TACKLING OSTEOARTHRITIS

					TACKLING OSTEOARTHRITIS
-Research Tools At Our Disposal




           Mahita Kadmiel
            July 21, 2005
        OSTEOARTHRITIS
• Arthritis -most common medical problem
• No. 1 cause of disability in America.
• arthron = joint        itis = inflammation.
      arthritis = joint inflammation.
• osteoarthritis, is the most common form of
  arthritis
• affects nearly 21 million people in the
  United States
                       MENISCUS
    The Meniscus: Shock Absorber for the Knee

                           Meniscal Tears

• Traumatic tears
  From a sudden load being applied to the meniscal tissue which is
  severe enough to cause the meniscal cartilage to fail and let go.
  Ex. Twisting injury

• Degenerative meniscal tears
  Failure of the meniscus over time.
  The meniscus becomes less elastic and compliant
  May fail with only minimal trauma
  Ex. Just getting down into a squat

   *Degenerative meniscal tears can lead to osteoarthritis*
Healthy meniscus   Torn meniscus
The expression of genetic material in the meniscus
                    dictates it
Central Dogma of Life




        Reverse Transcription
Proteins make a cell what it is
                                     Staining to find
                                      -how the cells
                                                                                      Staining to find
                                     look (anatomy)
                                                                                     -if cells are dead
                                         (TARA)
                                                                                     or alive (viability)
                           TISSUE                                                         (TUMUL)
                                                                          CELLS
                                     Histology


                                                                        Cell Biology



   Proteins

                      Biochemistry

Western Blotting
-To detect proteins                                                                     DNA
ELISA
-To quantify                                                                       Southern Blotting
                                                                                   -To find copy number
proteins                                                                           of genes
                                                        Northern Blotting
Enzyme Assays                                           RT-PCR                     Genome Sequencing
-To measure                               RNA           Real-Time PCR
                                                        -To study gene
enzyme activity
                                                        expression (TUMUL, BASIA
                                                                   & MYSELF)
Tools used in our lab




                   RT-PCR
                   Real-Time PCR
                   -To study gene
                   expression




                    ELISA
                    -To quantify proteins
Preparation of cDNA or first strand RT



                     Reverse Transcription


   5’ GACCCAAUUGGUCAGCUAAAAAAA 3’                     mRNA




   5’ GACCCAAUUGGUCAGCUAAAAAAA 3’
                         Reverse
                      transcriptase

                             ……TTTTTTT 5’
        A, T, G, C
          dNTPs                         Reverse
                                      Transcription



   3’ CTGGGTTAACCAGTCGATTTTTTT 5’
   1ST strand cDNA (complementary DNA)
PCR : Polymerase Chain Reaction
                      Reverse Transcriptase-
                    Polymerase Chain Reaction
                     -Exponential amplification


                                                            End of 35 cycles




                                                            236 = millions of copies



                                                               PCR products
  RT
                                                   Marker


RNA
        22        23           24
       4 copies   8 copies   16 copies 32 copies
                       Real-Time PCR


                                     SYBR Green Dye


        PCR products




                                 Single stranded Double stranded
                                      DNA         PCR product

                           SYBR Green fluoresces brightly only when
                               bound to double stranded DNA


Ethidium Bromide
                Real-Time PCR
   Quantitative method
   Most reliable for mRNA (gene) expression
   Small amounts of RNA required / tissue
   Amplification monitored by fluorescence in real-time




                          96 well plate
CYCLE NUMBER    AMOUNT OF DNA
            0                    1
            1                    2                                        Theoretical and Ideal
            2                    4
                                                             10000000000
            3                    8                            1000000000
            4                   16




                                             AMOUNT OF DNA
                                                               100000000
            5                   32                              10000000
                                                                 1000000
            6                   64                                100000
            7                  128                                 10000
            8                  256                                  1000
                                                                     100
            9                  512
                                                                      10
           10                1,024                                     1
           11                2,048                                            0   5   10   15    20   25       30    35
           12                4,096                                                     PCR CYCLE NUMBER
           13                8,192
           14               16,384
           15               32,768
           16               65,536
           17              131,072
           18              262,144
           19              524,288                                                     Practical !!!!!
           20            1,048,576
                                                             1600000000
           21            2,097,152
                                                             1400000000
           22            4,194,304

                                     AMOUNT OF DNA
                                                             1200000000
           23            8,388,608
                                                             1000000000
           24           16,777,216
                                                              800000000
           25           33,554,432
                                                              600000000
           26           67,108,864
                                                              400000000
           27          134,217,728
                                                              200000000
           28          268,435,456
                                                                      0
           29          536,870,912
                                                                          0       5   10   15    20       25    30        35
           30        1,073,741,824
                                                                                       PCR CYCLE NUMBER
           31        1,400,000,000
           32        1,500,000,000
           33        1,550,000,000
           34        1,580,000,000
      SERIES OF 10-FOLD DILUTIONS




 Standard curve generated using serial dilution
Melting / Dissociation Curve


                       primer dimer
E       Enzyme                      Protein molecule that performs a
                                            chemical reaction




L       Linked
                                        Linking an enzyme to an
                                               assay/test




I        Immuno
S
                                        Attachment of antibodies

         Sorbent




A       Assay
                                       Test to find out something




 Technique based on antigen-antibody reaction
 Examples: HIV tests &PGE2
                             Well with antibodies Well with antibodies and BSA added
                                                                                       Well with antibodies,
                                             antigen binding sites                     BSA, and test sample

Well in a microtiter plate


                                              Antibody structure
                                                                                Well after washes with
                                                                                     wash buffer

 Well after adding substrate

 Color developed due to the
  formation of a substrate
                                                                      Secondary antibody linked to
                                                                     an enzynme is added to the well
                                          Well after removing
                                           excess antibody
               Other Techniques

•   Genome Sequencing
    – To find out
            » the base composition (A, T, G, C)
            » The order in which the bases are arranged

•   Northern Blotting ( mRNA expression)
•   Southern Blotting (copy number)
•   Western Blotting ( protein expression)
Southern / Northern Blotting
Western Blotting
                  IL-1     RT-PCR               IL-1
                  TNF                          iNOS
                                               COX-2
                                               MMP

                          ELISA                 PGE2
                  iNOS

                         Colorimetric Assays
                                                 GAG
                                               Nitrate &
                                                Nitrite
                  NO


       MMP                  COX-2
                             PGE2
                            (GAG)



Degrades tissue
Questions???????

				
DOCUMENT INFO
Shared By:
Categories:
Stats:
views:95
posted:3/31/2008
language:
pages:24