Molecular Bio Lab gel by benbenzhou

VIEWS: 30 PAGES: 8

More Info
									Molecular Bio Lab

Introduction to basis of technique

        DNA is the basic chemical building block of life. It is made of up four types of
nucleotides: cytosine (C), guanine (G), thymine (T), adenine (A). These nucleotides are
arranged in various combinations to encode sequences of genetic information. Many
DNA sequences are unique to specific species and even to individuals. Because DNA
has distinct sequences it can be used to differentiate or identify organisms.

       There are several methods of distinguishing different DNA sequences. One
method, called DNA sequencing, actually allows scientists to determine the exact order
of each nucleotide in a DNA molecule. This process if very precise, but is more
expensive and takes a longer time to complete than other techniques.

        A simple method of comparing DNA from different sources is to cut or digest it
with restriction enzymes. Restriction enzymes can be thought of as molecular scissors.
They are proteins that cleave DNA only where certain combinations of nucleotides occur.
In Table 1, there are several restriction enzymes listed along with their recognition
sequences. The site where the enzyme cuts is indicated by arrows.

             Table 1. Restriction enzymes and their recognition sequences

                             Restriction      Recognition
                             Enzyme           Sequence
                                              (site of cutting)

                             EcoR I



                             Msc I



                             Hind III



                             Sma I




        If you look at Table 2 you will see two DNA sequences. Imagine that we digest
both these pieces of DNA with the restriction enzyme Msc I. Draw a line through the
sequences where they would be cut.
             Table 2. Examples of DNA sequences that may be digested with Msc I


               DNA      Sequence                                   Number of
                                                                   fragments after
                                                                   digestion
               1

                        ATGCGTGGCCAGCTGGGCCATGGCCAGGTTCGTC
                        TACGCACCGGTCGACCCGGTACCGGTCCAAGCAG




               2


                        TAGCCGGATTGCTGGCCATCGTTGCGGGAAATTTT
                        ATCGGCCTAACGACCGGTAGCAACGCCCTTTAAAA




        You should see that the cuts would generate 3 small pieces in the first strand of
DNA and 2 larger pieces in the second strand of DNA. So even if we didn’t know the
sequence of the DNA, we would know that the digestion gave us three small pieces from
one DNA source and two large pieces from the other DNA source. Because the digestion
yielded different sizes and numbers of fragments, we know the sequences of the DNA
strands are not the same.

        But, as you’ll see when you look at the DNA samples provided, DNA dissolves in
solution and appears to the naked eye like water in the bottom of a tube. How can we
actually see the three little fragments and the two larger ones? They can’t be seen with
the eye, or even a microscope, but we can visualize them using agarose gel
electrophoresis and a fluorescent dye that binds to DNA.

        Agarose is a gelatin-like substance that is purified from seaweed. Polymers of
agarose form a tiny mesh network when they solidify into a gel. Agarose gels can be
thought of as molecular sieves. When you shake sand through a sieve, the smallest
pieces come out first and the larger pieces remain in the sieve. Just like sand, when you
push DNA through an agarose gel, the smallest pieces will move faster through the gel
than the larger pieces.

        We can push DNA through the gel by applying an electrical current. The top of
the gel is negatively charged (cathode) and the bottom of the gel is positively charged
(anode). DNA molecules are negatively charged because of phosphates in the backbone
of the structure. The DNA is loaded into a small chamber called a well at the top of the
gel. When the electrical current is applied the negatively charged DNA will move
towards the positive charge at the bottom of the gel with the smaller fragments moving
faster than the large fragments. The electrical current is then stopped and the DNA is
stuck in the gel. The fragments of DNA can be seen as distinct bands when the gel is
viewed with ultra violet (UV) light that excites the fluorescent dye in the gel. A band is
not just a single piece of DNA, but a collection of pieces that are all the same size.

        An example of an agarose gel with DNA bands being illuminated with UV light is
shown in Figure 1. Draw an arrow to represent the direction that the DNA moves in
the gel. Are the smallest DNA fragments found at the top or the bottom of this gel?




                               Figure 1. Sample of an agarose gel




                                                                         Copper
                                                                         electrode (-)




                                                                         Copper
                                                                         electrode (+)
        In order to apply an electrical current, the gel inserted into an apparatus with
control buttons and an adaptor cord that is inserted into an electrical outlet. A diagram of
the E-gel Base is shown in Figure 2.

                                Figure 2. Diagram of E-gel Base




        Normally, a DNA ladder is also run in the gel with your DNA samples. The
ladder has a pool of fragments of known sizes and two colored dyes. One of the dyes is
small and will migrate quickly through the gel at the same rate as the smallest pieces of
DNA. The other dye is large and will migrate slowly through the gel at the same rate as
the largest pieces of DNA. The two dyes in the ladder will allow you to make sure that
your DNA fragments are fully separated, but the small fragments don’t run off the bottom
of the gel. You can also compare your DNA bands to those of the ladder and estimate the
size of your DNA fragments. Double-stranded DNA is measured in pairs of nucleotides
called base pairs. Figure 3, on the following page, shows in image of the DNA ladder
that you will use in this lab. Look again at table 2, above each DNA sequence write
the number of base pairs found in the fragments of digested DNA.
            Figure 3. Image of DNA ladder and size of DNA fragments in each band
                         (numbers indicate base pairs of DNA)




        This method of comparing DNA is less expensive and faster than DNA
sequencing. Rapid identification of DNA is important in a variety of scientific fields, like
forensics and epidemiology. You’ve probably heard of forensic science, where
molecular biology can be used to analyze evidence found at the scene of a crime.
Epidemiology is a lesser known field of science that studies the cause and distribution of
disease in a population to control spread of disease. When the cause is identified, it is
called the etiological agent of the disease.

         For example, this type of DNA analysis could be used to determine the source of
a food poisoning outbreak. Food poisoning is often caused by ingestion of a food
contaminated with bacteria. The bacteria colonize the intestine and infect the person who
consumed the food causing nausea diarrhea, abdominal pain, head ache, vomiting,
gastroenteritis, fever, or fatigue. In some cases the illness may result in death. It is
critical that scientists identify the contaminated food as quickly as possible to prevent the
spread of disease. Today we would like you to help solve an epidemiological study.



Food Poisoning Lab

        A food poisoning outbreak has occurred in your town. Yesterday 45 people were
admitted into the local hospital because they were experiencing symptoms of severe food
infection including vomiting, abdominal pain, and diarrhea. The clinical lab at the
hospital determined that the people were infected by the bacteria Salmonella enterica. A
questionnaire was given to all of the patients asking where and what they had eaten in the
last 48 hours. All of the patients had attended a school picnic the previous day. The
remaining food was stored in a refrigerator at the school.
        You are a microbiologist with the department of health and we need you to find
out as soon as possible which of the food was contaminated to prevent further illness.
Table 3 below shows the results of the questionnaire and indicates what percentage of
infected patients ate each type of food.


        Table 3. Percentage of patients that consumed each food from the picnic.

              Food at the picnic             % of infected patients who
                                             consumed the food
              Spinach salad                  57%
              Potato salad                   25%
              Sliced tomatoes                37%
              Green beans                    98%
              Peanuts                        15%
              Hot dogs                       53%


        Based on the results of the questionnaire, what is your hypothesis for which
food likely contains bacteria that caused the infection and it the etiological agent of
the outbreak?




        DNA from S. enterica as well as DNA from the bacterial culture of the food has
been purified from cell samples for you by your assistant. You will find these tubes in
your kit labeled S (pre-cut Salmonella DNA) and G (DNA from bacteria found in green
beans). The Salmonella DNA has already been digested with Sma I. You will need to
digest DNA from the bacteria found in green beans with the same restriction enzyme.
You will then analyze the size of DNA fragments produced in the digestion using agarose
gel electrophoresis. By comparing the bands of the Salmonella DNA to those of the
bacteria cultured from the food, you should be able to determine if the green beans
contain Salmonella and were the cause of the food poisoning outbreak. You should also
be able to determine the approximate size of each fragment relative to the DNA ladder.

       If your hypothesis is correct, how will the bands of the predigested
Salmonella DNA compare to the DNA isolated from bacteria in green beans that
you digest?
Materials

       This lab should be done in pairs. Before getting started, please check that you and
your partner have the following materials:

E-gel base
E-gel
Pipette
Box of pipette tips
Tube labeled S (Pre-cut Salmonella DNA)
Tube labeled G (DNA from bacteria found in green beans)
Tube labeled L (DNA ladder)
Tube labeled D (Loading dye)
Tube labeled B (Restriction enzyme buffer)
Tube labeled W (Sterile water)
Beaker (for disposal of used pipette tips)
Empty 1.5 ml tube labeled U
Tube rack
Lab gloves


DNA digestion

        The first step of the lab is to digest the DNA purified from the bacteria growing in
the green beans. Follow the procedure below:

   1. Put on your gloves to protect your samples from your DNA
   2. Get an empty 1.5 ml tube and label the top with your initials and U (for unknown)
   3. To the empty tube add 14 µl of sterile water (from the W tube)
   4. Add 2 µl of restriction enzyme buffer (from the B tube)
   5. Add 3 µl of DNA from bacteria found in the green beans (from the G tube)
   6. At the front of the room there is an ice bucket that contains a tube labeled Sma I,
      bring your tube over to the ice bucket and add 1 µl of the Sma I restriction
      enzyme
   7. Mix the reaction components by pipetting up and down in the tube
   8. Set the tube into your tube rack and incubate the reaction at room temperature for
      10 minutes
   9. While the reaction is incubating set up your E-gel


Gel electrophoresis

        The next step is to analyze the fragments produced in the digestion reaction. You
will compare your reaction to undigested DNA, the Salmonella DNA that has already
been digested with Sma I, and the DNA ladder. Using undigested DNA is a negative
control. It allows you to see that the DNA was not cut prior to your digestion. Using the
pre-cut Salmonella DNA is a positive control. It allows you to see what your DNA digest
should look like if the bacteria contaminating the green beans were also Salmonella. The
DNA ladder will allow you to estimate the size of all the DNA bands in the gel. To carry
out this analysis, follow the procedure below:

     1. Plug in your E-gel Base
     2. Open the package containing the E-gel and insert it into the base following the
         diagram in Figure 2 and the demonstration from your instructor
     3. Check that a red light comes on at the top of the gel
     4. Hold down the 15 min. button until you hear two short beeps
     5. Check that the light is now blinking green
     6. After about 1 min., the gel will start beeping and a red light will blink
     7. Once your restriction digestion is complete, add 2 µl of loading dye to the tube
     8. Make a dilution of the remaining DNA from tube G by adding 14 µl of sterile
         water to the tube. This is the undigested negative control DNA sample.
     9. Add 2 µl of loading dye to the diluted DNA in tube G
     10. Add 2 µl of loading dye to the pre-cut Salmonella DNA in tube S
     11. Your samples are now ready to load into your gel
     12. Gently, remove the plastic comb that is in the wells at the top of the gel
     13. Following the demonstration by your instructor, each partner should practice
         loading the gel with loading dye alone
     14. Once you are comfortable, load 20 µl of your DNA samples (Tubes U, G, and S)
         and 10 µl of ladder (TUBE L) into the gel into the lane numbers corresponding to
         the chart below

1          2          3   4        5           6            7            8   9   10   11   12
practice   practice       Ladder   Your        Undigested   Pre-cut
                          (TUBE    digestion   DNA          Salmonella
                          L)       reaction    (TUBE G)     DNA
                                   (TUBE                    (TUBE S)
                                   U)


     15. After you gel is loaded, press the 30 min. button again and the light should turn
         green
     16. The gel will beep when it has completed the run
     17. Remove your gel from the E-gel base and look at it on the Safe-Imager light box
     18. Take a picture of the gel if possible and estimate the size of the DNA fragments


Based on your results, did Salmonella cause the food poisoning outbreak? How do
you know?

								
To top