Learning Center
Plans & pricing Sign in
Sign Out



-Research Tools At Our Disposal

           Mahita Kadmiel
            July 21, 2005
• Arthritis -most common medical problem
• No. 1 cause of disability in America.
• arthron = joint        itis = inflammation.
      arthritis = joint inflammation.
• osteoarthritis, is the most common form of
• affects nearly 21 million people in the
  United States
    The Meniscus: Shock Absorber for the Knee

                           Meniscal Tears

• Traumatic tears
  From a sudden load being applied to the meniscal tissue which is
  severe enough to cause the meniscal cartilage to fail and let go.
  Ex. Twisting injury

• Degenerative meniscal tears
  Failure of the meniscus over time.
  The meniscus becomes less elastic and compliant
  May fail with only minimal trauma
  Ex. Just getting down into a squat

   *Degenerative meniscal tears can lead to osteoarthritis*
Healthy meniscus   Torn meniscus
The expression of genetic material in the meniscus
                    dictates it
Central Dogma of Life

        Reverse Transcription
Proteins make a cell what it is
                                     Staining to find
                                      -how the cells
                                                                                      Staining to find
                                     look (anatomy)
                                                                                     -if cells are dead
                                                                                     or alive (viability)
                           TISSUE                                                         (TUMUL)

                                                                        Cell Biology



Western Blotting
-To detect proteins                                                                     DNA
-To quantify                                                                       Southern Blotting
                                                                                   -To find copy number
proteins                                                                           of genes
                                                        Northern Blotting
Enzyme Assays                                           RT-PCR                     Genome Sequencing
-To measure                               RNA           Real-Time PCR
                                                        -To study gene
enzyme activity
                                                        expression (TUMUL, BASIA
                                                                   & MYSELF)
Tools used in our lab

                   Real-Time PCR
                   -To study gene

                    -To quantify proteins
Preparation of cDNA or first strand RT

                     Reverse Transcription

   5’ GACCCAAUUGGUCAGCUAAAAAAA 3’                     mRNA


                             ……TTTTTTT 5’
        A, T, G, C
          dNTPs                         Reverse

   1ST strand cDNA (complementary DNA)
PCR : Polymerase Chain Reaction
                      Reverse Transcriptase-
                    Polymerase Chain Reaction
                     -Exponential amplification

                                                            End of 35 cycles

                                                            236 = millions of copies

                                                               PCR products

        22        23           24
       4 copies   8 copies   16 copies 32 copies
                       Real-Time PCR

                                     SYBR Green Dye

        PCR products

                                 Single stranded Double stranded
                                      DNA         PCR product

                           SYBR Green fluoresces brightly only when
                               bound to double stranded DNA

Ethidium Bromide
                Real-Time PCR
   Quantitative method
   Most reliable for mRNA (gene) expression
   Small amounts of RNA required / tissue
   Amplification monitored by fluorescence in real-time

                          96 well plate
            0                    1
            1                    2                                        Theoretical and Ideal
            2                    4
            3                    8                            1000000000
            4                   16

                                             AMOUNT OF DNA
            5                   32                              10000000
            6                   64                                100000
            7                  128                                 10000
            8                  256                                  1000
            9                  512
           10                1,024                                     1
           11                2,048                                            0   5   10   15    20   25       30    35
           12                4,096                                                     PCR CYCLE NUMBER
           13                8,192
           14               16,384
           15               32,768
           16               65,536
           17              131,072
           18              262,144
           19              524,288                                                     Practical !!!!!
           20            1,048,576
           21            2,097,152
           22            4,194,304

                                     AMOUNT OF DNA
           23            8,388,608
           24           16,777,216
           25           33,554,432
           26           67,108,864
           27          134,217,728
           28          268,435,456
           29          536,870,912
                                                                          0       5   10   15    20       25    30        35
           30        1,073,741,824
                                                                                       PCR CYCLE NUMBER
           31        1,400,000,000
           32        1,500,000,000
           33        1,550,000,000
           34        1,580,000,000

 Standard curve generated using serial dilution
Melting / Dissociation Curve

                       primer dimer
E       Enzyme                      Protein molecule that performs a
                                            chemical reaction

L       Linked
                                        Linking an enzyme to an

I        Immuno
                                        Attachment of antibodies


A       Assay
                                       Test to find out something

 Technique based on antigen-antibody reaction
 Examples: HIV tests &PGE2
                             Well with antibodies Well with antibodies and BSA added
                                                                                       Well with antibodies,
                                             antigen binding sites                     BSA, and test sample

Well in a microtiter plate

                                              Antibody structure
                                                                                Well after washes with
                                                                                     wash buffer

 Well after adding substrate

 Color developed due to the
  formation of a substrate
                                                                      Secondary antibody linked to
                                                                     an enzynme is added to the well
                                          Well after removing
                                           excess antibody
               Other Techniques

•   Genome Sequencing
    – To find out
            » the base composition (A, T, G, C)
            » The order in which the bases are arranged

•   Northern Blotting ( mRNA expression)
•   Southern Blotting (copy number)
•   Western Blotting ( protein expression)
Southern / Northern Blotting
Western Blotting
                  IL-1     RT-PCR               IL-1
                  TNF                          iNOS

                          ELISA                 PGE2

                         Colorimetric Assays
                                               Nitrate &

       MMP                  COX-2

Degrades tissue

To top