DNA methylation in Yersiniaenterocolitica role of the
Document Sample


Microbiology (2005), 151, 2291–2299 DOI 10.1099/mic.0.27946-0
DNA methylation in Yersinia enterocolitica: role of
the DNA adenine methyltransferase in mismatch
repair and regulation of virulence factors
¨
Stefan Falker, M. Alexander Schmidt and Gerhard Heusipp
Correspondence Institut fur Infektiologie, Zentrum fur Molekularbiologie der Entzundung (ZMBE),
¨ ¨ ¨
Gerhard Heusipp ¨
Universitatsklinikum Munster, von-Esmarch-Str. 56, 48149 Munster, Germany
¨ ¨
heusipp@uni-muenster.de
DNA adenine methyltransferase (Dam) plays an important role in physiological processes of
Gram-negative bacteria such as mismatch repair and replication. In addition, Dam regulates the
expression of virulence genes in various species. The authors cloned the dam gene of Yersinia
enterocolitica and showed that Dam is essential for viability. Dam overproduction in Y. enterocolitica
resulted in an increased frequency of spontaneous mutation and decreased resistance to
2-aminopurine; however, these effects were only marginal compared to the effect of overproduction
of Escherichia coli-derived Dam in Y. enterocolitica, implying different roles or activities of
Dam in mismatch repair of the two species. These differences in Dam function are not the cause
for the essentiality of Dam in Y. enterocolitica, as Dam of E. coli can complement a dam defect
in Y. enterocolitica. Instead, Dam seems to interfere with expression of essential genes.
Received 4 February 2005 Furthermore, Dam mediates virulence of Y. enterocolitica. Dam overproduction results in increased
Revised 21 March 2005 tissue culture invasion of Y. enterocolitica, while the expression of specifically in vivo-expressed
Accepted 24 March 2005 genes is not altered.
INTRODUCTION of uropathogenic E. coli that mediates adhesion to
uroepithelial cells. The expression of Pap pili is subject to
In Escherichia coli, the Dam enzyme (DNA adenine methyl-
phase variation, which occurs without a DNA sequence
transferase, encoded by the dam gene) catalyses the methyl-
change. Instead, the methylation pattern of two GATC sites
ation of adenine at the N6 position in GATC sequences
proximal to the papBA promoter influences the binding
of double-stranded DNA (Geier & Modrich, 1979). Many
of the regulatory proteins Lrp and PapI, which correlates
important physiological processes such as DNA replication,
with the ON and the OFF stage of pilus expression (Hernday
methyl-directed mismatch repair and transposition are
et al., 2002).
regulated in E. coli by Dam-mediated DNA methylation
(Marinus, 1996). During replication, delayed methylation of Mutants of Salmonella typhimurium lacking the Dam
newly synthesized DNA at the replication fork results in enzyme are avirulent in mice, suggesting a role for DNA
temporarily hemimethylated DNA, which is required for adenine methylation in virulence of this pathogen. Dam is
parental strand-directed mismatch repair (Modrich, 1987). involved in the regulation of a subset of specifically in vivo
Therefore, dam mutant strains as well as strains over- induced (ivi) genes. The expression of more than 20 ivi
producing the Dam enzyme show increased spontaneous genes was significantly repressed in Salmonella dam mutant
mutability and sensitivity to base analogues and other strains (Heithoff et al., 1999). Furthermore, the dam mutant
mutagens (Glickman et al., 1978; Herman & Modrich, 1981; strain was unable to disseminate to deeper tissues in mice
Marinus & Morris, 1974). In addition to the role in mis- and could be successfully used as a live vaccine against
match repair, changes in DNA methylation can alter the salmonellosis in different animal models (Dueger et al.,
affinity of regulatory proteins to DNA target sites; con- 2001, 2003; Garcia-Del Portillo et al., 1999; Heithoff et al.,
versely, DNA-binding proteins can inhibit methylation of 1999, 2001). Recently it was shown that the pathogenicity
specific DNA sequences. Both mechanisms may lead to of Vibrio cholerae, Yersinia pseudotuberculosis, Pasteurella
alterations in gene expression (Bolker & Kahmann, 1989; multocida and Haemophilus influenzae is also affected
Braaten et al., 1994; Lu et al., 1994; Sternberg, 1985). One of by DNA adenine methylation. As in Salmonella, Dam-
the best-studied examples for regulation of gene expression overproducing strains of Y. pseudotuberculosis confer
by DNA methylation patterns is the Pap pilus expression protective immunity in mice. Additionally, Dam over-
production leads to expression and secretion of Yop viru-
Abbreviations: Dam, DNA adenine methyltransferase; 2-AP, 2-amino- lence proteins under non-permissive conditions (Chen et al.,
purine. 2003; Julio et al., 2001, 2002; Watson et al., 2004).
0002-7946 G 2005 SGM Printed in Great Britain 2291
¨
S. Falker, M. A. Schmidt and G. Heusipp
Table 1. Bacterial strains and plasmids
Strain or plasmid Genotype Source or reference
Y. enterocolitica
JB580v DyenR(r2 m+) Nalr, pYV+ Kinder et al. (1993)
GHY15 hreP : : lacZYA This study
GHY29 rpoE : : lacZYA Heusipp et al. (2003)
GHY121 dam+ : : pEP-dam : : V(SmR/SpR) This study
GHY125 dam+ : : pEP-dam : : V(SmR/SpR), pVLT-dam1/2 This study
GHY128 fyuA : : lacZYA This study
GHY129 mdoH : : lacZYA This study
GHY130 rscR : : lacZYA This study
GHY137 fyuA : : lacZYA, pTP166Kan-damD This study
GHY138 hreP : : lacZYA, pTP166Kan This study
GHY139 hreP : : lacZYA, pTP166Kan-damD This study
GHY140 mdoH : : lacZYA, pTP166Kan This study
GHY141 mdoH : : lacZYA, pTP166Kan-damD This study
GHY142 rpoE : : lacZYA, pTP166Kan This study
GHY143 rpoE : : lacZYA, pTP166Kan-damD This study
GHY144 rscR : : lacZYA, pTP166Kan This study
GHY145 rscR : : lacZYA, pTP166Kan-damD This study
GHY146 fyuA : : lacZYA, pTP166Kan This study
GHY147 JB580v, pTP166Kan-damD This study
GHY148 GHY147, pYV2 This study
GHY150 JB580v, pTP166Kan This study
GHY151 GHY150, pYV2 This study
GHY157 JB580v, pTP166Kan-YEdamrev This study
GHY158 JB580v, pTP166Kan-YEdam This study
GHY226 dam : : pEP-damV(SmR/SpR), pVLT-ECdam2/5 This study
E. coli
DH5a w80dD(lacZ)M15 D(argF–lac)U169 endA1 recA1 hsdR17(r{ mz )
k k Gibco-BRL
deoR thi-1 supE44 gyrA96 relA1
S17-1lpir TpR SmR recA thi pro hsdR M+ RP4 : : 2-Tc : : Mu : : Km Tn7lpir Miller & Mekalanos (1988)
lysogen
GM2163 F2 ara-14 leuB6 fhuA31 lacY1 tsx78 glnV44 galK2 galT22 mcrA Marinus et al. (1983)
dcm-6 hisG4 rfbD1 rps136(StrR) dam13 : : Tn9 (CamR) xylA5
mtl-1 thi-1 mcrB1 hsdR2
GHE131 DH5a, pBS-dam1/2 This study
GHE134 GM2163, pVLT33 This study
GHE135 GM2163, pVLT-dam1/2 This study
Plasmids
pBluescriptIIKS+ Ampr, high-copy-number cloning vector Stratagene
pVLT33 KanR, Ptac expression vector, RSF1010 ori De Lorenzo et al. (1993)
pEP185.2 CamR, mob+ (RP4), R6K ori (suicide vector) Kinder et al. (1993)
pFUSE CamR, mob+ (RP4), R6K ori, lacZYA operon fusion suicide vector ¨
Baumler et al. (1996)
pSmUC AmpR SmR SpR, V(SmR/SpR) in pUC129 Nelson et al. (2001)
pTP166 AmpR, high-copy-number expression vector, E. coli dam under Ptac Marinus et al. (1984)
control
pBS-dam1/2 Y. enterocolitica dam in pBluescriptIIKS+, AmpR This study
pWSK-4J7opp Derivative of pGY50 with hreP fragment in opposite orientation, Heusipp et al. (2001)
AmpR
pVLT-dam1/2 Y. enterocolitica dam in pVLT33, KanR This study
pVLT-ECdam2/5 E. coli dam in pVLT33, KanR This study
pEP-dam : : V(SmR/SpR) Y. enterocolitica dam : : V(SmR/SpR) in pEP185.2, CamR SmR SpR This study
pTP166Kan KanR derivative (AmpS) of pTP166 This study
pTP166Kan-damD dam derivative of pTP166Kan This study
2292 Microbiology 151
Dam of Yersinia enterocolitica
Table 1. cont.
Strain or plasmid Genotype Source or reference
R S
pTP166Kan-YEdam Kan derivative (Amp ) of pTP166, Y. enterocolitica dam under Ptac This study
control
pTP166Kan-YEdamrev KanR derivative (AmpS) of pTP166, contains Y. enterocolitica dam in This study
reverse orientation
pFUSE-hreP pFUSE with hreP : : lacZYA This study
pKN8-fyuA pKN8 with fyuA : : lacZYA This study
pKN8-mdoH pKN8 with mdoH : : lacZYA This study
pKN8-rscR pKN8 with rscR : : lacZYA This study
Although a role for Dam in the regulation of virulence Cloning and sequencing of the Y. enterocolitica dam gene.
has been described for various pathogens, the underly- To clone the putative dam gene of Y. enterocolitica, a 930 bp
fragment was amplified by PCR using the primers GH-dam1 and
ing molecular mechanisms and regulatory networks have
GH-dam2 (Table 2), digested with KpnI and XbaI and ligated into
mainly been analysed in E. coli. We cloned the dam gene KpnI/XbaI-digested pBluescriptIIKS+. To confirm the identity of
of the human-pathogenic bacterium Y. enterocolitica in an the cloned DNA to the sequence derived from the unfinished
initial effort to characterize the role of DNA methylation Y. enterocolitica genome project (http://www.sanger.ac.uk/Projects/
in Y. enterocolitica compared to the E. coli model and in Y_enterocolitica/), the resulting plasmid pBS-dam1/2 was sequenced
virulence gene expression. We show that in contrast to E. using standard primers (Eurogentec).
coli, Dam is essential for growth in Y. enterocolitica. This is
Complementation of an E. coli dam mutant strain. A 930 bp
possibly linked to an altered expression of essential genes,
KpnI/XbaI fragment of pBS-dam1/2 containing the dam ORF was
but not to Dam’s role in mismatch repair. Initial experi- isolated and subcloned into pVLT33. The resulting plasmid, pVLT-
ments support the anticipated role of Dam in virulence dam1/2, and pVLT33 as a control plasmid were transferred into the
factor expression in Y. enterocolitica. Our studies contribute E. coli dam mutant strain GM2163 by electroporation. After induc-
to the elucidation of the multifaceted role of DNA methyl- tion of dam expression from the Ptac promoter, the plasmids were
ation in Y. enterocolitica. reisolated and digested with MboI and Sau3AI. The resulting frag-
ments were analysed by 1 % agarose gel electrophoresis.
METHODS Construction of mutant strains. For the construction of a Y.
enterocolitica dam mutant strain, a 2 kb EcoRI fragment encoding
Bacterial strains, plasmids and growth conditions. Bacterial the V(SmR/SpR) cassette of pSmUC was ligated into the unique
strains and plasmids used in this study are listed in Table 1. Unless EcoRI site of the dam gene in pBS-dam1/2, resulting in pBS-
otherwise indicated, all strains were grown in Luria–Bertani (LB) dam : : Sm. This plasmid was used as a template in a PCR to amplify
broth or on agar plates, at 26 uC for Y. enterocolitica or 37 uC for E. a dam : : V(SmR/SpR) fragment using the primers GH-dam1 and
coli. Antibiotics were used at the following final concentrations: for GH-dam2, and Pfu polymerase. The PCR product was phosphory-
Y. enterocolitica, nalidixic acid (Nal; 20 mg ml21), kanamycin (Kan; lated by polynucleotide kinase and ligated into the SmaI site of
100 mg ml21), chloramphenicol (Cam; 12?5 mg ml21), spectino- pEP185.2 (Kinder et al., 1993), resulting in pEP-dam : : V(SmR/SpR).
mycin (Sp; 50 mg ml21) and streptomycin (Sm; 50 mg ml21); for This suicide plasmid was transferred to Y. enterocolitica JB580v by
E. coli, ampicillin (Amp; 100 mg ml21), kanamycin (50 mg ml21), conjugation and integrated into the chromosome by homologous
chloramphenicol (25 mg ml21), spectinomycin (50 mg ml21) and recombination after selection for chloramphenicol and streptomycin
streptomycin (50 mg ml21). When appropriate, 1 mM IPTG was resistance. The result was a merodiploid dam+-dam : : V(SmR/SpR)
used to induce expression of genes under Ptac control. strain. This was confirmed by Southern blot analysis. Subsequently,
Table 2. Oligonucleotides
Oligo Sequence (5§R3§), restriction sites underlined Restriction site
GH-dam1 GGGGTACCCGGCTCTGAATTATTAAGTAG KpnI
GH-dam2 GCTCTAGAATCTCTTTGTTTTATGAGGGCG XbaI
SF-fyu1 GCTCTAGATGCTGAAGTGGAATCGGCACT XbaI
SF-fyu2 GAAGATCTGCCGAGCGGGAAGATTGTTTA BglII
SF-mdo1 GCTCTAGAAAGAGTGGCTGCTATTCACCG XbaI
SF-mdo2 GAAGATCTGTGCCTGCTTAGCCACATCAT BglII
SF-rsc1 GCTCTAGAGATTGAGCACAGTTTACCGGG XbaI
SF-rsc2 GAAGATCTCTGACTGCCGATTGTGAAAGC BglII
SF-ECdam2 GGAATTCCACAGCCGGAGAAGGTGTA EcoRI
SF-ECdam5 GGAATTCCAAAATCAGCCGACAGAATTG EcoRI
http://mic.sgmjournals.org 2293
¨
S. Falker, M. A. Schmidt and G. Heusipp
cycloserine enrichment was used in an effort to isolate CamS SmR cells were collected, washed twice in LB and resuspended in 1 ml LB.
SpR exconjugants as previously described (Kinder et al., 1993). To Appropriate dilutions were plated on LB agar, cultivated for 2 days at
show that the dam gene is essential, plasmid pVLT-dam1/2 was 26 uC and viable counts were determined.
transferred to the merodiploid dam+-dam : : V(SmR/SpR) strain, and
CamS exconjugants were enriched by treatment with cycloserine. Construction of transcriptional fusions. All transcriptional
The presence of the dam : : V(SmR/SpR) genotype on the chromo- fusions to the lacZ gene were constructed in pFUSE or in pKN8, a
some was analysed by Southern blotting of CamS SmR SpR KanR pFUSE derivative containing a BglII restriction site instead of the
exconjugants (data not shown). For the complementation experi- ¨
SmaI site (Baumler et al., 1996). Both vectors contain an R6K origin
ment with the E. coli dam, a 950 bp fragment containing the E. coli of replication, which is not functional in Y. enterocolitica. Therefore,
dam ORF was amplified by PCR using the primers SF-ECdam2 and constructs integrate into the chromosome by homologous recombi-
SF-ECdam5 and plasmid pTP166 as template, digested with EcoRI nation after conjugation to Y. enterocolitica and selection for CamR.
and cloned into the EcoRI-digested vector pVLT33, resulting in plas- Integration of the plasmids was confirmed by Southern blot analysis
mid pVLT-ECdam2/5. Correct orientation of the insert was con- (data not shown).
firmed by a restriction enzyme digest. The expression of a functional
E. coli Dam was confirmed in the E. coli dam mutant strain GM2163 For the construction of W(fyuA : : lacZ), W(rscR : : lacZ) and
as described above. Plasmid pVLT-ECdam2/5 was transferred to W(mdoH : : lacZ) fusion strains, approximately 650 bp fragments
the merodiploid dam+-dam : : V(SmR/SpR) strain by conjugation. containing the 59 end of the respective gene including the promoter
Subsequently, cycloserine enrichment was used to generate CamS region were amplified by PCR using the primer pairs SF-fyu1/SF-fyu2,
SmR SpR KanR exconjugants. The presence of the mutant genotype SF-rsc1/SF-rsc2 and SF-mdo1/SF-mdo2, respectively (Table 2), with
was confirmed by Southern blot analysis and PCR. genomic DNA of Y. enterocolitica JB580v as template. The PCR
products were digested with BglII and XbaI, and ligated into BglII/
Construction of plasmids. The high-copy-number plasmid XbaI-restricted pKN8, resulting in pKN8-fyuA, pKN8-rscR and
pTP166 carries the E. coli dam gene under the control of the Ptac pKN8-mdoH, respectively, which were subsequently conjugated into
promoter (Marinus et al., 1984). For use in Y. enterocolitica, the bla Y. enterocolitica JB580v.
gene of pTP166 was removed by digestion with DraI and AatII. A
blunt-ended 2?2 kb EcoRI fragment encoding the kanamycin- For the construction of the W(hreP : : lacZ) strain, a 1 kb EcoRV
resistance cassette of pCNB5 (De Lorenzo et al., 1993) was ligated to fragment of pWSK-4J7opp was ligated into SmaI-digested pFUSE,
the remaining part of pTP166 treated with T4 DNA polymerase, resulting in pFUSE-hreP. The correct orientation of the insert was
resulting in plasmid pTP166Kan. Plasmid pTP166Kan-damD was analysed by restriction enzyme digestion. Subsequently, pFUSE-hreP
generated by digestion of pTP166Kan with MluI and EcoRI, treat- was conjugated into Y. enterocolitica JB580v.
ment with T4 DNA polymerase and religation, thereby deleting a
1?2 kb fragment containing the Ptac promoter and the 59 part of b-Galactosidase assay experiments. b-Galactosidase assays were
the dam gene. Plasmids were transferred to Y. enterocolitica by performed as previously described (Miller, 1972). Overnight cultures
electroporation. grown in LB at 26 uC were diluted 1 : 20 in fresh medium and sub-
cultured for 3 h at 26 uC or at 37 uC. The bacterial cells were col-
For the construction of a Y. enterocolitica Dam-overproducing strain, lected by centrifugation and washed in 0?85 % (w/v) NaCl before
the E. coli dam gene from pTP166 was removed as a 1?2 kb XbaI/PvuII enzyme activity assays. Enzyme activities are expressed as arbitrary
fragment. The 930 bp KpnI/XbaI fragment containing Y. enterocolitica Miller units and were averaged from at least three independent
dam from pBS-dam1/2 was treated with T4 DNA polymerase to experiments, each performed in triplicate.
produce blunt ends and cloned into the remaining pTP166 frag-
ment, which had been treated with T4 DNA polymerase, resulting in Tissue culture invasion assays. Invasion assays were performed
pTP166-YEdam. For use in Y. enterocolitica, the kanamycin-resistance using CHO cells as previously described (Miller & Falkow, 1988). Y.
cassette from pCNB5 (De Lorenzo et al., 1993) was excised as a 2?2 kb enterocolitica strain JB580c, which is cured of the pYV virulence
EcoRI fragment, treated with T4 DNA polymerase and cloned plasmid, carrying either pTP166Kan (GHY151) or pTP166Kan-
into pTP166-YEdam, which had been digested with PstI and treated damD (GHY148) was grown for 15–18 h at 26 uC before infection.
with T4 DNA polymerase, generating pTP166Kan-YEdam. For use as a Assays were repeated six times, each in triplicate, and mean results
control plasmid, pTP166Kan-YEdamrev was constructed based on are reported as percentage invasion [=1006(number of bacteria
pTP166Kan-YEdam by insertion of the dam fragment in the opposite resistant to gentamicin/initial number of bacteria)] with GHY148
orientation. Plasmids were electroporated into Y. enterocolitica. referred to as the wild-type.
Analysis of frequencies of spontaneous mutation and of
resistance to 2-aminopurine (2-AP). All assays were performed RESULTS
in triplicate as previously described (Ostendorf et al., 1999). For the
determination of spontaneous mutation frequencies, appropriate
dilutions of overnight cultures in LB were plated on selective (LB Sequence and cloning of the Y. enterocolitica
containing 30 mg streptomycin ml21 or 7–10 mg chloramphenicol dam gene
ml21) and nonselective (viable count) media and incubated at 26 uC
for 2–3 days in the presence of 1 mM IPTG to induce dam expres-
The sequence of the E. coli dam gene (Brooks et al., 1983) was
sion from Ptac. The mutation frequency is expressed as the ratio of used to screen the unfinished Y. enterocolitica genome se-
the number of resistant cells to the number of viable cells. quence (http://www.sanger.ac.uk/Projects/Y_enterocolitica/).
We identified an ORF of 813 bp encoding a protein of
The influence of 2-AP on survival (based on the frequency of 270 amino acids with a calculated molecular mass of
lethal mutations) was determined as described by Ostendorf et al. 31?2 kDa. An alignment of the corresponding protein
(1999) with the following modifications. Overnight cultures of Y.
enterocolitica strains grown in LB at 26 uC were diluted to
sequences revealed an identity of 70?6 % to the E. coli
26107 cells ml21. 2-AP was added to 10 ml of culture at final con- Dam protein. Different conserved motifs involved in
centrations of 0, 10, 50, 100 and 200 mg ml21. The cultures were S-adenosylmethionine binding and catalysis that have
then incubated with aeration for 3 h at 26 uC before the bacterial been described for members of the a group of N6-adenine
2294 Microbiology 151
Dam of Yersinia enterocolitica
aminomethyltransferases (Malone et al., 1995) are all in Y. pseudotuberculosis and Vibrio cholerae (Julio et al.,
present in the Dam protein of Y. enterocolitica in the 2001). To construct a Y. enterocolitica dam mutant strain,
correct sequential order. A comparison of the Dam sequence an V(SmR/SpR) cassette was inserted into the unique EcoRI
to entries in databases using the BLAST program (Altschul site of dam, cloned into pEP185.2 and mated into Y.
et al., 1997) revealed highest homology to Dam of Y. pestis, enterocolitica JB580v. This led to several merodiploid
Y. pseudotuberculosis and Serratia marcescens (85 %, 85 %, conjugants with an integrated plasmid. However, despite
and 80 % identity, respectively). The dam gene of Y. intense and repeated efforts, a CamS SmR SpR exconjugant
enterocolitica was amplified by PCR and ligated into pBlue- could never be obtained. This suggested that dam is essen-
scriptIIKS+. The resulting plasmid, pBS-dam1/2, was tial and required for growth in Y. enterocolitica, as found
sequenced to confirm the identity of the cloned gene to for Y. pseudotuberculosis and V. cholerae. To confirm the
the sequence derived from the database. essentiality of dam, pVLT-dam1/2 was introduced into a
merodiploid dam+ dam : : pEP-dam : : V(SmR/SpR) strain.
Complementation of an E. coli dam mutant Subsequently, we screened for CamS SmR SpR exconjugants
strain with the Y. enterocolitica dam gene in which the second cross-over had occurred, leaving
behind dam : : V(SmR/SpR) on the chromosome. When a
To confirm functionality of the cloned dam gene, we wild-type copy of the dam gene was provided in trans,
subcloned a 930 bp fragment of pBS-dam1/2 containing the exconjugants with a V(SmR/SpR) insertion in the chromo-
Y. enterocolitica dam ORF into pVLT33 under the control of somal dam gene could be generated; 57 % of all chlor-
an inducible Ptac promoter, resulting in pVLT-dam1/2, and amphenicol-sensitive exconjugants were dam : : V(SmR/SpR)
introduced it into the dam mutant strain E. coli GM2163. as confirmed by the SmR SpR phenotype, PCR and Southern
Plasmid DNA isolated from E. coli GM2163 carrying either blot analysis (data not shown). From these data we con-
pVLT33 or pVLT-dam1/2 and grown in the presence of clude that dam is an essential gene in Y. enterocolitica as in
IPTG was analysed for DNA methylation by a restriction Y. pseudotuberculosis and V. cholerae.
digest with Sau3AI or MboI. Both enzymes recognize
the sequence GATC. While Sau3AI cleaves this sequence
independent of its methylation status, MboI only cleaves Effect of Dam overproduction on spontaneous
unmethylated DNA. DNA isolated from E. coli GM2163 mutation frequency and resistance to 2-AP
carrying pVLT-dam1/2 could only be digested with Sau3AI
but not with MboI, indicating methylation of GATC In E. coli, strains which lack or overproduce the Dam
sequences, whereas DNA isolated from E. coli GM2163 enzyme show an increased spontaneous mutation fre-
carrying pVLT33 could be digested with Sau3AI and with quency and are sensitive to base analogues like 2-AP. As
MboI, confirming that the cloned DNA fragment from Y. dam mutant strains of Y. enterocolitica are not viable,
enterocolitica encodes a protein with DNA adenine methyl- we investigated the influence of Dam overproduction on
ase activity similar to the Dam enzyme of E. coli. mutation avoidance. As an initial control, we inves-
tigated whether overproduction of Dam might be detri-
mental for growth of Y. enterocolitica. No obvious growth
Dam is essential for viability of
defect could be observed in a strain overexpressing dam
Y. enterocolitica
from a Ptac promoter during growth from lag through
Dam regulates a variety of physiological processes in the stationary phase. We then analysed the effect of the Dam
bacterial cell and in addition plays a role in virulence of enzyme on mutability in Y. enterocolitica. Overproduc-
several enteric bacteria. To analyse the function of Dam in tion of the Y. enterocolitica Dam enzyme from plasmid
Y. enterocolitica, we attempted to generate a Y. enterocolitica pTP166Kan-YEdam increased the spontaneous resistance
dam mutant strain. Strains lacking a functional dam gene to chloramphenicol and streptomycin by a factor of
have been described for E. coli, Salmonella typhimurium, 4?4 and 1?6, respectively, in comparison to control cells
Serratia marcescens and H. influenzae (Bale et al., 1979; carrying plasmid pTP166Kan-YEdamrev (Table 3). In
Bayliss et al., 2002; Ostendorf et al., 1999; Torreblanca & addition to the increased spontaneous mutability, Dam-
Casadesus, 1996). However, Dam is essential for viability overproducing strains of Y. enterocolitica also showed an
Table 3. Spontaneous resistance to antibiotics of strains overproducing Dam of Y. enterocolitica (Y-Dam OP) or E. coli
(E-Dam OP)
Antibiotic Mutation frequency* OP/WT ratio Mutation frequency* OP/WT ratio
WT Y-Dam OP WT E-Dam OP
Cam 4?461025 1?961024 4?4 5?261026 1?161024 21?2
Sm 2?961024 3?161024 1?6 3?361023 1?361021 39?4
*The data are means of three independent experiments and expressed as percentage of viable counts plated on LB agar without antibiotics.
http://mic.sgmjournals.org 2295
¨
S. Falker, M. A. Schmidt and G. Heusipp
and Fig. 1, overproduction of the E. coli Dam enzyme
from plasmid pTP166Kan in Y. enterocolitica increased
the spontaneous resistance of Y. enterocolitica to chlor-
amphenicol 21?2-fold and to streptomycin 39?4-fold
in comparison to cells carrying the control plasmid
pTP166Kan-damD. In addition, the decrease in resistance
of Y. enterocolitica to 2-AP was much more pronounced
when the E. coli Dam enzyme was overproduced compared
to overproduction of the Y. enterocolitica Dam enzyme.
A strong decrease in resistance could already be detected
at a 2-AP concentration of 10 mg ml21 (compared to
>150 mg ml21 when overproducing the Y. enterocolitica
Dam). The differences in mismatch repair after over-
production of Dam from E. coli or Y. enterocolitica are not
due to differences in the expression level, as the expres-
sion vectors used differ only in the coding sequences for
the respective Dam enzyme. The data are similar to the effect
of Dam overproduction in E. coli (Herman & Modrich,
1981; Marinus et al., 1984), indicating that the mechani-
sms underlying methyl-directed mismatch repair in Y.
enterocolitica are different from those in E. coli, potentially
due to differences in Dam functionality or activity.
Fig. 1. Effect of 2-AP treatment on survival of Dam-over-
producing and control strains: overproduction of E. coli Dam Functional complementation of a
(GHY150) or Y. enterocolitica Dam (GHY158) increases sensi- Y. enterocolitica dam strain by the E. coli dam
tivity to different concentrations of 2-AP. Bacteria were treated gene in trans
for 3 h with the concentrations of 2-AP indicated. Viable
counts were determined by plating on LB agar. n, GHY157 As dam is an essential gene in Y. enterocolitica but not in
(pTP166Kan-YEdamrev); m, GH158 (pTP166Kan-YEdam); %, E. coli, and as overproduction of the E. coli Dam enzyme
GHY147 (pTP166Kan-damD); &, GHY150 (pTP166Kan). Data has a strong effect on spontaneous mutability compared
are means and standard deviations of at least three indepen- to the Y. enterocolitica Dam enzyme, we were interested in
dent experiments. determining if the E. coli dam gene is able to complement a
dam mutant of Y. enterocolitica. Plasmid pVLT-ECdam2/5
carrying the E. coli dam gene under the control of the Ptac
increased sensitivity towards 2-AP at concentrations above promoter was introduced into the merodiploid dam+-
150 mg ml21 (Fig. 1). However, in comparison to the effects dam : : V(SmR/SpR) Y. enterocolitica strain GHY121. As
reported in E. coli and Serratia marcescens (Glickman, 1979; already shown for the complementation with the Y. entero-
Ostendorf et al., 1999), the increase in sensitivity towards colitica dam gene, CamS SmR SpR exconjugants could be
2-AP related to Dam overproduction appears to be only obtained. All chloramphenicol-sensitive exconjugants
marginal. were dam : : V(SmR/SpR) as confirmed by the SmR SpR
phenotype, PCR and Southern blot analysis (data not
shown). From these data we conclude that the essentiality
Overproduction of the E. coli Dam enzyme in of Dam in Y. enterocolitica is not due to different activities
Y. enterocolitica has effects on spontaneous in mismatch repair in comparison to Dam of E. coli. Instead,
mutation frequency and 2-AP resistance Dam is essential as an altered methylation pattern of GATC
comparable to Dam overproduction in E. coli sequences in promoters interferes with the proper expres-
sion of essential genes in Y. enterocolitica, while in E. coli
A dam mutant strain of H. influenzae is not hyper- different subsets of (non-essential) genes are expressed in a
mutable and it was therefore suggested that mismatch Dam-dependent fashion.
repair in H. influenzae might be different from that in E. coli
(Bayliss et al., 2002; Watson et al., 2004). Therefore we
The expression of hre loci is not influenced by
hypothesized that the relatively small effect due to Dam
Dam overproduction
overproduction on the spontaneous mutation frequency
and on 2-AP resistance in Y. enterocolitica might reflect Multiple aspects of virulence of various enteric pathogens
differences in the role of Dam in mismatch repair compared are influenced by the expression of Dam (Chen et al., 2003;
to the E. coli model. To analyse this in more detail, we Low et al., 2001; Watson et al., 2004). As it was shown by
overproduced the E. coli Dam enzyme in Y. enterocolitica, Heithoff et al. (1999) that the expression of at least 20 genes
expecting to see differences in comparison to overproduc- identified as induced during an infection (the so-called
ing the Y. enterocolitica Dam. Indeed, as shown in Table 3 in vivo-induced or ivi genes) is altered in a dam mutant
2296 Microbiology 151
Dam of Yersinia enterocolitica
Table 4. Expression of specifically in vivo-expressed genes (hre genes) in a Dam over-
producing (OP) and a wild-type (WT) strain of Y. enterocolitica
hre gene Expression at 26 6C (Miller units)* Expression at 37 6C (Miller units)*
WT OP WT OP
fyuA 1648±966 1714±588 2333±767 2674±880
hreP 57±7 44±4 43±4 39±5
mdoH 81±11 70±5 94±6 105±9
rpoE 1358±126 1186±88 1076±57 1180±186
rscR 406±22 345±64 589±82 567±82
*The data are means and standard deviations of at least three independent experiments, each performed in
triplicate.
strain of Salmonella typhimurium, we were particularly pseudotuberculosis, V. cholerae and H. influenzae (Garcia-Del
interested in the effect of Dam overproduction on expres- Portillo et al., 1999; Heithoff et al., 1999; Julio et al., 2001;
sion of hre loci of Y. enterocolitica specifically expressed Watson et al., 2004). In this study we describe the cloning
during an infection in the mouse model of yersiniosis of the Y. enterocolitica dam gene. We show that dam is
(Young & Miller, 1997). We used transcriptional fusions essential for viability and is involved in mutation avoidance
of the lacZ gene to the hre genes rpoE, hreP, rscR, mdoH and regulation of virulence factors.
and fyuA, and analysed their expression after overproduc-
tion of Dam. These fusions were chosen as they represent The dam gene was identified in the unfinished sequence of
genes involved in various aspects of virulence of Yersinia Y. enterocolitica by identity to the E. coli dam gene. The
and other pathogens (RpoE is an extracytoplasmic func- genes share an identity of 67 %, which is even more
tion sigma factor; HreP is a protease; RscR is a regulator pronounced at the protein level (70?6 %). Conserved motifs
involved in systemic dissemination of Y. enterocolitica; MdoH of aminomethyltransferases are present in the correct
is involved in biosynthesis of membrane-derived oligosac- sequential order, placing Dam of Y. enterocolitica in the a
charides; FyuA is an iron siderophore receptor). As shown in group of N6-adenine aminomethyltransferases (Malone
Table 4, overproduction of Dam had no significant effect on et al., 1995). The complementation of an E. coli dam
the expression of the hre genes investigated. We conclude mutant with dam of Y. enterocolitica implies a functional
from these data that Dam overproduction has no general homology between the two Dam proteins, as the dam
regulatory effect on the expression of the in vivo-expressed strain retained its ability to methylate adenine in GATC
genes of Y. enterocolitica analysed here. sequences. Moreover, overproduction of the E. coli Dam
protein in Y. enterocolitica affects the spontaneous muta-
Dam overproduction leads to increased invasion tion frequency and the resistance to the base analogue
of Y. enterocolitica into eukaryotic cells 2-AP, comparable to the effect of Dam overproduction in
A characteristic virulence-associated phenotype of Y. E. coli. However, the effect is less pronounced when the Y.
enterocolitica, which can be analysed by an in vitro assay, enterocolitica Dam is overproduced, indicating similarities
is the invasion of eukaryotic cells. In Salmonella, a dam as well as differences in methyl-directed mismatch repair
mutant strain showed a reduced capacity to invade epithelial between E. coli and Y. enterocolitica. This is in agreement
cells (Garcia-Del Portillo et al., 1999). This prompted us to with previous data obtained from H. influenzae, where a
analyse the invasion of a Dam-overproducing Y. entero- dam mutant strain showed no significant difference in
colitica strain into CHO cells. The invasion of the Dam- mutation frequency from the wild-type (Bayliss et al., 2002;
overproducing strain increased twofold compared to the Watson et al., 2004). Data from studies on the methyl-
control strain (GHY151, 19?5±8?6 % invasion; GHY148, directed mismatch repair in E. coli as a model organism
9?7±3?8 % invasion), indicating that Dam methylation cannot be transferred in every detail to other species. Even
enhances the invasion of Y. enterocolitica into epithelial cells. in Shigella flexneri, a phylogenetically very close relative of
E. coli, a dam mutant strain has a 1000-fold increased
spontaneous mutation frequency compared to 20- to 80-
DISCUSSION fold in E. coli (Honma et al., 2004). Obviously, although
DNA adenine methylation regulates a variety of physio- bacteria use similar mechanisms of methyl-directed mis-
logical processes in the bacterial cell, including replica- match repair, the exact function or activity of Dam on the
tion, mismatch repair and gene expression (Marinus, molecular level in this process differs between bacterial
1996). More recently it has become evident that Dam species. This needs to be analysed in more detail to gain a
plays an important role in the pathogenesis of several better understanding of the role of DNA methylation in
bacterial species, including Salmonella typhimurium, Y. mutation avoidance.
http://mic.sgmjournals.org 2297
¨
S. Falker, M. A. Schmidt and G. Heusipp
In Y. pseudotuberculosis and V. cholerae, Dam is essential it will be interesting to analyse tissue colonization and
for growth (Julio et al., 2001). However, overproduction of virulence of a Dam-overproducing strain of Y. enterocolitica
Dam does not lead to a detectable growth defect. This is in the mouse model of infection.
also true for Dam of Y. enterocolitica. Interestingly, a dam
mutant strain could be constructed in E. coli, Salmonella As we used pYV-cured strains for the invasion assay, we can
typhimurium, Serratia marcescens and H. influenzae (Bayliss exclude that the effect of Dam overproduction on inva-
et al., 2002; Marinus & Morris, 1973; Marinus et al., 1983; sion depends on the virulence plasmid encoded invasin
Ostendorf et al., 1999; Torreblanca & Casadesus, 1996). It YadA, implying that Dam acts on a chromosomally encoded
remains to be determined why Dam is essential for viability invasin like Inv or Ail. This will be addressed in future
in some c-proteobacteria, but not in others. The phenotype experiments together with a molecular analysis of regulatory
of an E. coli dam strain is pleiotropic (Marinus, 1996; mechanisms underlying the phenotype.
Oshima et al., 2002). Although this has not been studied in
detail, it probably also holds true for other bacteria, and
therefore it cannot be easily determined which function ACKNOWLEDGEMENTS
affected by Dam is important for viability in one bacterial We thank M. G. Marinus for plasmid pTP166 and G. M. Young for
species but not in others. Our studies imply that the role of constructing pFUSE-hreP. This work was supported by Innovative
Dam in methyl-directed mismatch repair is not the reason Medical Research grants (IMF: HE120201, HE110401) of the Medical
for essentiality in Y. enterocolitica, although its activity or ¨
School of the University of Munster and in part by grants of the
function seems to be different in this process compared to Deutsche Forschungsgemeinschaft (DFG SFB293/B5, SCHM770/10).
E. coli. Rather, our data imply that GATC methylation
affects the expression of different subsets of genes in
different species, and that some or at least one gene(s) REFERENCES
affected in Y. enterocolitica, and putatively also in Y. Altschul, S. F., Madden, T. L., Schaffer, A. A., Zhang, J., Zhang, Z.,
pseudotuberculosis and V. cholerae, are essential for growth. Miller, W. & Lipman, D. J. (1997). Gapped BLAST and PSI-BLAST: a
new generation of protein database search programs. Nucleic Acids
Besides physiological functions in mutation avoidance and Res 25, 3389–3402.
regulation of replication, Dam is also involved in the Bale, A., d’Alarcao, M. & Marinus, M. G. (1979). Characterization of
regulation of virulence-associated genes of diverse human, DNA adenine methylation mutants of Escherichia coli K12. Mutat Res
animal and plant pathogens (Chen et al., 2003; Heithoff 59, 157–165.
et al., 1999; Julio et al., 2001; Low et al., 2001; Watson et al., ¨
Baumler, A. J., Tsolis, R. M., van der Velden, A. W., Stojiljkovic, I.,
2004). In an initial approach to study the effect of Dam on Anic, S. & Heffron, F. (1996). Identification of a new iron regulated
virulence gene expression in Y. enterocolitica, the specifically locus of Salmonella typhi. Gene 183, 207–213.
in vivo-expressed genes (hre genes) fyuA, hreP, mdoH, rpoE, Bayliss, C. D., van de Ven, T. & Moxon, E. R. (2002). Mutations in
and rscR (Young & Miller, 1997) were analysed in wild- polI but not mutSLH destabilize Haemophilus influenzae tetranucleo-
tide repeats. EMBO J 21, 1465–1476.
type and Dam-overproducing strains for differences in
expression, as expression of in vivo-induced genes (ivi) of Bolker, M. & Kahmann, R. (1989). The Escherichia coli regulatory
protein OxyR discriminates between methylated and unmethylated
Salmonella typhimurium was influenced by DNA adenine states of the phage Mu mom promoter. EMBO J 8, 2403–2410.
methylation (Heithoff et al., 1999). Interestingly, in contrast
Braaten, B. A., Nou, X., Kaltenbach, L. S. & Low, D. A. (1994).
to Salmonella, disturbance of the DNA methylation pattern Methylation patterns in pap regulatory DNA control pyelonephritis-
had no effect on expression of the hre genes examined, associated pili phase variation in E. coli. Cell 76, 577–588.
indicating involvement of different regulatory mechanisms Brooks, J. E., Blumenthal, R. M. & Gingeras, T. R. (1983). The
in expression of in vivo-induced genes in Y. enterocolitica isolation and characterization of the Escherichia coli DNA adenine
and Salmonella typhimurium. Alternatively, the lack of an methylase (dam) gene. Nucleic Acids Res 11, 837–851.
effect of Dam overproduction on hre expression in Y. entero- Chen, L., Paulsen, D. B., Scruggs, D. W., Banes, M. M., Reeks, B. Y.
colitica might also be due to the relatively small number of & Lawrence, M. L. (2003). Alteration of DNA adenine methylase
hre genes in comparison to the ivi genes analysed in the (Dam) activity in Pasteurella multocida causes increased spontaneous
Salmonella study (Heithoff et al., 1999). mutation frequency and attenuation in mice. Microbiology 149,
2283–2290.
The effect of Dam overproduction on invasion of epithelial De Lorenzo, V., Eltis, L., Kessler, B. & Timmis, K. N. (1993). Analysis
cells shows that in Y. enterocolitica not only is Dam involved of Pseudomonas gene products using lacIq/Ptrp-lac plasmids and
in physiological processes like mismatch repair and muta- transposons that confer conditional phenotypes. Gene 123, 17–24.
tion avoidance, but DNA methylation also influences Dueger, E. L., House, J. K., Heithoff, D. M. & Mahan, M. J. (2001).
Salmonella DNA adenine methylase mutants elicit protective
virulence factor expression. In previous studies with Y.
immune responses to homologous and heterologous serovars in
pseudotuberculosis, a Dam-overproducing strain did not chickens. Infect Immun 69, 7950–7954.
colonize mucosal tissues of mice differently from the wild- Dueger, E. L., House, J. K., Heithoff, D. M. & Mahan, M. J.
type (Julio et al., 2002). This might imply that invasion is (2003). Salmonella DNA adenine methylase mutants elicit early and
not changed in Y. pseudotuberculosis or that this pheno- late onset protective immune responses in calves. Vaccine 21,
type is not detectable under in vivo conditions. Therefore 3249–3258.
2298 Microbiology 151
Dam of Yersinia enterocolitica
Garcia-Del Portillo, F., Pucciarelli, M. G. & Casadesus, J. (1999). Malone, T., Blumenthal, R. M. & Cheng, X. (1995). Structure-guided
DNA adenine methylase mutants of Salmonella typhimurium show analysis reveals nine sequence motifs conserved among DNA amino-
defects in protein secretion, cell invasion, and M cell cytotoxicity. methyltransferases, and suggests a catalytic mechanism for these
Proc Natl Acad Sci U S A 96, 11578–11583. enzymes. J Mol Biol 253, 618–632.
Geier, G. E. & Modrich, P. (1979). Recognition sequence of the Dam Marinus, M. G. (1996). Methylation of DNA. In Escherichia coli and
methylase of Escherichia coli K12 and mode of cleavage of DpnI Salmonella: Cellular and Molecular Biology, pp. 782–791. Edited by
endonuclease. J Biol Chem 254, 1408–1413. F. C. Neidhardt and others. Washington, DC: American Society for
Glickman, B. W. (1979). Spontaneous mutagenesis in Escherichia coli Microbiology.
strains lacking 6-methyladenine residues in their DNA: an altered Marinus, M. G. & Morris, N. R. (1973). Isolation of deoxyribonucleic
mutational spectrum in dam- mutants. Mutat Res 61, 153–162. acid methylase mutants of Escherichia coli K-12. J Bacteriol 114,
Glickman, B., van den Elsen, P. & Radman, M. (1978). Induced 1143–1150.
mutagenesis in dam2 mutants of Escherichia coli: a role for 6- Marinus, M. G. & Morris, N. R. (1974). Biological function for 6-
methyladenine residues in mutation avoidance. Mol Gen Genet 163, methyladenine residues in the DNA of Escherichia coli K12. J Mol
307–312. Biol 85, 309–322.
Heithoff, D. M., Sinsheimer, R. L., Low, D. A. & Mahan, M. J. (1999). Marinus, M. G., Carraway, M., Frey, A. Z., Brown, L. & Arraj, J. A.
An essential role for DNA adenine methylation in bacterial virulence. (1983). Insertion mutations in the dam gene of Escherichia coli K-12.
Science 284, 967–970. Mol Gen Genet 192, 288–289.
Heithoff, D. M., Enioutina, E. Y., Daynes, R. A., Sinsheimer, R. L., Marinus, M. G., Poteete, A. & Arraj, J. A. (1984). Correlation of
Low, D. A. & Mahan, M. J. (2001). Salmonella DNA adenine DNA adenine methylase activity with spontaneous mutability in
methylase mutants confer cross-protective immunity. Infect Immun Escherichia coli K-12. Gene 28, 123–125.
69, 6725–6730.
Miller, J. H. (1972). Experiments in Molecular Genetics. Cold Spring
Herman, G. E. & Modrich, P. (1981). Escherichia coli K-12 clones that Harbor, NY: Cold Spring Harbor Laboratory.
overproduce Dam methylase are hypermutable. J Bacteriol 145,
Miller, V. L. & Falkow, S. (1988). Evidence for two genetic loci in
644–646.
Yersinia enterocolitica that can promote invasion of epithelial cells.
Hernday, A., Krabbe, M., Braaten, B. & Low, D. (2002). Self- Infect Immun 56, 1242–1248.
perpetuating epigenetic pili switches in bacteria. Proc Natl Acad Sci
U S A 99, 16470–16476. Miller, V. L. & Mekalanos, J. J. (1988). A novel suicide vector and its
use in construction of insertion mutations: osmoregulation of outer
Heusipp, G., Young, G. M. & Miller, V. L. (2001). HreP, an in vivo- membrane proteins and virulence determinants in Vibrio cholerae
expressed protease of Yersinia enterocolitica, is a new member of the requires toxR. J Bacteriol 170, 2575–2583.
family of subtilisin/kexin-like proteases. J Bacteriol 183, 3556–3563.
Modrich, P. (1987). DNA mismatch correction. Annu Rev Biochem
Heusipp, G., Schmidt, M. A. & Miller, V. L. (2003). Identification of
56, 435–466.
rpoE and nadB as host responsive elements of Yersinia enterocolitica.
FEMS Microbiol Lett 226, 291–298. Nelson, K. M., Young, G. M. & Miller, V. L. (2001). Identification of a
locus involved in systemic dissemination of Yersinia enterocolitica.
Honma, Y., Fernandez, R. E. & Maurelli, A. T. (2004). A DNA
Infect Immun 69, 6201–6208.
adenine methylase mutant of Shigella flexneri shows no significant
attenuation of virulence. Microbiology 150, 1073–1078. Oshima, T., Wada, C., Kawagoe, Y., Ara, T., Maeda, M., Masuda, Y.,
Hiraga, S. & Mori, H. (2002). Genome-wide analysis of deoxy-
Julio, S. M., Heithoff, D. M., Provenzano, D., Klose, K. E.,
adenosine methyltransferase-mediated control of gene expression in
Sinsheimer, R. L., Low, D. A. & Mahan, M. J. (2001). DNA adenine
Escherichia coli. Mol Microbiol 45, 673–695.
methylase is essential for viability and plays a role in the
pathogenesis of Yersinia pseudotuberculosis and Vibrio cholerae. Ostendorf, T., Cherepanov, P., de Vries, J. & Wackernagel,
Infect Immun 69, 7610–7615. W. (1999). Characterization of a dam mutant of Serratia mar-
cescens and nucleotide sequence of the dam region. J Bacteriol 181,
Julio, S. M., Heithoff, D. M., Sinsheimer, R. L., Low, D. A. & Mahan,
3880–3885.
M. J. (2002). DNA adenine methylase overproduction in Yersinia
pseudotuberculosis alters YopE expression and secretion and host Sternberg, N. (1985). Evidence that adenine methylation influences
immune responses to infection. Infect Immun 70, 1006–1009. DNA–protein interactions in Escherichia coli. J Bacteriol 164,
Kinder, S. A., Badger, J. L., Bryant, G. O., Pepe, J. C. & Miller, V. L. 490–493.
(1993). Cloning of the YenI restriction endonuclease and methyl- Torreblanca, J. & Casadesus, J. (1996). DNA adenine methylase
transferase from Yersinia enterocolitica serotype O : 8 and construc- mutants of Salmonella typhimurium and a novel dam-regulated
tion of a transformable R2M+ mutant. Gene 136, 271–275. locus. Genetics 144, 15–26.
Low, D. A., Weyand, N. J. & Mahan, M. J. (2001). Roles of DNA Watson, M. E., Jr, Jarisch, J. & Smith, A. L. (2004). Inactivation of
adenine methylation in regulating bacterial gene expression and deoxyadenosine methyltransferase (dam) attenuates Haemophilus
virulence. Infect Immun 69, 7197–7204. influenzae virulence. Mol Microbiol 53, 651–664.
Lu, M., Campbell, J. L., Boye, E. & Kleckner, N. (1994). SeqA: a Young, G. M. & Miller, V. L. (1997). Identification of novel
negative modulator of replication initiation in E. coli. Cell 77, chromosomal loci affecting Yersinia enterocolitica pathogenesis.
413–426. Mol Microbiol 25, 319–328.
http://mic.sgmjournals.org 2299
Related docs
Get documents about "