DNA methylation in Yersiniaenterocolitica role of the

Document Sample
scope of work template
							Microbiology (2005), 151, 2291–2299                                                                         DOI 10.1099/mic.0.27946-0




                                    DNA methylation in Yersinia enterocolitica: role of
                                    the DNA adenine methyltransferase in mismatch
                                    repair and regulation of virulence factors
                                            ¨
                                    Stefan Falker, M. Alexander Schmidt and Gerhard Heusipp
 Correspondence                     Institut fur Infektiologie, Zentrum fur Molekularbiologie der Entzundung (ZMBE),
                                              ¨                          ¨                            ¨
 Gerhard Heusipp                              ¨
                                    Universitatsklinikum Munster, von-Esmarch-Str. 56, 48149 Munster, Germany
                                                              ¨                                    ¨
 heusipp@uni-muenster.de

                                    DNA adenine methyltransferase (Dam) plays an important role in physiological processes of
                                    Gram-negative bacteria such as mismatch repair and replication. In addition, Dam regulates the
                                    expression of virulence genes in various species. The authors cloned the dam gene of Yersinia
                                    enterocolitica and showed that Dam is essential for viability. Dam overproduction in Y. enterocolitica
                                    resulted in an increased frequency of spontaneous mutation and decreased resistance to
                                    2-aminopurine; however, these effects were only marginal compared to the effect of overproduction
                                    of Escherichia coli-derived Dam in Y. enterocolitica, implying different roles or activities of
                                    Dam in mismatch repair of the two species. These differences in Dam function are not the cause
                                    for the essentiality of Dam in Y. enterocolitica, as Dam of E. coli can complement a dam defect
                                    in Y. enterocolitica. Instead, Dam seems to interfere with expression of essential genes.
 Received 4 February 2005           Furthermore, Dam mediates virulence of Y. enterocolitica. Dam overproduction results in increased
 Revised    21 March 2005           tissue culture invasion of Y. enterocolitica, while the expression of specifically in vivo-expressed
 Accepted 24 March 2005             genes is not altered.



INTRODUCTION                                                            of uropathogenic E. coli that mediates adhesion to
                                                                        uroepithelial cells. The expression of Pap pili is subject to
In Escherichia coli, the Dam enzyme (DNA adenine methyl-
                                                                        phase variation, which occurs without a DNA sequence
transferase, encoded by the dam gene) catalyses the methyl-
                                                                        change. Instead, the methylation pattern of two GATC sites
ation of adenine at the N6 position in GATC sequences
                                                                        proximal to the papBA promoter influences the binding
of double-stranded DNA (Geier & Modrich, 1979). Many
                                                                        of the regulatory proteins Lrp and PapI, which correlates
important physiological processes such as DNA replication,
                                                                        with the ON and the OFF stage of pilus expression (Hernday
methyl-directed mismatch repair and transposition are
                                                                        et al., 2002).
regulated in E. coli by Dam-mediated DNA methylation
(Marinus, 1996). During replication, delayed methylation of             Mutants of Salmonella typhimurium lacking the Dam
newly synthesized DNA at the replication fork results in                enzyme are avirulent in mice, suggesting a role for DNA
temporarily hemimethylated DNA, which is required for                   adenine methylation in virulence of this pathogen. Dam is
parental strand-directed mismatch repair (Modrich, 1987).               involved in the regulation of a subset of specifically in vivo
Therefore, dam mutant strains as well as strains over-                  induced (ivi) genes. The expression of more than 20 ivi
producing the Dam enzyme show increased spontaneous                     genes was significantly repressed in Salmonella dam mutant
mutability and sensitivity to base analogues and other                  strains (Heithoff et al., 1999). Furthermore, the dam mutant
mutagens (Glickman et al., 1978; Herman & Modrich, 1981;                strain was unable to disseminate to deeper tissues in mice
Marinus & Morris, 1974). In addition to the role in mis-                and could be successfully used as a live vaccine against
match repair, changes in DNA methylation can alter the                  salmonellosis in different animal models (Dueger et al.,
affinity of regulatory proteins to DNA target sites; con-                2001, 2003; Garcia-Del Portillo et al., 1999; Heithoff et al.,
versely, DNA-binding proteins can inhibit methylation of                1999, 2001). Recently it was shown that the pathogenicity
specific DNA sequences. Both mechanisms may lead to                      of Vibrio cholerae, Yersinia pseudotuberculosis, Pasteurella
alterations in gene expression (Bolker & Kahmann, 1989;                 multocida and Haemophilus influenzae is also affected
Braaten et al., 1994; Lu et al., 1994; Sternberg, 1985). One of         by DNA adenine methylation. As in Salmonella, Dam-
the best-studied examples for regulation of gene expression             overproducing strains of Y. pseudotuberculosis confer
by DNA methylation patterns is the Pap pilus expression                 protective immunity in mice. Additionally, Dam over-
                                                                        production leads to expression and secretion of Yop viru-
Abbreviations: Dam, DNA adenine methyltransferase; 2-AP, 2-amino-       lence proteins under non-permissive conditions (Chen et al.,
purine.                                                                 2003; Julio et al., 2001, 2002; Watson et al., 2004).

0002-7946 G 2005 SGM        Printed in Great Britain                                                                                2291
    ¨
S. Falker, M. A. Schmidt and G. Heusipp


Table 1. Bacterial strains and plasmids

 Strain or plasmid                                          Genotype                                 Source or reference

 Y. enterocolitica
 JB580v                        DyenR(r2 m+) Nalr, pYV+                                            Kinder et al. (1993)
 GHY15                         hreP : : lacZYA                                                    This study
 GHY29                         rpoE : : lacZYA                                                    Heusipp et al. (2003)
 GHY121                        dam+ : : pEP-dam : : V(SmR/SpR)                                    This study
 GHY125                        dam+ : : pEP-dam : : V(SmR/SpR), pVLT-dam1/2                       This study
 GHY128                        fyuA : : lacZYA                                                    This study
 GHY129                        mdoH : : lacZYA                                                    This study
 GHY130                        rscR : : lacZYA                                                    This study
 GHY137                        fyuA : : lacZYA, pTP166Kan-damD                                    This study
 GHY138                        hreP : : lacZYA, pTP166Kan                                         This study
 GHY139                        hreP : : lacZYA, pTP166Kan-damD                                    This study
 GHY140                        mdoH : : lacZYA, pTP166Kan                                         This study
 GHY141                        mdoH : : lacZYA, pTP166Kan-damD                                    This study
 GHY142                        rpoE : : lacZYA, pTP166Kan                                         This study
 GHY143                        rpoE : : lacZYA, pTP166Kan-damD                                    This study
 GHY144                        rscR : : lacZYA, pTP166Kan                                         This study
 GHY145                        rscR : : lacZYA, pTP166Kan-damD                                    This study
 GHY146                        fyuA : : lacZYA, pTP166Kan                                         This study
 GHY147                        JB580v, pTP166Kan-damD                                             This study
 GHY148                        GHY147, pYV2                                                       This study
 GHY150                        JB580v, pTP166Kan                                                  This study
 GHY151                        GHY150, pYV2                                                       This study
 GHY157                        JB580v, pTP166Kan-YEdamrev                                         This study
 GHY158                        JB580v, pTP166Kan-YEdam                                            This study
 GHY226                        dam : : pEP-damV(SmR/SpR), pVLT-ECdam2/5                           This study
 E. coli
 DH5a                          w80dD(lacZ)M15 D(argF–lac)U169 endA1 recA1 hsdR17(r{ mz )
                                                                                  k  k            Gibco-BRL
                                deoR thi-1 supE44 gyrA96 relA1
 S17-1lpir                     TpR SmR recA thi pro hsdR M+ RP4 : : 2-Tc : : Mu : : Km Tn7lpir    Miller & Mekalanos (1988)
                                lysogen
 GM2163                        F2 ara-14 leuB6 fhuA31 lacY1 tsx78 glnV44 galK2 galT22 mcrA        Marinus et al. (1983)
                                dcm-6 hisG4 rfbD1 rps136(StrR) dam13 : : Tn9 (CamR) xylA5
                                mtl-1 thi-1 mcrB1 hsdR2
 GHE131                        DH5a, pBS-dam1/2                                                   This study
 GHE134                        GM2163, pVLT33                                                     This study
 GHE135                        GM2163, pVLT-dam1/2                                                This study
 Plasmids
 pBluescriptIIKS+              Ampr, high-copy-number cloning vector                              Stratagene
 pVLT33                        KanR, Ptac expression vector, RSF1010 ori                          De Lorenzo et al. (1993)
 pEP185.2                      CamR, mob+ (RP4), R6K ori (suicide vector)                         Kinder et al. (1993)
 pFUSE                         CamR, mob+ (RP4), R6K ori, lacZYA operon fusion suicide vector      ¨
                                                                                                  Baumler et al. (1996)
 pSmUC                         AmpR SmR SpR, V(SmR/SpR) in pUC129                                 Nelson et al. (2001)
 pTP166                        AmpR, high-copy-number expression vector, E. coli dam under Ptac   Marinus et al. (1984)
                                control
 pBS-dam1/2                    Y. enterocolitica dam in pBluescriptIIKS+, AmpR                    This study
 pWSK-4J7opp                   Derivative of pGY50 with hreP fragment in opposite orientation,    Heusipp et al. (2001)
                                AmpR
 pVLT-dam1/2                   Y. enterocolitica dam in pVLT33, KanR                              This   study
 pVLT-ECdam2/5                 E. coli dam in pVLT33, KanR                                        This   study
 pEP-dam : : V(SmR/SpR)        Y. enterocolitica dam : : V(SmR/SpR) in pEP185.2, CamR SmR SpR     This   study
 pTP166Kan                     KanR derivative (AmpS) of pTP166                                   This   study
 pTP166Kan-damD                dam derivative of pTP166Kan                                        This   study




2292                                                                                                             Microbiology 151
                                                                                                                   Dam of Yersinia enterocolitica


Table 1. cont.

 Strain or plasmid                                                    Genotype                                             Source or reference
                                           R                  S
 pTP166Kan-YEdam                      Kan derivative (Amp ) of pTP166, Y. enterocolitica dam under Ptac                         This study
                                       control
 pTP166Kan-YEdamrev                   KanR derivative (AmpS) of pTP166, contains Y. enterocolitica dam in                       This study
                                       reverse orientation
 pFUSE-hreP                           pFUSE with hreP : : lacZYA                                                                This   study
 pKN8-fyuA                            pKN8 with fyuA : : lacZYA                                                                 This   study
 pKN8-mdoH                            pKN8 with mdoH : : lacZYA                                                                 This   study
 pKN8-rscR                            pKN8 with rscR : : lacZYA                                                                 This   study


Although a role for Dam in the regulation of virulence                        Cloning and sequencing of the Y. enterocolitica dam gene.
has been described for various pathogens, the underly-                        To clone the putative dam gene of Y. enterocolitica, a 930 bp
                                                                              fragment was amplified by PCR using the primers GH-dam1 and
ing molecular mechanisms and regulatory networks have
                                                                              GH-dam2 (Table 2), digested with KpnI and XbaI and ligated into
mainly been analysed in E. coli. We cloned the dam gene                       KpnI/XbaI-digested pBluescriptIIKS+. To confirm the identity of
of the human-pathogenic bacterium Y. enterocolitica in an                     the cloned DNA to the sequence derived from the unfinished
initial effort to characterize the role of DNA methylation                    Y. enterocolitica genome project (http://www.sanger.ac.uk/Projects/
in Y. enterocolitica compared to the E. coli model and in                     Y_enterocolitica/), the resulting plasmid pBS-dam1/2 was sequenced
virulence gene expression. We show that in contrast to E.                     using standard primers (Eurogentec).
coli, Dam is essential for growth in Y. enterocolitica. This is
                                                                              Complementation of an E. coli dam mutant strain. A 930 bp
possibly linked to an altered expression of essential genes,
                                                                              KpnI/XbaI fragment of pBS-dam1/2 containing the dam ORF was
but not to Dam’s role in mismatch repair. Initial experi-                     isolated and subcloned into pVLT33. The resulting plasmid, pVLT-
ments support the anticipated role of Dam in virulence                        dam1/2, and pVLT33 as a control plasmid were transferred into the
factor expression in Y. enterocolitica. Our studies contribute                E. coli dam mutant strain GM2163 by electroporation. After induc-
to the elucidation of the multifaceted role of DNA methyl-                    tion of dam expression from the Ptac promoter, the plasmids were
ation in Y. enterocolitica.                                                   reisolated and digested with MboI and Sau3AI. The resulting frag-
                                                                              ments were analysed by 1 % agarose gel electrophoresis.

METHODS                                                                       Construction of mutant strains. For the construction of a Y.
                                                                              enterocolitica dam mutant strain, a 2 kb EcoRI fragment encoding
Bacterial strains, plasmids and growth conditions. Bacterial                  the V(SmR/SpR) cassette of pSmUC was ligated into the unique
strains and plasmids used in this study are listed in Table 1. Unless         EcoRI site of the dam gene in pBS-dam1/2, resulting in pBS-
otherwise indicated, all strains were grown in Luria–Bertani (LB)             dam : : Sm. This plasmid was used as a template in a PCR to amplify
broth or on agar plates, at 26 uC for Y. enterocolitica or 37 uC for E.       a dam : : V(SmR/SpR) fragment using the primers GH-dam1 and
coli. Antibiotics were used at the following final concentrations: for         GH-dam2, and Pfu polymerase. The PCR product was phosphory-
Y. enterocolitica, nalidixic acid (Nal; 20 mg ml21), kanamycin (Kan;          lated by polynucleotide kinase and ligated into the SmaI site of
100 mg ml21), chloramphenicol (Cam; 12?5 mg ml21), spectino-                  pEP185.2 (Kinder et al., 1993), resulting in pEP-dam : : V(SmR/SpR).
mycin (Sp; 50 mg ml21) and streptomycin (Sm; 50 mg ml21); for                 This suicide plasmid was transferred to Y. enterocolitica JB580v by
E. coli, ampicillin (Amp; 100 mg ml21), kanamycin (50 mg ml21),               conjugation and integrated into the chromosome by homologous
chloramphenicol (25 mg ml21), spectinomycin (50 mg ml21) and                  recombination after selection for chloramphenicol and streptomycin
streptomycin (50 mg ml21). When appropriate, 1 mM IPTG was                    resistance. The result was a merodiploid dam+-dam : : V(SmR/SpR)
used to induce expression of genes under Ptac control.                        strain. This was confirmed by Southern blot analysis. Subsequently,


Table 2. Oligonucleotides

 Oligo                       Sequence (5§R3§), restriction sites underlined                Restriction site

 GH-dam1                     GGGGTACCCGGCTCTGAATTATTAAGTAG                                      KpnI
 GH-dam2                     GCTCTAGAATCTCTTTGTTTTATGAGGGCG                                     XbaI
 SF-fyu1                     GCTCTAGATGCTGAAGTGGAATCGGCACT                                      XbaI
 SF-fyu2                     GAAGATCTGCCGAGCGGGAAGATTGTTTA                                      BglII
 SF-mdo1                     GCTCTAGAAAGAGTGGCTGCTATTCACCG                                      XbaI
 SF-mdo2                     GAAGATCTGTGCCTGCTTAGCCACATCAT                                      BglII
 SF-rsc1                     GCTCTAGAGATTGAGCACAGTTTACCGGG                                      XbaI
 SF-rsc2                     GAAGATCTCTGACTGCCGATTGTGAAAGC                                      BglII
 SF-ECdam2                   GGAATTCCACAGCCGGAGAAGGTGTA                                         EcoRI
 SF-ECdam5                   GGAATTCCAAAATCAGCCGACAGAATTG                                       EcoRI


http://mic.sgmjournals.org                                                                                                                     2293
    ¨
S. Falker, M. A. Schmidt and G. Heusipp


cycloserine enrichment was used in an effort to isolate CamS SmR          cells were collected, washed twice in LB and resuspended in 1 ml LB.
SpR exconjugants as previously described (Kinder et al., 1993). To        Appropriate dilutions were plated on LB agar, cultivated for 2 days at
show that the dam gene is essential, plasmid pVLT-dam1/2 was              26 uC and viable counts were determined.
transferred to the merodiploid dam+-dam : : V(SmR/SpR) strain, and
CamS exconjugants were enriched by treatment with cycloserine.            Construction of transcriptional fusions. All transcriptional
The presence of the dam : : V(SmR/SpR) genotype on the chromo-            fusions to the lacZ gene were constructed in pFUSE or in pKN8, a
some was analysed by Southern blotting of CamS SmR SpR KanR               pFUSE derivative containing a BglII restriction site instead of the
exconjugants (data not shown). For the complementation experi-                         ¨
                                                                          SmaI site (Baumler et al., 1996). Both vectors contain an R6K origin
ment with the E. coli dam, a 950 bp fragment containing the E. coli       of replication, which is not functional in Y. enterocolitica. Therefore,
dam ORF was amplified by PCR using the primers SF-ECdam2 and               constructs integrate into the chromosome by homologous recombi-
SF-ECdam5 and plasmid pTP166 as template, digested with EcoRI             nation after conjugation to Y. enterocolitica and selection for CamR.
and cloned into the EcoRI-digested vector pVLT33, resulting in plas-      Integration of the plasmids was confirmed by Southern blot analysis
mid pVLT-ECdam2/5. Correct orientation of the insert was con-             (data not shown).
firmed by a restriction enzyme digest. The expression of a functional
E. coli Dam was confirmed in the E. coli dam mutant strain GM2163          For the construction of W(fyuA : : lacZ), W(rscR : : lacZ) and
as described above. Plasmid pVLT-ECdam2/5 was transferred to              W(mdoH : : lacZ) fusion strains, approximately 650 bp fragments
the merodiploid dam+-dam : : V(SmR/SpR) strain by conjugation.            containing the 59 end of the respective gene including the promoter
Subsequently, cycloserine enrichment was used to generate CamS            region were amplified by PCR using the primer pairs SF-fyu1/SF-fyu2,
SmR SpR KanR exconjugants. The presence of the mutant genotype            SF-rsc1/SF-rsc2 and SF-mdo1/SF-mdo2, respectively (Table 2), with
was confirmed by Southern blot analysis and PCR.                           genomic DNA of Y. enterocolitica JB580v as template. The PCR
                                                                          products were digested with BglII and XbaI, and ligated into BglII/
Construction      of plasmids. The high-copy-number plasmid               XbaI-restricted pKN8, resulting in pKN8-fyuA, pKN8-rscR and
pTP166 carries the E. coli dam gene under the control of the Ptac         pKN8-mdoH, respectively, which were subsequently conjugated into
promoter (Marinus et al., 1984). For use in Y. enterocolitica, the bla    Y. enterocolitica JB580v.
gene of pTP166 was removed by digestion with DraI and AatII. A
blunt-ended 2?2 kb EcoRI fragment encoding the kanamycin-                 For the construction of the W(hreP : : lacZ) strain, a 1 kb EcoRV
resistance cassette of pCNB5 (De Lorenzo et al., 1993) was ligated to     fragment of pWSK-4J7opp was ligated into SmaI-digested pFUSE,
the remaining part of pTP166 treated with T4 DNA polymerase,              resulting in pFUSE-hreP. The correct orientation of the insert was
resulting in plasmid pTP166Kan. Plasmid pTP166Kan-damD was                analysed by restriction enzyme digestion. Subsequently, pFUSE-hreP
generated by digestion of pTP166Kan with MluI and EcoRI, treat-           was conjugated into Y. enterocolitica JB580v.
ment with T4 DNA polymerase and religation, thereby deleting a
1?2 kb fragment containing the Ptac promoter and the 59 part of           b-Galactosidase assay experiments. b-Galactosidase assays were
the dam gene. Plasmids were transferred to Y. enterocolitica by           performed as previously described (Miller, 1972). Overnight cultures
electroporation.                                                          grown in LB at 26 uC were diluted 1 : 20 in fresh medium and sub-
                                                                          cultured for 3 h at 26 uC or at 37 uC. The bacterial cells were col-
For the construction of a Y. enterocolitica Dam-overproducing strain,     lected by centrifugation and washed in 0?85 % (w/v) NaCl before
the E. coli dam gene from pTP166 was removed as a 1?2 kb XbaI/PvuII       enzyme activity assays. Enzyme activities are expressed as arbitrary
fragment. The 930 bp KpnI/XbaI fragment containing Y. enterocolitica      Miller units and were averaged from at least three independent
dam from pBS-dam1/2 was treated with T4 DNA polymerase to                 experiments, each performed in triplicate.
produce blunt ends and cloned into the remaining pTP166 frag-
ment, which had been treated with T4 DNA polymerase, resulting in         Tissue culture invasion assays. Invasion assays were performed
pTP166-YEdam. For use in Y. enterocolitica, the kanamycin-resistance      using CHO cells as previously described (Miller & Falkow, 1988). Y.
cassette from pCNB5 (De Lorenzo et al., 1993) was excised as a 2?2 kb     enterocolitica strain JB580c, which is cured of the pYV virulence
EcoRI fragment, treated with T4 DNA polymerase and cloned                 plasmid, carrying either pTP166Kan (GHY151) or pTP166Kan-
into pTP166-YEdam, which had been digested with PstI and treated          damD (GHY148) was grown for 15–18 h at 26 uC before infection.
with T4 DNA polymerase, generating pTP166Kan-YEdam. For use as a          Assays were repeated six times, each in triplicate, and mean results
control plasmid, pTP166Kan-YEdamrev was constructed based on              are reported as percentage invasion [=1006(number of bacteria
pTP166Kan-YEdam by insertion of the dam fragment in the opposite          resistant to gentamicin/initial number of bacteria)] with GHY148
orientation. Plasmids were electroporated into Y. enterocolitica.         referred to as the wild-type.

Analysis of frequencies of spontaneous mutation and of
resistance to 2-aminopurine (2-AP). All assays were performed             RESULTS
in triplicate as previously described (Ostendorf et al., 1999). For the
determination of spontaneous mutation frequencies, appropriate
dilutions of overnight cultures in LB were plated on selective (LB        Sequence and cloning of the Y. enterocolitica
containing 30 mg streptomycin ml21 or 7–10 mg chloramphenicol             dam gene
ml21) and nonselective (viable count) media and incubated at 26 uC
for 2–3 days in the presence of 1 mM IPTG to induce dam expres-
                                                                          The sequence of the E. coli dam gene (Brooks et al., 1983) was
sion from Ptac. The mutation frequency is expressed as the ratio of       used to screen the unfinished Y. enterocolitica genome se-
the number of resistant cells to the number of viable cells.              quence (http://www.sanger.ac.uk/Projects/Y_enterocolitica/).
                                                                          We identified an ORF of 813 bp encoding a protein of
The influence of 2-AP on survival (based on the frequency of               270 amino acids with a calculated molecular mass of
lethal mutations) was determined as described by Ostendorf et al.         31?2 kDa. An alignment of the corresponding protein
(1999) with the following modifications. Overnight cultures of Y.
enterocolitica strains grown in LB at 26 uC were diluted to
                                                                          sequences revealed an identity of 70?6 % to the E. coli
26107 cells ml21. 2-AP was added to 10 ml of culture at final con-         Dam protein. Different conserved motifs involved in
centrations of 0, 10, 50, 100 and 200 mg ml21. The cultures were          S-adenosylmethionine binding and catalysis that have
then incubated with aeration for 3 h at 26 uC before the bacterial        been described for members of the a group of N6-adenine

2294                                                                                                                           Microbiology 151
                                                                                                            Dam of Yersinia enterocolitica


aminomethyltransferases (Malone et al., 1995) are all                   in Y. pseudotuberculosis and Vibrio cholerae (Julio et al.,
present in the Dam protein of Y. enterocolitica in the                  2001). To construct a Y. enterocolitica dam mutant strain,
correct sequential order. A comparison of the Dam sequence              an V(SmR/SpR) cassette was inserted into the unique EcoRI
to entries in databases using the BLAST program (Altschul               site of dam, cloned into pEP185.2 and mated into Y.
et al., 1997) revealed highest homology to Dam of Y. pestis,            enterocolitica JB580v. This led to several merodiploid
Y. pseudotuberculosis and Serratia marcescens (85 %, 85 %,              conjugants with an integrated plasmid. However, despite
and 80 % identity, respectively). The dam gene of Y.                    intense and repeated efforts, a CamS SmR SpR exconjugant
enterocolitica was amplified by PCR and ligated into pBlue-              could never be obtained. This suggested that dam is essen-
scriptIIKS+. The resulting plasmid, pBS-dam1/2, was                     tial and required for growth in Y. enterocolitica, as found
sequenced to confirm the identity of the cloned gene to                  for Y. pseudotuberculosis and V. cholerae. To confirm the
the sequence derived from the database.                                 essentiality of dam, pVLT-dam1/2 was introduced into a
                                                                        merodiploid dam+ dam : : pEP-dam : : V(SmR/SpR) strain.
Complementation of an E. coli dam mutant                                Subsequently, we screened for CamS SmR SpR exconjugants
strain with the Y. enterocolitica dam gene                              in which the second cross-over had occurred, leaving
                                                                        behind dam : : V(SmR/SpR) on the chromosome. When a
To confirm functionality of the cloned dam gene, we                      wild-type copy of the dam gene was provided in trans,
subcloned a 930 bp fragment of pBS-dam1/2 containing the                exconjugants with a V(SmR/SpR) insertion in the chromo-
Y. enterocolitica dam ORF into pVLT33 under the control of              somal dam gene could be generated; 57 % of all chlor-
an inducible Ptac promoter, resulting in pVLT-dam1/2, and               amphenicol-sensitive exconjugants were dam : : V(SmR/SpR)
introduced it into the dam mutant strain E. coli GM2163.                as confirmed by the SmR SpR phenotype, PCR and Southern
Plasmid DNA isolated from E. coli GM2163 carrying either                blot analysis (data not shown). From these data we con-
pVLT33 or pVLT-dam1/2 and grown in the presence of                      clude that dam is an essential gene in Y. enterocolitica as in
IPTG was analysed for DNA methylation by a restriction                  Y. pseudotuberculosis and V. cholerae.
digest with Sau3AI or MboI. Both enzymes recognize
the sequence GATC. While Sau3AI cleaves this sequence
independent of its methylation status, MboI only cleaves                Effect of Dam overproduction on spontaneous
unmethylated DNA. DNA isolated from E. coli GM2163                      mutation frequency and resistance to 2-AP
carrying pVLT-dam1/2 could only be digested with Sau3AI
but not with MboI, indicating methylation of GATC                       In E. coli, strains which lack or overproduce the Dam
sequences, whereas DNA isolated from E. coli GM2163                     enzyme show an increased spontaneous mutation fre-
carrying pVLT33 could be digested with Sau3AI and with                  quency and are sensitive to base analogues like 2-AP. As
MboI, confirming that the cloned DNA fragment from Y.                    dam mutant strains of Y. enterocolitica are not viable,
enterocolitica encodes a protein with DNA adenine methyl-               we investigated the influence of Dam overproduction on
ase activity similar to the Dam enzyme of E. coli.                      mutation avoidance. As an initial control, we inves-
                                                                        tigated whether overproduction of Dam might be detri-
                                                                        mental for growth of Y. enterocolitica. No obvious growth
Dam is essential for viability of
                                                                        defect could be observed in a strain overexpressing dam
Y. enterocolitica
                                                                        from a Ptac promoter during growth from lag through
Dam regulates a variety of physiological processes in the               stationary phase. We then analysed the effect of the Dam
bacterial cell and in addition plays a role in virulence of             enzyme on mutability in Y. enterocolitica. Overproduc-
several enteric bacteria. To analyse the function of Dam in             tion of the Y. enterocolitica Dam enzyme from plasmid
Y. enterocolitica, we attempted to generate a Y. enterocolitica         pTP166Kan-YEdam increased the spontaneous resistance
dam mutant strain. Strains lacking a functional dam gene                to chloramphenicol and streptomycin by a factor of
have been described for E. coli, Salmonella typhimurium,                4?4 and 1?6, respectively, in comparison to control cells
Serratia marcescens and H. influenzae (Bale et al., 1979;                carrying plasmid pTP166Kan-YEdamrev (Table 3). In
Bayliss et al., 2002; Ostendorf et al., 1999; Torreblanca &             addition to the increased spontaneous mutability, Dam-
Casadesus, 1996). However, Dam is essential for viability               overproducing strains of Y. enterocolitica also showed an


Table 3. Spontaneous resistance to antibiotics of strains overproducing Dam of Y. enterocolitica (Y-Dam OP) or E. coli
(E-Dam OP)

 Antibiotic                  Mutation frequency*            OP/WT ratio                Mutation frequency*                OP/WT ratio

                        WT                Y-Dam OP                                   WT               E-Dam OP

 Cam                 4?461025             1?961024                4?4              5?261026           1?161024                 21?2
 Sm                  2?961024             3?161024                1?6              3?361023           1?361021                 39?4

*The data are means of three independent experiments and expressed as percentage of viable counts plated on LB agar without antibiotics.

http://mic.sgmjournals.org                                                                                                            2295
    ¨
S. Falker, M. A. Schmidt and G. Heusipp


                                                                    and Fig. 1, overproduction of the E. coli Dam enzyme
                                                                    from plasmid pTP166Kan in Y. enterocolitica increased
                                                                    the spontaneous resistance of Y. enterocolitica to chlor-
                                                                    amphenicol 21?2-fold and to streptomycin 39?4-fold
                                                                    in comparison to cells carrying the control plasmid
                                                                    pTP166Kan-damD. In addition, the decrease in resistance
                                                                    of Y. enterocolitica to 2-AP was much more pronounced
                                                                    when the E. coli Dam enzyme was overproduced compared
                                                                    to overproduction of the Y. enterocolitica Dam enzyme.
                                                                    A strong decrease in resistance could already be detected
                                                                    at a 2-AP concentration of 10 mg ml21 (compared to
                                                                    >150 mg ml21 when overproducing the Y. enterocolitica
                                                                    Dam). The differences in mismatch repair after over-
                                                                    production of Dam from E. coli or Y. enterocolitica are not
                                                                    due to differences in the expression level, as the expres-
                                                                    sion vectors used differ only in the coding sequences for
                                                                    the respective Dam enzyme. The data are similar to the effect
                                                                    of Dam overproduction in E. coli (Herman & Modrich,
                                                                    1981; Marinus et al., 1984), indicating that the mechani-
                                                                    sms underlying methyl-directed mismatch repair in Y.
                                                                    enterocolitica are different from those in E. coli, potentially
                                                                    due to differences in Dam functionality or activity.
Fig. 1. Effect of 2-AP treatment on survival of Dam-over-
producing and control strains: overproduction of E. coli Dam        Functional complementation of a
(GHY150) or Y. enterocolitica Dam (GHY158) increases sensi-         Y. enterocolitica dam strain by the E. coli dam
tivity to different concentrations of 2-AP. Bacteria were treated   gene in trans
for 3 h with the concentrations of 2-AP indicated. Viable
counts were determined by plating on LB agar. n, GHY157             As dam is an essential gene in Y. enterocolitica but not in
(pTP166Kan-YEdamrev); m, GH158 (pTP166Kan-YEdam); %,                E. coli, and as overproduction of the E. coli Dam enzyme
GHY147 (pTP166Kan-damD); &, GHY150 (pTP166Kan). Data                has a strong effect on spontaneous mutability compared
are means and standard deviations of at least three indepen-        to the Y. enterocolitica Dam enzyme, we were interested in
dent experiments.                                                   determining if the E. coli dam gene is able to complement a
                                                                    dam mutant of Y. enterocolitica. Plasmid pVLT-ECdam2/5
                                                                    carrying the E. coli dam gene under the control of the Ptac
increased sensitivity towards 2-AP at concentrations above          promoter was introduced into the merodiploid dam+-
150 mg ml21 (Fig. 1). However, in comparison to the effects         dam : : V(SmR/SpR) Y. enterocolitica strain GHY121. As
reported in E. coli and Serratia marcescens (Glickman, 1979;        already shown for the complementation with the Y. entero-
Ostendorf et al., 1999), the increase in sensitivity towards        colitica dam gene, CamS SmR SpR exconjugants could be
2-AP related to Dam overproduction appears to be only               obtained. All chloramphenicol-sensitive exconjugants
marginal.                                                           were dam : : V(SmR/SpR) as confirmed by the SmR SpR
                                                                    phenotype, PCR and Southern blot analysis (data not
                                                                    shown). From these data we conclude that the essentiality
Overproduction of the E. coli Dam enzyme in                         of Dam in Y. enterocolitica is not due to different activities
Y. enterocolitica has effects on spontaneous                        in mismatch repair in comparison to Dam of E. coli. Instead,
mutation frequency and 2-AP resistance                              Dam is essential as an altered methylation pattern of GATC
comparable to Dam overproduction in E. coli                         sequences in promoters interferes with the proper expres-
                                                                    sion of essential genes in Y. enterocolitica, while in E. coli
A dam mutant strain of H. influenzae is not hyper-                   different subsets of (non-essential) genes are expressed in a
mutable and it was therefore suggested that mismatch                Dam-dependent fashion.
repair in H. influenzae might be different from that in E. coli
(Bayliss et al., 2002; Watson et al., 2004). Therefore we
                                                                    The expression of hre loci is not influenced by
hypothesized that the relatively small effect due to Dam
                                                                    Dam overproduction
overproduction on the spontaneous mutation frequency
and on 2-AP resistance in Y. enterocolitica might reflect            Multiple aspects of virulence of various enteric pathogens
differences in the role of Dam in mismatch repair compared          are influenced by the expression of Dam (Chen et al., 2003;
to the E. coli model. To analyse this in more detail, we            Low et al., 2001; Watson et al., 2004). As it was shown by
overproduced the E. coli Dam enzyme in Y. enterocolitica,           Heithoff et al. (1999) that the expression of at least 20 genes
expecting to see differences in comparison to overproduc-           identified as induced during an infection (the so-called
ing the Y. enterocolitica Dam. Indeed, as shown in Table 3          in vivo-induced or ivi genes) is altered in a dam mutant

2296                                                                                                              Microbiology 151
                                                                                                            Dam of Yersinia enterocolitica


Table 4. Expression of specifically in vivo-expressed genes (hre genes) in a Dam over-
producing (OP) and a wild-type (WT) strain of Y. enterocolitica

 hre gene         Expression at 26 6C (Miller units)*           Expression at 37 6C (Miller units)*

                      WT                     OP                     WT                     OP

 fyuA              1648±966               1714±588               2333±767               2674±880
 hreP                57±7                   44±4                   43±4                   39±5
 mdoH                81±11                  70±5                   94±6                  105±9
 rpoE              1358±126               1186±88                1076±57                1180±186
 rscR               406±22                 345±64                 589±82                 567±82

*The data are means and standard deviations of at least three independent experiments, each performed in
triplicate.


strain of Salmonella typhimurium, we were particularly                   pseudotuberculosis, V. cholerae and H. influenzae (Garcia-Del
interested in the effect of Dam overproduction on expres-                Portillo et al., 1999; Heithoff et al., 1999; Julio et al., 2001;
sion of hre loci of Y. enterocolitica specifically expressed              Watson et al., 2004). In this study we describe the cloning
during an infection in the mouse model of yersiniosis                    of the Y. enterocolitica dam gene. We show that dam is
(Young & Miller, 1997). We used transcriptional fusions                  essential for viability and is involved in mutation avoidance
of the lacZ gene to the hre genes rpoE, hreP, rscR, mdoH                 and regulation of virulence factors.
and fyuA, and analysed their expression after overproduc-
tion of Dam. These fusions were chosen as they represent                 The dam gene was identified in the unfinished sequence of
genes involved in various aspects of virulence of Yersinia               Y. enterocolitica by identity to the E. coli dam gene. The
and other pathogens (RpoE is an extracytoplasmic func-                   genes share an identity of 67 %, which is even more
tion sigma factor; HreP is a protease; RscR is a regulator               pronounced at the protein level (70?6 %). Conserved motifs
involved in systemic dissemination of Y. enterocolitica; MdoH            of aminomethyltransferases are present in the correct
is involved in biosynthesis of membrane-derived oligosac-                sequential order, placing Dam of Y. enterocolitica in the a
charides; FyuA is an iron siderophore receptor). As shown in             group of N6-adenine aminomethyltransferases (Malone
Table 4, overproduction of Dam had no significant effect on               et al., 1995). The complementation of an E. coli dam
the expression of the hre genes investigated. We conclude                mutant with dam of Y. enterocolitica implies a functional
from these data that Dam overproduction has no general                   homology between the two Dam proteins, as the dam
regulatory effect on the expression of the in vivo-expressed             strain retained its ability to methylate adenine in GATC
genes of Y. enterocolitica analysed here.                                sequences. Moreover, overproduction of the E. coli Dam
                                                                         protein in Y. enterocolitica affects the spontaneous muta-
Dam overproduction leads to increased invasion                           tion frequency and the resistance to the base analogue
of Y. enterocolitica into eukaryotic cells                               2-AP, comparable to the effect of Dam overproduction in
A characteristic virulence-associated phenotype of Y.                    E. coli. However, the effect is less pronounced when the Y.
enterocolitica, which can be analysed by an in vitro assay,              enterocolitica Dam is overproduced, indicating similarities
is the invasion of eukaryotic cells. In Salmonella, a dam                as well as differences in methyl-directed mismatch repair
mutant strain showed a reduced capacity to invade epithelial             between E. coli and Y. enterocolitica. This is in agreement
cells (Garcia-Del Portillo et al., 1999). This prompted us to            with previous data obtained from H. influenzae, where a
analyse the invasion of a Dam-overproducing Y. entero-                   dam mutant strain showed no significant difference in
colitica strain into CHO cells. The invasion of the Dam-                 mutation frequency from the wild-type (Bayliss et al., 2002;
overproducing strain increased twofold compared to the                   Watson et al., 2004). Data from studies on the methyl-
control strain (GHY151, 19?5±8?6 % invasion; GHY148,                     directed mismatch repair in E. coli as a model organism
9?7±3?8 % invasion), indicating that Dam methylation                     cannot be transferred in every detail to other species. Even
enhances the invasion of Y. enterocolitica into epithelial cells.        in Shigella flexneri, a phylogenetically very close relative of
                                                                         E. coli, a dam mutant strain has a 1000-fold increased
                                                                         spontaneous mutation frequency compared to 20- to 80-
DISCUSSION                                                               fold in E. coli (Honma et al., 2004). Obviously, although
DNA adenine methylation regulates a variety of physio-                   bacteria use similar mechanisms of methyl-directed mis-
logical processes in the bacterial cell, including replica-              match repair, the exact function or activity of Dam on the
tion, mismatch repair and gene expression (Marinus,                      molecular level in this process differs between bacterial
1996). More recently it has become evident that Dam                      species. This needs to be analysed in more detail to gain a
plays an important role in the pathogenesis of several                   better understanding of the role of DNA methylation in
bacterial species, including Salmonella typhimurium, Y.                  mutation avoidance.

http://mic.sgmjournals.org                                                                                                          2297
    ¨
S. Falker, M. A. Schmidt and G. Heusipp


In Y. pseudotuberculosis and V. cholerae, Dam is essential           it will be interesting to analyse tissue colonization and
for growth (Julio et al., 2001). However, overproduction of          virulence of a Dam-overproducing strain of Y. enterocolitica
Dam does not lead to a detectable growth defect. This is             in the mouse model of infection.
also true for Dam of Y. enterocolitica. Interestingly, a dam
mutant strain could be constructed in E. coli, Salmonella            As we used pYV-cured strains for the invasion assay, we can
typhimurium, Serratia marcescens and H. influenzae (Bayliss           exclude that the effect of Dam overproduction on inva-
et al., 2002; Marinus & Morris, 1973; Marinus et al., 1983;          sion depends on the virulence plasmid encoded invasin
Ostendorf et al., 1999; Torreblanca & Casadesus, 1996). It           YadA, implying that Dam acts on a chromosomally encoded
remains to be determined why Dam is essential for viability          invasin like Inv or Ail. This will be addressed in future
in some c-proteobacteria, but not in others. The phenotype           experiments together with a molecular analysis of regulatory
of an E. coli dam strain is pleiotropic (Marinus, 1996;              mechanisms underlying the phenotype.
Oshima et al., 2002). Although this has not been studied in
detail, it probably also holds true for other bacteria, and
therefore it cannot be easily determined which function              ACKNOWLEDGEMENTS
affected by Dam is important for viability in one bacterial          We thank M. G. Marinus for plasmid pTP166 and G. M. Young for
species but not in others. Our studies imply that the role of        constructing pFUSE-hreP. This work was supported by Innovative
Dam in methyl-directed mismatch repair is not the reason             Medical Research grants (IMF: HE120201, HE110401) of the Medical
for essentiality in Y. enterocolitica, although its activity or                                    ¨
                                                                     School of the University of Munster and in part by grants of the
function seems to be different in this process compared to           Deutsche Forschungsgemeinschaft (DFG SFB293/B5, SCHM770/10).
E. coli. Rather, our data imply that GATC methylation
affects the expression of different subsets of genes in
different species, and that some or at least one gene(s)             REFERENCES
affected in Y. enterocolitica, and putatively also in Y.             Altschul, S. F., Madden, T. L., Schaffer, A. A., Zhang, J., Zhang, Z.,
pseudotuberculosis and V. cholerae, are essential for growth.        Miller, W. & Lipman, D. J. (1997). Gapped BLAST and PSI-BLAST: a
                                                                     new generation of protein database search programs. Nucleic Acids
Besides physiological functions in mutation avoidance and            Res 25, 3389–3402.
regulation of replication, Dam is also involved in the               Bale, A., d’Alarcao, M. & Marinus, M. G. (1979). Characterization of
regulation of virulence-associated genes of diverse human,           DNA adenine methylation mutants of Escherichia coli K12. Mutat Res
animal and plant pathogens (Chen et al., 2003; Heithoff              59, 157–165.
et al., 1999; Julio et al., 2001; Low et al., 2001; Watson et al.,    ¨
                                                                     Baumler, A. J., Tsolis, R. M., van der Velden, A. W., Stojiljkovic, I.,
2004). In an initial approach to study the effect of Dam on          Anic, S. & Heffron, F. (1996). Identification of a new iron regulated
virulence gene expression in Y. enterocolitica, the specifically      locus of Salmonella typhi. Gene 183, 207–213.
in vivo-expressed genes (hre genes) fyuA, hreP, mdoH, rpoE,          Bayliss, C. D., van de Ven, T. & Moxon, E. R. (2002). Mutations in
and rscR (Young & Miller, 1997) were analysed in wild-               polI but not mutSLH destabilize Haemophilus influenzae tetranucleo-
                                                                     tide repeats. EMBO J 21, 1465–1476.
type and Dam-overproducing strains for differences in
expression, as expression of in vivo-induced genes (ivi) of          Bolker, M. & Kahmann, R. (1989). The Escherichia coli regulatory
                                                                     protein OxyR discriminates between methylated and unmethylated
Salmonella typhimurium was influenced by DNA adenine                  states of the phage Mu mom promoter. EMBO J 8, 2403–2410.
methylation (Heithoff et al., 1999). Interestingly, in contrast
                                                                     Braaten, B. A., Nou, X., Kaltenbach, L. S. & Low, D. A. (1994).
to Salmonella, disturbance of the DNA methylation pattern            Methylation patterns in pap regulatory DNA control pyelonephritis-
had no effect on expression of the hre genes examined,               associated pili phase variation in E. coli. Cell 76, 577–588.
indicating involvement of different regulatory mechanisms            Brooks, J. E., Blumenthal, R. M. & Gingeras, T. R. (1983). The
in expression of in vivo-induced genes in Y. enterocolitica          isolation and characterization of the Escherichia coli DNA adenine
and Salmonella typhimurium. Alternatively, the lack of an            methylase (dam) gene. Nucleic Acids Res 11, 837–851.
effect of Dam overproduction on hre expression in Y. entero-         Chen, L., Paulsen, D. B., Scruggs, D. W., Banes, M. M., Reeks, B. Y.
colitica might also be due to the relatively small number of         & Lawrence, M. L. (2003). Alteration of DNA adenine methylase
hre genes in comparison to the ivi genes analysed in the             (Dam) activity in Pasteurella multocida causes increased spontaneous
Salmonella study (Heithoff et al., 1999).                            mutation frequency and attenuation in mice. Microbiology 149,
                                                                     2283–2290.
The effect of Dam overproduction on invasion of epithelial           De Lorenzo, V., Eltis, L., Kessler, B. & Timmis, K. N. (1993). Analysis
cells shows that in Y. enterocolitica not only is Dam involved       of Pseudomonas gene products using lacIq/Ptrp-lac plasmids and
in physiological processes like mismatch repair and muta-            transposons that confer conditional phenotypes. Gene 123, 17–24.
tion avoidance, but DNA methylation also influences                   Dueger, E. L., House, J. K., Heithoff, D. M. & Mahan, M. J. (2001).
                                                                     Salmonella DNA adenine methylase mutants elicit protective
virulence factor expression. In previous studies with Y.
                                                                     immune responses to homologous and heterologous serovars in
pseudotuberculosis, a Dam-overproducing strain did not               chickens. Infect Immun 69, 7950–7954.
colonize mucosal tissues of mice differently from the wild-          Dueger, E. L., House, J. K., Heithoff, D. M. & Mahan, M. J.
type (Julio et al., 2002). This might imply that invasion is         (2003). Salmonella DNA adenine methylase mutants elicit early and
not changed in Y. pseudotuberculosis or that this pheno-             late onset protective immune responses in calves. Vaccine 21,
type is not detectable under in vivo conditions. Therefore           3249–3258.

2298                                                                                                                     Microbiology 151
                                                                                                                  Dam of Yersinia enterocolitica


Garcia-Del Portillo, F., Pucciarelli, M. G. & Casadesus, J. (1999).        Malone, T., Blumenthal, R. M. & Cheng, X. (1995). Structure-guided
DNA adenine methylase mutants of Salmonella typhimurium show               analysis reveals nine sequence motifs conserved among DNA amino-
defects in protein secretion, cell invasion, and M cell cytotoxicity.      methyltransferases, and suggests a catalytic mechanism for these
Proc Natl Acad Sci U S A 96, 11578–11583.                                  enzymes. J Mol Biol 253, 618–632.
Geier, G. E. & Modrich, P. (1979). Recognition sequence of the Dam         Marinus, M. G. (1996). Methylation of DNA. In Escherichia coli and
methylase of Escherichia coli K12 and mode of cleavage of DpnI             Salmonella: Cellular and Molecular Biology, pp. 782–791. Edited by
endonuclease. J Biol Chem 254, 1408–1413.                                  F. C. Neidhardt and others. Washington, DC: American Society for
Glickman, B. W. (1979). Spontaneous mutagenesis in Escherichia coli        Microbiology.
strains lacking 6-methyladenine residues in their DNA: an altered          Marinus, M. G. & Morris, N. R. (1973). Isolation of deoxyribonucleic
mutational spectrum in dam- mutants. Mutat Res 61, 153–162.                acid methylase mutants of Escherichia coli K-12. J Bacteriol 114,
Glickman, B., van den Elsen, P. & Radman, M. (1978). Induced               1143–1150.
mutagenesis in dam2 mutants of Escherichia coli: a role for 6-             Marinus, M. G. & Morris, N. R. (1974). Biological function for 6-
methyladenine residues in mutation avoidance. Mol Gen Genet 163,           methyladenine residues in the DNA of Escherichia coli K12. J Mol
307–312.                                                                   Biol 85, 309–322.
Heithoff, D. M., Sinsheimer, R. L., Low, D. A. & Mahan, M. J. (1999).      Marinus, M. G., Carraway, M., Frey, A. Z., Brown, L. & Arraj, J. A.
An essential role for DNA adenine methylation in bacterial virulence.      (1983). Insertion mutations in the dam gene of Escherichia coli K-12.
Science 284, 967–970.                                                      Mol Gen Genet 192, 288–289.
Heithoff, D. M., Enioutina, E. Y., Daynes, R. A., Sinsheimer, R. L.,       Marinus, M. G., Poteete, A. & Arraj, J. A. (1984). Correlation of
Low, D. A. & Mahan, M. J. (2001). Salmonella DNA adenine                   DNA adenine methylase activity with spontaneous mutability in
methylase mutants confer cross-protective immunity. Infect Immun           Escherichia coli K-12. Gene 28, 123–125.
69, 6725–6730.
                                                                           Miller, J. H. (1972). Experiments in Molecular Genetics. Cold Spring
Herman, G. E. & Modrich, P. (1981). Escherichia coli K-12 clones that      Harbor, NY: Cold Spring Harbor Laboratory.
overproduce Dam methylase are hypermutable. J Bacteriol 145,
                                                                           Miller, V. L. & Falkow, S. (1988). Evidence for two genetic loci in
644–646.
                                                                           Yersinia enterocolitica that can promote invasion of epithelial cells.
Hernday, A., Krabbe, M., Braaten, B. & Low, D. (2002). Self-               Infect Immun 56, 1242–1248.
perpetuating epigenetic pili switches in bacteria. Proc Natl Acad Sci
U S A 99, 16470–16476.                                                     Miller, V. L. & Mekalanos, J. J. (1988). A novel suicide vector and its
                                                                           use in construction of insertion mutations: osmoregulation of outer
Heusipp, G., Young, G. M. & Miller, V. L. (2001). HreP, an in vivo-        membrane proteins and virulence determinants in Vibrio cholerae
expressed protease of Yersinia enterocolitica, is a new member of the      requires toxR. J Bacteriol 170, 2575–2583.
family of subtilisin/kexin-like proteases. J Bacteriol 183, 3556–3563.
                                                                           Modrich, P. (1987). DNA mismatch correction. Annu Rev Biochem
Heusipp, G., Schmidt, M. A. & Miller, V. L. (2003). Identification of
                                                                           56, 435–466.
rpoE and nadB as host responsive elements of Yersinia enterocolitica.
FEMS Microbiol Lett 226, 291–298.                                          Nelson, K. M., Young, G. M. & Miller, V. L. (2001). Identification of a
                                                                           locus involved in systemic dissemination of Yersinia enterocolitica.
Honma, Y., Fernandez, R. E. & Maurelli, A. T. (2004). A DNA
                                                                           Infect Immun 69, 6201–6208.
adenine methylase mutant of Shigella flexneri shows no significant
attenuation of virulence. Microbiology 150, 1073–1078.                     Oshima, T., Wada, C., Kawagoe, Y., Ara, T., Maeda, M., Masuda, Y.,
                                                                           Hiraga, S. & Mori, H. (2002). Genome-wide analysis of deoxy-
Julio, S. M., Heithoff, D. M., Provenzano, D., Klose, K. E.,
                                                                           adenosine methyltransferase-mediated control of gene expression in
Sinsheimer, R. L., Low, D. A. & Mahan, M. J. (2001). DNA adenine
                                                                           Escherichia coli. Mol Microbiol 45, 673–695.
methylase is essential for viability and plays a role in the
pathogenesis of Yersinia pseudotuberculosis and Vibrio cholerae.           Ostendorf, T., Cherepanov, P., de Vries, J. & Wackernagel,
Infect Immun 69, 7610–7615.                                                W. (1999). Characterization of a dam mutant of Serratia mar-
                                                                           cescens and nucleotide sequence of the dam region. J Bacteriol 181,
Julio, S. M., Heithoff, D. M., Sinsheimer, R. L., Low, D. A. & Mahan,
                                                                           3880–3885.
M. J. (2002). DNA adenine methylase overproduction in Yersinia
pseudotuberculosis alters YopE expression and secretion and host           Sternberg, N. (1985). Evidence that adenine methylation influences
immune responses to infection. Infect Immun 70, 1006–1009.                 DNA–protein interactions in Escherichia coli. J Bacteriol 164,
Kinder, S. A., Badger, J. L., Bryant, G. O., Pepe, J. C. & Miller, V. L.   490–493.
(1993). Cloning of the YenI restriction endonuclease and methyl-           Torreblanca, J. & Casadesus, J. (1996). DNA adenine methylase
transferase from Yersinia enterocolitica serotype O : 8 and construc-      mutants of Salmonella typhimurium and a novel dam-regulated
tion of a transformable R2M+ mutant. Gene 136, 271–275.                    locus. Genetics 144, 15–26.
Low, D. A., Weyand, N. J. & Mahan, M. J. (2001). Roles of DNA              Watson, M. E., Jr, Jarisch, J. & Smith, A. L. (2004). Inactivation of
adenine methylation in regulating bacterial gene expression and            deoxyadenosine methyltransferase (dam) attenuates Haemophilus
virulence. Infect Immun 69, 7197–7204.                                     influenzae virulence. Mol Microbiol 53, 651–664.
Lu, M., Campbell, J. L., Boye, E. & Kleckner, N. (1994). SeqA: a           Young, G. M. & Miller, V. L. (1997). Identification of novel
negative modulator of replication initiation in E. coli. Cell 77,          chromosomal loci affecting Yersinia enterocolitica pathogenesis.
413–426.                                                                   Mol Microbiol 25, 319–328.




http://mic.sgmjournals.org                                                                                                                  2299

						
Related docs