Get documents about "MRI Detection of Thrombin with Aptamer Functionalized
Document Sample
412 Bioconjugate Chem. 2008, 19, 412–417
MRI Detection of Thrombin with Aptamer Functionalized
Superparamagnetic Iron Oxide Nanoparticles
Mehmet Veysel Yigit,†,‡ Debapriya Mazumdar,‡,§ and Yi Lu*,†,‡,§,4
Center for Biophysics and Computational Biology, Beckman Institute for Advanced Science and Technology, Department of
Chemistry and Department of Biochemistry, University of Illinois at Urbana–Champaign, 600 S. Mathews Avenue, Urbana, IL
61801. Received October 22, 2007; Revised Manuscript Received November 27, 2007
Design of smart MRI contrast agent based on superparamagnetic iron oxide nanoparticles and aptamers has been
described for the detection of human R-thrombin protein. The contrast agent is based on the assembly of the
aptamer functionalized nanoparticles in the presence of thrombin. A detectable change in MRI signal is observed
with 25 nM thrombin in human serum. Changes were neither observed with control analytes, streptavidin, or
bovine serum albumin, nor with inactive aptamer functionalized nanoparticles.
Magnetic resonance imaging (MRI) is advancing rapidly, as molecules with high affinity and selectivity (25–28). They are
it provides noninvasive, three-dimensional examination of obtained through a combinatorial biology technique called
biological events in living organisms. A particularly active area systematic evolution of ligands by exponential enrichment
of research in the MRI field is the development of MRI contrast (SELEX), by isolating the active species from a large random
agents for image enhancement (1–9). Superparamagnetic iron pool of DNA or RNA molecules (25, 26). They are often
oxide nanoparticles (SPIOs) are attractive, since they are shown analogous to antibodies due to their selectivity and sensitivity
to be effective in enhancing magnetic resonance image contrast in binding to a broad range of molecules (29–32). When
(4). The applications of SPIOs in MRI have ranged from compared to antibodies, aptamers serve several advantages such
nontargeted detection of diseases by accumulating at certain
as the relative ease with which they can be selected for any
tissues to targeted detection of biomolecular markers in
target analyte and their stability against biodegradation and
cells (10–16). Target-specific MRI detection using SPIOs is
particularly interesting, as it helps monitor several cellular or denaturation. Due to these properties, aptamers are good
molecular processes (16–18). For example, cross-linked dextran- candidates for building chemical and biological sensors in many
coated superparamagnetic iron oxide (CLIO) nanoparticles have fields such as medical diagnostics and environmental monitoring.
been functionalized with different biomolecules and used for Therefore, these aptamers have been transformed into fluorescent
detection of different targets including oligonucleotides (19, 20) (33–47), colorimetric (48–57), and electrochemical sensors
proteins (17, 20, 21), enzymatic activities (22), viruses (23), (58–60). Although these aptamer sensors have been widely
and enantiomeric impurities (24). It has been shown that CLIO investigated in Vitro, their applications in ViVo remain a
nanoparticle assemblies create a distinctive magnetic phenom- significant challenge because light penetration through skin is
enon called magnetic relaxation switching (MRS), where the difficult and signal interference from cellular components is
core of a single nanoparticle in the assemblies becomes more common. Recently, we reported a method for combining
effective in enhancing T2 relaxation time of adjacent water adenosine aptamer and CLIO nanoparticles into a system to
protons, when compared to dispersed nanoparticles (4, 19). This detect adenosine in the micromolar range via MRI. The contrast
mechanism has been widely used in many magnetic detection in MR image of the nanoparticle solution increases as the
schemes either going from a disperse state to an assembled state adenosine concentration increases in the environment (61).
of nanoparticles or visa versa (19, 20, 22, 24). For instance, it Herein, we describe a new method for combining magnetic
has been shown that oligonucleotide functionalized dispersed relaxation switching properties of CLIO nanoparticles with
CLIO nanoparticles can be used for the sequence-specific
aptamer technology in order to create MRI contrast agents with
detection of complementary oligonucleotides simply by hybrid-
izing oligonucleotides and assembling CLIO nanoparticles into nanomolar detection limit. The advantage of this technique over
clusters (19). This process enhances the T2 relaxation of the other sensing methods is that MRI signal is much less vulnerable
nearby water protons and can be detected by MRI. While this to changes in background colors or fluorescence from biological
approach is effective in oligonucleotide detection, it would be media, such as serum and cell suspensions. In contrast to our
very interesting if this nucleic acid-based approach could be previously reported system with adenosine, which depends on
expanded beyond nucleic acid detection to MRI of even broader analyte-induced disassembly of particles to produce an increase
classes of targets. in brightness, this method is based on assembly of particles
Aptamers are single-stranded functional nucleic acid mol- leading to a decrease in brightness of MR image. This change
ecules which can bind a variety of chemical and biological in signal from bright to dark is a significant advantage, as this
is preferred in T2-weighted MR imaging. Furthermore, instead
* Fax: (+1) 217-333-2685. Tel: (+1) 217-333-2619. E-mail yi-lu@ of a metabolite, we demonstrate the detection of a protein in
uiuc.edu. the current system, as proteins constitute most enzymes and
†
Center for Biophysics and Computational Biology. biomolecular markers in living systems.
‡
Beckman Institute for Advanced Science and Technology.
§
Department of Chemistry. To demonstrate the use of aptamer functionalized CLIO
4
Department of Biochemistry. nanoparticles for protein detection we chose to detect thrombin
10.1021/bc7003928 CCC: $40.75 2008 American Chemical Society
Published on Web 01/04/2008
Communications Bioconjugate Chem., Vol. 19, No. 2, 2008 413
Scheme 1. Schematic Illustration for Thrombin Detection Using MRIa
a
The CLIO nanoparticles (shown as red spheres) have been modified with either Thrm-A, a DNA aptamer (shown as blue lines) that binds to
fibrinogen-recognition exosite of thrombin, or Thrm-B, a DNA aptamer (shown as green lines) that binds to the heparin-binding exosite of thrombin.
Addition of thrombin consisting of both fibrinogen (as blue donuts) and heparin (as green donuts) exosites resulted in aggregation of CLIO nanoparticle
assembly, reducing the T2 relaxation time. The DNA sequences are shown at the bottom. The drawing is not to scale.
via MRI . We combined the CLIO nanoparticles with thrombin
aptamers, Thrm-A, which binds to the fibrinogen-recognition
exosite of thrombin, and Thrm-B, which binds to the heparin-
binding exosite of thrombin, as shown in Scheme 1 (62, 63).
Materials: All DNA samples were purchased from Integrated DNA
Technologies Inc. (Coralville, IA). The thiol-modified DNA molecules
were purified by the standard desalting method. Human alpha thrombin
was purchased from Haematologic Technologies Inc. (Essex Junction,
VT). BSA was purchased from Aldrich (St. Louis, MO). Streptavidin
was purchased from SouthernBiotech (Birmingham, AL). N-Succin-
imidyl-3-(2-pyridylthio)-propionate (SPDP) was purchased from Mo-
lecular Biosciences (Boulder, CO). Cross-linked dextran coated super-
paramagnetic iron oxide nanoparticles (CLIO, 500 µg Fe mL-1) were
synthesized and coupled to SPDP according to literature procedure and
purified with PD-10 column (17). The thiol modified oligos, Thrm-A
(5′ SH-T15-GGTTGGTGTGGTTGG 3′), Thrm-B (5′ SH-TTTTTAGTC-
CGTGGTAGGGCAGGTTGGGGTGACT 3′), CNT-Thrm-A (5′ TCA-
CAGATGAGT-A12-SH 3′), and CNT-Thrm-B (5′ SH-CCCAGGT-
TCTCT 3′) were activated by incubating with eight equivalent of tris Figure 1. Particle size distribution of 1:1 CLIO-Thrm-A and CLIO-
(2-carboxyethyl) phosphine hydrochloride (TCEP). Excess TCEP was Thrm-B mixture before (light gray bars) and after (dark gray bars)
addition of 50 nM thrombin.
removed by desalting using a SepPak C-18 catridge. TCEP-activated
thiol modified DNA (50 µM final concentration) was mixed with CLIO-
SPDP (400 µg Fe mL-1) in 100 mM phosphate buffer at pH 8.0 The contrast agent designed for thrombin detection is composed
overnight. Excess DNA was removed by magnetic separation column of a 1:1 mixture of Thrm-A and Thrm-B functionalized CLIO
(Miltenyi Biotec, Auburn, CA) from CLIO-DNA conjugates. Sample nanoparticles (CLIO-Thrm-A and CLIO-Thrm-B, respectively)
preparation and MRI detection: CLIO-Thrm-A and CLIO-Thrm-B were in aqueous solution. In the presence of thrombin, aptamer
mixed in 1:1 ratio and diluted in 100 mM NaCl, 25 mM KCl, and 25 sequences fold into a G-quadruplex arrangement in order to bind
mM tris-HCl buffer at pH 7.4. 250 µL of sample (12 µg Fe mL-1) to thrombin (64, 65). After attachment of the CLIO nanoparticles
was aliquoted into the wells of a microplate and varying amounts of to thrombin, the disperse nanoparticles assemble into aggregates,
analyte was added in each well. T2-weighted MR images were obtained
changing the magnetic relaxation properties of nearby water
on a 4.7 T NMR instrument using a spin–echo pulse sequence with
variable echo time (TE ) 25–100 ms) and repetition time (TR) of 3000 protons, thereby reducing the T2 relaxation time. This event
ms. Light-scattering experiments: DLS measurements were performed can be monitored as a decrease in brightness of T2-weighted
using Nicomp 380 ZLS Particle Sizer (Particle Sizing Systems, Santa MR image of the solution via MRI (24).
Barbara, CA). An intensity-weighted value was used to report the To confirm that the aptamer functionalized nanoparticles bind
average particle diameter. to thrombin, 1 µM thrombin was added into the 1:1 homoge-
414 Bioconjugate Chem., Vol. 19, No. 2, 2008 Communications
Figure 2. (A) Contrast change in T2-weighted MR image in 1:1 CLIO-Thrm-A and CLIO-Thrm-B mixture with 0, 10, 25, and 50 nM thrombin
(first column), BSA (second column), and streptavidin (third column). (B) Contrast change in T2-weighted MR image with 0, 10, 25, and 50 nM
thrombin in CLIO-Thrm-A and CLIO-Thrm-B mixture (first column), and in CNT-CLIO-Thrm-A and CNT-CLIO-Thrm-B mixture (second column).
Figure 3. (A) Contrast change in T2-weighted MR image with 0, 10, 25, and 50 nM thrombin in CLIO-Thrm-A (first column), CLIO-Thrm-A and
CLIO-Thrm-B mixture. (Note: The image is completely dark at 50 nM thrombin) (second column) and in CLIO-Thrm-B (third column). (B)
Particle diameter change with CLIO-Thrm-A, 1:1 CLIO-Thrm-A and CLIO-Thrm-B mixture, or CLIO-Thrm-B with addition of thrombin.
increased from 58.9 ( 4.4 nm to 259.5 ( 22.5 nm. Figure 1
shows the intensity-weighted particle size distribution of CLIO
nanoparticles obtained with dynamic light scattering (DLS),
which indicates that the nanoparticles are cross-linked by
thrombin molecules, therefore increasing the average diameter.
At this CLIO nanoparticle concentration, precipitation of
nanoparticles was not observed (19). These results strongly
Figure 4. T2-weighted MR image of 1:1 CLIO-Thrm-A and CLIO- suggest that thrombin binding to aptamers on CLIO nanopar-
Thrm-B mixture in human serum. ticles induces the assembly of nanoparticles.
After confirming thrombin-induced assembly of nanoparticles
neous mixture of CLIO-Thrm-A and CLIO-Thrm-B (150 µg via DLS, we proceeded to check its utility as an MRI contrast
Fe mL-1), which resulted in rapid precipitation in seconds (data agent. The binding of CLIO-Thrm-A and CLIO-Thrm-B to
not shown). Similar behavior was not observed when bovine thrombin, assembled the nanoparticles into clusters, resulting
serum albumin (BSA) or streptavidin was used as an analyte. in a decrease of the T2 relaxation time of the neighboring water
This result indicates that the precipitation of nanoparticles is protons in the medium. We have tested the system at different
due to the binding event of analyte and its aptamer. Particle thrombin concentrations from 0 to 50 nM. A decrease in
size analysis also showed that, upon addition of 50 nM thrombin brightness of the MR image of the samples was observed as
into a mixture of CLIO-Thrm-A and CLIO-Thrm-B (12 µg Fe the concentration of thrombin was increased (Figure 2A), which
mL-1), the average diameter of CLIO nanoparticles immediately was attributed to a decrease in T2 relaxation time (24). A
Communications Bioconjugate Chem., Vol. 19, No. 2, 2008 415
noticeable change in contrast was observed even as low as 10 Imaging Center of the Beckman Institute for Advanced Science
nM thrombin, and a significant change was observed at 50 nM and Technology and University of Illinois at Urbana–Cham-
thrombin. paign.
To ensure that the contrast is solely due to the binding event
and not any other artifact, the system was tested with BSA and LITERATURE CITED
streptavadin. The MR images obtained with these two analytes
did not show a difference in contrast when their concentration (1) Carr, D. H., Brown, J., Bydder, G. M., Steiner, R. E.,
was increased from 0 to 50 nM. This result suggests that the Weinmann, H. J., Speck, U., Hall, A. S., and Young, I. R. (1984)
change in contrast is due to thrombin and not any other effect. Gadolinium-DTPA as a contrast agent in MRI: initial clinical
In order to check if the change in contrast is due to aptamer experience in 20 patients. Am. J. Roentgenol. 143, 215–224.
and analyte binding and not thrombin molecule itself, we have (2) Kabalka, G., Buonocore, E., Hubner, K., Moss, T., Norley, N.,
and Huang, L. (1987) Gadolinium-labeled liposomes: targeted
tested random DNA sequences of different lengths that do not
MR contrast agents for the liver and spleen. Radiology 163, 255–
bind to thrombin. To do so, we prepared a 1:1 mixture of random
258.
DNA sequence (CNT-Thrm-A and CNT-Thrm-B) functionalized (3) Weissleder, R., Hahn, P. F., Stark, D. D., Rummeny, E., Saini,
CLIO nanoparticles (CNT-CLIO-Thrm-A and CNT-CLIO- S., Wittenberg, J., and Ferrucci, J. T. (1987) MR imaging of
Thrm-B). The control samples were subjected to the same splenic metastases: ferrite-enhanced detection in rats. Am. J.
procedure as was used in preparing CLIO-Thrm-A and CLIO- Roentgenol. 149, 723–726.
Thrm-B, and then placed into the wells of a microplate. (4) Josephson, L., Lewis, J., Jacobs, P., Hahn, P. F., and Stark,
Thrombin was added to both systems with an increasing D. D. (1988) The effects of iron oxides on proton relaxivity.
concentration from 0 to 50 nM. The obtained MR images Magn. Reson. Imaging 6, 647–653.
showed a change in brightness for samples with CLIO-Thrm-A (5) Saeed, M., Wagner, S., Wendland, M. F., Derugin, N.,
and CLIO-Thrm-B, but no change with CNT-CLIO-Thrm-A and Finkbeiner, W. E., and Higgins, C. B. (1989) Occlusive and
CNT-CLIO-Thrm-B (see Figure 2B). This result suggests that reperfused myocardial infarcts: differentiation with Mn-DPDP–
the change in the MR signal is due to active thrombin binding enhanced MR imaging. Radiology 172, 59–64.
aptamers and not any other nonspecific interaction of DNA with (6) Li, W.-h., Fraser, S. E., and Meade, T. J. (1999) A calcium-
thrombin. The two control experiments taken together strongly sensitive magnetic resonance imaging contrast agent. J. Am.
indicate that the change in MR signal is solely due to the binding Chem. Soc. 121, 1413–1414.
event of thrombin to the aptamers, which results in assembly (7) Harisinghani, M. G., Barentsz, J., Hahn, P. F., Deserno, W. M.,
of CLIO nanoparticles into clusters, decreasing the T2 relaxation Tabatabaei, S., van de Kaa, C. H., de la, R. J., and Weissleder,
time of the environment. R. (2003) Noninvasive detection of clinically occult lymph-node
metastases in prostate cancer. N. Engl. J. Med. 348, 2491–2499.
In order to demonstrate that thrombin molecule requires a (8) Lee, J., Zylka, M. J., Anderson, D. J., Burdette, J. E., Woodruff,
mixture of CLIO-Thrm-A and CLIO-Thrm-B to generate a MR T. K., and Meade, T. J. (2005) A steroid-conjugated contrast
signal, we tried to use only CLIO-Thrm-A or CLIO-Thrm-B to agent for magnetic resonance imaging of cell signaling. J. Am.
detect thrombin. As seen in Figure 3A, the MR signal did not Chem. Soc. 127, 13164–13166.
change with neither of these nanoparticle suspensions, but a (9) Frullano, L., Tejerina, B., and Meade, T. J. (2006) Synthesis
clear change in MR signal was observed with the 1:1 mixture and characterization of a doxorubicin-Gd(III) contrast agent
of nanoparticles. The particle size analysis confirms this result, conjugate: A new approach toward prodrug-procontrast com-
as an increase in particle diameter was observed when thrombin plexes. Inorg. Chem. 45, 8489–8491.
was added into the 1:1 mixture of nanoparticles, but such an (10) Kresse, M., Wagner, S., Pfefferer, D., Lawaczeck, R., Elste,
increase was not observed with CLIO-Thrm-A or CLIO-Thrm-B V., and Semmler, W. (1998) Targeting of ultrasmall superpara-
alone (see Figure 3B). MR data and particle size analysis magnetic iron oxide (USPIO) particles to tumor cells in vivo by
together suggest that both CLIO-Thrm-A and CLIO-Thrm-B using transferrin receptor pathways. Magn. Reson. Med. 40, 236–
are necessary for detection of thrombin with magnetic relaxation 242.
switching. (11) Enochs, W. S., Harsh, G., Hochberg, F., and Weissleder, R.
(1999) Improved delineation of human brain tumors on MR
To check the utility of this system in biological fluids, we
images using a long-circulating, superparamagnetic iron oxide
tested our sample in 50% human serum. A clear change in the
agent. J. Magn. Reson. Imaging 9, 228–232.
MR signal was observed with 25 nM, and a significant change (12) Dodd, C. H., Hsu, H.-C., Chu, W.-J., Yang, P., Zhang, H.-
was seen with 75 nM thrombin (Figure 4). This result G., Mountz, J. D., Zinn, K., Forder, J., Josephson, L., Weissleder,
demonstrates that the system works in human serum without R., Mountz, J. M., and Mountz, J. D. (2001) Normal T-cell
interference of biological components in serum. response and in vivo magnetic resonance imaging of T cells
In conclusion, we demonstrated aptamer functionalized su- loaded with HIV transactivator-peptide-derived superparamag-
perparamagnetic iron oxide nanoparticles for detection of an netic nanoparticles. J. Immunol. Methods 256, 89–105.
analyte, which is dependent upon the binding event of aptamer (13) Kooi, M. E., Cappendijk, V. C., Cleutjens, K. B. J. M.,
conjugated CLIO nanoparticles and the target molecule. The Kessels, A. G. H., Kitslaar, P. J. E. H. M., Borgers, M., Frederik,
system demonstrated here is specific to thrombin and the P. M., Daemen, M. J. A. P., and van Engelshoven, J. M. A.
sensitivity is as low as 10 nM. Similar approaches can be applied (2003) Accumulation of ultrasmall superparamagnetic particles
to other aptamer and CLIO nanoparticle systems. of iron oxide in human atherosclerotic plaques can be detected
by in vivo magnetic resonance imaging. Circulation 107, 2453–
2458.
(14) Artemov, D., Mori, N., Okollie, B., and Bhujwalla, Z. M.
ACKNOWLEDGMENT (2003) MR molecular imaging of the Her-2/neu receptor in breast
cancer cells using targeted iron oxide nanoparticles. Magn. Reson.
The authors thank Natasha Yeung for helpful discussions and Med. 49, 403–408.
for comments on the manuscript and Dr. Boris Odintsov for (15) Corot, C., Petry, K. G., Trivedi, R., Saleh, A., Jonkmanns,
his help in operating the MRI equipment. This material is based C., Le, B. J.-F., Blezer, E., Rausch, M., Brochet, B., Foster-
upon work supported by the National Science Foundation Gareau, P., Baleriaux, D., Gaillard, S., and Dousset, V. (2004)
(DMR-0117792, DMI-0328162, and CTS-0120978), the U.S. Macrophage imaging in central nervous system and in carotid
Army Research Office (DAAD19-03-1-0227), and Biomedical atherosclerotic plaque using ultrasmall superparamagnetic iron
416 Bioconjugate Chem., Vol. 19, No. 2, 2008 Communications
oxide in magnetic resonance imaging. InVest. Radiol. 39, 619– (36) Li, J., and Lu, Y. (2000) A highly sensitive and selective
625. catalytic DNA biosensor for lead ions. J. Am. Chem. Soc. 122,
(16) Nitin, N., LaConte, L. E. W., Zurkiya, O., Hu, X., and Bao, 10466–10467. .
G. (2004) Functionalization and peptide-based delivery of (37) Hamaguchi, N., Ellington, A., and Stanton, M. (2001) Aptamer
magnetic nanoparticles as an intracellular MRI contrast agent. beacons for the direct detection of proteins. Anal. Biochem. 294,
J. Biol. Inorg. Chem. 9, 706–712. 126–131.
(17) Josephson, L., Tung, C.-H., Moore, A., and Weissleder, R. (38) Fang, X., Cao, Z., Beck, T., and Tan, W. (2001) Molecular
(1999) High-efficiency intracellular magnetic labeling with novel aptamer for real-time oncoprotein platelet-derived growth factor
superparamagnetic-Tat peptide conjugates. Bioconjugate Chem. monitoring by fluorescence anisotropy. Anal. Chem. 73, 5752–
10, 186–191. 5757.
(18) Lewin, M., Carlesso, N., Tung, C.-H., Tang, X.-W., Cory, (39) Stojanovic, M. N., de Prada, P., and Landry, D. W. (2001)
D., Scadden, D. T., and Weissleder, R. (2000) Tat peptide- Aptamer-based folding fluorescent sensor for cocaine. J. Am.
derivatized magnetic nanoparticles allow in vivo tracking and Chem. Soc. 123, 4928–4931.
recovery of progenitor cells. Nat. Biotechnol. 18, 410–414. (40) Li, J. J., Fang, X., and Tan, W. (2002) Molecular aptamer
(19) Josephson, L., Perez, J. M., and Weissleder, R. (2001) beacons for real-time protein recognition. Biochem. Biophys. Res.
Magnetic nanosensors for the detection of oligonucleotide Commun. 292, 31–40.
sequences. Angew. Chem., Int. Ed. 40, 3204–3206. (41) Nutiu, R., and Li, Y. (2003) Structure-switching signaling
(20) Perez, J. M., Josephson, L., and Weissleder, R. (2004) Use aptamers. J. Am. Chem. Soc. 125, 4771–4778.
of magnetic nanoparticles as nanosensors to probe for molecular (42) Nutiu, R., and Li, Y. (2004) Structure-switching signaling
interactions. ChemBioChem 5, 261–264. aptamers: Transducing molecular recognition into fluorescence
(21) Zhao, M., Kircher, M. F., Josephson, L., and Weissleder, R. signaling. Chem.sEur. J. 10, 1868–1876.
(2002) Differential conjugation of Tat peptide to superparamag- (43) Chen, Y., Wang, M., and Mao, C. (2004) An autonomous
netic nanoparticles and its effect on cellular uptake. Bioconjugate DNA nanomotor powered by a DNA enzyme. Angew. Chem.,
Chem. 13, 840–844. Int. Ed. 43, 3554–3557.
(22) Zhao, M., Josephson, L., Tang, Y., and Weissleder, R. (2003) (44) Nutiu, R., Mei, S., Liu, Z., and Li, Y. (2004) Engineering
Magnetic sensors for protease assays. Angew. Chem., Int. Ed. DNA aptamers and DNA enzymes with fluorescence-signaling
42, 1375–1378. properties. Pure Appl. Chem. 76, 1547–1561.
(23) Perez, J. M., Simeone, F. J., Saeki, Y., Josephson, L., and (45) Liu, Y., Lin, C., Li, H., and Yan, H. (2005) Aptamer-directed
Weissleder, R. (2003) Viral-induced self-assembly of magnetic self-assembly of protein arrays on a DNA nanostructure. Angew.
nanoparticles allows the detection of viral particles in biological Chem., Int. Ed. 44, 4333–4338.
media. J. Am. Chem. Soc. 125, 10192–10193.
(46) Tian, Y., and Mao, C. (2005) DNAzyme amplification of
(24) Tsourkas, A., Hofstetter, O., Hofstetter, H., Weissleder, R.,
molecular beacon signal. Talanta 67, 532–537.
and Josephson, L. (2004) Magnetic relaxation switch immun-
osensors detect enantiomeric impurities. Angew. Chem., Int. Ed. (47) Navani, N. K., and Li, Y. (2006) Nucleic acid aptamers and
43, 2395–2399. enzymes as sensors. Curr. Opin. Chem. Biol. 10, 272–281.
(25) Ellington, A. D., and Szostak, J. W. (1990) In vitro selection (48) Stojanovic, M. N., and Landry, D. W. (2002) Aptamer-based
of RNA molecules that bind specific ligands. Nature (London) colorimetric probe for cocaine. J. Am. Chem. Soc. 124, 9678–
346, 818–822. 9679.
(26) Tuerk, C., and Gold, L. (1990) Systematic evolution of ligands (49) Liu, J., and Lu, Y. (2003) A colorimetric lead biosensor using
by exponential enrichment: RNA ligands to bacteriophage T4 DNAzyme-directed assembly of gold nanoparticles. J. Am. Chem.
DNA polymerase. Science 249, 505–510. Soc. 125, 6642–6643.
(27) Wilson, D. S., and Szostak, J. W. (1999) In vitro selection of (50) Pavlov, V., Xiao, Y., Shlyahovsky, B., and Willner, I. (2004)
functional nucleic acids. Annu. ReV. Biochem. 68, 611–647. Aptamer-functionalized Au nanoparticles for the amplified optical
(28) Famulok, M., Mayer, G., and Blind, M. (2000) Nucleic acid detection of thrombin. J. Am. Chem. Soc. 126, 11768–11769.
aptamers-from selection in vitro to applications in vivo. Acc. (51) Liu, J., and Lu, Y. (2004) Adenosine-dependent assembly of
Chem. Res. 33, 591–599. aptazyme-functionalized gold nanoparticles and its application
(29) Drolet, D. W., Moon-McDermott, L., and Romig, T. S. (1996) as a colorimetric biosensor. Anal. Chem. 76, 1627–1632.
An enzyme-linked oligonucleotide assay. Nat. Biotechnol. 14, (52) Ho, H.-A., and Leclerc, M. (2004) Optical sensors based on
1021–1025. hybrid aptamer/conjugated polymer complexes. J. Am. Chem.
(30) Wang, Y., Killian, J., Hamasaki, K., and Rando, R. R. (1996) Soc. 126, 1384–1387.
RNA molecules that specifically and stoichiometrically bind (53) Huang, C.-C., Huang, Y.-F., Cao, Z., Tan, W., and Chang,
aminoglycoside antibiotics with high affinities. Biochemistry 35, H.-T. (2005) Aptamer-modified gold nanoparticles for colori-
12338–12346. metric determination of platelet-derived growth factors and their
(31) Jayasena, S. D. (1999) Aptamers: an emerging class of receptors. Anal. Chem. 77, 5735–5741.
molecules that rival antibodies in diagnostics. Clin. Chem. 45, (54) Liu, J., and Lu, Y. (2006) Fast colorimetric sensing of
1628–1650. adenosine and cocaine based on a general sensor design involving
(32) Liss, M., Petersen, B., Wolf, H., and Prohaska, E. (2002) An aptamers and nanoparticles. Angew. Chem., Int. Ed. 45, 90–94.
aptamer-based quartz crystal protein biosensor. Anal. Chem. 74, (55) Liu, J., and Lu, Y. (2007) Non-base pairing DNA provides a
4488–4495. new dimension for controlling aptamer-linked nanoparticles and
(33) Yamamoto, R., Baba, T., and Kumar, P. K. (2000) Molecular sensors. J. Am. Chem. Soc. 129, 8634–8643.
beacon aptamer fluoresces in the presence of Tat protein of HIV- (56) Lu, Y., and Liu, J. (2006) Functional DNA nanotechnology:
1. Genes Cells 5, 389–96. emerging applications of DNAzymes and aptamers. Curr. Opin.
(34) Jhaveri, S. D., Kirby, R., Conrad, R., Maglott, E. J., Bowser, Biotechnol. 17, 580–588.
M., Kennedy, R. T., Glick, G., and Ellington, A. D. (2000) (57) Lu, Y., and Liu, J. (2007) Smart nanomaterials inspired by
Designed signaling aptamers that transduce molecular recognition biology: dynamic assembly of error-free nanomaterials in
to changes in fluorescence intensity. J. Am. Chem. Soc. 122, response to multiple chemical and biological stimuli. Acc. Chem.
2469–2473. Res. 40, 315–323.
(35) Stojanovic, M. N., de Prada, P., and Landry, D. W. (2000) (58) Xu, D., Xu, D., Yu, X., Liu, Z., He, W., and Ma, Z. (2005)
Fluorescent sensors based on aptamer self-assembly. J. Am. Label-free electrochemical detection for aptamer-based array
Chem. Soc. 122, 11547–11548. electrodes. Anal. Chem. 77, 5107–5113.
Communications Bioconjugate Chem., Vol. 19, No. 2, 2008 417
(59) Xiao, Y., Piorek, B. D., Plaxco, K. W., and Heeger, A. J. molecules that bind and inhibit human thrombin. Nature (Lon-
(2005) A reagentless signal-on architecture for electronic, don) 355, 564–566.
aptamer-based sensors via target-induced strand displacement. (63) Tasset, D. M., Kubik, M. F., and Steiner, W. (1997) Oligo-
J. Am. Chem. Soc. 127, 17990–17991. nucleotide inhibitors of human thrombin that bind distinct
(60) Xiao, Y., Lubin, A. A., Heeger, A. J., and Plaxco, K. W. epitopes. J. Mol. Biol. 272, 688–698.
(2005) Label-free electronic detection of thrombin in blood serum (64) Macaya, R. F., Schultze, P., Smith, F. W., Roe, J. A., and
by using an aptamer-based sensor. Angew. Chem., Int. Ed. 44, Feigon, J. (1993) Thrombin-binding DNA aptamer forms a
5456–5459. unimolecular quadruplex structure in solution. Proc. Natl. Acad.
(61) Yigit, M. V., Mazumdar, D., Kim, H.-K., Lee, J. H., Sci. U.S.A. 90, 3745–3749.
Odintsov, B., and Lu, Y. (2007) Smart “turn-on” magnetic (65) Padmanabhan, K., Padmanabhan, K. P., Ferrara, J. D., Sadler,
resonance contrast agents based on aptamer-functionalized J. E., and Tulinsky, A. (1993) The structure of a-thrombin
superparamagnetic iron oxide nanoparticles. ChemBioChem 8, inhibited by a 15-mer single-stranded DNA aptamer. J. Biol.
1675–1678. Chem. 268, 17651–17654.
(62) Bock, L. C., Griffin, L. C., Latham, J. A., Vermaas, E. H.,
and Toole, J. J. (1992) Selection of single-stranded DNA BC7003928
