Shiga Toxin, Shiga-like Toxin I1 Variant, and Ricin Are All by qws18475

VIEWS: 7 PAGES: 6

									THE          CHEMISTRY
   JOURNAL BIOLOGICAL
         OF                                                                                   Vol. 264, No. 1, Issue of January 5,pp. 596-601,1989
                                                                                                                                  Printed in U.S A .



Shiga Toxin, Shiga-like Toxin I1 Variant, andRicin Are All
Single-site RNA N-Glycosidases of 28 S RNA When Microinjected into
Xenopus Oocytes*
                                                                                             (Received for publication, July 1988)
                                                                                                                           28,


            Shailendra K. Saxena, Alison D. O’BrienS, and Eric J. Ackermans
                                                                       of Diabetes and Digestive and Kidney
            From the Genetics and Biochemistry Branch, National Institute                                  Diseases, National
            Institutes of Health, Bethesda, Maryland 20892 and the $Department Microbiology, Uniformed Services University the
                                                                             of                                           of
            Health Sciences, Bethesda, Maryland20814-4799



  Ricin, Shiga toxin, and Shiga-like toxin I1 (SLT-11,                two-subunit toxins of bacterial origin that are members of a
Vero toxin 2) exhibit an RNA N-glycosidase activity                   family of potent cytotoxins (for review, see Ref. 6). Shiga
which specifically removes a single base near the 3’                  toxin, the prototype of the family, is produced by the agent
end of 28 S rRNA in isolated rat liver ribosomes and                  of bacillary dysentery, Shigella dysenteriue type 1. SLT-IIv is
deproteinized 28 S rRNA (Endo Y., Mitsui, K., Moti-                   produced by Escherichia coli that cause edema disease of swine
zuki, M., & Tsurugi, K. (1987) J. Biol. Chem. 262,                    (7) and is highly related (8)to Shiga-like toxin 11, a cytotoxin
5908-5912; EndoY. & Tsurugi, K. (1987) J. Biol.                       synthesized by enterohemorrhagic E. coli (9). SLT-IIv appears
Chem. 262, 8128-8130, Endo, Y., Tsurugi, K., Yut-                     to have a different binding specificity than Shiga toxin or
sudo, T., Takeda, Y., Ogasawara, K. & Igarashi, K.                    SLT-I1 (7,8). The B subunit of the prototype Shiga toxin is
(1988) Eur. J. Biochem. 171, 45-50). These workers
                                                                      responsible for toxin binding to the eukaryotic cell receptor
identified the single base removed, A-4324, by exam-
ining a 28 S rRNA degradation product which was                       (10, 11) which is believed to be a Galal-4      Gal containing
generated by contaminating ribonucleases associated                   glycolipid, Gb3 (12). The A subunit of Shiga toxin must be
with the ribosomes. To determine whether this N-                      proteolytically nicked and reduced to the AI fragment before
glycosidase activity applies in living cells, microin-
                                            we                        it can inhibit cellular protein synthesis (11).Shiga toxin and
jected ricin into Xenopus oocytes. We also microin-                   SLT-IIv share 56% homology at the amino acid level in the
jected Shiga toxin and a variant of Shiga-like toxin I1               A subunit and 61% homology in the B subunit (8).
(SLT-IIv). All three toxinsspecifically removed A-                       Several mechanisms have been proposed for the molecular
3732, located 378 nucleotides from the 3‘ end of 28 S                 basis of translation inhibition by these toxins.Obrig (13)
rRNA. This base is analogous to the site observed in                                                            ricin
                                                                      reported RNase activity associated with and Shiga toxin.
rat 28 S rRNA for ricin, Shiga toxin, and SLT-11.                     Brown et ul. (14) reported that Shiga toxin inhibited protein
                                A
Purified, glycosylated, ricin chain contains this RNA                 synthesis in reticulocyte lysates by inactivation of aminoacyl-
N-glycosidaseactivity in oocytes. We also demon-                      tRNA binding. Nilsson and Nygard (15) reported that ricin
strated that the nonglycosylated A subunit of recom-                  inhibits the GTP    hydrolysis induced by elongation factor 1.
binant ricin exhibits this RNA N-glycosidase activity                    Recently, Endo et al. (16-18) reported that ricin, Shiga
when injected into Xenopus oocytes. Ricin, Shiga toxin,               toxin, and SLT-I1 (also called Vero toxin 11) are specific N -
and SLT-IIv also caused a rapid decline in oocyte pro-                glycosidases for both deproteinized28 S rRNA and S rRNA
                                                                                                                           28
tein synthesisfor nonsecretory proteins.                              in isolated rat ribosomes. Endo noticed that one the rRNA
                                                                                                                         of
                                                                      degradation fragments seen for ricin-treated rat liver ribo-
                                                                      somes exhibited an unusual mobility when electrophoresed
                                                                      on nondenaturinggels. This rRNA degradation fragment had
                                                                      presumably been generated by contaminating ribonucleases
   Ricin is a two subunit plant toxin which catalytically in- associated with preparation the ribosomes. Various RNases
                                                                                                    of
activates ribosomes (forreview, see Ref. 1).Subunit B appears were used to                                                     no
                                                                                    cleave this degradation fragment, but cleavage
to be involved in the interaction of the toxin with a cell was observed at G-4323 and A-4324. The lability of a single
receptor and also facilitates cellular entry of the A subunit (2, phosphodiester bond within this fragment to           mild alkaline
3). Ricin A subunits must be separated from B subunits to digestion and aniline treatment at acidic pH suggested that
inhibit translation (4,5 ) .                                          the ricin removed base A-4324. This base is significant be-
   Shiga toxin and Shiga-like toxin I1 variant (SLT-IIv)’ are cause it is adjacent to the         nucleotide cleaved by a-sarcin.
                                                                         The cytotoxin a-sarcin from the Aspergillus gigunteus
                                                                                                           mold
   * SLT-IIv and Shiga toxin were prepared under the sponsorship of   specifically cleaves 28 S rRNA at G-4323 in isolated rat liver
DIATECH protocol 09961000640 and National Institutes of Health ribosomes (19, 20) and at an analogous position of Xenopus
Grant AI20148-05, respectively (to A. D. 0.). costs of publication
                                              The                     28 S rRNA, G-3733, when the toxin is microinjected into
of this article were defrayed in part by the payment of page charges. Xenopus oocytes (21). Rat liver 28 S rRNA contains 4718
This article must therefore be hereby marked “advertisement” in nucleotides (22) and a-sarcin treatment rat liver ribosomes
                                                                                                                of
accordance with 18 U.S.C. Section 1734 solely to indicate this fact.  produces a fragment of 393 nucleotides (19); Xenopus 28 S
   § To whom correspondence should be addressed NIH, Bldg. 10,
Rm. 9D-15, Bethesda, MD 20892.                                        rRNA contains 4110 nucleotides (23) and a-sarcin treatment
   ’ The abbreviations used are: SLT-IIv, Shiga-liketoxin I1 variant; of Xenopus ribosomes produces afragment of 377 nucleotides
SDS, sodium dodecyl sulfate.                                          (21). The 28 S rRNA cleavage site for a-sarcin occurs within

                                                               596
                                                        Toxins Activity
                                                        with
                                                        N-Glycosidase
                                                                  in
                                                       SpecificOocytes                                                                                     597
     A     SHIGA TOXIN,
                      SLT-IIv, or RICIN                                                           A       B      C      D       E      F      G
              REMOVES THIS ADENINE             ~
                                                                       ALPHA SARCIN SITE



Xenopus              AAUCCUGCUCA C U A         \ /        C A C A C C A
                                                          C                A
                                                                           CCGCAGGUUCA

                                                                                                                                                    -28s
 a
Rt                   AAUCCUGCUCA C U A C C A C A C G A A CCGCAGGUUCA
Yeast                AAUUGAACUUA C U A C C A C A C C A A CAGUUCAUUCG

E . coli             GGCUGCUCCUA C 0 A C C A C A C 0 A C CGGAGUGGACG
Xenopus m i t o      GUAUUUUUCUA C 0 A C C A A A C C A C CGAAAAAAUGA                                                                                -18s




           5'   ,
                I,
                                                                          -400 nl.




                B
                      0




                     Hb
                                                   3732

                                         -Shiga              Toxin, SLT-IIv or Ricin


                     -
                                                            Removes Adenine m32

            Anllim
                           0    OH
                           I
                       O.P-0.
                           I                                                                                                                       -5.8s
                           I              ClJUlim3733
                          HCH              I

                                                                                              FIG. 2. Ricin, Shiga toxin, and SLT-IIv injected into Xeno-
                                                                                           pus oocytes are not RNases. Total RNA from microinjected oo-
                                0 OH                                                       cytes was recovered as described under "Experimental Procedures."
                                I -                                                        RNA was electrophoresed on 3.2% gels and stained with methylene
                            ep-0                                                           blue. Calf 28 and 18 S rRNA aswell as Bethesda Research Laboratory
                                I -Alpha                      Sarcin
                                                                                           RNA size markers were used. Lanes A and G, uninjected oocytes;
                                0
                                                                                           lanes B and F, 0.1 X Barth-injected oocytes; lane C, ricin-injected
                                I              Adcnim 3m
                                                                                           oocytes; lane D, Shiga toxin-injected oocytes; and lane E , SLT-IIv-
                            HCH                    I
                                                                                           injected oocytes. 30-40 nl of each toxin (0.2 mg/ml) was injected into
                                                                                           the vegetal pole.

                                    0 OH                                      show that microinjected, nonglycosylated, recombinant ricin
                                     I                                        A chain contains this RNA    glycosidase activity.
                             O=P.O'
                                I                                                We also investigated the putative glycosidase activity of
                                                                              microinjected Shiga toxin and SLT-IIv in Xenopus oocytes.
           Specific Cleavage Sites of Toxins in Xenopus UIS rRNA.             Although SLT-IIv was assumed to have the same mode of
   FIG.1. Specific nucleotidesof 28 S rRNA attacked by tox- action as Shiga toxin and SLT-I1(8), this hypothesis had not
ins. A, a-Sarcin recognition site (24). Only the rat (19) and Xenopus been tested. Since 0-sarcin, ricin, Shiga toxin, and SLT-IIv
(21) a-sarcin cleavage sites have been precisely determined; a-sarcin all differ in their host cell specificities (see Refs. in 1, 6, and
generates specific fragments for yeast andE. coli (25). The       boM letters 24), we used microinjectioninto Xenopus oocytes to determine
designate bases identical in all species. The arrow signifies the cleav- the molecular mechanisms of these toxins in living cells. We
age site for a-sarcin in Xenopus and rat 28 S rRNA. The indicated
adenosine is the base specifically removed by ricin in rat (17) and report that Shiga toxin and SLT-IIv both have the same
Xenopus (reported here) 28 S rRNA. B, specificcleavage sites of specific RNA N-glycosidase activity as ricin when microin-
toxins in Xenopus 28 S rRNA (Ref. 21; see following data for ricin,           jected into Xenopus oocytes, and neither toxin appears to
Shiga toxin, and SLT-IIv). After hydrolysis of the glycosidic bond, have any associated ribonucleaseactivity.Although                     recent
aniline induces  cleavage of the 3'-phosphoester bond B elimination proposals suggest that ricin and Shiga toxin are activated
                                                              via
(26) where indicated.                                                         within coated pits following receptor-mediated endocytosis
                                                                              (reviewed in Ref. 27), our data indicate that direct injection
a conserved 14-nucleotide region; there is only one change in into the cytoplasm is sufficient for toxin                 activity.
this region from E. coli to rat (Ref. 24, Fig. 1A). &arcin also
                                                                                               EXPERIMENTALPROCEDURES
suppresses protein synthesis E. coli, yeast, and rat
                                          in                      ribosome
extracts (19,22) and when          microinjected into Xenopus oocytes           Materials-Ribonucleases T1, U2, Phy. M., B. cereus, and P1 were
                                                                              purchased from Bethesda Research Laboratory. Polynucleotideki-
(21).                                                                         nase was from New England Biolabs. Calf intestine alkaline phos-
   We report that ricin microinjected into Xenopus oocytes phatase was fromBoehringerMannheim.                          [y-'*P]ATP  (6000Ci/
does not appear to have anyassociated ribonuclease activity mmol)and~-[~'sS]Met (1134 Ci/mmol) were fromDuPont-New
and insteadspecifically removes A-3732 from 28 S rRNA. We England Nuclear. a-Sarcin was a generous gift from the Michigan
598                                  Toxins
                                     with                Specific N-Glycosidase
                                                                         Activity              in Oocytes
                                                                                1

                         A                                                          B
                                    A        B   C   D    E   F   C
                             28s-
                                    -   .-
                                                                                           A B C D E
                                                                      -4.4
                                                                      -2.4
                             18s-

                                                                      -1.4




                                                                                I




                                                                                                             c




                                                                                                             a0.24




                FIG.3. Ricin, Shiga toxin, and SLT-IIv injected into oocytes specifically attack 28 S rRNA. Total
             RNA extracted from injected oocytes was electrophoresed as described in the legend to Fig. 2 and thenblotted and
             probed with an oligonucleotide specific for the small a-sarcin fragment (A) The arrow indicates the position of the
             small a-sarcin fragment. RNA extracted from injected oocytes was treated with aniline to induce cleavage at the
             toxin N-glycosidase site. Lune A, no injection; lane B, a-sarcin injected; lane C, Shiga toxin injected + aniline
             treatment; lane D,Shiga toxin injected; lane E, ricin-injected + aniline treatment; lane F, ricin injected; and lane
             G, no injection + aniline treatment. B, a similar microinjection and blotting experiment was done with SLT-IIv.
             Lune A, 0.1 X Barth injected; lane B, a-sarcin injected; lane C, SLT-IIv injected; lane D, SLT-IIv injected +
             aniline; and lane E, 0.1 X Barth injected + aniline.


Department of Public Health. The toxin was part of the same batch            M Tris-HC1 pH 7.5, 1 M NaCI, 0.1% Na.$20,,       1% SDS, 100 pg/ml
used by other investigators and had identical properties on SDS gels         denatured salmon sperm DNA, and 0.2% Denhardt's solution. The
(19). Ricin D (28) was obtained from Dr. Richard Youle, National             filters were washed once for 15 min a t room temperature with 2 X
Institutes of Health, and also purchased from Calbiochem. Xenopus            SSPE containing 0.1% SDS and then four washes of 15 min each a t
laeuis were purchased from Xenopus-I, Ann Arbor, MI. Nonglycosy-             45 "C in the same buffer followed by a final wash of 15 min at room
lated recombinant ricin A chain and native glycosylated ricin A chain        temperature in 0.1 X SSPE (0.18 M NaCl, 10 m NaPO,, 1 m
                                                                                                                                M              M
were provided by Cetus Corporation. Shiga toxin and rabbit antitoxin         EDTA, pH 7.0), 0.1% SDS.
were purified as described previously (29, 30). SLT-IIv was isolated            Purification and Sequencing of Shiga, SLT-IIu, and Ricin rRNA
from cultured supernatants of an E. coli K12strain transformed with          Fragments-Anilinelacetate-treated Shiga, SLT-IIv, and ricin rRNA
the hybrid plasmid pDLW5 (8)that contained the SLT-IIv structural            preparations were dephosphorylated by calf intestine alkaline phos-
genes.                                                                       phatase before 5' end labeling with [-p3'P]ATP and polynucleotide
   Oocyte Microinjection and Protein Labeling--20-nl samples were            kinase (36) and thenelectrophoresed as mentioned above. The rRNA
microinjected into the vegetal pole of mature stage VI oocytes. All          fragments were recovered (37) and electrophoresed over a 6% poly-
microinjection procedures were as described by Gurdon (31). A t              acrylamide gel as above. The Shiga, SLT-IIv, and ricin fragments
various times after injection (2-16 h), oocytes were incubated individ-      from the gels were eluted, ethanol-precipitated, and used for RNA
ually in 20 pl of 1 X Barth containing -8 pCi of ~-["SlMet for 16 h.         sequencing and 5' end terminal base analysis by procedures supplied
To determine oocyte cytoplasmic protein synthesis, each oocyte was           by Bethesda Research Laboratory with their nucleases.
thentransferred and washed several times in 1 X Barth before                    SDS-Polyacrylamide Gel Electrophoresis-~-[~"S]Met-labeledcy-
homogenization (32).                                                         toplasmic protein samples were analyzed by SDS electrophoresis in
   Preparation of Oocyte rRNA-Microinjected oocytes were homog-              17.5% acrylamide, 0.08% bisacrylamide running gel with a stacking
enized (50 oocytes/ml) and total RNArecovered by guanidinium                 gel consisting of 5% acrylamide and 0.15% bisacrylamide according
isothiocyanate/CsCl ultracentrifugation (33). Total RNA from toxin           to Laemmli (38). The gels werestained with Coomassie Brilliant Blue
and 0.1 X Barth's microinjected oocytes were treated with 1M aniline/        R-250 (Bio-Rad), destained, treated with EN3HANCE (Du Pont) and
acetate solution pH 4.5 a t 60 "C for 5 min in the dark according to         autoradiographed.
Peattie (26, 34).                                                               Oligonucleotide Probes-We thank Dr. Carol Camerini-Otero for
   rRNA Analysis--5 pg of rRNA samples were electrophoresed on               synthesizingoligonucleotides  with an Applied Biosystems model 381A
3.2% polyacrylamide gels (acry1amide:bisacrylamide;19:l) containing          DNA synthesizer. An oligonucleotide probe specific for Xenopus 28
7.5 M urea. Electrophoresis was a t 20 watt using TBE buffer (89 m   M       S rRNA (23) complementary to nucleotides 3749-3773:        AGA-
                         M
Tris-borate, pH 8.3, 2 m EDTA). Gels were fixed in 6% acetic acid            CATTTGGTGTATGTGCTTGGCT was synthesized.
solution and stained with methylene blue. For Northern blots (35),
                           M
gels were placed in 50 m sodium hydroxide solution for 45 min.,                                RESULTSANDDISCUSSION
followed by neutralization with 0.1 M Tris-HC1, pH 7.6. Transfer to
0.45-pm Nytran" (Schleicher & Schuell) was done electrophoretically            Ricin, Shiga Toxin, and SLT-IIv Do Not Behave as Nu-
for 15 h in TBE buffer with a Hoeffer apparatus. Prehybridizations           cleases in Oocytes-The a-sarcin recognitionsequence (24)
and hybridizations with oligonucleotide probes were at 42 "C in 0.05         and the specific sites of attack for a-sarcin (19, 21), ricin,
                                     Toxins with Specific Activity
                                                  N-Glycosidase                         in Oocytes                               599
                                                                       duced an a-sarcin                                     of
                                                                                           sized fragment upon treatment the rRNA
                                                                       with aniline (Fig. 3A). RNA from oocytes microinjected with
                                                                       0.1 x Barth media (Fig. 3B) or Shiga toxin pretreated with
                                                                       Shiga toxin-specific antibody did not produce an a-sarcin-
                                                                       sized fragment even when treated with aniline (not shown).
                                                                       Therefore, oocytes microinjected with ricin, Shiga toxin, or
                                                                       SLT-IIv produce28 S rRNA containinga labile phosphodies-
                                                                       ter bond located within the a-sarcinrecognition region.
                                                                          Nucleotide Sequence a t the Toxin N-Glycosidase Site-To
                                                                       determine the exact                           by
                                                                                             cleavage site induced aniline treatment
                                                                       of rRNA isolated from oocytes microinjected with ricin, Shiga
                                                                                              we
                                                                       toxin, and SLT-IIv, sequenced the appropriate           RNA frag-
                                                                       ments. It was necessary to dephosphorylate the RNA samples
                                                                       before labeling their5' ends with kinase and      [y-"P]ATP. No
                                         G                             labeling of these RNA fragments occurred in the absence of
                                         A
                                         C                             dephosphorylation (not shown). This is consistent with the
                                         G                             expected mechanism of aniline-induced cleavage of a labile
                                         C                             phosphodiester bond (Fig. 1, Ref. 26). The RNA sequences
                                         C                                                                                  from
                                                                       from the5' end of the small fragments resulting aniline-
                                         A           "
                                         A                             induced cleavage of the rRNAs isolated from       oocytes microin-
                                         C                             jected with ricin and Shiga toxin are shown in Fig. 4. The
                                                                       RNA sequence for SLT-IIv (not shown) was             identical. All
                                         G
                                                                       three microinjected toxins remove exactly the samebase, A-
                                                                       3732, in Xenopus 28 S rRNA. Therefore, the extreme speci-
                                          P                            ficity of ricin and Shiga toxin removing a single base from
                                                                                                         for
                                                                       28 S rRNA in isolated rat liver ribosomes or deproteinized 28
                                                                       S rRNA (16-18) is retained in living cells.
                                                                          MicroinjectedToxins Inhibit Oocyte Cytoplasmic Protein
                                                                       Synthesis-Injected ricin, Shiga toxin, and SLT-IIv eliminate
                                                                       protein synthesis for nonsecretory proteins (Fig. 5). These
                                                                       injected toxins were inhibitory with as little 0.2 pg of ricin/
                                                                                                                        as
                                                                       oocyte and 4 pg of Shiga toxin or SLT-IIv/oocyte. This is the
                                                                       first demonstration that SLT-IIv inhibits protein synthesis.
                                                                       The results for Shiga toxin and ricin were expected because
  FIG. 4. RNA sequence at the 5' end of the small28 S rRNA             of the well known effectsof these toxins on protein synthesis
fragment purified from toxinmicroinjected oocytes. The small           in vitro (1, 6). A single molecule of diphtheria toxin (39) or
rRNA fragments produced byaniline-induced cleavage of 28 S rRNA                                                     to
                                                                       ricin (40) is supposedto be sufficient kill a mouse Lcell or
recoveredfrom microinjected oocytes were dephosphorylated with         HeLa cell, respectively. Therefore it was surprising that x   -2
calf intestinal phosphatase and labeled at their 5' end with polynu-
cleotide kinase and [yR2P]ATP    and digested with ribonuclease T 1    IO6molecules of ricin/oocyte and -3 X lo7 molecules of Shiga
( G ) ,U2 (A), Phy. M (A/U), B. cereus (C/U). The alkaline digest is   toxin or SLT-IIv/oocyte were required to diminish protein
designated OH- and the untreated sample as -E. The 5"terminal          synthesis in our injection experiments. The      oocyte is -1 mm
guanosine was determined by TLC analysis. A, sequence of ricin         in diameter and therefore -lo6 times larger than a typical
fragment; B, sequence of Shiga toxin fragment.                         somatic cell. The oocyte's larger sizemay account for the
                                                                       requirement for more toxin molecules to inhibit protein syn-
Shiga toxin, and SLT-IIv (see  below) when microinjected into          thesis. Another possibility is that Xenopus oocytes contain
Xenopus oocytes are shown in Fig. 1. To test whether ricin,            the equivalent 28 S rRNA of -400 somatic cells. Assuming
Shiga toxin, and SLT-IIv behaveas ribonucleases or as spe-             toxin-inactivated 28 S rRNA inoocyte ribosomesis efficiently
cific N-glycosidases, we microinjected these toxins into Xen-          replaced by native 28 S rRNA from this      large stockpile, larger
opus oocytes. The oocyteswere incubated for 16 h after                 amounts of toxin would be required to inhibit protein synthe-
microinjection and the RNA analyzed on 7.5 M urea, 3.2%                sis. Our results show that large numbers of toxin molecules
polyacrylamide gels stained with methylene  blue (Fig. 2). The         are required to quickly inhibit oocyteendogenous protein
oocytesinjected with media alone (Fig. 2, lanes B and F )              synthesis.
contain slightly more of a degradation fragmentwhich is seen              The microinjected toxins do not cause general proteolytic
in every lane, including the uninjected oocytes. Clearly there         degradation of the pre-existing oocyte cytoplasmic proteins.
                          of
is no general degradation the endogenous RNA in microin-               This was determined by staining the gel used in Fig. 6 with
jected oocytes, even 16 h after microinjection of the toxins           Coomassie Blue prior to fluorography. There was no differ-
(Fig. 2).                                                              ence for the pre-existing pool of proteins between the unin-
   Microinjected Ricin, Shiga Toxin, and SLT-IIv Specifically          jected oocytes and the toxin-injectedoocytes (not shown).
Remove a Base Near the 3' End of 28 S rRNA-A more                         Injected nonglycosylated recombinant ricin A chain elimi-
                                                 a specific N-
specific and sensitive assay is required to detect                     nated soluble, newly synthesized oocyte cytoplasmic protein
glycosidase or cleavage activity.Alabeledoligonucleotide               synthesis (Fig. 6, lune A ) . Injected glycosylated native ricin A
probe specific to the expected ricin fragment of 378 nucleo-           chain also eliminated soluble cytoplasmic protein synthesis
tides (probel), was usedas a hybridization probe for Northern          (Fig. 6, lane B).
blots (Fig. 3). We used this same probe to demonstrate that               The effects of ricin, Shiga t,oxin, and SLT-IIv in oocytes
cy-sarcin microinjected into Xenopus oocytes causes a single           therefore seem to be limited to a specific N-glycosidase activ-
specific cleavage in 28 S rRNA (21). RNAfrom oocytes                   ity at A-3732 of Xenopus 28 S rRNA and suppression of
microinjected with ricin, Shiga toxin, or SLT-IIv only pro-            nonsecretory protein synthesis.
600                                                                   Activity in Oocytes
                                     Toxins with Specific N-Glycosidase
                                              A    B    C    D    E     F   G   H    I J     K    L    M    N    O       P    Q    R


   FIG. 5 MicroinjectedShiga toxin,
          .
SLT-IIv, and ricin suppress oocyte
cytoplasmic protein synthesis. 00-
cytes were microinjected with 0 1 X .
Barth, cycloheximide (20mg/ml), Shiga
toxin, ricin, and SLT-IIv and incubated
for 6 h in 1 X Barth before labeling and
                                for
then labeled with ~ - [ ~ ~ S l M e t16 h.
The oocytes were homogenized and the
labeled protein was analyzed on SDS gels
(38).All toxins were diluted in 0.1 X
Barth containing 0.1% gelatin. Lane A,
uninjected oocytes; lane B, 0 1 X Barth
                             .
with 0.1% gelatin injected; lane C-I: ri-
cin injected at 0.0001, 0.001, 0.01, 0.1,
        and
1.0,10, 100 pg/ml, respectively; lanes
J-N: Shiga toxin injected a t 0.02, 0.2,
2.0,20,  and 200 pg/ml; lanes 0-Q,  SLT-
IIv injected a t 0.02, 0.2, 2.0 pg/ml;
                          and
and lane R, cycloheximide injected.




                                                                          Acknowledgments-We are grateful to Richard Youle, Henry Wu,
                 A        B        C D                                  and Dan Camerini-Otero for critically reading the manuscript and
                                                                        for useful discussions.
                                                                                                   REFERENCES
                                                                         1. Jimenez, A. & Vazquez, D. (1985)  Annu. Rev.Microbiol. 39,649-
                                                                              672
                                                                         2 Martin, H. B. & Houston, L. L. (1983)Biochim. Biophys. Acta
                                                                          .
                                                                              762,128-134
                                                                         3 Olsnes, S. & Pihl, A. (1982)Cancer Suru. 1,467-487
                                                                          .
                                                                         4. Oda, T. & Funatsu, G. (1979)  Agric. Biol. Chem. 43,547-554
                                                                         5. Montesano, L., Cawley, D. & Herschman, H. R. (1982)Biochem.
                                                                              Biophys. Res. Commun. 109,7-13
                                                                         6. O’Brien A. D. & Holmes R. K. (1987)Micriobiol. Reu. 51, 206-
                                                                              220
                                                                         7 Marques, L. R. M., Peiris, J. S. M., Cryz, S. J. & O’Brien, A. D.
                                                                          .
                                                                              (1987) FEMS Lett. 44, 33-38
                                                                         8 Weinstein, D. L., Jackson, M. P., Samuel, J. E., Holmes, R. K. &
                                                                          .
                                                                                                    J.
                                                                              O’Brien, A. D. (1988) Bacteriol. 170,4223-4230
                                                                         9. Strockbine, N. A., Marques, L. R. M., Newland, J. W., Smith H.
                                                                              W., Holmes, R. K. & O’Brien, A. D. (1986)Infect. Immun. 53,
                                                                              135-140
                                                                        10. Donohue-Rolfe, A., Keusch, G . T., Edson, C., Thorley-Lawson,
                                                                              D. & Jacewicz, M. (1984) . Exp. Med. 160,1767-1781
                                                                                                        J
                                                                        11. Reisbig, R., Olsnes, S. & Eiklid, K. (1981)J. Biol. Chem. 256,
                                                                              8739-8744
                                                                        12. Lindberg, A.A., Brown, J. E., Stromberg, N., Westling-Ryd, M.,
                                                                              Schultz, J. E. & Karlson, K.A. (1987)J. Biol. Chem. 262,
                                                                              1779-1785
                                                                        13. Obrig, T G., Moran, T. P. & Colinas, R. J. (1985)Biochem.
                                                                                     .
                                                                              Biophys. Res. Commun. 130,879-884
                                                                        14. Brown, J. E., Obrig, T. G., Ussery, M. A. & Moran, T P. (1986)
                                                                                                                                 .
                                                                              Microb. Pathog. 1,325-334
                                                                        15. Nilsson, L. & Nygard, 0.  (1986)Eur. J. Biochem. 161, 111-117
                                                                        16. Endo, Y., Mitsui, K., Motizuki, M. & Tsurugi, K. (1987)J. Biol.
                                                                              Chem. 262,5908-5912
                                                                                                           J.
                                                                        17. Endo, Y. & Tsurugi, K. (1987) Biol. Chem. 262,8128-8130
                                                                        18. Endo, Y., Tsurugi, K., Yutsudo, T., Takeda, Y., Ogasawara, K. &
                                                                              Igarashi, K. (1988)Eur. J. Bwchem. 171.45-50
                                                                        19. Endo, Y. & Wool, I. G . (1982)J. Biol. Chem. 257,9054-9060
                                                                        20. Endo, Y., Huber, P. W. & Wool, I. G. (1983) Biol. Chem. 258,
                                                                                                                         J.
  FIG. 6. Injected recombinant ricin A chain inhibits soluble                 2662-2667
cytoplasmic protein synthesis. Oocytes were injected with recom-        21. Ackerman,E. J., Saxena, S. K. & Ulbrich, N. (1988)J. Biol.
binant ricin A chain and analyzed as described in the legend to Fig.          Chem. 263,17076-17083
5.Lane A, nonglycosylated recombinant ricin A chain (1pglml); lane      22. Chan, Y.L., Olvera. J. & Wool. I. G . (1983)Nucleic Acids Res.
                                                                                                                    .    .
B, glycosylated native ricin A chain (1pglml); lane C, native ricin D         11,7819-7831
(1pg/ml); lane D,uninjected oocytes.                                    23. Ware, V. C., Tague, B. W., Clark, C.G., Gourse, R. L., Brand, R.
                                                                              C. & Gerbi, S. A. (1983)Nucleic Acid Res. 11,7795-7817
                                                                                in
                                      Toxins with Specific N-Glycosidase Activity Oocytes                                                  601
24. Wool, I. G. (1984) Trends Biochem. Sci. 9, 14-17                    33. Chirgwin, J. H.,  Przybla, A. E., McDonald, R. J. & Rutter, W. J .
25. Schindler, D.G. & Davies, J. E. (1977) Nucleic AcidsRes. 4,               (1979) Biochemistry 18,5294-5299
      1097-1110                                                         34. Peattie, D. A. (1979) Proc. Natl. Acad. Sci. U. S. A . 76, 1760-
26. Peattie, D. A. (1983) in Methods of DNA and RNA Sequencing                1764
      (Weissman, S. M., ed) Praeger, New York                           35. Wahl, G. M., Stern, M. & Stark, G. R. (1979) Proc. Natl. Acad.
27. Olsnes, S. & Sandvig K. (1988) in Zmmunotorins (Frankel, A. E.,           Sci. U. S. A . 76,3683-3687
      ed) Martinus Nijhoff, Boston                                      36. Silberklang, M., Gillum, A. M. & RajBhandary, U. L. (1979)
28. Youle, R. J . & Neville, D. M., Jr. (1982) J. Bwl.Chem. 257,              Methods Enzymol. 59G, 58-109
      1598-1601                                                         37. Maxam, A. M. & Gilbert, W. (1980) Methods Enzymol. 65,499-
29. O’Brien, A. D. & LaVeck, G. D. (1983) Infect. Zmmun. 40, 675-             560
      683                                                               38. Laemmli, U. K. (1970) Nature 227,680-685
30. O’Brien, A. D., LaVeck, G. D., Griffin, D. E. & Thompson, M. R.     39. Yamaizumi, M., Mekada, E., Uchida, T. & Okada Y. (1978) Cell
      (1980) Infect. Zmmun. 30, 170-179                                       15,245-250
31. Gurdon, J. B. (1977) Methods Cell Biol. 16, 125-139                 40. Eiklid, K., Olsnes, S. & Pihl, A. (1980) Enp. Cell Res. 1 2 6 , 321-
32. Melton, D. A. (1985) Proc. Natl. Acad. Sci. U. S. A . 82, 144-148         326

								
To top