Docstoc

INTERNATIONAL POTATO CENTER - DOC

Document Sample
INTERNATIONAL POTATO CENTER - DOC Powered By Docstoc
					                       INTERNATIONAL POTATO CENTER
                         Annual Project Progress Report
               Reporting Period: January 1, 2005- December 31, 2005


1. Title of Project

Sweetpotato Varieties for Improved Nutrition and Industrial Use (CIPFIS 33)

2. Project and sub-project leaders

Project leader: Wolfgang Grüneberg
Sub-project leaders: Wolfgang Grüneberg and Regina Kapinga

3. Main outputs per category, and milestone achievement in 2005 (these are from
   MTP, give reasons for non-achievement)

    Output                   Output                         Milestone 2005                Achievement
   category*                                                                                 (%)**
                          Germplasm                            Germplasm                   Germplasm
 Materials       SSA:
                 20 local OFSP landraces in SSA        20 local OFSP landraces                100%
                 collected & virus cleaned             collected in SSA
                 30 OFSP clones from Lima (≥ 30
                 % DM, high β-carotene)                Introduction of 30 new OFSP            100%
                 introduced into Nigeria, Zambia &     to SSA
                 South Africa
 Materials       ESEAP:
                 1000 SP accessions from               Maintaining of SP germplasm             80%
                 Indonesia maintained                  from Indonesian
                 80 out of 150 PNG SP                  Transfer of a SP core                   80%
                 accessions ready to be shipped        collection from Papua to CIP-
                 to CIP-Lima (*)                       Lima
                 8 SP clones with salinity             No milestone                          Achieved
                 tolerance introduced to Tsunamy
                 areas Indonesia (*)
 Materials       SWCA:
                 5 SP clones for drought               Improved sweetpotatoes with             50%
                 tolerance evaluated – 2 clones        high productivity and quality
                 selected                              identified in SWCA
 Materials       LAC & across regions:
                 23 promising OFSP clones              Establishment of OFSP                  100%
                 introduced to Nicaragua, Cuba,        testing in SP breeding
                 Dominican Republic, Brazil (*)        programs in LAC
                 6 clones [3 white, 3 high β-
                 carotene SP (Jewel, Resisto,
                 SPK004)] deployed for Harvest
                 Plus vitamin A & Fe bioavailability
                 study (Bangladesh)
                       Seed production                      Seed production             Seed production
 Materials       SSA:
                  ≥100,000 OFSP seeds produced         10,000 – 15,000 OFSP seeds             >100%
                 for SSA (Uganda) by polycross         produced by controlled & poly-
                 nurseries                             crosses
Materials   SSA & LAC:
            242 OFSP families with > 40           10,000 OFSP controlled                       100%
            seeds per cross (about 10,000         crossings seeds produced
            seeds) produced by controlled
            crossings [OFSP “Population
            ZAPSPK” (VA-1 generation)] for
            testing in SSA & Peru                                                              80%
            4 OFSP families with 1000 seeds       5000 OFSP elite crossings
            per cross (about 4000 seeds)          seeds produced
            produced by elite-polycrosses for
            testing in Peru, Nicaragua, Brazil,
            Cuba, Dom. Rep. (each country
            1000 seeds)
Materials   ESEAP:
            842 seeds (Vietnam ) produced         1000 SP seeds produced                       90%
            by polycrosses with 11 parents
Materials   ESEAP & LAC:
            71 SP families with > 40 seeds        60 families for high starch SP in           >100%
            per cross (about 3,000 seeds)         population “HighStar-1”
            produced by controlled crossings
            [population high starch “HighStar”
            (HighStar-1 generation) for testing
            Peru and Indonesia                                                                >100%
            40 SP families with >40 seeds         30 families for high purple SP
            per cross (about 1600 seeds)          in population “HighP1”
            produced by controlled crossings
            [population high purple “HighP1”
            generation for testing in Peru and
            Indonesia
             Population Development                     Population                     Population D & T
                    & Testing                     Development & Testing
            SSA:                                            Not reported
Materials   Population Development –
            seedling trials conducted (Uganda)
            population means: unknown

            ESEAP:                                800 – 1000 clones evaluated in                80%
Materials   470 SP clones developed and           seedling trials                     (bad seed germination)
            tested (Vietnam), population
            means: unknown – results 62
            clones selected for promising yield
            trials (PYT)


            SWCA:                                           Not reported
Materials   15 seed families tested
            (Bangladesh), population means:
            unknown – results 52 genotypes
            selected for promising yield trails
            (PYT)


            LAC & across regions:                 4000 – 5000 OFSP VA–0x                       100%
Materials   4200 OFSP clones developed            generation clones developed &
            and tested (3 locations, Peru,        tested
            population “Jewel ”, VA-0x
            generation, population means
            (n=4200): 15.0 t/ha storage root
            yield, 28.8 t/ha foliage yield, 30%
            DM, 79 ppm total carotenoids, 21
            ppm Fe & 9 ppm Zn
               Variety Development                 Variety Development                Variety Develop.
Materials   SSA:
            15 - 20 promising OFSP clones          40 – 50 promising clones
            identified & widely deployed           tested, 1 - 2 clone superior to
            through participatory evaluation       check clones
            NARs, farmers, CBOs & NGOs in
            3 countries, means: not reported
            10 advanced OFSP clones in
            SSA GxE trials in 6 countries
            1 high yielding wide adapted           5 – 10 OFSP varieties identified          100%
            OFSP clone (CIP 19906.12) for          / officially released in SSA
            East Africa (Uganda, Kenya
            Tanzania) identified
            2 high yielding wide adapted
            OFSP clones (CIP material) for
            South Africa identified
            4 OFSP varieties (Ethiopia)
            officially released
Materials   ESEAP:
            61 promising clones (Vietnam)
            identified, means (N = 61): 26.6
            t/ha storage root yield, 19.6 t/ha     Testing of 20 advanced
            foliage yield                          clones, 1 - 2 clone superior to           100%
            53 promising clones (Indonesia)        check clones
            developed, means: unknown
            20 advanced clones (Vietnam)
            developed, means (N=20): 14.8
            t/ha root yield, 12.9 t/ha foliage
            yield, 3 clones selected
Materials   SWCA:
            9 promising clones tested
            (Bangladesh) 4 clones selected.
            Means (N=4): 48.1 t/ha root yield,
            17.2 t/ha foliage yield                Improved SP with high                     80%
             3 advanced clones (Bangladesh)        productivity and quality
            2 clones selected Means: (N=2)         identified in East and South
            34.8 t/ha storage root yield, 31.5 %   East Asia
            DM
            10 advanced clones (Sri Lanka),
            means (N = 10: 13.9 t/ha root
            yield, 2 - 3 clones selected
            9 advanced clones (India) not
            harvested until end 2005
Materials   LAC & across regions:
            68 promising OFSP clones
            (Peru, 3 locations) selected from        45 promising OFSP clones                      >100%
            population “Jewel ” (VA-0x               identified from population
            generation), means (N=68): 24.6          “Jewel” VA-0x generation for
            t/ha storage root yield, 32.8 t/ha       global distribution after reaching
            foliage yield, 29.4% DM, 222 ppm         health status 2
            total carotenoids, 24 ppm Fe & 11
            ppm Zn
            17 advanced SP clones (Peru, 3                                                            50%
            locations) means (N = 17): 18.86         15 – 20 advanced clones; 1 –2        (insufficient combination
            t/ha storage root yield, foliage yield   potential varieties identified       between yield and quality
            not recorded, 33.7% DM, 55 ppm,                                               no new potential variety)
            total carotenoids, 17 ppm Fe & 7
            ppm Zn; 5 clones selected,
            means (N=5): 17.3 t/ha storage
            root yield, foliage yield not
            recorded, 30.6% DM, 156 ppm,
            total carotenoids, 18 ppm Fe & 8
            ppm Zn
             Variety Dissemination &                 Variety Dissemination &                 Variety Diss. &
                  on-farm trials                          on farm trials                     On-farm trials
Materials   SSA:
            On-farm acceptability studies
            with 5 –10 OFSP varieties in
            SSA varieties identified through
            participatory evaluation with            New advanced OFSP clones                         85%
            national programs, farmers, CBOs         disseminated                         (late planting due to rain
            & NGOs.                                                                       shortage in some
            Multiplication & dissemination                                                selected sites)
            of planting material of popular
            breeder’s varieties in SSA: Basic
            plots for multiplication of clean
            planting material established in ≥ 5
            countries
Materials   ESEAP:
                                                                                          75% [this work was
            4 clones verified to be adapted for      Adapted germplasm for Timor          conducted under seed of
            East Timor and about 10,000              identified                           life project. (CIP; ACIAR;
            cuttings of these clones were                                                 East Timor Gov.)]
            distributed
Materials   SWCA:
            3-4 clones in SriLanka verified to
            be adapted, > 20,000
            cuttings distributed by HORDI to
            farming communities and other            Three advanced sweetpotato                   Achieved
            potential growers, means (N=4))          genotypes disseminated
            unknown .
            4 clones in Bangladesh [CIP
            440074-2, BARISP-7 (Kalmegh),
            BARISP-5, BARISP-7]
            disseminated
            Majority of available OFSPs              Dissemination of OFSPs to                    Achieved
            varieties in Orrisa / India were         more locations
            distributed
Materials   LAC & Across Regions:
            Introduction of 22 Elite
            Demonstration clones into LAC,           CIP Elite-Demonstration & GE
            ESAP & SWAC (Nicaragua (1                trails established across                      100%
            location), Cuba (1 location),            regions with the most famous
            Dominican Republic (1 location),         OFSP & yellow/ white high dry
            Brazil (1 location), Indonesia (3        matter varieties
            locations), Vietnam (2 locations),
            India (2 locations) (*)
                       Specials                             Specials                       Specials
Materials   Across Regions:
            NIRs calibration files for protein,   NIRs calibration files for total             100%
            total caroteniods, Fe, Zn, Ca & P     caroteniods, Fe & Zn
            available to determine quality in
            freeze dried root samples
            24 families each with 20 clones       Variance components between                   50%
            (2 location test) to estimate         and within crosses for most          (1 location lost – trial
            variance components for model         important traits estimated          repeated Dec. 2005 –
            calculations to determine the                                                   March 2006)
            optimum of number of crosses and
            number of clones per cross
                   Biotechnology                        Biotechnology                  Biotechnology
Materials   Across regions:
            26 new SSR markers were                                                             90%
            developed for Ipomoea batatas         30 new SSR marker                  (all published sequences
            using all published sequences of                                                 screened)
            this species – total available SSR
            markers N=50 for SP end of 2005.                                                  >100%
            Microarrays containing 13,328         Microarrays containing 10,000      (in co-operation ARCsr /
            cDNA clones representing              cDNA clones representing                    Austria)
            different stages of root              different stages of Sweetpotato
            development and 1,072 clones of       development
            leaf origin were developed
            Three populations to map              Three populations – each with              >100%
            genes for biosynthesisrelated ß-      100 genotypes - to map genes
            carotene and starch genes             for biosynthesis - related ß-
            developed – each with 150             carotene and starch genes have
            genotypes currently tested at 2       been developed
            locations                                                                (in co-operation ARCsr /
            10,000 ESTs sequenced new             Not a milestone in 2005                     Austria)
            sources of SSR markers
Practices   SSA:
            SP methods for germplasm
            management demonstrated               Yes                                         >100%
            maintenance, multiplication &
            distribution
Practices   LAC & SSA:
            Fast quality screening at CIP-        Fast quality screening at CIP-               50%
            Peru & CIP-Uganda by NIRs for         Peru & CIP-Uganda                  (100% will be achieved in
            protein, total carotenoids, Fe, Zn,   established                             March 2006)
            Ca and P established - applied to
            screen 4270 samples for SP
            biofortifiaction
Practices   SWCA:
            SP selection methods in India
            demonstrated - screening              On farm demonstration trials               Achieved
            genotypes and evaluation after
            hybridization demonstrated
Practices   Across Region:
            Principal practice of SP test                       Yes                          Achieved
            capacity allocation for yield &
            quality due to the GE pattern of
            SP published
 Capacity          SSA & LAC:
                   Capacity building for NARS              Conduct planning meetings for
                   breeders in SP Biofortification         SP Biofortification
                   programs Planning meetings for
                   Biofortification SP in SSA & LAC
                   Two Statistic & GxE courses for         1 Statistic & G&E course in SSA            >100%
                   15 and 4 breeders from SSA
                   countries
                   Exchange visits during harvesting
                   of trials was done with 16 NARS
                   breeders and technicians from
                   Tanzania, Kenya and Uganda.
                   Support three NARS scientists           Attend and present papers at
                   at the African Crop Science to          the African Crop Science
                   attend and present papers
                   Support of 1 PhD study (Silver                       Yes                          Achieved
                   Tumwegmire): GxE assessment of
                   β-carotene, Fe & Zn in SSA
                   landraces
 Capacity          ESEAP:
                   3 Bsc. students made their Bsc.                      Yes                          Achieved
                   thesis on sweetpotato (Supervised
                   by Asep Setiawan / Indonesia)
                   1 Master of science candidate,                       Yes
                                                                                                     Achieved
                   Title: Screening of Cylas
                   resistance sweetpotato
                   (Supervised by Asep Setiawan /
                   Indonesia)
                   Improvised workshop “The                    Not a milestone in 2005
                   Multi-trait selection problem and
                   expected breeding progress”
                   with SP working group in Xushu /
                   China
 Capacity          SWCA:                                   Increased knowledge on the                Achieved
                   India: More no. of farmers were         nutrition and production of
                   involved in doing on farm trials        healthy planting material
 Capacity          Across Regions:
                   Support of 1 PhD thesis                 Milestone in 2005                         Achieved
                   (Dhayriasheel P. Desay)                                                     (In co-operation with
                   Title:Regulation of beta-carotene                                              ARCsr / Austria)
                   synthesis in white and orange
                   flesh sweetpotato analysed by
                   gene expression profiling                                                         Achieved
                   2st Training step: Gabriella            Milestone in 2005                   (in co-operation with
                   Burgos (CIP) β-carotene & HPLC                                            Instituto de Biociencias
                   in Brazil                                                                 Univ. Estadual Paulista,
                                                                                               Sao Jose Rio Preto)

 Other kinds       Across Regions:
                   Genetic parameters of SP                                                            > 100 %
 of                storage root quality traits to          Milestone in 2005                 Collaborative research
 knowledge         make more informed choices in SP                                          activities between CIP
                   crop improvement; range:                                                  and Louisiana State
                   Root dry matter 20 – 45%, β-                                              University (LSU) for plant
                   carotene 0 – 400ppm, Fe 10 –                                              quality analysis
                   41ppm & 5 –15 ppm Zn content;
                   heritabilities: dry matter 85%, β-
                   carotene 90%, Fe 70% and Zn
                   70%; genetic correlations between
                   these 4 traits about -0.5 -0.3, -0.3,
                   0.4, 0.4, 0.75

                   New knowledge about neglected           Not a milestone in 2005
                   root & tuber crops – manuscripts
                   submitted / published
* Outputs have been achieved through collaborative work with Division 2.
4. Report of 2005 work

4.1 Germplasm evaluation, maintenance and introduction
    One of CIP major outputs / activities is to make sweetpotato germplasm available. The exchange
    of accessions between countries in SSA is well organized and nearly independent from CIP-HQ.
    However, the exchange between countries in ESEAP and SWCA is more difficult and requires
    the facilities of CIP-HQ. In 2005 the sweetpotato working group shipped in collaboration with
    Division 2 22 varieties to 3 countries in the ESEAP and SWCA and 22 varieties + 23
    breeding lines to 4 countries in the LAC region as well as 30 breeding lines to CIP-Nairobi.
    The distribution of breeding lines is limited by the situation that the biotechnology group of
    sweetpotato breeding has no direct access to in-vitro-propagation facilities (both in-vitro-
    laboratories within Division 3 are in use for transgene plants). This is also a limitation to work with
    double-triploids in CIP sweetpotato breeding which would be an extreme breeding advantage in
    hexaploid sweetpotato (see also 4.5 Biotechnology). We estimated that the capacity of shipping
    sweetpotatoes breeding lines to the regions is about 100 clones to 4 countries. Within the next
    years the sweetpotato working group will put the emphasis on testing each year least 50
    promising OFSP clones in 8 countries (Indonesia, Vietnam, India, Nicaragua / Honduras, Cuba,
    Brazil, Dominican Republic/Haiti and Kenya) and to conduct continuously co-called “Elite
    Demonstration & GE trials” (about 22 varieties) in different agro-ecological zones of the world.
    These Elite Demonstration & GE trials will allow us to distribute the most successful OFSP and
    white/yellow high starch varieties to different regions and to obtain more information about agro-
    ecological zones, GE pattern and adaptation of sweetpotato genotypes. For SSA the main
    strategy of CIP sweetpotato breeding at HQ is to support the SSA region with seeds form
    controlled crossings, to conduct seedling trails (population development) in the SSA region (3
    countries: Kenya, Uganda, Mozambique).

    A very important output of sweetpotato breeding in 2005 was the collection of about 50 OFSP
    SSA landraces and to start to evaluated this material. These collection were initiated by Regina
    Kapinga, because there are only very few successful OFSP varieties in SSA (SPK004, Resisto,
    Jonathan). It can be expected that the new collected OFSP clones in SSA will speed up the
    dissemination efforts as well as the release of new high-dry-matter OFSP varieties in SSA in
    2006/2007. This will contribute to eradicate extreme poverty and hunger, reduce child mortality,
    improve maternal health and caombat HIV/ADIS, malaria and other diseases in SSA. The
    landraces are currently tested in connection with the PhD thesis of Silver Tumwegamire (CIP
    assistant sweetpotato breeder). Moreover, a very interesting output is the maintaining of about
    1000 accessions from Indonesia and Papua at CIP-Bogor by Asep Setiawan. This material
    merits quality evaluation, which could be easily achieved if there is a dry freezer at CIP Bogor.
    Moreover, the dry freezing capacity would allow CIP to test and breed for high starch varieties in
    the ESEAP region. It should be noted that sweetpotato still has higher starch yields than cassava.

4.2 Seed Production
    Crossings and seed production is the only way to develop new genetic variation in sweetpotato
    for population and variety development. However, seed formation is low in sweetpotato (about 3
    seed per cross). CIP sweetpotato breeders and the NARs sweetpotato breeder Robert Mwanga
    at Namulonge / Uganda have developed about 200,000 polycross OFSP seeds by open
    pollination for SSA. However, polycrosses have the disadvantage that the frequencies of allele
    contribution of each male parent is often extremely unbalanced and nearly unknown. Morevover,
    the correlation between off-spring performance and performance of the female parent is expected
    to be very low in sweetpotato, because sweetpotato is hexaploid and highly heterozygous. For
    this reason CIP OFSP sweetpotato breeding at HQ is conducting mainly controlled crossings.
    About 15,000 controlled OFSP seeds (about 400 families) have been developed in 2005 for the
    biofortification program of sweetpotato at CIP which is mainly aiming at the SSA and LAC region.
    In the future (> 2005) the off-spring of many parental combinations will be tested with 20
    genotypes in Peru and 20 genotypes in Kenya, Uganda and Mozambique, respectively. The risk
    with polycrosses should be considered as too high that this will not give us superior OFSP
    populations within short terms (3 - 5 years). Moreover, OFSP sweetpotato breeding at CIP
    started in 2005 to work with 2 OFSP populations (population 1: “Jewel” and population 2:
    “ZAPSPK”). In 2005 the status of population “Jewel” was clones tested in seedling population
    trials and the status of population “ZAPSPK” was seeds developed from controlled crossings
    between 100 x 6 parental combinations. This will allow us in the future to exploit heterosis in
    OFSP sweetpotato breeding. If this can result in yield improvements of OFSP’s comparable to the
    yield improvements by the exploitation of heterosis in maize remains to be investigated. We
    expect results for this very interesting research question in 2007/2008.

    As mentioned above sweetpotato still has higher starch yields than cassava. Although the CIP
    resources to breed for high extractable dry matter /starch are low, this section of sweetpotato
    breeding should be kept alive. In 2005 about 3000 controlled seeds have been developed to
    improve the starch yield of sweetpotato in the co-called “HighStar” population. In total 71
    families of the “HighStar” population will be evaluated at CIP-HQ and CIP-Bogor. For this it would
    be a considerable advantage if CIP-Bogor would have a dry freezer. Storage root amples could
    be easily shipped from CIP-Bogor to to CIP-HQ for starch determination by NIRs. So far it is only
    possible to determine the starch yield of the families (test conducted at CIP-HQ). For variety
    development out of the population it is required to determine the starch content in clones.
    Moreover, such an equipment at CIP-Bogor would allow us to support a biofortification program
    for OFSP in the ESEAP region. It should be noted that CIP sweetpotato breeding has also a
    small seed production program for purple flesh sweetpotatos. This is mainly conducted to create
    and develop genetic variation for this type of sweetpotatoes. There might be more requests to
    obtain purple fleshed sweetpotatos from CIP in the future and the genetic basis of this
    sweetpotato type is very narrow.

    As can be seen sweetpotato breeding at CIP is putting the main emphasis on OFSP. This OFSP
    have also higher iron and zinc content (see 4.3 population development). We expect that CIP
    sweetpotato breeding develops successful OFSP varieties for Elite-Demonstration and GE trails
    and will contribute to the MDGs, especially: MDG 4 reduce child mortality, MDG 5 improve
    maternal health and MDG 6 combat HIV/ADIS, malaria and other diseases. However, by menas
    of non-sweet high starch sweetpotatoes also a contribution to MDG 1 eradicate extreme poverty
    and hunger. Starch has a large world market and has lead to income generation, unfortunately
    nearly exclusively exploited by cassava.

4.3 Population Development
    The famous plant breeder Schell has once compared population development with the pump and
    the varieties with water: “The pump must run”. Moreover, population development is the central
    point where the breeding progress of a crop improvement program can be measured. In 2005 the
    population “Jewel” (VA-0x generation) was at status clones. The population was grown at 4
    locations [SanRamon1, San Ramon2, La Molina and Canete – the location Canete was used to
    determine the virus tolerance of clones after 3 clonal propagation steps (Elisa test)]. All main
    genetic parameters were estimated (means, heritabilities and genetic correlations) and used for
    model calculations. The most interesting observations in the population were: Sweetpotato
    genotypes can have more than 300 ppm total carotenoids and more than 30 ppm Fe
    content in storage roots (Table 1). The model calculations with the genetic parameter
    (heritabilities and genetic correlations) showed again (this also observed from model calculations
    with genetic parameters estimated from advanced clones and families in 2004), that there is a
    strong negative trade-off between storage root dry matter improvement and the improvement of
    total carotenoids, Fe and Zn. This trade-off occurs by applying all usually used selection
    procedures!! This can only be avoided by using the Pesek Baker selection index. It should be
    noted that there are several very high estimations for yield in the population (Table 1). However,
    such observations out of the range of on-farm trails usually occur in experimental plots and they
    can be up 30% for yield estimations. The estimations of means and standard deviations for yields
    usually have a small error.
Table 1. Descriptions (means, standard deviations and range) of the population Jewel in VA-0x
generation across 3 environments for observed traits.

    Traits            Genotypes         Mean         Std.Dev.             Min.             Max.
 Storage root      4175                  15.0              8.4                 0             98.8
  yield (t /ha)
 foliage yield     4167                  29.9           18.7               0.5               175.8
      t/ha)
  Agro. score      4141                  2.25           0.55               1.0               4.0
      (1-4)
    Root dry       2708                  30.0           4.66              16.0               50.3
   matter (%)
  *Total caro-     2709                   79           101.7               0.0               398
tenoids (ppm)
       *Fe         2709                  21.2              5.0             1.9               40.4
     (ppm)
       *Zn         2709                  9.3               1.6             4.8               14.9
      Ppm
* measured on dry matter basis

Owing to the model calculations a selection progress can be expected for all traits, which is
between 0.2 – 0.6 of Standard Deviation (Std.Dev.). In total 191 female parents and 6 male
parents (Table 2) were selected for controlled crossing in 2006 (VA-1x gneration).

Table 2. Means of selected parents for observed traits to develop the population Jewel (VA-1x).

                         Storage       foliage                   Total caro-
     Clone             root yield (t    yield     Root dry        tenoids            Fe       Zn
Male parents (N= 6)        /ha)         t/ha)    matter (%)        (ppm)           (ppm)     ppm
    3356                   30            46         28.5            315             33        13
    1583                   15            33         25.1            345             38        14
     100                   16            31         27.4            311             31        13
  101048.1                27.3            -         28.3            256              -         -
  TN92.282                32.1            -         24.1           >250              -         -
  YM89.099                38.9            -         25.8           >250              -         -
   Resistan                 -             -         26.2           >50               -         -
Female parents
 Means (N = 191)          23             33         29.6            196             24        11

In 2005 CIP has also be conducted population development on a large scale in SSA and on a
small scale in the ESEAP (Vietnam) and the SWCA (Bangladesh) region. However, the reports
do not give detailed statistical descriptions of these populations. It can be estimated that about
15,000 clones have been tested in seedling trials in SSA and about 500 clones in Vietnam and
500 clones in Bangladesh.

However, the results available clearly show that sweetpotato can be also biofortified for the traits
Fe and Zn and that sweetpotato can become a crop to reduce the population affected by anemia
(about 2,000 millions). Since the upper biomass of sweetpotato (unfortunately we have so far no
own results) has considerable more Fe than the sweetpotato storage roots it might be of interest
to develop an intermediate food product (defined mixtures of dried sweetpotato root chips and
dried sweetpotato leaves) to develop a cheap weaning food product. This would require one NRS
to demonstrate this for Lima / Peru where 50% of the children are affect by anemia.
4.3 Variety Development

    CIP sweetpotato variety development in 2005 was successful in SSA. It is reported that 1 high
    yield wide adapted OFSP clone (CIP 19906.12) is short before variety release in East Africa
    (Uganda, Kenya Tanzania), 2 wide adapted OFSP clones (CIP material) are short before
    variety release in South Africa (Mozambique) and 4 OFSP varieties have been released in
    2005 in Ethiopia. Moreover, there have been 2 – 3 advanced breeding clones selected to
    become new varieties in the ESEAP region (Vietnam, Indonesia) and the SWCA region
    (SriLanka, India, Bangladesh). However, the characteristics of these new clones released or short
    before to be release as new varieties are often not well described.

    Variety development at CIP-HQ has not resulted in development of new varieties in 2005. No
    advanced breeding clone with higher dry matter and high β-carotene content of storage roots was
    superior to the yield of check clones. The reasons for this are: storage root dry matter content is
    negatively correlated with β-carotene (-0.45 to -0.55), Fe (-0.4 to -0.5) and Zn (-0.4 to -0.5) and to
    break this correlation CIP has done in the past to few recombination/crossings and tested to few
    new clones. This has changed: 1) in 2004 24 families were developed from controlled crossings
    for OFSP and in 2005 about 400 families have been developed for OFSP and 2) in 2004 22
    promising clones were tested (only 4 clones were OFSP); in 2005 300 promising OFSP clones
    were tested and out of these 300 promising OFSP clones 67 + 3 clones were selected. The
    means (N=67) of these selected promising clones were: 24.6 t/ha storage root yield, 32.8 t/ha
    foliage yield, 29.4% storage root dry matter, 222 ppm total carotenoid content 24 ppm iron
    content and 11ppm zinc content of storage roots. A list of these clones is given in appendix 1.
    The material is currently cleaned to reach health status 2. To speed up virus cleaning all
    clones/genotypes developed from seeds are maintained in Huanuco [an environment with low
    virus pressure (2600m)]. The clones of selected entries grown at this environment are taken to
    be tested/virus cleaned for germplasm distribution into the regions. We hope that this procedure
    will speed up the availability of new breeding lines from CIP-HQ, especially for CIP programs in
    the ESEAP and SWCA region were the number of developed new OFSP clones per year is low.

4.4 Variety Dissemination & on-farm trails
    For SSA it is reported that with 5 -10 OFSP clones on-farm acceptability studies have been
    conducted in several SSA countries by participatory evaluation with national programs, farmers,
    CBOs & NGOs and that basic plots for multiplication of clean planting material have been
    established in more than 5 SSA countries. This OFSP variety dissemination is conducted in co-
    operation with division 4. It can be estimated that CIP supports annually the dissemination of
    100,000 – 200,000 cuttings of 5 - 10 OFSP varieties in SSA. At least in Uganda and
    Mozambique we expect a significant impact on MDG 1 eradicate extreme poverty and hunger,
    MDG 4 reduce child mortality, MDG 5 improve maternal health and MDG 6 combat HIV/ADIS,
    malaria and other diseases. An additional reason for this is that in 2005 HarvestPlus decided to
    start the enduser component with OFSP and to focus on Ugnada and Mozambique. The impact
    of OFSP variety dissemination might be higher if CIP could achieve to maintain on several
    hectare OFSP planting material in “health-environments” with low or no virus pressure (high
    altitude environments like in KEPHIS / Nairobi). In cases of a food crisis such as the drought in
    Malawi in 2005 such fields could be used to get a large amount of certified planting material into a
    region were cuttings are need. There are opinions that it takes us to long to disseminate planting
    material in the case of an emergence e.g. the introduction of 8 SP clones with salinity tolerance
    introduced to Tsunamy areas of Indonesia. Theoretically sweetpotato is one of the best crops in
    such emergency case, because farmers can start to harvest food after 2-3 months.

    For ESEAP it is reported that for 4 clones about 10,000 cuttings have been distributed in East
    Timor and in SWCA CIP supported in 2005 the dissemination of >20,000 cuttings of 2-3 clones
    in SriLanka and several 1,000 cuttings of 4 clones in Bangladesh [CIP 440074-2, BARISP-7
    (Kalmegh), BARISP-5, BARISP-7]. Moreover, the majority of available OFSPs varieties in Orrisa
    / India were distributed. The impact of this activity seems to be much more successful than it is
    reported. The “Indo-Swiss Natural Resources Management Program Orissa” is saying that in
    Orissa OFSP is disseminating faster as you can walk.




4.5 Special Materials
    In this paragraph the use or generation of special materials for research is considered. In 2005
    there were two outputs of special materials: 1) At set of clones from family and advanced trials
    were were used to develop NIRs calibrations files for protein, total caroteniods, Fe, Zn, Ca & P
    for freeze dried storage root samples. The material represented a large genotypic range for these
    quality traits grown in two contrasting environments. This work should be considered as very
    successful, because the precision of calibrations were after the first step of calibration
    development clearly sufficient to use this practice of quality screening directly in the ongoing
    breeding programs (see above 4.3 Population Development). The cost of this quality screening
    would have been by chemical analyses about 80,000 USD (5418 samples, 8 USD for Fe and Zn,
    7 USD for total caroteniods per sample) and results wouldn’t have been available at the end of
    2005. This practice will also be implemented at Namulonge / Uganda for the sweetotato breeding
    work of Robert Mwanga, Regina Kapinga and Silver Tumwegamire. Moreover, sweetpotato
    breeding is testing a balanced data set of 24 families each with 20 clones at two locations and
    two replications. The main point is that in this material no selection has been conducted in earlier
    breeding steps (discarded entries from the ongoing breeding program were planted again with
    selected entries). This will allow us to estimate all required variance components (variation within
    and between crosses) for model calculations. The results of these model calculations will give
    us to topography of the optimum ratio between the number of crosses and the number of clones
    per cross. Currently 20 clones per cross are used in seeding trails to test the value of a cross.
    There is no information if this to low or to higher (close to the optimum or far away form the
    optimum). This knowledge will improve the selection efficiency in sweetpotato breeding.

4.5 Biotechnology
    The main output in 2005 for biotechnology from the CIP sweetpotato breeding workgroup was the
    development of 26 new SSR markers using all published sequences of sweetpotato. A list of
    these markers is given in appendix 2. In total 50 SSR marker are now available for Ipomoea
    batatas. The number of 50 SSR markers should be considered as the minimum to conduct the
    work plans for two larger projects 1) Molecular characterization of sweetpotato (GCP) and 2)
    Mapping of genes for biosynthesis related ß-carotene and starch genes (conducted in co-
    operation with ARCsr / Austria). Within the first project so far only 50 genotypes have been
    characterized with only 15 SSR markers and it is difficult to understand why this work is not
    making progress. Until mid 2006 about 500 sweetpotato genotypes must be characterized with 50
    SSR markers. Within the second project microarrays were developed containing 13,328 cDNA
    clones representing different stages of sweetpotato root development and 1,072 clones of leaf
    origin and more than 10,000 ESTs have been sequenced. These new sequences will become a
    new source to develop SSR markers. Moreover, three populations to map the genes for
    biosynthesis related ß-carotene and starch genes were developed and each population was
    planted at end of 2005 with 150 genotypes at 2 locations.

    The possibility of the sweetpotato breeding working group at CIP-HQ to conduct biotechnology
    research non-transgenic plants is very limited. The group has no direct access to in-vitro-
    propagation facilities (both in-vitro-laboratories within Division 3 are in use for transgenic plants).
    All in-vitro popagation for send breeding lines for testing into other countries can only be done at
    the working facilities of division 2. Usually breeders want to send considerable more promising
    clones to other regions as the ADU is usually sending in the case of requests of accessions.
    Moreover, it would be very interesting to produce double-triploids in CIP sweetpotato breeding
    working group. This could have an extreme efficiency advantage in hexaploid sweetpotato
    breeding – inbreeding sweetpotato is practically only achieved by introducing douple-triploid step,
    because with self-fertilization years are needed to reach an inbreeding coefficient of 50%. We
    should note that double-haploids are today routinely used in many crops by research institutions
    as well as breeding companies.


4.6 Practices, capacities and other types of knowledge
    Details about practices, capacity building and other types of knowledge are given in section 3, 5
    and 9. One point is perhaps worth to note. In 2005 there was an improvised workshop with the
    SP working group in Xushu / China during my visits in Asia. I think that the discussions later on
    were not only a polite smile and exchange of words. Concerning CIP sweetpotato activities in
    China we should primarily focus on the exchange of knowledge, because China has considerable
    larger breeding capacities for sweetpotato than CIP. The institutions in China are clearly
    interested in knowledge exchange. There is no need for the CIP activity “Breeding varieties with
    high dry matter yield and disease resistance in China” (330103) – China has more than 10 times
    more breeding capacity to work on this activity than CIP. The activity 330103 should change the
    target: “Development and Improvement of SP Breeding Methods with China”.

5. Related Training Activities conducted (workshops, individual training, theses,
   internships).

  Course name,          Dates and      Type (Individual,         Trainee         Trainer      Location
     topic               duration      group), if group       (Institution)*
                        (in days)      include number
                                       of participants in
                                           brackets
 The Multi-trait       June 2005       Improvised             The SP working Wolfgang        Xushu /
 selection problem     1 day           workshop with SP       group in Xushu / Gruneberg     China
 and expected                          working group in       hina (6 persons)
 breeding progress                     Xushu (6 persons)
                               th
 Statistics & GxE      25-26 Nov.      Group (15)             NARS              W.           Seeta,
 using PLABSTAB        2005                                   breeders from     Gruneberg    Uganda
                                                              10 countries)
                          th
                       4-5 Dec.        Group (4)              NARS              W.           Maputo
                       2005                                   breeders from     Gruneberg    Mozambique
                                                              Mozambique
 Standardization of    May, 2005       Group (10)             NARS              R.           Kampala,
 breeding                                                     breeders fro      Kapinga      Uganda
 methodology
 course for breeders

 Sweetpotato joint     November,       Group (19)             East African      R.           CIP-SSA
 trial harvesting      2005                                   breeders and      Kapinga
 exchange visit                                               technicians

 Trainers’ workshop    May, 2005       Group (21)             Farmers from      R.           Mansa,
 on production,                                               Mansa district    Kapinga      Zambia
 management,
 multiplication and
 protection of
 sweetpotato
 Aplicacion de la      14 y 15 de      Grupal (15)            Facultad de       Dr.          Universidad
 tecnica de            octubre del                            Agronomía         Reinero      Nacional
 produccion de         2005 (2 dias)                          Programa de       Benega       Agraria La
 dobles haploids en                                           Cereales y        García       Molina
 el mejoramiento                                              granos Nativos                 (UNALM)
 genetico de plantas
 Biotechnology in       3               Group (12)            J. Solis              -          Cartagena
 breeding                                                     CIP-HQ


6. Activities to Strengthen Team work at the project level:
       1. January, 2005. Attending CGIAR response to tsunami catastrophe in Indonesia on 20
          January, 2005. A planning meeting attended by CIP, CIFOR, ICRAF, ILCARM, ICRISAT
          and other centers to develop a plan of action held at CIFOR-HQ office. Oral presentation:
          Sweetpotato as Nutritious Storage food for Tsunami victims in Aceh.
       2. June 2005. Attending The 2nd International Symposium on Sweetpotato and Cassava
          (2ISSC), Kuala Lumpur, Malaysia 14 – 17 June 2005. Presenting 2 poster paper
       3. September 2005. Attending The Regional Strategic Planning meeting in Harbin-China
          September 5-6, 2005.
       4. November 2005, attending CIP’s annual - and planning meeting. Lima, Peru. Oct 31 to
          Nov 11, 2005.
       5. Individual NIRS training within CIP national staff Feb./March 2005 (2 weeks)
           st
       6. 2 Training step: Gabriella Burgos (CIP) β-carotene & HPLC in Brazil / in co-operation
          with Instituto de Biociencias Univ. Estadual Paulista, Sao Jose Rio Preto

7. Comments on impediments to progress

Progress achieved according to workplans with few small exceptions discussed under
section 4

8. Summary of proposals submitted this year
 Title                     Donor            Stage (PNM, concept                         Submission
                                            note, full proposal)                        date               Status*
 Speed up OFSP variety release       HarvestPlus        Full proposal                   August 2005        Approved
 in Uganda                           (40,000 USD)
 Sweetpotato Biofortification in     HarvestPlus        Full proposal                   August 2005        Approved
 South Africa (Mozambique)           (82,000 USD
 Feasibility Study for Fast          HarvestPlus        Full proposal                   August 2005        In review
 Quality Screening in Harvest        (25,000 USD)
 Plus by NIRS
 Development of Drought              Government of      Full proposal                   October 2005       In review
 Resistant Orange-fleshed            Austria; 600,000
 Sweetpotato for SSA;                USD.
 Combating Vitamin A deficiency                         Concept note                    2004               Not
 through the use of orange                                                                                 known
 fleshed sweetpotato in the tribal
 regions of Eastern India


9. Publications (list all publications differentiating those submitted, accepted or published).

                                              Published:
   Grüneberg W. J, K. Manrique, D. Zhang, M. Hermann 2005: Genotyp x Environment Interactions
      for a diverse Set of Sweetpotato Clones Evaluated across Varying Ecogeographic Conditions
      in Peru. Crop Sci. 45:2160-2171.
   Karuniawan A, A. Iswandi, P.R. Kale, J. Heinzemann, W.J. Grüneberg 2005: Vigna vexillata (L.)
      A. Rich. Cultivated as a Root Crop in Bali and Timor. GRES ISSN: 0925-9864 (Paper) 1573-
      5109 (Online First Publication)
    Setiawan A. and K. O. Fuglie. 2005 (Editors). Sweetpotato Research and Development: Its
         Contribution to the Asian Food Economy. Proceedings of an International seminar on
                                             th
         sweetpotato. Held on September 19 , in Bogor Indonesia. 161p.
    Setiawan A. and Tjintokohadi 2005. CIP's effort to breed high dry matter varieties for South East
         Asia. Poster paper presented at The 2nd International Symposium on Sweetpotato and
         Cassava (2ISSC), Kuala Lumpur, Malaysia 14 – 17 June 2005.
    Setiawan A., Tjintokohadi, H. Agusta, and K. O. Fuglie. 2005. CIP-Toyota collaboration
         experience in developing agro-industrial use of sweetpotato ( Ipomoea batatas (L.) Lam.) as
         animal feed in Indonesia. Poster paper presented at The 2nd International Symposium on
         Sweetpotato and Cassava (2ISSC), Kuala Lumpur, Malaysia 14 – 17 June 2005.
    Setiawan A., Tjintokohadi, H. Agusta, M. S. Rahayu, M. Ghulamahdi, Suwarto, D. Kuswaryanti, I.
         Pramedyaswari, Widiastuti, U. Sumirat, and M. Jusuf. 2005. Over-view of sweetpotato
         Breeding and Genetic resources Management by CIP in Indonesia. in Sweetpotato Research
         and Development: Its Contribution to the Asian Food Economy. Proceedings of an
                                                                      th
         International seminar on sweetpotato. Held on September 19 , in Bogor Indonesia. 161p.
         Setiawan A. and K. O. Fuglie. 2005 (Editors).
    Sreekanth Attaluri and Sarath Ilangantileke. 2004. Combating Vitamin A deficiency
        using Orange fleshed sweetpotatoes in Eastern India-CIP’s experience. Abstract:
        International Workshop on Micronutrient in South and South East Asia. Sep. 8-10 in
        Kathmandu, Nepal. PP: 10
    Rahayu, M. S., U. Sumirat and A. Setiawan. 2005. In-vitro Screening of Aluminum Tolerance’s
         Sweetpotato (Ipomoea batatas (L.) Lam) in Sweetpotato Research and Development: Its
         Contribution to the Asian Food Economy. Proceedings of an International seminar on
                                             th
         sweetpotato. Held on September 19 , in Bogor Indonesia. 161p. Setiawan A. and K. O.
         Fuglie. 2005 (Editors).

                                                Submitted:
    Sweetpotato:
   Estimation of genetic variances, covariances and genotype-by- environment interactions for
    simultaneous yield and quality improvement in sweetpotato – submitted to Plant Breeding
   Solis J., O. Yañez, R. Schafleitner, W.J. Grüneberg (2005) Twenty six new SSR markers for
    sweetpotato breeding. TAG (Submitted)

    ARC:
   Zanklan S., W.J. Grüneberg 2005: Genetic diversity of Yam Bean. Submitted to Crop Sci.
   Zanklan S., W.J. Grüneberg 2005: Agronomic Evaluation of Yam Bean. Submitted to Crop Sci.




10. Funding gaps. What priority research needs funding at the project level?

    In the subproject reports covering the activities from ESEAP and SWCA the following two
    suggestions were made: 1) support for breeding activities for purple fleshed sweetpotatoes and
    2) support of research on drought tolerance in sweetpotatoes. Both gaps have been closed
    and from 2006 on CIP is supporting the development of genetic variation for purple flesh
    sweetpotatoes on a small scale and drought research by core funds and special project
    proposals.
                                                      Appendix 1
                 Sixty-seven new promising clones developed at CIP-HQ in 2005

Description of 67 new promising clones developed at CIP-HQ in 2005 evaluated at 3 environments (clone
= CIP or field number of clone, YLD = storage root yield (kg / 1m row), FYLD = foliage yield (kg / 1m row),
eagro = agronomical evaluation (scores 1-4), t-c = total carotenoid content of storage roots (ppm on dry
matter basis), Fe = iron content of storage roots (ppm on dry matter basis), Zn = zinc content of storage
roots (ppm on dry matter basis), FMVD = Elisa test negative (0) for FMVD and CSVD = Elisa test negative(0) for
CSVD after 3 clonal propagation steps in the field.

    clone    YLD       FYLD eagro DM           t-c       Fe        Zn      FMVD   CSVD
    349      2.15333   2.825    3.0   27.135   164.950   23.7500   10.8500 0          0
    4640     2.20000   4.200    3.0   27.170   268.300   22.3000    8.9000   0        0
    448      2.25000   1.875    3.0   29.490   171.050   19.8000    9.5500 .      .
    887      2.20000   2.550    2.5   28.160   157.400   25.1000   10.9500 0          0
    86       2.55000   4.335    2.5   28.515   150.050   21.1500   10.3000 0          0
    160      2.26667   3.350    3.0   27.020   210.200   22.3000   10.1000 0          0
    727      2.09333   2.425    2.5   28.620   164.050   24.2500   10.7500 0          0
    2368     2.37333   3.150    3.5   27.535   152.634   21.9356    9.6383   0        0
    2162     2.04333   1.875    3.0   28.120   191.000   21.8500   10.3500 0          0
    838      2.11667   2.275    3.0   28.630   222.600   22.1000   10.3500 0          0
    576      2.05000   2.625    2.5   28.275   190.700   26.0000   12.0000 0          0
    647      2.16667   4.550    3.0   30.395   181.600   20.8500   10.0500 0          0
    3399     2.48333   1.900    3.0   28.015   168.929   24.3245   10.6178 0          0
    611      2.36667   2.700    2.5   30.535   194.500   23.6000    9.4500   0        0
    4390     2.60000   2.000    3.0   28.290   186.857   22.3687   10.9321 0          0
    41       2.71667   3.300    3.0   26.615   221.750   23.8500   10.0500 0          0
    2264     2.75000   3.150    2.5   28.740   191.444   22.6879    9.3468   0        0
    4589     2.06667   1.550    2.5   31.810   191.798   21.4540    9.4948   0        0
    3311     2.45000   3.250    2.5   26.550   265.476   26.0702   11.5453 0          0
    11       2.41667   1.350    2.5   29.605   229.750   22.9500   10.1000 0          0
    292      2.22667   6.100    2.5   30.155   255.850   24.3500   11.0000 0          0
    24       2.41000   2.730    3.5   28.630   223.350   24.1000   10.5500 .        .
    4131     3.26667   4.900    2.5   27.140   230.962   23.1849   10.4113 0          0
    4077     2.78333   5.950    2.5   28.305   263.951   23.0024   10.7460 0          0
    1378     3.83333   3.525    2.5   29.340   157.100   20.4000    9.6000   0        0
    4793     3.51667   3.575    3.0   28.920   172.462   18.9553    8.7582   0        0
    823      2.33333   2.225    2.5   31.400   258.150   20.4000    9.9500   0        0
    188      2.49667   5.375    3.5   26.780   262.500   23.8000   11.6000 0          0
    290      2.10000   2.950    2.5   35.055   197.000   18.6000    9.2500   0        0
  1706       2.60000   2.725    3.0   29.955   218.100   21.6500    9.8500   0        0
   2154      2.76667   3.400    2.5   29.005   215.600   25.5500   10.9000 .        .
    2182     2.49667   2.225    3.0   29.770   217.306   23.9844   10.3465 .        .
    315      3.52000   4.175    3.0   26.940   204.450   26.0500   10.6500 0          0
    1255     4.41667   3.825    3.5   26.260   183.900   19.7000    9.1000   0        0
    118      2.90000   2.575    3.5   28.680   253.100   21.4500   10.2000 0          0
    1189     3.05000   3.300    3.0   33.790   202.600   19.6000   10.0000 .        .
    651      3.58333   4.050    3.5   27.605   228.450   24.3000   10.9500 0          0
    224      4.10000   5.925    2.5   28.120   172.200   28.3500   12.0500 0          0
    463      5.42500   3.750    3.0   26.980   202.900   18.0000    8.9000   0        0
    3356     3.08333   4.600    3.0   28.510   315.019   33.4426   12.4911 0          0
    1363     5.96667   4.325    3.5   28.525   174.400   19.5500    9.7500   0        0
    506      9.35000   3.025    3.5   26.265   274.350   22.6000   10.0000 0          0
    100      1.61000   3.125    2.0   27.430   311.200   31.3000   13.3000 0          0
    1583     1.50000   3.300    2.0   25.050   344.700   37.6000   14.0000 0          0
    3477     1.70000   2.750    2.0   29.820   241.423   30.6002   11.9748 0          0
    2188     1.37333   3.025    2.5   29.900   305.565   29.0858   11.2527 0          0
    30       2.03333   5.950    3.0   28.070   250.600   30.2500   11.5000 0          0
    3373     2.10000   2.150    2.5   25.200   210.080   35.0263   12.9995 0          0
    346      1.96333   1.850    2.5   38.740   254.300   27.3500   12.8500 0          0
   39     1.64667   4.750   3.5   31.820   287.450   26.2500   11.1500    0     0
   382    1.85667   2.875   2.0   31.510   271.600   26.5000   10.6000    0     0
  42      1.60000   2.720   3.0   31.665   209.400   24.8500   11.4500    0     0
  760     1.96667   5.375   2.0   32.090   237.100   24.2000   11.0000    0     0
  4395    1.88333   4.000   2.5   32.925   218.405   22.0511   10.5709    0     0
  1852    1.65000   3.100   3.0   30.955   213.900   25.8500   11.0500    0     0
  23      1.28333   2.600   2.5   32.830   259.500   23.4500    9.9500   0    0
  862     1.48333   3.675   2.0   29.640   305.600   23.5000   11.4000   0    0
  355     1.50000   3.675   3.0   29.640   217.000   22.9000   10.4000   0    0
  929     1.23333   3.300   2.0   33.000   184.100   27.1000   11.9000   0    0
  3371    1.71667   2.050   2.0   30.420   235.278   24.1915    9.9746   0    0
  4636    1.35000   0.600   3.5   30.420   243.500   22.1000    9.4000   0    0
  571     1.33667   3.550   2.0   32.750   200.600   21.8000   11.0000   0    0
  2124    1.45000   3.150   2.0   30.030   243.500   24.2500   10.4000   0    0
  286     1.89000   6.950   2.5   30.135   209.050   22.3000   10.0000   0    0
  643     1.41000   1.850   3.0   30.000   239.050   20.6500   10.3500   0    0
  643     1.41000   1.850   3.0   30.000   239.050   20.6500   10.3500   0    0
 4388     1.28333   1.325   2.5   33.470   205.600   21.0000   10.1000   0    0
01048.1   2.72700       .     .   28.300   256.030   12.8000    6.0000    .   .
                                                   Appendix 2
                  Twenty-Six new SSR markers developed at CIP-HQ in 2005



   SSR_    Researcher Forward Primer            Reverse Primer             SSR Motif                       Ta (ºC)      Range Size
   Name

 J175       J.Solis   atctatgaaatccatcactctcg   Actcaattgtaagccaaccctc     aatcaatcaatcaatc                 57.6         120-132
 J530       J.Solis   tctccaacgccaagttcgtctct   attcatcccctcctttcttcagca   cggcggcggcagcggcggcg              50          148-149
  J27       J.Solis   tctagaggggaaagtgcttcct    agtgcaaaacaaagccccaagg     cctacctacctacctacctac             50          212-243
 J522A      J.Solis   acccgcatagacactcacct      Tgaccgaagtgtatctagtgg      caccaccaccaccaccaccacca           57      211(212)-229(230)
 J10A       J.Solis   tcaaccactttcattcactcc     Gtaattccaccttgcgaagc       aagaagaagaagaagaagaa             58.5         176-206
  J67       J.Solis   cacccatttgatcatctcaacc    Ggctctgagcttccattgttag     gaagaagaagaagaa                   58        178(179)-212
 J162E      J.Solis   ataaagtagcggagagcgtgaaa   gagaaatcatagcatacggagtaa actactactactactactact              56.5            ND
 J315E      J.Solis   taggtgtgtttatgggagatt     Gggacttgactttcattattac     tcagatcagatcagatcaga             56.5            ND
J1809E      J.Solis   Cttctcttgctcgcctgttc      Gatagtcggaggcatctcca       cctcctcctcctcctcctcc             60.8         129-146
 J116A      J.Solis   tcttttgcatcaaagaaatcca    Cctcagcttctgggaaacag       cctcctcctcctcctcctcc            57-58         188-212
 J130       J.Solis   ccagttgtggcggagaaag       Ggattcttgtgagggacaaca      gaagaagaagaagaagaagaagaaga       60.7         151-161
 J664E      J.Solis   cacatgccatggacgctccaa     Gattcttctccttccagctcct     cttcttcttcttcttcttc             55 - 57       203-207
 J104       J.Solis   caaggttgacgtttgcggtg      Gctcatccttcttctcttgtg      cctcctcctcctcctcctcc              55             ND
  J263      J.Solis   Ctctgcttctcctgctgctt      Gtgcggcacttgtctttgata      aacaacaacaacaac                   55          161-189
 J544b      J.Solis   agcagttgaggaaagcaagg      Caggatttacagccccagaa       tcttcttcttcttcttc                 62          147-196
 J206A      J.Solis   atcagggagagaggacagtaa     taggcaaaccataaacagaga      gatgatgatgatgatgat                59            ND
 J462E      J.Solis   ttctgaaaatttgtcctcgctg    Tggggaacagagggatagaa       tggtggtggtggtggtg                 62            ND
  J273      J.Solis   gaggttggtgctgagatgga      cgggtagacattacacaaacac     ctactactactacta                   57          165-179
IBCIP-1    O. Yañez   cccacccttcattccattact     gaacaacaacaaaaggtagagcag                  (acc)7a            63          140-153
IBCIP-2    O. Yañez   gtaacctgtcagccatctgt      Cctagtgggtatttgcagag                     (acc)2+6            63          268-290
IBCIP-5    O. Yañez   Cctcaacgaatttgacctc       Gatgacggtgtgtctgaag                        (acc)6            65          114-142
IBCIP-7    O. Yañez   ggtttgaccgtggagttgtt      Ggacgaactttcccaaatca        (cca)2+3+(ccg)2+1+3(cca)3+(c     48          260-338
                                                                                             g)4
 IBCIP-8   O. Yañez   ataaccccacccttcattcc      tggagagataaccctagcagtct                    (acc)7            48          206-323
 IBCIP-9   O. Yañez   agactgctagggttatctctcca   Gacattgccaaggacactga                  (cca)2ac(acc)6         48          177-200
IBCIP-12   O. Yañez   cgtaaagcaaaagcgaggac      Gacgggaatttggaaggaag                   (ctt)3ct(ctt)ct       63          307-310
IBCIP-13   O. Yañez   cgtgcttgaggtctgagtagaa    Ttccctagaagctgcgtgat         (acc)3+(cgg)2+(tgc)3+(gtc)2     53          338-380

				
DOCUMENT INFO
Shared By:
Categories:
Stats:
views:46
posted:3/23/2010
language:English
pages:17