophy 2-like 3                                   EXN   171
                        solute carrier family 25 (mitochondrial carrier; citrate transporter),
SLC25A1                 member 1                                                                 UPS   922
KCNJ12                  potassium inwardly-rectifying channel, subfamily J, member 12            UPS   4203
SLC22A2                 solute carrier family 22 (organic cation transporter), member 2          DS    19540
C1QTNF6                 C1q and tumor necrosis factor related protein 6                          UPS   671, 9571
CLIC2                   chloride intracellular channel 2                                         UPS   366
                        solute carrier family 25 (mitochondrial carrier; phosphate carrier),
SLC25A25                member 25                                                                INT   256
COPG                    coatomer protein complex, subunit gamma                                  UPS   3780
ZNF406                  zinc finger protein 406                                                  INT   10934, 11357
VPS18                   vacuolar protein sorting protein 18                                      UPS   2668
HPX                     hemopexin                                                                DS    1813
SLC35A2                 solute carrier family 35 (UDP-galactose transporter), member A2          UPS   195
MTCH2                   mitochondrial carrier homolog 2 (C. elegans)                             UPS   66

Other biological processes
C1orf191                 chromosome 1 open reading frame 191                                     UPS   8524
BATF2                    hypothetical protein BC012330                                           EXN   118
RND1                     Rho family GTPase 1                                                     DS    12542, 13750
EIF1                     putative translation initiation factor                                  UPS   9819
FLJ32926                 hypothetical protein FLJ32926                                           DS    13806
FLJ25660                 hypothetical protein FLJ25660                                           DS    14356
C2orf18                  chromosome 2 open reading frame 18                                      UPS   6304
LHFPL5                   lipoma HMGIC fusion partner-like 5                                      INT   6227
PRPF4                    PRP4 pre-mRNA processing factor 4 homolog (yeast)                       UPS   306
C16orf47                 FLJ26184 protein                                                        DS    2438, 19985
PAF1                     hypothetical protein F23149_1                                           UPS   11736
ZNF473                   zinc finger protein 473                                                 UPS   283
CLPS                     colipase, pancreatic                                                    UPS   14195
LONPL                    peroxisomal lon protease                                                UPS   12349
ZNF114                   hypothetical protein MGC17986                                           DS    18873
RPL7A                    ribosomal protein L7a                                                   UPS   11938
PUS3                     pseudouridylate synthase 3                                              INT   85
LOC441108        hypothetical protein                                                DS    16654
VAT1             vesicle amine transport protein 1 homolog (T californica)           DS    15536
C9orf88          chromosome 9 open reading frame 88                                  INT   12964
IXL              intersex-like (Drosophila)                                          DS    11453
APBB1            amyloid beta (A4) precursor protein-binding, family B, member 1     UPS   19736
LOC399900        hypothetical protein                                                DS    5254
NAGLU            N-acetylglucosaminidase, alpha- (Sanfilippo disease IIIB)           DS    5397
BBS4             Bardet-Biedl syndrome 4                                             UPS   15058
MGC14327         hypothetical protein MGC14327                                       DS    7245
PTPN21           protein tyrosine phosphatase, non-receptor type 21                  UPS   5222
                 sema domain, immunoglobulin domain (Ig), short basic domain,
SEMA3F           secreted, (semaphorin) 3F                                           DS    8681
COQ4             coenzyme Q4 homolog (yeast)                                         DS    17256
COQ4             coenzyme Q4 homolog (yeast)                                         EXN   144
                 serine (or cysteine) proteinase inhibitor, clade B (ovalbumin),
SERPINB6         member 6                                                            UPS   16784
DSCR4            Down syndrome critical region gene 4                                UPS   18568
                 src-related kinase lacking C-terminal regulatory tyrosine and N-
SRMS             terminal myristylation sites                                        DS    9499
                 pleckstrin homology domain containing, family G (with RhoGef
PLEKHG2          domain) member 2                                                    UPS   10334
ASB6             ankyrin repeat and SOCS box-containing 6                            DS    15858
APOA1BP          apolipoprotein A-I binding protein                                  DS    9445
TMEM55B          chromosome 14 open reading frame 9                                  UPS   307
NQO2             NAD(P)H dehydrogenase, quinone 2                                    UPS   11356
MGC13168         vitelliform macular dystrophy 2-like 3                              DS    10227
ICAM4            intercellular adhesion molecule 4, Landsteiner-Wiener blood group   UPS   15479
C1orf147         chromosome 1 open reading frame 147                                 UPS   16027, 17153
                 MCM2 minichromosome maintenance deficient 2, mitotin (S.
MCM2             cerevisiae)                                                         DS    19019
PODXL2           podocalyxin-like 2                                                  UPS   11788
FLJ37078         hypothetical protein                                                DS    9788
TRUB2            TruB pseudouridine (psi) synthase homolog 2 (E. coli)               UPS   261, 17373
DKFZp686I15217   hypothetical protein DKFZp686I15217                                 UPS   58
ZNF302           zinc finger protein 302                                             UPS   292
C17orf41         hypothetical protein FLJ12735                                       EXN   317
SSTR3            somatostatin receptor 3                                             DS    14452
C6orf65          chromosome 6 open reading frame 65                                  UPS   16498
SLBP             stem-loop (histone) binding protein                                 UPS   15299
C1orf111         hypothetical protein LOC284680                                      UPS   4553
C1orf90          hypothetical protein MGC10820                                       UPS   15
DENND1A          KIAA1608                                                            UPS   3696
SHC1             SHC (Src homology 2 domain containing) transforming protein 1       UPS   9158
C9orf32          AD-003 protein                                                      INT   152
UBASH3A          ubiquitin associated and SH3 domain containing, A                   UPS   7729, 8564
NUP210           nucleoporin 210kDa                                                  UPS   581
NPFFR1           G protein-coupled receptor 147                                      UPS   1091
MCL1             myeloid cell leukemia sequence 1 (BCL2-related)                     DS    17076
LOC93343         hypothetical protein BC011840                                       UPS   14477
PELI3            pellino 3 alpha                                                     UPS   12477
TMEM104          hypothetical protein FLJ20255                                       UPS   18599
HSD17B1          hydroxysteroid (17-beta) dehydrogenase 1                            UPS   10636
CRLF3       cytokine receptor-like factor 3                                             UPS   7648
ANKRD13D    hypothetical protein LOC338692                                              UPS   1179
C1orf138    chromosome 1 open reading frame 138                                         UPS   469
ZNF335      zinc finger protein 335                                                     UPS   11289
FLJ45248    FLJ45248 protein                                                            EXN   961
RARRES2     retinoic acid receptor responder (tazarotene induced) 2                     DS    18775
ZC3H3       zinc finger CCCH type domain containing 3                                   UPS   5825
SNX1        sorting nexin 1                                                             UPS   2129
PLXDC1      plexin domain containing 1                                                  DS    12343
DSCR8       Down syndrome critical region gene 8                                        DS    18456
KIAA0040    KIAA0040 gene product                                                       UPS   697
LOC284751   hypothetical protein                                                        INT   236
C7orf29     chromosome 7 open reading frame 29                                          UPS   7006
TMPRSS3     transmembrane protease, serine 3                                            DS    746
TMPRSS3     transmembrane protease, serine 3                                            UPS   89
TMEM61      hypothetical protein LOC199964                                              UPS   7273
THAP2       hypothetical protein DKFZp564I0422                                          EXN   145
MTHFR       5,10-methylenetetrahydrofolate reductase (NADPH)                            DS    15179
RARG        retinoic acid receptor, gamma                                               UPS   19431
AEBP2       AE binding protein 2                                                        UPS   7648
LCK         lymphocyte-specific protein tyrosine kinase                                 UPS   4113
GPATC4      G patch domain containing 4                                                 INT   268
TMEM50A     small membrane protein 1                                                    DS    17864
RND2        ras homolog gene family, member N                                           UPS   18398
CKS1B       CDC28 protein kinase regulatory subunit 1B                                  DS    8785
PPAP2C      phosphatidic acid phosphatase type 2C                                       INT   951
ELF3        E74-like factor 3 (ets domain transcription factor, epithelial-specific )   EXN   2183
SULT1A2     sulfotransferase family, cytosolic, 1A, phenol-preferring, member 2         UPS   7036
PCGF2       ring finger protein 110                                                     UPS   4536
ZNF367      zinc finger protein 367                                                     EXN   313
PSCA        prostate stem cell antigen                                                  INT   614
MFSD5       hypothetical protein MGC11308                                               UPS   468
PSRC1       p53-regulated DDA3                                                          UPS   2058
C11orf10    chromosome 11 open reading frame 10                                         EXN   10
LOC153222   adult retina protein                                                        UPS   144
NDOR1       NADPH dependent diflavin oxidoreductase 1                                   UPS   7337
CRI1        CREBBP/EP300 inhibitor 1                                                    UPS   6502
FOXL2       forkhead box L2                                                             DS    5389
            similar to Golgi autoantigen, golgin subfamily A member 6 (Golgin
GOLGA       linked to PML) (Golgin-like protein)                                        DS    16438
ZNF181      zinc finger protein 181                                                     UPS   377
LOC389289   hypothetical protein                                                        UPS   175
RPL27       ribosomal protein L27                                                       DS    8414
SSNA1       Sjogren's syndrome nuclear autoantigen 1                                    DS    9713
JRK         jerky homolog (mouse)                                                       UPS   14561
KRTHB1      keratin, hair, basic, 1                                                     DS    10462, 10906
ESPL1       extra spindle poles like 1 (S. cerevisiae)                                  UPS   17139
SPINK4      serine protease inhibitor, Kazal type 4                                     UPS   5807
C9orf50     hypothetical protein LOC375759                                              UPS   5531
ARL2        ADP-ribosylation factor-like 2                                              UPS   17269
HAND1       heart and neural crest derivatives expressed 1                              DS    6787
HM13        histocompatibility (minor) 13                                      INT   345
TACC3       transforming, acidic coiled-coil containing protein 3              DS    6064
TMEM62      hypothetical protein FLJ23375                                      UPS   10223
P8          p8 protein (candidate of metastasis 1)                             DS    6914
MRPL4       mitochondrial ribosomal protein L4                                 DS    19531
MRPL11      mitochondrial ribosomal protein L11                                UPS   15616
CLCN6       chloride channel 6                                                 UPS   15357
FAM96A      hypothetical protein FLJ22875                                      EXN   160
ZFP36       zinc finger protein 36, C3H type, homolog (mouse)                  UPS   4071
PREX1       PREX1 protein                                                      UPS   4123
C20orf195   hypothetical protein MGC5356                                       UPS   15014
SSH3        slingshot homolog 3 (Drosophila)                                   UPS   15361
APOC2       apolipoprotein C-II                                                DS    8883
PIM2        pim-2 oncogene                                                     DS    7156
ICAM5       intercellular adhesion molecule 5, telencephalin                   UPS   18484
C9orf106    chromosome 9 open reading frame 106                                DS    12981
CDC26       cell division cycle 26                                             EXN   202
LENEP       lens epithelial protein                                            UPS   10063
UBR1        ubiquitin protein ligase E3 component n-recognin 1                 UPS   17212
            ATP synthase, H+ transporting, mitochondrial F1 complex, beta
ATP5B       polypeptide                                                        DS    9386
TMEM129     hypothetical protein BC009331                                      UPS   6245
LOC284912   hypothetical gene supported by BC001801                            UPS   13488
EDEM2       chromosome 20 open reading frame 31                                INT   281
SURF5       surfeit 5                                                          DS    11842
C5orf13     chromosome 5 open reading frame 13                                 DS    9040
C20orf149   chromosome 20 open reading frame 149                               DS    17226
HYLS1       hypothetical protein FLJ32915                                      DS    19512
DDX23       DEAD (Asp-Glu-Ala-Asp) box polypeptide 23                          EXN   54
DDX23       DEAD (Asp-Glu-Ala-Asp) box polypeptide 23                          UPS   1154
C9orf75     chromosome 9 open reading frame 75                                 INT   1712
BAZ2A       bromodomain adjacent to zinc finger domain, 2A                     UPS   303
C10orf47    chromosome 10 open reading frame 47                                UPS   12703
OSGEP       O-sialoglycoprotein endopeptidase                                  UPS   6745
APEX1       APEX nuclease (multifunctional DNA repair enzyme) 1                DS    6654
LRRC61      hypothetical protein MGC3036                                       UPS   673
WDR34       WD repeat domain 34                                                EXN   33
APOC4       apolipoprotein C-IV                                                DS    12631
GSDMDC1     gasdermin domain containing 1                                      UPS   11063
NOB1        nin one binding protein                                            UPS   35
FEN1        flap structure-specific endonuclease 1                             UPS   74
PQBP1       polyglutamine binding protein 1                                    DS    13590
KRT7        keratin 7                                                          DS    11172
KRT7        keratin 7                                                          UPS   946
C14orf79    chromosome 14 open reading frame 79                                UPS   8799
NAT9        embryo brain specific protein                                      DS    18396
RHOV        ras homolog gene family, member V                                  UPS   17520
TIMM17B     translocase of inner mitochondrial membrane 17 homolog B (yeast)   UPS   13702
RTDR1       rhabdoid tumor deletion region gene 1                              UPS   10611
PARP9       poly (ADP-ribose) polymerase family, member 9                      INT   354
HAPLN2      hyaluronan and proteoglycan link protein 2                         UPS   18083
DDX25              DEAD (Asp-Glu-Ala-Asp) box polypeptide 25                 UPS     1382
LTBR               lymphotoxin beta receptor (TNFR superfamily, member 3)    UPS     13465
NP                 nucleoside phosphorylase                                  UPS     7621
KRTAP17-1          keratin associated protein 17-1                           UPS     13707
WWP2               WW domain containing E3 ubiquitin protein ligase 2        UPS     7409
ARPC5L             actin related protein 2/3 complex, subunit 5-like         UPS     5513
FLAD1              FAD synthetase                                            INT     182
ADAMTSL4           thrombospondin repeat containing 1                        DS      13163
DAB2IP             DAB2 interacting protein                                  UPS     5701
PSRC2              hypothetical protein MGC23401                             UPS     179
CLPTM1             cleft lip and palate associated transmembrane protein 1   UPS     512
LY6K               lymphocyte antigen 6 complex, locus K                     UPS     19042
FCHO2              FCH domain only 2                                         UPS     72
FTH1               ferritin, heavy polypeptide 1                             UPS     5387
ANAPC2             anaphase promoting complex subunit 2                      UPS     9788
FLJ11806           nuclear protein UKp68                                     UPS     2968
CCNL1              cyclin L1                                                 UPS     14267
KIAA1618           KIAA1618                                                  UPS     6047
STOM               stomatin                                                  INT     7363
MRVI1              murine retrovirus integration site 1 homolog              INT     17906


UPS: upstream, DS: downstream, EXN: first exon, INT : first intron

Supplemental Table 3. Primers used for quantitative PCR analysis.

Locus              Primer sequence
IRF1-D             Forward: CTAGAACCCACCAACCTCCA
                   Reverse: TGCCTCGAACTCACCCTACT
IRF1-P             Forward: CTGAAGCTGGCTGGAAAATC
                   Reverse: AGCACTGGAGCAATTCCTTG
SLC25A25           Forward: GGCAGCATTTAGGGAACTTG
                   Reverse: CAGGCACAGACAGAGCATGT
STAT3              Forward: ACGCGGGAATCAGCTAGTTA
                   Reverse: TTTTTGTTGTCCCCAGAACC
chr22-34786430     Forward: GGATTTTCACCATCGGACTG
                   Reverse: TCTCCTCCCTTCTCCCTGAT
TNFRSF1A           Forward: AGGGGAGAGGGAACTAGCAG
                   Reverse: CCTTCTGCCTTTCTGCTGAC
DAPK3              Forward: AACAATTGACCGAGGTTTGG
                   Reverse: GCCCAGCTCTTGGATGTTTA
C1S                Forward: GAGGACGCTGTCCTTGTTTC
                   Reverse: GGCTGGGAGACCATGACTTA
APOL6              Forward: CCTCCCTTACAGCCATTTCA
                   Reverse: AGTGGAGGGACAAATGCAAC
ADAM17             Forward: ATCCAGCCACCCTACTCCTT
                   Reverse: GCTCCCTAGCTTTGTGTTCG
GAPDH              Forward: AAAAGCGGGGAGAAAGTAGG
                   Reverse: GTCTTGAGGCCTGAGCTACG
GAPDH indicates the gapdh promoter that was used as a reference for calculating fold enrichment
for each locus tested. ADAM17 did not validate as a target.

				
DOCUMENT INFO