MRI Detection of Thrombin with Aptamer Functionalized

Document Sample
scope of work template
							412                                               Bioconjugate Chem. 2008, 19, 412–417


MRI Detection of Thrombin with Aptamer Functionalized
Superparamagnetic Iron Oxide Nanoparticles
Mehmet Veysel Yigit,†,‡ Debapriya Mazumdar,‡,§ and Yi Lu*,†,‡,§,4
Center for Biophysics and Computational Biology, Beckman Institute for Advanced Science and Technology, Department of
Chemistry and Department of Biochemistry, University of Illinois at Urbana–Champaign, 600 S. Mathews Avenue, Urbana, IL
61801. Received October 22, 2007; Revised Manuscript Received November 27, 2007


         Design of smart MRI contrast agent based on superparamagnetic iron oxide nanoparticles and aptamers has been
         described for the detection of human R-thrombin protein. The contrast agent is based on the assembly of the
         aptamer functionalized nanoparticles in the presence of thrombin. A detectable change in MRI signal is observed
         with 25 nM thrombin in human serum. Changes were neither observed with control analytes, streptavidin, or
         bovine serum albumin, nor with inactive aptamer functionalized nanoparticles.



   Magnetic resonance imaging (MRI) is advancing rapidly, as           molecules with high affinity and selectivity (25–28). They are
it provides noninvasive, three-dimensional examination of              obtained through a combinatorial biology technique called
biological events in living organisms. A particularly active area      systematic evolution of ligands by exponential enrichment
of research in the MRI field is the development of MRI contrast         (SELEX), by isolating the active species from a large random
agents for image enhancement (1–9). Superparamagnetic iron             pool of DNA or RNA molecules (25, 26). They are often
oxide nanoparticles (SPIOs) are attractive, since they are shown       analogous to antibodies due to their selectivity and sensitivity
to be effective in enhancing magnetic resonance image contrast         in binding to a broad range of molecules (29–32). When
(4). The applications of SPIOs in MRI have ranged from                 compared to antibodies, aptamers serve several advantages such
nontargeted detection of diseases by accumulating at certain
                                                                       as the relative ease with which they can be selected for any
tissues to targeted detection of biomolecular markers in
                                                                       target analyte and their stability against biodegradation and
cells (10–16). Target-specific MRI detection using SPIOs is
particularly interesting, as it helps monitor several cellular or      denaturation. Due to these properties, aptamers are good
molecular processes (16–18). For example, cross-linked dextran-        candidates for building chemical and biological sensors in many
coated superparamagnetic iron oxide (CLIO) nanoparticles have          fields such as medical diagnostics and environmental monitoring.
been functionalized with different biomolecules and used for           Therefore, these aptamers have been transformed into fluorescent
detection of different targets including oligonucleotides (19, 20)     (33–47), colorimetric (48–57), and electrochemical sensors
proteins (17, 20, 21), enzymatic activities (22), viruses (23),        (58–60). Although these aptamer sensors have been widely
and enantiomeric impurities (24). It has been shown that CLIO          investigated in Vitro, their applications in ViVo remain a
nanoparticle assemblies create a distinctive magnetic phenom-          significant challenge because light penetration through skin is
enon called magnetic relaxation switching (MRS), where the             difficult and signal interference from cellular components is
core of a single nanoparticle in the assemblies becomes more           common. Recently, we reported a method for combining
effective in enhancing T2 relaxation time of adjacent water            adenosine aptamer and CLIO nanoparticles into a system to
protons, when compared to dispersed nanoparticles (4, 19). This        detect adenosine in the micromolar range via MRI. The contrast
mechanism has been widely used in many magnetic detection              in MR image of the nanoparticle solution increases as the
schemes either going from a disperse state to an assembled state       adenosine concentration increases in the environment (61).
of nanoparticles or visa versa (19, 20, 22, 24). For instance, it      Herein, we describe a new method for combining magnetic
has been shown that oligonucleotide functionalized dispersed           relaxation switching properties of CLIO nanoparticles with
CLIO nanoparticles can be used for the sequence-specific
                                                                       aptamer technology in order to create MRI contrast agents with
detection of complementary oligonucleotides simply by hybrid-
izing oligonucleotides and assembling CLIO nanoparticles into          nanomolar detection limit. The advantage of this technique over
clusters (19). This process enhances the T2 relaxation of the          other sensing methods is that MRI signal is much less vulnerable
nearby water protons and can be detected by MRI. While this            to changes in background colors or fluorescence from biological
approach is effective in oligonucleotide detection, it would be        media, such as serum and cell suspensions. In contrast to our
very interesting if this nucleic acid-based approach could be          previously reported system with adenosine, which depends on
expanded beyond nucleic acid detection to MRI of even broader          analyte-induced disassembly of particles to produce an increase
classes of targets.                                                    in brightness, this method is based on assembly of particles
   Aptamers are single-stranded functional nucleic acid mol-           leading to a decrease in brightness of MR image. This change
ecules which can bind a variety of chemical and biological             in signal from bright to dark is a significant advantage, as this
                                                                       is preferred in T2-weighted MR imaging. Furthermore, instead
   * Fax: (+1) 217-333-2685. Tel: (+1) 217-333-2619. E-mail yi-lu@     of a metabolite, we demonstrate the detection of a protein in
uiuc.edu.                                                              the current system, as proteins constitute most enzymes and
   †
     Center for Biophysics and Computational Biology.                  biomolecular markers in living systems.
   ‡
     Beckman Institute for Advanced Science and Technology.
   §
     Department of Chemistry.                                             To demonstrate the use of aptamer functionalized CLIO
   4
     Department of Biochemistry.                                       nanoparticles for protein detection we chose to detect thrombin
                                   10.1021/bc7003928 CCC: $40.75  2008 American Chemical Society
                                                      Published on Web 01/04/2008
Communications                                                                                       Bioconjugate Chem., Vol. 19, No. 2, 2008 413

Scheme 1. Schematic Illustration for Thrombin Detection Using MRIa




   a
     The CLIO nanoparticles (shown as red spheres) have been modified with either Thrm-A, a DNA aptamer (shown as blue lines) that binds to
fibrinogen-recognition exosite of thrombin, or Thrm-B, a DNA aptamer (shown as green lines) that binds to the heparin-binding exosite of thrombin.
Addition of thrombin consisting of both fibrinogen (as blue donuts) and heparin (as green donuts) exosites resulted in aggregation of CLIO nanoparticle
assembly, reducing the T2 relaxation time. The DNA sequences are shown at the bottom. The drawing is not to scale.


via MRI . We combined the CLIO nanoparticles with thrombin
aptamers, Thrm-A, which binds to the fibrinogen-recognition
exosite of thrombin, and Thrm-B, which binds to the heparin-
binding exosite of thrombin, as shown in Scheme 1 (62, 63).

   Materials: All DNA samples were purchased from Integrated DNA
Technologies Inc. (Coralville, IA). The thiol-modified DNA molecules
were purified by the standard desalting method. Human alpha thrombin
was purchased from Haematologic Technologies Inc. (Essex Junction,
VT). BSA was purchased from Aldrich (St. Louis, MO). Streptavidin
was purchased from SouthernBiotech (Birmingham, AL). N-Succin-
imidyl-3-(2-pyridylthio)-propionate (SPDP) was purchased from Mo-
lecular Biosciences (Boulder, CO). Cross-linked dextran coated super-
paramagnetic iron oxide nanoparticles (CLIO, 500 µg Fe mL-1) were
synthesized and coupled to SPDP according to literature procedure and
purified with PD-10 column (17). The thiol modified oligos, Thrm-A
(5′ SH-T15-GGTTGGTGTGGTTGG 3′), Thrm-B (5′ SH-TTTTTAGTC-
CGTGGTAGGGCAGGTTGGGGTGACT 3′), CNT-Thrm-A (5′ TCA-
CAGATGAGT-A12-SH 3′), and CNT-Thrm-B (5′ SH-CCCAGGT-
TCTCT 3′) were activated by incubating with eight equivalent of tris          Figure 1. Particle size distribution of 1:1 CLIO-Thrm-A and CLIO-
(2-carboxyethyl) phosphine hydrochloride (TCEP). Excess TCEP was              Thrm-B mixture before (light gray bars) and after (dark gray bars)
                                                                              addition of 50 nM thrombin.
removed by desalting using a SepPak C-18 catridge. TCEP-activated
thiol modified DNA (50 µM final concentration) was mixed with CLIO-
SPDP (400 µg Fe mL-1) in 100 mM phosphate buffer at pH 8.0                    The contrast agent designed for thrombin detection is composed
overnight. Excess DNA was removed by magnetic separation column               of a 1:1 mixture of Thrm-A and Thrm-B functionalized CLIO
(Miltenyi Biotec, Auburn, CA) from CLIO-DNA conjugates. Sample                nanoparticles (CLIO-Thrm-A and CLIO-Thrm-B, respectively)
preparation and MRI detection: CLIO-Thrm-A and CLIO-Thrm-B were               in aqueous solution. In the presence of thrombin, aptamer
mixed in 1:1 ratio and diluted in 100 mM NaCl, 25 mM KCl, and 25              sequences fold into a G-quadruplex arrangement in order to bind
mM tris-HCl buffer at pH 7.4. 250 µL of sample (12 µg Fe mL-1)                to thrombin (64, 65). After attachment of the CLIO nanoparticles
was aliquoted into the wells of a microplate and varying amounts of           to thrombin, the disperse nanoparticles assemble into aggregates,
analyte was added in each well. T2-weighted MR images were obtained
                                                                              changing the magnetic relaxation properties of nearby water
on a 4.7 T NMR instrument using a spin–echo pulse sequence with
variable echo time (TE ) 25–100 ms) and repetition time (TR) of 3000          protons, thereby reducing the T2 relaxation time. This event
ms. Light-scattering experiments: DLS measurements were performed             can be monitored as a decrease in brightness of T2-weighted
using Nicomp 380 ZLS Particle Sizer (Particle Sizing Systems, Santa           MR image of the solution via MRI (24).
Barbara, CA). An intensity-weighted value was used to report the                 To confirm that the aptamer functionalized nanoparticles bind
average particle diameter.                                                    to thrombin, 1 µM thrombin was added into the 1:1 homoge-
414 Bioconjugate Chem., Vol. 19, No. 2, 2008                                                                              Communications




Figure 2. (A) Contrast change in T2-weighted MR image in 1:1 CLIO-Thrm-A and CLIO-Thrm-B mixture with 0, 10, 25, and 50 nM thrombin
(first column), BSA (second column), and streptavidin (third column). (B) Contrast change in T2-weighted MR image with 0, 10, 25, and 50 nM
thrombin in CLIO-Thrm-A and CLIO-Thrm-B mixture (first column), and in CNT-CLIO-Thrm-A and CNT-CLIO-Thrm-B mixture (second column).




Figure 3. (A) Contrast change in T2-weighted MR image with 0, 10, 25, and 50 nM thrombin in CLIO-Thrm-A (first column), CLIO-Thrm-A and
CLIO-Thrm-B mixture. (Note: The image is completely dark at 50 nM thrombin) (second column) and in CLIO-Thrm-B (third column). (B)
Particle diameter change with CLIO-Thrm-A, 1:1 CLIO-Thrm-A and CLIO-Thrm-B mixture, or CLIO-Thrm-B with addition of thrombin.


                                                                        increased from 58.9 ( 4.4 nm to 259.5 ( 22.5 nm. Figure 1
                                                                        shows the intensity-weighted particle size distribution of CLIO
                                                                        nanoparticles obtained with dynamic light scattering (DLS),
                                                                        which indicates that the nanoparticles are cross-linked by
                                                                        thrombin molecules, therefore increasing the average diameter.
                                                                        At this CLIO nanoparticle concentration, precipitation of
                                                                        nanoparticles was not observed (19). These results strongly
Figure 4. T2-weighted MR image of 1:1 CLIO-Thrm-A and CLIO-             suggest that thrombin binding to aptamers on CLIO nanopar-
Thrm-B mixture in human serum.                                          ticles induces the assembly of nanoparticles.
                                                                           After confirming thrombin-induced assembly of nanoparticles
neous mixture of CLIO-Thrm-A and CLIO-Thrm-B (150 µg                    via DLS, we proceeded to check its utility as an MRI contrast
Fe mL-1), which resulted in rapid precipitation in seconds (data        agent. The binding of CLIO-Thrm-A and CLIO-Thrm-B to
not shown). Similar behavior was not observed when bovine               thrombin, assembled the nanoparticles into clusters, resulting
serum albumin (BSA) or streptavidin was used as an analyte.             in a decrease of the T2 relaxation time of the neighboring water
This result indicates that the precipitation of nanoparticles is        protons in the medium. We have tested the system at different
due to the binding event of analyte and its aptamer. Particle           thrombin concentrations from 0 to 50 nM. A decrease in
size analysis also showed that, upon addition of 50 nM thrombin         brightness of the MR image of the samples was observed as
into a mixture of CLIO-Thrm-A and CLIO-Thrm-B (12 µg Fe                 the concentration of thrombin was increased (Figure 2A), which
mL-1), the average diameter of CLIO nanoparticles immediately           was attributed to a decrease in T2 relaxation time (24). A
Communications                                                                             Bioconjugate Chem., Vol. 19, No. 2, 2008 415

noticeable change in contrast was observed even as low as 10         Imaging Center of the Beckman Institute for Advanced Science
nM thrombin, and a significant change was observed at 50 nM           and Technology and University of Illinois at Urbana–Cham-
thrombin.                                                            paign.
   To ensure that the contrast is solely due to the binding event
and not any other artifact, the system was tested with BSA and       LITERATURE CITED
streptavadin. The MR images obtained with these two analytes
did not show a difference in contrast when their concentration       (1) Carr, D. H., Brown, J., Bydder, G. M., Steiner, R. E.,
was increased from 0 to 50 nM. This result suggests that the            Weinmann, H. J., Speck, U., Hall, A. S., and Young, I. R. (1984)
change in contrast is due to thrombin and not any other effect.         Gadolinium-DTPA as a contrast agent in MRI: initial clinical
In order to check if the change in contrast is due to aptamer           experience in 20 patients. Am. J. Roentgenol. 143, 215–224.
and analyte binding and not thrombin molecule itself, we have        (2) Kabalka, G., Buonocore, E., Hubner, K., Moss, T., Norley, N.,
                                                                        and Huang, L. (1987) Gadolinium-labeled liposomes: targeted
tested random DNA sequences of different lengths that do not
                                                                        MR contrast agents for the liver and spleen. Radiology 163, 255–
bind to thrombin. To do so, we prepared a 1:1 mixture of random
                                                                        258.
DNA sequence (CNT-Thrm-A and CNT-Thrm-B) functionalized              (3) Weissleder, R., Hahn, P. F., Stark, D. D., Rummeny, E., Saini,
CLIO nanoparticles (CNT-CLIO-Thrm-A and CNT-CLIO-                       S., Wittenberg, J., and Ferrucci, J. T. (1987) MR imaging of
Thrm-B). The control samples were subjected to the same                 splenic metastases: ferrite-enhanced detection in rats. Am. J.
procedure as was used in preparing CLIO-Thrm-A and CLIO-                Roentgenol. 149, 723–726.
Thrm-B, and then placed into the wells of a microplate.              (4) Josephson, L., Lewis, J., Jacobs, P., Hahn, P. F., and Stark,
Thrombin was added to both systems with an increasing                   D. D. (1988) The effects of iron oxides on proton relaxivity.
concentration from 0 to 50 nM. The obtained MR images                   Magn. Reson. Imaging 6, 647–653.
showed a change in brightness for samples with CLIO-Thrm-A           (5) Saeed, M., Wagner, S., Wendland, M. F., Derugin, N.,
and CLIO-Thrm-B, but no change with CNT-CLIO-Thrm-A and                 Finkbeiner, W. E., and Higgins, C. B. (1989) Occlusive and
CNT-CLIO-Thrm-B (see Figure 2B). This result suggests that              reperfused myocardial infarcts: differentiation with Mn-DPDP–
the change in the MR signal is due to active thrombin binding           enhanced MR imaging. Radiology 172, 59–64.
aptamers and not any other nonspecific interaction of DNA with        (6) Li, W.-h., Fraser, S. E., and Meade, T. J. (1999) A calcium-
thrombin. The two control experiments taken together strongly           sensitive magnetic resonance imaging contrast agent. J. Am.
indicate that the change in MR signal is solely due to the binding      Chem. Soc. 121, 1413–1414.
event of thrombin to the aptamers, which results in assembly         (7) Harisinghani, M. G., Barentsz, J., Hahn, P. F., Deserno, W. M.,
of CLIO nanoparticles into clusters, decreasing the T2 relaxation       Tabatabaei, S., van de Kaa, C. H., de la, R. J., and Weissleder,
time of the environment.                                                R. (2003) Noninvasive detection of clinically occult lymph-node
                                                                        metastases in prostate cancer. N. Engl. J. Med. 348, 2491–2499.
   In order to demonstrate that thrombin molecule requires a         (8) Lee, J., Zylka, M. J., Anderson, D. J., Burdette, J. E., Woodruff,
mixture of CLIO-Thrm-A and CLIO-Thrm-B to generate a MR                 T. K., and Meade, T. J. (2005) A steroid-conjugated contrast
signal, we tried to use only CLIO-Thrm-A or CLIO-Thrm-B to              agent for magnetic resonance imaging of cell signaling. J. Am.
detect thrombin. As seen in Figure 3A, the MR signal did not            Chem. Soc. 127, 13164–13166.
change with neither of these nanoparticle suspensions, but a         (9) Frullano, L., Tejerina, B., and Meade, T. J. (2006) Synthesis
clear change in MR signal was observed with the 1:1 mixture             and characterization of a doxorubicin-Gd(III) contrast agent
of nanoparticles. The particle size analysis confirms this result,       conjugate: A new approach toward prodrug-procontrast com-
as an increase in particle diameter was observed when thrombin          plexes. Inorg. Chem. 45, 8489–8491.
was added into the 1:1 mixture of nanoparticles, but such an         (10) Kresse, M., Wagner, S., Pfefferer, D., Lawaczeck, R., Elste,
increase was not observed with CLIO-Thrm-A or CLIO-Thrm-B               V., and Semmler, W. (1998) Targeting of ultrasmall superpara-
alone (see Figure 3B). MR data and particle size analysis               magnetic iron oxide (USPIO) particles to tumor cells in vivo by
together suggest that both CLIO-Thrm-A and CLIO-Thrm-B                  using transferrin receptor pathways. Magn. Reson. Med. 40, 236–
are necessary for detection of thrombin with magnetic relaxation        242.
switching.                                                           (11) Enochs, W. S., Harsh, G., Hochberg, F., and Weissleder, R.
                                                                        (1999) Improved delineation of human brain tumors on MR
   To check the utility of this system in biological fluids, we
                                                                        images using a long-circulating, superparamagnetic iron oxide
tested our sample in 50% human serum. A clear change in the
                                                                        agent. J. Magn. Reson. Imaging 9, 228–232.
MR signal was observed with 25 nM, and a significant change           (12) Dodd, C. H., Hsu, H.-C., Chu, W.-J., Yang, P., Zhang, H.-
was seen with 75 nM thrombin (Figure 4). This result                    G., Mountz, J. D., Zinn, K., Forder, J., Josephson, L., Weissleder,
demonstrates that the system works in human serum without               R., Mountz, J. M., and Mountz, J. D. (2001) Normal T-cell
interference of biological components in serum.                         response and in vivo magnetic resonance imaging of T cells
   In conclusion, we demonstrated aptamer functionalized su-            loaded with HIV transactivator-peptide-derived superparamag-
perparamagnetic iron oxide nanoparticles for detection of an            netic nanoparticles. J. Immunol. Methods 256, 89–105.
analyte, which is dependent upon the binding event of aptamer        (13) Kooi, M. E., Cappendijk, V. C., Cleutjens, K. B. J. M.,
conjugated CLIO nanoparticles and the target molecule. The              Kessels, A. G. H., Kitslaar, P. J. E. H. M., Borgers, M., Frederik,
system demonstrated here is specific to thrombin and the                 P. M., Daemen, M. J. A. P., and van Engelshoven, J. M. A.
sensitivity is as low as 10 nM. Similar approaches can be applied       (2003) Accumulation of ultrasmall superparamagnetic particles
to other aptamer and CLIO nanoparticle systems.                         of iron oxide in human atherosclerotic plaques can be detected
                                                                        by in vivo magnetic resonance imaging. Circulation 107, 2453–
                                                                        2458.
                                                                     (14) Artemov, D., Mori, N., Okollie, B., and Bhujwalla, Z. M.
ACKNOWLEDGMENT                                                          (2003) MR molecular imaging of the Her-2/neu receptor in breast
                                                                        cancer cells using targeted iron oxide nanoparticles. Magn. Reson.
   The authors thank Natasha Yeung for helpful discussions and          Med. 49, 403–408.
for comments on the manuscript and Dr. Boris Odintsov for            (15) Corot, C., Petry, K. G., Trivedi, R., Saleh, A., Jonkmanns,
his help in operating the MRI equipment. This material is based         C., Le, B. J.-F., Blezer, E., Rausch, M., Brochet, B., Foster-
upon work supported by the National Science Foundation                  Gareau, P., Baleriaux, D., Gaillard, S., and Dousset, V. (2004)
(DMR-0117792, DMI-0328162, and CTS-0120978), the U.S.                   Macrophage imaging in central nervous system and in carotid
Army Research Office (DAAD19-03-1-0227), and Biomedical                  atherosclerotic plaque using ultrasmall superparamagnetic iron
416 Bioconjugate Chem., Vol. 19, No. 2, 2008                                                                                Communications

  oxide in magnetic resonance imaging. InVest. Radiol. 39, 619–         (36) Li, J., and Lu, Y. (2000) A highly sensitive and selective
  625.                                                                     catalytic DNA biosensor for lead ions. J. Am. Chem. Soc. 122,
(16) Nitin, N., LaConte, L. E. W., Zurkiya, O., Hu, X., and Bao,           10466–10467. .
  G. (2004) Functionalization and peptide-based delivery of             (37) Hamaguchi, N., Ellington, A., and Stanton, M. (2001) Aptamer
  magnetic nanoparticles as an intracellular MRI contrast agent.           beacons for the direct detection of proteins. Anal. Biochem. 294,
  J. Biol. Inorg. Chem. 9, 706–712.                                        126–131.
(17) Josephson, L., Tung, C.-H., Moore, A., and Weissleder, R.          (38) Fang, X., Cao, Z., Beck, T., and Tan, W. (2001) Molecular
  (1999) High-efficiency intracellular magnetic labeling with novel         aptamer for real-time oncoprotein platelet-derived growth factor
  superparamagnetic-Tat peptide conjugates. Bioconjugate Chem.             monitoring by fluorescence anisotropy. Anal. Chem. 73, 5752–
  10, 186–191.                                                             5757.
(18) Lewin, M., Carlesso, N., Tung, C.-H., Tang, X.-W., Cory,           (39) Stojanovic, M. N., de Prada, P., and Landry, D. W. (2001)
  D., Scadden, D. T., and Weissleder, R. (2000) Tat peptide-               Aptamer-based folding fluorescent sensor for cocaine. J. Am.
  derivatized magnetic nanoparticles allow in vivo tracking and            Chem. Soc. 123, 4928–4931.
  recovery of progenitor cells. Nat. Biotechnol. 18, 410–414.           (40) Li, J. J., Fang, X., and Tan, W. (2002) Molecular aptamer
(19) Josephson, L., Perez, J. M., and Weissleder, R. (2001)                beacons for real-time protein recognition. Biochem. Biophys. Res.
  Magnetic nanosensors for the detection of oligonucleotide                Commun. 292, 31–40.
  sequences. Angew. Chem., Int. Ed. 40, 3204–3206.                      (41) Nutiu, R., and Li, Y. (2003) Structure-switching signaling
(20) Perez, J. M., Josephson, L., and Weissleder, R. (2004) Use            aptamers. J. Am. Chem. Soc. 125, 4771–4778.
  of magnetic nanoparticles as nanosensors to probe for molecular       (42) Nutiu, R., and Li, Y. (2004) Structure-switching signaling
  interactions. ChemBioChem 5, 261–264.                                    aptamers: Transducing molecular recognition into fluorescence
(21) Zhao, M., Kircher, M. F., Josephson, L., and Weissleder, R.           signaling. Chem.sEur. J. 10, 1868–1876.
  (2002) Differential conjugation of Tat peptide to superparamag-       (43) Chen, Y., Wang, M., and Mao, C. (2004) An autonomous
  netic nanoparticles and its effect on cellular uptake. Bioconjugate      DNA nanomotor powered by a DNA enzyme. Angew. Chem.,
  Chem. 13, 840–844.                                                       Int. Ed. 43, 3554–3557.
(22) Zhao, M., Josephson, L., Tang, Y., and Weissleder, R. (2003)       (44) Nutiu, R., Mei, S., Liu, Z., and Li, Y. (2004) Engineering
  Magnetic sensors for protease assays. Angew. Chem., Int. Ed.             DNA aptamers and DNA enzymes with fluorescence-signaling
  42, 1375–1378.                                                           properties. Pure Appl. Chem. 76, 1547–1561.
(23) Perez, J. M., Simeone, F. J., Saeki, Y., Josephson, L., and        (45) Liu, Y., Lin, C., Li, H., and Yan, H. (2005) Aptamer-directed
  Weissleder, R. (2003) Viral-induced self-assembly of magnetic            self-assembly of protein arrays on a DNA nanostructure. Angew.
  nanoparticles allows the detection of viral particles in biological      Chem., Int. Ed. 44, 4333–4338.
  media. J. Am. Chem. Soc. 125, 10192–10193.
                                                                        (46) Tian, Y., and Mao, C. (2005) DNAzyme amplification of
(24) Tsourkas, A., Hofstetter, O., Hofstetter, H., Weissleder, R.,
                                                                           molecular beacon signal. Talanta 67, 532–537.
  and Josephson, L. (2004) Magnetic relaxation switch immun-
  osensors detect enantiomeric impurities. Angew. Chem., Int. Ed.       (47) Navani, N. K., and Li, Y. (2006) Nucleic acid aptamers and
  43, 2395–2399.                                                           enzymes as sensors. Curr. Opin. Chem. Biol. 10, 272–281.
(25) Ellington, A. D., and Szostak, J. W. (1990) In vitro selection     (48) Stojanovic, M. N., and Landry, D. W. (2002) Aptamer-based
  of RNA molecules that bind specific ligands. Nature (London)              colorimetric probe for cocaine. J. Am. Chem. Soc. 124, 9678–
  346, 818–822.                                                            9679.
(26) Tuerk, C., and Gold, L. (1990) Systematic evolution of ligands     (49) Liu, J., and Lu, Y. (2003) A colorimetric lead biosensor using
  by exponential enrichment: RNA ligands to bacteriophage T4               DNAzyme-directed assembly of gold nanoparticles. J. Am. Chem.
  DNA polymerase. Science 249, 505–510.                                    Soc. 125, 6642–6643.
(27) Wilson, D. S., and Szostak, J. W. (1999) In vitro selection of     (50) Pavlov, V., Xiao, Y., Shlyahovsky, B., and Willner, I. (2004)
  functional nucleic acids. Annu. ReV. Biochem. 68, 611–647.               Aptamer-functionalized Au nanoparticles for the amplified optical
(28) Famulok, M., Mayer, G., and Blind, M. (2000) Nucleic acid             detection of thrombin. J. Am. Chem. Soc. 126, 11768–11769.
  aptamers-from selection in vitro to applications in vivo. Acc.        (51) Liu, J., and Lu, Y. (2004) Adenosine-dependent assembly of
  Chem. Res. 33, 591–599.                                                  aptazyme-functionalized gold nanoparticles and its application
(29) Drolet, D. W., Moon-McDermott, L., and Romig, T. S. (1996)            as a colorimetric biosensor. Anal. Chem. 76, 1627–1632.
  An enzyme-linked oligonucleotide assay. Nat. Biotechnol. 14,          (52) Ho, H.-A., and Leclerc, M. (2004) Optical sensors based on
  1021–1025.                                                               hybrid aptamer/conjugated polymer complexes. J. Am. Chem.
(30) Wang, Y., Killian, J., Hamasaki, K., and Rando, R. R. (1996)          Soc. 126, 1384–1387.
  RNA molecules that specifically and stoichiometrically bind            (53) Huang, C.-C., Huang, Y.-F., Cao, Z., Tan, W., and Chang,
  aminoglycoside antibiotics with high affinities. Biochemistry 35,         H.-T. (2005) Aptamer-modified gold nanoparticles for colori-
  12338–12346.                                                             metric determination of platelet-derived growth factors and their
(31) Jayasena, S. D. (1999) Aptamers: an emerging class of                 receptors. Anal. Chem. 77, 5735–5741.
  molecules that rival antibodies in diagnostics. Clin. Chem. 45,       (54) Liu, J., and Lu, Y. (2006) Fast colorimetric sensing of
  1628–1650.                                                               adenosine and cocaine based on a general sensor design involving
(32) Liss, M., Petersen, B., Wolf, H., and Prohaska, E. (2002) An          aptamers and nanoparticles. Angew. Chem., Int. Ed. 45, 90–94.
  aptamer-based quartz crystal protein biosensor. Anal. Chem. 74,       (55) Liu, J., and Lu, Y. (2007) Non-base pairing DNA provides a
  4488–4495.                                                               new dimension for controlling aptamer-linked nanoparticles and
(33) Yamamoto, R., Baba, T., and Kumar, P. K. (2000) Molecular             sensors. J. Am. Chem. Soc. 129, 8634–8643.
  beacon aptamer fluoresces in the presence of Tat protein of HIV-       (56) Lu, Y., and Liu, J. (2006) Functional DNA nanotechnology:
  1. Genes Cells 5, 389–96.                                                emerging applications of DNAzymes and aptamers. Curr. Opin.
(34) Jhaveri, S. D., Kirby, R., Conrad, R., Maglott, E. J., Bowser,        Biotechnol. 17, 580–588.
  M., Kennedy, R. T., Glick, G., and Ellington, A. D. (2000)            (57) Lu, Y., and Liu, J. (2007) Smart nanomaterials inspired by
  Designed signaling aptamers that transduce molecular recognition         biology: dynamic assembly of error-free nanomaterials in
  to changes in fluorescence intensity. J. Am. Chem. Soc. 122,              response to multiple chemical and biological stimuli. Acc. Chem.
  2469–2473.                                                               Res. 40, 315–323.
(35) Stojanovic, M. N., de Prada, P., and Landry, D. W. (2000)          (58) Xu, D., Xu, D., Yu, X., Liu, Z., He, W., and Ma, Z. (2005)
  Fluorescent sensors based on aptamer self-assembly. J. Am.               Label-free electrochemical detection for aptamer-based array
  Chem. Soc. 122, 11547–11548.                                             electrodes. Anal. Chem. 77, 5107–5113.
Communications                                                                             Bioconjugate Chem., Vol. 19, No. 2, 2008 417

(59) Xiao, Y., Piorek, B. D., Plaxco, K. W., and Heeger, A. J.          molecules that bind and inhibit human thrombin. Nature (Lon-
  (2005) A reagentless signal-on architecture for electronic,           don) 355, 564–566.
  aptamer-based sensors via target-induced strand displacement.       (63) Tasset, D. M., Kubik, M. F., and Steiner, W. (1997) Oligo-
  J. Am. Chem. Soc. 127, 17990–17991.                                   nucleotide inhibitors of human thrombin that bind distinct
(60) Xiao, Y., Lubin, A. A., Heeger, A. J., and Plaxco, K. W.           epitopes. J. Mol. Biol. 272, 688–698.
  (2005) Label-free electronic detection of thrombin in blood serum   (64) Macaya, R. F., Schultze, P., Smith, F. W., Roe, J. A., and
  by using an aptamer-based sensor. Angew. Chem., Int. Ed. 44,          Feigon, J. (1993) Thrombin-binding DNA aptamer forms a
  5456–5459.                                                            unimolecular quadruplex structure in solution. Proc. Natl. Acad.
(61) Yigit, M. V., Mazumdar, D., Kim, H.-K., Lee, J. H.,                Sci. U.S.A. 90, 3745–3749.
  Odintsov, B., and Lu, Y. (2007) Smart “turn-on” magnetic            (65) Padmanabhan, K., Padmanabhan, K. P., Ferrara, J. D., Sadler,
  resonance contrast agents based on aptamer-functionalized             J. E., and Tulinsky, A. (1993) The structure of a-thrombin
  superparamagnetic iron oxide nanoparticles. ChemBioChem 8,            inhibited by a 15-mer single-stranded DNA aptamer. J. Biol.
  1675–1678.                                                            Chem. 268, 17651–17654.
(62) Bock, L. C., Griffin, L. C., Latham, J. A., Vermaas, E. H.,
  and Toole, J. J. (1992) Selection of single-stranded DNA              BC7003928

						
Other docs by fld20046