High throughput detection of bluetongue virus by anew

Document Sample
scope of work template
							J Vet Diagn Invest 18:7–17 (2006)




        High throughput detection of bluetongue virus by a new
         real-time fluorogenic reverse transcription–polymerase
          chain reaction: Application on clinical samples from
                    current Mediterranean outbreaks
       Miguel Angel Jimenez-Clavero,1 Montserrat Aguero, Elena San Miguel, Tomas Mayoral,
                       ´                           ¨                          ´
                    ´        ´    ´
       Maria Cruz Lopez, Marıa Jose Ruano, Esther Romero, Federica Monaco, Andrea Polci,
                                                     ´   ´
                          Giovanni Savini, Concepcion Gomez-Tejedor

         Abstract. A real-time reverse transcription–polymerase chain reaction (RT-PCR) assay was developed for
      the detection of bluetongue virus (BTV) in blood samples. A combination of primers specific for a highly
      conserved region in RNA segment 5 (based on Mediterranean BTV sequences) and a DNA probe bound to 5 -
      Taq nuclease-3 minor groove binder (TaqMan MGB) was used to detect a range of isolates. This real-time
      RT-PCR assay could detect 5.4 10 3 tissue culture infectious doses (TCID50) of virus per milliliter of sample,
      which was comparable to our current BTV diagnostic nested RT-PCR assay. The assay detected all recent
      Mediterranean isolates (including serotypes 2, 4, and 16), BTV vaccine strains for serotypes 2 and 4, and 15
      out of the 24 BTV reference strains available (all serotypes), but did not detect the related orbiviruses epizootic
      hemorrhagic disease and African horse sickness viruses. Following assay evaluation, the ability of this assay
      to identify BTV in recent isolates (2003, 2004) from ovine and bovine samples from an epizootic outbreak in
      Spain was also tested. Minor nucleotide changes (detected by sequencing viral genomes) within the probe-
      binding region were found to have a profound effect on virus detection. This assay has the benefits of being
      fast and simple, and the 96-well format enables large-scale epidemiological screening for BTV, especially when
      combined with a high-throughput nucleic acid extraction method.

         Key words: Bluetongue virus; diagnosis; high throughput; real-time reverse transcription–polymerase chain
      reaction.


                        Introduction                                   graphically distinct evolutionary lineages, or topo-
                                                                       types,11,12 allowing the differentiation of BTV variants
   Bluetongue virus (BTV) is the prototype member of
                                                                       from different origins, even within the same serotype.
the genus Orbivirus within the family Reoviridae, and
                                                                       The emergence of new BTV variants is considered to
its primary route of transmission among sheep and
                                                                       be driven by reassortment of RNA segments (i.e., ge-
other ruminants is via the arthropod vector Culicoides
                                                                       netic shift),24,30,31 whereas individual gene segments
(midge). Cattle are suspected to be the predominant
                                                                       evolve independently by genetic drift due to immu-
reservoir for this virus, as BTV infection is asymptom-
                                                                       nological pressure from the infected host.6
atic in cattle, but results in a prolonged viremia.8,9 The
                                                                          The distribution of Bluetongue disease is deter-
BTV genome consists of 10 double-stranded RNA
                                                                       mined by the geographic distribution of the arthropod
segments that encode 7 structural proteins (VP1 to
                                                                       vector and includes both tropical and temperate areas,
VP7) and 4 nonstructural (NS1, NS2, NS3, and NS3a)
                                                                       including Africa, southern Asia, Australia, the Middle
proteins. Not only is there marked genetic variation
                                                                       East, and the Americas. Due to the serious socioeco-
among the 24 known BTV serotypes, but also among
                                                                       nomic consequences of BTV outbreaks on the inter-
the virus strains within each serotype.7,12 In addition,
                                                                       national trade of animals and animal products, it has
this group of viruses exhibits genetically and geo-                    been included in the Office International des Epizo-
                                                                       oties (OIE) list of notifiable diseases (formerly List
   From the Laboratorio Central de Veterinaria, Algete, Spain          A).25 Epizootic episodes of BTV, which occur infre-
(Jimenez-Clavero, Aguero, San Miguel, Mayoral, Cruz Lopez, Ru-
     ´                ¨                                  ´             quently, result in large losses through required control
                  ´
ano, Romero, Gomez-Tejedor), and Istituto Zooprofilattico Speri-        measures of infected and cohoused livestock. In au-
mentale dell’Abruzzo e del Molise ‘‘G. Caporale,’’ Teramo, Italy
                                                                       tumn 2003, several outbreaks of BTV serotype 4 virus
(Monaco, Polci, Savini).
   1Corresponding author: Miguel Angel Jimenez-Clavero, Departa-
                                           ´                           were reported in the western Mediterranean region
mento de Enfermedades Emergentes, Laboratorio Central de Veter-        (Corsica, Sardinia, and Menorca) (OIE-Handistatus II,
inaria, Ctra. Algete km 8, 28110, Algete, Madrid, Spain.               http://www.oie.int/hs2 [accessed June 2005]) and BTV
                                                                   7
8                                                   ´
                                                 Jimenez-Clavero et al.


serotype 2 outbreaks had been previously reported in         Union (EU) reference laboratory for BTV (Pirbright, UK)
this area in 1999–2000.13,22,38 Although BTV had never       (http://www.iah.bbsrc.ac.uk/dsRNA virus proteins/ReoID/
been detected in this area before 1999, the presence of      BTV-isolates.htm [accessed June 2005]); field isolates from
the Culicoides vectors23,32,37 and theoretical modeling      the Mediterranean region: SPA2000 (Majorca, Spain) and
based on climate data37 and satellite remote sensing35       SAD2000 (Sardinia, Italy), both belonging to serotype 2;
                                                             SPA2003 (Menorca, Spain), SAD2003 (Sardinia, Italy),
predicted that this region was at high risk for BTV
                                                                          ´
                                                             SPA2004 (Cadiz, Spain), and MOR2004 (Morocco), belong-
epizootic infections. In autumn 2004, these predictions      ing to serotype 4; ITL2002 (Puglia, Italy), belonging to se-
were borne out by new epizootic outbreaks of BTV             rotype 16; and live attenuated monovalent vaccines for se-
serotype 4, first reported in northern Morocco, and           rotypes 2 and 4 (OBPa, Onderstepoort, South Africa). Virus-
soon after in the Iberian Peninsula, which had been          es were propagated and virus concentrations were deter-
free of BTV since the 1950s. Other areas of the Med-         mined by microtitration assay28 using Vero cells, which were
iterranean region where BTV outbreaks have been re-          cultured in Eagle medium (EMEM) supplemented with L-
ported in the last 7 years include Albania, Algeria,         glutamine, antibiotics (100 U/ml penicillin, 100 g/ml strep-
Bosnia and Herzegovina, Bulgaria, Croatia, Cyprus,           tomycin) and 5% fetal calf serum. Assay specificity was as-
Greece, Israel, Italy (mainland), Kosovo, Macedonia,         sessed using phylogenetically or symptomatically related vi-
Serbia and Montenegro, Tunisia, and Turkey (OIE-             ruses (or both): African horse sickness virus (AHSV sero-
Handistatus II, http://www.oie.int/hs2 [accessed June        type 4, isolate SPA’87, from the National Reference
                                                             Laboratory for African Horse sickness virus, Central Veter-
2005]).
                                                             inary Laboratory, Algete, Spain); epizootic hemorrhagic dis-
   The speed of the assays to detect BTV is directly         ease virus (EHDV North American prototype serotypes 2
related to the ability to detect viremic animals and         and 4)c; foot-and-mouth disease virus, FMDV serotypes A,
therefore to limiting the spread of disease. Viremia can     O, C, Asia-1, SAT-1, SAT-2, and SAT-3d; and contagious
be demonstrated in blood of infected animals by either       ecthyma virus (field isolate, Central Veterinary Laboratory,
virus isolation or nucleic acid detection methods. Al-       Algete, Spain, unpublished).
though virus isolation in embryonated chicken eggs is
reliable and sensitive, it is technically cumbersome and     Samples
requires significantly longer to yield a result than nu-         Ethylenediamine tetraacetic acid was used to stop the co-
cleic acid–based detection assays. For these reasons,        agulation of blood collected from sheep or cattle suspected
the latter have become the method of choice for BTV          of having BTV and from sentinel cattle during recent out-
detection. Several reverse transcription–polymerase          breaks in Spain during either October–December 2003
                                                             (Mediterranean island of Menorca, Balearic Islands) or Oc-
chain reaction (RT-PCR) methods have previously
                                                             tober–December 2004 (mainland [Andalusia and Extremad-
been described,1–4,10,15,17,33 and the BTV segment 5 (en-    ura]) (OIE-Handistatus II, http://www.oie.int/hs2 [accessed
coding the NS1 protein) is the most commonly tar-            June 2005]). Tissue samples (spleen, heart blood, and gut)
geted gene due its high degree of conservation across        from a sheep fatally infected with BTV during one of these
BTV serogroups (segment 10 has also been used).              outbreaks were also tested. Virus isolated from this sheep
Current RT-PCR methods for BTV detection are rapid           was identified as serotype 4 by the European Reference Lab-
and show satisfactory sensitivity and specificity; how-       oratory for BTV at Pirbright, UK, and is referred to as
ever, this methodology is not well suited to high-           SPA2003 isolate in the Results section. Control ovine blood
throughput analysis, limiting its use in large-scale ep-     samples were obtained from 50 healthy BTV-seronegative
idemiological surveillance. For these reasons, we have       (as determined by enzyme-linked immunosorbent assay
examined the use of real-time fluorogenic RT-PCR              [ELISA]b testing) sheep from areas where BTV has never
methodologies in a 96-well format for high-throughput        been reported. Control bovine blood samples were obtained
sample monitoring.                                           from 300 healthy BTV ELISAb-negative cattle, used in the
                                                             Spanish surveillance program for BTV, in areas where the
   We developed a real-time fluorogenic RT-PCR
                                                             disease was absent at the time of testing.
method using a 5 -Taq nuclease-3 minor groove bind-
er18 (TaqMan MGB) DNA probe for the detection of             Sample processing and total nucleic acid extraction
BTV in a 96-well format. We then evaluated the use-             Single tube-spin protocol. Five hundred microliters of
fulness of the assay using laboratory and previously         each blood sample was lysed with 1 ml of sterile water,
characterized BTV serotypes (isolated from western           incubated for 10 minutes on ice, and then centrifuged at
Mediterranean outbreaks) and tested the assay against        16,000 g for 5 minutes at 4 C. The supernatant was then
samples from recent Spanish BTV outbreaks.                   removed and the pellet was resuspended in 0.2 ml of binding
                                                             buffer that had been provided by the High Pure Viral (HPV)
               Materials and methods                         nucleic acid extraction kit.e The total RNA extraction was
Viruses, vaccines, cells, and virus propagation in           completed as indicated in the manufacturer’s instructions us-
cell cultures                                                ing 50 l as the elution volume. Tissue samples (approxi-
   The following BTV strains were used in this study: pro-   mately 0.5 g) were homogenized in 1 ml of phosphate-buff-
totype strains for all 24 BTV serotypes from the European    ered saline (PBS) and following a 10-minute centrifugation
                               High throughput detection of bluetongue virus by real-time RT-PCR                            9


at 16,000 g, 1 volume (0.2 ml) of supernatant was mixed          nucleic acid extraction was performed as described in the
with 1 volume of binding buffer (from the same kit as            single tube-spin protocol (see above).
above), and nucleic acid extraction was achieved in the same
way. Total RNA extraction of infected cell culture superna-      Sequence analysis
tants containing BTV serotypes or control viruses at titers         To analyze the detection range of the real-time RT-PCR
of at least 1 104 TCID50 /ml (starting volume, 20–200 l),        method in more detail, the RNA regions corresponding to
was achieved in the same way.                                    nucleotide positions 316–790 (numbered according to
   Nucleic acid extraction in 96-well format. Two separate       GenBank AY137387) within segment 5 were sequenced for
formats were used: 1) The Nucleospin Multi-96 virus nucleic      the following isolates: BTV-2 SPA2000, BTV-4 SPA2003,
acid extraction kitf was applied as follows: 0.1 ml of blood     BTV-4 SPA2004, BTV-4 MOR2004, BTV-4 ITL2002, BTV-
and 0.2 ml of distilled water was added to each well in the      4 (vaccine straina), BTV-4 reference strain, BTV-16 refer-
96-well lysis microplate. Following centrifugation as above,     ence strain, BTV-24 reference strain, BTV-19 reference
the cell pellet that was resuspended in 0.4 ml of RAV1 buffer    strain, BTV-10 reference strain, BTV-13 reference strain,
plus 20 l (1 g/ l) of proteinase K and RNA extraction            and BTV-7 reference strain. RNA sequence was determined
completed according to the manufacturer’s instructions. 2)       following amplification by nested RT-PCR,2 which was bi-
High Pure viral nucleic acid extraction kite in 96-well format   directionally sequenced using the inner primers of the nested
(HPV-96): samples were prepared essentially according to         reaction, the Big Dye Terminator (version 3.1) Cycle Se-
the manufacturer’s instructions except that Whatman 96-well      quencing Kit, j and an ABI 3730 XL DNA Analyzer.k Elec-
Unifilter microplatesg were used instead of the spin columns      tropherograms were analyzed using the Sequencing Analysis
provided in the kit. The final protocol was as follows: 0.1-      (version 5.1) softwarel and sequences have been submitted
ml blood samples were lysed in the same way as described         to GenBank under accession numbers AY741396 (BTV-2
above for Nucleospin Multi-96, but using a Whatman 800-          SPA2000), AY741397 (BTV-4 SPA2003), DQ098094 (BTV-
  l round-bottom 96-well Uniplate.h The cell pellet was re-      4 ITL2002), DQ098092 (BTV-4 MOR2004), DQ098093
suspended in 0.1 ml of binding buffer plus 20 l (1 g/ l)         (BTV-4 SPA2004), DQ098095 (BTV-4 vaccine straina),
of proteinase K (provided in the kit), and subjected to a 10-    DQ098096 (BTV-4 reference strain), DQ098097 (BTV-7 ref-
minute incubation at 72 C, followed by the addition of 50        erence strain), DQ098098 (BTV-10 reference strain),
  l of isopropanol to each well. After gentle mixing, the en-    DQ098099 (BTV-13 reference strain), DQ098100 (BTV-16
tire contents of each well was removed from the 96-well          reference strain), DQ098101 (BTV-19 reference strain), and
Uniplate, transferred to a Unifilter microplate,g and placed      DQ098102 (BTV-24 reference strain). The sequences ob-
over another 800- l round-bottom 96-well Uniplateh for col-      tained were aligned with the following BTV NS1 sequences
lection of the filtrates, following centrifugation for 15 min-    available in GenBank: AY137387 (BTV-2 Corsica 2002),
utes at 2,250      g. The filtrates were discarded and 250 l      Y00422 (BTV-10, US prototype strain), X17041 (BTV-17,
of inhibitor buffer (provided in the kit) was added to each      US prototype strain), M97681 (BTV-11, US prototype
filter well and the plate was centrifuged for 4 minutes at        strain), M97762 (BTV-13, US prototype strain), M97680
2,250 g. The filter wells were then washed twice with 250         (BTV-2, US prototype strain), AY462225 (BTV-2 KN, Tai-
  l of wash buffer (provided in the kit) and subjected to 2      wan), and X56735 (BTV-20, Australia) using the CLUSTAL
centrifugation steps for 4 minutes and 15 minutes at 2,250       W 1.6 program.36
   g. The filtrate was discarded and the filters were then dried
by centrifugation at 2,250      g for a further 5 minutes. The   Real-time fluorogenic RT-PCR
recovery plate was changed to a Whatman 250- l V-bottom             Oligonucleotide primers and a Taqman-MGB fluorogenic
96-well Uniplate,i and 50 l of nuclease-free water was add-      probe were designed using Primer Express (version 2.0.0)
ed to each filter well and the plate centrifuged for 10 minutes   softwarem based on the BTV-2 (SPA2000) and BTV-4
at 2,250 g to elute the nucleic acids from the filters. The       (SPA2003) isolate sequences; however, homology to the
eluted nucleic acids were either immediately analyzed by         same region of the BTV genome (GenBank accession num-
RT-PCR or stored at 20 C for future use.                         bers AY137387, AY138895, M97762, X17041, X15891,
   Comparison between single-tube and 96-well nucleic acid       Y00422, M97681, M97680, and X56735) were also con-
extraction methods. BTV-seropositive blood samples (1            firmed. The CLUSTAL W 1.6 program36 was used to design
from sheep, 2 from cattle) were serially diluted in BTV-         conserved sequence primers: forward (5 -GTTGAGAGA-
seronegative blood from the same species, whereas the vac-       CAAATTAACACATGTCC-3 ) and reverse (5 -AATGCT
cine was diluted in PBS. All samples were subjected to nu-       TCGCAAAATCATCCAT-3 ). These primers amplified a re-
cleic acid extraction in parallel.                               gion comprising nucleotides 606–723 of BTV segment 5,
                                                                 and a fluorogenic TaqMan-MGB probe (6-FAM-CGATT-
Nested RT-PCR for BTV and RT-PCR for                             CAGCTGATCAAT-MGB) was designed to hybridize nucle-
other viruses                                                    otides 676–692 (nucleotide position numbering according to
   Nested RT-PCR for BTV detection was performed ac-             the AY137387 sequence). The final protocol consisted of an
cording to the method described by Aradaib et al.2 We also       initial denaturation step during which primers (final concen-
used PCR or RT-PCR methods already described for the de-         tration: 0.5 M each) and viral RNA (2 l) were heated at
tection of African horse sickness virus,34 epizootic hemor-      95 C for 5 minutes in a volume of 7 l of RNAase-free
rhagic disease virus,2 contagious ecthyma virus,14 and foot-     water, and then chilled on ice. This denaturation step was
and-mouth disease virus.29 In the case of control viruses,       followed by the addition of 18 l containing (per reaction)
10                                                          ´
                                                         Jimenez-Clavero et al.




   Figure 1. Comparative sensitivity analysis of BTV-2 RNA (SPA2000 isolate) using fluorogenic real-time RT-PCR and nested RT-PCR
methods. Tenfold dilutions of the viral extract were subjected to both real-time fluorogenic RT-PCR and nested RT-PCR analysis in parallel.
The results of the fluorogenic RT-PCR analysis are plotted as curves of fluorescence (matching the course of the amplification) as a function
of PCR cycle number. The insert within the plot shows the result of the nested RT-PCR as a photograph of gel electrophoresis stained with
ethidium bromide. The equivalent viral units (TCID50/ml) of each dilution are indicated both on the right side of the plot and above the
corresponding lanes in the gel. The same experiment was repeated twice with identical results.



12.5 l of TaqMan 2 universal PCR master mix, 0.6 l of                 dilution to yield a Ct value below 40. All determinations
40 Multiscribe and RNase inhibitor mix, both from the                 were confirmed by repeating the experiment at least once.
commercial RT-PCR amplification kit TaqMan One-step RT-                The sensitivity of the assay including the RNA extraction
PCR Master Mix Reagents,n 0.12 l of the TaqMan-MGB                    was also assessed by repeating the above experiment on 10-
probe (final concentration: 0.25 M), and RNase-free water.             fold dilutions of the viral stock, which were then processed
The final reaction volume was 25 l.                                    for nucleic acid extraction and analyzed by both the real-
   The reactions were analyzed in 96-well optical PCR plates          time and nested RT-PCR methods.
using an ABI PRISM 7000 Sequence Detection System
(SDSo) apparatus and the SDS 7000 (version 1.1) softwarep.                                         Results
Reverse transcription was carried out at 48 C for 25 minutes
followed by 10 minutes at 95 C (‘‘hot start’’) and 40 PCR                Detection of BTV by a new real-time RT-PCR
cycles of 15 seconds at 95 C and 1 minute at 61 C (total              method was compared with an existing nested RT-PCR
reaction time 2 hours 11 minutes). Samples were considered            method (Fig. 1). Both methods were able to detect a
positive for BTV if they yielded Ct values lower than 40              10 5 dilution of the BTV RNA (equivalent to 0.0054
(threshold set automatically following the instructions of the        TCID50 /ml of sample) extracted from 1,080 TCID50 of
SDS 7000 analysis software, version 1.1). The sensitivity of          cell-cultured BTV serotype 2 (SPA2000). As shown in
the fluorogenic real-time RT-PCR assay was assessed using              Fig. 2, the detection achieved by the real-time RT-PCR
10-fold dilutions from the control BTV-2 isolate RNA                  assay showed a linear relationship between signal and
(SPA2000 isolate), comparing detection of viral extract for
                                                                      the concentration of template present in the sample
both real-time fluorogenic RT-PCR and nested RT-PCR anal-
ysis in parallel.                                                     (correlation coefficient of 0.9948, and a slope of
   Sensitivity was determined as the highest dilution giving            3.334) over a range of 102 to 10 3 TCID50 /ml. To
a positive result: for nested RT-PCR this was the highest             assess whether the nucleic acid extraction step affected
dilution at which a band was visible on an ethidium bro-              the performance of the method, 10-fold dilutions of
mide–stained gel; for real-time RT-PCR this was the highest           the viral stock (instead the purified RNA) were also
                                High throughput detection of bluetongue virus by real-time RT-PCR                            11




   Figure 2. Linearity and efficiency of the real-time RT-PCR assay for BTV. The experiment shown in Fig. 1 is plotted here as Ct
(threshold value) as a function of quantity of viral RNA (equivalent TCID50 infectious units per milliliter) on a log scale.



analyzed. A comparable level of sensitivity (0.001                all recent BTV field variants from the Mediterranean
TCID50 /ml) and linearity (dynamic range, 102 to 10 3;            region (serotypes 2, 4, and 16); vaccine strains from
r2, 0.9941; slope, 3.592) was obtained, indicating                BTV serotypes 2 and 4, and 15 out of 24 serotype
that the nucleic acid extraction does not significantly            BTV reference strains. No cross-reactivity was ob-
affect the overall performance of the method, at least            served for non-BTV virus samples by our real-time
with this type of sample.                                         RT-PCR assay, regardless of whether they belong to
   The specificity of the new method was determined                the Orbivirus genus or have similar pathogenic se-
by analyzing reference BTV isolates from all 24 se-               quelae. However, the integrity of the nucleic acids iso-
rotypes (obtained from the EU reference laboratory for            lated from the negative control viruses was confirmed
BTV disease, Pirbright, UK), as well as vaccine strains           by positive results for their own specific PCR or RT-
(OBP, Onderstepoort, South Africa) and field variants              PCR detection assays (not shown).
isolated in recent years from the Mediterranean region.              Although the BTV serotype 4 reference strain was
We also determined whether our real-time RT-PCR                   not detected by our real-time RT-PCR assay, all other
method cross-reacted with other members of the Or-                BTV serotype 4 field isolates and the vaccine strain
bivirus genus (AHSV serotype 4, EHDV serotypes 2                  were detected (Table 1). Similarly, a field isolate of
and 4); viruses that cause symptoms similar to blue-              BTV serotype 16 was detected even though the ref-
tongue (contagious ecthyma virus, a member of Pox-                erence strain was not (Table 1). These results indicate
viridae); or foot-and-mouth disease virus (serotypes A,           that the inability to detect the reference strains does
O, C, Asia, SAT1, SAT2, and SAT3; Picornavirus fam-               not rule out its effectiveness at detecting these sero-
ily) (Table 1). The real-time RT-PCR assay detected               types in the field. The failure of our assay to detect
12                                                         ´
                                                        Jimenez-Clavero et al.


   Table 1. Specificity of the real-time fluorogenic RT-PCR assay     in the BTV-4 reference strain, for which a single mis-
for BTV. Analysis of BTV cell culture supernatants, vaccines, and   match in the probe region and 2 more in the forward
other viruses to assess specificity.
                                                                    (5 ) primer resulted in a loss of detection. In other
     Virus (serotype)            Isolate/origin         Result      nondetected reference strains (serotypes 7, 10, 13, 16,
BTV-1                      494 2E (reference strain)   positive
                                                                    19, and 24), the differences in nucleotide sequence
BTV-2                      reference strain            positive     ranged from 1 to 3 mismatches in the forward (5 )
BTV-2                      field isolate SPA/2000       positive     primer, 1 to 5 mismatches in the probe, and at least 1
BTV-2                      field isolate SAD/2000       positive     mismatch in the reverse (3 ) primer. It is remarkable
BTV-2                      vaccine (South Africa)      positive     that there was a low homology in the target region
BTV-3                      reference strain            positive
BTV-4                      reference strain            negative
                                                                    between the BTV-16 reference strain and the BTV-16
BTV-4                      field isolate SPA2003        positive     field isolate used in this study. Table 2 shows the nu-
BTV-4                      field isolate SAD2003        positive     cleotide sequence alignments of BTV serotypes used
BTV-4                      field isolate SPA2004        positive     in this study, but also includes the available sequences
BTV-4                      field isolate MOR2004        positive     for prototype strains from US BTV serotypes, BTV-2
BTV-4                      vaccine (South Africa)      positive
BTV-5                      reference strain            positive
                                                                    from Taiwan, and BTV-20 from Australia. Given the
BTV-6                      reference strain            positive     homology, we would expect viruses showing 100%
BTV-7                      reference strain            negative     identity within the probe region (US BTV-11, -13, and
BTV-8                      reference strain            positive     -17) and almost complete nucleotide sequence identity
BTV-9                      reference strain            positive     within the primer regions would be detected, whereas
BTV-9                      vaccine (South Africa)      positive
BTV-10                     reference strain            negative
                                                                    those BTV strains showing at least 1 mismatch within
BTV-11                     reference strain            positive     the probe region (US BTV-2, and BTV-10, Australian
BTV-12                     reference strain            positive     BTV-20, and Taiwan BTV-2) would likely remain un-
BTV-13                     reference strain            negative     detected. These expectations are supported by a much
BTV-14                     reference strain            positive     larger number of mismatches in the primer and probe
BTV-15                     reference strain            positive
BTV-16                     reference strain            negative
                                                                    regions in published sequences for EHDV and AHSV
BTV-16                     puglia 2002                 positive     (not shown), which were not detected by our real-time
BTV-17                     reference strain            positive     RT-PCR assay (Table 1).
BTV-18                     reference strain            positive        To assess the performance of the new BTV detec-
BTV-19                     reference strain            negative     tion method under normal diagnostic laboratory con-
BTV-20                     reference strain            negative
BTV-21                     reference strain            negative
                                                                    ditions, 76 sheep and 21 cattle blood samples from the
BTV-22                     reference strain            positive     2003 Menorca outbreak (previously identified as BTV-
BTV-23                     reference strain            positive     positive by the nested RT-PCR method) were analyzed
BTV-24                     reference strain            negative     by real-time fluorogenic RT-PCR. In addition, spleen,
AHSV-4                     SPA/1987                    negative     heart blood, and gut homogenates from a symptomatic
EHDV-2                     reference strain            negative
EHDV-4                     reference strain            negative
                                                                    sheep that died as a consequence of BTV disease in
Contagious ecthyma virus   field positive sample        negative     this outbreak were also tested. As a control, blood
FMDV-A                     reference strain            negative     samples from 50 BTV-seronegative sheep in BTV-free
FMDV-O                     reference strain            negative     areas were also tested by nested RT-PCR and the new
FMDV-C                     reference strain            negative     real-time fluorogenic RT-PCR. Similarly, 300 BTV-se-
FMDV-Asia                  reference strain            negative
FMDV-SAT1                  reference strain            negative
                                                                    ronegative blood samples collected from sentinel cattle
FMDV-SAT2                  reference strain            negative     in BT-free areas during the 2004 Spanish BTV sur-
FMDV-SAT3                  reference strain            negative     veillance program were also tested. As shown in Table
                                                                    3, there was complete agreement between the results
                                                                    obtained with both nested and real-time fluorogenic
some BTV isolates was investigated by comparing the                 RT-PCR methods. All 97 BTV blood samples found
sequence of the primer and probe target regions from                positive by the nested RT-PCR assay were also posi-
undetected BTV isolates and a selection of the detect-              tive by the real-time fluorogenic RT-PCR method.
ed viruses (Table 2). Although the primer binding re-               BTV was detected by both methods from spleen and
gions were found to allow 1 (e.g., BTV-2 SPA2000)                   heart blood, but not gut tissue samples. All BTV-neg-
or 2 (e.g., BTV-4 and BTV-2 vaccine strains, BTV-16                 ative samples yielded negative results in both assays
ITL2002) mismatches without loss of detection, higher               (i.e., a zero false-positive rate).
stringency was found for the probe-binding sequence,                   The real-time fluorogenic RT-PCR method can be
as a single mismatch resulting in loss of detection for             performed in a 96-well format, and this feature opens
1 isolate. The lowest number of nucleotide sequence                 the possibility of using RT-PCR methodology in the
changes that rendered a strain nondetectable was found              high-throughput screening of field samples. As nucleic
  Table 2.   Primer and probe-binding sequences from genome segment 5 from different BTV isolates, and correlation with real-time RT-PCR (RRT-PCR) detection.

                             GenBank                                                                                                                        Primer 3 (reverse
                             accession              RRT-PCR                          Primer 5                          Taqman MGB-probe                  complementary sequence)
  BTV isolate†                number                detection                        606-631*                              676–692*                             702–723*

BT2    COR2002              AY137387               not tested            GTTGAGAGACAAATTAACACATGTCC                   CGATTCAGCTGATCAAT                ATGGATGATTTTGCGAAGCATT
BT4    SPA2003              AY741397                                     ——————————————————————————                   —————————————————                ——————————————————————
BT4    SPA2004              DQ098093                                     ——————————————————————————                   —————————————————                ——————————————————————
BT4    MOR2004              DQ098092                                     ——————————————————————————                   —————————————————                ——————————————————————
BT2    SPA2000              AY741396                                     ———————————————————————C——                   —————————————————                ——————————————————————
BT2    VAC                  AY138895                                     ————————G—————————————————                   —————————————————                —————————————————A————
BT4    VAC                  DQ098095                                     ———————————————————————C——                   —————————————————                ————C—————————————————
BT4    REF                  DQ098096                                     —————————————————T—————C——                   ——————————A——————                ——————————————————————
BT16    IT2002              DQ098094                                     ————————G—————————————————                   —————————————————                —————————————————A————
BT16    REF                 DQ098100                                     ——A—————G————————T————————                   —A——C——AA————A———                ———————————C————————C—
BT24    REF                 DQ098102                                     —————————————————T—————C——                   ——————————A—————C                ——————————————————————
BT19    REF                 DQ098101                                     ———————————G—————T—————C——                   ——————————A——————                —————————N—NNN————————
BT10    REF                 DQ098098                                     ————————G——————————————C——                   —————————————T———                ——————————————————————
BT13    REF                 DQ098099                                     ————————G—————————————————                   ————————T————————                —————————————————A————
BT7    REF                  DQ097097                                     ————————G——————————————C——                   —N————NNT————————                —————N——N————————A————
BT10    US                  Y00422                 not   tested          ———————————————————————C——                   ——————————A——————                ——————————————————————
BT17    US                  X17041                 not   tested          ———————————————————————C——                   —————————————————                ——————————————————————
BT11    US                  M97681                 not   tested          ———————————————————————C——                   —————————————————                ———————————————————G——
BT13    US                  M97762                 not   tested          ———————————————————————C——                   —————————————————                ——————————————————————
BT2    US                   M97680                 not   tested          ———————————————————————C——                   —A———————————————                ——————————————————————
BT2    Taiw                 AY462225               not   tested          ————————G————————T————————                   —A——C——AA————A———                ——————————————————————
BT20    AUS                 X56735                 not   tested          ————————G——G——C—————T——C——                   —A—————A——A——A——C                ——————————————A——A————
  * Nucleotide position (numbering according to GenBank AY137387 sequence).
                                                                                                                                                                                            High throughput detection of bluetongue virus by real-time RT-PCR




  † Isolates marked as ‘‘VAC’’ are vaccine strains; ‘‘REF’’ are the prototype strains from the EU reference collection; ‘‘US’’ are US prototype strains, ‘‘Taiw’’ is a BTV-2 isolate from
Taiwan, and ‘‘AUS’’ is the Australian BTV-20 isolate.
                                                                                                                                                                                            13
14                                                          ´
                                                         Jimenez-Clavero et al.


 Table 3. Assessment of the performance of the real-time fluorogenic RT-PCR assay for BTV detection using clinical samples from the
Menorca 2003 outbreak, as well as BTV-free control samples.

                                                                                                             Real time fluorogenic
                                                                           Nested RT-PCR                            RT-PCR
     Type of
     sample                  Origin                 n              Positive              Negative        Positive             Negative

ovine blood           outbreak                     76                 76                   0              76                     0
ovine blood           BTV-free                     50                 —                    —               0                    50
bovine blood          outbreak                     21                 21                   0              21                     0
bovine blood          BTV-free (sentinel)         300                 —                    —               0                   300
ovine heart           BTV-free (sentinel)           1                  1                   0               1                     0
ovine gut             BTV-free (sentinel)           1                  0                   1               0                     1



acid extraction represents a bottleneck when large                   timization of the nucleic acid extraction step may be
numbers of samples are to be analyzed by RT-PCR,                     required for these types of samples. These findings
the efficacies of 2 high-throughput (96-well format)                  were confirmed by reanalysis on a separate day.
nucleic acid extraction methods were also evaluated.                    Based on the satisfactory correlation between results
Tenfold dilutions of each of 4 different samples, 3 of               from the new fluorogenic real-time RT-PCR method
them field BTV-positive blood samples from the recent                 and the RT-PCR method currently used in our labo-
BTV-4 Menorca outbreak (1 from sheep, 2 from cat-                    ratory, and the high-throughput capacity of the new
tle), and a control BTV-2 attenuated vaccine isolate                 assay, a decision was made to apply the real-time fluo-
were subjected to nucleic acid extraction by the 3                   rogenic RT-PCR in the large-scale monitoring of BTV
methods in parallel, and analyzed by real-time RT-                   circulation in Spain during 2004 and 2005. A total of
PCR for BTV RNA. As shown in Table 4, the results                    47,532 blood samples (34,170 cattle and 12,142 sheep)
obtained with both high-throughput RNA isolation                     were tested between January 2004 and June 2005.
methods were comparable to those obtained with the                   Some of these samples came from the surveillance
conventional single-tube method; if differences in start             program established in Spain in 2004 using strategi-
volume and elution volumes are taken into account,                   cally located sentinel cattle. This surveillance was suc-
the high-throughput methods appear to have a slightly                cessful in detecting a BTV outbreak in cattle on the
higher yield than the single spin-column protocol (Ta-               Spanish mainland in October 2004, 9 days before it
ble 4). However, Ct values for 1 of the bovine blood                 was detected in sheep. In the period between October
samples (cattle blood-1) and the vaccine control were                2004 and March 2005, after the BTV outbreak in pen-
higher than expected at the higher dilutions for all                 insular Spain was first detected, 26,787 blood samples
RNA extraction methods, suggesting that further op-                  have been tested in our laboratory by this technique,

  Table 4. Comparison of the efficiency of 3 nucleic acid extraction methods, 2 high-throughput (96-well format) systems (Nucleospin-
96 and HPV-96), and 1 conventional single tube-spin column (HPV-col) kit.

                                                   HPV-col
                                                                                HPV-96 (Ct*)                   Nucleospin-96 (Ct*)
                                                    (Ct*)
        Sample                Dilution             Observed             Observed           Normalized†     Observed           Normalized†

BTV-2 vaccine                 1:10                  28.83                  27.92              25.62          26.93               23.63
                              1:100                 33.40                  31.82              29.52          33.39               30.09
                              1:1000                37.87                  37.01              34.71          38.80               35.50
                              1:10000            not detected                      not   detected                     not   detected
Sheep blood-1                 1:1                   33.16                  35.08              32.78          35.82               32.52
                              1:10                  35.64                  38.21              35.91          38.82               35.52
                              1:100              not detected                      not   detected                     not   detected
Cattle blood-1                1:1                   29.50                  29.76              27.40          31.15               27.85
                              1:10                  37.21                  35.01              32.71          35.56               32.26
                              1:100              not detected                      not   detected                     not   detected
Cattle blood-2                1:1                   32.83                  33.70              31.40          34.00               30.70
                              1:10                  35.72                  38.90              36.60          37.92               34.62
                              1:100              not detected                      not   detected                     not   detected
sample volume ( l)                                 500                                   100                                100
elution volume ( l)                                 50                                    50                                100
 * Ct: Threshold cycle.
 † The normalization accounts for the different starting and elution volumes of each method, indicated in the bottom of the table.
                              High throughput detection of bluetongue virus by real-time RT-PCR                       15


which has reached as high as 2,635 samples in a single          essarily indicate the presence of contagious virus in
week.                                                           the animal.
                                                                   The data presented herein demonstrates that this
                       Discussion                               new method is capable of detecting a wide range of
   Real-time RT-PCR methods (especially those based             BTV isolates, including those currently circulating in
on fluorogenic probe hybridization, such as TaqMan               the western Mediterranean. However, 9 out of 24 ref-
probes,19 molecular beacons,20 and fluorescence reso-            erence BTV serotypes strains were not detected. Al-
nance energy transfer (FRET) probes26) are gaining              though EU reference strains of serotypes 4 and 16
popularity in the diagnosis of animal viral diseases. As        were among those not detected, our assay did detect
well as providing higher sensitivity and comparable,            all 4 BTV-4 field isolates previously identified, 1 vac-
or even higher, specificity than traditional nucleic acid        cine BTV-4 strain, and the only BTV-16 field isolate
detection methods, they are much faster and less cum-           available. We determined the primer and probe se-
bersome because they do not require electrophoresis             quence requirements for detection by comparing the
in agarose gels. In addition, some real-time instru-            gene segment 5 sequences between detected and un-
                                                                detected BTV strains. Although this region is fairly
ments allow the use of 96-well plate formats, which
                                                                highly conserved, it does exhibit enough sequence var-
further increases the capacity and speed of analysis.
                                                                iation among isolates to render some of them unde-
The BTV diagnostic assay developed in this study is
                                                                tectable. Our investigation found that minor nucleotide
suitable for screening large numbers of samples con-
                                                                changes within the probe region were more detrimen-
sistent with those analyzed in recent BTV outbreaks.
                                                                tal to detection by the assay than changes in the prim-
The only real-time RT-PCR method for BTV previ-
                                                                er-binding region. It is important to note, however, that
ously described in the literature is a recent protocol
                                                                the fewest changes resulting in loss of signal included
that restricted its analysis to the differentiation of vac-
                                                                1 mismatch within the probe region as well as 2 mis-
cine and field variants of a single BTV serotype (BTV-
                                                                matches in the primer-binding region, whereas a single
2).26 When attenuated BTV vaccines are used to pro-
                                                                nucleotide mismatch within each of the primer-hybrid-
tect livestock from BTV infection, the ability to dis-
                                                                izing regions did not cause loss of detection. The BTV-
tinguish between wild-type and vaccine strains of BTV
                                                                4 undetectable EU reference BTV-4 strain and the de-
makes it possible to know whether an RT-PCR positive
                                                                tectable vaccine strain differed only by 2 nucleotides
result is derived from an acquired wild-type virus or           within the target region, 1 of which is located in the
is the result of vaccination. While the real-time RT-           probe-hybridizing region. The ability of this method
PCR that distinguishes wild-type infections from vac-           to detect a majority of BTV serotypes is likely due to
cinations is a useful diagnostic tool, it has a different       its detection of RNA segment 5, rather than segment
purpose than our real-time RT-PCR method, which is              2, which contains the serotype determinant sequence.27
the first method designed to screen field samples for a           It is noteworthy that all nondetected BTV variants had
wide range of BT viruses. Furthermore, the method               also been previously isolated from regions that were
developed in this study represents a great improvement          geographically or temporally distant (or both) from the
over previous conventional (i.e., nonfluorogenic) RT-            variants currently circulating in the Mediterranean re-
PCR methods, because it can be performed on a large             gion.
scale to monitor virus circulation in animal popula-               Taken together, these results suggest that the devel-
tions. The sensitivity of the new assay was comparable          opment of a real-time RT-PCR with fluorogenic probes
to that of the established nested RT-PCR protocol (Fig.         that is capable of detecting all BTV variants might not
1) that can detect 0.1 fg of BTV RNA.2 This level of            be an easy task. However, our assay is currently used
sensitivity is also comparable to virus isolation in em-        as the standard to identify new BTV outbreaks and
bryonated chicken eggs,2 which takes considerably               monitor the spread of epizootic infections in Spain.
longer to yield results. However, results of PCR-based          This approach can be adapted to other geographic lo-
BTV diagnosis, including the fluorogenic method de-              cations by 1) identifying the local BTV variants cir-
scribed here, need to be interpreted with caution as            culating in the affected area, 2) obtaining sequence
BTV has been detected by RT-PCR from the blood of               data from conserved regions (here we propose a short,
infected calves and sheep for at least 30 days, and             conserved stretch within RNA segment 5) of the BTV
sometimes longer (up to 90 days) after the virus iso-           variants identified, and 3) designing a set of primers
lation ceases to be positive.5,16,21 Transmission of BTV        and fluorogenic Taqman probe for real-time RT-PCR,
by biting midges fed with this noninfectious blood,             taking into account that a single nucleotide mismatch
even though it is RT-PCR positive, is poor.5,16,21 Thus         in the probe-binding region could result in a dramatic
detection of virus-specific nucleic acid by these meth-          loss of detection. In this regard, the use of an MGB
ods indicates recent viral infection, but does not nec-         group linked to the Taqman probe can be of great help,
16                                                  ´
                                                 Jimenez-Clavero et al.


because it increases the binding strength of the probe       ing of the introduction and spread of BTV in a large
to the nucleic acid,18 allowing the selection of shorter     population of cattle and sheep at risk. This technique
target sequences. In this study, this approach was suc-      is currently being used to monitor BTV outbreaks in
cessful at detecting all BTV variants currently circu-       Spain.
lating in the western Mediterranean. Whether or not
our assay could be applied to other BTV epizootics                                Acknowledgements
occurring in different parts of the world would depend          We are indebted to O. Brad Spiller for critically reviewing
on the nucleotide sequence similarity within the primer      the manuscript, C. Hambling for providing BTV prototype
and probe-binding regions in RNA segment 5 of the            strains, M. El Harrak for providing the field samples from
BTV variant(s) involved. For instance, based on nu-          which the MOR2004 BTV isolate was obtained, and W. C.
                                                             Wilson for providing EHDV isolates. We thank Roche Di-
cleotide sequence similarity, it is predicted that only 3
                                                             agnostic Systems Spain, for advice and technical assistance
out of 5 US BTV prototype strains (BTV-11, -13, and          in the adaptation of the HPV nucleic acid extraction kit from
-17) are likely to be detectable by our assay.               single column to 96-well format.
   The specificity of the new real-time fluorogenic RT-
PCR assay was further confirmed by the lack of de-                           Sources and manufacturers
tection of non-BTV orbiviruses (AHSV and EHDV)               a. BTV live attenuated vaccines (serotypes 2 and 4), OBP Onder-
and phylogenetically unrelated viruses that cause sim-          stepoort Biological Products, Onderstepoort, South Africa.
ilar symptoms to BTV (foot-and-mouth disease virus           b. Bluetongue Virus Antibody test kit, VMRD, Pullman, WA.
and contagious ecthyma virus). Consequently, this as-        c. EHDV North American prototype serotypes 2 and 4, kindly pro-
                                                                vided by W. C. Wilson, Arthropod-Borne Animal Disease Re-
say could be of great help in the differential diagnosis        search Laboratory, Laramie WY.
of bluetongue disease, once it is ascertained that BTV       d. Foot-and-mouth disease virus, FMDV serotypes A, O, C, Asia-
variants circulating in the affected region are detect-         1, SAT-1, SAT-2, and SAT-3, provided by the World Reference
able by this method.                                            Laboratory for foot-and-mouth disease, Institute for Animal
   The fluorogenic real-time RT-PCR assay described              Health, Pirbright, UK.
                                                             e. High Pure Viral (HPV) Nucleic Acid extraction kit, Roche Di-
here yields levels of sensitivity and specificity com-           agnostics, Indianapolis, IN.
parable to virus isolation and conventional nested RT-       f. Nucleospin Multi-96 Virus nucleic acid extraction kit, Machin-
PCR methods used for BTV nucleic acid detection. In                           ¨
                                                                ery-Nagel, Duren, Germany.
addition, the new assay presents 2 major advantages          g. 96-Well Unifilter GF/F microplate, Whatman, Clifton, NJ.
over conventional nested RT-PCR methods. First, it           h. 800- l round-bottom 96-well Uniplate, Whatman, Clifton, NJ.
                                                             i. 250- l V-bottom 96-well Uniplate, Whatman, Clifton, NJ.
can be used in large-scale screening because of its abil-    j. Big Dye Terminator (version 3.0) Cycle sequencing kit, Applied
ity to simultaneously analyze up to 96 samples per run.         Biosystems, Branchburg, NJ.
In fact, the nucleic acid extraction protocol for 2          k. 3730 XL DNA Analyzer, Applied Biosystems, Branchburg, NJ.
blocks of 96 samples can be carried out in less than 2       l. Sequence Analysis (version 5.1) software, Applied Biosystems,
hours, which together with sample preparation and the           Branchburg, NJ.
                                                             m. Primer Express (version 2.0.0) software, Applied Biosystems,
time required for each real-time RT-PCR (2 hours 11             Branchburg, NJ.
minutes), gives a processing capacity of 192 samples         n. TaqMan One-step RT-PCR Master Mix Reagents, Applied Bio-
in approximately 6 hours. Currently, testing capacity           systems, Branchburg, NJ.
in the authors’ laboratories has been increased to up        o. ABI PRISM 7000 Sequence Detection System SDS, Applied
to 500 blood samples per day by using 2 real-time               Biosystems, Branchburg, NJ.
                                                             p. SDS 7000 (version 1.1) software, Applied Biosystems, Branch-
thermal cyclers working in parallel with 96-well                burg, NJ.
plates. With a working scheme like this, testing ca-
pacity reached 2,600 samples per week in peak periods                                  References
during the recent BTV outbreaks in Spain. Further op-         1. Akita GY, Chinsangaram J, Osburn BI, et al.: 1992, Detection
timization, including a fully automated system for nu-           of bluetongue virus serogroup by polymerase chain reaction. J
cleic acid extraction, and adaptation to a recently avail-       Vet Diagn Invest 4:400–405.
able 384-well format, is ongoing in the authors’ lab-         2. Aradaib IE, Smith WL, Osburn BI, Cullor JS: 2003, A multiplex
oratories and testing capacity is expected to reach              PCR for simultaneous detection and differentiation of North
                                                                 American serotypes of bluetongue and epizootic hemorrhagic
1,000 samples per day. Second, the real-time fluoro-              disease viruses. Comp Immunol Microbiol Infect Dis 26:77–87.
genic RT-PCR is less susceptible than nested RT-PCR           3. Aradaib IE, Schore CE, Cullor JS, Osburn BI: 1998, A nested
to potential contamination problems, which often pre-            PCR for detection of North American isolates of bluetongue
vent many laboratories from using nested RT-PCR                  virus based on NS1 genome sequence analysis of BTV-17. Vet
methods.                                                         Microbiol 59:99–108.
                                                              4. Billinis C, Koumbati M, Spyrou V, et al.: 2001, Bluetongue
   In summary, the real-time fluorogenic RT-PCR                   virus diagnosis of clinical cases by a duplex reverse transcrip-
method developed and applied in this study represents            tion PCR: a comparison with conventional methods. J Virol
a new analytical tool that allows large-scale monitor-           Methods 98:77–89.
                                    High throughput detection of bluetongue virus by real-time RT-PCR                                        17


 5. Bonneau KR, DeMaula CD, Mullens BA, MacLachlan NJ:                         parison of virus isolation, PCR assay, and in vitro feeding of
    2002, Duration of viraemia infectious to Culicoides sonorensis             Culicoides variipennis. Arch Virol 136:1–8.
    in bluetongue virus-infected cattle and sheep. Vet Microbiol 88:     22.   Mellor PS, Whittmann EJ: 2002, Bluetongue virus in the Med-
    115–125.                                                                   iterranean basin 1998–2001. Vet J 164:20–37.
 6. Bonneau KR, Mullens BA, MacLachlan NJ: 2001, Occurrence              23.                       ´          ´
                                                                               Miranda MA, Borras D, Rincon C, Alemany A: 2003, Presence
    of genetic drift and founder effect during quasispecies evolution                           ´
                                                                               of Culicoides imıcola and Culicoides obsoletus in the Balearic
    of the VP2 and NS3/NS3A genes of bluetongue virus upon pas-                Islands. Med Vet Entomol 17:1–4.
    sage between sheep, cattle, and Culicoides sonorensis. J Virol       24.   Oberst RD, Stott JL, Blanchard-Channell M, Osburn BI: 1987,
    75:8298–8305.                                                              Genetic reassortment of bluetongue virus serotype 11 strains in
 7. Bonneau KR, Zhang N, Zhu J, et al.: 1999, Sequence compar-                 the bovine. Vet Microbiol 15:11–18.
    ison of the L2 and S10 genes of bluetongue viruses from the          25.   OIE Terrestrial animal health code, 13th ed., 2004: OIE Orga-
    United States and the People’s Republic of China. Virus Res                nization International des epizooties. Office International des
    61:153–160.                                                                Epizooties: 2004, Terrestrial Animal Health Code. Thirteenth
 8. Brewer AW, MacLachlan NJ: 1992, Ultrastructural characteriza-              Edition, Office International des Epizooties, Paris.
    tion of the interaction of bluetongue virus with bovine eryth-       26.   Orru G, De Santis P, Solinas F, et al.: 2005, Differentiation of
    rocytes in vitro. Vet Pathol 29:356–359.                                   Italian field and South African vaccine strains of bluetongue
 9. Brewer AW, MacLachlan NJ: 1994, The pathogenesis of blue-                  virus serotype 2 using real-time PCR. J Virol Methods 122:37–
    tongue virus infection of bovine blood cells in vitro: ultrastruc-         43.
    tural characterization. Arch Virol 136:287–298.                      27.   Pritchard LI, Gould AR: 1995, Phylogenetic comparison of the
10. Dangler CA, De Mattos CA, De Mattos CC, Osburn BI: 1990,                   serotype-specific VP2 protein of bluetongue and related orbi-
    Identifying bluetongue virus ribonucleic acid sequences by the             viruses. Virus Res 39:207–20.
    polymerase chain reaction. J Virol Methods 28:281–292.               28.   Reed LJ, Muench H: 1938, A simple method of estimating fifty
11. Gould AR: 1987, The complete nucleotide sequence of blue-                  percent endpoints. Am J Hyg 27:493–497.
    tongue virus serotype 1 RNA3 and a comparison with other             29.   Reid SM, Ferris NP, Hutchings GH, et al.: 2000, Primary di-
    geographic serotypes from Australia, South Africa and United               agnosis of foot-and-mouth disease virus by reverse transcription
    States of America, and with other orbivirus isolates. Virus Res            PCR. J Virol Methods 89:167–176.
    7:169–183.                                                           30.   Samal SK, El-Hussein A, Holbrook FR, et al.: 1987. Mixed
12. Gould AR, Pritchard LI: 1990, Relationships amongst blue-                  infection of Culicoides variipennis with bluetongue virus sero-
    tongue viruses revealed by comparisons of capsid and outer coat            types 10 and 17: evidence for high frequency reassortment in
    protein nucleotide sequences. Virus Res 17:31–52.                          the vector. J Gen Virol 68:2319–2329.
                                                                         31.   Samal SK, Livingston Jr CW, McConnell S, Ramig RF: 1987,
                                                      `
13. Gregory M, Zientara S, Hendrikx P: 2002, La fievre catarrhale
                                                                               Analysis of mixed infection of sheep with bluetongue virus se-
                                                         ´
    du mouton en Corse en 2000 et 2001. Bulletin Epidemiologique
                                                                               rotypes 10 and 17: evidence for genetic reassortment in the ver-
               ´                              ˆ
    du Ministere de l’Agriculture et de la Peche 4:1–3.
                                                                               tebrate host. J Virol 61:1086–1091.
14. Inoshima Y, Morooka A, Sentsui H: 2000, Detection and diag-
                                                                         32.                          ´
                                                                               Sarto I, Monteys V, Saiz-Ardanaz M: 2003, Culicoides midges
    nosis of parapoxvirus by the polymerase chain reaction. J Virol
                                                                               in Catalonia (Spain), with special reference to likely bluetongue
    Methods 84:201–208.
                                                                               virus vectors. Med Vet Entomol 17:288–293.
15. Johnson DJ, Wilson WC, Paul PS: 2000, Validation of a reverse
                                                                         33.   Shad G, Wilson WC, Mecham JO, Evermann JF: 1997, Blue-
    transcriptase multiplex PCR test for the serotype determination            tongue virus detection: a safer reverse-transcription polymerase
    of U.S. isolates of bluetongue virus. Vet Microbiol 76:105–115.            chain reaction for prediction of viremia in sheep. J Vet Diagn
16. Katz J, Alstad D, Gustafson G, Evermann J: 1994, Diagnostic                Invest 9:118–124.
    analysis of the prolonged bluetongue virus RNA presence found        34.   Stone-Marschat M, Carville A, Skowronek A, Laegreid WW:
    in the blood of naturally infected cattle and experimentally in-           1994, Detection of African horse sickness virus by reverse tran-
    fected sheep. J Vet Diagn Invest 6:139–142.                                scription-PCR. J Clin Microbiol 32:697–700.
17. Katz JB, Alstad AD, Gustafson GA, Moser KM: 1993, Sensitive          35.   Tatem AJ, Baylis M, Mellor PS, et al.: 2003, Prediction of blue-
    identification of bluetongue virus serogroup by a colorimetric              tongue vector distribution in Europe and North Africa using
    dual oligonucleotide sorbent assay of amplified viral nucleic               satellite imagery. Vet Microbiol 97:13–29.
    acid. J Clin Microbiol 31:3028–3030.                                 36.   Thompson JD, Higgins DG, Gibson TJ: 1994, CLUSTAL W:
18. Kutyavin IV, Afonina IA, Mills A, et al.: 2000, 3 -minor groove            improving the sensitivity of progressive multiple sequence
    binder-DNA probes increase sequence specificity at PCR exten-               alignment through sequence weighting, position-specific gap
    sion temperatures. Nucl Acids Res 28:655–661.                              penalties and weight matrix choice. Nucleic Acids Res 22:4673–
19. Lanciotti RS, Kerst AJ, Nasci RS, et al.: 2000, Rapid detection            4680.
    of West Nile virus from human clinical specimens, field collec-       37.   Whittmann EJ, Mellor PS, Baylis M: 2001, Using climate data
    tion mosquitoes, and avian samples by a TaqMan reverse tran-               to map the potential distribution of Culicoides imicola (Diptera:
    scriptase-PCR assay. J Clin Microbiol 38:4066–4071.                        Ceratopogonidae) in Europe. Rev Sci Tech Off Int Epiz 20:731–
20. Lanciotti RS, Kerst AJ: 2001, Nucleic acid sequence-based am-              740.
    plification assays for rapid detection of West Nile and St. Louis     38.   Zientara S, Sailleau C, Dauphin G, et al.: 2002, Identification
    encephalitis viruses. J Clin Microbiol 39:4506–4513.                       of bluetongue virus serotype 2 (Corsican strain) by reverse-tran-
21. MacLachlan NJ, Nunamaker RA, Katz JB, et al.: 1994, Detec-                 scriptase PCR reaction analysis of segment 2 of the genome.
    tion of bluetongue virus in the blood of inoculated calves: com-           Vet Rec 150:598–601.

						
Related docs