RDF Lab Manual - DOC

W
Shared by: decree
Categories
Tags
-
Stats
views:
168
posted:
4/20/2010
language:
English
pages:
129
Document Sample
scope of work template
							      MOLECULAR BIOLOGY
      LABORATORY MANUAL


A COMPILATION OF METHODS CURRENTLY USED IN
            THE LABORATORY OF
               DR. B. HILDA YE




                   pag. 1
                          TABLE OF CONTENTS
                           METHOD                                PAGE

1.    Oligolabeling (Random priming)                                5

2.    Screening Recombinant Phage Libraries                         7

3.    Total RNA Preparation                                        13

4.    Phage Mini-prep                                              17

5.    PEG Plasmid Prep                                             19

6.    Extraction of DNA from Low Melting Point Agarose Gels        21

7.    Plasmid Cloning: Ligation and Transformation                 22

8.    Preparation of Plasmid Cloning Vectors                       24

9.    Preparation and Freezing of Competent Bacteria               25

10.   Lambda Phage Prep                                            27

11.   Screening Library with Oligonucleotides Probes               29

12.   Preparation of Polyacrylamide-Urea "Sequencing" Gels         30

13.   Southern Blotting and striping filters                       36

14.   DNA Sequencing                                               39

15.   Field Inversion Gel Electrophoresis                          43

16.   DNA Molecular Weight Markers                                 44

17.   Retroviral Gene Transfer: Infections Cells in Suspension     46

18.   Titration of Virus-producing Cells                           48

19.   Run-Off Transcription                                        50

20.   RNase Protection Assay                                       58

21.   Northern Blotting                                            64

22.   Freezing Bacteria                                            65
                                    pag. 2
23.   Multi-gene Expression Assay (Reverse Northern Slot Blot)    66

24.   Mini-prep Plasmid DNA Protocol for Sequenase                67

25.   Purification of Crude Oligonucleotides                      70

26.   Preparation polyA+ mRNA                                     73

27.   Direct sequencing of PCR Amplified Fragments                74

28.   Oligomer Purification for Trityl off Synthesis              77

29.   Protocol for Race-PCR                                       78

30.   Electroporation and selection of human B and T cells        82

31.   CAT assay                                                   86

32.   Beta galactosidase assay                                    90

33.   Transfection by Ca-P Precipitation                          91

34.   Agar cloning                                                93

35.   Freezing tissue cultured cells                              95

36.   Titration of virus producing cells (simplified method)      96

37.   Titration of virus producing clones by RT-PCR               98

38.   Recipes of Cell Culture                                    101

39.   Pulse Field Gel Electrophoresis                            102

40.   SSCP (Single Strand Conformation Polymorphism)             105

41.   Immunofluorescence (HA)                                    108

42.   Aldh Assay                                                 109

43.   Instructions for Blotter (Genie)                           110

44.   Suggestions on How to scan a Picture                       111

45.    Protocol for SDS-PAGE (Laemmli)                           112

46.   Cisplatin Resistance Assay                                 113
                                    pag. 3
47.   MTT Assay                                                  114

48.   96 well microplate staining for FACS analysis              115

49.   96 well microplate nuclear staining for FACS analysis      117

50.   Gel mobility shift assay (EMSA)-for BCL-6                  119

51.   Rapid mouse tail tip DNA extraction protocol               120

52.   Preparation of total DNA from apoptotic cells              121

53.   Starvation of Rat-1 myc cells                              122

54.   Stain for Beta-Galactosidase Expression in Cell Culture    123

55.   Procedures for Inducing Gene Expression from MT Promoter   127




                                  pag. 4
1. Oligolabelling (Random Priming)
           Feinberg and Vogelstein (1983) Anal Biochem 132:6-13 and (1984)
Anal Biochem 137:266-267.



-DNA to be labeled (if not ≤ 500 bp, cleave with an appropriate restriction
enzyme)
-32P- -dATP (dCTP), 3000 Ci/mmole, 10 mCi/ml
-Klenow fragment (labeling grade-BMB #1008 404), this enzyme is very labile,
keep on ice and return to -20° as soon as possible.
-G-50 medium Sephadex swollen in TNE (TE + 100 mM NaCl)
-5X OLB -dA (-dC)
-Dry ice

To make 5X OLB-dATP(or -dCTP) mix Solutions A:B:C in the ratio of
100:250:150 (see below):

Buffer "O":   1.45 M TrisHCl pH 8.0
              0.145 M MgCl2

Solution A:   0.865 ml Buffer O
              0.018 ml 2-mercaptoethanol
              0.005 ml of each of 100 mM solutions of dGTP, dTTP and dCTP
              (or dATP) obtained from Pharmacia (#27207001, #27208001, and
              #27206001 (or #27205001), respectively)
              0.135 ml H2O

Solution B:   2M HEPES pH 6.6 @ 4°.

Solution C:   d(N)6 Pharmacia # 27-2166, 90.0 O.D. units/ml in H2O

                                       -70°. Aliquots can be thawed and then
refrozen @ -20°.



1. Denature DNA fragment to be labeled (fragments should be <500 bp in length
for optimal labeling). Begin thawing 32P.

              Mix 25 ng DNA fragment and H2
              Boil 3 min
              Chill on ice->Spin 2" to pellet droplets.

2. Add 5X OLB-dA, 32P-dATP, Klenow:

              5X OLB-dA (Oligonucleotide buffer without dATP)

                                       pag. 5
               32P-                        dry ice!)
               Klenow fragment 2U/ul


               Total volume:

3. Incubate @ room temperature 2-24 hr. The labeling reaction can be scaled up
proportionately as needed.

               Terminate reaction by adding: 0.5 M EDTA pH 8
                                              TNE
               This yields a final volume of:

4. Next, separate reacted from unincorporated 32
Sephadex G-50 spin column equlibrated in TNE. Spin 4 min @ setting marked
6.6 on yellow Fisher Centrific Centrifuge. (See Maniatis manual, p. 466.)

                of eluate mixed in 5 ml scintillant in a liquid scintillation counter (all
channels open). This should yield 100 - 500,000 cpm, which yields specific
activities of ~4 x 108 - 2 x 109. The probe should be stored @ -20° (shielded in a
plexiglas box) and can be used for 3-4 days.




                                         pag. 6
2. Screening Recombinant Phage Libraries
           Modified from Maniatis manual as per a Clontech technical bulletin.



For titering and plating:
-Bacteria: E. coli C600 hfla- (for
or EMBL genomic libraries); an O/N culture (from a frozen stock prepared from a
single colony) is pelleted (3000 rpm, 4°, 20' in a table top Sorvall) and
resuspended in 10 mM MgSO4 and kept @ 4° for up to 6 wk.
-10 mM MgSO4 (sterile, for preparing the bacterial culture above)
-Plates:
       For lifts: 150 mm dishes (Falcon "Integrid", VWR #25383103), containing
       40 ml bottom agar (15% agar in LB broth (GIBCO #M27000B))
       For titering: 100 mm dishes (VWR #25384-070) containing 15 ml bottom
       agar
-NZYCM top agarose (prepare aliqouts by combining 1.8 g agarose with 250 ml
NZYCM broth (Gibco #M36550) and autoclaving; to use melt and cool to 60°)
-SM buffer (100 mM NaCl / 8 mM MgSO4 / 50 mM Tris, pH 7.5 / 0.01% gelatin)
       To prepare, combine:
           5.8 g. NaCl, 2 g. MgSO4•7 H2O, 25 ml 2 M Tris-HCl, pH 7.5, and 5 ml
           2% gelatin . Bring to 1000 ml total volume with H2O. Autoclave.
-Phage library to be screened (100,000 to 1,000,000 pfu)
For plaque lifts:
-Nitrocellulose filters (BA85; 137mm, S&S, VWR.#28151830 or Sartorius
#11336.137K; the latter are a bit more fragile)
-Buffers (all of which are normally maintained as lab stocks):
       Denaturing solution (0.5 N NaOH / 1.5 M NaCl)
       Neutralizing solution (0.5 M Tris-HCl, pH 7.4 / 3.0 M NaCl)
       3XSSC; diluted from 20X SSC (3 M NaCl / 0.3 M Na Citrate pH 7.0)
-3MM Whatman paper (VWR #21427386)
-Permanent black ink (India ink)
-Forceps (Millipore #?)
For hybridization and washing:
-Pretreatment, wetting and hybridization solutions:

                    Pretreatment Solution

Volume             Stock                             Final

 250 ml            100% Formamide                    50%
                   BRL #5515UB
  75 ml            20X SSC                           3X
  25 ml            2M Tris•HCl, pH 7.4               0.1 M
  50 ml            50X Denhardt's Solution§          5X
 100 ml            dH2O
 500 ml
                                    pag. 7
§ 50X Denhardt's solution contains 1g. of PVP, Ficoll & BSA per 100 ml H 2O

-Hybridization solution is the same as above except that 100 ml 50% dextran
sulfate in H2O is used instead of 100 ml H2O. To prepare dextran sulfate, weigh
out 25 g into two 50 ml Falcon orange-cap tubes. Add H2O and heat 37° - 60° C
until dissolved.
-Wetting solution is prepared the same way as pretreatment solution except that
50 ml of H2O is used in place of 50 X Denhardt's solution.
-Random priming reagents (see Procedure #1)
-Salmon sperm DNA, sonicated (10 mg/ml)
-Washing solution (0.2 X SSC / 0.5% SDS; assuming high stringency screening)
-60° water bath
-Fluorescent or radioactive "ink"



This procedure outlines the screening of a typical recombinant phage library.
Begin by titering the library, and then plating phages, at high density, on 150 mm
agar plates. The phages are "lifted" in duplicate onto nitrocellulose filters, which
are subsequently treated to fix and denature the phage DNA. Next, an
appropriate probe is hybridized to the filters and the primary phage isolates are
identified, picked and purified by further rounds of lifting and hybridizing. The
procedures outlined here take about 11 days to obtain purified phages.

Day 1: Titer the library:

Beginning with a library of unknown titer, it is first necessary to determine the
titer. To do this prepare a series of dilutions one or two logs above or below the
"expected" titer.

1. From each dilution assemble the following in a (sterile) 16 ml snap cap tube:

     Phage in SM buffer                                                  100
     Host bacteria (choose an appropriate host and prepare as
     above; the amount of bacteria used may have to be
     established empirically)

2. Incubate @ 37° for 10'.

3. Combine each dilution with 3.5 ml top agarose (cooled to 60°) and (quickly!)
plate on a 100 mm plate.

4. Incubate, inverted, O/N @ 37°.

5. Count the plaques and determine the titer (pfu/ml).



                                       pag. 8
Day 2: Plate out the library

1. Calculate the number of plaques to screen. This varies from one experimental
situation to the next. In general, it is necessary to screen 1 x 106 pfu to isolate a
single copy gene from a genomic library, while 1 x 105 pfu may be sufficient to
identify an abundantly expressed cDNA clone. About 1 x 10 4 to 5 x 104 pfu can
be squeezed onto a 150 mm plate, depending on the size of the plaques
produced by a given phage. This procedure is designed to screen about 20
plates at a time. It is often helpful to plate a few "trial" plates at a variety of (high
density) titers in order to see how many pfu can be squeezed onto a plate.

2. For each plate prepare the following in a (sterile) 16 ml snap cap tube:

     Phage in SM buffer                                                      200
     Host bacterial

3. Incubate @ 37° for 10'.

4. Combine each dilution with 7.5 ml top agarose (cooled to 60°) and (quickly!)
plate on a 150 mm plate.

5. Incubate, inverted, O/N @ 37°.

Day 3: Lift plaques (transfer to nitrocellulose filters)

1. Chill plates > 1 hr. @ 4° (keep cold until use).

2. While plates are chilling label two 137 mm nitrocellulose filters for each plate
to be screened.

3. Remove two plates at a time from the refrigerator and make duplicate plaque
lifts from each:

       -Carefully center the filter on the plate (it sometimes helps to partly fold
       the filter in half when aligning it with the plate) and with gloved fingers
       make sure it is in contact with the top agarose.

       -Begin timing 1' and mark the filter and the plate using a 1 cc syringe filled
       with permanent black ink.

       -Remove the filter with a forceps and place it to dry (plaques up!) on a
       sheet of 3MM paper

       -Repeat this process for the duplicate filter, this time allowing 2' contact
       with the top agarose layer and marking the filter in the same places as the
       first filter

       -Lift all the filters first, before proceeding with the next steps

                                         pag. 9
5. In order to treat the filters to denature and fix the phage DNA on the
nitrocellulose, prepare three pans (pyrex glass dishes work well) containing:

       -Denaturing solution (~500 ml in a dish about 28 x 18 cm )
       -Neutralizing solution (~800 ml in a dish about 38 x 25 cm)
       -3 X SSC (~800 ml in another dish about 38 x 25 cm)

6. Float two filters at a time, plaque-side up, for 1' (rather precisely), in
denaturing solution. At the end of the 1' treatment submerged briefly, drain and
then submerge the filters in the dish containing neutralizing solution.

7. Repeat step 6 for two more pairs of filters (collect six filters in the neutralizing
bath; there will be some overlap among the submerged filters).

8. Soak these six filters an additional 5' in neutralizing solution

9. Remove filters from the neutralizing solution, drain and submerge in 3 X SSC.

10. Once the first set of six filters are in the 3 X SSC, return to step 6 and
denature etc. another set of six filters.

11. While the second set of six filters is soaking in the neutralizing solution (step
8), remove the first set of six filters from the 3X SSC, drain and place on 3MM
paper to air dry.

12. Continue this process (steps 6-11) until all filters have been denatured,
neutralized, soaked in 3 X SSC and finally air dried.

Day 4: Hybridization of filters

1. Collect the dried filters into a stack, separating each filter with a 6" x 6" piece
of 3 MM paper.

2. Bake filters in 80° vacuum oven for 2 hr.

3. Pretreat the filters as follows:

       -Use one square tupperware dish for every 20 or so filters. Pour about 50
       ml of wetting solution in a separate dish and briefly wet each filter, then
       place into the tupperware dish, squeezing out air bubbles trapped
       between filters with gentle finger tip pressure. Drain off residual wetting
       solution and then add 100 ml of pretreatment solution (for 20 filters).

       -Denature salmon sperm DNA by boiling for 5' and then cooling on ice.

       -For 20 filters in a single dish, add:

               1.0 ml denatured salmon sperm (final concentration = 100
               1.0 ml 20% SDS (final concentration = 0.2% v/v).

                                        pag. 10
       -Incubate for 4 hr. on a platform shaker (very gentle shaking) @ 37°.

4. While the pretreatment is taking place, label the probe for screening the library
(see Procedure #1). Scale up the labeling reaction to provide 2.5-5.0 x 106 cpm
per filter.

5. Hybridize the filters as follows:

       -Denature the probe and salmon sperm DNA by boiling for 5' and chilling
       on ice.

       -Drain off all of the pretreatment solution

       -For 20 filters in a single dish, add:

              50 ml hybridization solution
              0.5 ml denatured salmon sperm (final concentration = 100
              0.5 ml 20% SDS (final concentration = 0.2% v/v).
              denatured probe (0.5-2.0 x 106 cpm per ml)

       -Incubate for O/N on a platform shaker (very gentle shaking) @37°.

Day 5: Wash and expose filters

1. Wash the filters as follows (assuming 100% homology between probe and
phages sought ):

       -Pour off hybridization solution into liquid radioactive waste container in
       the hood. Wear lab coat and double-gloves.

       -Wash filters 4X successively at RT with 0.2X SSC/0.5% SDS. Discard
       the first two washes into liquid radioactive waste container in the hood.

       -Wash filters 4X, 30' each time, @ 60° in a large metal pan with a large
       excess of 0.2X SSC/0.5% SDS (~1L).

       -Wash filters 1X with 3X SSC @ RT (to remove SDS).

       -Air dry filters @ RT

2. Expose filters as follows:

       -Wrap filters between sheets of plastic wrap (6 filters per large cassette)

       -Mark plastic wrap with phosphorescent paint for alignment

       -For plaques which are 100% homologous to the probe, expose for 16 hr.
       @ RT without enhancing screens (or 3 hrs. with screens @ -70°)
                                        pag. 11
Day 6: Pick primary plaques and titer for secondary screening

1. Align autoradiographs with filters, marking the position of the needle marks.
Then choose "primary" positive(s) by aligning plates with autoradiograph. If
plated at the high density suggested,i.e., 1 x 104 - 5 x 104 /plate, the "primary" is
punched out using the back of a Pasteur pipetted and allowed to diffuse into 1 ml
SM buffer (> 1 hr. @ RT).

2. Titer the primary "picks" as per the Day 1 procedure; expect titers of ~1-10 x
107.

Day 7: Plate primary plaques for secondary screening

1. Plate 200-300 pfu as per the Day 2 procedure (on 150 mm plates)

Days 8, 9 and 10: Lift, hybridize and wash filters for secondary screening

1. Follow the Day 3, 4 and 5 procedures to obtain secondary phages

Day 11: Pick purified plaques

1. As per Day 6, step 1, pick purified plaques which are now ready for further
analysis. Sometimes it is necessary to perform a third round of screening to
obtain a pure plaque. If there are no positives, it may be necessary to repeat the
secondary screening at a higher density, and then follow this with a third round of
screening.




                                      pag. 12
3.Total RNA Preparation
             Chirgwin et al. (1979) Biochemistry 18:5294



RNAase-free solutions:

√DEPC H2O: Add diethylpyrocarbonate (DEPC) to H2
ml) and autoclave.
√3M Sodium acetate pH 5.2 / 0.1% DEPC (autoclave)
√0.5 M EDTA pH 8 / 0.1% DEPC (autoclave)
√2 M Tris-HCl pH 7.5 (make up in previously autoclaved DEPC H2O)

Use these solutions to prepare the following RNAase-free solutions (for
extracting RNA from cells grown in tissue culture):

√5 M CsCl:       Weigh out 41.6 g cesium chloride (CsCl) (BRL # 5507UB) into a
                 50 ml polypropylene "Falcon" tube. Add 0.5 ml EDTA and 1.67
                 ml 3 M sodium acetate, pH 5.0. Top up to 50 ml with DEPC H2O.
                 Dissolve.and filter. Store @ RT.

√4 M GITC:       Weigh out 23.6 g guanidine isothiocyanate (GITC) (BRL
                 #5535UA). Add 0.5 ml EDTA and 1.67 ml 3 M sodium acetate,
                 pH 5.0. Top up to 50 ml with DEPC H2O. Warm @ 37° C to
                 dissolve. Store @ 4° C for 2 - 5 days (or @ -20° for longer).
                                        or
             For extracting RNA from frozen 1 ml vials of tumor cells:

√4.6 M GITC:    Weigh out 27.1 g. guanidine isothiocyanate (GITC) (BRL
                #5535UA). Add 0.57 ml EDTA and 1.92 ml 3 M sodium acetate,
                pH 5.0. Top up to 50 ml with DEPC H2O. Warm @ 37° C to
                dissolve. Store @ 4° C for 2 - 5 days (or @ -20° for longer).
                                      or
                For extracting RNA from fresh tumors or tissues:

√4 M GITC        Weigh out 23.6 g guanidine isothiocyanate (GITC) (BRL
plus 2-ME:       #5535UA). Add 2.5 ml 2M Tris-HCl pH 7.4 and 0.5 ml 2-ME (14
                 M). Top up to 50 ml with DEPC H2O. Warm @ 37° C to dissolve.
                 Store @ 4° C for 2 - 5 days (or @ -20° for longer).

-SW41 rotor, buckets and disposable polyallomer tubes (Beckman #331372)
-RNAase free plasticware: tips, microfuge tubes etc.
-Reagents for an agarose-formaldehyde gel (see Procedure #?)




                                    pag. 13
Day 1

1. Lyse the cells or tissue in GITC:

For cells in suspension culture: Extract RNA from 100 - 150 x 106 cells
(depending on the volume of the particular cell type) per gradient, i.e., 7.5 ml
GITC per 100 - 150 x 106 cells. Cells should be "healthy" in log-phase growth.

        Pellet cells (no need to wash). Pour off media. Stand upside down to
        drain.

        Vortex and/or pipette to resuspend fully. (Use a 10 ml pipette.)

For adherent cells in culture: Extract RNA from about 1-3 large (15 cm) plates
per gradient. Again, cells should be in log phase growth (i.e. subconfluent).

        Aspirate media off plates and rinse once with PBS. Aspirate off as much
        of the PBS as possible.

        Add a small quantity of GITC to each plate and lyse cells by gently rocking
        plate.

        Use a disposable scaper and pipet to recover the lysate.

For frozen tumor cells from DK: Extract RNA from a 1 ml vial. Expect yields
between 50-200

        Thaw rapidly @ 60 - 70° C, and then immediately pipeting the contents of
        the vial into 6.5 ml of a 4.6 M GITC solution.

For fresh tissue or tissue blocks frozen in OTC:

        Freeze the tissue immediately in liquid nitrogen, or pry tissue block (in
        OTC) off cork backing and keep on dry ice.

        Place frozen tissue between two (RNAase-free) weighing boats, on top of
        a large flat piece of dry ice.

        Moving quickly, use a hammer to pulverize the tissue into dust and then
        pour these fragments into an appropriate amounty of GITC with 2-ME.
        Immediately grind up tissue with a Polytron homogenizer, and adjust
        volume with GITC/2-ME.

2. Shear with 18 gauge needle. (This should enhance yield if lysate is very
viscous by preventing "trapping"). Usually not necessary with tumor cell
preparations. Do not shear if also recovering DNA.


                                       pag. 14
3. Using a 10 ml pipette, put 4.0 ml CsCl into SW41 tube (polyallomer tubes,
Beckman).

4. Using a Pasteur pipette, layer 7.5 ml GITC-lysate. 7.5 ml/tube X 6 tubes = 45
ml. Balance +/- 10 mg per pair, e.g., 1 & 4; 2 & 5; 3 & 6.

5. Spin 31,00 rpm @ 20° C for 16 - 24 h in a SW41 rotor (brake "on" is O.K.).

Day 2

1. With a Pasteur pipette and house vacuum, aspirate all but about 0.5 ml of the
gradient. Remember to label gradients on lower portion of tube!

2. Take to hood. Heat scalpel in flame. Cut off all but lower 0.5 cm of tube.

3. Return to the bench and pour off rest. Invert to drain at room temperature for
15 min. A blue white pellet should be visible. The sample can be frozen @ -70°
at this point and stored more or less indefinitely.

4. Prepare a series of microfuge tubes containing phenol, phenol-CIA and CIA in
preparation for step 6.

5. Resuspend pellet in DEPC H2O (usually 0.4 ml per gradient). Once the pellet
is resuspended, immediately pipet into a microfuge tube containing phenol and
hold on ice while resuspending the remaining pellets. Work quickly.

6. Extract (usually in microfuge tubes for speed and convenience):
                      2X with phenol
                      2X with phenol:CIA
                      1X with CIA

7. Add 0.1 volumes 3 M Na acetate, pH 5.0 plus 2.5 volumes 100% ethanol.
Incubate on dry ice for at least 15 min. Spin in microfuge for 15 min.
Resuspend pellet in small volume, according to expected yield. Remove an
aliquot and freeze the remainder on dry ice; store @ -70°. Read the optical
density in spectrophotometer on the aliquot. to determine the yield.

8. Run a 1% agarose-formaldehyde mini-gel (see Procedure #? for details on the
reagents) to assess the quality of the RNA:

        -Prepare the gel by combining the following in a 50 ml "Falcon" tube:
                     10 X FGRB                                 2.5 ml
                     37% Formaldehyde                          4.5 ml
                     1.4% molten agarose prepared in H2O 18 ml
        -Pour the minigel (immediately) in a chemical hood!
        -When set add 1 x FGRB to submerge the gel and return to bench top



                                     pag. 15
-Prepare the RNA for electrophoresis by combining (in an RNAase-free
tube):
              RNA (2-                    2O
              (If the [RNA] < 1 mg/ml, it is necessary to EtOH ppt the
                                                                  2O)
              10 X FGRB                                        l
              37% Formaldehyde
              100% deionized Formamide
-Heat @ 60° for 5'
-
-After electrophoresis:
              Soak 2-3 X 5' in H2O to remove formaldehyde
                                                             in
              Soak 2-3 X 5' in H2O to destain
              Photograph




                             pag. 16
4. Phage Mini-Prep
            Adapted from Maniatis



-SPN: 20% (w/v) PEG / 2M NaCl
       To prepare, combine:
          100 g polyethylene glycol (PEG) 8000 (Fisher Carbowax 8000 #P155-
          500) plus 58.44 g. NaCl. Bring to 500 ml total volume with SM buffer.
          Autoclave. Store @ 4°.
-SM: 100 mM NaCl / 8 mM MgSO4 / 50 mM Tris-HCl, pH 7.5 / 0.01% gelatin
       To prepare, combine:
          5.8 g. NaCl, 2 g. MgSO4•7 H2O, 25 ml 2 M Tris-HCl, pH 7.5, and 5 ml
          2% gelatin . Bring to 1000 ml total volume with H2O. Autoclave.
-Plates: 15% agarose in NZCYM broth
       To prepare, combine:
          7.5 g. agarose and 500 ml NZCYM broth (GIBCO #M36550, prepared
          as per instructions on bottle) and autoclave. Cool to 60° and dispense
          40 ml per 150 mm plate.
-Top agarose: 7.5% agarose in NZYCM broth
       To prepare, combine:
          1.8 g. agarose and 250 ml NZYCM broth. Autoclave and cool to 60°.
-RNAaseA: 10 mg/ml in H2O
-DNAseI: 10 mg/ml in H2O
-Water baths set to 37° and 68°



DAY 1

1. For each purified plaque, prepare one confluent 150 mm plate (or three 100
mm plates). This usually requires 10-
has been eluted in 1 ml SM buffer. Plate phage (see Procedure #2) and
incubate overnight @ 37°.

DAY 2

N.B.: All of the waste (including the spent bacterial plates) from steps 1-10
should be placed in a biohazard bag and autoclaved in order to prevent
contamination of the bench etc. with phage particles.

2. Add 13-15 ml of SM buffer per plate plus 25-                   rm (not CHCl3 :
IAA). Shake gently @ RT for 2 hr.

3. Collect SM (10 ml) in a 16 ml snap-cap polypropylene tube.

4. Spin 8000 rpm @ 4° for 10 min in Sorvall SS-34 rotor.
                                      pag. 17
5. Decant supernatant into 30 ml Corex tubes.

                                        wrap with parafilm and mix. Incubate for
30' @ 37°.

7. Add 10 ml SPN (4°), wrap with parafilm and mix, and then incubate 1 hr. on
ice (store O/N at this point , if desired…).

8. Spin 10,000 rpm for 20' @ 4°. Discard supernatant and drain inverted.

9. Resuspend in 1 ml SM. Vortex into solution. Spin 2', and recover
supernatant. (A loose white pellet is usually present and should be discarded).

10. Add 5

11. Extract with 0.4 volumes of…
                     Phenol (2X)
                     Phenol: chloroform: iso-amylalcohol (CIA) (1X)
                     CIA (1X)

12. Add isopropanol 1:1 v/v to precipitate DNA. The precipitate should be
immediately obvious. If necessary, add NaAcetate to 0.3 M and incubate on wet
ice for 10'. Spin in microfuge for 10' @ RT

13. Discard supernatant and rinse pellet with 70% EtOH. Drain and remove all
residual EtOH. Air dry for 5-10'.

14. Resuspend in 50
minutes.

                            -

Incubate overnight.

DAY 3

16.                                      -

immediately visible (if not incubate on ice for 10'). Spin 5' in microfuge, drain and
remove all residual EtOH and air dry briefly.

17. Resuspend in a convenient volume, and electrophorese on a mini-gel to
determine the size of the insert. Transfer the mini-gel (see Procedure ?) in order
to hybridize to the original probe used in isolating phage.




                                      pag. 18
5. PEG Plasmid Prep
           Modified from the Promega Biotec catalog.



-Solution I: 50 mM glucose / 10 mM EDTA pH 8.0 / 25 mM Tris pH 8
       To prepare, combine:
            4.5 g. glucose, 6.25 ml 2M Tris-HCl pH 8.0 and 10 ml 0.5 M EDTA pH
            8.0 in a final volume of 500 ml H2O, autoclave and store @ 4°.
-Solution I with lysozyme (2 mg/ml ).
       Prepare fresh each day. Each 250 ml prep requires 6 ml.
-Solution II: 0.2 N NaOH / 1% SDS
       To prepare, combine:
            1 ml 10 N NaOH and 2.5 ml 20% SDS in a final volume of 50 ml H 2O.
            Prepare fresh each day. Each 250 ml prep requires 12 ml.
-Solution III: 3 M potassium / 5 M acetate
       To prepare:
            dissolve 147.23 g. potassium acetate (Fisher #BP 364-500) in ~ 350
            ml H2O, add 57.5 ml of glacial acetic acid, adjust volume to 500 ml
            with H2O, filter and store @ 4°. Each 250 ml prep requires 7.5 ml.
-PEG solution: 13% (w/v) polyethylene glycol in H2O
       Dissolve, autoclave and store @ RT.
-Phenol:CIA



1. Grow bacteria by combining the folowing in a plastic 2 L erlenmeyer flask:
             0.1 - 0.5 ml miniprep culture or starter culture.
             0.5 ml stock Ampicillin (stock = 50 mg/ml; final = 100
             250 ml LB broth

2. Shake overnight @ 37°; if needed, remove 5 ml of culture to grow a bacterial
stock for storage (freezing).

3. Harvest bacteria by spinning 5000 rpm for 15 min @ 4°.

4. While centrifuge is spinning prepare Solution I + lysozyme and Solution II.

5. Decant supernatant, drain inverted, resuspend each pellet (quickly!) in 6 ml of
Solution I + lysozyme then transfer to 50 ml Oak Ridge tubes.

6. Incubate for 10' @ RT.

7. Add 12 ml Solution II, shake vigorously and incubate on ice for 10'. The
solution should be straw yellow and clear.



                                     pag. 19
8. Add 7.5 ml of Solution III and incubate on ice for 10'. A white precipitate will
form.

9. Spin 10,000 rpm for 15' @ 4° to pellet the precipitate.

10. Pour the supernatant through gauze or cheesecloth into a 50 ml "Falcon"
tube.


Incubate for 30' @ 37°.

12. Extract 2X with 10 ml phenol:CIA. It is usually most convenient to do this
extraction in disposable 50 ml "Falcon" tubes. Spin 3000 rpm for 15' @ RT.
Make sure the layers are well separated.

13. Recover ~17-20 ml from the upper layer of the second extraction and
transfer to a 50 ml Oak Ridge tube. Add 12 ml of isopropanol and precipitate
DNA by incubating for 10' @ RT (if convenient, can store @ 4° O/N).

14. Spin 10,000 rpm for 15' @ RT or 4°.

15. Discard supernatant and drain inverted. Be careful of pellet!

16. Resuspend DNA in 1.68 ml TE (in a 16 ml polypropylene tube). Add 0.32 ml
5 M NaCl and 2 ml 13% PEG. Let stand for 1 hr. on ice (if convenient, can store
@ 4° O/N).

17. Spin 10,000 for 10 min @ 4° in order to pellet DNA. Decant supernatant and
invert to drain; remove residual droplets with a Q-tip.

18. Resuspend pellet in 0.4 ml TE in an Eppendorf tube.

19. Extract (with equal volume):
       1X Phenol (Spin in a microfuge for 2 min)
      1X Chloroform:IAA

20. Recover about 0.36 ml aqueous phase. Add 0.04 ml 3 M sodium acetate pH
5.2 and 1 ml 100% ethanol. Precipitate is usually readily visible; if not incubate
for 10' on ice. Spin for 10' in microfuge @ RT.

21. Wash 1X with 70% EtOH. Decant supernatant. and remove all residual
ethanol. Dry under vacuum. Resuspend in 0.5 ml TE.

22.  Measure optical density on a 1/20 -1/100 dilution. Expected yield: 500 -
1500




                                       pag. 20
6. Extraction of DNA from Low Melting Point Agarose Gels
1. Prepare a low melting point agarose gel (LMP Agarose, BRL #5517UB) by
boiling agarose (at the desired concentration) in 1X TAE, cooling in a 37° bath
and pouring the gel in the cold room (the LMP agarose gels very slowly @ RT)

not overload lanes, or fractionation will be compromised. Typically, 5 -
digest per lane, but this will vary depending on size of fragments, etc.)

2. Once bands have separated adequately, place gel (careful!) on gel tray over
UV box. Excise band of interest (exposing the DNA to a minimal dose of UV
light) and place in microfuge tubes. You can fill tube approximately 1/2 to 3/4 full
with agarose.

3. Melt agarose @ 65 - 70° C for 5 min in a heating block (fill wells with H2O) or
water bath. Be sure all agarose is melted! Balance tubes.

4. Add 0.5 to 1 volume phenol. Vortex vigorously. Hold on ice 10 min.

5. Spin in microfuge 5 - 10 min @ 4°.

6. Repeat above phenol extraction.

7. Extract:          1X with phenol:CIA
                     1X with CIA

8. Add 3 M sodium acetate to a final concentration = 0.3 M.

9. Add 2.5 vols 100% EtOH to precipitate DNA. Incubate on wet ice for 15 min.

10. Spin in microfuge @ 4° for 10 min. Pipette off ethanol. Invert tube on paper
towel to drain. Remove all residual EtOH and dry in air or under vacuum. Pool
and resuspend pellets in 0.1 X TE.

11. If sufficient material is available, read OD260/280 in spectrophotometer. In
some cases it is convenient to dilute the sample to 0.3 ml and read the entire
sample. In this case it is essential to thoroughly clean the cuvettes because you
will want to recover sample.

12. Run an aliquot (10 - 200 ng) on a minigel to check size (and confirm the
quantitation) of the recovered fragment. This DNA works very well for ligation
and labeling.




                                      pag. 21
7. Plasmid Cloning: Ligation and Transformation
            Adapted from Maniatis



-Vector: prepared as per Procedure #?
-Ligation reagents (see below)
-Insert DNA: purified from LMP agarose gel or equivalent
-Competent E. coli HB101 (or other strain as required): prepared as per
Procedure #?
-LB broth
-LB plates containing antibiotic:
        Ampicillin plates: melt and cool agar to 60°, add ampicillin to 50
        pour 40 ml per 150 mm plate. Allow plates to dry thoroughly (up to 24 hr.
        @ RT). Store wrapped @ 4° for up to 2 wks.
        Tetracycline plates: melt and cool agar to 60°, add tetracycline to 12
                                                                   RT in the dark
        (tetracycline is light sensitive).



Ligation:

1.Prepare on ice:

Vector, digested with appropriate restriction enzymes and treated with
calf intestinal phosphatase (concentration = 0.05-

10X Ligase buffer (prepared as per Maniatis)

10 mM ATP (prepare as per Maniatis, thaw carefully, keep on ice,
refreeze immediately)

Insert: use a 3:1 insert:vector molar ratio, adjust volume with H2O

T4 ligase (NEB)
Total volume

If the vector preparation is untested, or if the cloning efficiency is expected to be
marginal, assemble a negative control (substitute H2O for insert DNA) and a
positive control (containing a fragment known to ligate well). Increase both insert
& vector amounts, keeping ratio the same, for blunt-end ligations.

2. Incubate @ 16° (using a H2O bath set up in a cold room): 2 - 24 hr. for "sticky
end" ligations and 4 - 24 hr. for "blunt end" ligations.

3. Dilute ligation mixture to 100         2O.

                                      pag. 22
Transformation

4. Remove an aliquot of frozen competent E. coli. (stored @ - 70°); gently thaw
and immediately put on ice, then add 10-

5. Incubate for 40 min on ice. Meanwhile, set a heating block or H2O bath to 42°
precisely.

6. Heat shock for exactly 2 min @ 42°.

7. Add 1 ml LB broth (without antibiotics). Incubate for 40 min @ 37° without
shaking.

8. Spread (using a glass "spreader" which has been dipped in EtOH and
"flamed") the entire contents (or a portion if a large number of recombinants are
exprected) on a 150 mm plate containing LB and antibiotics. Air dry for 30-60
min. Incubate inverted @ 37° overnight.

9. Compare the number of colonies on the control and experimental plates to
judged the efficiency of the ligation. Analyze the putative recombinants to
confirm that the fragment of interest was successfully cloned (this is typically
done by preparing mini-preps from a few colonies).




                                      pag. 23
8. Preparation of plasmid cloning vector
           John Krolewski, as modified from Maniatis




In general, the plasmid vector is digested, dephosphorylated, phenol extracted to
inactivate the restriction endonuclease and phosphatase, ethanol pppt'd and
resuspended at 0.2
this cannot be achieved, the digested vector should be purified from an agarose
gel. For those cases where a double digested vector is required (i.e., to clone a
fragment generated by double digestion) digest one half of the vector with
restriction enzyme A and the other half with enzyme B. Next, analyze the digests
on a minigel to check for completeness. If the restriction enzyme buffers are
compatible (i.e. the salt concentration is similar), complete the vector digestion
by adding the other enzyme. If necessary phenol extract and ethanol ppt. in
order to change the restriction buffer, and then complete the digestion using the
second enzyme.

FOR VECTORS DIGESTED WITH ONE RESTRICTION ENZYME:

Mix:
             Vector DNA (10-




                                     pag. 24
9. Preparation and Freezing of Competent Bacteria
            Ethel Ceasarman, 1986



-Calcium chloride buffer (50 mM CaCl2 / 10 mM Tris-HCl pH 8)
       To prepare, combine:
           2.78 g CaCl2, 2.5 ml 2M Tris-HCl pH 8 and bring to 500 ml with MilliQ
           H2O. Autoclave and chill on ice before use.
-Glycerol (80% (v/v) in H2O)
       Autoclave and store @ RT.
-6 ml snap-cap polypropylene tubes (sterile) (VWR #60818500)



Note: all procedures should be conducted under sterile conditions (i.e. in a
hood).

Day 1

1. Start a 10 ml overnight culture of E. coli HB101 from a frozen stock.

Day 2

1. Inoculate a 2 L flask with 300 ml of LB media plus 1 ml of the HB101 overnight
culture. Shake vigorously @ 37° to A600 = 0.2 (read the OD against an LB blank)
. If the culture overgrows, dilute back 3X and allow to grow back to A 600 = 0.2.

2. Chill flask. Transfer to 6 (six) sterile 50 ml "Falcon" tubes and spin 3000 rpm
in a Sorvall table top centrifugem for 10' @ 4° (or use sterile (autoclaved) Oak
Ridge centrifuge tubes and spin 5000 rpm (10' @ 4°) in a Sorvall RC-5C or
equivalent centrifuge).

3. Resuspend in 150 ml (total) cold (ice chilled) sterile 50 mM CaCl2 / 10 mM
Tris-HCl, pH 8.0. Keep cells on ice while resuspending.

4. Incubate on ice for 15'. Repeat spin as per above.

5. Resuspend in 20 ml 50 mM CaCl2 / 10 mM Tris-HCl, pH 8.0 (can store here @
4° for up to a few hours; however O/N incubation @ 4° appears to be toxic under
these conditions). Mix bacteria with 4.6 ml 80% glycerol / H2O (autoclaved
sterile), aliquot 0.25 ml into 6 ml snap cap tubes and transfer to dry ice to freeze.
Transfer to -70° freezer for storage.

Day 3



                                      pag. 25
1. Check efficiency of the competent cells by transforming (see procedure #7)
100 pg of intact supercoiled vector DNA (such as pBR322 or pGEM3). Expect
10-500 colonies (1x105 - 5x106
mock transformation (no DNA) to check for contamination with Amp R bacteria.
Record the transformation efficiency and the number of tubes frozen in the
appropriate log books.




                                    pag. 26
10. Lambda Phage Prep

Reference: (Modified from Blattner. To make a moderate amount: more and
cleaner DNA than the mini-prep method.)

Materials:

SM buffer:           NaCl                               5.8 g
                     2 M Tris•HCl, pH 7.5               25 ml
                     2% gelatin                         5 ml
                     MgSO4•7 H2O                        2g
                     Add H2O to make 1 L
                     Autoclave.

Solutions for Step-Gradient:

                     Density:            1.7           1.5           1.45
                     CsCl (g)           48.0          33.5          30.0
                     SM (ml)            37.0          41.5          42.5

Procedure:

1.       Prepare five 150 mm plates of confluent lysis, i.e., 10 to 50,000 pfu/plate.
(It is important to obtain confluent lysis with the minimal m.o.i. necessary. Excess
phage will lead to a high proportion of "empty heads".)

2.     Overlay each plate with 7.5 ml SM buffer plus a few drops of chloroform.
Let stand 2 - 3 h or overnight.

3.     Harvest lysate SM buffer and rinse plates. Tilt to drain. Adjust volume to
45 ml in Falcon tube.

4.     Add 2.7 g solid NaCl to 45 ml lysate. Transfer to Oak Ridge tube.

5.   Spin 5000 rpm for 15 min @ 4° C (Sorvall RC5B). Meanwhile, weigh 3.2 g
PEG 8000 in another Oak Ridge tube.

6.   Discard the pellet and transfer the supernatant to the tube containing 3.2
g PEG. Dissolve thoroughly.

7.     Let stand for 1 h on ice.

8.    Spin 10,000 rpm for 30 min @ 4° C. Meanwhile, weigh out 2.5 g CsCl in
16 ml polypropylene tubes.

9.     Resuspend pellet in 5 ml SM buffer. Extract 1X with an equal volume of
chloroform (no IAA). Then add 2.5 g CsCl. (Make sure exactly 5 ml of phage in
SM are added to CsCl.)

                                      pag. 27
10.     Make step gradient (2 ml each step): p (rho) = 1.7, 1.5, 1.45 from bottom
to top. Overlay 5 ml CsCl phage "lysate".




11.    Balance +/- 20 mg. Use class H ultra-centrifuge and SW41 rotor. Spin
30,000 rpm for 3 h @ room temperature (or 38,000 rpm for 2 h).

12.   Collect p = 1.5/1.45 interface with a Pasteur pipette.

13.    Equilibrium gradient: Take p 1.5+ phage band and top up tube with p =
1.5 CsCl/SM. Spin 45,000 rpm for 8 h (overnight) @ room temperature. Use
class H ultra-centrifuge and VTi 65.1 rotor.

14.   Vent tube with a 25 G needle and collect band with an 18 G needle
attached to a 3 or 5 ml syringe.

15.    Dialyze against two changes (3 - 4 h) of 1 L SM buffer in the cold. Use
prepared dialysis tubing BRL 5961FA, 1/4"x25'. Flush out with distilled H2O
before use. Check for leaks. It is best to use clips to seal ends.

16.    DNA extraction: Adjust to 25 ug/ml Proteinase K, 0.2% SDS, 5 mM EDTA.
Incubate for 30 min @ 37° C. Then, phenol extract X2, chloroform:IAA extract
and precipitate with 2.5 volumes of 100% ethanol and final concentration of 0.3
M sodium acetate for 20 min on ice. Spin 10,000 rpm for 20 min. Resuspend in
0.2 ml TE and read O.D. in spectrophotometer. (1/20 dilution = 15 ul sample plus
285 ul TE)




                                     pag. 28
11. Modifications for Screening Library with Oligonucleotide
Probes
Pretreatment Solution:

Volume (ml)         Stock                             Final Concentration
 200                Formamide 100%                    20%
 300                20X SSC                           6X
  50                2 M Tris•HCl, pH 7.4              0.1 M
 100                50X Denhardt's solution           5X
 350                H2O                               ---
1000

Hybridization Solution:

Same as above, except use 200 ml 50% dextran sulfate instead of 200 ml H2O.

TMAC:               4M stock - Dissolve 500 g of TMAC crystals in 1106 ml
                    H2O. Filter through 0.45 u filter.

3M wash solution:

For 1 liter                             Final Conc
750 ml              4M TMAC stock       3M
4 ml                0.5 M EDTA          2 mM
25 ml               2 M Tris pH 8       50 mM
5 ml                20% SDS             0.1%

       Steps 1 - 8 as per standard library screening procedure, except
substituting the above solutions. See page .

9.   Wash essentially as per step 9, using 6X SSC for room temperature
washes (no SDS since it falls out of solution).

10.    Next, wash 4 X 20 min, room temperature, in 6X SSC.

11.    Follow this by washing 2X for 20 min @ 37° C in 3M TMAC solution in
order to remove all sodium ions.

12.   Wash 2X 20 min @ Tm, a function of probe size and percent homology
between target and probe - see Wood et al. PNAS 82:1585 (1985).

13.    Rinse using 6X SSC @ room temperature.

14.    Air dry. Expose as per steps 10 - 12 and pick plaques




                                    pag. 29
12. Preparation of Polyacrylamide-Urea "Sequencing" Gels
            adapted from a procedure recommended by LKB



-Sequencing plates for BRL S2 apparatus (#1034 ND), one etched with "X"
(shorter plate) and the other etched with "S" (longer plate).
-0.4 mm combs and spacers (for routine sequencing, we use a 60 well comb
made by cutting off four wells from an IBI 64 well comb (#80110), for RNAase
protection analysis and "PCR Sequencing" we use a 30 well version of IBI
#80100).
-Dichlorodimethylsilane (Fisher #1347327); CAUTION! Use in a fume hood only.
-1,1,1 Trichloroethane (Fisher #T-398-4).
-Bind Silane (LKB #A-174).
-Detergent, sponges (it is prudent to have separate sponges for the S and X
plates)
-Yellow plastic "electrical" tape (Brownell Electric #56)
-Urea (BRL #5055UA)
-19:1 premixed Bis-Acrylamide mixture (Biorad #161-0123 or NJG&LS #5729);
prepare a 50% (w/v) stock solution (add ~162 ml H2O to 150 g.) and store @ 4°
-5X TBE pH 8.3;
       To prepare combine:
            162 g Tris base,
            82.5 g Boric acid,
            60 ml 0.5 M EDTA pH 8.0,
            dissolve and bring to 3 liters with dH2O.
            pH should be 8.3 + 0.2, if not discard and re-prepare
-TEMED (BMB #100-139)
-10% Ammonium persulfate (Aldrich #24,861-4); in H2O, dispense in 0.6 ml
aliquots, store @ -20°.

Prepare the following working solutions:

      Binder:
      this solution fresh (in duplicate tubes) for each "sandwich" prepared. Do
      not prepare this solution near the S plate

      Siliconizer: 10 ml dichlorodimethylsilane in 500 ml 1,1,1 trichloroethane
      (i.e. 2%). This can be made and stored in a brown bottle @ RT
      indefinitely. Use in a chemical hood!



Each gel "sandwich" is made with a shorter X plate (to which the Binder solution
is applied and the gel will subsequently stick to when the sandwich is
disassembled) and a longer S plate (to which the Siliconizer solution is applied).


                                     pag. 30
The working surfaces (which face each other in the assembled sandwich) are
opposite the side on which the X or S is etched.

A. Washing the Plates

1. Beginning with a previously used X plate, use EtOH or acetone to clean off
any residual markings and grease (its very important to remove all grease to
prevent contamination of the clean working surface; otherwise bubbles may form
when the gel is poured!) .

2. Run very warm water over the gel which is on the X plate until the gel is soft
enough to scrape off (usually takes 2-3').

3. Scrape gel off plate with scraper onto saran wrap, and repeat the above steps
to ensure that as much gel is removed as possible.

4. Wrap up gel and dispose of it in the in vitro radioactive waste can.

5. Generously squirt liquid dish washing detergent onto plate (the X side is down)
and scrub with the coarse side of sponge. Clean vigorously. Rinse under warm
water.

6. Turn plate over and wash once as described above.

7. Turn the plate over again (the etched "X" should be facing down again) and
wash the working surface as directed 2-3 more times.

8. After completing the washes, rinse with RO H2O, and dry with paper towels.

9. Repeat steps 5.-8. for the S (siliconized) plate.

B. Treating the Plates

1. When both plates are clean, set them on a low support (like a piece of
styrofoam) with the etched side down (i.e. the working surface up). It is
imperative that the plates be physically separated in order to avoid
contamination of the S plate by droplets of the Binder solution. The S plate
should be treated in a chemical hood!

2. Clean the plates with EtOH a few times. On the last cleaning use lint free
tissue (such as Kimwipes).

3. At this point take careful note of the plate(s). Make certain that the short (X)
plate(s) are being treated with the bind solution and the long (S) plate(s) are
being treated with the siliconizing solution. Once again be sure to have the
plates physically separated and proceed with the following steps by completing
the entire treatment of the S plate(s) before beginning treatment of the X
plate(s).

                                       pag. 31
4. The Binder solution should be prepared immediately before use. Using a lint-
free tissue, spread the solution (8 ml) over the X plate. Make sure the entire
surface of the plate is coated. Leave to dry for 5-10' then polish with a dry lint-
free tissue. Wash with EtOH

5. Repeat step 4.

6. If the plate is virgin (or recently treated with KOH), it is advisable to repeat the
coating a third time.

7. Using a lint-free tissue, carefully spread approximately 8 ml of Siliconizing
solution over the entire surface of the S plate and leave to dry for a few minutes.
Polish carefully with a lint-free tissue. Wash the plate with EtOH.

8. Repeat step 7.

C. Assembling the sandwich

1. Place spacers on plates and put the X and S plate pair together. Using yellow
electrical tape, wrap the sides and bottom with tape, making sure the corners are
sealed. Then wrap a band of tape around bottom to prevent leaks. When taping
the sandwich together do not apply pressure to the plates as this can actually
bend the plates slightly (particularly in the middle of the sandwich), resulting in a
gel which is not of uniform thickness. Bands will migrate artifactually ("frowning")
in such a gel. Finally, clip as per diagram (see below) making sure that the clips
are centered over the spacers.

                                 Clip after pouring.




                                        Yellow
                                          tape




                                         "Ban d"

                                Clip befo re pouring.

                                        pag. 32
D. Preparing and pouring the urea acrylamide mixture

1. Warm the 50% bis/acrylamide to ensure that it is in solution. Wear gloves
when handling the acrylamide monomer, as it is neurotoxic.

2. In a 150 ml beaker, combine 48 g. urea, 20 ml 5X TBE, 12 ml of the 50%
bis/acrylamide solution (to make a 6% gel which is used in a typical sequencing
reaction) and enough MilliQ H2O to bring the volume to ~90 ml and dissolve the
urea by gentle heating (do not exceed position #2 on Fisher hot plate).

3. When dissolved bring up to 100 ml with H2O.

4. Filter the mixture with a 50 ml syringe through a 0.45
clean 150 ml beaker.

5. Before proceeding further, have the sandwich assembled and clipped, and
have 3 additional clips and an appropriate comb ready.


thoroughly and then take up the solution in a 50 ml syringe, gently, in order to
avoid creating bubbles. Move quickly as the gel will polymerize in 10-30'.

7. Hold the gel with one hand, tipping it at a 45° angle, with only one corner
resting on the bench. Syringe the gel mixture into the sandwich beginning at one
corner, ensuring that the mixture runs along the side of the sandwich and that no
bubbles form. If bubbles form wait until the entire sandwich is full then try to
"free" the bubble(s) by tapping on the plates. Insert the comb (evenly!), place gel
flat and add the 3 final clips, as per diagram above.

8. Allow at least 1 hr. to polymerize. The gel can be stored for 24 hr. @ RT (in
this case the top should be wrapped tightly with saran wrap or covered with wet
paper towels). To save time the next day, the gel can be mounted and left O/N.

E. Mounting the gel in the verticle apparatus

1. Prepare 1 L of 1X TBE.

2. Once the gel is polymerized, remove the clips, and cut off the tape on the
bottom of the gel and remove the band of tape around the bottom of the gel.

3. Rinse off the outside of the sandwich in order to remove any gel mixture
around the wells and on the outside of the shorter plate (as this plate must come
into full contact with the heat sink).

4. Carefully remove the comb (pull slowly and evenly).




                                      pag. 33
5. Place the small "sponges" in place at the top of the short plate. If the sponges
have been previousdly used, it is necessary to put a minute amount of grease
on the surfaces of the sponge to ensure a tight seal.

6. Close the drain on the gel apparatus and mount the sandwich. Secure it by
evenly tightening the clamps.

7. Fill reservoirs with 1X TBE, ~650 ml in top tank and the rest in the bottom
tank. Check for leaks.

8. Using a pipet and bulb, or a syringe and needle, flush the wells clean of any
bits of gel material and urea.

F. Resuscitating "fished" or otherwise dirty glass plates

If the plates "fish" (i.e. a part of the gel sticks to both the X and S plates, as if
filleted like a fish) or if bubbles form frequently, then it is necessary to take
drastic action

1. Clean the plates as per usual to remove any gel material.

2. Place the plates (separated with glass pipets) in a large plastic dish containing
a solution of freshly prepared 5-10% KOH made up in 50% H2O / 50% EtOH
(handle with CAUTION!!) and soak, preferably with gentle shaking, overnight.

3. Next, drain off the alcoholic KOH, and briefly rinse the plates with a very dilute
solution of "cleaning acid" (chromic-sulfuric acid mixture).

4. Rinse thoroughly with H2O. The H2O should "sheet" off of the plate surface.

5. Treat as above (you may want to add an additional treatment or two to ensure
coating of the new plates).




                                        pag. 34
13. Southern Blotting
             Southern (1975), JMB




The following procedure is outlined for a typical genomic Southern blot, i. e.
detecting single copy sequences in a sample of eukaryotic genomic DNA. It can
obviously be adapted for use in other situations requiring considerably less
sensitivity, i.e. detecting homology between a particular probe and a cloned
plasmid or phage DNA. In general, it takes five days to obtain the final
autoradiograph, including digesting the genomic DNA, electrophoresis, transfer
to the filter, hybridization, washing and exposing the filter.

Day 1: Restriction digestion of DNA samples

(Optional 5 - 15 min soak in 0.1 N HCl until bromophenol blue band just begins
to turn yellow)

Soak in denaturing solution 30 - 45 min (depending on the gel thickness)

Soak in neutralizing solution 45 - 60 min

Soak in 10X SSC 15 - 30 min

             RNA to Nitrocellulose or Nylon

Option 1:    Soak in 20X SSC for 30 - 45 min

Option 2:    Destain thoroughly 3 - 4X for 5 min in H2O. Alkali treat (50 mM
             NaOH/10 mM NaCl) for 10 - 20 min. Then 0.1 M Tris, pH 7.5 for
             20 min. Then 20X SSC for 30 - 45 min.

             DNA to Nylon

Soak 10 - 30 min in 0.4 N NaOH (or protocol as above for NC)




                                     pag. 35
II.          Preparing filters:
1.           Nitrocellulose - wet with H20. Then: DNA - 10X SSC; RNA - 20X
             SSC for 10 - 30 min.

2.           Nylon - DNA wet with H2O only; RNA wet with H20 then
             20X SSC

3.           Set up the castle:




4.           Assemble castle.

5.           Wet top piece of blot block in last gel soaking solution      and
place on top of pile.

6.           Wet a piece of thin Whatman and place on top

7.           Place filter on top. Squeeze out any bubbles.

8.           Carefully place gel over filter. Squeeze out any bubbles.

9.             Place one piece of wetted thin Whatman, cut to exact size   of gel,
on top of gel.

10.           Rinse sponges thoroughly. Soak (dripping wet) and place     on top
of castle. Make sure that no "shunting" can take place. Wrap up with Saran
wrap.

11.          Transfer overnight.




                                     pag. 36
12.             Next day:

13.             Take off sponges and top paper. Do not disturb gel and      filter!

14.             Mark (cut-down) filter:




15.             Peel off gel and discard.

16.             Rinse once in 3X SSC (5 sec).

17.             Air dry (20 min). O.K. to leave nitrocellulose overnight.

18.             Label filter with indelible marker.

19.             Ultra-violet irradiate 5 - 1-0 min for nylon.

20.             Bake 2 h in vacuum oven (80° C).




Strip-off Radio-labeled DNA probes from Nitrocellulose and Duralose filters

      1. In an appropriate container, add 1.25 ml 20X SSC and 10ml 0.5M EDTA
         to a total volume of 500ml ddw;

      2. Bring to a boil in microwave or over a flame;

      3. Add 2.5 ml 20% SDS;

      4. Put filters in, and leave on bench for 20 min.

      5. Check the result with a Geiger counter. Repeat 1-5 if necessary. Filters
         can be used with a short (~1 hr) prehyb. incubation before applying a new
         probe.




                                          pag. 37
14. DNA SEQUENCING
           SEQUENASE kit instructions.



-Sequenase kit components:
      Sequenase (version 2): stored @ -
      dGTP labeling mix (green tube), stored @ -70°
      dGTP termination mixes (pink tubes), stored @ -70°
      5X reaction buffer, stored @ -70°
      0.1 M DTT, stored @ -70°
      Sequenase dilution buffer
      Stop buffer / tracking dye, stored @ -70°
      (the "extension" buffer and the Mn++ containing 5X reaction buffer are
      used to obtain sequence very far from and very near to, respectively, the
      primer.)
-35S- -dATP (1300 Ci/mmole, 12.5 uCi/ul; NEN-034H), stored @ -70°
-Appropriate primer oligonucleotides, stored @ -70°
-Denaturing solution (make fresh each time): 2N NaOH / 2 mM EDTA pH 8.0;
      To prepare combine:
           0.2 ml 10 N NaOH

            0.796 ml H2O
-5X TBE pH 8.3;
       To prepare combine:
            162 g Tris base,
            82.5 g Boric acid,
            60 ml 0.5 M EDTA pH 8.0,
            dissolve and bring to 3 liters with dH2O.
            pH should be 8.3 + 0.2, if not discard and reprepare
-6% Sequencing gel (see procedure #12)
-Hair dryer
-X-ray film and cassette
-Dry bath heat block (filled with H2O) @ 37°



These instructions are for sequencing inserts in double-stranded plasmid vectors
(such as pGEM3 and Bluescript -KS-(+)). Typically, the reactions are run and
the gels are poured on the first day, the reaction products are electrophoresed
on the second day, and the sequence can be read on the third day. Up to 12
sets (G,A,T &C lanes) of tracks can fit on a gel, with a blank well between each
group of three sets. If the usual three loadings are performed per primer-
template reaction, 300-400 bases of sequence can be read. If a lot of
sequencing is being done, it is convenient to sequence eight primer-template
pairs per day (i.e. both primers from four plasmid clones) and run the products
on two sequencing gels. An energetic worker can increase this output 50% (i.e.
                                     pag. 38
twelve primer-template pairs run on three gels). The pGEM3 vector has SP6
and T7 primer sites, while the Bluescript vector contains T7 and T3 primer sites
along with M13 universal (forward) and M13 reverse primer sites (which lie
outside the T7 and T3 sites).



In order to maintain quality control, the SEQUENASE enzyme should be
dispensed in 1                         -70°. Each aliquot is sufficient for four
primer-template reactions.



DAY 1: Sequencing reactions and gel preparation.

1. Denaturing double-stranded DNA:

Combine the following in an eppendorf tube (for each primer-template reaction):
            Double-                                     2O
            Denaturing solution

Incubate 5' @ R.T., then add:

              3M Na Acetate pH 5.2
              dH2O
              100% ETOH

Incubate 10' on ice, then spin 10' @ 4°, decant supernatant, add 0.5 ml cold
70% ETOH, repeat spin, decant supernatant again, and dessicate dry.
                           2O.

2. Annealing primer to template:

For each primer-
template into an eppendorf tube. Then add:

              Primer (0.5-5 pmoles)
              5X reaction buffer

Then incubate the template primer mixture at 37° for 15-120'. Remove the 35S-
  -dATP from the freezer and place at RT , behind a shield , to thaw. When
thawed, place on ice. Label four tubes per each primer-template pair (A, G, T &
C) and adjust a heat block (filled with H2O) to 37°.

3. Labeling reactions

Remove and thaw the DTT, labeling mix and termination mixes. Also remove an
aliquot of sequenase (keep on dry ice). For standard sequencing reactions add

                                       pag. 39
7         2
used for reading very close, i.e. within 30 bp, to the primer). Finally, dilute the
sequenase

When the annealing is complete, briefly spin to pellet any condensation droplets,
then add the following to the annealing mixtures (perform this step on as many
as four sets of primer-template at a time):

              DTT (0.1 M)
              Diluted labeling mix
              35S- -dATP
              Diluted sequenase

Incubate for 10' @ RT. Refreeze the 35S- -dATP on dry ice, then return it to
the the -
the labeled termination tubes. Refreeze all the reagents on dry ice and return
them to the -70°. With 2-3' remaining in the labeling reaction, place the tubes
(snap caps open) containing the termination mixes into the 37° heat block.

4. Termination reactions:


the appropriate termination tubes, capping the tube and then immediately
returning it to the 37° bath. (This takes ~3 minutes for a set of 16 tubes.) Once

Tracking Dye solution to each tube. In this way all 16 tubes are "terminated" for
10'.

Repeat the process for the additional sets of primer-template reactions. It is
usually feasible to "dovetail" the reaction sets by beginning the labeling reaction
for the second set while the first set is terminating, etc.

Store the reactions O/N @ -20° (they can be stored for longer periods at -70°).

5. Prepare the gels (6%) required for the next day, following Procedure #12. The
gels should be mounted the night before so that pre-electrophoresis can begin
promptly in the a.m. To do this cut off the tape from the bottom of the gel,
remove the comb, attach the corner "sponge" spacers, add the buffer (1 L 1X
TBE) and flush out the wells.

DAY 2: Electrophoresing, fixing and exposing the gel

6. Pre-electrophorese the gel @ 60 watts constant power (1600 -1800 volts) for
30-60'. Adjust a heat block containing H2O to 70-80°. Mark the lanes on the gel.

7. Once the pre-electrophoresis is complete (the plates should feel warm to the
touch - 35-45°), heat the samples 3-
"spade" type pipet tip. This is the 3° loading.

                                       pag. 40
8. Continue running the gel until ~20' after the lead dye (BPB) runs off the end
(~2 hr.), then repeat the process of loading (2°) as per step 7. Electrophorese
the same distance and repeat the process to apply the 1° loading. Allow the 1°
loading to run off 20-60' depending on the position of the primer and the cloning
site utilized.

9. Take down the gel, remove the tape and spacers and pry the gel plates apart.
The gel should stick to the "X" plate! Fix the gel and remove the urea by soaking
the plate & gel in 2L of freshly prepared 10% acetic acid, with gentle agitation for
30'. Rinse the gel with tap water, blot the gel dry with paper towels and then dry
the gel onto the plate with a hair dryer (takes 20-30'). (Alternatively, allow the gel
to dry overnight on the bench top.) Expose the gel directly to film (no saran
wrap!), @ RT, O/N. Save the "S" plate in order to orient the position of the
samples on the autoradiogram.




                                       pag. 41
15. FIELD INVERSION GEL ELECTROPHORESIS

1. DNA SAMPLE PREPARATION:

Reagents:
             -1.6% LMP agarose (LKB Ultra-low gelling point agarose,
       Cat# 2206-106) in TE @ 60o.
             - ESP:       0.5 M EDTA pH 8
                          1% Lauryl sarcosine
                          1 mg/ml Proteinase K
                          (dissolve sarcosine & PK into EDTA, shake)
             -TE pH 8 (aautoclaved)
             -PBS (autoclaved)
             -37o heat block or bath
             -Plug molds (LKB cat#      )

Cells must be in excellent condition to assure good quality DNA.

Pellet cells and resuspend in PBS @ 2 X 107 /ml. (Typically, use 20-50 X 106
cell.) Place 0.5 ml aliquots of the cells @ 37o.

Set up molds for plugs by taping the bottoms.

Add 0.5 ml of LMP agarose to 0.5 ml aliquot of cells, mix well and quicky
distribute 0.1 ml aliquots (using a P1000 pipeter) into molds. Two ml of cells will
yield 20 plugs.

Keep molds @ 4o for about 30'. Using a bent pateur pipet, gently push plugs
into two volumes of ESP (e.g., for 20 plugs use 4ml). A 15 ml tube is convenient
for this step.

Incubate @ 50o, with rotation, for 48 hrs.

Remove ESP by aspiration (carefully!), move plugs to a 50 ml "Falcon" tube,
add 50 ml TE, incubate @ R.T. for 30", aspirate and repeat wash once or twice.
Plugs can now be stored @ 4 in TE.




                                      pag. 42
16. Molecular Weight Markers

FOR ETHIDIUM BROMIDE STAINED AGAROSE GELS:

           Mix the following together:
                                 -
                         heat at 65°C for 5 min. (to visualize band 4.4kB)
                         add NaCl 50 mM (10µl NaCl 5M)
                                   -174 - HaeIII digested DNA (BRL #5611 SA)
           Adjust volume to 0.85 ml with 0.1 X TE
           Add 0.15 ml tracking dye (15% Ficoll, 0.25% xylene cyanole, & 0.25%
           bromphenol blue)

           Schematic of marker bands:                ng of DNA per

                                                     aliquot
                                                        381
                        23      kB
                                                        156
                        9.4                             110
                        6.6
                        4.4              HindIII       73

                        2.3                              38
                        2.0                              33

                                                        100
                        1.353
                                                         80
                        1.078             X-174         65
                        0.875                            45 8
                        0.603, 0.506     HindIII
                                                         23
                        0.310                            21 20
                        0.281, 0.271                     17
                        0.234                            14
                                          X-174          9
                        0.194
                        0.118                             5
                        0.072




                                     pag. 43
FOR ALKALINE AGAROSE GELS (to size labeled cDNA):


                           pBR322 + EcoR1
                           pGEM3 + EcoR1
                           pUC19 + TaqI

             2. Add:             -32P-dATP (pBR322 & pGEM digests)
                                  or
                                 -32P-dCTP (pUC19 digest)
                                  and


             3. Incubate 30 minutes @ RT




             5. Apply 100,000 cpm of each marker on a typical alkaline mini-gel,
             when analyzing first strand cDNA prepared as per procedure #

             6. The autoradiography pattern:

                                    4.3 kB

                                    3.0


                                    1.7


                                    0.7
                                 0.5
Due to recent degradation problems of the molecular weight markers, here are some
recommendations about preparation and storage:

Prepare the markers following the lab manual, but skip the -174-HaeIII digested
DNA and add NaCl to final concentration of 20-50 mM (NaCl will prevent the small


Heat 65oC for 5 minutes, put on ice.

            -174-Hae III digested DNA (if this component is heated it will degrade
easily).

Store the markers at -20o                                                      oC and
don't reheate it before loading. (Katarina Cechova)

                                       pag. 44
17. RETROVIRAL GENE TRANSFER: PROTOCOL FOR INFECTION OF CELLS IN
SUSPENSION.

NOTE:

1) an appropriate dose for antibiotic selection must be established for the particular
target cell line used; i.e., at what dose will 100% of the uninfected target cells be killed
after 10-12 days of cultivation in G418. As a guideline, the selective dose for
lymphoblastoid cells lines is typically 0.6 mg/ml of G418 (active G418, not the powder;
each lot of G418 has a specific activity which is noted by the manufacturer)

2) cell line must be in optimal condition on the day of infection
i.e. 100% viable and in log phase of growth.

3) Reagents include: polybrene, 1.0 mg/ml, in water
             appropriate growth medium for cells



Procedure: This procedure outlines supernatant infection)

1. Virus-producing cells should be plated 2 days before infection at 2 x 106 in a 10 cm
tissue culture dish. The cells should be incubated in 10 ml of DMEM + 10% FCS at
37oC in incubator until they are confluent (this should take about 24 hours). Prepare
one dish for every 2-3 million cells you will infect.

2. When the cells are confluent, remove the medium and add one-half the volume of
fresh medium ( 5 ml) and incubate for 16 hours.

3. After 16 hours, harvest the supernatant into a conical centrifuge tube (this now
contains virus), render it 10 ug/ml polybrene (i.e, 1:100 with the polybrene stock) and
centrifuge for 10 minutes at 3000 rpm at 4oC to remove debris. Filter the supernatant
through a .45 micron syringe filter. Medium containing virus is now ready for use. It
must be used within 1 hour of the harvest, and if there is a delay in the use of the
supernatant, it should be kept at 4 oC.

4. Count target cells. Pellet cells under the usual conditions (i.e., whatever is
appropriate for your particular target cells).

5. Resuspend target cells in virus-containing supernatant, 2-3 ml/million cells. Transfer
cells to tissue culture flask.

6. Incubate at 37oC in incubator for 3 hours.

7. Harvest target cells; pellet cells under appropriate conditions and discard virus-
containing supernatant.


                                      pag. 45
8. Resuspend in growth medium under appropriate conditions (i.e., as you usually grow
the cells).

9. Steps 1-8 may be repeated at 24 hour intervals if necessary to increase efficiency of
infection. (no more frequently as the exposure to polybrene is fairly toxic).

10. Start antibiotic selection at 48 hours after completion of infection step with
appropriate concentration of antibiotic. If the doubling time of your target cell is longer
than 30 hours, you may wish to prolong the interval between infection and the start of
selection.

11. Count cells every 2 days and make whatever adjustments are appropriate to
maintain cells at the optimal concentration of viable cells for growth.

12. Maintain an aliquot of uninfected cells through selection; selection is complete
when there are no further viable cells in this aliquot.




                                      pag. 46
18. PROTOCOL FOR TITRATION OF VIRUS-PRODUCING CELLS.

Note: Appropriate target cells for titration in the murine system is NIH3T3.             An
appropriate human target cell is the osteosarcoma cell line U2OS.

Prepare virus-containing supernatant:

1. Virus-producing cells should be plated at 2 x 106 in a 10 cm tissue culture dish in 10
ml of DMEM 10% FCS at 37o in the incubator until they are confluent (this should take
about 24 hours).

2. When the cells are confluent, remove the medium and add one-half the volume of
fresh medium (i.e. 5 ml) and incubate for 16 hours.

3. After 16 hours, harvest the supernatant into a conical tube (this now contains virus),
render it 10 ug/ml polybrene (i.e. 1/100 of a 1 mg/ml stock) and centrifuge it for 10
minutes at 4oC at 3000 rpm to remove debris. Filter the supernatant through a .45
micron syringe filter. Medium containing virus is now ready for testing.

4. Dilute virus-containing supernatant 1/10 , 1/10 , and 1/10 with DMEM + 10% FCS +
10ug/ml polybrene.

Prepare target cells:

1. Plate NIH3T3 cells at 5 x 105/10 cm plate the night before you anticipate doing the
infection step of the titration. These cells should be grown in DMEM + 10% CS (calf
serum) but FCS is OK also. This should obviously be done the same evening you do
step 2 above. Prepare at least 4 plates for each virus to be tested, 3 dilutions to be
tested and a negative control.

Performing the infection:

1. Remove medium from NIH3T3 cells.

2. Add 3 ml respectively of each of the dilutions of virus-containing supernatant to a
plate of target cells. Add 3 ml of medium + polybrene alone to the negative control
plate.

3. Incubate at 37o for three hours with frequent tipping of the plates to distribute the
medium well.

4. Remove the medium after three hours and add 10 ml of DMEM + 10% CS.

5. Incubate for 48 hours at 37o.

6. After 48 hours, trypsinize the plates and split 1:4 (i.e., into 4 10 cm plates); seed the
cells in 10 ml per plate of DMEM + 10%CS + 0.25 mg/ml G418 (this is the dose that will


                                      pag. 47
guarantee complete selection in 10-12 days in NIH3T3 cells). ( See notes on infection
protocol with regard to the issue of active G418).

7. Change medium every 3 days.

8. Score plates for colonies when the negative control plate is completely dead.

9. You may want to fix (with 10% formaldehyde in PBS for 10 minutes) and stain the
plates with e.g. crystal violet (stain for 20 minutes, wash with distilled water) as
visualization of colonies is much enhanced. (See note below as to preparation of crystal
violet).

10. Titre # of colonies/plate [avg of 4 plates]   1
    ml    vol. of virus-containing sup. used sup. dilution


NOTE: To make up crystal violet stain:

   dissolve 1.5 g crystal violet powder in
   900 ml 95% ethanol; then add
   450 ml 1M NaCl.
   Bring total volume to 3 L. (Obviously this can be scaled down as needed).




                                     pag. 48
19. RUN-OFF TRANSCRIPTION

Materials:

All the solutions are made up in DEPC treated water autoclaved.and filtered

Stocks

1.     1M Tris pH 8
2.     1M MgCl2
3.     3M KCl
4.     100 mM NTPs pH 7
5.     10M NH4OAc
6.     1M TES pH7.4
7.     20% SDS
8.     0.5M EDTA pH8
9.     5M NaCl
10.    50X Denhardt's
11.    E.Coli RNA 10mg/ml
12.    Non fat dry milk powder.
13.    1M Mg(OAc)2
14     1M DTT
15     Triton X 100 10%
16     Nonidet P40 10%

BUFFERS


-PBS

-0.3 M sucrose buffer-
-     0.3 M sucrose
      10mM Tris HCl pH7.4
       5mM Mg(OAc)2
       0.5mM DTT ( add fresh each time)

-1.5 M sucrose buffer
    as above but 1.5M sucrose.

-2M sucrose buffer
   as above but 2M sucrose

- RSB
     10mM Tris HCl pH7.4
     10mM NaCl
       3mM MgCl2
-10X SET -
    10% SDS,

                                    pag. 49
      100mM Tris pH7.5,
       50mM EDTA

-1X SET -
      1% SDS,
     10mM Tris pH 7.5,
     50mM EDTA

-TE

-5X RUN-OFF BUFFER: 200 ul= 3 reactions


Final conc. Stock
       H2O 160ul
25mM Tris pH 8      1M   5ul
12.5 mM MgCl2       1M    2.5ul
325 mM KCl          3M    25ul
1.25 mM CTP         100mM        2.5ul
1.25 mM ATP          100mM      2.5ul
1.25 mM GTP          100mM       2.5ul
RNasin 200 U/ml


-NUCLEI FREEZING BUFFER : 50 ml


Final conc.         Stock

 50 mM Tris pH 8      1M 2.5ml
 5 mM MgCl2           1M 0.25ml
 40% Glycerol       100% 20ml
 0.5 mM DTT          0.5M 50ul ( add fresh each time)
.H2O                   27.2 ml



-HYBRIDIZATION BUFFER


.Nitrocellulose

Final conc.

10 mM TES pH7.4              1M 1ml
0.2% SDS                    20% 1ml
10 mM EDTA                  0.5M 2ml
0.3 M NaCl                  5M   6ml
1X Denhardt's                50X 2ml

                                   pag. 50
 0.5% Dry milk     add fresh powder each time to an aliquote
 250ug/ml E. coli RNA        10mg/ml 2.5ml
.H2O                             85.5
 Heat at 65°. for 10 min before use

  .Nylon membranes (Genescreen plus)
The hybridization solution is identical except for the concentration of SDS
which is
  increased to 1%
I


WASHING SOLUTION           1 liter

Final conc.           Stock

0.1% SDS       20% 5ml
0.1X SSC       20x 5ml
 H2O     990ml


PREPARATION OF NUCLEI FOR RUN-OFF TRANSCRIPTION



-The cells must be healthy. The best results are obtained when the cells are in
"log phase" growth.

-Each cell line might have a different optimal protocol of nuclei preparation that
has to be established empirically.

-The sucrose buffer protocol has given good results for various T-cell lines
,periferal blood T-lymphocytes , myeloid cell lines.

-The RSB protocol gives the best result for lymphoblastoid cell lines, HeLa,
U2OS, some myeloid cell lines.




-Preparation of nuclei using sucrose buffers -


Use 20-50 X106 cells/ run -off sample.

1-Collect the cells by centrifugation ,scraping or trypsinization. From this point on
all the procedures are performed at 4°

2-Wash the cells twice in cold PBS.

                                      pag. 51
3-Resuspend the cells in 0.3M sucrose buffer at 5-10X 106/ml

4-Quickly add 10% Triton X 100 to a final concenteration of 0.1% and mix ( this
concentration is only an indication :useful concentrations range from 0.02% to
0.5% ; also NP40 could be used at a concentration of about 1/2 of that of triton.)

5- Tansfer the cells to a glass Dounce homogenizer precooled on ice. Save a
small aliquot of intact cells as a control."Dounce" the cells . You can use different
pestles (Teflon, A, B which is usually the loosest) and a different number of
strokes . 10 to 20 strokes with pestle B are usually enough

6- Check the preparaton under the microscope. The nuclei should not be
clumping.
 A little bit of cytoplasm can still be visible at this point in a small percentage of
the nuclei.

7- Add one volume of 2M sucrose buffer.

8- Layer the nuclei suspension onto a cushion of 1.5M sucrose buffer.( 3vol. on
1 vol.)

9- Spin in a swinging bucket rotor at 8000rpm for 30 min at 4°.

10- Resuspend the pellet in a small volume of 0.3M sucrose buffer .

11- Spin at 1500rpm for 10 min at 4°.

12 -Resuspend the nuclei at 20-50X106 / aliquot in 210ml of nuclei freezing
buffer.

13- Freeze directly in liqid nitrogen.



  -Preparation of nuclei using RSB-


1-2-Collect and wash the cells as above .

3- Resuspend the cells in ice cold RSB.

4- Add Triton X100 10% to a final concentration to be empirically determined (
0.05-0.1% for lymphoblastoid cells 0.2 % for HL-60 etc.).

5- Mix by inverting the tube

6- Check the preparation under the microscope.


                                         pag. 52
7-For some cell lines (HeLa) you might need to "dounce" the cells or to mix hard

8- Spin the nuclei at 1500 rpm for 10 min at 4°

9- Resuspend in nuclei freezing buffer at 20-50X106/sample of 210ml

10- Freeze in liquid nitrogen




  PREPARATION OF THE FILTERS




Single stranded probes


The tipical amount of DNA used is 1ug/slot (increasing the amount of DNA
above 1ug/ slot does not increase the intensity of the signal)

-Add to the DNA 1x SSC to 200ul/slot

-Load the slot and apply vacuum

-When the slot is empty load 200ul of fresh SSC and apply again the vacuum.



Double stranded probes

The tipical amount of DNA used is 5ug / slot
-Add to the DNA TE to 180ul/slot

-Add 3N NaOH 20ul FC= 0.3N

-Heat at 65 degrees for 15 min to 1 hour
 if using nylon filters the sample is ready to be loaded.
 if using nitrocellulose neutralize with 200ul 2M ammonium acetate

-Load the sample

-Rinse the slot with 300ul of 10x SSC


- Air dry the filters

- Bake nitrocellulose filters for 2 hours at 80 degrees under vacuum

                                    pag. 53
- Cross link the DNA to nylon filters by UV irradiation in a cell culture hood for 10
min and / or bake them
 .




                                       pag. 54
RUN-OFF TRANSCRIPTON PROCEDURE



1. Prepare in Eppendorf tubes 210 ul of nuclei suspension
  (20-50 mill.) in run-off freezing buffer.(If the nuclei are clumped disperse by
pipetting through a yellow tip).

2. Add: 60ul of 5x transcription buffer.(Make fresh each time from stock
solutions.)
        30ul 32P-UTP (3000 Ci/mmol)

2b.Add 1.5ul a-Amanitin 0.25 mg/ml (when needed)
    incubate 10 min. on ice

3. Cap, mix gently.
  Incubate 30 min at 30 degrees (26-30 degr. OK, a little longer    OK too).

4. Add 15ul DNase I RNase free (3mg/ml). Vortex to mix.
  Incubate 10 min at 30 degrees.

5. Add 36ul of 10X SET buffer and 10 ul proteinase K(10mg/ml)

6. Heat 1min at 65 deg. to get SDS in solution, then incubate
  at 37 deg. for 45 min.

7. Extract with phenol/chlor. Spin 10 min.. The interface must be   avoided.

8. Reextract the interface with 100ul of 1X SET.

9. The volume should be 460ul: add 135ul 10M NH4OAC (final 2.3M)

10. Add isopropyl alcohol 1:1. Freeze at -70.

11. Make now Sephadex G-50 columns. Don't spin them yet.

12. Precipitate the RNA in a microfuge at room temperature.

13. Resuspend the pellet in 100ul of TE. Heat at 37 for a few min. to facilitate
the resuspension. Vortex. Spin in a microfuge for 1 min. to make sure all is
resuspended.

14. Spin now the sephadex columns for 5 min. at 1400 rpm.

15. Load the columns with the labelled RNA. Spin 5 min at 1400
  rpm.




                                     pag. 55
16. Measure the volume of the eluate. Add 1 vol. of 2X hybridization buffer. Bring
to 500ul with 1X HB.Count 5ul.From 1 x 107 nuclei you should get from 10 to 20
x 107

17. Hybridize 10-20 million counts/ ml at 65° for 36 hours in a plastic bag (mix
frequently).

18. Washing :-I- 3 washes at room temp. in 0.1 % SDS
                                                 0.1X SSC
                   2x 30 min. washes at 65° in the same soln.

                -II- 2 washes at room temp. in 2x SSC
                     2x 1 hour washes at 65 °. in 2x SSC
                      Incubate in 2x SSC- 10ug/ ml RNase A
                      at 37 deg. for 30 min
                       Wash in 2x SSC at 37° . for 1 hour

20. Air dry, wrap, expose.




                                     pag. 56
20. RNAase PROTECTION ASSAY
             Promega Biotec, Ethel Caesarman, Franco Gringani



(Reagents indicated with √ must be RNAase-free)

-√5X TB (transcription buffer): 200mM Tris•HCl pH 7.5/ 30 mM MgCl2, 10 mM
spermidine
-√DTT (100 mM)
-√rNTPs: GTP, ATP, UTP (10 mM)
-
(The 4 reagents listed above are available as a kit - Promega #P1121)
-√RNAsin (Promega #N2112)
-√SP6, T7, T3 RNA polymerases (Promega #P1083, #P2073 & BRL #8036SB,
respectively))
-√DNAaseI-RNAase free (1 mg/ml) (Worthington #???)
-32P- -CTP (NEN #NEG-008X, 400 Ci/mmole, 10 mCi/ml)
-√1M NH4OAc
-√20% SDS
-√Proteinase K (10 mg/ml in H2O)
-Phenol:CHCl3/Iso amyl alcohol (phen
-√Hybridization buffer, prepared as follows (scale up if necessary, store -20°):
               0.8 ml 100% formamide (deionized, e.g. BRL #5515UB)
               0.08 ml 5 M NaCl
               0.002 ml 0.5 M EDTA pH 8
               0.04 ml 1 M PIPES pH 6.7 (prepare by dissolving 15 g PIPES in
               ~43 ml H2O + ~7 ml 10 N NaOH, pH should then be very close to
               6.7)
-√tRNA (10 mg/ml in H2O)
-√RNAase solution, prepared as follows:

             #R5125; prepare stock in RNAase-free, non-DEPC H2O, & store -
             20°)
                                     and

             Worthington #3518)
                                       into
              9.93 ml of Digestion Buffer (10 mM Tris-HCl pH 7.5, 5 mM EDTA
              pH 8, 300 mM NaCl)
      Boil for 10'(best to make fresh each time)
-Reagents for preparing a urea polyacrylamide gel (see Procedure # 12)
-Formamide tracking dye:
              25 ml 100% formamide
              0.25 ml 2 M Tris pH 7.4
              0.125 ml 20% SDS
              0.25% (w/v) bromophenol blue
                                     pag. 57
             0.25% (w/v) xylene cyanol
-Reagents for preparing end labeled size markers (these are good for 1-2
months):
      -32P- -dGTP (NEG014H, 3000 Ci/mmole, 10 mCi/ml)
                                          or
      -32P- -ATP (NEG002A, 800 Ci/mmole, 10 mCi/ml)
      -Klenow (BMB #1008404) or T4 Kinase (NEB #201)
      -




This assay is useful for:   1.) Defining intron-exon boundaries
                            2.) Sensitive detection of gene expression
                            3.) Detecting point mutations in transcribed genes

In general, a DNA (either genomic or cDNA; note that cDNA will not be useful
for (1.) ) is cloned into a plasmid vector containing the promoter sites for one of
the phage RNA polymerases (SP6 or T7 in the pGEM vectors, T7 or T3 in the
Bluescript vectors). The plasmid is linearized at a restriction site within, or just
beyond, the cloned gene, a labeled anti-sense RNA transcript probe is prepared
and hybridize
Length and secondary structure will influence the efficiency of these
polymerases. We routinely synthesize probes up to 500 nt. under the conditions
given; for longer probes one may want to increase the amount of cold rCTP. For
very hot probes it should be helpful to lower or eliminate the cold rCTP
altogether. It is advisable to run an analytical gel to check the size of the
transcript, particularly when a new probe is being used. The transcript probe that
is used must contain a region of sequence (in the form of plasmid sequence
and/or genomic sequence not present in the mature mRNA) which is not
complementary to the target RNA in order to provide a detectable size difference
between the undigested and the "protected" probe.

Frequently it is convenient to simultaneously hybridized two (or more) probes to
a particular sample. For example, a GAPDH probe can be used to control for
the total amount of RNA when using this assay to quantitate gene expression
(see below for limitations on the use of multiple probes). The single stranded
RNA is digested and the RNA-RNA hybrids are denatured and electrophoresed
on a "sequencing" gel. The digestion conditions are adjusted to digest all single
stranded RNA; thus, the probe fragment which remains reflects the size of the
"protected" sequence. When applying this assay in uses (1.) & (2.) it is
necessary to test each probe to find conditions (hybridization temperature & the
time and temperature of RNAase digestion) which completely degrade
unprotected probe (i.e., probe hybridized with tRNA). Typically, the probe is
hybridized with tRNA at a number of different temperatures, usually between 50°
& 70° and then digested at RT & 37° with RNAase for up to 15-20'. The lowest
hybridization temperature and mildest digestion condition which suffice are
chosen. Sometimes it is not possible to completely degrade the unprotected


                                      pag. 58
probe; this situation is usually acceptable if the protected and unprotected
fragments are clearly resolved on the gel.

When quantitating gene expression, it is best to choose a control probe which
can be hybridized under similar conditions. It is also advisable to use a test
probe which produces a protected band that is larger than the size of the un-
protected transcript of the control probe. In this way partially protected
fragments which may be generated by the control probe cannot obscure the
protected fragment produced by the test probe . Currently we are using either:

        i) a human GAPDH control probe (pB-Hu-GAPDH-100, linearized with
        BamH1, T3 transcribed) which yields an unprotected transcript of ~130 nt
        and a series of protected fragments ~100 nt when hybridized @ 50°-65°
        and digested @ RT for 15'.

                                         or

        ii) a rat GAPDH control probe (pG-R-GAPDH-70, linearized with Xba, SP6
        transcribed) which yields an unprotected transcript of ~70 nt and a series
        of protected fragments (with human RNA) of ~20 nt when hyridized @ 50°
        and digested @ RT for 15'.

When assaying human RNA the human GAPDH probe yields a strong signal in a
few hr. @ RT, while the rat GAPDH usually requires an O/N exposure @ -70°
with a screen (this may actually be more convenient as only a single exposure
needs to be made).

When this assay is used to detect point mutations, the hybridization temperature
is determined first and then the time and temperature of RNAase digestion are
determined using both an RNA which is a perfect match to the probe, and an
RNA which contains mismatches relative to the probe. Typically, detection of a
single base pair mutation will require a series of digestions @ 37° for 12, 60 and
120 minutes. Note that this assay will not detect all possible mismatches!!



Day 1

1. Preparation of labeled transcript (riboprobe):

        a.) Linearize the plasmid with an appropriate restriction enzyme, phenol
        extract, EtOH ppt. and resuspend in RNAase-free H2
        Typically it is convenient to prepare 10-
        time.

        b.) Synthesize the riboprobe (adapted from the Promega kit) by mixing the
        following (reaction can be scaled down to save reagents):



                                      pag. 59
                     rATP (10 mM)
                     rUTP (10 mM)
                     rGTP (10 mM)
                     H2O

                             plasmid
                     -32P-rCTP


             Incubate @ 37°, 1- 1.5 hr.

      c.) Digest the DNA template by adding:
                                            -free),

             Incubate @ 37°, 15'

      d.) Purify the riboprobe:
             Add 0.28 ml 1M NH4                                  0.3 ml


             Spin 2 min, & add supernatant to 0.75 ml EtOH,

             Incubate 10' on dry ice, spin 10' @ 4°, discard supernantant, drain,
             resuspend in NH4AOc and EtOH ppt. as before,


             hybridization soln.,

                                                                     - 1,000,000
             cpm).

2. Prepare molecular weight markers by either of two methods:
       a.) Method #1 (Klenow exchange reaction); combine the following:
                      -174 HaeIII digested DNA
                 10X Klenow buffer (see Maniatis, p. 112)
              1-      -32P-dGTP
              H2


             Incubate 30' @ R.T.




                                       pag. 60
       b.) Method #2 (Kinase end labeling); combine the following:
                        -174 HaeIII digested DNA (dephosphorylated)

                    -32P-ATP
             H2


             Incubate 30' @ 37°, then fractionate unincorporated nucleotides as


3. Hybridize riboprobe with RNAs of interest:

       a.) Prepare RNA:

             RNAase-free H2O, then immediately…

       b.) Add riboprobes & incubate overnight:

             75,000 - 500,000 cpm of riboprobe(s) (the lower amount of cpm is
             used when detecting genes which are weakly expressed as this
             lowers the background)

             Vortex, spin briefly, heat samples to 85° for 5', & then incubate
             O/N, at desired hybridization T° (a heat block filled with H 2O is a
             convenient "water bath")

       c.) Prepare a 6-10% (the % depending on the size of the fragments which
       must be resolved) urea acrylamide sequencing gel (or make it the next
       A.M.). Use the comb with the wide wells (0.8 cm; 30 wells per comb;
       modified by cutting 2 wells off an IBI #80100)

Day2

3. RNAase hybrids and prepare samples for electrophoresis:

       a.) RNAase:
             Add 0.3 ml of RNAase solution, immediately after removing sample
             from bath, then incubate at desired T° & time,

             (begin pre-running gel at this time)

       b.) Inactivate RNAases:
              When digestion is complete, place samples on ice, then add:

                                       teinase K

             Incubate 37° for 15',


                                     pag. 61
             (prepare labeled tubes with 0.75 ml EtOH during this incubation)

             At the end of the incubation, add:


             Vortex, spin 3', and pipet aqueous phase into 0.75 ml EtOH,
             Incubate 10' on ice, spin 10' @ RT, decant sup & drain inverted,
             Add 0.5 ml 70% EtOH (RT), vortex vigorously (pellet is usually quite
             large), spin 5' @ RT, decant, drain inverted, dry under vaccum &
                                                                      -20° O/N)

4. Gel electrophoresis:

      a.) Prepare molecular weight standards:
             2000-4000 cpm of labeled FX-174 HaeIII digested DNA (per lane)
             100-500 cpm of native riboprobe (per lane)

      b.) Heat, load and run samples as per DNA sequencing gel (with the
      exception of heating the samples @ 85°) until the bromophenol blue is
      near the bottom.

      c.) Fix, dry and expose gel @ -70° (with an intensifying screen) an
      appropriate length of time. In general, 1 - 3 days is sufficient. A few
      hours is generally sufficient for visualizing the GAPDH band(s) when using
      an homologous probe.




                                    pag. 62
21. Northern Blotting
1. Amount of RNA to load in one lane is 10-16 ug. The concentration of RNA
   samples need to be ~1 ug/ul.

2. Sample preparation:
           For each lane,      RNA + DEPC ddw + 35 ul sample mix = 44ul
           Sample mix* = 200 ul formamide
                         70 ul   formaldehyde
                         40 ul   10X FGRB
                         40 ul   10X RNA gel loading dye

      Optional: add 0.4 ul 10mg/ml ethidium to the above mixture (for 10 lanes).
      If RNA is prepare by Trisol method, add 0.2 ul of RNase-free DNase I to each
       sample (RNA +DEPC ddw) , incubate at 37 C for 15 min before addition of the
       sample mix.
      After adding sample mix, denature samples at 68˚C for 10 min, then put on ice
       right away.

3. Denaturing RNA gel:
      Gel can be casted before sample preparation. It’s best to run RNA gel that has
       been just prepared since formaldehyde will evaporate from gels that have been
       made for a long time.

Weigh 1.35g of agarose, melt in 108 ml ddw.
When the gel cools down to ~ 60˚C, add 15ml of 10 X FGRB, 27ml of
formaldehyde, total = 150ml. Final concentration of the agarose gel is 0.9%.
Need about 110ml for one medium size gel.

Level the gel tray, pour under chemical hood. The gel sets in about 40 min.
Since the RNA gel contains formaldehyde which evaporates, it’s best that you
run the gel within 1hr.

4. Run the gel at either 25 volts o/n (~14 hours), or 65 volts for 5 hrs. The BPB
    dye should run out ~ 7 cm from the wells.

5. Next day, if the RNA gel was run without ethidium, after the gel has run:
       i) Soak 3X 5' in H2O
                                               2O
       iii) Destain 2-3X 5' in H2O
       iv) Photograph
       v) Soak in 20xSSC for 45', cut filter (nylon or nitrocellulose) to size, label,
wet in H2O & soak in 20 x SSC
       vi) Transfer as per usual with 20 X SSC

If ethidium was added to the RNA samples, after the gel has run:
        i) Photograph with a fluorescent ruler next to the gel, to show the position
of the well, 28S as well as 18S rRNAs; Mark the picture with exp. # and date;
        ii) Soak in 20XSSC for 30-45’ with gentle shaking;

                                       pag. 63
         iii) Transfer in 20 X SSC to Duralon membrane. After transfer, marke the
filter the same way you marked your gel picture. Proceed to UV cross-link and
prehybridization etc as you would do with Southern Blot.




22. Freezing Bacteria
1.           Place 1.0 ml of fresh overnight culture in freezing (Nunc) vial.

2.           Add 0.23 ml autoclaved 80% glycerol in H2O. Mix. Freeze on
             dry ice.

3.           Transfer to -70 °C storage.




                                     pag. 64
23. Multi-gene Expression Assay (Reverse Northern Slot Blot)
1. cDNA PROBE SYNTHESIS:

          a.) First strand cDNA synthesis

          Combine the following in an RNAase-free tube, on ice:
               RNA* + H2O                       21.5
               5X RT buffer (BRL)
               dNTPs (2.5 mM each)
               oligo dT (1.25 mg/ml)

                 R.T.'ase (BRL-
                 _______________________________
                 total volume

          In order to determine the quantity and quality of the cDNA

          any 32P- -dXTP (3000 Ci/mmole, 10 mCi/ml)

          Incubate both tubes at 37°, 1-2 hr.

          Store the large scale reaction (-20°) while the analytical reaction is
          analyzed:

                 Add:
                             1
                                     2O

                                                               i/ 1% NaPi,
                 incubate @4°, 15', collect and count TCA ppt'ble material,
                 and determine yield

                                        4
                                            is material on a 1.2% alkaline
                 agarose gel (Maniatis p. 171). The products should be a
                 smear between 0.5 - 4.5 kB (see procedure # for making
                 appropriate markers)




                                  pag. 65
24. Mini-prep Plasmid DNA Protocol for Sequenase

             Robert Kraft, Biotechniques (1988) 6: 514-547

Materials:



1. Cells containing the plasmids are grown in tightly capped 15 ml plastic screw
top tubes with 5 ml of LB broth containing 100 ug/ml ampicillin. The cultures are
aerated by mixing on an orbital rocker (Nutator) in a 370C incubator for 20 - 24
hours.

2. 1.5 ml of the cultures are transferred to a 1.5 microfuge tubes and centrifuged
for 2 min. The supernatant is removed, an additional 1.5 ml of the culture is
added, and the tubes are again spun for 2 min. The supernatant is thoroughly
removed.

3. 100 ul of ice cold solution containing 50 mM glucose, 10 mM EDTA, and 25
mM Tris-HCL , pH 8.0, is added and the cells are resuspended by vortexing.

4. After 5 min at room temp., 200 ul of a freshly prepared 0.2 N NaOH, 1% SDS
solution is added. The now viscous samples are mixed by inversion and
incubated for 5 min on ice.

5. 150 ul of ice cold potassium acetate, pH 4.8, is added, mixed briefly by
vortexing, and incubated on ice for 5 min. This solution is prepared by adding
7ml glacial acetic acid and 3 ml distilled H2O to 15 ml 5M potassium acetate.

6. Following centrifugation at 4oC for 5 min, the supernatants are transferred to
fresh 1.5 ml tubes , centrifuged for another 5 min, and again transferred to new
tubes avoiding any carry over of any precipitate. The supernatant volume is
about 400 ul.

7. RNase A is added to final concentration of 50 ug/ml and incubated at 37 oC
for 30 min.

8. An equal volume of phenol/ chloroform (400 ul, 1:1, saturated with 10 mM
Tris-HCL, 1mM EDTA (TE), pH 8.0) is added, vortexed and spun in a microfuge
for 2 min. The aqueous phase (top) is transferred to a fresh 1.5 ml tube.

9. 2.5 volumes (1 ml) of ice cold 100% ethanol are added, mixed by inversion,
and incubated at -70oC for 10 - 30 min.

10. The samples are centrifuged at 4oC for 5 min. and the supernatants are
removed. The pellets are rinsed with 1 ml ice cold 70% ethanol and
recentrifuged 1 min. The resulting pellets are dried under vacuum (Normally, a
white pellet is visible).

                                     pag. 66
11. The pellets are dissolved in 16.8 ul distilled deionized H2O (if you wish to
perform a restriction digest on the plasmid to verify you have cloned the proper
sized insert, you can dissolve the pellets in
20 ul and remove 3.2 ul for the digest).

12. 3.2 ul of 5M NaCl is added and mixed. 20 ul of 13% PEG is then added,
mixed well and incubated on ice in the cold room for a minimum of 30 min. to
overnight (A 1 ml solution is made by dissolving 130 mg of PEG 8000 into
distilled deionized H2O).

13. The samples are centrifuged at 4oC for 10 min. and the supernatants are
discarded. The pellets are rinsed with 1 ml ice cold 70% ethanol, centrifuged 1
min. and again, the supernatants are discarded. The pellets are dried under
vacuum (normally, a pellet is not obviously present and appears as a small
transparent flake, if at all).

14. The DNAs are dissolved in 20 ul distilled deionized H2O (if you wish to verify
that the PEG precipitation worked, you can dissolve the pellets in 22 ul and
remove 2 ul to run on an agarose gel to visualize your yield).

15. 2 ul of a freshly prepared 2 N NaOH, 2mM EDTA solution is added, mixed
well, and incubated 5 min. at room temp.

16. On ice, 8 ul 1 M Tris-HCL (pH < 5) and 3.4 ul 3 M sodium acetate are added
sequentially. 75 ul ice cold 100% ethanol is added and the samples are
precipitated on dry ice for 20 min.

17. The tubes are centrifuged at 4oC for 5 min., the supernatants are removed,
the pellets are rinsed with 200 ul ice cold 70% ethanol, the tubes are spun an
additional 2 min at 4oC, and the supernatants are removed. The samples are
dried under vacuum (again, the pellets are normally not visible)
The following steps are a modification of the Sequenase protocol:

18. 1 ul of the appropriate sequencing primer, 2 ul of 5X Sequenase
Sequencing Buffer, and 7 ul of distilled deionized H2O are added to the dried
denatured DNAs. The samples are mixed and incubated at 37 oC for 30 minutes.

19. While the annealing mixes are incubating, 4 tubes per DNA sample are
prepared, each containing 2.5 ul of one of the four Termination mixes (ddGTP,
ddATP, ddTTP, ddCTP). These tubes appropriately labeled G, A, T, C, are pre-
warmed at 37oC.

20. The Sequenase is diluted 1:8 with ice cold TE, pH 7.4. The labeling mix is
diluted1:5 with distilled deionized H2O.

21. The following are added to each annealing mix:
                  1 ul 0.1 M DDT
                  2 ul Labeling Mix dilution
                  0.5 ul (4 uCi) [35S]dATP

                                     pag. 67
                  2 ul Sequenase enzyme dilution
These labeling reactions are incubated at room temperature for 5 min.

22. 3.5 ul of labeling reaction is transferred to each of four termination mix tubes
and incubated at 37oC for 5 min.

23. 4 ul of stop solution is added to each tube. The completed reactions are
stored at -20oC until use.

24. Before being loaded onto a sequencing gel, the samples are heated at 70 oC
in a water bath for 10 min and are then quickly transferred to ice. The tubes are
spun briefly in a microfuge and 2.5 ul of sample is used per lane on the gel.

  We use a 6% polyacrylamide/8 M urea gel stock prepared in 1X TBE buffer
(0.1 M Tris-borate, 2 mM EDTA pH 8.3) and run the gel in the same buffer at 80
watts. We do not fix our gels, but simply dry them onto Whatman 3M filter paper
and expose them to kodak SB 100 film for 12-24 hours at room temp. without an
intensifying screen. We have found that the plasmid preparations provide the
greatest yield when the sodium hydroxide, potassium acetate, and PEG
solutions used are less than a month old. Lysozyme can be used in the initial
glucose buffer, but we obtain equivalent yields without it. PEG precipitations of
only 30 min provide sufficient quantities of DNA for the reactions but longer times
are acceptable and we find this step to be a convenient point to interupt the
protocol overnight.




                                      pag. 68
25. Purification of Crude Oligonucleotides
            adapted from a variety of sources by John Krolewski



For routine purification:

-80% acetic acid
-55° bath
-speed vac

For gel purification:

-Reagents for preparing a urea-polyacrylamide gel (see procedure #12); Note:
the gel must be prepared on two siliconized plates (i.e. the long and short plates
are both siliconized) in order to visualize and excise the oligo.
-Fluorescent thin layer chromatography plate for "shadowing" band
-Short wave length UV source (hand held) for "shadowing" band
-Elution buffer (0.5 M ammonium acetate / 0.01 M magnesium acetate)
        To prepare 100 ml, combine:
           3.85 g Ammonium acetate and 0.21 g Magnesium acetate and adjust
           to 100 ml with MilliQ H2O . Filter (0.45 micron).
-Siliconized glass wool (rinse thoroughly and autoclave; handle with gloves)



This procedure is designed to deprotect and purify oligonucleotides synthe-sized
by the triester method on a solid phase DNA synthesizer such as the Applied
Biosystems 380-A. Following synthesis, thiopental is used to remove methoxy
groups from the phosphates and then ammonium hydroxide is used to cleave
the oligomer from the silica support. We usually receive the oligo after this step
(to verify, just smell the crude solution). The following steps detritylate the
oligomer and purify it. Taking the oligomer through step 9 is usually sufficient for
most uses (sequencing, PCR). For oligomers of 30 or more nucleotides length it
is advisable to gel purify the oligomer in order to remove short byproducts which
accumulate during the synthesis. Gel purification is also advisable for any oligo
which needs to be extra clean (such as reverse transcriptase primers) or
whenever there is a problem with the biologic activity of the oligomer.



1. Incubate the tritylated crude (in ammonium hyroxide) @ 55° O/N to remove
the trityl groups. Typically the crude oligomer comes in a volume of ~1.5 ml. It is
prudent to take half of the crude (0.7 ml) and incubate in a screw cap microfuge
tube, and save the remainder @ -20°.

2. Next a.m., speed vac until dry

                                      pag. 69
3. Resuspend the pellet in 0.3 ml 80% acetic acid and incubate 30' @ RT.

4. Speed vac until dry

5. Resuspend in:

             H2O                                       180
             3M Na acetate pH 5.2
             20% SDS

6. Spin 2' to pellet insoluble debris, take sup into clean tube and add 400 ml
100% EtOH and incubate -20° O/N

7. Spin 15' @ 4°, decant sup and remove residual EtOH

8. Wash 2X with 0.5 ml 70% EtOH, remove all residual EtOH and air dry.

                                   -free H2O, and remove an aliquot to determine
the OD260.

Further purification on a urea-polyacrylamide gel

10. Prepare a urea-acrylamide "sequencing' gel using two siliconized plates for
the "sandwich" (this makes it possible to eventually remove the gel entirely from
the plates in order to excise the band.) and the wide well comb (30 well version
of IBI #80100). Use the following table as a guide to choosing the appropriate
percentage acrylamide for optimal fractionation:

                    Oligomer length        Percent Acrylamide

                            <20                      20
                           20-30                     15
                            >30                      10

11. Load 0.5 - 2.0 OD260 units per well by first mixing the crude from step 9 with
an equal volume of 100% formamide (no tracking dye) and then heating to 55°
for
Load some tracking dye in a separate lane to monitor migration.

12. Run the gel @ 60 watts contstant power, using the following table as a guide
to expected migration:

   Percent Acrylamide              XC runs as a…             BPB runs as a…
           10                         55-mer                    12-mer
           20                         28-mer                     8-mer




                                      pag. 70
13. At the end of the run, disassemble the gel by lifting off one of the plates.
Next, cover the gel with a sheet of saran wrap and invert the gel onto a
fluorescent TLC plate.

14. Remove the other plate and visualize the oligomer with a short wave length
UV source (this is called "shadowing"). Use a clean blade to excise the band.
Don't get greedy; avoid the n-1 band!

15. Chop the band into small (1mm) cubes and put into a 2 ml screw cap tube.
Add 1.5 ml of elution buffer and incube O/N @ 37° on a rotator.

16. Pass the slurry through a syringe barrel containing a small amount of
siliconized glass wool. Rinse the fragments with 0.5 ml of elution buffer.

17. Speed vac down to 0.4 ml and then precipiate the oligomer with 1 ml of EtOH
(incubate on ice 10' or O/N @ -20°). Spin, decant EtOH, rinse with 70% EtOH
and dry pellet.

18. Resuspend in ~100      2O and determine the concentration
spectrophotometrically. Expect 100-




                                      pag. 71
26. Preparation of polyA+ mRNA
             adapted from Maniatis



Prepare the following RNAase-free solutions in glassware which has been


baked >2 hr. @ 250° (most caps cannot be baked; instead, soak O/N in 0.1%
DEPC H2O and then autoclave).

-DEPC treated H2O: collect ~500 ml MilliQ H2O directly from spigot (remove any
rubber tubing) into baked bottle, add 0.5 ml DEPC, mix thoroughly and
autoclave.



Procedure:




                                     pag. 72
27. DIRECT SEQUENCING OF PCR AMPLIFIED FRAGMENTS


( N. Neri, adapted from Mc. Mahon, PNAS vol.84, pp.4974-4979 )




MATERIALS NEEDED :


1) LMP Agarose


2) DNA sample


3) Phenol, Phenol-Chloroform, Chloroform


4) Two dry baths


5) Hand UV ligth ( long wave )


6) 3 M Na-Acetate, T.E. ( Tris10mM- Edta1 mM )


7) 70% Ethanol


8) T4 polynucleotidase Kinase


9) Sequenase kit ( from USB )


10) P-4 beads ( BioP-Gel P-4, from Bio-Rad )


PROCEDURE
A) PREPARATION OF DNA


1. Turn on dry bath, set to 68 degrees
2. extract the amplification reaction/mineral oil mixture with 60 ul chloroform
3. add 10% running buffer to the supernatant
4. run on an agarose minigel composed of: 2.1% LMP Agarose, Ethidium
Bromide .5 ug./ml, in TAE 1x buffer


                                   pag. 73
5. observe the band only with the long wave lenth UV light from the hand held
unit
6. cut out the band completely but with as little extra agarose as possible
7. place in the 68 degree dry bath for 5'
8. bring to 600 ul with TEN 1x and immediately add 600 ul of Phenol
9. mix and place on ice for 5', then spin 15' in a refrigerate centrifuge
10. take the supernatant and extract twice with an equal volume of
Phenol/Chloroform
11. extract once with an equal volume of Chloroform
12. add 10% of the volume of 3M Na-acetate pH 5.2, and twice the volume of
ethanol
13. precipitate 15' in dry ice, then spin 15' in a refrigerate centrifuge
14. discard supernatant
15. add 1 ml of cold 70% ethanol and spin 15'
16. discard the supernatant, invert the tube and let dry 30"
17. bring up to 12ul or less ( depending on the amount of pcr product ) with T.E.



B) LABELLING OF THE PRIMERS



Thaw on ice , the primers, the gamma-ATP, and the 10X T4 kinase buffer;
Mix : 7,5 ul gamma ATP, 10 picomoles of the primer, 1 ul kinase buffer, 0,5 ul of
T4 polynucleotide kinase ( final volume : 10 ul )
Incubate 1 hour at 37 degrees
Bring to 100 ul with T.E.
Spin on a P-4 column ( prepare the column in a 1 ml syringe, like a G-50 column
)
Recover the labelled primer and count the radioactivity in a beta counter ( a good
incorporation should be > 300.000 cpm/ ul/ minute
Concentrate the primer to about the volume of 40 ul.
The labelled primer can be store 24-48 hours at -20 degrees before the use.



C) SEQUENCING REACTION


1. Turn on two dry baths, one to 95 degrees the other to 55
                                     pag. 74
2. start prerun the gel
3. label one sample tube for each sample of DNA, one for each ddNTP, and one
reaction tube for each sample / ddNTP combination
4. in each sample tube add 2.5 ul of DNA solution ( the PCR product eluated
from LPM )
5. in each of ddNTP tubes ( G, A,T,C ) add the following reagents for each
sample:
       2.5 ul of ddNTP sequenase termination mix
       0.38 ul of 5X sequenase buffer
       0.22 ul of 0.1 M DTT
and when the water baths are ready,
          0.15 ul sequenase
it is best to do several samples at once for pipetting accuracy
6. mix and spin 2"
7. aliquote 3.2 ul in to the appropriate reaction tubes
8. add 11 ul of the labelled primer to the sample tube, mix and spin
9. put the sample tube at 95 degrees for 5'
10. spin 2"
11. put 2' at 55 degrees , in the meanwhile lower the 95 bath to 75-80
12. add 2,8 ul of sample mixture to each reaction tube
13. mix and spin 5"
14. incubate 5' at 37 degrees
15. add 3 ul of stop solution
16. heat to 75-80 degrees for at least 3' before loading ( 7 ul/ loading for only one
loading, 4 ul for two loading )




                                      pag. 75
28. OLIGOMER PURIFICATION FOR TRITYL OFF SYNTHESIS
Paolo Corradini, adapted from DNA facilities Columbia University, NY


- Incubate sealed vial @ 55 C 1-2 hours


- Quench 3' on ice (prevent explosion !)


- Aliquot 110 ul of crude oligo in Eppendorf tube


- Speedvac until dry (usually 35' with heater on )

- Resuspend the pellet in 40 ul of 0.1N NaOH


- Neutralize with 5 ul of 2 M Tris-HCl (pH 8) and add 55 ul of dd water


- Load the oligo (100 ul) onto P4 or G25 1 ml column


- Measure OD 260. With a 0.2 umole scale synthesis the recover is between
20 and 70 pmols/ul




                                     pag. 76
29. PROTOCOL FOR RACE-PCR
Paolo Corradini, adapted from Frohman ( PNAS 85, 8998; 1988)


1-For RNA extraction follow Lab Manual RDF


2-DNase treatment


20 ug RNA     7ul
10mM MgCl     2ul
DNase          1ul (RNase free, BM)


Incubate 10' @ RT
Inactivate heating 5' @ 70 C



3- cDNA synthesis using BRL SuperScript reverse transcriptase


   Heat 20-25 ug RNA with 20 pmols of RT primer @ 70 C for 10'
   Quench on ice 2'


    Add:    0.1 M DTT      5 ul    (BRL)
            5X RT buff    10 ul       "
            10 mM dNTPs     5 ul (Pharmacia)
             RNasin       0.5 ul (Promega)
             M MLV H-       2 ul (BRL)
             Total volume   50 ul with H2O


Mix and incubate 1-2 hour      37 C




                                      pag. 77
4-Alkali treatment


add :     50 ul H2O
           100ul 0.5 N NaOH / 5mM EDTA
boil for 1.30"
put on ice and add: 25 ul 1M tris pH8
                    25 ul 1N HCL


Dilute up to 2 ml with 0.1X TE and spin in Centricon 30 (Amicon)
2X @ 14 C for 30' @ 6000 RPM in Sorvall SS34 rotor
1X @ 14 C for 25' @ 6000 RPM same rotor
The cDNA is usually recovered in a final volume of 40-50 ul



5-dA Tailing


Use 44 ul of cDNA and add :
       6mM dATP      2ul
        5X TdT buff   12ul
         TdT enz.       2ul
         Total volume   60ul


Incubate 10' at 37 C ; inactivate the enzyme at 65 C for 15'
Dilute to 2 ml with 0.1X TE and spin 1X in Centricon 30 at the same conditions
used for the cDNA


6- First PCR reaction


in a PCR tube add :
2mM dNTPs       5ul (Pharmacia)
10X Taq buff    5ul (10 mM Mg ++)
Taq pol.       0.5ul (Perkin Elmer Cetus Kit)
DMSO             5ul
dT34             1ul (10 pmols)
Adap 19          1ul (20 pmols)
JH33             1ul (20 pmols)
                                    pag. 78
H2O             26.5ul
cDNA             5ul
Total             50 ul


Thermocycler conditions as in the log book of RDF lab (file 67 and 68)


7- 1.5 % LMP gel
After the run (5-6 cm) cut out the band using a long wave UV lamp
Melt at 68 C reamplify 5-10%


8- PCR 2

Use file 20 of log book
dNTPs           5ul
10X Taq         5ul (20 mM Mg++)
Tap pol         0.5ul
Adap19           1ul
JH19             1ul
H2O            26.5 ul
melted slice   10ul
total          50ul



9-PCR product digestion for cloning


-Melt the product at 68 C and extract from oil
-dilute the PCR product up to 100ul with 0.1X TE
-inactivate Taq pol and LMP extract using :
1X phenol
1X phenol/sevag
1X sevag
spin in G50 column equilibrated with 0.1X TE
precipitate 2 vol 100% ETOH plus 1/10 3M NaAc , 20' in dry ice
spin 20' @ 4C
let dry
resuspend in 25 ul of 0.1XTE


                                      pag. 79
add for digestion:


Eco RI 20U (BM)
HindIII 20U
B buff     5 ul
   H2O    16 ul
total      50 ul
 incubate @ ,37 C 3-4 hours


10-run 1.5% LMP gel


11-LMP extract as in RDF lab manual


12-Ligation , transformation and sequencing according to RDF lab manual



13-PCR 3 using clone specific oligos , the conditions of annealing temperature
and Mg++ concentrations as well as the number of cycles are dependent on
target DNA .


14- Southern blot as in RDF manual



15- Filter hybridization and washing conditions


Seal the duralon filter (Stratagene) in a seal a meal bag with 8 ml of TMAC hyb.
sol.
(11X 7 filter)
Prehybridize in the same solution for 1-2 hours at 58 C
Squeeze out the solution and add 7 ml of the same solut. that contains 1.5
million CPM of probe per ml
Hybridize 8-15 hours at 58 C
Drain bag into radioactive waste and start washes
3X 20' at RT with 500ml of 2X SSC/ 1% SDS
Rinse filter with 100 ml of 3M TMAC/ 1% SDS
Wash 2X 40' at 62 C with 350 ml of 3M TMAC/ 1%SDS . During the wash
invert several times the filter or use a shaking bath
                                     pag. 80
Rinse briefly with 2X SSC
Dry the filter 30' at RT
Expose -70 C with screens for 3-24 hours
This conditions work using a 21 bp oligo probe, but the temperatures have to be
changed when using oligos of different size


-3M TMAC Hybr. solut.:
5.38M TMAC        55.76 ml
20% SDS              5
2M Tris pH 7.6      2.5
0.5 M EDTA            0.4
50X Denhardts' sol    10
H2O                    25.34
total                   99


Before hybridization add 10ul/ml of boiled salmon sperm




                                    pag. 81
30. TRANSFECTION OF HUMAN B CELLS BY ELECTROPORATION USING
BIORAD GENE PULSER APPARATUS
(Katarina Cechova)
Materials:
-Routine cell culture materials
-Disposable 0.4cm Gene Pulser Cuvettes(Catalog No 165-2088)
-Electroporation buffer ( Isotonic Hepes buffer)
   137mM NaCl
   20 mM Hepes
   5 mM KCl
   0.7 mM Na2HPO4
   6 mM Dextrose
   pH 7.4


Preparation of the cells:
Cells must be in excellent condition and in log phase of growth.If there are lot of
dead cells or cell debris, the cells should be Ficolled 2-3 days prior to
electroporation.
The night before transfection seed the cells at 800 000/ml with changing 1/2 of
the fresh media.
Usually 12-15 million cells are transfected per sample.


Preparation of the DNA.
-The plasmid DNA to be transfected is prepared by two consecutive cesium
gradient centrifugations. The plasmid DNA is assumed to be sterile after the 70%
EtOH wash. All the steps after precipitation are performed in a sterile hood. The
70% EtOH is poured off, the DNA is allowed to, dry and resuspended in sterile
TE. The concentration of the DNA must be 4-5ug/ul.
Usually 5 pM plasmid DNA is transfected per sample in order to establish stable
cell line.(1pM=0.66ug/kb).
The amount of DNA to be transfected is normalized to 50ug using carrier DNA
(pGEM, calf thymus DNA).

Electroporation procedure:
-Prepare a series of 25 sq.cm flasks with 5 ml of growth medium and put them in
the incubator.
                                      pag. 82
-Prepare a series of 15 ml tubes containing 1 ml cell growth medium.
-Count the cells and aliquote them in the tubes (15 million cells/tube=1 sample).
-Spin down the cells at 4oC.
-Resuspend the cells in 5 ml of cold electroporation buffer and spin again.
-Resuspend the cell pellet in 0.4 ml of cold electroporation buffer.
-Add the DNA and resuspend again.
-Transfer the cells with the DNA into the electroporation cuvette.
-Keep on ice for 10 minutes.
-Electroporate.
-Keep the cells on ice 10 minutes after the electroporation.
-Add the cells slowly into the 15 ml tube containing 1 ml culture media that you
prepared at the beginning.
-Let stand for 10 minutes at room temperature.
-Transfer the cells to a flask containing 5 ml of growth media prewarmed in the
incubator.
-Keep the flasks vertically in the incubator.
-If the media is yellow and the cells are very concentrated after 24 hours, add
fresh media to reach the concentration of 1 million/ml and put the flasks
horizontally in the incubator.
-After 48 hours of incubation collect the cells for transient assays or selection.


We obtained the best efficiency of transfection using this settings:


       Cell line                   Capacitance Voltage          Cell viab.
                                   (uF)        (V)              aft.48 hr.
                                                               (%)
P3HR1(Burkitt lymphoma,EBV+) 500                  250           65
U937(Histiocytic lymphoma)   500                  150           89
CB 33(lymphoblast. line, EBV+) 250                300           68
U266(multiple myeloma)         960                250           72
KK125(Burkitt lymphoma, EBV-) 500                 250           79
EB 3 (Burkitt lymphoma, EBV+) 500                 250           30
Ramos ( Burkitt lymphoma, EBV -)960               250           52
                          OR, 960                 350           30 (used by Matty’s lab)

NOTE!!!


                                      pag. 83
Ramos cell line is electroporated in IMDM, 10% FBS (regular tissue culture
media), instead of isotonic hepes buffer at room temperature , instead of 4
oC



• MUTU BL gr.III (cl.176)              500          200         ~65
IMDM, 10% FCS, RT
• MUTU BL gr.I (cl.59)           960         200          ~65
IMDM, 10% FCS, RT
• Ly1 (diffuse large-cell
   lymphoma cell line)           960         250          ~65
IMDM, 10% FCS, RT
• Ly8(diffuse large-cell
   lymphoma cell line)           950         25 0         ~65
IMDM, 10% FCS, RT
• Val(B-NHLw/ BCL-6 xlocation)   500         25 0
IMDM, 10% FCS, RT
• Ly7(DLCL)                      960         25 0         ~65
IMDM, 10% FCS, RT
• Ly18 (DLCL)                    960         30 0         ~65
IMDM, 10% FCS, RT


Raji                          960         250
In RPMI/DEAE dextran/DNA solution (Gauss GH and Lieber MR, NAR, 20:6739-
40 (1992))


ER/EB                            960         250          ~60
RPMI, 10% FCS, RT


NSO (mouse plasma cell)          960         250          ~70
IMDM, 10% FBS, RT


30018 (mouse pre B-cell)         960         250          ~75
IMDM, 10% FBS, RT

ED 20 (mouse pre B-cell)         960         250          ~80
IMDM, 10% FBS, RT


                                   pag. 84
Jurkat(T cell)                    960           250
plain PBS, 4 C



Sensitivity of cell lines to selection antibiotics
(Katarina Cechova)


cell line                  G418                 Hygro B           Puromycin
                           (g/ml)              (g/ml)           (g/ml)
                    active concentration

NIH3T3                     120                  400U/ml (MCB, 20:2839, 2000)
SAOS-2                      400                 100
Ramos                      1400                 600               0.6
P3HR1                      1600                 900
EB3                        1400                 900
Jurkat                                          400
Daudi                       900                 900
ST 486                     1000
Rat-1                      600                  300
Balb-c                     1000
Bcl-1                      100
BL-74                      1100                 300
BL-113                     1100                 400
BL-54                       800                 300
Mutu BL gr.I               1000                 400               0.7
Mutu BL gr. III             800                 450
Val                                             225-250           0.7
Ly1                                             300               0.4
Ly8                        1200                 (300-350)         0.5
Ly3                                             <100
Ly7                                             400
Ly17                                            100-200*
Ly18                                            200-300*
Karpas                                          200
RCK8                                            100-200*


                                     pag. 85
*: Hi concentrations kill all the parental cell in 11 days; low conc. Kills in 2 wks.




Sensitivity of Cell Lines to Cadmium Chloride


                                   (uM)
Ramos                              0.5
Ly-1                               1.5
Ly7                                1.0
Ly-8                               2.0
Ly18                               4.0
Val                                2.0
Mutu I                             5.0
P3HR1                              2.0
EREB                               5.0




                                         pag. 86
31. CHLORAMPHENICOL ACETYLTRANSFERASE ASSAY
(Katarina Cechova)


References:
1 C.M. Gorman,et al (1982) Mol.Cell Biol. 2: 1044-1051
2 C.M. Gorman, et al. (1982) Proc. Natl. Acad. Sci. 79: 6777-6781.


A. MATERIALS AND GENERAL PRECAUTIONS:


1) Acetyl CoA is very unstable: it should either be made up fresh or, if stored,
aliquoted and kept at -20oC for not over 2 weeks. We purchase acetyl CoA from
Sigma and store solid at -20oC.
Catalog # A-2056 (5mg)


2) 14C chloramphenicol is stored at -20oC.Repeated thawing should be avoided.
We purchase it from New England Nuclear.
Catalog # NEC-408.


3) Ethyl acetate may be stored at 4 degrees or room temperature. Pipette this
reagent using glass pipettes only.


4) Reactions are generally carried out and processed in 1.5ml Eppendorf
microfuge tubes. Both we and several other groups have found that some lots of
Sarstadt tubes do not work well.


5) The TLC tank is best eqilibrated by placing filter paper around the inside of the
tank. Solvent should be made fresh each day, since chloroform is very volatile.


6) Silica gel TLC plates may be purchased from Scientific Products (Silica gel
60:cat No.C5460-6 -run in 1 hr) or Thomas (Baker Flex; cat No. 2738-E10 -run
in 2.5 hr.)




                                      pag. 87
B. ASSAY PROTOCOL


1) Harvest cells 36-48 hrs after transfection.
a)Wash cells carefully 3x with PBS (without Ca/Mg).
b) Add 1 ml Tris-EDTA-NaCl (0.04 M Tris-HCl, pH 7.4 / 1 mM EDTA / 0.15 M
NaCl), allow to sit at room temperature for 5 minutes.
c) Scrape off and pellet cells for 2 minutes at 4oC. Pellet may be frozen and
stored at -20oC for up to 4 months.




3) Disrupt cells by sonication or several freeze-thaw cycles.
   Sonication: 5x 0.5-1 sec bursts at RT using microtip at low-
                medium power (40-50 watts)-it is important to avoid
                frothing or splattering of the sample.
   Freeze-thaw:Immerse in EtOH/dry ice bath x5 min, thaw in 37
                  degrees bath x 5 minutes; repeat cycle 3 times.


4) Spin down debris (5 minutes in microfuge at 4 degrees), transfer 100 ul
supernatant to new tube; supernatant can be assayed directly or stored at -20oC.


 5) Depending on the cell type and promoter to be assayed, the amount of
extract used can be varied between 1-50 ul and the amount of 14C
chloramphenicol varied between1-5 ul.


Sample reaction (final volume 150 ul):
     70 ul 1 M Tris HCl, pH 7.8
      20 ul extract
      20 ul 4 mM acetyl CoA
      35 ul H2O
      5 ul 14C chloramphenicol (40-50 mCi/mmole) dilution 1:5 in
           cold EtOH-prepate in that moment.
Vortex and bring down in microfuge.

6) Incubate 10-30-60-90 minutes at 37oC. The time varies depending of the


                                     pag. 88
7) Extract chloramphenicol with 1 ml cold ethyl acetate by vortexing for 30
seconds.


8) Spin in microfuge (30 sec. at RT) and take top organic phase avoiding
interface.


9) Dry down ethyl acetate using vacuum aspirator ( requires about 2 hrs.)
Alternative:dry down overnite in fume hood-this occassionally
             causes partial 14C chloramphenicol breakdown, giving
            extraneous spots on the TCL.

10) Take up samples in 30 ul ethyl acetate and spot on silica gel TCL.


11) Develop TCL in chloroform:methanol (95:5); ascending. Prepare the tank at
least 1 hour before using it.


12) Expose against XAR-2 Kodak. film (or equivalent) overnite at RT. If a weak
signal is anticipated, sensitivity may be increased about 5x by treating the TCL
with Enhance Spray (NEN) and exposing overnite at -70 degrees




                                     pag. 89
(Katarina Cechova)


-Cell extract: See CAT assay
-Sample reaction: 1 ml PM2
                    15-
                     0.2 ml ONPG


PM2:       Na2HPO4                 60 mM
          NaH2PO4                40 mM
          KCl                   10 mM
          MgCl2                  1 mM




ONPG:       2 mg/ml, in Na2HPO4     60 mM
                      NaH2PO4      40 mM


-Incubation at 37oC (until a yellow shade is obvious 20-60 minutes).
-Add 0.5 ml stop solution (1 M Na2CO3 ).
-O.D. at 420 nm
-


                OD 420 nm x 380 x 10




Reference: Herbomel et al. Cell 39:653, 1984




                                     pag. 90
33. TRANSFECTION OF ADHERENT CELLS BY CALCIUM PHOSPHATE
PRECIPITATION
(Katarina Cechova)


Solutions:
Media: DMEM + 10% FCS


Trypsin/EDTA and Hank's


Hepes-NaCl: 50mM Hepes-from 1M sol. from Biofluids or
                         1.19g/100ml
           200mM NaCl-from powder 1.168g/100ml
           pH to 7.05 with 10N NaOH, and filter to sterilize. Make 5
           to 15 ml aliquots and store at-20.Check pH again after
           thawing to make sure it didn't change and filter again.


NaP: 35mM NaH2PO4 anhydrous-0.169g(monohydrate 194g)
    35mM Na2HPO4 anhydrous-0.199g
                                 to 40 ml H2O
     Filter to sterilize and store at 4o C.


2M CaCl: dilute in H2O, filter to sterilize and make 1 ml aliquots.
       Store at -20 C.


Procedure:


1. On the day prior to transfection plate the cells at:
 200 000 NIH3T3/100mm plate
 500 000 HeLa/100mm plate.


2. Refeed the cells with fresh media 4 hours prior to addition of
 DNA.

3. Prepare the CaPO4-DNA precipitate. All solutions should be at
 room temperature.


                                       pag. 91
   Depending on the goal of your transfection you can transfect
   1-3pM of your plasmid: for big plasmids you don't need carrier
   DNA. Use sterile screw cap Eppendorf tubes.
 b) Add sterile H2                                         -62)
                                                              -
   -NaCl-pNa made by mixing 49 to 1 volumes of these solutions.
                   -
   the pH of Hepes-NaCl is 7.05.
                        2 to each tube containing DNA+H2O. Vortex

   these and bring down in microfuge at RT( in cold it will
   precipitate).
 e) Form precipitate by adding the DNA solution slowly (1drop
   every 2-3 seconds) to the buffer. To obtain uniform mixing,
   bubble air into the buffer with a pipet during addition of DNA.


4. Allow precipitate to stand for 10-20 minutes.(the precipitate can
  stand up to 1 hour, but it will have to be resuspended) at RT.
  Pipette slowly into 10ml medium covering cells, mix gently
  without swirling, and place dish in incubator immediately.


5. Refeed with proper medium 16 hr. after transfection.Precipitate
  should appear at this time as dust-like layer covering the cells.


6. 48 hr after transfection either split the cells into selective
  media or harvest.




                                        pag. 92
34. AGAR CLONING.
(Katarina Cechova)


Materials:


Small Petri dishes, 35mmx10mm, Gibco cat # 925-3020XT


3% agar.Weight agar (Difco Laboratories, VWR catalog #
DF0140-01) and resuspend in PBS. Dissolve at low power in microwave oven.
Be carefull not to loose anything by boiling, otherwise your concentration will be
changed. Put the flask with agar in beaker with boiling water and boil it for 20
minutes. At this point agar is considered sterile.Aliquote agar in 2ml screw cap
tubes and keep them in the dry bath at 60 oC under the hood.


Fetal bovine serum. We use FCS, that was not heat inactivated.


Medium:IMDM + 20% FCS + P/S.


10x cell suspension resuspended in IMDM only.


Procedure:


_All the samples should be done in triplicate.


_Prepare the bottom, 0.5 % agar layer.Mix in following order:
 -3.2 ml media
 -1 ml FCS
 -0.8 ml agar (3%)
This will give you total of 5 ml. Prepare 4 Petri dishes and add 1 ml of agar
mixture to the bottom of each. Ignore the left over mixture.Prepare more dishes
with the bottom layer than you will need, in case agar will solidify quickly so you
can still have plates enough.


-Count the cells. Prepare the cells diluted in 10x concentration in IMDM only. The
final number of cells we use is 5x103, 104 and 2x104. It is strongly recommended
to use this titrated dilutions in order to be sure about the efficiency of
transfection which should increase linearly.
                                      pag. 93
-Prepare the upper (0.3%) agar layer by mixing in following order:
 -2.4ml of medium
 -0.8 ml FCS
 -0.4 ml cell suspension (10x)
mix this suspension and add carefully against the wall of the tube
 -0.4 ml agar (3%)                                                 not to kill the
cells by the hot agar.


-Remove the plates with the bottom layer from the refrigerator 30 minutes before
you plan to lay the upper layer.Lay the upper layer and leave the dishes under
the hood for 2 hours.


-After 2 hours put on plastic trays, add Petri dishes filled with sterile water on the
tray and incubate at 37 C. Score the colonies in 14 days.




                                       pag. 94
35. FREEZING TISSUE CULTURED CELLS.
(Katarina Cechova)


Spin down the cells you want to freeze at 4oC centrifuge. Usually 20x106
suspension cells or 1 subconfluent 100 mm Petri dish are frozen per vial.
Resuspend the cells in 0.9 ml of cold 30 % FCS IMDM. Add slowly, drop by drop,
0.9 ml of 20 % DMSO IMDM. Resuspend with pipet and transfer to freezing vial.
Put the vial immediately on ice.
Keep at -70oC 2-24 hr, than transfer to liquid nitrogen tank.
In order to get good quality of thawed cells it is very important, that your freezing
media are ice cold and the cells that you freeze are in excellent condition.




                                      pag. 95
36. TITRATION OF VIRUS-PRODUCING CELLS
(Simplified method)

Day 1

Grow Virus producing cells to 70% confluence
this can be accomplished by plating 2 days before infection

2 x106 cell for PA317/100mm dish
or
3.5 x106 " for psi2 AM/100mm dish

or the day before titration double concentration as they have 18 hr approx
doubling time


Day 2

Plate target cells
NIH 3T3 murine system
U2OS      human "

The day before titration plate 1 x 10 5 cells/ 6 well dishes
2 ml of 5 X 10 4 cells gives a more regular distributions of the cells
Make 3 replicates for each dilutions of the VCM that you want to test and 3
replicates for control of selection (medium + polybrene only)
example:1 virus 4 dilutions x 3 replicates =12 + 3 wells for control=15 wells

The night before titration change media to Virus producing cells with 1/2 of the
original volume w/o antibiotic.(5 ml)
Incubate 16 hrs ( o/n )


Day 3

Purification of supernatant
everything has to be done sterile
The lifetimes of the virus in the SN is between 6 and 12 hrs..
Prepare Iscove 8ug/ml polybrene for every single dilutions and for control of
selection.
Harvest SN and pass through 0.45 um filter
Dilute 2 x 10-2, 2 x 10-3, 2 x 10-4 and 2 x 10-5 (optional)
Stock solution of polybrene 1mg/ml in water ,-20 C,can be freeze/thaw
ex 100 ul in 12 ml of dmem 10%FCS
Dilution suggestion dilute 1:10
200 ul in 1.8 ml medium +polybrene
use 0.5 ml/well

                                     pag. 96
Infection
Remove medium from target cells
Starting from lower dilutions,add 0.5 ml of each dilution
Add 0.5 ml of medium +Polybrene
Incubate 3 hrs in the incubator at 37 C(frequent tilting)
Change medium

Day 4

Selection
Put cells at the appropriate concentration of anthibiotics

Day 14

Colonies scoring: stain plates

10% Formhaldeide in PBS ; 30 min at RT
Remove
Crystal violet ; 30 min RT
Wash DDW
Score




                                      pag. 97
37. TITRATION OF VIRUS PRODUCING CLONES BY RT-PCR
Modified from Morgan et al.,Hum.Gen Ther.1:135-149,1990

Reagents:
M-MLV Superscript GIBCO-BRL#8053SA
RQ1 RNase-free DNase Promega#M6101
RNasin Promega#N2111
random hexamers pdN6 Pharmacia #27-2166-01
reconstitute 1 vial with o.825 ml DDW will lead to 2000ug/ml (10 x)
dNTP Set 100mM solutionsPharmacia #27-2035-01
DEPC treated DDW
3M NaOAc pH 5.2
Taq polymerase Perkin Elmer #N 80110046

Isolate single cell clones
Wash cells with PBS
deposit 10 ul trypsine/EDTA
wait 2-3 min
with 5 ul medium+ serum pipette up and down 2-3 time
transfer in well of a 12 wells dish
When clones reach confluence, add 1/2 volume of fresh medium w/o selective
agents and prepare for RT-PCR the following day.

RNA isolation
Harvest supernatant(s), filter through 0.45 um syringe filter
Mix 400ul with 400ul of 8M LiCl
SN can be stored @ -70 C and freeze thawing 2-3 times do not affect RNA
preparation
Put immediately in dry ice for at least 10' , then transfer @ -20 C for minimum 1
hour.
Spin in microfuge @ 4 C 30'
Wash with 70% ETOH 2X
it is important that you wash very carefully as LiCl is inhibiting RT
dry pellet under vacuum

DNase treatment
Resuspend in 35 ul of DEPC treated DDW
Add 10ul of RT buffer 5X(supplied with Superscript)
and 4.5 ul of RNase free DNase (1U/ul)
Incubate @ 37 C for30'
Inactivate @ 68-70 C for 10'
Cool in ice
Divide samples in two different tubes of 25 ul each
one for RT plus and one for RT minus

ReverseTrancription and control
As a suggestion prepare a mix with all reagents, eccept the enzyme
To minimize carry over, start with control reactions and aliquot the mix in RT
minus tubes
                                     pag. 98
Then add the necessary amount of E for your reactions and aliquot the mix in
RT plus tubes

RT minus
Add as a mix
-7.5 ul DEPC treated DDW
-5 ul NTP's mix 10 mM
-5 ul RT buffer
-5 ul DTT 0.1 M provided with Superscript
-0.5 ul RNasin
-1 ul pdN6 200ug /ul dilute 1:10 your stock
RT plus
Add as a mix
-7.5 ul DEPC treated DDW
-5 ul NTP's mix 10 mM
-5 ul RT buffer
-5 ul DTT 0.1 M provided with Superscript
-0.5 ul RNasin
-1 ul pdN6 200ug /ul dilute 1:10 your stock
-1 ul M-MLV
Incubate @ 37 C 60 '
Inactivate RT @ 68 -70 C for 10'

NaOAc Precipitation
add 5ul of 3M NaOAc pH 5.2 and 125 ul ETOH
dry ice for 20'
spin for 20'
wash 70% ETOH
dry pellet under vacuum
resuspend in 18.2 ul of DDW

PCR reaction
For 25 ul reaction:
-1    ul Primer 5' 10pm/ul
-1    ul Primer 3' "
-2    ul NTP's 2.5 mM mix
-2.5 ul Taq buffer 10x 15 mM MgCl2
-0.25 ul Taq Polymerase
Add 25 ul mineral oil

PCR thermocycler
30 cycles of amplification
1'   Denaturation
1'   Annealing
1.30' Extension
Check 10 ul of your reaction




                                    pag. 99
pag. 100
38. RECIPES OF CELL CULTURE

TPA
5mg/ml in DMSO

IL2 h-Rec
20U/uL
10.000 U in 500 ul medium +FCS
M.W.15 000
15 000 gr =1M
15 000 pg =1pM
15 ng     =1pM
C.R.
6.2 x 106 U/mg prot
6.2 U/ng       prot
100U =16 ng

OUABAIN
dilute to 10mM in DDW
working solution 0.5 uM

PHA(Wellcome)
dilute in PBS and add Pen/Strep


CRYSTAL VIOLET

0.15 g crystal violet
 90 ml ddw
   5 ml NaCl 5M
300 ml ddw

PBS 10 X (1 Liter)

 80      g NaCl
 2       g KCl
 6.1    g Na2HPO4(anh.)
  2      g KH2PO4




                                  pag. 101
39.     Pulsed Field Gel Electrophoresis (PFGE)
        (Gianluca Gaidano)


General organization

PFGE consists of 5 phases:

1. Preparation of DNA
2. Digestion of DNA
3. Gel electrophoresis
4. DNA breakage
5. Southern blot, hybridization, washings, and exposure

As of 2/94, all hardware for PFGE (plugs mold, gel trays, combs) is kept in
bottom drawer below the CHEF mapper in Sequencing Room.


Phase 1. Preparation of DNA.

Depending on the size range of the fragments of interest, different DNA sources
may be used:

for fragments < 30 Kb: standard genomic DNA is sufficient
for fragments > 30 Kb: DNA plugs are necessary

For the preparation of DNA plugs, the following reagents are required:

-     viable cells
-     cold PBS
-     0.9 % NaCl (autoclaved)
-     LMP agarose (Biorad # 162-0019)
-     Lysis buffer (0.5 M EDTA pH 8.0, 1 % Sarcosyl)
-     Proteinase K
-     TE pH 8.0 (autoclaved)
-     PMSF
-     EDTA 0.5 M pH 8.0
-     plugs mold


Procedure:

As a general rule, in order to avoid DNA degradation, use disposable steryle
pipets (for cell culture).
- Prepare 1 % LMP agarose in 0.9 % NaCl. Keep at 42 oC.
- Wash cells 2X in cold PBS
- Resuspend cells in 0.9 % NaCl (5 x 107 cells/ml)
- Keep cells at 42 oC for 30-60 seconds
- Mix cells + LMP agarose 1:1 (mix has to be homogeneous)
                                    pag. 102
-   Pour into molds on ice (each slot will accomodate 300 µl and will be good for
    3-10 PFGE lanes, depending on size of the wells used in the gel)
-   Keep on ice for 15 min
-   Transfer solidified plugs to Lysis buffer (e.g. 20 plugs in 50 ml of lysis buffer
    in Falcon tube). You can help the plug sliding off the mold using a sterile
    disposable bacterial loop. It is convenient to do the following steps in Falcon
    tube
-   Add Proteinase K (1 mg/ml final)
-   Incubate 24 h at 50 oC in water bath
-   Change buffer by adding 50 ml fresh lysis buffer + proteinase K (1 mg/ml
    final)
-   Incubate 24 h at 50 oC in water bath
-   Wash plugs in TE for 10 minutes
-   Decant TE and incubate in fresh TE + PMSF 40 µg/ml for 1 h at 50 oC
-   Decant, add fresh TE + PMSF 40 µg/ml, incubate for 1 h at 50 oC
-   Wash in TE for 30 min at RT
-   Decant and repeat 10 times, each time with 50 ml of fresh TE for 30 min
    (careful! these washings are essential in order to remove the lysis buffer)
-   Wash in TE at 4 oC O/N
-   Wash in TE at RT 5 times for 30 min

If you intend to digest the plugs immediately, go the phase 2. Otherwise, plugs
can be stored in 0.5 M EDTA at 4 oC for months.


Phase 2. Digestion of DNA.

-   If plugs have been stored in EDTA, wash them in TE for 5 times (10 ml each
    time for each plug). It is best to do it in small Petri dishes.
-   With a clean blade, cut the plug of the size of the well you are going to use
    (see phase 3).
-   Place the cut plug on the bottom of a 5 ml snap cap tube
-   Digest in 300 µl (i.e.: 30 µl of Reaction buffer + 270 µl of dH 2O) with 100 U
    of RE. For each RE, use the appropriate buffer and temperature.
-   Digest O/N
-   Wash digested plug in TE twice (in Petri dish). Load them in gel as described
    in phase 3.


Phase 3. Gel electrophoresis (using the CHEF mapper autoalgorithm).

Reagents and materials needed:

PFGE certified agarose (Biorad 162-0137)
Gel tray + comb
CHEF mapper manual



                                     pag. 103
To learn how to use the autoalgorithm, read the CHEF mapper manual carefully
at the autoalgorithm section (pages xx-yy). The manual will also give you
detailed information on how to prepare and load the gel. Here below are some
practical tips which complement the instructions found in the manual.

-   As a first step, check on the CHEF mapper autoalgorithm the agarose
    concentration and the type of running buffer (0.5X TBE or 1X TAE) that you
    need for the selected size range
-   Prepare agarose gel as suggested by the autoalgorithm (as for concentration
    and buffer)
-   Choose comb depending on the desired number of lanes
-   Prepare gel as described in the CHEF mapper manual (pages xx-yy)
-   Fill the wells with DNA plug. Seal the well with LMP agarose of the same []
    as the actual gel. Allow the LMP gel to solidify.
-   Pour 2 liters of running buffer into the electrophoresis tank and precool the
    buffer to the temperature suggested by the autoalgorithm. Recirculate the
    buffer by using the pump connected with the tank and the cooler. For optimal
    recirculation speed, set pump between 7 and 8. Check buffer temperature in
    the tank. Do not start the electrophoresis before the temperature in the tank
    reaches the value suggested by the autoalgorithm (usually, 14 oC). Change
    the buffer (precooling it every time) every 24 hours of run.


Phase 4. DNA breakage.

Stain the gel in EB for 30 min. Take picture (avoid long exposure of the gel to
UV). In order to break the DNA: place the gel on saran wrap in the Stratalinker
and activate it at 60 mJ.


Phase 5. Southern blotting, Hybridization, Washings, and Exposure.

As for standar Southern blots.


-  With a clean blade, cut the plug of the size of the well you are going to use
   (see phase 3).
- Place the cut plug on the bottom of a 5 ml snap cap tube
- Digest in 300 µl (i.e.: 30 µl of Reaction buffer + 270 µl of dH 2O) with 100 U
   of RE. For each RE, use the appropriate buffer and temperature.
- Digest O/N
-      Wash digested plug in TE twice (in Petri dish). Load them in gel as
described in phase 3.




                                    pag. 104
    40. SINGLE STRAND CONFORMATION POLYMORPHISM
          (Gianluca Gaidano)


Stock Reagents:

-    Taq polymerase
-    Oligonucleotide primers 10 pmol/µl
-    Standard PCR Buffer (from lab stock): 100 mM Tris pH 8.8, 500 mM KCl, 0.1
     % gelatin, 1 mM MgCl2. [MgCl2] may vary from 1 mM to 2 mM according to
     each pair of oligonucleotides used.
-    1 mM dNTPs (A + G + T + C; each of them 1 mM)
      32P-dCTP (10 mCi/ml)
-    5X TBE (from lab stock)
-    Acrylamide/Bis solution (19:1) (from lab stock)
-    Glycerol
-    20 % SDS
-    Stop solution (95 % Formamide; 0.05 % BPB; 0.05 % XCBB; 20 mM EDTA)



Hardware:

Thermocycler
Sequencing gel electrophoresis apparatus



General organization:

The SSCP procedure consists of 5 phases:

1. SSCP-PCR reaction
2. Gel preparation
3. Denaturation of the PCR product
4. Gel electrophoresis
5. Exposure



Phase 1. SSCP PCR reaction

Careful! The protocol for PCR reaction outlined below is not the standard PCR
protocol. It has been specifically adapted for SSCP and yeilds a significantly
lower amount of PCR product than the standard PCR reaction. In some cases,
the yeild may be so low that you will not be able to see the PCR product by EB
staining on agarose gel.

                                     pag. 105
Before setting the reaction:
a) thaw 32P-dCTP and dilute 1:10 in dH2O.
b) thaw an aliquot of 1mM dNTPs and dilute 1:40 in dH2O (i.e. 25 µM).
c) dilute Taq polymerase to 0.5 U/µl.

Set the SSCP-PCR reaction as follows:

DNA 0.1 µg/µl             1 µl
10X PCR Buffer            1 µl
1 mM dNTP 1:40            1 µl (final in reaction: 2.5 µM)
5' primer                 1 µl
3' primer                 1 µl
  32P-dCTP 1:10           1 µl
dH2O                      3 µl
Taq polymerase 0.5 U/µl   1 µl
                          ____
                          10 µl

Perform PCR reaction as best suited for your specific PCR product. (A prototype
reaction consists of 30 cycles at 94 oC, XX oC (depending on your pair of
primers), and 72 oC, for 30, 30, and 60 seconds, respectively). The PCR
products can now be stored for up tp 1 week before denaturation and gel
electrophoresis (careful! they are radioactive).

If you are testing a new PCR product:

 you must first set the PCR conditions by a Mg/temperature curve. You can
perform the Mg/temperature curve by using the protocol for PCR reaction
described above. Since the PCR products will be checked by EB staining on
agarose gel, substitute the 32P-dCTP with dH2O. If you are unable to see the
PCR product on agarose gels, try to set your Mg/temperature curve using the
standard PCR protocol of the lab. As a rule, the best PCR product obtained in
your Mg/temperature curve for standard PCR reactions will also be suitable for
PCR-SSCP.



Phase 2. Gel preparation.

Treat and assemble the gel plates exactly as described in the DNA sequencing
section of the manual. The preparation of the gel itsel is as follows:

5X TBE             20 ml
50 % Acrylamide/Bis       12 ml (final 6 %)
glycerol           10 ml
H2O                up to 100 ml


                                   pag. 106
Mix by stirring.
Filter the gel mixture with a 50 ml syringe through a 0.45 µ syringe filter into a
clean beaker.
Add 1 ml of 10 % of APS and 100 µl of TEMED. Stir thoroughly and pour into gel
sandwich, as described for DNA sequencing gels. Use the comb with 0.8 cm
wells.



Phase 3. Denaturation of the PCR product.


Set a heat block at 85-90 oC.
Dilute 2 µl of PCR reaction into 50 µl of 0.1 % SDS/10 mM EDTA. Mix 2 µl of the
diluted PCR reaction with 2 µl of stop solution, and heat denature at 85-90 oC for
5 minutes. Place the samples immediately on ice and load them within 10-15
min. Load 3 µl of each denatured PCR reaction per well.


Phase 4. Gel electrophoresis.


No need to pre-heat the gel. Run the electrophoresis at 8 W per gel at RT for 12-
15 h depending on the size of the PCR product.


Phase 5. Exposure.


Fix the gel in 10 % acetic acid for 30 min. Rinse quickly with tap water. Air dry.
Expose at -70 oC with screen O/N.




                                    pag. 107
41. IMMUNOFLUORESCENCE (HA)
                                                      (Wilfredo Mellado)
       NOTE: Keep antibodies on ice

1.-   Use Chamber Slide (Nunc 177402). All solutions must be         filtered (0.22 um).
Every well has an area of 0.8 cm2 .

2.-     Coat the dishes with polylysine (40 ug/ml) 30' at RT, rinse with    dH2O
(sterile). For cells in suspension we use Cell-Tak (Collaborative      Biomedical
Products Cat# 40240) at 3.5 ug Cell-Tak/cm2 of surface.

3.-    Plate cells and incubate for 4 hrs at incubator (37 oC 5% CO2)
4.-    Wash slide with PBS 2x ( for 10 sec each).
5.-    Fix with 4% Paraformaldehyde (in PBS) for 10 min at RT.
6.-    Wash with PBS 2x.
7.-    Fix with cold methanol 7 min (in freezer).
8.-    Wash with PBS 2x.

9.-    Block 30 min with diluent (10% goat serum diluted in PBS).
10.-   Incubate 30 min with antibody at RT (for HA use 1/50).
11.-   Wash 2x with PBS.
12.-   Incubate with 2o Ab (fluoresceine) 1/200 for 30 min at RT.
13.-   Wash 2x with PBS.
14.-   Add Aqua-mount and coverslip. View after drying.



       Plate 2000 to 4000 cells per well, for a good distribution.




                                    pag. 108
42. Aldh assay

Kohn et al (1987) Cancer Res. 47, 3180 - 3185

Assay                                     Stock         30 tubes

32      mM    NaPPi pH 8.2                64 ul 0.25 M             1920 ul
0.1     mM    Pyrazole             0.17   0.3         5.1
5       mM    NAC*                 5      0.5         150
1       mM    EDTA                 5      0.1         150
4       mM    NAD                  40     0.05        1200

4       mM    Acetaldehyde                20            0.1


* NAC is N-acetyl-cysteine (Sigma, cat # A-7250)

Start the reaction (final volume 500 ul) with the addition of 4 mM Acetaldehyde (20
ul 0.1 M stock). Acetaldehyde (Baker, d= 0.78109 kg/l, 17.7 M) 0.1 M = 11.3 ul 17.7
M in 2 ml of 32 mM Na Pyrophosphate pH 8.2.

Control is the same without acetaldehyde.
Change of Absorbance at 340 nm for 60 min at 37 oC. The difference at time 60
minutes should be about 0.08-0.1 A340 .

Sample:
Cell lines were extracted in 500 ul of 1.15% KCl containing 1 mM EDTA and 0.1
ug/ul Leupeptin (Sigma). Sonicated 10 seconds at 90 Watts (Microsom, Ultrasonic).
Finally they were centrifuged at 100 000 x g (Beckman TL-100) for 10 minutes at 4
oC. Usually we get a solution of 2.0 to 2.8 ug/ul. We add 200 ug of protein per
reaction.

Protein determination by the Bradford method (Bio Rad). For L1210 cells 30 ug of
protein is approx. to 1 x 106 cells.

Positive control=
       Aldh 1 from yeast (Sigma cat # A5550) 0.1 units/ul. We use from 0.001 to
0.1 units/reaction and the change in A340 is about 1.0.

The extintion coefficient for NADH at 340 is 6.22 x 10 -3.




                                     pag. 109
43. Instructions to use Blotter (Genie)

1.- Place negative electrode at the bottom of the tray (the connector should be
in the upper left side).
2.- Place a plastic bubble screen on the electrode (the ribbed side contacting
the electrode). Caution: The plastic bubble screen has a flat side and a
ribbed side.
3.- Place one pad on top of the plastic bubble.
4.- Place one filter paper (Whatman 3 MM). Cut the paper the same size as the
pad (15x17 cm).

5.- Add buffer (the normal Tris - Glycine - 20% Methanol, without adjusting the
pH). Take care that no bubbles are trapped. Approx. vol.= 500 ml.
6.- Place the gel (usually I flip the gel, so that the NC, after transfer, has the
same distribution as the loaded gel).
7.- Place a wet NC on top of the gel. No bubbles are allowed to stay between
the paper and the gel!!.

8.- Place another filter paper (Whatman 3 MM). It doesn't need to be the same
size as the pad.
9.- Place 2 pads.
10.- Place another plastic bubble, now the ribbed side should be up.
11.- Finally place the other electrode and use the plastic to close the tray. Add
more buffer if necessary. Slide the tray into the case.

Move the case to a vertical position and connect the electrodes.
Minigels were compleatly transfered in 30' at 20 volts.

After the run dry everything thoroughly before assembling!!!




                                    pag. 110
44. Suggestions to scan pictures

1.- Open Ofoto
2.- At the scan control window set the proper image type. i.e. select
        grayscale photo for XAR films.
3.- Prescan (Click on Prescan).
4.- Crop the area needed.
5.- Scan
6.- Select options if it is required. If not, save the scanned file.


Suggestions how to use Image 1.58

1.- Open Image 1.58
2.- Open the gel that you want to use for densitometry.
3.- Load Macros:
        - Click on "Special" and go to "load macros"
        - Look for the macros folder in RDF Power PC, inside folder
        "Applications" and inside folder "Image 1.58".
        - Open the "Macros" folder and open the "Gel plotting macros (old)".
4.- Select lane to analyze.
5.- Click on "Special" and go to "Setup to plot gel". Enter the number of lanes
to be analyzed.
6.- Again under "Special" select "Plot lane". The densitometry of the lane
selected will appear.
7.- In order to get numbers (area under the curve) select from the tool box the
line maker.
8.- Make the proper lines, so that a closed area could be selected. Repeat the
same proces to every plot that you made.
9.- Select from the tool box the "Magic thoothpick" (is tool number nine from
the first column). and click inside the area that you want information.
10.- Finally, under "Analyze" click on "show results" and a window will open with
the number of pixels contained in each area that you selected. Note that the
numbers will be introduced in the order that you selected them with the "Magic
thoothpick". At this point you can print the results.




                                     pag. 111
45. SDS-PAGE protocol

Method:        Laemmli (1970)
Running Gel (30 ml)

                                     4%    5%     6%    7%    7.5% 10%     12%   15%
                                     ========================================================

Acrylamide:bis (30:0.8)                      4     5       6     7         7.5   10   12   15

Tris-HCl pH 8.8 (1.5 M)              7.5   7.5    7.5   7.5   7.5   7.5    7.5   7.5
SDS            (10 %)                0.3   0.3    0.3   0.3   0.3   0.3    0.3   0.3
Glycerol         (50 %)              6     6      6     6     6     6      6     6
EDTA            (0.1 M)              0.3   0.3    0.3   0.3   0.3   0.3    0.3   0.3
dWater                               11.9  10.9   9.9   8.9   8.4   5.9    3.9   0.9
                                     ========================================================
TEMED (ul)                     45    45    45     45    45    45    45     45
A. Persulfate (ul 10%)               150   150    150   150   150   150    150   150


       Stacking Gel (10 ml)

Acrylamide:bis (30:0.8)              1.5
Tris-HCl pH 6.8 (0.5 M)        2.5
EDTA           (0.1 M)         0.1
SDS            (10 %)          0.1
dWater                         5.8
                               ===
TEMED (ul)              37.5
A. Persulfate (ul 10 %)        150



       2X SAMPLE BUFER (Laemmli, 1970)

                                     10 ml         50 ml

125 mM Tris-HCl (pH 6.8)             2.5           12.5 ml 0.5 M
4 % SDS                              4             20 ml 10 %
20 % Glycerol                        2             10 ml 100 %
10 % 2-mercaptoethanol                       1             5     ml 100%
0.02 % Bromophenol blue                      0.2           1     ml 1 %




                                       pag. 112
46. Cisplatin Resistance Assay

LD50 for Cisplatin

Cells will be incubated for 3 days with increasing concentrations of cisplatin.

Ref:   Godwin et al., (1992), PNAS 89, 3070-3074.


Stock Cisplatin:     25 mg in 50 ml (1.67 mM)

Cells in duplicated for each clone. Use 96 well plates.

Cisplatin concentrations:          uM     0, 0.05, 0.1, 0.5, 1, 5, 10, 50.

Make a 10X stock on a 96 well plate in 150 ul

       10X uM        ul stock                                   uM final

       0.5           15 ul from 1/10 dilution 5 uM              0.05
       1             15 ul from 1/10 dilution 10 uM             0.1
       5             15 ul from 1/10 dilution 50 uM             0.5
       10            15 ul from 1/10 dilution 100 uM            1
       50            15 ul from 1/10 dilution 500 uM            5
       100            9 ul from stock 1.67 mM                   10
       500           45 ul from stock 1.67 mM                   50

Incubate cells for 3 days at 37 oC.
Determine cell viability by the MTT assay.




                                     pag. 113
47. Determination of cell viability by the MTT Assay

MTT (3,(4,5-dimethylthiazol-2-yl)2,5,-diphenyl-tetrazolium bromide)

Ref:   Hansen et al., (1989), J. Imm. Meth. 119, 203-210

Dissolve MTT at 5 mg/ml in sterile PBS. Filter (0.2 u) and keep it at 4 oC in the
dark.

Add 40 ul of the solution to each well.
Incubate the cells for 2 hrs at 37 oC.
Add 100 ul of lysis buffer.

Lysis Buffer: 20% SDS in 50% DMF. Adjust the to pH 4.7 with Acetic Acid.

Incubate O.N at 37 oC.
Read Absorbance at 570 nm.




                                     pag. 114
48. 96 well microplate staining for FACS analysis

1- Resuspend the cells in complete medium at a convenient concentration (each
      microtiter well contains 300 µl and you may not stain less than 250.000
      cells per well).

2- Place 0.25 to 3 millions cell per well of a 96 U bottom wells plate.

3- Centrifuge at 1500 rpm for 5 min (below the 4.5 tag on the big bench
      centrifuge)

4- Discard the supernatant in the sink with a quick wrist-forearm movement.

5- Vortex the whole plate in order to resuspend the cells in the few µl left.

6- Fix for 10 min in 200µl Becton Dickinson lysing buffer 1x (made from the 10x
        stock solution).

7- repeat steps 3 to 5

8- add 250 µl of PBS to each well

9- repeat steps 3 to 5

10- add 100µl of goat serum to each well and leave for 15-45 min.

11- fill up with PBS

12- repeat steps 3 to 5

13- add the diluted antibodies (50 to 100 µl/well) and incubate for 45 min to
      overnight

14- repeat steps 3 to 5

15- add 250 µl of PBS to each well

16- repeat steps 14 and 15

17- add the secondary antibody (50 to 100 µl/well) and incubate for 45 min.
      Protect from direct light exposure.

18- repeat steps 14 and 15.

19- repeat steps 3 to 5

20- add 50 µl of 10% buffered formalin to each well, protect from light and store
      at +4°C


                                      pag. 115
21- resuspend each well and transfer to 300 to 500 µl of PBS in a FACS tube.

Contributed by
Giorgio Cattoretti, M.D.
Columbia University, Department of Pathology
P&S 15-410
630 West 168th Street,
New York, N.Y. 10032
phone (212) 305-6048
FAX (212) 305-5498
email: gc87@columbia.edu




                                   pag. 116
49. 96 well microplate nuclear staining for FACS analysis
(modified from Am J Clin Pathol 99: 298, 1993)

Perform all steps at +4°C, up to the fixation point. Do not use PI counterstaining.

Single color nuclear immunostaining.

1- Resuspend the cells in complete medium at a convenient concentration (each
         microtiter well contains 300 µl and you may not stain less than 250.000 cells per well).
2- Place 0.25 to 3 millions cell per well of a U bottom 96 wells plate.
3- Centrifuge at 1000 rpm for 5 min
4- Discard the supernatant in a basin with a quick wrist-forearm movement.
5- Vortex the whole plate in order to resuspend the cells in the few µl left.
6- Fix for 10 min in 200µl lysing buffer 1x (made from the 10x stock solution).
         Several companies sell this lysis buffer. Alternatively see J Immunol
         Methods 124: 103, 1989. Plain formalin or gluteraldehyde fixation makes
         the cells very sticky.
7- repeat steps 3 to 5
8- add 250 µl of PBS to each well
9- repeat steps 3 to 5 (centrifuge, discard the supn and vortex)
10- add 50µl of goat serum (1:10 in PBS) to each well and leave for 15-45 min.
         Alternative blocking sera may be used (e.g. human, providing that the
         same serum is added to the secondary antibody used). Blocking with milk
         should be avoided because antigenicity may be reduced.
11- fill up with PBS
12- repeat steps 3 to 5 (centrifuge, discard the supn and vortex)
13- add the diluted antibodies (50 to 100 µl/well) and incubate for 45 min to
         overnight. Do not exceed 24 hrs of incubation because the formalin bonds
         begin to become loose thereafter. Anti BCL-6 antibody PGB6 may be
         used 1:10 from the supernatant. Do not use anti BCL-6 polyclonal
         antibodies because the results may be unpredictable. Set up a well
        with a 100% positive immunostain (e.g. HLA-ABC) for each
        fluorescence wavelenght you will use. This is to set up the
        machine. Provide at least 1 million cells in this well.
14- repeat steps 3 to 5 (centrifuge, discard the supn and vortex)
15- add 250 µl of PBS to each well
16- repeat steps 14 and 15
17- add the secondary antibody (50 to 100 µl/well) and incubate for 45 min.
       Protect from direct light exposure. Do not exceed 24 hrs of incubation
       because the formalin bonds begin to become loose thereafter.
18- repeat steps 14 and 15.
19- repeat steps 3 to 5 (centrifuge, discard the supn and vortex)
20- add 50 µl of 10% buffered formalin to each well, protect from light and store
       at +4°C The cells are now very stable and can be read within 15 days.
21- resuspend each well and transfer to 300 to 500 µl of PBS in a FACS tube.

Double color nuclear immunostaining.


                                           pag. 117
Providing that the both antibodies perform optimally with this type of fixation and
        permeabilization, mix the two antibodies in step 13 and then mix the two
        secondary antibodies in step 17. If the primary antibodies are made in the
        same species and of the same isotype, chose a directly conjugated form
        of one of the pair. If else use anti-isotype or species-specific secondary
        antibodies. PGB6 is mouse IgG1 ab.
If the second antibody needs a formalin-methanol fixation method, then proceed
        with BCL-6 staining (or other staining) up to step 15 included. Then
16- repeat step 14
16-a- add 250 µl of cold methanol to each well and incubate 10 min.
16-b- repeat steps 3 to 5 (centrifuge, discard the supn and vortex)
16-c- add 250 µl of PBS to each well
16-d- repeat steps 3 to 5 (centrifuge, discard the supn and vortex)
16-e- add 250 µl of PBS to each well
16-f- repeat steps 3 to 5 (centrifuge, discard the supn and vortex)
Proceed as for double color nuclear immunostaining.
Suggested positive controls: anti-TdT monoclonal antibodies and anti-Ki-67
        polyclonal antibody.


Double color membrane and nuclear immunostaining.

Most of the antibodies equally stain fresh and fixed cells (J Immunol Methods
      124: 103, 1989). The difference is that in fixed cells intracellular and
      nuclear antigen are also stained. If you will use fixed cells proceed,
      proceed as above. If you like to mantain selective membrane staining,
      stain the live cells in the usual way, wash, fix in the fixative and then
      proceed with a species-specific or isotype specific sequence. If you have
      directly conjugated antibodies available, use pairs of them.


Contributed by
Giorgio Cattoretti, M.D.
Columbia University, Department of Pathology
P&S 15-410
630 West 168th Street,
New York, N.Y. 10032
phone (212) 305-6048
FAX (212) 305-5498
email: gc87@columbia.edu




                                     pag. 118
50. Gel Mobility Shift Assay (EMSA)
Specifically designed for detection of BCL-6 and Gal4 DNA binding complexes in
nuclear extracts.

       A. prepare your gel (5% 100 ml)
              20 ml 5xTBE
              16.6 ml 30 % acrylamide-Bis ( ratio 37.5:1)
              62.4 ml H2O
              1 ml 10 % APS

              filter through 0.2 uM filter

              add 50 ul TEMED

       B. prepare your running buffer
              0.5x TBE

       C. Prepare reaction mixture
1. For 20 ul of reaction, prepare following reaction mixture (13 ul)

               4 ul polydI-dC (500 ug/ml)
               4 ul of 5X gel shift buffer
               1 ul buffer D
               3 ul H20
               add fresh DTT to 2.5 mM (final concentration)
2. if antiserum is needed, add 1 ul antiserum (1:3 dilution)
3. to reaction mixture, add 5 ul nuclear extracts in buffer D.
4. incubate the reaction for 30 min at 40C
5. add 2 ul your DNA probe (20000-50000 cpm).
6. incubate for another 25 min at room temperature.
7. add 2 ul 0.02 %bromophenol blue .

       D. run your gel at 200 mA for 2-3 h.

1x gel shift buffer                               Buffer D:
       20 mM Hepes pH7.5                                 20 mM Hepes pH 7.9
       50 mM KCl                                  0.1 M KCl
       5 mM MgCl2                                 0.2 mM EDTA
       10 uM ZnCl2                                0.5 mM PMSF
       4 % glycerol                               0.5 mM DTT
       100 ug/ml BSA (final concentration)               20 % glycerol




                                       pag. 119
51. Rapid mouse tail tip DNA extraction protocol
(Katarina Cechova)


Day 1: Material -- ependorf tubes, razor blade,


      1. Sex mice to be analyzed. Give each mouse an ID# and appropriate ear
marking for identification. Record information on both the data sheet and on the
cage card.
      2. Add 250 l 2X lysis buffer and 250 l filtered water to each ependorff
tube using a multipipetor. Cut tail tip into each tube. Tail tip should be no greater
than about 0.5 cm for DNA to digest and run efficiently on the Southern.

       Important: Make every effort to proceed through step 4 on the same day.
Proteinase K lysate can be safely stored at 4C for about a week. But
unprocessed tail tissue doesn’t store well. If have to stop here, put away tails in
the buffer in –80C freezer.


       3. Add 50 l 20mg/ml proteinase K to each sample using multipipetor but
with sterile pipet.
       4. Rock each sample in @ 56C incubator o/n. The tubes are taped in
rows with paper tape and then sandwiched between bundles of paper towel
inside of the hybridization tube to ensure head-to-tail rotation. Be careful to make
sure each tube is tightly sealed to prevent leakage while rocking.


DAY 2:
     5. Label 2 sets of ependorf tubes corresponding to tail tip sample
numbers. In set one fill each tube with approximately 1 ml 100% EtOH. Keep set
two aside for now.
      6. Remove digested tail tips from incubator and spin down debris for 1


first set of tubes containing EtOH. Do this for all the samples.
        7. Fill the second set of
        8. To spool DNA from first set of tubes, close tube and rock it manually at
first, getting more and more vigorous with each rock.
        9. Spool DNA with a clean yellow tip and transfer to tube containing 0.1x
TE by twirling the tip.
                                      pag. 120
       10. After spooling all samples, rock on table top rocker for about 30
minutes to solubilize DNA. At this point the DNA is either ready for digestion by
the appropriaterestriction enzyme or can be stored at 4 oC.



2x lysis buffer


chemical                    final conc.          for 1000 ml final volume


urea powder                 8M                   480 g
CDTA 0.5M pH 8.0            20 mM                        40 ml
*sarcosyl 30%               1%                   33 ml
Tris-Cl pH 8.0 1.0 M        0.2M                 200 ml
NaCl 5M                     0.4 M                80 ml

Start with initial volume of sterile H2O of 150-200 ml. Add urea powder little by
little while stirring on a hot plate ( moderate high heat).
Add all other reagent and bring volume and bring volume to 1000 ml.
* Prepare sarcosyl (N-lauroylsarcosine) in hot plate slowly. Start with initial
volume of 30 ml H2O for final volume of 100 ml. Wear goggles, gloves and mask.


CDTA is trans-1,2 diaminocyclohexane N,N,N,N, tetraacetic acid

0.5 M CDTA pH 8.0 mix 100 ml H2O and 17 g CDTA




                                     pag. 121
52. Preparation of total soluble DNA from mammalian cells. We use this
method to extract DNA from apoptotic cells.
(Katarina Cechova)


       1. Triturate the cells off the same tissue culture dishes, centrifuge the cell
suspension (about 800 g for 5 minutes) and wash the pelleted cells twice with
ice-cold PBS (Ca2+, Mg2+ free). It is a good idea to triturate the cells in their
medium, to avoid loosing floating, dying cells that have fragmented DNA. If it is
necesary to tritutrate the cells, then wash the cultures twice with ice-cold PBS
and scrape the cells directly in lysis solution. Both methods have been succefully
used for detection of DNA ladder in Rat-1 myc cells.
        2. Resuspend the cell pellet in lysis solution containing 5 mM Tris, pH 7.4;
20 mM EDTA and 0.5 % Triton X-100. Incubate for 20 minutes in a rotor at 4 oC.
Approximately 5-10 x 10 6 cells or less are lysed in 500 l of lysis solution, 2x107
cells in 1 ml, 5x107 cells in 2 ml.
        3. Centrifuge at about 3,000 g (4,000 0RPM at a tabletop for 15 minutes
at 4oC.
        4. Extract supernatants twice with equal volume of Tris-buffered phenol
(pH 8.0) and twice with equal volume of chloroform-isoamyl alcohol (24:1 v/v).
       5. Precipitate the DNA, that is in the aqueous phase, in ethanol (final 0.1
M NaCl and 2 vol. Et.OH), overnite at -20 oC.
       6. Spin at about 10,000 g for 30 minutes and resuspend the pellet in
10mM Tris (pH 7.4), 1 mM EDTA (pH 8.0)
       7. Treat with RNAse for 30 minutes at 37oC and read the OD. In a
medium gel we us
at 50 V and later at 100 V. Don't put the ethydium bromide into the gel. Stain and
destain the gel after you run it.




                                      pag. 122
53. Starvation of Rat-1 myc cells
(Katarina Cechova)


Day before starvation


Split the cells in regular media (10% FBS, DMEM, Hygromycin B) at 1.5 x 10 6/
integrid dish in 30 ml of total volume of media.


Starvation


wash the cells 2x with serum-free medium, add 30 ml of serum free medium and


( final volume 0.1% FBS, DMEM) .


Starve for 30 and 40 hours.




                                   pag. 123
 54.    Protocol: Stain for Beta-Galactosidase Expression in Cell
                               Culture

  1. COMPLETE B-Gal Stain base solutioin must be prepared FRESH for each
staining. Prepare as follows:
       Warm the volume of Stain Base Solution needed for the experiment in a
37oC water bath, keeping it in the dark.
       Thaw the X-Gal Stock Solution. Make a 1:40 dilution of the X-Gal Stock
Solution in warm Stain Base Solution, mix with a pipet and hold in the dark at
37oC until used. Dilution of X-Gal Stock Solution into cold Stain Base will cause
the X-Gal to precipitate.

  2. Cell Cultures transfected with a Beta-galactosidase expression vector for
transient expression of B-Gal should be incubated for 24 to 72 hours post
transfection and then fixed and stained for B-Gal activity. Cell cultures
transfected with a Beta-galactosidase expression vector for stable expression of
B-Gal can be fixed and stained anytime after stable transfectants have been
selected.

  3. Remove the media from the cells and wash the cells with DPBS (cat.# BSS-
1005) warmed to 37oC. DPBS wash volume: 48-well dish= 0.5ml/well; 24-well
dish= 1.0 ml/well; 12-well dish= 1.5 ml/well; 6-well dish= 2.0 ml/well; 35 mm dish
= 2.0 ml/dish; 60 mm dish = 5.0 ml/dish; 100 mm dish = 10.0 ml/dish.

  4. Cells grown in suspension should first be pelleted (1,000 rpm, 5 minutes),
the media aspirated, the pellet resuspended in 10ml DPBS (cat.# BSS-1005),
centrifuged again, and the DPBS wash aspirated.

  5. Add B-Gal Fixative, warmed in a 37oC water bath, to the cells and incubate
for 5 minutes at room temperature. Suspension cells will need to first be gently
resuspended in the fixative.

  6. Remove B-Gal Fixative and wash the cells 2X with DPBS as described in
step #3.

  7. Add COMPLETE B-Gal Stain Solution (solution should be at 37oC) to cells.
Cells grown in suspension should be resuspended in 1 to 3 ml, depending upon
the number of cells.

  8. Stain cells for 2 to 24 hours at 37oC, until dark blue color develops in the
cells. The intensity of the blue stain correlates with the level of expression of B-
Gal (the darker the blue the higher the level of expression).

  9. Remove the B-Gal Stain Solution and discard. Rinse the cells 2X with DPBS
as described in step #3. Remove final DPBS rinse and add B-Gal Holding
Solution (solution should be at 2oC to 8oC). B-Gal Holding Solution volume: 48-
well dish= 0.5ml/well; 24-well dish= 1.0 ml/well; 12-well dish= 1.5 ml/well; 6-well
                                     pag. 124
dish= 2.0 ml/well; 35 mm dish = 2.0 ml/dish; 60 mm dish = 3.0 ml/dish; 100 mm
dish = 5.0 ml/dish.

 10. Cells grown in suspension should be resuspended in 1 to 3 ml of Holding
Solution, depending upon the number of cells. Observe under an inverted
microscope. Store cells at 2oC to 8oC.



     Stain for Beta-Galactosidase Expression in Cell Culture
Our Beta-Gal products are for visualizing the expression of the LacZ Reporter
Gene in cell culture. Also check out our Stain for Beta-Galactosidase Expression
in Tissue.

The Beta-gal Fixative is used to fix cells which have been transfected with a
Beta-Galactosidase expression vector for the expression of B-Gal. The Beta-Gal
Stain Base solution is a histochemical stain used to detect the presence of B-
galactosidase after the cells have been fixed in the B-Gal fixative. The intensity
of the blue color correlates with the level of expression. The Beta-Gal Holding
Solution is used to hold the cells for further observation. The X-Gal is a
histochemical substrate used to detect the presence of B-galactosidase. It
produces a blue precipitate upon hydrolysis, making it suitable for use in
immunoblotting and immunocytochemical assays. Cells expressing active B-
galactosidase produce blue colonies when stained with X-Gal.

Product

DPBS (1X)
           contains calcium & magnesium
                           500ml
                               BSS-1005-B
                                    $9.50
                           1 liter
                               BSS-1006-A
                                    $16.00
B-Gal Fixative
           2% (v/v) Formaldehyde
           0.2% (v/v) gluteraldehyde
           prepared in DPBS (cat.# BSS-1005)
                           100ml
                                 BG-1-C
                                    $13.50
B-Gal Stain Base Solution
           5 mM potassium ferricyanide
           5 mM potassium ferrocyanide
           2 mM MgCl2
           prepared in DPBS (cat.# BSS-1005)
                           100ml
                                    pag. 125
                            BG-2-C
                               $13.50
B-Gal Holding Solution
           60% (v/v) glycerol in DPBS
                          100ml
                               BG-4-C
                                   $29.90
X-Gal Stock Solution
           40 mg/ml X-gal dissolved in DMSO
                          1.0 ml
                               BG-3-G
                                   $24.75




                                pag. 126
55. Cyclic Amplification and Selection of Targets (CASTing ) Protocol


A. Preparation of Magnetic Beads
    1. Mix          10 ml hybridoma cell supernatant (12CA5)
                    200 ul        Dynabeads M-450 Sheep anti-mouse IgG
                           (Dynabeads, Research Products, Great Neck, NY,
                           prod. # 110.01)
    2. Rotate overnight at room temperature – use end over end mixing.
    3. Collect the beads with a magnet.
    4. Wash with 0.5 ml of Washing Buffer.
     5. Collect the beads with a 12lb magnet.
     6. Resuspend beads in 200ul Washing Buffer.
     7. Store at 4 C.


B. In vitro Translation of the DNA-Binding Protein:
     1. Linearize plasmid.
     2. Transcribe with Megascript kit (Ambion, Austin, TX). Adjust
         concentration to 1mg/ml.
     3. In Vitro translate according to the Rabbit Reticuylocyte Lysate Protocol
        (Promega, Madison, WI).
        OR, combine step 2 and 3 with any commercial In Vitro
        transcription/translation kit.


C. Synthesis of the double stranded 75mer DNA:
     1. Synthesize 75mer oligonucleotide and primers 75F and 75R:

         GCGTCGACAAGCTTTCTAGA            – (N)35- GAATTCGGATCCCTCGAGCG




                                         pag. 127
Procedures for Inducing Gene Expression from MT Promoter:

Before the induction, stabling transfected B cells should be maintained in proper
selection antibiotics and 10uM EDTA to prevent leakiness of MT promoter.

1. The day prior to induction, check the cell growth. Make sure the viability of
   the culture is above 85% (Ficoll the culture if there are too many dead cells).
   Seed the cells at a density <=1.0 X 106/ml to ensure log phase growth of the
   cells prior to induction.

2. Next morning, remove aliquots of the culture, two aliquots/line, set aside;
   Start to spin down the cells, wash a total of three times with PBS or DMEM;
   While spinning and washing the cells, count cells, calculate total cell number
   of each cell line;

3. Seed the cells at 1.0 X 106/ml in DMEM plus CdCl2, for Ly1, use 1.0uM.
   (Leave out the antibiotic at this stage as they will slow down cell growth.)

4. Start to collect samples at planned time point for analysis.

   Count cell viability by Trypan Blue staining:

   Annexin V:

   Protein/Western:       Spin down 5-10 X 106 cells, wash once with PBS;
                  Lyse in 40-60ul RIPA buffer supplemented with protease
                  inhibitors to obtain total cell lysate. Freeze down at -80oC.

                     Lyse with RIPA buffer:
                     a. Add 6X protenase inhibitors to RIPA buffer;
                     b. Use a large orifice tip, add RIPA to cell pellet,
                        resuspend by pipetting up-and-down 5 times;
                     c. Leave on ice for 30 min;
                     d. Spin down at 4 oC in microcentrifuge for 10 min;
                     e. Collect supernatant, freeze at -80oC.

   RNA/Northern: Spin down 5-10 X 106 cells, lyse cell pellet with 1ml of Trizol
                 reagent directly by pipetting until all viscous DNA fibers
                 disappear; (Don’t wash before lyse!)

                     Incubate at RT for 10min;
                     Continue per BRL instruction to prepare RNA or stop here
                     and freeze the Trizol lysate at -80oC.


   Time points for Ly1 antisense transfectants:

                                     pag. 128
0 hr (can be collected right before addition of CdCl2);
4 hr
8 hr
24hr
36hr




                                  pag. 129

						
Related docs
Other docs by decree
Nearctic Gestüt Görlsdorf
Views: 1  |  Downloads: 0
B
Views: 360  |  Downloads: 0
ppt - lecture 10
Views: 27  |  Downloads: 0
This is tentative program
Views: 18  |  Downloads: 0
flood Impacts on urbanization and ruralization
Views: 19  |  Downloads: 0
CALL TO ORDER
Views: 11  |  Downloads: 0