Molecular Approaches to Nutrition

Molecular Approaches to Nutrition Molecular Biology 2 Principles and Methods Dr. Janice Drew Principles and Methods     Purification and handling of DNA/RNA Gel Electrophoresis Nucleic Acid Hybridisation Cutting and rejoining DNA     Methods of introducing DNA into cells PCR DNA sequencing Sequence interpretation Handling of DNA/RNA   DNases and RNases Glass and plasticware Solutions  Extraction of DNA/RNA DNA extraction     Alkaline lysis Neutralisation Precipitation of proteins and cell debris Precipitation or elution using spin column RNA extraction    Lysis incorporating instantaneous inactivation of RNases Separation of contaminating DNA Precipitation or elution using spin column Quantitation and analysis of DNA/RNA   Spectrometric determination at 260nm Gel Electrophoresis Agilent technology  Gel Electrophoresis  Nucleic acids are negatively charged  PO4- groups    Electrophoresis resolves by size Agarose is the usual gel matrix Ethidium bromide/SYBR green ‘stains’ DNA & RNA  Fluorescent colour under UV illumination Agarose Gel Preparation Agarose : fine white powder; polysaccharide (galactose polymer) isolated from seaweed. 1% (w/v) dissolves in Tris-acetate buffer at ~60 °C and the solution sets at ~30 °C Agarose Gel Image Markers (DNA Ladder) Known Sizes _ Largest (1,500bp) Smallest (100bp) + Agilent Technology Electropherogram showing Agilent analysis of total RNA 28S 18S Fluorescence Times (seconds) Hybridisation Identification of DNA/RNA  Agarose gel electrophoresis separates nucleic acids on the basis of size - does not identify DNA/RNA fragments  Nucleic acid probes are used to identify specific DNA/RNA sequences in a gel  Probe is a known nucleic acid sequence  Relies on the principle of base pairing complementary DNA/RNA sequences stick (hybridise) together Hybridisation Identification of DNA/RNA Many molecular biology procedures to identify specific DNA/RNA sequences use this principle Southern (DNA) or Northern (RNA) blotting In situ hybridisation Microarrays Antisense technologies Probe Production  Synthesise a known fragment OR  Purify a known fragment of DNA  Restriction enzyme digestion   Heat denature to give single strands Add primers, DNA polymerase and radioactive/colour labelled nucleotides  Make a radioactive/ colour labelled complementary strand  Denature to give single strands nylon membrane and transferred DNA TREAT and BLOT GEL Transfer to nylon membrane Southern/Northern Blotting and HYBRIDISATION OVEN Incubate filter and probe in hybridisation buffer Hybridisation Restriction Endonucleases  Restriction endonucleases cut DNA  Present in bacteria  Cut at sequence specific sites  Usually 4 or 6 base pairs long Bacteria protect their own DNA against self-cutting by special methylation of their DNA  Bacteria use them to destroy ‘foreign’ DNA   Restriction enzymes can be purified and are used in genetic engineering studies Restriction Endonucleases  Example Restriction enzymes   EcoR I (E. coli Restriction Endonuclease I) Stu I (Streptomyces tubercidicus I) EcoR I 5’ Palindromic Axis of rotational symmetry 3’ 5’ 5’ Stu I 3’ GAATTC 3’ CTTAAG Sticky Ended AGGCCT 3’ 5’ TCCGGA Blunt Ended Molecular Scissors and Glue  There are 100’s of restriction enzymes, each one with a different recognition site  These enzymes are ‘molecular scissors’ and can be used to specifically cut long DNA strands into smaller pieces  The T4 virus, which infects E. coli, has an enzyme, T4 DNA ligase, which can form a phosphodiester bonds between DNA molecules  Purified T4 DNA ligase can be used as ‘molecular glue’ to join pieces of DNA. This enzyme is widely used for DNA cloning Ligation of DNA EcoR I T4 DNA Ligase OH 3’ 5’ PO 4 EcoR I Stu I GAATTC CTTAAG PO4 5’ 3’OH Circular DNA T4 DNA Ligase T4 DNA ligase catalyses the formation of phosphodiester bonds Methods of introducing DNA into cells  Plasmids Viruses DNA and RNA viruses Phage vectors  Cloning DNA into Plasmids  Bacteria have a circular DNA genome  5 to 10 million base pairs (bp) in size Small circular DNA molecules, ~3,000 to 50,000 bp Note: The bacterial genome is not a plasmid  Many bacteria also contain plasmids    Plasmids contain ‘extra’ genes which are often vital for the survival of the bacterium  Nutrient metabolism, antibiotic resistance  Plasmids can be used as vectors in which foreign DNA can be ligated (cloned) A General Laboratory Plasmid Multiple Cloning Site A foreign gene can be ligated into a plasmid, and the genetically engineered plasmid introduced into E. coli. Cloning DNA into a Plasmid Both plasmid and foreign DNA have sticky EcoR I ends Agar plates contain antibiotic. Grow at 37 °C Insertion into E. coli (transformation) Place 1 colony in liquid media + antibiotic. Grow at 37 °C Purify Plasmid DNA (Billions of copies) DNA and Retroviruses can serve as vehicles for the introduction of new DNA into a cell DNA / RNA viruses as ‘vehicles’ Chromosomal DNA Viral DNA gene x Integration into genome Gene Therapy and Transgenics Polymerase Chain Reaction (PCR)  PCR generates multiple copies of DNA  Heat resistant DNA polymerase used to copy a section of DNA e.g Taq  Very efficient copying  Billions of copies from a single ‘template’ DNA  Small volume / quick analysis Polymerase Chain Reaction (PCR)  Entire reaction performed in single tube  10 to 50 μl volume Template DNA, heat resistant DNA polymerase, a pair of specific DNA primers (in excess over the template), nucleotide bases, appropriate reaction buffer  Reaction contains   Reaction is repeatedly cycled through 3 temperatures (x30)    95 °C (makes DNA single stranded) ~55 - 60 °C (primers anneal to template DNA) 72 °C DNA polymerase copies DNA, starting from the primers A Thermocycler This thermocycler can accept 1500 reactions at a time, and complete them in 2 to 4 hours. Principal of PCR AGCTAGCATGTTGCGCGTATCATGTACAGTGCATACGTCCCCTTAGCT |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| 3’TCGATCGTACAACGCGCATAGTACATGTCACGTATGCAGGGGAATCGA 5’ 5’ 3’ DNA (Double Stranded) Heat 95°C (Denatures) 5’ AGCTAGCATGTTGCGCGTATCATGTACAGTGCATACGTCCCCTTAGCT |||||||||||||||||||||||||||||||||||||||||||||||| 3’ Heat Denature (Becomes Single Stranded) |||||||||||||||||||||||||||||||||||||||||||||||| TCGATCGTACAACGCGCATAGTACATGTCACGTATGCAGGGGAATCGA 3’ 5’ Add Specific Primers Heat toto72 °C Cool 55°C 5’ AGCTAGCATGTTGCGCGTATCATGTACAGTGCATACGTCCCCTTAGCT3’ |||||||||||||||||||||||||||||||||||||||||||||||| ||||| GTATG 3’ 5’ 5’ 3’ Cool. This allows specific ‘primers’ to anneal as shown 3’ GTTGC ||||| |||||||||||||||||||||||||||||||||||||||||||||||| TCGATCGTACAACGCGCATAGTACATGTCACGTATGCAGGGGAATCGA5’ Heat to 72 °C. Heat resistant DNA polymerase extends new DNA from the primers DNA Sequencing   A specific primer binds to denatured DNA Heat resistant DNA polymerase extends a new strand from this primer Complementary nucleotides are added as appropriate In the reaction are small quantities of coloured dideoxynucleotides     Colours: ddTTP ddGTP ddATP ddCTP These prevent further additions (terminators) Dideoxynucleotides ddNTPs have no 3’ OH, so when added they cannot form the phosphodiester bond required to add the next nucleotide DNA Sequencing Reaction The reaction is boiled to make all the DNA single stranded and then the reaction is resolved on a long polyacrylamide or capillary gel in a DNA sequencer Electropherogram of sequencing gel Decoding DNA sequence data