chapel hill biology pacing guide

W
Shared by: fjhuangjun
Categories
Tags
-
Stats
views:
320
posted:
3/15/2010
language:
English
pages:
158
Document Sample
scope of work template
							                                     COURSE: Biology

I.      Grade Level/Unit Number:         9 - 12   Unit 1

II:     Unit Title:   Life on a Cellular Level

III.    Unit Length: 3 weeks (on a 90 min per day block schedule)

IV.     Major Learning Outcomes:

        The student will gain an understanding of
         role of inquiry in investigating cells
         basic macromolecules found in living things, the structures of those molecules and
           their function in living systems.
         the function of those macromolecules within the context of cell structure
         the functions of various cell organelles
         the maintenance of homeostasis within a cell
         the replication of DNA in order to prepare for cell division
         sexual and asexual reproduction at the cellular level
         how DNA directs the production of proteins within a cell
         the effects of mutations on protein production
         the relationship of gene regulation, cell specialization, and cell communication


V.      Content Objectives Included (with RBT Tags):

 Objective     Objective                                                                         RBT
 Number                                                                                          Tag
 Goal 1        Learner will develop abilities necessary to do and understand scientific
               inquiry. Goal 1 addresses scientific investigation. These objectives are an
               integral part of each of the other goals. Students must be given the
               opportunity to design and conduct their own investigations in a safe
               laboratory. The students should use questions and models to formulate the
               relationship identified in their investigations and then report and share those
               findings with others.
 1.01          Identify biological problems and questions that can be answered through           B1
               scientific investigations.
 1.02          Design and conduct scientific investigations to answer biological questions.      B6
                 Create testable hypotheses.
                 Identify variables.
                 Use a control or comparison group when appropriate.
                 Select and use appropriate measurement tools.
                 Collect and record data.
                 Organize data into charts and graphs.
                 Analyze and interpret data.
                 Communicate findings
 1.03          Formulate and revise scientific explanations and models of biological             B6
               phenomena using logic and evidence to:
                Explain observations.
                Make inferences and predictions.


Biology- Unit 1                                                                                  1
                 Explain the relationship between evidence and explanation.

 1.04        Apply safety procedures in the laboratory and in field studies:                C3
              Recognize and avoid potential hazards.
              Safely manipulate materials and equipment needed for scientific
                  investigations.
 1.05        Analyze reports of scientific investigations from an informed scientifically   B4
             literate viewpoint including considerations of:
                   Appropriate sample.
                   Adequacy of experimental controls.
                   Replication of findings. Alternative interpretations of the data.
 2.01        Compare and contrast the structure and functions of the following organic      B2
             molecules:
                   Carbohydrates.
                   Proteins.
                   Lipids.
                   Nucleic Acids.
 2.02        Investigate and describe the structure and function of cells including:        B4
                   Cell organelles.                                                        C3
                   Cell specialization
                   Communication among cells within an organism.
 3.01        Analyze the molecular basis of heredity including:                             B4
                   DNA Replication
                   Protein Synthesis
                  (transcription and translation)
                   Gene Regulation
 3.02        Compare and contrast the characteristics of asexual and sexual reproduction    B2


VI.   English Language Development Objectives (ELD) Included: NC English
Language Proficiency (ELP) Standard 4 (2008) for Limited English Proficiency
Students (LEP)- English Language learners communicate information, ideas, and
concepts necessary for academic success in the content area of science.

Suggestions for modified instruction and scaffolding for LEP students and/or students
who need additional support are embedded in the unit plan and/or are added at the end
of the corresponding section of the lessons. The amount of scaffolding needed will
depend on the level of English proficiency of each LEP student. Therefore, novice level
students will need more support with the language needed to understand and
demonstrate the acquisition of concepts than intermediate or advanced students.




Biology- Unit 1                                                                             2
VII.   Materials/Equipment Needed:

Activity                        Materials
Yum! Liquid Lunch: A Study of   Albumin
Nutrients                       Starch solution
                                Vegetable oil
                                Food Solution A
                                Food Solution
                                Glucose Solution
                                Test tubes
                                Test tube rack
                                Testing solutions – Benedicts, Biurets, Iodine,
                                Sudan III

 Yum! Liquid Lunch: A          Test tubes
Study of nutrients              Test tube rack
                                Benedict’s (for simple sugars)
                                Biuret’s (for proteins)
                                Lugol’s Iodine (for starch)

                                Sudan III (for lipids)
                                Glucose solution
                                Albumin
                                HCl
                                Pepsin
                                Starch solution
                                Vegetable oil

Sort the Groceries (LEP        Intact packages of grocery items and household
Alternative)                    products
Molecule Madness Webquest       Computer with Internet access (Suggestion: 1
                                computer per 2 students)
Organic Molecules Concept       Blank paper- variety of sizes
Map                             Post-it Notes
                                Markers

 Organic Molecules Concept     Index Cards
Map (CONCEPT MAP for            Markers
Biomolecules)

Energy in a Nut                 Celsius thermometer
                                Metal can with holes
                                Paper clip
                                Balance
                                Ring stand and ring
                                Stirring rod
                                Walnut chunk
                                Almond chunk
                                Mini marshmallow
                                Matches



Biology- Unit 1                                                                   3
Introduction to Microscope      Microscope
                                Letter “e”
                                Microscope slides
                                Cover slips
                                Water
                                Thread (different colors)

 Introduction to Microscope    Microscope
                                Letter “e”
                                Microscope slides
                                Cover slips
                                Water
Investigating Cells             Various types of cells:
                                     cork
                                     onion
                                     Elodea
                                     potato
                                     cheek
                                     yeast
                                     stomata
                                Dropper bottles of:
                                     water
                                     salt water
                                     iodine solution
                                     methylene blue solution
                                Toothpicks
                                Lens paper
                                Slides
                                Cover slips
                                Microscope
 Investigating Cells           Drawing paper
                                Pencils
                                Markers
Cell Foldable                   1 piece of construction paper (preferably a light
                                color)
                                Scissors
                                Pictures/diagrams
Cell Simile Project- (Cells R   Poster board (Bulletin board paper is an
Us! Cell Simile () Project)    alternative.)
                                Markers
                                Pens
                                Pencils
Cell Storybook                  Paper (notebook or typing)
                                Pens
                                Markers
                                Materials for cover (variety of sturdy paper
                                products)

Cell Storybook                 Paper (notebook or typing)
                                Pens
                                Markers



Biology- Unit 1                                                                     4
                                 Materials for cover (variety of sturdy paper
                                 products)

Cell Size and Diffusion- (Cell   Knox Gelatin blocks containing
Size: Surface to Volume          phenolphthalein
Ratios)                          Plastic spoon
                                 Metric ruler
                                 Paper towels
                                 Plastic knife
                                 small bowl
                                 0.1% sodium hydroxide (NaOH)
                                 Latex gloves

Cell Cycle Inquiry Lab           microscope
                                 onion root tip slides
                                 five note cards
                                 pencil

Mitosis in Motion Flipbook       3 x 5 cards – 16 per student
                                 Templates: available at this website:
                                 http://sciencespot.net/Media/mitosisbook.pdf
                                 Colored pens or pencils
                                 Stapler

Comparison of Mitosis &          Scissors
Meiosis                          Piece of string (6 feet in length)

Online Review of Mitosis &       Computer with Internet access (Suggestion: 1
Meiosis                          computer per 2 students)




Biology- Unit 1                                                                 5
                               1 heavy duty zip-lock baggie
Strawberry DNA Extraction      1 strawberry (fresh or frozen and thawed)
                               cheesecloth
                               funnel
                               100 ml beaker
                               test tube
                               stirrer
                               shampoo without conditioner or liquid
                               dishwashing detergent
                               NaCl
                               Distilled water
                               95% ethanol or 95% isopropyl alcohol

                               Small cup
Collect Your Own DNA!          6% salt solution
(Alternate to Strawberry DNA   Test tube
Extraction)                    10% soap solution
                               Alcohol

                               Two 5 oz. Plastic cups
DNA in My Food- Banana         Blender
(Alternate to Strawberry DNA   Plastic spoon
Extraction)                    #2 Cone coffee filters
                               Distilled water
                               Clear-colored shampoo
                               3 bananas
                               Table salt (either iodized or non-iodized)
                               One plastic transfer pipette or medicine
                               dropper
                               One test tube with stopper
                               95% ethanol

                               Modeling materials- teacher/student choice
DNA Model Building             (clay, play dough, jelly beans, toothpicks, pipe
                               cleaners, cotton balls, etc.)

                               Computer with Internet access (Suggestion: 1
Cracking the DNA Code          computer per 2 students)

                               Computer with Internet access (Suggestion: 1
DNA Web Quest                  computer per 2 students)

                               Paper for drawing
Alien Encounters               Pencils
                               Colored pencils
                               Markers

Alien Encounters              Paper
                               Pencils

Cell Specialization and Gene   Computer with Internet access (Suggestion: 1
Regulation Web Quest- (Cell    computer per 2 students)


Biology- Unit 1                                                                   6
Specialization and Control of
Gene Expression Webquest)
Summary Foldable                  1 piece of construction paper (preferably a light
                                  color)
                                  Scissors



   VIII.    Detailed Content Description:

Please see the detailed content description for each objective in the biology support document.
The link to this downloadable document is in the Biology Standard Course of Study at:

http://www.ncpublicschools.org/curriculum/science/scos/2004/23biology

   IX.      Unit Notes

This unit is focused on the cell as the basic component of structure and function in living things.
In particular, this unit is focused on basic biochemistry and cell processes. Students will learn
about cells and many of the molecules that are involved in cell function. Specifically, students
will gain an understanding of:

        basic macromolecules found in living things, the structures of those molecules and their
         function in living systems.
        the function of those macromolecules within the context of cell structure
        the functions of various cell organelles
        the maintenance of homeostasis within a cell
        the replication of DNA in order to prepare for cell division
        sexual and asexual reproduction at the cellular level
        how DNA directs the production of proteins within a cell
        the effects of mutations on protein production
        the relationship of gene regulation, cell specialization, and cell communication

In each unit, Goal 1 objectives which relate to the process of scientific investigation are
included. In each of the units, students will be practicing the processes of science: observing,
hypothesizing, collecting data, analyzing, and concluding.

The unit guide gives an overview of the activities that are suggested to meet the Standard
Course of Study Goals for Unit One. The guide includes activities, teacher notes on how to
weave the activities into the content, and supplementary notes related to other issues such as
preparation time and time to complete the activity. If a teacher follows this unit (s)he will have
addressed the goals and objectives of the SCOS. However, teachers may want to substitute
other activities that teach the same concept.

Teachers should also refer to the support document for Biology at
http://www.ncpublicschools.org/curriculum/science/scos/2004/23biology for the detailed content
description for each objective to be sure they are emphasizing the specified concepts for each
objective.

Essential Questions for Unit One:
Following are the essential questions for this unit. Essential questions are those questions that
lead to enduring understanding. These are the questions that students should be able to


Biology- Unit 1                                                                                    7
answer at some level years after the course. These questions are designed to incorporate
multiple concepts. Students will work on answering these questions throughout the unit.
Teachers are advised to put these questions up in a prominent place in the classroom and refer
to them during the teaching of the unit.

   1) What is the role and importance of organic molecules to cells?
   2) How do cells function as the smallest unit of life?
   3) How do cells specialize and communicate in order to promote the functioning of an
      organism?

Modified Activities for LEP Students:
Those activities marked with a  have a modified version or notes designed to assist teachers
in supporting students who are English language learners. Teachers should also consult the
Department of Public Instruction website for English as a Second Language at:
http://www.ncpublicschools.org/curriculum/esl/ to find additional resources.


Computer Based Activities
Several of the recommended activities are computer based and require students to visit various
internet sites and view animations of various biological processes. These animations require
various players and plug-ins which may or may not already be installed on your computers.
Additionally some districts have firewalls that block downloading these types of files. Before
assigning these activities to students it is essential for the teacher to try them on the computers
that the students will use and to consult with the technology or media specialist if there are
issues. These animations also have sound. Teachers may wish to provide headphones if
possible.


   X.      Global Content: Aligned with 21st Skills

One of the goals of the unit plans is to provide strategies that will enable educators to develop
the 21st Century skills for their students. As much as students need to master the NCSOS goals
and objectives, they need to master the skills that develop problem solving strategies, as well as
the creativity and innovative thinking skills that have become critical in today’s increasingly
interconnected workforce and society. The Partnership for 21st Century Skills website is
provided below for more information about the skills and resources related to the 21st Century
classroom.

http://www.21stcenturyskills.org/index.php?option=com_content&task=view&id=27&Itemid=120

NC SCS Biology                21st Century Skills                           Activity
                             Communication Skills
 1.01, 1.02, 2.01,    Conveying thought or opinions           Cell Simile
    2.02, 2.04        effectively                             Organic Molecules Concept Map
                                                              Reproduction at a Glance
                                                              Strawberry DNA
                      When presenting information,            Reproduction at a Glance
                      distinguishing between relevant and
                      irrelevant information
                      Explaining a concept to others          Cell Simile
                                                              Cell Storybook


Biology- Unit 1                                                                                   8
                  Interviewing others or being
                  interviewed
                          Computer Knowledge
                  Using word-processing and
                  database programs
                  Developing visual aides for
                  presentations
                  Using a computer for
                  communication
                  Learning new software programs
                           Employability Skills
                  Assuming responsibility for own        Cell Storybook
                  learning
                  Persisting until job is completed
                  Working independently                  Cell Storybook
                  Developing career interest/goals
                  Responding to criticism or questions
                       Information-retrieval Skills
                  Searching for information via the      Cell specialization and control of
                  computer                               gene expression
                                                         Mitosis and Meiosis Online Review
                                                         Activity
                                                         Molecule Madness
                  Searching for print information
                  Searching for information using
                  community members
                      Language Skills - Reading
                  Following written directions           Most of the activities can be
                                                         presented as opportunities for
                                                         students to follow written directions.
                                                         The teacher will have to work with
                                                         most students to develop this skill
                                                         over time. The following activities
                                                         are well suited to developing skills
                                                         in following directions:
                                                               Alien Encounters
                                                               Collect Your Own DNA
                                                               DNA In My Food – Banana
                                                               Introduction to the
                                                                  Microscope
                                                               Onion Root Tip Mitosis
                  Identifying cause and effect           DNA Web Quest
                  relationships
                  Summarizing main points after          Cell Specialization and Control of
                  reading                                Gene Expression
                                                         Cracking the DNA Code
                                                         Molecule Madness
                  Locating and choosing appropriate
                  reference materials
                  Reading for personal learning
                        Language Skill - Writing



Biology- Unit 1                                                                               9
                  Using language accurately            Cell Cycle Inquiry Lab
                                                       Cell Storybook
                                                       Investigating Cells
                                                       Reproduction at a Glance
                  Organizing and relating ideas when   Alien Encounters
                  writing                              Cell Storybook
                                                       Comparison of Mitosis and Meiosis
                                                       Strawberry DNA
                  Proofing and Editing                 Cell Storybook
                  Synthesizing information from        Cell Storybook
                  several sources                      Mitosis and Meiosis Online Review
                                                       Activity
                  Documenting sources
                  Developing an outline
                  Writing to persuade or justify a     Strawberry DNA
                  position
                  Creating memos, letters, other
                  forms of correspondence
                                Teamwork
                  Taking initiative
                  Working on a team                    Most of the activities are designed
                                                       to be done and discussed in teams.
                                                       The following activities are well
                                                       suited to developing team
                                                       interdependence skills:
                                                       Organic Molecules Concept Map
                                                       Sell That Organelle
                   Thinking/Problem-Solving Skills
                  Identifying key problems or
                  questions
                  Evaluating results                   Cell Growth Activity
                                                       Energy in a Nut
                                                       Mutation Lab
                  Developing strategies to address     DNA Model Building
                  problems
                  Developing an action plan or
                  timeline




Biology- Unit 1                                                                        10
ENGAGE: (20 min.)

What nutrients are found in foods? How do you know? How do we test for them? Think, Pair,
Share activity – ask students to think about everything they ate the previous day, what nutrients
were present in those foods, how do they know? Introduce liquid lunch lab as simple nutrient
testing. Have them think and share their ideas with a partner. Have brief class discussion on
how we know what is in foods. In addition to serving as an engage activity this allows the
teacher to assess previous knowledge.

  LEP Modification:     Write students’ input/comments on chart paper so that you may refer to it
  and add to it as you teach the unit.




EXPLORE:
This activity (Yum! Liquid Lunch: A Study of Nutrients) is intended to allow students to
explore organic molecules with a concrete experience. Students will test different mixtures for
the presence of glucose, starch, lipid, and protein.

Guiding Question: What are the nutrients that are found in various foods and how do we test
for them?

Before the activity: The teacher should prepare students for the basic procedures of the activity
such as how to do the nutrient tests and safety rules, but should avoid giving too much content
information during the explore phase. Students will research content later.

Activity Time: One 60 minute period. This will include class discussion.

Preparation Time: The time will vary; the teacher needs to prepare a class set of testing
solutions and unknowns. This could take about 2 hours; however, once the testing solutions
have been made they will be ready for the next year and the preparation time will be much less.
Note: the amounts of materials in each test tube can be varied.

Safety: Be aware of students who may have allergies to the foods used (although they should
not be drinking the liquid lunches).

Consult MSDS for safety issues surrounding testing solutions.

Make sure students use goggles.


 Language Objectives:          Students will:
        read laboratory procedures
        fill in a chart to show whether or not reactions indicate a positive result.


Focus Objectives 2.01, 1.02



Biology- Unit 1                                                                                   11
                    Yum! Liquid Lunch: A Study of Nutrients
Materials:
Test tubes
Test tube rack
Testing solutions – Benedicts, Biurets,
                    Iodine, Sudan III
Glucose solution
Albumin
Starch solution
Vegetable oil
Food Solution A
Food Solution B




Biology- Unit 1                                               12
WEAR GOGGLES
Simple sugars test: Set up 4 test tubes as shown in the chart. Add 10 drops Benedict’s Solution
to each tube. Place tubes in boiling water bath. Leave for a few minutes and note color change.
If solution turns olive green to yellow to orange to brick red, there are simple sugars present.

Test Tube                   Benedicts solution        Results
1 – 2 ml water              10 drops



2 – 2 ml glucose solution   10 drops



3 – 2 ml food solution A    10 drops



4 – 2 ml food solution B    10 drops




Protein Test: Set up 4 test tubes with the solutions as shown in the chart. Add 5 drops of
Biuret’s Solution to each one. Observe color change and record. A violet color indicates the
presence of proteins.

Test Tube                   Biurets solution          Results
1 – 2 ml water              5 drops



2 – 2 ml albumin solution   5 drops



3 – 2 ml Food solution A    5 drops



4 – 2 ml Food solution B    5 drops



Starch test: Set up 4 test tubes with the solutions as shown in the chart. Add 2 drops of Iodine
solution to each tube. Observe color change and record.

Test Tube                   Iodine solution           Results
1 – 2 ml water              2 drops



2 – 2 ml starch solution    2 drops



Biology- Unit 1                                                                                13
3 – 2 ml food solution A    2 drops



4 – 2 ml food solution B    2 drops




Fats Test: Set up 4 test tubes as shown in the chart. Add 5 drops of Sudan III solution.
Observe color change and record.
Test Tube                 Sudan III solution          Results
1 – 5 ml water              5 drops



2 – 5 ml oil                5 drops



3 – 5 ml food solution A    5 drops



4 – 5 ml food solution B    5 drops



NOTE:
Benedict's solution is used to test for simple sugars. It is a clear turquoise blue solution that
changes color in the presence of simple sugars and after heating. The blue solution changes to olive
green, then to yellow, and then to brick-red, depending on the amount of sugar.

Iodine solution is used to identify the presence of starch. The solution is brownish-yellow, but
produces a blue-black precipitate when it reacts with starch.

Biuret solution is used to identify the presence of protein. Biuret solution is deep blue initially and
when it reacts with protein, it changes color to violet (pinkish-purple).

Sudan III is used to identify the presence of lipids in liquids. It stains fats red.

Teacher:
Starch test:
Starch solution: Mix 1 gram soluble starch with 200 ml water
Undiluted Lugol’s iodine

Protein test:
Powdered albumin or egg whites 1 part albumin to 5 parts water
Biuret’s solution


Biology- Unit 1                                                                                     14
Sugar Test:

Glucose solution: mix 3 grams glucose or dextrose in 200 ml water
Benedict’s solution

Fats Test:
Oil: Any oil will do; you could use lard and have students put the drops of Sudan III directly on the
lard
Sudan III solution



Mixing the meal

Break the meal into small pieces and then put into a blender. Mix very well with blender.
Filter the mixture through a few layers of cheesecloth or a coffee filter into a beaker.

You can use any “meal” you wish. Try to choose a meal that will have all the nutrients.

Fast food meals (hamburger, fries)
Cafeteria meals (pizza)
Deli sandwich meal

You can do two meals (data chart is set up for this) or just one if time is a problem.



               Yum! Liquid Lunch: A Study of Nutrients- LEP

Key Vocaculary:
Starch                  lipids                   carbohydrates
Benedict’s solution     Biuret’s solution        Lugol’s solution
Iodine                  albumin                  pepsin
Oil                     Sudan III

Pre-Lab Questions:
Circle the correct answer in each set of parentheses)
    1. (Starch / Oil) is a carbohydrate.
    2. (Albumin / Glucose) is a protein.
    3. (Oil / Pepsin) is a lipid.
    4. (Biuret’s / Lugol’s) is deep blue to start.
    5. (Iodine / Lugol’s) is yellow-orange.
    6. Sudan III tests for (fats / proteins)
    7. (Lugol’s / Benedict’s) is clear, light blue to start.


Materials:



Biology- Unit 1                                                                                   15
Test tubes
Test tube rack
Benedict’s (for simple sugars)
Biuret’s (for proteins)
Lugol’s Iodine (for starch)
Sudan III (for lipids)
Glucose solution
Albumin
HCl
Pepsin
Starch solution
Vegetable oil




Biology- Unit 1                  16
WEAR GOGGLES!!!!!

Simple sugars test: Set up 4 test tubes as shown in the chart. Add 10 drops Benedict’s Solution
to each tube. Place tubes in boiling water bath. Leave for 5 minutes and record color change.
If solution turns olive green to yellow to orange to brick red, there are simple sugars present.

Test Tube                   Benedicts solution       Color Change
1 – 2 ml water              10 drops



2 – 2 ml glucose solution   10 drops



3 – 2 ml food solution A    10 drops



4 – 2 ml food solution B    10 drops




Protein Test: Set up 4 test tubes with the solutions as shown in the chart. Add 5 drops of
Biuret’s Solution to each one. Observe color change and record. A purple color indicates the
presence of proteins.

Test Tube                   Biurets solution         Color Change
1 – 2 ml water              5 drops



2 – 2 ml albumin solution   5 drops



3 – 2 ml Food solution A    5 drops



4 – 2 ml Food solution B    5 drops



Starch test: Set up 4 test tubes with the solutions as shown in the chart. Add 1-5 drops of
Iodine solution to each tube. Observe color change and record.

Test Tube                   Iodine solution          Color Change
1 – 2 ml water              5 drops



2 – 2 ml starch solution    5 drops



Biology- Unit 1                           DRAFT                                                106
3 – 2 ml food solution A    5 drops



4 – 2 ml food solution B    5 drops




Fats Test: Set up 4 test tubes as shown in the chart. Add 5 drops of Sudan III solution.
Observe color change and record.
Test Tube                 Sudan III solution          Results
1 – 5 ml water              5 drops



2 – 5 ml oil                5 drops



3 – 5 ml food solution A    5 drops



4 – 5 ml food solution B    5 drops



NOTE:
Benedict's solution is used to test for simple sugars. It is a clear turquoise blue solution that
changes color in the presence of simple sugars and after heating. The blue solution changes to olive
green, then to yellow, and then to brick-red, depending on the amount of sugar.

Lugol's iodine solution is used to identify the presence of starch. The solution is brownish-yellow,
but produces a blue-black precipitate when it reacts with starch.

Biuret solution is used to identify the presence of protein. Biuret solution is deep blue initially and
when it reacts with protein, it changes color to violet (pinkish-purple).

Sudan III is used to identify the presence of lipids in liquids. It stains fats red.



Teacher Prep:
Starch test:
Starch solution: Mix 1 gram soluble starch with 200 ml water
Undiluted Lugol’s iodine

Protein test:
Powdered albumin or egg whites 1 part albumin to 5 parts water
Biuret’s solution

Sugar Test:

Biology- Unit 1                            DRAFT                                                   107
Glucose solution: mix 3 grams glucose or dextrose in 200 ml water
Benedict’s solution

Fats Test:
Oil: Any oil will do; you could use lard and have students put the drops of Sudan III directly on the
lard
Sudan III solution



Mixing the meal
Break the meal into small pieces and then put into a blender. Mix very well with blender.
Filter the mixture through a few layers of cheesecloth or a coffee filter into a beaker.

You can use any “meal” you wish. Try to choose a meal that will have all the nutrients.

Fast food meals (hamburger, fries)
Cafeteria meals (pizza)
Deli sandwich meal

You can do two meals (data chart is set up for this) or just one if time is a problem.




Alternative:    Sort the Groceries-LEP

 Language Objectives:       Students will:
        read food labels and sort the items into proper categories
        orally explain why each item is placed into its corresponding category
        write examples of products that represent proteins, carbohydrates, lipids, and nucleic acids.




Alternative: If teachers do not have enough preparation time, Sort the Groceries
could be done instead. Students are given packages of various grocery items. They
will sort them into categories based on their contents. The categories are Lipids,
Carbohydrates, Proteins, and Nucleic Acids. For this activity teachers will need: empty
packages of various grocery items and signs to indicate the 4 categories.


                               Sort The Groceries- LEP

Teacher Notes:
You will need to collect empty, intact packages of grocery items and household
products. You may also use real objects. Refer to the list below for ideas. You
may have students bring them in and/or you may collect them on your own. A



Biology- Unit 1                           DRAFT                                                  108
children’s play food set (available at large discount stores) works well. You will
need a great variety and enough for every student to have at least one item.

Place signs at 4 locations around the classroom to indicate a place for lipids, nucleic
acids, proteins, and carbohydrates.

Have each student choose an item and put it into the appropriate category location.
Encourage students to read nutrition labels and make their decision based upon
which organic molecule makes up the majority of the product.

After all items are sorted, lead a discussion about whether or not each item is
correctly placed. Move any items that are misplaced.

Once all items are appropriately placed, have students divide a sheet of paper into
4 quadrants. Label each square with a category name. Students should go to each
of the categories and write down examples of actual items in each.

On the 4-square sheet have students take notes on each category.

Product Examples:

CARBOHYDRATES                           NUCLEIC ACIDS
chip bags                               DNA models
candy wrappers                          magazine pictures:
cereal boxes                                 red flowers vs. white flowers
paperback book (cellulose)                          people of different races
wooden ruler                                 DNA items from science catalogs

LIPIDS                                  PROTEINS
cooking oil                             dairy product packaging
motor oil                               play food meats
candles                                        nut cans
chap-stik                               RID-X for septic tanks (enzymes)
lotion
car wax
butter package
margarine packaging




Biology- Unit 1                    DRAFT                                             109
EXPLAIN:

After the activity: The teacher should lead students in discussing which of their
“lunches” had more lipid, protein, starch, or sugar. Then the teacher could ask “Which
lunch would be better in terms of nutrition and why?” All answers should be
considered. Again this is an explore activity so the teacher is not explaining the
answers at this point. Students will research these questions in the next activity.

ELABORATE:
The purpose of this web quest is to build on the nutrient testing experience of “Yum:
Liquid Lunch” by having students research the structures and functions of the
molecules. Students will go to websites to research the characteristics of the
macromolecules identified in Liquid Lunch as well as others such as nucleic acids.
Emphasis will be on structure (monomers and polymers) and on function.

Guiding Question: What is the structure and function of each of the essential nutrients?


Before the activity: The teacher should explain to students that they will be researching
the structure and function of the macromolecules that they tested for in the previous
activity. The teacher should also show how to access and navigate the website. The
teacher should be sure to go the website ahead of time to learn how it works.



Focus Objective 2:01

 Language Objectives:        Students will:
        listen to teacher discussion about information on websites
         read information and study diagrams/animations on websites
        summarize in writing and complete a chart
        answer questions in complete sentences.



Activity Time: one 90 minute period (LEP students will likely require more time
and substantial teacher support).

Preparation: Check the recommended websites to be sure they are all still active before
copying the handouts. Teachers may want to substitute other websites and or allow
students to use textbooks and additional reference materials.

Note: For this activity, students will need to have access to computers. This activity
would be excellent for pairs of students to work at one computer. Alternatively, the
teacher could use one computer and a projection device and have the whole class work
together. The teacher centered method works better with students that have a harder
time academically.


Biology- Unit 1                       DRAFT                                             110
             Molecule Madness Online Learning Activity
                      NAME_____________________


Go to the following websites to fill in the chart below and to answer the questions
below.
http://www.cst.cmich.edu/users/baile1re/bio101fall/atmolorga/molecu/moleprez/sld001.ht
m
http://www2.visalia.k12.ca.us/eldiamante/science/biology/powerpoints/biochem.pdf
http://faculty.dccc.edu/~rmarcus/Unit01/04BiologicalMolecules.pdf
http://www.bmhs-
la.org/academics/faculty/teachers/lwalle/files/Honors%20Biology/HonorsBioCh3.pdf
            (When you open the website above, change the view to 150%).

Type of     Elements    Monomers General           Function     Examples     Test
Molecule                         structure                                   for




Questions:
  1. Describe the relationship between a monomer and a polymer and give an
     example from one of the macromolecules in the chart.

Biology- Unit 1                    DRAFT                                            111
   2. Which macromolecule is not a polymer?

   3. What is the chemical process that links the monomers together?

   4. What is the chemical process that breaks monomers apart?

   5. What essential protein is involved in the breaking and linking of monomers?

   6. Describe the differences between a monosaccharide, a disaccharide, and a
      polysaccharide?

   7. Name three important polysaccharides. Describe their functions.

   8. What type of molecule is glucose?

   9. How many different amino acids are there?

   10. One of the most important roles of proteins is to function as enzymes.
       Generally, describe the function of enzymes.

   11. What does it mean to say that a protein functions by a “lock and key” model?

   12. What is the active site of a protein?

   13. What determines the shape of a protein?

   14. What type of molecule is insulin? What is the function of insulin?

   15. What type of molecule if hemoglobin?    What is the function of hemoglobin?



After the activity: The teacher should help the students summarize some basic ideas
giving students plenty of opportunities to use the vocabulary of organic molecules as
they discuss the questions. What monomers are the polymers composed of? What are
the primary functions of each type of macromolecule? How do mutations affect the
functioning of a protein? What is the importance of enzymes? Be sure to relate the
discussion back to Liquid Lunch and nutrients in food.

EVALUATE:


Biology- Unit 1                    DRAFT                                          112
In this activity (Organic Molecules concept map), students will work together in groups;
they can generate the words or be given a list of words to include in their concept maps.
This activity is intended to help them synthesize the information gathered in the web
search. It will build upon the discussion that they had at the end of their web quest.

Guiding Question: How do the macromolecules relate to each other?


Before the activity: Teachers should explain to students how to create concept maps.
These instructions are given in the activity. Teachers should also explain that concepts
maps are a good way for students to synthesize and build connections among ideas
which will help them remember better.
Preparation Time: 15 minutes to gather materials and set them out.

Notes: Concept maps can be done using software that is listed in the activity. But a
low tech alternative is to use post-it notes. Each post-it note will have one word.
Students can rearrange their post-it notes on a large piece of paper until they are
satisfied with the organization and then they can add the connecting words.

Sharing concept maps can be done by having students walk around the room to
observe each map and see if they understand it. Alternatively, students could formally
present their maps in front of the class. The advantage of sharing is that the concepts
are reinforced in different ways leading to better understanding and memory.


Organic Molecules concept map
Organic Molecules concept map-LEP

 Language Objectives:       Students will:
        create and be able to orally explain their concept maps
        concept maps may be used as a framework for writing paragraphs about each of the
         molecule types.

OR

 Organic Molecules Quadrant Notes-LEP
  Language Objectives:       Students will:
        participate in class discussion
        create notes for future reference
        Notes may be used as a framework for writing paragraphs about each of the molecules.
         types.
Focus Objective: 2.01

Activity Time: 45 minutes




Biology- Unit 1                      DRAFT                                              113
                        Organic Molecules Concept Map
Definition
A concept map is a written representation of the relationships among major concepts,
ideas, objects or activities. Concept maps consist of nodes and labeled lines. All
words/phrases that represent a concept are called nodes and are usually written within
a circle or some other shape. The labeled lines represent connections between the
nodes. The labels describe the relationship between the nodes and an arrow
represents the direction of that relationship. See example below.




Teacher Demonstration
If your students are familiar with concept mapping then this initial demonstration can be
skipped. If your students are not familiar with concept mapping they will need an
example to go by.

Model the creation of a concept map by choosing a topic that is a familiar concept to
your students (for example a sport (football), your class environment, a food (pizza) or
anything else your students can relate to). Make sure to choose a quick and simple
concept to demonstrate.

   1. First make a list of major concepts to include on the map that describe your topic.
   2. Next to each major concept, list more specific concepts to form a cluster of
       related ideas.
   3. Write the topic in the center of your working area, blackboard, overhead etc.,
       surrounded by a circle.
   4. Surround the topic with the words/phrases from your major concept list.
   5. Draw links connecting the major ideas to the topic.
   6. Write labels on the lines that describe how one concept links/relates to the topic.
   7. Add in the words/phrases from your specific concept list around the appropriate
       major concepts identified in your map.
   8. Draw links connecting the specific ideas to the major concepts.
   9. Write labels on the lines that describe how the specific concept links/ relates to
       the major concepts.
   10. Draw cross-links that relate concepts in one part of the map to concepts in
       another part of the map. Cross-links should have an arrowhead that indicates the
       intended direction of the relationship.
   11. Label these lines to describe the connections.

Explain that there are many correct ways to map the same set of concepts.

Activity

Biology- Unit 1                      DRAFT                                            114
Split the students into small groups.

Supply students with a large surface to prepare their map, such as poster board, bulletin
board paper, legal paper, etc. They will also need post-it notes and markers.

Each group generates a list of the most important concepts related to organic
compounds. Students can brainstorm this list or a list can be generated by the teacher
and given to the students. Next to each major concept, students should list more
specific concepts to form a cluster of related ideas.

Have students write Organic Compounds in the center of their working area surrounded
by a circle. Write all the major and specific concepts on separate post-it notes. This
allows the students to arrange and rearrange these concepts around the topic as they
work through their thinking as a team.

Students arrange the major concepts around the center item and the specific concepts
around the major concepts. Arrange the post-it notes so that related terms are close to
each other. As the map expands, the concepts tend to become more detailed and
specific.

Students should edit this first phase and think about the relation of the outside items to
the center item. Remove, rearrange, edit, and/or shorten words to key ideas.

Once they have decided on the arrangement of the concepts, they can draw the
connecting lines and label these lines to describe the connections.

Students can then share their maps with the rest of the class and explain their
reasoning behind the arrangement of the map. This map is a personal learning
document. It combines what the students know with what they are learning
and determines what they may need to know to complete their understanding of organic
compounds.
These maps can be kept, added to, and edited as student’s knowledge is strengthened
through instruction.

Evaluation
   1. Map should be neat and easy to read.
   2. Look for original work. Each team should have their own way of organizing the
      information.
   3. Concept lists should be appropriate to the topic. They should represent a good
      overview of the topic without showing extreme detail.
   4. Connections should show correct linkage and descriptions of the relationships.
   5. Map should possess cross-links that are rich in meaning using precise linking
      terms.

Sample Concept Maps




Biology- Unit 1                         DRAFT                                           115
This diagram created using Inspiration® by Inspiration Software®, Inc




http://www.graphic.org/similie.html

Resources
Computer tools for concept- or mind mapping
Inspiration Software, Inc. maker of Inspiration

Biology- Unit 1                      DRAFT                              116
Axon Idea Processor 5.0 by Chan Bok
CMap 2.0 for Macintosh fetch by gopher
Decision Explorer (formerly called Graphics COPE) by Banxia Software
SemNet Research Group maker of SemNet
MindMan by Micheal Jetter
CoCo Systems maker of VisiMap and InfoMap (Lite)
Activity Map by Time/system Int.
TextVision / TekstNet by Piet Kommers.
SMART Ideas by SMART Technologies
EGLE Magic (info by e-mail) maker of Mind Mapper [Mind Mapper fetch by ftp (approx.
300kb)]


                                CONCEPT MAP WRAP-UP
Make index cards for each of the following. Students should arrange them to form
a concept map showing the biomolecules, their functions, and examples.

Alternate: provide the following on different colored paper. Have students cut
out each item, arrange them into a concept map, and glue them down.

Colors listed in ( ) allow students to differentiate between categories, functions,
and examples.

ORGANIC MOLECULES                 (white)


NUCLEIC ACIDS      (yellow)
DNA (pink)
RNA (pink)
genetic information (blue)
determine traits (blue)
directions for making proteins      (blue)
made of nucleotides (blue)

CARBOHYDRATES        (yellow)
energy source for cells (blue)
names end in –ose (blue)
cellulose=cell walls of plants   (pink)
lactose=milk sugar (pink)
cereal (pink)
candy (pink)

Biology- Unit 1                           DRAFT                                   117
sucrose=table sugar (pink)
glucose=simple sugar from photosynthesis     (pink)


PROTEINS    (yellow)
structure (blue)
skin, hair, nails (pink)
made of amino acids (blue)
meat, fish, eggs (pink)
nuts (pink)
muscles (pink)
names end in –in (blue)
enzymes are 1 group (blue)
speed up chemical reactions     (blue)
names end in –ase (blue)

LIPIDS yellow
store energy (blue)
insulation (blue)
waterproof coverings   (blue)
oil (pink)
fat (pink)
wax (pink)

                                 Organic Molecules
                       LEP Alternative to Concept Map

Have students divide a sheet of paper into 4 quadrants.
Label each quadrant as follows: Lipids, Carbohydrates, Proteins, Nucleic Acids

Give students the following list. They should place each item in the correct
quadrant.
(Depending upon your students, you may need to edit the list)

sugars
important for structure
glucose
determine traits
DNA
made of amino acids
Hair, skin, nails
Biology- Unit 1                          DRAFT                                   118
glucose
cellulose
enzymes
RNA
used to make proteins
maltose
rice
lard
candles
important for insulation
waterproof coatings
starch-food storage for plants
glycogen-food storage for animals
important for long-term energy storage
main source of energy for cells

When complete, students should work with a partner to discuss/check their work.
Check to make sure all students have all items placed correctly.

EXPLAIN:
After the activity: The teachers should have students share their concept maps. The
teacher can ask questions to prompt filling in missing concepts and clarify additional
points.

ELABORATE:
At this point, students have been studying the structure and function of macro-
molecules. This activity (Energy in a Nut) will help them see the connection between
macromolecules and energy contained in the bonds of those molecules. Students will
use tin can calorimeters and paper clips to hold a walnut and/or a pecan. They will
ignite each nut and calculate the energy in terms of calories.

In addition, the teacher can use this opportunity to explain the difference between the
release of energy by burning (combustion) and the slow enzymatic release of energy in
cells. Both release carbon dioxide, a point that can be returned to later when discussing
the carbon cycle.

Guiding Question: What is the connection between nutrient molecules and energy?


Before the activity: The teacher should explain to students that they are going to learn
about macromolecules and energy. But the teacher should not give too much
information. More content can be developed after the activity.


Focus Objective 2.01
Biology- Unit 1                     DRAFT                                            119
Activity Time: One 60 minute period

Preparation: It will take about 1 hour to gather the materials and set up the lab
stations. The materials needed are listed in the activity. The teacher will have to get a
supply of walnuts, almonds, and mini-marshmallows. Often students are willing to bring
these materials, but you will have to ask for them a few days ahead of the lab. Also,
the teacher will have to collect the cans ahead of time and prepare them. Soup cans,
cans from vegetables or regular sized dog food cans are great. An awl can be used to
push holes in the two opposite sides close to the top. These will be used to hang the
can on the ring stand using large paperclip that go through the holes in the can and then
over the ring on the ring stand. The cans may be reused.

Safety: Be alert to any student allergies to the food products used. Make sure that
students follow good safety procedures in using matches. Teachers should monitor
this part of the lab very closely. Students should use goggles.

Notes: Here are the actual calories taken from: http://www.calorie-charts.net/

Almond:       5780 calories/gram
Walnut:      6540 calories/gram
Marshmallows: 3180 calories/gram

It is important to remember that a 1000 calories = 1 Calorie. The Calorie is what is used
in food charts


                                    Energy in a Nut

NAME________________________________

DATE_____________________PER________
PURPOSE:

In this lab, you will use a simple calorimeter to calculate the energy content of a walnut, an
almond and a mini-marshmallow. By measuring the increase in temperature of a can of
water, you will be able to determine the amount of heat given off by the tasty morsel. The
unit of heat energy you will use is the CALORIE. The CALORIE is: the amount of heat
energy required to raise the temperature of one gram of water one Celsius degree
(Co).

MATERIALS:
Celsius thermometer                 metal can with holes                 paper clip
Balance                             ring stand and ring                  stirring rod
Walnut chunk                        Almond chunk                         mini-marshmallow
Matches

HYPOTHESIS:
Which do you think will have more calories per gram – the walnut, the almond or the mini-
marshmallow? Give a reason for your hypothesis.

Biology- Unit 1                        DRAFT                                              120
PROCEDURE
1. Shape a paper clip so that it can hold a peanut about 2-3 cm above the base of your
ring stand.

2. Adjust the ring on the ring stand so that you can hold the can about 3-4 cm above the
top of the paper clip. You will hang your can from the ring stand with paper clips that are
looped into the holes on each side of the top of the can.

3. Weigh the paper clip and the empty can and record these masses to the nearest 0.1 g.

4. Fill the can about 1/3 full of water. Weigh the can again WITH the water. Record the
mass. Calculate the mass of the water alone.

5. Push the end of the paper clip into the food that you are going to burn. Use sort of a
drilling motion. Weigh the paper clip WITH the food bit and record the mass. Calculate
the mass of the food bit.

6. Measure the temperature of the water and record your result.

7. Place the mounted food bit under the water can. Ignite the food bit by holding a match
under it until it is able to burn on its own.

8. Stuff the water with a stirring rod until the flame goes out.

9. Record the final water temperature. Calculate the change in water temperature.



Table 1 – DATA for Determine the Energy Value of Two Nuts and a Mini-Marshmallow


            Walnut      Almond      Mini-                    Walnut   Almond      Mini-
                                    Mallow                                        Mallow
Mass of                                         Mass of
can +                                           Nut +
water                                           clip
Mass of                                         Mass of
can                                             clip

Mass of                                         Mass of
water                                           nut

Final
Water
Temp.
Initial
Water
Temp.
Change
in water
Temp.




Biology- Unit 1                        DRAFT                                             121
CALCULATIONS:
1. Calculate the number of calories in each of the food bits above.
               Mass of water (g) x temp. change of water (oC) = energy to heat water (g)

       Walnut:         ____________g x ________________ oC = _______________ calories

       Almond:         ____________g x ________________ oC = _______________ calories

       Marshmallow: ____________g x ________________ oC = _______________ calories

2. Next, calculate the amount of energy per gram of each food bit:

       Walnut:         energy/gram = energy to heat water      = calories =    _____ calories/gram
                                        Mass of nut               grams

       Almond:         energy/gram = energy to heat water      = calories =    _____ calories/gram
                                        Mass of nut               grams

       Marshmallow: energy/gram = energy to heat water         = calories =    _____ calories/gram
                                     Mass of nut                  grams

3. When the word “calories” is used in reference to food, it actually means kilocalories or Calorie
with a capital “C”. A kilocalorie is equal to 1,000 calories. Now, calculate the number of
kilocalories per gram of each of your food bits.


       Walnut:         energy/gram     ___________ cal/g ÷ 1000 cal = _______ kcal/gram
       Almond:         energy/gram     ___________ cal/g ÷ 1000 cal = _______ kcal/gram
       Marshmallow: energy/gram        ___________ cal/g ÷ 1000 cal = _______ kcal/gram

4. Do a little research and find the actual calories in a gram of each of your food bits.

       Walnut:    _______ cal/g       Almond: _______ cal/g          Marshmallow_______ cal/g

5. Calculate your “percent error” for each nut. The formula for percent error is:

               Observed value – expected value x 100 = % error
                     Expected value

       Note: your observed value is the one you determined in the lab and your expected value is
       the one we got from research.

       SHOW YOUR WORK:




Biology- Unit 1                           DRAFT                                                  122
       Walnut % error: _______      Almond % error: ________ Marshmallow% error: ________

DISCUSSION QUESTIONS:
1. Your calculations assumed that all of the heat produced by the burning of the nut was absorbed
by the water in the can. What is your evidence that this is not really true?




2. What else absorbed heat energy (besides the water)?




3. What evidence is there that the burning might have been incomplete?



4. If you had used a more efficient device, how would this have changed your calculated value for
energy per gram of food?



5. How do you account for any differences between your experimentally determined value and the
accepted value of calories in each of your food bits.



6. What was the ultimate SOURCE of energy for the nuts?



7. What form is the energy in each of the food items?




After the activity: The teacher will need to help students calculate percent error. The
percent errors will be huge because of the primitive nature of these calorimeters and the
large loss of energy to the atmosphere. Teachers should reinforce the idea that the
covalent bonds that hold macromolecules together release energy when they are
broken in digestion. In living organisms that energy is captured in ATP bonds (and
released as heat). In combustion the energy is light and heat and is released very
quickly.
.

EVALUATE:
At this point, students will go back to their concept maps and add the information about
energy. The will also make modifications if needed and present their modifications to
the class. (Learning by repetition)

Guiding Question: Where does energy fit into the concept map?

Biology- Unit 1                         DRAFT                                                 123
Before activity: The teacher should explain that students will be adding words such as
energy, covalent bonds, ATP, and heat to their concept maps.

Focus Objective: 2.01

Activity Time: 15 minutes

Preparation Time: The teacher may want to generate a list of new words for the
concept map.

Modify Concept Maps
 Organic Molecules Concept Map-LEP
 Language Objectives:     Students will:
       Construct a concept map representing the organic molecules and important related information
       Write a minimum of 1 paragraph summarizing what they have represented in their concept maps

  LEP Modification:     Have students use their concept maps as a framework for writing a narrative
  summary of what they have learned. You will need to model how to do this and it may be helpful to
  allow students to work in pairs.


After activity: The teacher will help students summarize what they have learned. The
teacher will refer to essential question #1. (What is the role and importance of organic
molecules to cells?) The teacher can help students understand that each of the
macromolecules has a function within organisms and that in the next part of the unit
they will learn how these molecules function within cells. The teacher may also want to
provide a brief written assessment at this point.




ENGAGE:
Peak students’ curiousity and interest by showing a video and/or a collection of pictures
showing a variety of cells. The teacher could produce a PowerPoint with pictures of a
variety of cells. For example, single-celled Protists come in many forms. In addition,
pictures of nerve cells, leaf cells, stomata, cheek cells, blood cells, etc. can be used.
Showing a variety of cells is intended to engage student interest in the wide variety of
cells and their various functions. There are also a wide variety of cell videos available.
One that would fit this activity is The Magic of Cells. This is available for purchase for
approximately $29.95. Look on-line for vendors. Questions are provided for this video
(The Magic of Cells Video Questions). The teacher could also modify the questions to
fit a different video or teacher-produced cell resource.

Guiding Question: Why do cells come in such a great variety?


Biology- Unit 1                       DRAFT                                               124
Before activity: The teacher should explain to students that they will be looking at a
variety of cells and that cells are the basic unit of living things. The teacher should also
explain that the molecules that the students have been studying are found within cells
and promote cell function. The teacher can also explain that although the students are
going to be studying “generic cells” as pictured in their texts, cells really come in a great
variety.

Focus Objective: 2.02

Activity Time: about 20 minutes

Preparation Time: If showing the video, the questions (below) will need to be copied.
If the teacher needs to create a PowerPoint or print pictures of cells, (s)he will need to
allot time for that.


                         The Magic of Cells- Video Questions

Lesson One:
   1. ___________________ are the building blocks of life.

   2. The three basic characteristics of life are:

          a. _________________________________

          b. __________________________________

          c.   _________________________________

   3. The two types of cells are:

          a. _________________________________

          b. _________________________________

Lesson Two:
   4. Two purposes of a membrane are ___________________ and
      ____________________.

   5. Cytoplasm is made mostly of ________________________.

   6. “Organelle” means __________________ organ.


Biology- Unit 1                       DRAFT                                              125
   7. The cytoskeleton is used to ____________________ the cell.

   8. Ribosomes manufacture ________________________.

   9. Vessicles store and ________________________ materials.

   10. Lysosomes have digestive ______________________.

   11. The nucleus has ____________ (use the abbreviation) inside it.

Lesson Three:
   12. Many plant cells have a ________________ wall.

   13. Vacuoles ______________________ materials.

   14. Chloroplasts help plants carry out ___________________________.

   15. Cilia and flagella help cells ____________________.

   16. Cells with similar function ____________________ alike.



After activity: The teacher should let students ask questions but there is no need to
answer all of them. But the teacher can help students begin to answer the guiding
question – focusing them on the fact that different cells have different functions and that
structure is related to function. Then the teacher can explain that students will be
looking at living cells after they learn how to use the microscope.

 LEP Modification:    Write students’ questions on chart paper so that they may be answered as
 you teach the unit. Keep the list in a prominent place in the classroom.


EXPLORE:
This activity (Introduction to Microscope) is intended to help students learn the features
of the microscope, including, total magnification, size of field of view of each objective,
reversal of images, and how to estimate size of objects viewed through the microscope.

Guiding Question: What happens to the image of an object when viewed through a
microscope?


Before activity: The teacher will explain that this activity is designed to help students
learn how to use one of tools that helps scientists study cells.


Biology- Unit 1                       DRAFT                                              126
Focus Objective: 2.02


  Language Objectives:        Students will:
         Locate and discuss the functions of the parts of the microscope with their partners. Students
          may do this orally, or you can have them write a list of the parts and their functions.
         Read laboratory procedures.
         Answer questions in complete, written sentences.


Activity Time: 90 minutes – although some students may need more time. Teachers
can invite students in during lunch or after school, etc. to finish if need be.

Preparation Time: The materials are listed with the activity. Teachers will need time to
copy the lab hand-out and to prepare the lab stations. It is useful to have a little basket
at each table with a dropper bottle of water, a small piece of newsprint with at least one
word that has a small “e”, a pair of scissors, a few slides and cover slips, and some lens
paper.

Safety: Make sure students learn the proper methods for carrying and using the
microscopes.

Students should use caution with the scissors.

Note: It is useful for the teacher to take the class through the first part of this activity.
Have every student list the rules of handling the microscope
Always hold the microscope with both hands.
Only use lens paper to clean the eyepiece and objectives.
Always start to focus with low power.
Never use coarse adjustment with high power.
Make sure you have a coverslip on the slide.
Don’t place microscope at the edge of table.



 LEP Modifications:    Have students make posters to illustrate the rules. Post their work
 around the room and leave them up for future reference.

The teacher can help the whole class by describing each part of the microscope and
also its function. (It is a nice time to point out that the structure determines the
function!) The teacher should also help students determine total magnification and
explain to them how to measure and calculate field of view diameters. Finally, the
teacher should explain how to estimate size of a cell using the microscope and how to
make a wet mount slide.




Biology- Unit 1                        DRAFT                                                127
                                              Introduction to the Microscope

                                   NAME___________________________



                      Microscope Vocabulary
                          1.
                         Know where each of the following is found and what the function is.
                         eyepiece (ocular)             arm            diaphragm
                         revolving nosepiece           stage clip     lamp (light)
                         low power objective           base           fine adjustment
       medium power objective       stage        coarse adjustment
high power objective

2. Rules for using microscope (care of the microscope):




3. When you are viewing material under high power, which is the ONLY adjustment knob that you
   should use?

4. Magnification and Field of View Diameters: Fill in the chart below.
To determine the diameter of the field of views:
       a. measure the diameter of the low power field of view using a ruler (mm units).
       b. Divide the low power magnification by the medium power magnification
       c. Multiply the answer to “b” by the low power diameter; the answer will be the medium
          power diameter.
       d. Repeat steps “b” and “c” using high power magnification to get the high power diameter.

SHOW YOUR WORK to the above steps:




 Eyepiece Magnification        x Objective Magnification   = Total Magnification   Diameter of Field of View
          10 x                   Low power:                                        Measured: _______mm
                                                                                              _______μm
          10 x                   Medium power:                                     Calculated: ______mm
                                                                                              _______μm

Biology- Unit 1                                   DRAFT                                                 128
         10 x            High power:                                         Calculated: ______mm
                                                                                        _______μm



5. Estimating the size of objects: Follow the steps listed.
   a. Note the magnification and diameter of the field you are using.
   b. Decide how many of your objects could fit across the diameter.
   c.   Divide that number into the diameter of the power being used.
   d.   That gives you the estimate of the dimension of your "cell".
   e.   Give your estimate in mm and um. (Remember 1 mm = 1000 um.)
   f. PRACTICE: (SHOW YOUR WORK!!!!)

MICROSCOPE 1: 100x                                          MICROSCOPE 2: 400x




(MP) algae strand                                           (HP) human cheek cells
Estimated width in mm:________                              Estimated diameter in mm:________

Estimated width in um:________                              Estimated width in um:________



6. Making Slides: Follow the procedure listed.
       a. Cut a lower case “e” from a piece of newpaper – you can use a whole word such as
           “decide.”
       b. Place the word on a slide and add a drop of water to it.
       c. After the newsprint is soaked, add a coverslip by holding the coverslip at a 45 o angle
           and slowly lowering it onto the word.
       d. Place the slide on the stage of the microscope and clamp it down. Put the word on your
           stage so that it is right side up BEFORE YOU VIEW IT WITH THE MICROSCOPE.
       e. Move the slide so that the letter “e” is in the center of the opening in the stage.
       f. Using low power, lower the objective to its lowest position; then slowly raise the
           objective (using coarse adjustment) until the newsprint comes into view. Use fine
           adjustment to sharpen the focus.
       g. Now change to the medium power objective. Use fine adjustment to sharpen the focus.
       h. Make a sketch of the letter “e” and describe how it looks under the microscope.

DATA/QUESTIONS
     Object Being                      Drawing and Observations
     Viewed

Biology- Unit 1                          DRAFT                                                129
       Letter "e"
       (Describe)
                                      Magnification_______




       i.   Now make a slide of two crossed hairs, one light and one dark. Follow the procedures
            above, but this time get your hairs visible under high power.

       crossed hairs                                         Drawing and Observations:
       (Describe)




                                                             Magnification:



       j.   Try moving the slide from right to left. Observe what happens.
       k.   Try moving the slide away from you. Observe what happens.

Questions:
1. What does the microscope do to the position of the viewed image (refer to your observations
   with the letter “e”).




2. What happens when you move the slide from right to left?



3. What happens when you move the slide away from you?



4. When you observed the crossed hairs under high power, could you see both in sharp focus at
   the same time?
   Why not?



Biology- Unit 1                          DRAFT                                                 130
5. How could you use the fine adjustment knob to determine which hair is on top?




6. When you switch from low to medium or high power:
   a. Is the field of view larger or smaller under the higher power?



   b. Does the position of the image change?



   c. Is there more or less light with the higher power than with low power?




                                        Microscope Investigation- LEP
                               NAME___________________________



                         Microscope Vocabulary
                          1.
                         Know where each of the following is found and what the function is.
                         eyepiece (ocular)             arm            diaphragm
                         revolving nosepiece           stage clip     lamp (light)
                         low power objective           base           fine adjustment
       medium power objective       stage        coarse adjustment
high power objective

   2. Rules for using microscope (care of the microscope):




   3. When you are viewing material under high power, which is the ONLY adjustment knob that
      you should use?




 Eyepiece Magnification   x Objective Magnification   = Total Magnification


Biology- Unit 1                              DRAFT                                             131
         10 x            Low power:

         10 x            Medium power:

         10 x            High power:




4. Making Slides: Follow the procedure listed.
       i. Cut a small “e” from a piece of newspaper.
       j. Place the “e” on a slide and add a drop of water to it.
       k. Holding a coverslip at a 45o angle and slowly lower it onto the “e”.
       l. Put the slide on your stage so that the “e” is right side up BEFORE YOU VIEW IT
           WITH THE MICROSCOPE.
       m. Move the slide so that the letter “e” is in the center of the opening in the stage.
       n. Use the low power objective and the coarse focus knob until the newsprint comes into
           view. Use the fine focus knob to sharpen the focus.
       o. Now change to the medium power objective. Use the fine focus knob to sharpen the
           focus.
       p. Make a sketch of the letter “e” and describe how it looks under the microscope.

DATA/QUESTIONS
     Object Being                      Drawing and Observations
     Viewed



       Letter "e"
       (Describe)
                                       Magnification_______




Questions:
5. What does the microscope do to the position of the viewed image (refer to your observations
with the letter “e”).




6. What happens when you move the slide from right to left?



7. What happens when you move the slide away from you?




8. When you switch from low to medium or high power:

Biology- Unit 1                          DRAFT                                               132
   c.       Is the field of view larger or smaller under the higher power?



   d. Does the position of the image change?



   c. Is there more or less light with the higher power than with low power?

EXPLAIN:
During the lab, the teacher should circulate the room and check to make sure that each
student understands each part of the activity by asking each student to explain how to
properly use a microscope.


EXPLORE:
Students will use microscopes to view various cells (cork, onion, Elodea, potato, cheek,
yeast, stomata). Students will investigate the specific functions of each of the types of
cells as they relate to the structures. The lab (Investigating Cells) also includes
investigating osmosis. This part of the lab could be done later in Unit 4.

Guiding Question: What are some of the important structures that determine the
functions of various cells?




 LEP Modification:          Have students draw, label, and color diagrams provided by teacher to learn
 organelles.



Focus Objective 2.02

 Language Objectives:           Students will:
            read laboratory procedures.
            discuss with a partner how to draw, color, and label diagrams.
            write answers to various questions.


Activity Time: 90 minutes

Preparation: The teacher needs to provide at each station: dropper bottles of: water,
salt water, iodine solution, and methylene blue solution. Each station should also have
toothpicks, lens paper, slides and cover slips. The teacher needs to prepare a general
station with: shavings of cork, a sprig of Elodea, some potato slices (in water), small
pieces of onion (in water), a yeast solution (with a little sugar so they will grow and bud),
and a geranium leaf (or other leaf) with stomata (on the thin tissue that covers the leaf).

Note: To save time, teachers can set-up seven stations and rotate students through
them. Each group of students will prepare the slides for just the first station they go to.

Biology- Unit 1                              DRAFT                                             133
Teachers may want to select a few of the tissues listed in this activity rather than all of
them.

Safety:
Consult MSDS for safety issues surrounding testing solutions.

Make sure students know the proper methods for carrying and using the microscopes.
(Refer to posters made during microscope lab.)


Before Activity: The teacher will explain to students how to make the various slides.
The teacher will also explain how to make labeled drawings. (Be sure to model
proper procedures and show examples of how you expect diagrams to look when
complete.)

Special Notes to Teacher Regarding Investigating Cells Lab:
Cork: Robert Hooke first coined the term “cell” while observing cork. These cells
come from the covering of the cork tree. They are dead and filled with air.

Onion: Use the very thin membrane that covers the onion sections. Students will
have to make two onion slides – on the first one, they will stain with iodine and on
the second they will apply salt to see what happens. They should be able to see a
clear nucleus and even nucleoli. When they add salt, the membrane will pull away
from the cell wall as the central vacuole loses water.

Elodea: The chloroplasts are very clear and the students may see “cytoplasmic
streaming” as the chloroplasts circulate – apparently this allows more efficient
photosynthesis. If a light is placed over the dish of Elodea overnight this
increases the chances of observing the streaming.

Potato: The leucoplasts are very visible, especially after staining with iodine. It is
important to note that onion stained with iodine looks golden and potato stained
with iodine looks “blue-black.” This reinforces the starch test done at the
beginning of this unit.

Cheek Cells: Students should be very careful to gently scrape the inside of their
cheeks – firmly but not enough to draw blood! They will stain the cheek cells with
methylene blue. The cheek cells are a clear example of form and function. They
are flat like pancakes and their function is to cover other tissues. Students
should make sure to throw away their used toothpicks.




Biology- Unit 1                       DRAFT                                              134
Yeast Cells: These cells are very small. They may be budding and this can be used
later in the unit when the students study asexual reproduction. A typical yeast cell
is only 4 µm in diameter! They will be golden when stained with iodine

Stomata: These are fairly easy to find on either the epidermis that covers either
the top or the bottom of the leaf. Instead of removing the epidermal layer of the
leaf, you can paint it with clear fingernail polish, then peel off the polish and
observe that lacquer layer through the microscope.




                               Investigating Cells

Name ___________________________________ Date _______________ Per _____

Item                    Draw & Label       Estimated Size          Observations
                          Include the       LP diam – 4 mm
                         magnification      MP dia – 1.6 mm
                                            LP dia - 0.4 mm
1. Cork                                                          What is the general
 These are the                                                   shape of these
   same cells that                                                cells?
   Robert Hooke
   observed.

   Look for and
    label the cell                                               What do you think is
    wall.                                                         inside these cells?




2. Onion Epidermal                                               How are onion cells
Cells                                                             similar to cork cells?
 Examine on low
    and high power.
                                                                 How can you tell
   Draw 3 cells and                                              that the cell has
    label the cell                                                depth?
    wall, nucleus,
    nucleolus
                                                                 Where is the water

Biology- Unit 1                   DRAFT                                               135
   Stain with iodine                in the onion cell?
    and note changes.

   Add salt water                  What happened
    and observe.                     when you put salt
    Draw cells to                    water on the cells?
    show what
    happens.

3. Elodea Cells                     Are all the
 Label the cell                     chloroplasts moving
   wall, chloroplasts,               in the same
   and nucleus.                      direction?

   Look for and                    Are they all moving
    describe                         at the same speed?
    movement of
    chloroplasts.                   What makes the
                                     chloroplasts move?
   Add salt water
    and observe.
                                    What is the function
                                     of the chloroplasts?




4. Potato Cells                     Where in the potato
 Observe a thin                     cell is the starch
   slice, then stain                 located?
   with iodine.
                                    What is the function
   Label the cell                   of potato cells?
    walls and
    leucoplasts.
                                    Do you see any
   Sketch and                       chloroplasts? Why
    estimate size of                 or why not?
    starch grains.




5. Human Cheek                      How are cheek cells
Cells                                and Elodea cells


Biology- Unit 1          DRAFT                            136
   Find cells that do               different?
    not overlap.
    Adjust
    diaphragm for
    best image.
                                    How is the flatness
   Stain with                       of the cheek cells
    methylene blue.                  related to their
                                     function?

   Label the cell
    membrane,
    nucleus, and
    cytoplasm.



6. Yeast Cells                      How does iodine
 Put a drop of                      stain yeast and
   yeast on a slide                  potato differently?
   and add a cover
   slip.
                                    Explain this
 Observe under                      difference.
   low, medium and
   high powers.

 Add a drop of                     How do you think
   iodine stain.                     yeast cells
                                     reproduce?
 Sketch five cells
   and their internal
   structures.

 Label and
   estimate size
7. Stomata                          Do guard cells have
 Put a small piece                  chloroplasts?
   of epidermis
   from a leaf on a
   slide.
                                    What is the function
   Add water and a                  of guard cells?
    cover slip.


Biology- Unit 1          DRAFT                          137
   Make a drawing
    of a stomata and                                                 What is the function
    label the guard                                                   of the stomata
    cells and the                                                     opening?
    opening.

   Estimate the size
    of a whole
    stomata and
    count the number                                                 Measure the area of
    of stomata you                                                    one leaf (in mm2).
    see in your field                                                 Calculate the area of
    of view.                                                          your field of view
                                                                      (r2) . Estimate how
                                                                      many stomata could
                                                                      be found on the
                                                                      underside of a
                                                                      typical leaf for the
                                                                      plant that you are
                                                                      using.




After Activity: The teacher should go over many of the questions, helping students
interpret what they have seen.


EXPLAIN:
Students will prepare a foldable which is a 3-D graphic organizer that is created by
folding and cutting paper to display information. They often have flaps that can be lifted
to reveal information. This activity can replace note-taking.

Guiding Question: What are some of the differences and similarities between plant and
animal cells?

Cell Foldable
LEP Note: Model each step of foldable construction. Monitor students’ progress
closely. Have students keep their foldable in their notebooks and encourage them to
refer to it when working on later assignments.

Focus Objective: 2.02


Biology- Unit 1                      DRAFT                                             138
Language Objectives:       Students will:
       read and summarize their notes to create a graphic organizer.
       may work with a partner to discuss foldable construction and what information to
        include.
       write key information to differentiate between plant and animal cells.


Activity Time: 25 minutes to start activity which students will finish as homework

Preparation: The teacher needs to gather the materials – construction paper, pictures,
tape and scissors. Students can also be assigned to do their own drawings or collect
their own pictures.

Before Activity: The teacher will explain to the students how to make their foldable and
give them examples of what to place in each section. The teacher should go over the
instructions that are on the attached hand-out.

                                       Cell Foldable
Definition
Foldables are 3-D graphic organizers that are created by folding and cutting paper
graphic to display information. They often have flaps that can be lifted to reveal
information. See Figure 1.




                                           Figure 1

Materials
1 piece of construction paper (preferable a light color)
Scissors
Pictures/diagrams
Markers

Activity
   1. Hold the construction paper in landscape format.
   2. Fold the paper in half.

Biology- Unit 1                        DRAFT                                               139
   3. Open flat and then fold each side toward the center fold.
   4. Title the left column “Animal Cell” and the right column “Plant Cell”.
   5. Write the names of the cell parts found in an animal cell on the front side of the
      “Animal Cell” column.
   6. Write the names of the cell parts found in a plant cell on the front side of the
      “Plant Cell” column.
   7. Using a pair of scissors, cut under each term until you get to the fold. This
      creates tabs. Do this for both columns. See Figure 1, however your columns will
      have more tabs than the one shown.
   8. Flip the tabs open and write a description of the term in your own words.
      Diagrams/pictures should be included.



Evaluation
   6. Foldable should be neat and easy to read.
   7. Cell terms should be comprehensive.
   8. Descriptions should be accurate and detailed.
   9. Diagrams should help enhance the understanding of the cell part.


Teacher Notes
Students will need you to demonstrate the folding and cutting of the paper. This
foldable creates a great study tool that can be added to as the students work through
the unit. They can use it as a resource for homework, labs, activities and even quizzes
and tests.


After Activity: Make sure to ask students if they have any questions or confusions and
have them summarize the differences between plant and animal cells – focusing on
form and function.

ELABORATE:
Students work in groups (or individually) to create a cell simile or cell storybook. In
either project, the focus is on showing how the organelles interact with each other to
support cell function. These activities may be adapted by using a reduced list of
organelles. This activity is a good extension activity and also allows the teacher to
evaluate student understanding of cell structure and function before going on to cell
reproduction

An extension activity is also included here. Sell that Organelle (LEP Note: Great
for LEP kids, but some may need extra help with slogan development.) In this activity,
students work in groups to develop an advertisement for a specific cell organelle; they
create a poster or commercial and then present to the class.

Guiding Question: How do the organelles in a cell interact to produce optimal
functioning of that cell?



Biology- Unit 1                      DRAFT                                                140
Focus Objective: 2.02
 Language Objectives:         Students will:
        write and illustrate a children’s story about organelles
        students will read about various organelles.


Activity Time: 90 minutes - 30 minutes to get a good start on the activity. Students will
finish the activity as homework. Give students 2-3 days to finish. 60 minutes to
present projects.

Preparation: The teacher needs to gather the materials – construction or poster paper,
scissors, tape or glue and markers.


Note: These activities may be adapted by using a reduced list of organelles.


Before Activity: Teachers should explain to students that they have now finished
identifying molecules and organelles each of which has a specific function within cells.
Now the students will be exploring how cell organelles interact to help cells function as a
whole unit.


                                     Cells R Us!
                               Cell Simile () Project




                                                                  Cell Biology
                                                                  Assignment:
                                                                  You have
embarked on a study of the cell: plant and animal cells. This project will allow you
to communicate your understanding of the inner structures of the animal cell and
how those structures function interdependently.

PROCEDURE:
PART ONE:
1. You will work individually to create a poster simile of a cell.

Biology- Unit 1                          DRAFT                                         141
2. Choose a human built structure to serve as the basis for your cell similes. The
   title of your poster will be “An Cell is like a…………..”. In the blank space you will
   put the name of your human built structure such as a/an airport, football game,
   circus, shopping mall, etc. The poster will actually show your human built
   structure – NOT the cell.
3. Choose details from your human built structure to compare to the structures
   and functions of the organelles of a cell. Often a cell is compared to a factory.
   A sample is attached – you will NOT use a factory for your simile. The logic
   and richness of your similes will help you to learn better how a cell and its
   structures function together to enable the cell to grow, acquire and use energy,
   produce wastes, divide, communicate, etc.
4. Next to each part of your human built structure, you will put a sentence that
   compares that part to a part of the cell. EXAMPLE: “Just as a
   shipping/receiving department determines what enters or leaves a factory, so
   the cell membrane selectively determines what can enter or leave a cell.”
5. Use the following organelles/structures:
       Plasma membrane                   Mitochondria              Lysosomes
       Cytoplasm                         Nucleus                   Peroxisomes
       Rough endoplasmic reticulum       Cytoskeleton              Golgi Apparatus

      BONUS: centriole                 Nucleolus                  smooth ER

6.   Strive for EXCELLENCE
        Use sturdy posterboard and PLAN BEFORE your start the poster.
        Use neat printing or computer generated text.
        Plan graphics that illustrate the simile without overwhelming it.
7.   Assessment: Your posters will be evaluated on the following criteria:
        Simile: Does your simile project a dominant, unified central image of the
          cell?
        Details: Have you included all of the animal cell organelles WITH details?
        Clarity: Have you produced clear, correct labels for each detail?
        Unity: Does your simile show that the parts of the cell function together
          coherently – that the cell is using energy, growing, responding, etc.)?
        Technical Details: Have you used posterboard? Does your poster have a
          title? Is your poster neat, attractive, and easy to read?
        Excellence: Is your poster creative, original, and interesting?




Here is an example of comparisons of cell parts to parts of a factory.

Biology- Unit 1                    DRAFT                                          142
Factory Job       Cell Organelle    Simile
Shipping and      Plasma            Just as the shipping and receiving department
Receiving         Membrane          controls what enters and leaves a factor, so the
Dept.                               plasma membrane regulates what enters and
                                    leaves a cell.
CEO – Chief       Nucleus           Just as the CEO directs all operations of the
Executive                           factory, so the nucleus and DNA controls all cell
Officer                             activities and what proteins will be made.
Factory           Cytoplasm         Just as the factory floor holds all of the
Floor                               machinery and parts in the factory, so the
                                    cytoplasm is the where all the organelles and
                                    activity are found in the cell.
Assembly          Rough ER          Just as the assembly line is the place where the
Line              (Endoplasmic      workers to their job in the factory, so the ER is
                  Reticulum)        the place where the ribosomes do their job of
                                    assembling proteins.
Finishing and     Golgi Apparatus   Just as the finishing and packaging department
Packaging                           prepares factory products for shipment, so the
Dept.                               Golgi apparatus prepares the proteins for use or
                                    export out of the cell.
Maintenance       Lysosomes         Just as the maintenance crew cleans up all of the
Crew                                trash and recycles what can still be used, so the
                                    lysosomes break down the cell waste so the parts
                                    can be reused.
Support           Cytoskeleton      Just as the support beams, walls, ceilings and
Beams,                              floor of the factory support the whole building,
Walls,                              so the cytoskeleton supports and maintains the
Ceilings,                           shape of the cell.
Floor
Power plant       Mitochondria      Just as the power plant provides energy for all
                                    the activities in the factory, so the mitochondria
                                    are the source of the ATP that is used for
                                    energy in cell processes.
Hazardous    Peroxisomes            Just as special hazardous waste removal bags are
Waste                               used to get rid of dangerous waste in the factor,
Removal Bags                        so the peroxisomes break down hazardous
                                    material such as hydrogen peroxide.



Biology- Unit 1                     DRAFT                                         143
                                  Cell Storybook
Name ___________________________________
Due Date ____________

Congratulations! You have just been hired by Cytophile Press- “Where Every Day is
a Cell-ebration”- to work in the children’s book department. Your first assignment
is to write and illustrate a storybook that explains the organelles present in an
animal or plant cell. Your book should be written so that an elementary student
could understand the structure and function of each organelle. Remember to be
creative! You could use a mystery format, a biography, or use the format of other
children’s books. In addition to writing and illustrating of the book, you should
design the book cover, which should include the title and author/illustrator name.
This assignment will be evaluated on the following scale:

Use of seven organelles: 7 points
Use of a story line (do not just state the functions)/ Creativity: 15 points
Identification features of plant and animal cells: 5 points
Function/structure of each organelle: 4 points each (total of 56 points)
Appropriate illustration to go along with the story line: 10 points
Spelling/Grammar: -2 for each mistake
Book Cover (with author/illustrator name): 7 points



                          CELL STORYBOOK- LEP

Your class has been chosen to write a children’s book about cells. Your book should
be written so that an elementary student could understand the structure and
function of each organelle.

You and your partner are responsible for writing about and illustrating one
organelle. We will put all of your work together to make the book.

I am working with
___________________________________________________.

Our organelle is
_____________________________________________________.

We have included the following:

Biology- Unit 1                    DRAFT                                       144
_____organelle’s name
_____organelle’s function
_____organelle’s diagram
_____at least 3 complete sentences about the organelle
_____our page is colorful and creative



EVALUATE:
The teacher can have the students present their similes or story books to the class.
During the presentations, the teacher can reinforce the relationships among and
between the organelles. The teacher should refer to the essential question “How do
cells function as the smallest unit of life?” and help students build a more in-depth
answer to this question.

ENGAGE:
Use the following assessment probe (Whale and Shrew) regarding a whale and a shrew
to assess students’ understanding of cells and cell size. The probe is designed to find
out if students think that animal cell size is related to the overall size of an animal.

Administering the Probe: Show a picture of a whale and a shrew to contrast size. Make
sure students focus on the concept of “average-sized” cells. You might explain that
some cells, such as neurons, vary considerably in size. If necessary, choose a
particular cell, such as a red blood cell or a cell from the liver.

Note: The best answer is C: The average cell of a blue whale is about the same size
as the average cell of a pygmy shrew. The size of average mammals cells (this
excludes cells that are unusually large, such as neurons) is similar in all mammal
species. Even though some body cells (such as neurons) can be very large and cells
vary, the average body cells of most mammals are about 10 micrometers in diameter.
Interestingly, the earliest-stage embryos of the whale and shrew are also in a similar
size, even though a whale eventually reaches a mass of 150,000 kg whereas a mouse
only reaches 15g--- a 10-million-fold difference!

Cells are limited in how large they can be because the surface area-to-volume ratio
does not stay the same as the size of a cell increases. Cells need to be able to move
materials into and out of a cell, and it is harder for a large cell to pass materials in and
out of the membrane and to move materials through the cell. The reason blue whales
are larger than pygmy shrew is because they have more cells, not because their cells
are larger.

                                   Whale and Shrew
The blue whale is the largest mammal in the world. The pygmy shrew is one of the
smallest mammals in the world. How does the size of average cells compare between
a blue whale and a pygmy shrew? Circle the answer that best matches your thinking.

          A)      The average cell of a blue whale is smaller than the average cell of a
                  pygmy shrew.

Biology- Unit 1                       DRAFT                                               145
           B)      The average cell of a blue whale is larger than the average cell of
                   pygmy shrew.
           C)      The average cell of a blue whale is about the same size as the
                   average cell of a pygmy shrew.

Explain your thinking. Describe the “rule” or reasoning you used to choose your
answer.

Reference: Keeley, P., Eberle, F. & Tugel, J. (2007). Uncovering Student Ideas in Science: 25 More
Formative Assessment Probes Vol. 2. Arlington, Virginia: NSTA Press

EXPLORE:
The purpose of this activity is to extend student knowledge about cells by stimulating
discussion of sexual and asexual reproduction. Teacher will set up centers around the
room with a variety of slides, plants, pictures of animals or preserved animals, pictures
of organisms, budding yeast to observe through the microscope, etc. Students will ask
the question of each organism “How do they reproduce?” Questions at each station
will ask students to evaluate the advantages and disadvantages of sexual and asexual
reproduction.

Guiding Question: How do different organisms reproduce?

Before Activity: The teacher will briefly explain sexual and asexual reproduction. Then
the students will go around to the stations and answer the questions.

Focus Objective: 3.02
  Language Objectives:        Students will:
         listen to teacher explanation of sexual and asexual reproduction.l
         discuss the items at each station with their partners.
         write answers to questions in complete sentences.
         orally share their answers with one another, the teacher, and the class.


                                 Reproduction at a Glance
Station 1: Budding Yeast

                                                                       The picture to the left shows
                                                                       yeast cells. Some of them are
                                                                       budding. The arrow is pointing
                                                                       to a cell that is budding.



                                                                       How do you think this type of
                                                                       reproduction works?




Biology- Unit 1                           DRAFT                                                      146
Do you think this is asexual or sexual reproduction? Why or why not?



http://bugs.bio.usyd.edu.au/Mycology/images/Topics/StructureFunction/buddingYeastCells.jpg




Station 2: Budding Hydra

                                                              The hydra to the left is also
                                                              budding. You can see the new
                                                              hydra on the right budding off the
                                                              older one.



                                                              How do you think this type of
                                                              reproduction works?




                                                              How many organisms are required
                                                              for budding to happen?




http://www.microscope-microscope.org/gallery/Mark-Simmons/images/hydra2.jpg



Station 3: Bacteria Reproducing

                                                              On the left are bacteria that are
                                                              reproducing. You can see that some
                                                              of them look like two bacteria
                                                              connected together.



                                                              What type of reproduction is this?




                                                              Describe how this type of
                                                              reproduction would happen.




Biology- Unit 1                         DRAFT                                                 147
http://www.emc.maricopa.edu/faculty/farabee/BIOBK/96444c.jpg


Station 4: Pine Tree Reproduction

                                                                On the left are two types of
                                                                cones found on a pine tree.
                                                                The small yellow cones produce
                                                                pollen and the large cone
                                                                contains ovules that become
                                                                seeds.

                                                                What type of reproduction is
                                                                this?



                                                                How many cells are needed for
                                                                this type of reproduction?




http://biology.clc.uc.edu/graphics/taxonomy/plants/spermatophyta/gymnosperms/other%20pines/
JSC%209805&06%20male%20&%20female%20pine%20cones%202.JPG


Station 5: Flowering Plant Reproduction

                                           The flower on the left is from a tulip plant. You can
                                           see the dark colored anthers that produce pollen
                                           and the white pistil that contains the ovules.



                                           What type of reproduction is this?



                                           What would be involved in producing new tulip
                                           plants?



                                           Would these plants look exactly like their parents?




Biology- Unit 1                      DRAFT                                                  148
http://www.bridgewater.edu/~lhill/images/tulipflowerpts.jpg
Station 6:



                                                        On the left is a picture of a peacock
                                                        wooing a peahen. Eventually, they will
                                                        produce fertilized eggs and the
                                                        peachicks will hatch.

                                                        What type of reproduction is this?

                                                        This type of reproduction can be
                                                        difficult because the male has to find a
                                                        mate. So what is the advantage of this
                                                        type of reproduction?




http://subjunctive.net/photoblog/2003/peacock-wooing-peahen.jpg
Activity Time: 45 minutes

Preparation: The teacher will need to set up the stations.

Note: The accompanying activity is a sample of the pictures and questions that a
teacher could use for this activity.


EXPLAIN:
The teacher will have the students discuss some of the examples and share their
answers. There is no need to be rigid about right and wrong answers at this point.
The teacher should explain that all cells need to divide whether for sexual or asexual
reproduction. (S)he will tell students that the next activity will help them understand
why some cells are stimulated to divide.

ELABORATE:
This activity (Cell Growth Activity or Cell Size and Diffusion- alternate) helps students
understand how changes in surface area:volume ratio affect diffusion in cells. This
leads to an understanding that small cells are more efficient and that mitosis may be
initiated when cell efficiency is compromised as the cell grows too large.

Guiding Question: What is the relationship between cell size and cell division?

Focus Objective 3.02


Biology- Unit 1                        DRAFT                                                 149
Activity Time: 45 minutes

Preparation: The teacher will need to copy the forms for the cutouts.

Safety:
    Consult MSDS for safety issues surrounding testing solutions.

      Students should wear goggles.

      Although the percentages of chemicals in this lab are very small, teachers could
       have students wear plastic gloves.

      If students cut their own agar, have them use care with the plastic knives.


Alternative: Teachers could provide a variety of plastic bags - craft bags, snack,
sandwich, quart and gallon). Then students could measure and compare the surface
area of each bag with the volume of water that each bag can hold.

Before Activity: The teacher will explain the procedure to the students and help them
with the math calculations. The teacher could do one of the calculations as a whole
class example. The teacher should reinforce the idea that there is a stimulus that
initiates cell division.



LEP Modification: After making the calculations, make an index card showing surface area
and volume of each type of bag used. Get a clean, dry example of each bag you used in class
and place its corresponding index card inside. Keep these examples to use as visuals as you
discuss and review the unit.


                           Cell Growth Activity
                  WHY DON’T CELLS GROW INDEFINITELY?
        Cell size is influenced by many different factors. The cell’s specific function is
one of the main factors that determine cell’s size and shape. For example, the shape of
a red blood cell is directly related to its ability to carry large amounts of oxygen. Other
factors to consider are surface area, volume and mass of the cell, which all change as a
cell grows. For example, think of filling a balloon with water. As water enters the
balloon, the balloon gets stretched which changes the surface area, the balloon gets
bigger, which changes the volume and the balloon gets heavier, which changes the
mass. Of these factors, which one limits the overall size of a cell? In addition, how do
these factors change in relationship to each other?

This activity is designed to consider the relationship between surface area, volume and
mass as a cell grows. Before producing cell models to help consider these relationship,
make a prediction about what happens to the surface area to volume ratio and the
surface area to mass ratio as a cell grows.

Biology- Unit 1                      DRAFT                                              150
Hypothesis:




Now, collect data to support or reject the above stated hypothesis. After the data has
been collected, complete the analysis section.

Analysis:

   1. Anything a cell takes in or lets out must pass through the plasma membrane.
      Which measurement best represents the plasma membrane?
   2. The cell contents, including the cytoplasm and the organelles, use food and
      oxygen and produce waste. Which two measurements best represent the
      contents of your model?
   3. As the cell grows larger and accumulates more contents, will it need more or less
      cell membrane to survive? Explain your answer.
   4. As the cell grows larger, what happens to the surface area to volume ratio?
      Explain the relationship between these factors as the cell grows.
   5. As the cell grows larger, what happens to the surface area to mass ratio?
      Explain the relationship between these factors as the cells grows.
   6. How are the total surface area/volume ratio and the total surface area/mass ratio
      related to the cell survival?
   7. Which size cell (small, medium or large) would have the greatest chance for
      survival and why?
   8. Did the data support or reject the hypothesis?


Procedure:
   1. Produce three cubes from the provided template. There should be a small,
      medium and large cube. These cubes will represent the different sizes that occur
      as a cell is growing.
   2. Calculate the surface area of one face of each cube, using the following
      equation: s X s. Place this information in the data table.
   3. Calculate the total surface area of each cube, using the following equation: 6 X (s
      X s). Place this information in the data table.
   4. Calculate the volume of each cube, using the following equation:
      s X s X s. Place this information in the data table.
   5. Determine the mass of each cube by filling the cube with bird seed and
      weighing it on a balance.
   6. Calculate the total surface area to volume ratio and the total surface area
      to mass ratio. Place this information in the data table.




Biology- Unit 1                     DRAFT                                            151
                      Small Cube   Medium Cube   Large Cube
                      S= 12.5 mm    S=25 mm       S=50 mm

 Area of One Face


 Total Surface Area


      Volume


   Mass (Weight)


Total Surface Area/
   Volume Ratio


Total Surface Area/
    Mass Ratio




Biology- Unit 1               DRAFT                           152
Biology- Unit 1   DRAFT   153
             WHY DON’T CELLS GROW INDEFINITELY?—LEP


Key Vocabulary:
Surface area
Volume
Mass

Language Objectives:
Students will work with a partner to complete this activity.
Students will orally discuss all parts of the activity with their partners.
Students will write in complete sentences.


Cell size is influenced by many different factors:
    function
    surface area
    volume
    mass

Think of filling a balloon with water.
Does the balloon get bigger?__________
Is this a change in volume?__________
Does the surface area change?__________

The amount of water is the balloon’s (surface area / volume).
The rubber is the balloon’s (surface area / volume).


This activity is designed to consider the relationship between surface area, volume and
mass as a cell grows.

Discuss the following question with your partner. Work together to write a hypothesis
for the problem. Write your hypothesis in a complete sentence.


Question:
Does volume of a cell have an effect on its survival?
Hypothesis:




Procedure:

Biology- Unit 1                        DRAFT                                        154
Working with a partner. . .
  5. Produce three cubes from the provided template. There should be a small,
      medium and large cube. These cubes will represent the different sizes that occur
      as a cell is growing.
  6. Calculate the surface area of one face of each cube, using the following
      equation: side (cm) X side (cm). Place this information in the data table.
  7. Calculate the total surface area of each cube, using the following equation: 6 X
      (side X side). Place this information in the data table.
  8. Calculate the volume of each cube, using the following equation:
      side X side X side. Place this information in the data table.
  5. Determine the mass of each cube by filling the cube with bird seed and
      weighing it on a balance.
  7. Calculate the total surface area to volume ratio and the total surface area
       to mass ratio. Place this information in the data table.



                        Small Cube         Medium Cube          Large Cube
                        S= 12.5 cm           S=25 cm             S=50 cm

 Area of One Face
    (side X side)
         cm2
Total Surface Area
   6(side X side)
         cm2
       Volume
(side X side X side)
         cm3
        Mass
          g

Total Surface Area/
   Volume Ratio
     cm2 / cm3
Total Surface Area/
    Mass Ratio
      cm2 / g


Analysis:
Answer all questions in complete sentences!!!
   9. Anything a cell takes in or lets out must pass through the
       _________________________.
   10. Which part of you cubes best represents the plasma membrane?




Biology- Unit 1                    DRAFT                                          155
   11. The cell contents, including the cytoplasm and the organelles, use food and
       oxygen and produce waste. What part of you model best represents the
       contents of a cell?

   12. Which cube has the most surface area?

   13. Which cube has the least surface area?

   14. Which cube has the largest volume?

   15. Which cube has the smallest volume?

   16. Which cell has the most cytoplasm and organelles?

   17. Which cell will require more nutrients?

   18. Which cell will need to get rid of more wastes?

   19. Is there enough surface area to supply what the cell needs and get rid of the
       wastes?

   20. If there is not enough surface area, what will happen to the cell?




Biology- Unit 1                      DRAFT                                             156
Biology- Unit 1   DRAFT   157
            Cell Size: Surface to Volume Ratios (Alternate Lab)

Purpose and Background     (Adapted from BSCS Green Version biology)

Why are cells so small? Why do they stop growing after reaching a certain size? How does the
size of a cell affect the diffusion of molecules across the membrane? What causes the cell to stop
growing and then to divide into two smaller cells? In this lab you will use some cell “models” to
learn about the relationship between the surface area of a cell, the volume of a cell, and the effect
of cell size on the efficiency of diffusion.
Materials

Knox Gelatin blocks containing phenolphthalein
Plastic spoon
Metric ruler
Paper towels
Plastic knife
small bowl
0.1% sodium hydroxide (NaOH)
Latex gloves
Procedure

1. Using the plastic knife cut the gelatin block into 3 cubes
       Cube A – 3 cm on each side
       Cube B – 2 cm on each side
       Cube C – 1 cm on each side
2. Place the cubes in the small dish and cover them with the NaOH. Use the spoon to turn the
cubes and make sure that the NaOH is circulating around the cubes. Continue for 10 minutes.

3. While the cubes are soaking in the NaOH, you can fill out your data table. Calculate the
surface area (SA) and volume (V) for each of cubes (your cell models). Also do the calculations for
the 4th very small cell – too small to create an agar model.

4. After 10 minutes, remove the gelatin cubes from the NaOH and blot them dry on some paper
towels.

5. With the plastic knife, slice each cube in half. Measure how deep the pink zone has penetrated
into the each cube. Record your measurements in mm.




Biology- Unit 1                           DRAFT                                                  158
Cell Size and Diffusion                  NAME___________________________________

                                         DATE______________________PER___________

DATA TABLE
Cube Dimensions           Surface area       Volume (V)           SA:V ratio         Depth of pink
                           (SA) (cm2)          (cm3)                                    (mm)
      3 cm

      2 cm

       1 cm

     0.01 cm



Discussion Questions:

1. a. Materials that a cell needs and materials that a cell needs to get rid of must go through the
membrane surrounding the cell. Which cell do you think will do the BEST job of moving materials
into and out of the cell?




   b. Why did you pick that cell?




2. How do the depths of the pink areas of each cube compare?




3. a. Which cell has the largest percentage of its volume pink?

   b. What does this mean about how efficient this cell is in receiving materials from the
      outside?




4. Looking at the surface area to volume ratio (SA:V) for each of your cells, explain efficiency of a
cell in terms of the SA:V ratio.




Biology- Unit 1                           DRAFT                                                  159
Teacher notes:

Gelatin should be made according to instructions on the box.    10 drops of phenolphthalein should
be added to the gelatin before it gels. Put the liquid mixture into a pan (pyrex for example) that is
about 13’ by 9”. The depth of the agar should be 3 cm. Then after the agar gels, give each group
of students a 3 cm by 5 cm block. This will be enough for them to cut their three cubes.

Alternative: If you have many classes you can make a pan of agar that is 3 cm deep, another that
is 2 cm deep and a final one that is 1 cm deep. You can cut the cubes and this will eliminate the
need for students to cut and measure their own cubes.

Sodium hydroxide 0.1% can be made by putting 1 gram of sodium hydroxide in 1000 ml of distilled
water.

Putting the cubes on white paper will make the effect more visible.

Because sodium hydroxide solution diffuses at an equal rate into each cube students will find that
the smallest cube will appear all pink or almost all pink inside. The 2 cm cube will have about 3-5
mm depth of pink around all edges and the largest cube will also have a 3-5 mm depth of pink. It
can be inferred that the largest “cell” is not able to eliminate waste effectively from the non-pink
area nor bring in needed molecules to that non-pink area.

Teachers can reinforce the idea that one stimulus for cell division might be a cell becoming too
large to efficiently take care of its needs.



After Activity: The teacher will explain that now that students understand what might
stimulate a cell to divide, they will be studying next what happens to the nucleus during
cell division.

ELABORATE:
This activity (Cell Cycle Inquiry Lab) will help students understand the cycle that cells go
through – from interphase to mitosis to cytokinesis and over again.

Guiding Question: What are the primary stages in the cell cycle?

Before Activity: Teacher should explain that students are now going to study how cells
go through cell division a process that is used for repair, growth, and asexual
reproduction.

Focus Objective: 3.02




Activity Time: 45 minutes


Biology- Unit 1                          DRAFT                                                     160
Language Objectives: Students will:
       read procedures.
       write descriptions of diagrams they draw during the lab.
       discuss the descriptions and sequence of diagrams with their partners.
       orally explain their diagrams and descriptions.



Preparation : This will vary; teacher needs to make the onion root tip mitosis slides
available and provide 3 x 5 cards as well as copy the hand-out.

Safety:
Remind students about proper microscope use. (Refer to posters made during
microscope lab.)




                  Cell Cycle Inquiry Lab: Background Information

Targeted Standard Course of Study: Goals and Objectives

        Goal 1: The learner will develop abilities necessary to do and understand
        scientific inquiry.
               1.02: Design and conduct scientific investigations to answer biological
               questions.
               1.03: Formulate and revise scientific explanations and models of
               biological phenomena using logic and evidence to:
               a) Explain observations.
               b) Make inferences and predictions.
               c) Explain the relationship between evidence and explanation.

        Goal 3: The learner will develop an understanding of the continuity of
        life and the changes of organisms over time.
               3.02: Compare and contrast the characteristics of asexual and sexual
               reproduction.

Introduction to the Teacher
Through inquiry techniques, students will recognize the process by which nuclear
division occurs. It is recommended that this laboratory activity be completed
prior to cell cycle instruction. Onion root tip slides will be observed and the five
different stages of the cell cycle will randomly be drawn. Students will then use
their drawings to place the cells in the different stages of the cell cycle in a
logical sequence to determine the correct order of cellular division. Upon the
completion of the activity, the teacher can collect the cards for the lab grade and
use the best drawings for classroom discussion.

Biology- Unit 1                        DRAFT                                            161
Students may have trouble visualizing individual cells when viewed under the
microscope in small groups. A solution to this would be to use a videoscope, flex
cam or overhead transparency to present the students with an enlarged picture of
an onion root tip. The teacher could then point out individual cells to stress the
importance of what these cells look like and what they represent to prepare
students for the inquiry lab. Another alternative would be to modify the
laboratory into a whole class activity. Students will need a good understanding of
the parts of the cell and the nuclear material before beginning this laboratory.

Some possible extensions of this lab may include the use of whitefish slides in
addition to the onion root tip slides. Whitefish slides could be used for the
comparison of the stages of the cell cycle. The class could be divided into an even
number of groups with half using the onion root tip and half using the whitefish
slides. The groups could then compare their diagrams and discuss the similarities
and differences between the cell cycle in plant and animal cells. Another
suggested extension would involve the use of a computer and data projector or
computer lab. Once students have completed the inquiry lab and the stages of the
cell cycle have been identified, students can practice recognizing the different
cells by using the Online Onion Root Tip Tutorial at
http://www.biology.arizona.edu/cell_bio/activities/cell_cycle/cell_cycle.html.
As students view the different cells, the number of cells present in each stage can
be recorded and a pie graph can be produced to show the percentage of time in
each stage.

Safety Considerations
Students should be reminded of proper microscope technique.

References
This lab was written based on a suggestion from Gena Barnhardt.

http://www.bioweb.uncc.edu/biol1110/Stages.html
This website provides microscope pictures of whitefish and onion root tip slides.

http://www.biology.arizona.edu/cell_bio/activities/cell_cycle/cell_cycle.html
This website allows the student to determine how many cells are found in each
stage of the cell cycle.

http://biologyinmotion.com/cell_division/
This website provides an animated tutorial of the process of mitosis.

Biology- Unit 1                   DRAFT                                         162
Cell Cycle Inquiry Lab: Activity
Purpose
To study the different stages of the cell cycle

Materials (per person or lab group)
   microscope
   onion root tip slides
   five note cards
   pencil



Procedure
1. Obtain all needed materials: microscope, onion root tip slide, 5 note cards, and
   pencil.
2. Start your observation of the onion root tip slide on low power using the coarse
   adjustment. The slide should be scanned until the region directly behind the
   root cap can be viewed.
3. Increase the magnification of the microscope by switching to the medium power
   objective and use the fine adjustment to focus the microscope so that several
   different cells can be viewed clearly at once.
4. Observe the cells in the field of view very carefully. You should notice
   differences between the cells, especially with the nuclear material. Each of the
   different looking cells should be drawn on a separate note card. As you draw
   your cells, you may need to increase the magnification of your microscope to
   more clearly view the individual cells and their nuclear material. When you have
   completed your diagrams, you should have five different cells on five separate
   note cards.
5. Have your teacher approve all of your diagrams.
6. After your diagrams have been approved, write a description at the bottom of
   each note card of how each cell looks different. Be sure to emphasize the
   differences between the nuclear materials.
7. After carefully studying your note cards and descriptions, place your diagrams
   in a logical order to determine the steps involved in the cell cycle.
8. Once you have placed your cards in order, number them 1-5 in the upper right
   hand corner.

Lab Data
Students will turn in their note cards with the diagrams of the cells and their
written description of the differences between the cells.

Biology- Unit 1                    DRAFT                                          163
After Activity: The teacher will allow time for questions and then will explain to students
that the process of mitosis is actually continuous rather than single steps – a movie not
a slide show.

Optional further extension: Onion Root Tip Mitosis
This extension activity has students count the number of cells in each stage of mitosis
and then infer the time that cells spend in each stage.

                                  Onion Root Tip Mitosis
NAME______________________________
DATE_____________________PER______

I. TITLE: Mitosis and Cell Division in Plants

II. PURPOSE: - to study the process of Mitosis and determine what occurs in each phase
             - to estimate how long a cell spends in each stage.

III. PROCEDURE:
1. Obtain a prepared slide of onion root tip. Under low power locate a group of cells near the
tapering end of the root tip. Make note that there are three root tips on your slide; you will be
using each one of them. Move to high power and find a good section with many cell divisions. Make
sure the field of view is completely filled with the cells.

2. We will use 300 as an estimate of the total number of cells in the high power field of view. Find
this number in the three columns beside "CELL TOTAL" at the bottom of the data table.

3. Count the number of cells in each phase of mitosis and record the numbers in the column labeled
"1". A good way to do this is for each lab partner to count independently and compare estimates,
then take the average of the two. Interphase numbers can be calculated by subtracting the other
four counts from the 300.

4. Follow the same procedure for the other two root tips on your slide.

5. Add columns 1, 2, and 3 for each phase; record in the column "TOTAL." Divide each of these
totals by 300 and multiply by 100 to find the percentage of cells in each phase.

6. Record your percentages in the chart on the front board. From this we will calculate the class
percentages.

7. From your data and the class data you are to construct a bar graph, showing both individual and
class percentages for each phase of mitosis.

DATA TABLE:

Phases           Root Tip #1       Root Tip #2     Root Tip #3      Average          Class Average
Prophase



Biology- Unit 1                           DRAFT                                                 164
Metaphase

Anaphase

Telophase

Interphase

Total Cells             300            300              300              300             300




Mitosis Investigation
DISCUSSION:

1. Why are root tips a good place to observe mitosis?




2. How does your data compare with the class data: Explain why the results are different.




3. Create a Pie Chart showing the proportions of each of the 5 phases. Remember that a circle
has 360o so if interphase is 30% of the cells it will fill 30% of 360 o.




4. Using the class data calculate the following. Suppose an onion cell takes six hours from the
beginning of one mitosis to the beginning of the next. How many minutes does the cell spend in each
of five phases?

interphase______prophase_______metaphase________ anaphase_______telophase_______

5. What are the principal sources of error in this laboratory investigation?




Biology- Unit 1                         DRAFT                                                  165
EVALUATE:
In this activity (Mitosis in Motion Flipbook), students will prepare a flip book of the
stages of the cell cycle in order to show the continuous nature of the process.

Guiding Question: How is mitosis more like a video rather than a slide show?


Before Activity: The teacher will explain the procedure and make sure students
understand what the product will look like.

Focus Objective 3.02

Activity Time: 45 minutes and then homework to finish it up.

Preparation Time: Teacher needs time to set out the 3 x 5 cards, pens and stapler as
well as copy the handout.




                                       Mitosis in Motion


Overview: Although when we study mitosis, it appears as a series of snap shots, in fact, it is a
continuous process involving a disappearing nuclear membrane and moving chromosomes. In this
activity, you will be creating a flip book on mitosis. When you finish you will have a little book that
you can scroll through and it will show a rough continuous animation of the process of mitosis.

Materials:
3 x 5 cards – 16 per student
Templates: available at this website: http://sciencespot.net/Media/mitosisbook.pdf
Colored pens or pencils
Stapler

Procedure:
On each card you will draw a cell going through some stage of mitosis. You will label the
appropriate structures and you will put a brief narrative of the steps. Your cell should have 4
chromosomes (2 pairs). Use the given number of 3 x 5 cards for each of the stages listed below.

        Title Page -    1 card
        Interphase -    2 cards
        Prophase -      3 cards
        Metaphase -     3 cards
        Anaphase -      3 cards
        Telophase -     3 cards
        Cytokinesis -   1 card

    1.   Get 16 3/5 cards.

Biology- Unit 1                           DRAFT                                                    166
   2. On the first card put your name and a title for the book (Mitosis in Motion, for example)
   3. Make sure that the location where you draw your nucleus will be on the same place on each
      card.
   4. Use colored pens or pencils and be consistent with your colors on each card.
   5. On each card label structures such as chromosomes, centromere, spindle fiber, nuclear
      membrane,
   6. On the back of each card, describe what is happening on the front.
   7. When finished, staple them together in the correct order along the left edge. When you
      flip through the book you will have Mitosis in Motion!

Notes:
            The first "cell" to begin each phase should be the beginning stages of that phase (e.g.,
             the first cell for metaphase should include the chromosomes lined up along the center
             of the cell and the spindle fibers attached to the centromere).
            The other cards for each phase should change very gradually to give the appearance of
             the cell actually dividing. You should also make sure that the last "cell" for a particular
             phase gradually changes into the beginnings of the next stage (e.g., the final "cell" for
             interphase should blend into the first "cell" for prophase).
            Make sure that you make your drawings in a place that they will be seen when you flip
             the pages. Also watch the size of your drawings. Do not make the drawings so large
             that you will be able to see only parts of the "cell," but do not make them so small that
             you will compromise details.




After Activity: The teacher will have students share what they have learned from the
activity. (S)he, then, should explain that that students will be studying two different types
of nuclear division, mitosis and meiosis. (S)he will connect mitosis with asexual cell
division that is used during cell repair, growth. Then, (s)he will connect meiosis to the
production of cells needed for sexual reproduction.

ELABORATE:
This activity (Comparison of Mitosis and Meiosis) is conducted as a whole class
experience. The teacher talks students through a simulation of mitosis and then
through a simulation of meiosis, helping students to compare both processes as they
simulate them. The focus is on the similarities and differences of each process in
terms of number and type of cell produced and function of each process. Teacher
should also stress the possibility of variations within each process.

Guiding Question:        What are the similarities and differences between mitosis and
meiosis?


Before Activity: The teacher should explain that students will be comparing two
processes – one of which is used for organism growth and repair and the other that is
used to produce gametes for sexual reproduction.

Focus Objective: 3.02
Biology- Unit 1                            DRAFT                                                     167
Language Objectives:         Students will:
        listen to teacher discussion.
        participate in class discussion.
        complete a chart comparing mitosis and meiosis.
        read questions and answer in complete sentences.



Activity Time: 90 minutes

Preparation: You need to copy the chromosome strips and the other handout. Each
student will need 2 pages of chromosome strips and one handout, as well as a piece of
string about 6 feet long to serve as a nuclear membrane.

Safety: Students should be careful using scissors.



                      Comparison of Mitosis and Meiosis
NAME______________________________
DATE_____________________PER______

1.   Complete the following chart comparing mitosis and meiosis (relative to the
     cell models that you worked with in the lab.


Characteristic            MITOSIS                           MEIOSIS
Location(s) where
process occurs

number of cells
produced

chromosome
number of
parent nucleus
(haploid/diploid)
chromosome
number of new
nucleus

type of cell
produced
(body cell/gamete)

function in the
organism



Biology- Unit 1                       DRAFT                                       168
2.   How are the nuclei of the cells resulting from mitosis different from the
     nuclei of egg and sperm cells formed in meiosis? (Describe in terms of
     chromosome number.)




3.   How are the nuclei of the cells resulting from mitosis different from the
     nuclei of the
      fertilized egg cells? (Describe in terms of chromosome number.)




4.   What are the functions of mitosis to organisms?




5.   What are the functions of meiosis to organisms?




Biology- Unit 1                    DRAFT                                         169
                   MITOSIS




   Diagram 1




   Diagram 2




Biology- Unit 1   DRAFT      170
                       MEIOSIS
                       Diagram 3




    Diagram 4




Diagram 5




    Biology- Unit 1   DRAFT        171
OOCYTE                         SPERM

Diagram 6




                   ZYGOTE
                   Diagram 7




                               FERTILIZATION
Teacher Notes:
Biology- Unit 1   DRAFT                        172
The teacher should give each student two sheets of chromosomes and a pair of
scissors. Have students cut out the chromosome strips and keep them in two
sets. Each set will have 2 long chromosomes with 5 genes, 2 medium
chromosome with 3 genes, and 2 short chromosomes with 2 genes. The
teacher can stress that for example, gene 1 on the long chromsome carries
information for the same trait although the specific information can vary.




Biology- Unit 1                DRAFT                                     173
Chromosome Strips for Meiosis Lab

Gene              Gene      Gene       Gene   Gene   Gene
1                 1         6          6      9      9




Gene              Gene      Gene       Gene   Gene   Gene
2                 2         7          7      10     10




Gene              Gene      Gene       Gene
3                 3         8          8




Gene              Gene
4                 4




Gene              Gene
5                 5




Biology- Unit 1                DRAFT                   174
After Activity: The teacher should help the students summarize the comparison
between mitosis and meiosis. The teacher can then lead students to the online review
which follows.
 LEP Modification:    Have students write a paragraph comparing mitosis and meiosis.

Additional or Alternate Activity for Comparison of Meiosis and Mitosis:
This activity (Mitosis and Meiosis Online Review Activity) directs students to different
websites to review mitosis and meiosis. One of these websites allows students to
review mitosis and meiosis and the other allows them to actually move the
chromosomes.

Focus Objective: 3.02

Activity Time: 30 minutes (LEP students will likely require more time and substantial
teacher support)

Preparation: Teacher will need either a computer lab or a computer and a projection
device. Check the computers you will be using in advance to be sure the necessary
plug-ins are installed to run the animations. Consult with your technology specialist if
you need assistance.

Before Activity: Explain to students that they will be reviewing the steps in mitosis and
meiosis.


(LEP students will likely require more time and substantial teacher support)

                    Mitosis and Meiosis Online Review Activity

Step One: Go to the following websites to review the steps in mitosis and meiosis
http://www.johnkyrk.com/mitosis.html
http://www.johnkyrk.com/meiosis.html

Step two: Go to http://biologyinmotion.com/cell_division/ to complete the
following activities.

Click on “practice mitosis”.

In the space provided, draw a sketch of the mother cell being sure to include the
chromosomes with the different color bands, which represent different genes.
You may use any four colors of your choosing. Next, following the instruction to
the left and show how the genetic material is distributed during mitosis. Next,
draw a sketch of the two daughter cells produced once the mother cell goes
through mitosis.


Biology- Unit 1                      DRAFT                                              175
Quit that activity and proceed to “Practice meiosis”
In the space provided, draw a sketch of the mother cell being sure to include the
chromosomes with the different color bands, which represent different genes.
You may use any four colors of your choosing. Next, following the instruction to
the left and show how the genetic material is distributed during meiosis. Next,
draw a sketch of the two daughter cells after the first division. Then draw a
sketch of the four daughter cells produced after the second cell division.




Provide a written description of the difference between cells produced in mitosis
and meiosis.

Biology- Unit 1                   DRAFT                                        176
After Activity: Summarize with students to ensure that they all understand the
similarities and differences between mitosis and meiosis.

ENGAGE:
The teacher should pose the following questions: Is DNA found in all species? What
does it mean? Record student responses on the board.

EXPLORE:
The teacher should remind students that DNA is found in the nucleus. Teachers
should also explain how the DNA will be extracted. Students will extract DNA from a
strawberry and answer questions about the presence of DNA in all species. Crushing
the strawberry helps break open the cells. The soap which is nonpolar helps break
open the plasma membrane. The salt which is ionic helps to unwind the DNA and
break it loose from the attached proteins. DNA is insoluble in alcohol and will
precipitate into the alcohol layer.

Focus Objective: 3.01

Activity Time: 45 minutes

Preparation: Teachers will need to buy strawberries and set up the stations. All the
materials and more teacher notes are listed in the activity handout.


Safety: Be alert to any student allergies to the food products used and consult MSDS
for safety issues surrounding testing solutions. Students should wear goggles If
teachers do human DNA collection, care should be taken to Clorox any glassware or
other materials that may have come in contact with human fluids.


                             Strawberry DNA Extraction
Purpose:

Students will extract DNA from strawberries.

Materials / Equipment (per student group):

   1.   1 heavy duty zip-lock baggie

   2. 1 strawberry (fresh or frozen and thawed)

   3. cheesecloth

   4. funnel

   5. 100 ml beaker

   6. test tube

Biology- Unit 1                        DRAFT                                           177
   7. stirrer
Reagents:
   1.   DNA extraction buffer (One liter: mix 100 ml of shampoo (without conditioner), 15 g NaCl,
        900 ml water or 50 ml liquid dishwashing detergent, 15 g NaCl and 950 ml water)

   2. Ice-cold 95% ethanol or 95% isopropyl alcohol

Procedure:

   1.   Place one strawberry in a zip lock baggie.

   2. Smash strawberry with fist for 2 minutes.

   3. Add 10 ml DNA extraction buffer to the bag.

   4. Mush again for one minute.

   5. Filter through cheesecloth in a funnel into beaker.

   6. Pour filtrate into test tube so that it is 1/8 full.

   7. Slowly pour the ice-cold alcohol into the tube until the tube is half full.

   8. At the interface, you will see the DNA precipitate out of solution and float to the top. You
      may spool the DNA on your glass rod or pipette tip.

Questions:

   1.   Where is DNA found in the cell?

   2. What does the soap (detergent) do to the cells. What is the purpose of the soap in this
      activity?

   3. What was the purpose of the sodium chloride? Don’t forget about polarity and charged
      particles.

   4. Why was the cold ethanol added to the soap and salt mixture?

   5. Describe the appearance of your final product?

   6. How might the DNA of a strawberry and the DNA of a human be the same?

   7. How might the DNA of a strawberry and the DNA of a human be different?

Teacher Notes:

   1.   Thaw strawberries before class.

   2. Set up the extraction buffer in small bottles at each lab station with a 10.0 ml pipette or a
      10.0 ml graduated cylinder.

   3. Set the alcohol in an ice bucket with ice to be ice cold. (70% isopropyl from the drug store
      will work)


Biology- Unit 1                           DRAFT                                                 178
   4. If there are enough funds and space, each student can do this experiment.

   5. You could also set up half of the stations for students to extract their own DNA – that way
      you can make the connection with the students that all organisms have DNA.



Alternative: Teachers could have a different extraction activity at each lab station. For
example, teachers can have half the class extract their own DNA from cheek cells and
the other half extract DNA from a plant.

Alternate DNA Activities:
Collect Your Own DNA or
DNA in My Food - Banana

                      Collect Your Own DNA! (Alternate Lab)

Materials:
       Small cup               6% salt solution (1 T salt to 8 oz.)
       Test tube               10% soap solution (1 part soap to 9 parts water)
                               Alcohol

Procedure:
1. Pour 15 mL of salt water solution into the cup.

2. Put the solution into your mouth and swirl it around your mouth for 30 seconds. REMEMBER:
   MORE VIGOROUS SWIRLING COLLECTS MORE CHEEK CELLS!

3. Spit the water back into the cup.

4. Pour enough of the swirled salt water into the test tube to fill it up half way.

5. Add 2 mL of soap solution and mix by swirling gently 3-4 times.

6. Add about 2 mL of ethanol. Pour it gently in along the side of the test tube so it forms a layer
   on top of the salt water/soap solution.

7. Wait one minute.

8. Hold the test tube up to the light and look for the cloudy, stringy substance forming at the
   bottom of the alcohol layer. You may see a cloud of bubbles. As the bubbles rise to the
   surface, you will begin to see white “strings” being drawn up along with the bubbles. These
   “strings” are clumps containing thousands of DNA molecules.

9. Take a glass rod and put it all the way into the test tube and turn it in one direction. DO NOT
   STIR! The DNA will wrap around the rod.

How it works:


Biology- Unit 1                           DRAFT                                                   179
Cells contain water, proteins and nucleic acids (DNA and RNA) within a membrane made of lipids
(fat). When you add soap, it breaks the membranes open and the contents of the cell spill out. The
salt changes the ionic concentration of the water and makes it easier for the DNA and RNA to
separate. DNA will not dissolve in alcohol, so when you add it to the solution, the DNA collects
where the two layers meet.


                      DNA IN MY FOOD!!!!! (Alternate Lab)
Introduction: DNA is present in the cells of all living organisms. The process of
extracting DNA from a cell is the first step for many laboratory procedures in
biotechnology.
Objective: To isolate DNA from bananas
Materials:
• Two 5 oz. Plastic cups
• blender
• plastic spoon
• #2 Cone coffee filters
• distilled water
• clear-colored shampoo
• 3 bananas
• table salt, either iodized or non-iodized
• One plastic transfer pipette or medicine dropper
• one sealed tube containing 95% ethanol (fill about 1/2 of the tube with alcohol),
kept on ice (the colder the better the results)
Methods:
1. To a blender add two bananas with one cup (250 ml) of distilled water. Blend for
15 to 20 seconds, until the solution is a slurry. (the teacher will prepare the
solution for you)
2. In one of the 5 oz. plastic cups make a solution of 1 teaspoon of shampoo and two
pinches of table salt. Add 20 ml (4 teaspoons) of distilled water. Dissolve the salt
and shampoo by stirring slowly with the plastic spoon to avoid foaming.
3. To the solution from step two add two heaping teaspoons of the banana slurry
from step 1. Mix the solution for 5-10 minutes.
4. Place #2 coffee filter inside the second 5 oz. plastic cup. Fold the coffee
filter’s edge around the cup so that the filter does not touch the bottom of the
cup.
5. Now filter the mixture from step three by pouring it into the filter and let the
solution drain for several minutes until there is approximately 5 ml (covers the
bottom of the cup) of the filtrate to test.
6. Obtain a test tube filled 1/2 full of the cold alcohol.
7. Fill the plastic pipette or medicine dropper with solution from step five and add
it to the alcohol.

Biology- Unit 1                         DRAFT                                                 180
8. Let the solution sit for 2 to 3 minutes without disturbing it. It is important not
to shake the tube, you can watch the white DNA precipitate out into the alcohol
layer. There will be enough DNA to spool on to a glass rod after good results are
obtained. DNA has the appearance of white, stringy mucus.


How does this experiment work?
The solution of banana treated with salt, distilled water, and shampoo is
specifically prepared. The shampoo, a detergent, breaks down the cell membrane
by dissolving lipids and proteins of the cell. This disrupts the bonds that hold the
cell membrane together. The detergent then causes these lipids and proteins to
precipitate out of solution. Therefore, the DNA is able to pass through the filter.
The salt brings the DNA strands together and since DNA does not dissolve in ice-
cold ethanol it separates out of solution.




Name_____________________________ Date _____________ Per _______
Questions:
  1. What does DNA stand for?

   2.   Describe the shape of DNA on a molecular level.



   3. Name the three parts of a nucleotide.

   4.   Who discovered the structure of DNA?

   5.   What type of bond holds the nitrogen bases together in the DNA molecule?

   6.   Why are the number of adenine and thymine always the same in a DNA
        molecule?

   7.   Provide the complementary strand for the DNA below:
                     A-T-A-C-G-T-C-G-A-C



 How did each of the following materials contribute to the extraction of the
banana DNA?
   8. Shampoo



Biology- Unit 1                    DRAFT                                           181
   9.    Coffee Filter


   10.   Salt


   11.   Distilled Water


   12.   Blender


   13.   Alcohol



   14.   Why is it important to use cold alcohol and not warm?



After Activity: Teacher should reinforce the concept that all living things have DNA and
the basic steps for extraction can be used with a great variety of materials.


EXPLORE:
In this activity (DNA Model Building), students will build a model of DNA.

Guiding Question: What is the basic structure of DNA? What parts are the same and
what parts are variable?

Before Activity: Teacher explains to students the basic structure of DNA so that they
can build their models.

Activity Time: 60 minutes for the paper activity or students could build the model as an
“out of class activity”. The paper model could be done in class and it would take about
60 minutes.

Preparation Time: If teachers do the paper model, it would take a little time for them to
copy the templates.

Safety:
Teachers should review student plans and be alert to any safety issues.

Notes: Templates for paper model available at:
http://www.csiro.au/files/files/pa5y.pdf



Biology- Unit 1                      DRAFT                                            182
There are several versions of DNA building activities. Some teachers may have
students each build their own models; others may prefer an in class activity. This site
includes a DNA project assignment and a link to templates for building a paper model.




                                DNA Model Building


Objective: to create a DNA model that is composed of at least 12 base pairs, the
appropriate sugars and phosphates and illustrates the double helix by showing the
hydrogen bonds and the helical spiral.

In your plan you need to consider the following:
      A. You need to clearly show the different subunits:
           deoxyribose, phosphate, and the four nitrogen bases (adenine, thymine,
           cytosine, and guanine)
      B. You need to show the double helix twist.
      C. You need to show the hydrogen bonds between the nitrogenous bases.
      D. Your model needs to be supported in some way.
      E. You need to correctly connect the various subunits and identify the
          hydrogen bonding between the bases.
      F. Make sure that your model is sturdy. DO NOT build it out of food or
          other degradable materials.




After Activity: Teacher should use the models to reinforce the structure of DNA and
then point out that the code is carried in the nucleotides (nitrogen bases). Teacher
should also explain to students that DNA needs to replicate during cell reproduction and
that the code is also used for producing proteins in the cell. This is a good time for the
teacher to remind students that proteins are extremely important molecules that form
structures within the cells and also serve as enzymes for all the chemical reactions in a
living cell.

Alternative: There is a DNA origami activity on the DNAi website. http://www.dnai.org

EXPLAIN:
This web quest (Cracking the DNA Code) will help students understand the historical
development of the knowledge of DNA structure. It will also allow them to review the
structure of DNA on an interactive site.

Biology- Unit 1                      DRAFT                                            183
Before Activity: The teacher will explain that this activity is helping students understand
the scientific research and problem solving that went into the discovery of the structure
of DNA.

Guiding Question: What were the major discoveries that led to understanding the
structure of DNA?

Activity Time: 45 minutes (LEP students will likely require more time and substantial
teacher support)

Preparation: Teacher will have to arrange for a computer lab or a classroom computer
with a projection device. The teacher will also have to copy the handout.


                                    Cracking the DNA Code
Use the following website, http://www.dnai.org , to complete this activity about the research that lead to
the discovery of DNA’s structure.

Click on “Code” from the menu on the website first page, then click on “Finding the
Structure”.

Part 1: Using the “Problem” Section, answer the following questions.
   1. How did Miescher’s contribute to our knowledge of DNA?
   2. Which tool of science assisted Miescher in his discovery? How was the tool
       useful?
   3. After Miescher, other scientists determined the “nuclein” contained lots of …
   4. Eventually DNA was determined to be a long chain that contained …
   5. Which molecule, DNA or protein, carries the information of hereditary? Who and
       how was this determined?

Part 2: Using the “Players” and “Pieces of the Puzzle” Sections, provide a short
summary of the contribution of each of the following scientists to the structure of DNA.

    1.   Erwin Chargaff
    2.   Rosalind Franklin
    3.   Linus Pauling
    4.   James Watson and Francis Crick
    5.   Maurice Wilkins

Part 3: Using the putting it together section, click on the base pairing interactive section
and follow the instruction on the screen to determine the structure of DNA. Provide a
diagram of DNA, which shows the general shape of the DNA molecule with the nitrogen
bases (A, T, C and G), sugar and phosphate in the correct location. How can the 3D
structure of DNA be described?




Biology- Unit 1                             DRAFT                                                       184
** Please note that fifteen activities have been created by the sponsors of DNA
interactive to be used with the website. The following link connects to the teacher
guide, http://www.dnai.org/teacherguide/guide.html . **


After Activity: The teacher should allow students to ask questions and discuss the
structure of DNA and the various participants who lead to that discovery. The teacher
might also want to point out that the work of many people went into the discovery.

ELABORATE:
This investigation (DNA Web Quest) is designed to help students learn how DNA
replicates and how DNA serves as the template for protein synthesis.

Guiding Question: What are the major functions of DNA and how do they work?

Before Activity: Explain to students that they will be learning about the functioning of
the DNA molecule.

Activity Time: 45 minutes (LEP students will likely require more time and substantial
teacher support)

Preparation: Teacher will have to arrange for a computer lab or a classroom computer
with a projection device. You must have Shockwave for Director installed. Try the
activity on the computers you will be using in advance and consult with a Technology
specialist if you have difficulty getting it to run. The teacher will also have to copy the
handout.



                                       DNA WebQuest
NAME___________________________ Date ___________ Per ____

Topic: Replication and Protein Synthesis
A. Go to: http://www.pbs.org/wgbh/aso/tryit/dna/shockwave.html

Click: “DNA replication” (upper left) and then click “unzip” Read the script, answer the questions
below, and then, click “OK”.

1.   In a real cell, what does the DNA molecule do before it unzips?

2.   What molecules break the rungs (bases) apart?


Drag the correct bases over to “synthesize” the new DNA halves.
Read script, answer questions, and then click “OK”.

3.   How many base pairs are in the real human genome?



Biology- Unit 1                          DRAFT                                                 185
Click “protein synthesis” (upper right).    Click “upzip”.

4.    How much of the DNA molecule actually unzips in a real cell?


Base pair the nucleotides for just one half of the DNA.
Read the script, answer the questions, and click “OK”.

5.    About how many bases would a real mRNA molecule have?

6.    Where does the mRNA go now?


Match the tRNA molecules to their base pair nucleotides on the mRNA. Answer the questions.

7.    Which molecule has the codons?

8.    Which molecule has the anticodons?

9.    What molecules are attached to the tRNAs?


Click “OK” and continue matching the tRNAs.        Read the script, answer questions, and click “OK”.

10.   Where does the first tRNA go?


Continue matching and answer questions.

11.   How long will a real polypeptide chain get to be?

12.   When does translation of the mRNA end?


Topic: Protein Synthesis
B. Go to: http://learn.genetics.utah.edu/units/basics/transcribe/
Click the button that says “click here to begin”
Use the keyboard to type the bases that would form the mRNA.
Follow the instructions to determine the order of the amino acids.

13.   List the order of your amino acids.

14.   How did the process know to end?


Read the script on the right side of the webpage.

15. Describe the process of transcription.



16. Describe the process of translation.



Biology- Unit 1                             DRAFT                                                  186
C. Go to: http://www.wisc-online.com/objects/index_tj.asp?objid=AP1302
Read the animation page by page – just click the “next” button when you are ready to move on.

17.   How does the mRNA leave the nucleus?

18.   Is just one mRNA molecule made? Explain.



19.   How many amino acids does each codon code for?

20.   Describe the structure of a tRNA molecule.



21.   Where does the energy to form the peptide bond between two amino acids come from?

22.   Can a single mRNA be read more than once? Explain.



Topic: Mutations
D. Go to: http://www.understandingevolution.com/evolibrary/article/0_0_0/mutations_03
Read the information and fill out the table below:

Type of mutation     Description                           Effect on resulting protein
Substitution

Insertion

Deletion

Frameshift



Topic: Replication
E. Go to: http://nobelprize.org/educational_games/medicine/dna_double_helix/
Click on “Play DNA Game”; Click “next” and reading each page, continue to click next until you come
to the game.; Click on organism #1 and match the base pairs as fast as you can! It is hard.
Click Next and then click on each organism until you identify the one that belongs to chromosome
#1; continue playing the game with the other two chromosomes, filling in the chart below.
Be careful, other teams may get different results.

 Chromosome #           How many          How many base      How many genes?        What is the
                      chromosomes?           pairs?                                 organism?
           1
           2
           3

Biology- Unit 1                         DRAFT                                                   187
 After Activity: The teacher should reinforce the functions of DNA with the students.

 EVALUATE:
 Students should answer the following questions. This can be done as an in-class
 assignment or for homework.

           1) How does the process of DNA replication allow for daughter cells to have
              an exact copy of parental DNA?
           2) Explain how the process of DNA replication is semi-conservative.
           3) Where, specifically in the cell, does DNA replication occur? Why is this
              location important?
           4) Explain the importance of relatively weak hydrogen bonds between
              nucleotides.
           5) The sequence of bases on one strand of DNA is:
              GGCACTTCATGC. What would be the sequence of bases on the
              complementary strand?
           6) Draw and label 3 DNA complementary pairs. Circle and label a
              nucleotide.
           7) Explain how mitosis is part of asexual reproduction and meiosis is part of
              sexual reproduction.
           8) Complete the following chart regarding the similarities and differences in
              mitosis and meiosis:


                                    Mitosis                       Meiosis
 Replication & separation of
 DNA

 Cellular material


 Changes in chromosome
 number

 Number of cell divisions


 Number of cells produced in
 complete cycle


Language Objectives:       Students will:
      follow along as their teacher reads a passage, or students may read the passage aloud.
      select key terms and concepts from a passage.
      orally summarize the passage, including key information.
      answer conclusion questions in complete sentences.


 Biology- Unit 1                       DRAFT                                               188
                                 Alien Encounters!




ENGAGE:
This activity (Alien Encounters!) connects the knowledge of how proteins are made with
actual traits in an organism. Each student will transcribe and translate bits of DNA to
determine the traits of their alien. They will then draw their alien.

Guiding Question: What is the relationship between DNA, mRNA, proteins, and actual
traits?

Before Activity: The teacher will go over the instructions to make sure students
understand the process.

Activity Time: 45 minutes but students may want to finish their alien drawings at home.

Preparation Time: The preparation mainly involves copying the materials. Each
student will receive a different alien to work with. There are 30 different aliens. The
teacher also should provide markers, crayons, or colored pencils and blank paper for
drawing the aliens.
LEP Caution-work through 1 or 2 examples, step-by-step with students.

Background: In the year 2050, an incredible archeological discovery was made in
the middle of a remote area of South America. It was an area where a large
meteor had struck the Earth. A pile of alien bones was found completely mixed up
together. The explorers who made the discovery immediately informed the
organization known as Scientific Phenomena Over Our Fabulous Sphere (S. P. O. O.
F. S). S. P. O. O. F. S. sent out its best scientists to collect DNA samples. (Yes,
these aliens really did have DNA!) The scientists were able to recover small
fragments of DNA which they brought back to their labs. After much work, they
determined that the DNA fragments represented 9 genes.


EXPLORE:
Purpose: In this activity, you will determine the traits of these unfortunate
recovered aliens by analyzing their DNA and determining the amino acid sequences
of the resulting small protein fragments. Each fragment is associated with a
particular gene and a specific alien characteristic (trait).
Procedure:
1. Put the DNA sequence for each gene in the proper location on your data sheet.

Biology- Unit 1                      DRAFT                                            189
2. Transcribe the DNA for each gene into mRNA. Record these sequences.
3. Translate the mRNA into amino acids using the provided mRNA Codon Chart.
Record the amino
   acid sequence for each gene.
4. Use the “Alien Genes” chart to determine the traits that are associated with
   each of your amino acids sequences and write those traits on the charts.

EXPLAIN:

Using a blank piece of paper, sketch and color your alien, making sure to include all
relevant (known) traits. Be sure to include your alien’s genus and species at the top
of your drawing and data sheet. Place your name on your drawing. (NOTE: The
genus name must be capitalized and the species name always starts with a lower
case letter.)

ELABORATE:
If you wish, add other unknown traits and explain why you chose to include them.

EVALUATE:
Answer the following questions on the back of your alien picture:

Questions:
A. Did you find any “identical” aliens in your group?
B. Give the tRNA sequences for Gene D.
C. How does a single change in a nitrogen base alter the formation of a resulting
protein?
D. If you knew a particular amino acid sequence, could you figure out the DNA for
that sequence?
    Why or why not?
E. What is the difference between transcription and translation?
F. What are the roles of the DNA, the mRNA, the rRNA, and tRNA in protein
synthesis?




Biology- Unit 1                    DRAFT                                         190
                  mRNA CODON CHART




Biology- Unit 1       DRAFT          191
DATA Tables for Alien Gene Analysis:     NAME__________________________

Alien Number _______ Alien Genus and species_________________________

Is your alien hairless or hairy?           Is your alien fat or skinny?
       GENE A                                     GENE B
DNA                                        DNA
mRNA                                       mRNA
Amino Acids                                Amino Acids
Trait                                      Trait

Does your alien have 4 legs or 8 legs?     What size nose does your alien have?
      GENE C                                     GENE D
DNA                                        DNA
mRNA                                       mRNA
Amino Acids                                Amino Acids
Trait                                      Trait

Does your alien have antennae or not?      What color skin does your alien have?
      GENE E                                     GENE F
DNA                                        DNA
mRNA                                       mRNA
Amino Acids                                Amino Acids
Trait                                      Trait

How many fingers does your alien have?     Does your alien have a tail?
      GENE G                                     GENE H
DNA                                        DNA
mRNA                                       mRNA
Amino Acids                                Amino Acids
Trait                                      Trait

Does your alien have 4 eyes or 8 eyes?
      GENE I
DNA
mRNA
Amino Acids
Trait


Biology- Unit 1                    DRAFT                                     192
                                  ALIEN GENES

This table shows the amino acid sequences for the various alien genes
and traits.

  Gene            Amino Acid Sequence             Resulting
 Letter                                         Characteristic
    A                 Val-pro-ileu         Hairless
                     Tryp-pro-ileu         Hairy
    B                 Tryp-val-val         fat
                      Ileu-ileu-ser        skinny
    C                   Ser-ala            4 legs
                        Ser-ser            8 legs
    D               Pro-ser-phe-gly        Long nose
                    Gln-ser-phe-gly        Short nose
    E                   Lys-phe            No antennae
                        Lys-leu            4 antennae
    F                 Pro-ala-ala          Blue skin
                      Pro-ala-asp          Red skin
                      Pro-ala-val          Yellow skin
                      Pro-ala-pro          Green skin
    G                 Gln-glut-asp         10 fingers
                      Gln-glut-lys         12 fingers
    H                 Gly-gly-ileu         tail
                      ala-gly-ileu         No tail
    I                 Ileu-asp-ala         4 eyes
                      Ser-asp-ala          8 eyes




Biology- Unit 1                   DRAFT                             193
Note to Teacher: This table shows the traits for each of the 30 alien species.

Trait      1   2   3   4   5   6   7   8   9   10   11   12   13   14   15
Hairless   x       x       x       x       x        x         x         x
Hairy          x       x       x       x        x        x         x
Fat        x   x           x   x           x    x             x    x
Skinny             x   x           x   x            x    x              x
4 legs                 x   x   x                x   x    x
8 legs     x   x   x               x   x   x                  x    x    x
Lg nose        x   x   x               x   x    x                  x    x
St nose    x               x   x   x                x    x    x
No ant     x   x                   x   x   x    x                       x
Ant                x   x   x   x                    x    x    x    x
Blue       x               x               x                            x
Green          x               x                x                  x
Red                x               x                x         x
Yellow                 x               x                 x
10 fing    x           x   x       x            x        x    x         x
12 fing        x   x           x       x   x        x              x
Tail               x   x   x   x                x             x    x    x
No tail    x   x                   x   x   x        x    x
4 eyes     x           x           x            x   x         x    x
8 eyes         x   x       x   x       x   x             x              x




Biology- Unit 1                                DRAFT                             194
To the teacher:      This table shows the traits of each of the 30 alien species.

Trait      16   17    18   19   20   21   22    23   24   25   26   27   28   29    30
Hairless        x          x         x          x         x         x         x
Hairy      x          x         x         x          x         x         x          x
Fat             x     x              x    x               x    x              x     x
Skinny     x               x    x               x    x              x    x
4 legs     x    x     x                   x     x    x                   x    x     x
8 legs                     x    x    x                    x    x    x
Lg nose    x                    x    x    x                    x    x    x
St nose         x     x    x                    x    x    x                   x     x
No ant     x    x     x         x    x    x          x    x              x    x
Ant                        x                    x              x    x               x
Blue       x                                    x    x
Green           x                         x               x                         x
Red                   x              x                         x              x
Yellow                     x    x                                   x    x
10 fing               x         x    x               x    x         x         x     x
12 fing    x    x          x              x     x              x         x
Tail            x     x                   x     x    x    x                         x
No tail    x               x    x    x                         x    x    x    x
4 eyes     x    x               x    x          x    x              x    x
8 eyes                x    x              x               x    x              x     x




Biology- Unit 1                                DRAFT                                     195
                  Recovered Sequences = Alien Species #1

GENE A:              CAAGGATAT

GENE B:              ACCCAACAA

GENE C:              AGCAGG

GENE D:              GTCAGGAAACCC

GENE E:              TTTAAA

GENE F:              GGACGCCGA

GENE G:              GTCGTCCTA

GENE H:              CGCCCCTAT

GENE I:              TATCTACGC




Biology- Unit 1                DRAFT                       196
              Recovered Sequences = Alien Species #2

GENE A:           ACCGGTTAT

GENE B:           ACCCAACAA

GENE C:           AGCAGG

GENE D:           GGTAGGAAACCC

GENE E:           TTTAAA

GENE F:           GGACGCGGG

GENE G:           GTCGTCTTT

GENE H:           CGCCCCTAT

GENE I:           AGCCTACGC




Biology- Unit 1            DRAFT                       197
              Recovered Sequences = Alien Species #3

GENE A:           CAAGGATAT

GENE B:           TATTATAGC

GENE C:           AGCAGG

GENE D:           GGTAGGAAACCC

GENE E:           TTTAAC

GENE F:           GGACGCCTA

GENE G:           GTCGTCTTT

GENE H:           CCCCCCTAT

GENE I:           AGCCTACGC




Biology- Unit 1            DRAFT                       198
              Recovered Sequences = Alien Species #4

GENE A:           ACCGGTTAT

GENE B:           TATTATAGC

GENE C:           AGCCGA

GENE D:           GGTAGGAAACCC

GENE E:           TTTAAC

GENE F:           GGACGCCAA

GENE G:           GTCGTCCTA

GENE H:           CCCCCCTAT

GENE I:           TATCTACGC




Biology- Unit 1            DRAFT                       199
              Recovered Sequences = Alien Species #5

GENE A:           CAAGGATAT

GENE B:           ACCCAACAA

GENE C:           AGCCGA

GENE D:           GTCAGGAAACCC

GENE E:           TTTAAC

GENE F:           GGACGCCGA

GENE G:           GTCGTCCTA

GENE H:           CCCCCCTAT

GENE I:           AGCCTACGC




Biology- Unit 1            DRAFT                       200
              Recovered Sequences = Alien Species #6

GENE A:           ACCGGTTAT

GENE B:           ACCCAACAA

GENE C:           AGCCGA

GENE D:           GTCAGGAAACCC

GENE E:           TTTAAC

GENE F:           GGACGCGGG

GENE G:           GTCGTCTTT

GENE H:           CCCCCCTAT

GENE I:           AGCCTACGC




Biology- Unit 1            DRAFT                       201
              Recovered Sequences = Alien Species #7

GENE A:           CAAGGATAT

GENE B:           TATTATAGC

GENE C:           AGCAGG

GENE D:           GTCAGGAAACCC

GENE E:           TTTAAA

GENE F:           GGACGCCTA

GENE G:           GTCGTCCTA

GENE H:           CGCCCCTAT

GENE I:           TATCTACGC




Biology- Unit 1            DRAFT                       202
              Recovered Sequences = Alien Species #8

GENE A:           ACCGGTTAT

GENE B:           TATTATAGC

GENE C:           AGCAGG

GENE D:           GGTAGGAAACCC

GENE E:           TTTAAA

GENE F:           GGACGCCAA

GENE G:           GTCGTCTTT

GENE H:           CGCCCCTAT

GENE I:           AGCCTACGC




Biology- Unit 1            DRAFT                       203
              Recovered Sequences = Alien Species #9

GENE A:           CAAGGATAT

GENE B:           ACCCAACAA

GENE C:           AGCAGG

GENE D:           GGTAGGAAACCC

GENE E:           TTTAAA

GENE F:           GGACGCCGA

GENE G:           GTCGTCTTT

GENE H:           CGCCCCTAT

GENE I:           AGCCTACGC




Biology- Unit 1            DRAFT                       204
              Recovered Sequences = Alien Species #10

GENE A:           ACCGGTTAT

GENE B:           ACCCAACAA

GENE C:           AGCCGA

GENE D:           GGTAGGAAACCC

GENE E:           TTTAAA

GENE F:           GGACGCGGG

GENE G:           GTCGTCCTA

GENE H:           CCCCCCTAT

GENE I:           TATCTACGC




Biology- Unit 1             DRAFT                       205
              Recovered Sequences = Alien Species #11

GENE A:           CAAGGATAT

GENE B:           TATTATAGC

GENE C:           AGCCGA

GENE D:           GTCAGGAAACCC

GENE E:           TTTAAC

GENE F:           GGACGCCTA

GENE G:           GTCGTCTTT

GENE H:           CGCCCCTAT

GENE I:           TATCTACGC




Biology- Unit 1             DRAFT                       206
              Recovered Sequences = Alien Species #12

GENE A:           ACCGGTTAT

GENE B:           TATTATAGC

GENE C:           AGCCGA

GENE D:           GTCAGGAAACCC

GENE E:           TTTAAC

GENE F:           GGACGCCAA

GENE G:           GTCGTCCTA

GENE H:           CGCCCCTAT

GENE I:           AGCCTACGC




Biology- Unit 1             DRAFT                       207
              Recovered Sequences = Alien Species #13

GENE A:           CAAGGATAT

GENE B:           ACCCAACAA

GENE C:           AGCAGG

GENE D:           GTCAGGAAACCC

GENE E:           TTTAAC

GENE F:           GGACGCCTA

GENE G:           GTCGTCCTA

GENE H:           CCCCCCTAT

GENE I:           TATCTACGC




Biology- Unit 1             DRAFT                       208
              Recovered Sequences = Alien Species #14

GENE A:           ACCGGTTAT

GENE B:           ACCCAACAA

GENE C:           AGCAGG

GENE D:           GGTAGGAAACCC

GENE E:           TTTAAC

GENE F:           GGACGCGGG

GENE G:           GTCGTCTTT

GENE H:           CCCCCCTAT

GENE I:           TATCTACGC




Biology- Unit 1             DRAFT                       209
              Recovered Sequences = Alien Species #15

GENE A:           CAAGGATAT

GENE B:           TATTATAGC

GENE C:           AGCAGG

GENE D:           GGTAGGAAACCC

GENE E:           TTTAAA

GENE F:           GGACGCCGA

GENE G:           GTCGTCCTA

GENE H:           CCCCCCTAT

GENE I:           AGCCTACGC




Biology- Unit 1             DRAFT                       210
              Recovered Sequences = Alien Species #16

GENE A:           ACCGGTTAT

GENE B:           TATTATAGC

GENE C:           AGCCGA

GENE D:           GGTAGGAAACCC

GENE E:           TTTAAA

GENE F:           GGACGCCGA

GENE G:           GTCGTCTTT

GENE H:           CGCCCCTAT

GENE I:           TATCTACGC




Biology- Unit 1             DRAFT                       211
              Recovered Sequences = Alien Species #17

GENE A:           CAAGGATAT

GENE B:           ACCCAACAA

GENE C:           AGCCGA

GENE D:           GTCAGGAAACCC

GENE E:           TTTAAA

GENE F:           GGACGCGGG

GENE G:           GTCGTCTTT

GENE H:           CCCCCCTAT

GENE I:           TATCTACGC




Biology- Unit 1             DRAFT                       212
              Recovered Sequences = Alien Species #18

GENE A:           ACCGGTTAT

GENE B:           ACCCAACAA

GENE C:           AGCCGA

GENE D:           GTCAGGAAACCC

GENE E:           TTTAAA

GENE F:           GGACGCCTA

GENE G:           GTCGTCCTA

GENE H:           CCCCCCTAT

GENE I:           AGCCTACGC




Biology- Unit 1             DRAFT                       213
              Recovered Sequences = Alien Species #19

GENE A:           CAAGGATAT

GENE B:           TATTATAGC

GENE C:           AGCAGG

GENE D:           GTCAGGAAACCC

GENE E:           TTTAAC

GENE F:           GGACGCCAA

GENE G:           GTCGTCTTT

GENE H:           CGCCCCTAT

GENE I:           AGCCTACGC




Biology- Unit 1             DRAFT                       214
             Recovered Sequences = Alien Species #20

GENE A:           ACCGGTTAT

GENE B:           TATTATAGC

GENE C:           AGCAGG

GENE D:           GGTAGGAAACCC

GENE E:           TTTAAA

GENE F:           GGACGCCAA

GENE G:           GTCGTCCTA

GENE H:           CGCCCCTAT

GENE I:           TATCTACGC




Biology- Unit 1            DRAFT                       215
              Recovered Sequences = Alien Species #21

GENE A:           CAAGGATAT

GENE B:           ACCCAACAA

GENE C:           AGCAGG

GENE D:           GGTAGGAAACCC

GENE E:           TTTAAA

GENE F:           GGACGCCTA

GENE G:           GTCGTCCTA

GENE H:           CGCCCCTAT

GENE I:           TATCTACGC




Biology- Unit 1             DRAFT                       216
             Recovered Sequences = Alien Species #22

GENE A:           ACCGGTTAT

GENE B:           ACCCAACAA

GENE C:           AGCCGA

GENE D:           GGTAGGAAACCC

GENE E:           TTTAAA

GENE F:           GGACGCGGG

GENE G:           GTCGTCTTT

GENE H:           CCCCCCTAT

GENE I:           AGCCTACGC




Biology- Unit 1            DRAFT                       217
             Recovered Sequences = Alien Species #23

GENE A:           CAAGGATAT

GENE B:           TATTATAGC

GENE C:           AGCCGA

GENE D:           GTCAGGAAACCC

GENE E:           TTTAAC

GENE F:           GGACGCCGA

GENE G:           GTCGTCTTT

GENE H:           CCCCCCTAT

GENE I:           TATCTACGC




Biology- Unit 1            DRAFT                       218
             Recovered Sequences = Alien Species #24

GENE A:           ACCGGTTAT

GENE B:           TATTATAGC

GENE C:           AGCCGA

GENE D:           GTCAGGAAACCC

GENE E:           TTTAAA

GENE F:           GGACGCCGA

GENE G:           GTCGTCCTA

GENE H:           CCCCCCTAT

GENE I:           TATCTACGC




Biology- Unit 1            DRAFT                       219
             Recovered Sequences = Alien Species #25

GENE A:           CAAGGATAT

GENE B:           ACCCAACAA

GENE C:           AGCAGG

GENE D:           GTCAGGAAACCC

GENE E:           TTTAAA

GENE F:           GGACGCGGG

GENE G:           GTCGTCCTA

GENE H:           CCCCCCTAT

GENE I:           AGCCTACGC




Biology- Unit 1            DRAFT                       220
             Recovered Sequences = Alien Species #26

GENE A:           ACCGGTTAT

GENE B:           ACCCAACAA

GENE C:           AGCAGG

GENE D:           GGTAGGAAACCC

GENE E:           TTTAAC

GENE F:           GGACGCCTA

GENE G:           GTCGTCTTT

GENE H:           CGCCCCTAT

GENE I:           AGCCTACGC




Biology- Unit 1            DRAFT                       221
             Recovered Sequences = Alien Species #27

GENE A:           CAAGGATAT

GENE B:           TATTATAGC

GENE C:           AGCAGG

GENE D:           GGTAGGAAACCC

GENE E:           TTTAAC

GENE F:           GGACGCCAA

GENE G:           GTCGTCCTA

GENE H:           CGCCCCTAT

GENE I:           TATCTACGC




Biology- Unit 1            DRAFT                       222
             Recovered Sequences = Alien Species #28

GENE A:           ACCGGTTAT

GENE B:           TATTATAGC

GENE C:           AGCCGA

GENE D:           GGTAGGAAACCC

GENE E:           TTTAAA

GENE F:           GGACGCCAA

GENE G:           GTCGTCTTT

GENE H:           CGCCCCTAT

GENE I:           TATCTACGC




Biology- Unit 1            DRAFT                       223
             Recovered Sequences = Alien Species #29

GENE A:           CAAGGATAT

GENE B:           ACCCAACAA

GENE C:           AGCCGA

GENE D:           GTCAGGAAACCC

GENE E:           TTTAAA

GENE F:           GGACGCCTA

GENE G:           GTCGTCCTA

GENE H:           CGCCCCTAT

GENE I:           AGCCTACGC




Biology- Unit 1            DRAFT                       224
             Recovered Sequences = Alien Species #30

GENE A:           ACCGGTTAT

GENE B:           ACCCAACAA

GENE C:           AGCCGA

GENE D:           GTCAGGAAACCC

GENE E:           TTTAAC

GENE F:           GGACGCGGG

GENE G:           GTCGTCCTA

GENE H:           CCCCCCTAT

GENE I:           AGCCTACGC




Biology- Unit 1            DRAFT                       225
Key Vocabulary:
genes              transcribe    ribosomes
DNA                translate     sequence
amino acids        mRNA
proteins           codons

Language Objectives:
Students will follow along as their teacher reads a passage.
Students will select key terms and concepts from a passage.
Students will orally summarize the passage, including key information.
Students will answer conclusion questions in complete sentences.



                                        Alien     Encounters!- LEP
                           Read the following story aloud with your teacher. Listen
                           carefully. After you have read it together, underline the
                           most important information. Work with your partner to
                           summarize or explain in your own words what the story is
                           about.

Background: In the year 2050, an incredible archeological discovery was made in
the middle of a remote area of South America. It was an area where a large
meteor had struck the Earth. A pile of alien bones were found completely mixed
up together. The explorers who made the discovery immediately informed the
organization known as Scientific Phenomena Over Our Fabulous Sphere (S. P. O. O.
F. S). S. P. O. O. F. S. sent out their best scientists to collect DNA samples. (Yes,
these aliens really did have DNA!) The scientists were able to recover small
fragments of DNA which they brought back to their labs. After much work, they
determined that the DNA fragments represented 9 genes.

Purpose: In this activity, you will determine the traits of the aliens by analyzing
their DNA and determining the amino acid sequences of the resulting protein
fragments. Each fragment is associated with a gene and a specific alien
characteristic (trait).




Biology- Unit 1                    DRAFT                                   226
Procedure:
1. Put the DNA sequence for each gene in the proper location on your data sheet.
2. Transcribe the DNA for each gene into mRNA. Record those sequences.
3. Translate the mRNA into amino acids using the provided mRNA Codon Chart. Record the amino
   acid sequence for each gene.
4. Use the “Alien Genes” chart to determine the traits that are associated with
   each of your amino acids sequences and write those traits on the charts.
5. Using a blank piece of paper, sketch and color your alien, making sure to include
   all relevant (known) traits. (You can add other unknown traits, if you wish.)
   Place your names on your drawing.


Questions:
Write your answers in COMPLETE SENTENCES on the back of your alien picture.
  1. Did you find any “identical” aliens in your group?
  2. What is the difference between transcription and translation?
  3. What are the roles of the DNA, the mRNA, and tRNA in protein synthesis?
  4. Which organelle is responsible for protein synthesis?



Note: The rest of this is identical to the non – LEP version of the Alien
Encounters activity.




Biology- Unit 1                       DRAFT                                       227
After Activity: The teacher should reinforce the concept that DNA is transcribed into
mRNA and then translated into proteins. These proteins then determine traits.

ELABORATE:
The Mutation Activity reinforces students’ understanding of protein synthesis while
allowing them to see how a change in a DNA nucleotide might mean a change in the
amino acid sequence of a protein.

Before Activity: Hypothesize with students what might happen if one of the nucleotides
in a strand of DNA was changed. Help students understand that this would mean a
change in mRNA and might mean that a different amino acid would be inserted into the
chain and that could affect the folding of the protein and ultimately the function of the
protein. Remind students that proteins often function as enzymes catalyzing important
reactions. Enzymes function according to their shape. If the shape changes, then the
enzyme cannot function appropriately that produces a genetic disorder.

Activity Time: 45 minutes

Preparation: Teachers need to copy the mRNA strips and the student hand-out. Each
student should receive four copies of the same mRNA strip. The teacher can make
four copies of a complete page. Then staple the pages together – one staple per strip
number. Then cut the strips out, cutting through all four pages. The result is four
identical strips stapled together- several units per page.


 What are the Effects of Various Mutations on Protein Synthesis?

Competency Goal 3: The learner will develop an understanding of the continuity of
life and the changes of organisms over time.
    3.01 Analyze the molecular basis of heredity including:
     DNA replication.
     Protein synthesis (transcription, translation).
     Gene regulation.


INTRODUCTION TO THE TEACHER:

This exercise provides a simple way of teaching about the molecular basis of
heredity and genetic coding. It also challenges the students to analyze the
effects of various types of mutations on the resulting protein (polypeptide).




Biology- Unit 1                     DRAFT                                     228
The central question of the exercise is how the genetic code is translated into
proteins as part of the Central Dogma of Biology (DNAmRNAProteinsTraits)
and what effect changes in the code (mutations) have on the protein sequence
(leading to possible changes in the trait).

This activity provides the teacher with much latitude in teaching transcription,
translation, and mutation. Some teachers may only want to use the randomly
generated mRNA strands to teach the concept of transcription, translation and
the use of an mRNA “dictionary.” However, the activity is designed as an
exploration of the effects of mutations on amino acid sequences.

Teachers may also choose to have students determine the DNA sequence (both
strands of the double helix) and teach DNA replication. Teachers may design a
“template” upon which students tape their individual strands to form an even larger
protein.

The mutation terms and definitions are purposely not given initially to the students
while they explore the actual effects of manipulating their strands of mRNA.
Teachers may give students the terms after the activity. However, there is no
need for the students to actually learn the names for the different types of
mutations. The main issue is that they understand how various types of mutations
affect the resulting polypeptide and possibly the related trait.

In step 1, each student is given a randomly generated mRNA sequence. The
student translates the sequence into the correct sequence of amino acids to form
a polypeptide. Each sequence begins with and initiation codon (AUG) and ends with
one of the three termination codons (UAA, UAG, or UGA).

In steps 2-4, each student changes the mRNA sequence in ways that simulate some
of the types of mutations. The student is challenged to determine the mutations
that have the most devastating effect on the resulting polypeptide and then to
think about the implications for the expression of the trait.




Biology- Unit 1                   DRAFT                                  229
Point mutations:

Step 2 has the students do a transition mutation by changing every cytosine that
is the last/third base in a codon to a uracil. A transition mutation is a purine to
purine or pyrimidine to pyrimidine shift.

Step 3 has the students do a transversion mutation by changing every cytosine
that is the last/third base in a codon to an adenine. A transversion mutation is a
purine to pyrimidine or pyrimidine to purine shift.

Frameshift mutation (insertions and/or deletions):

Step 4 has the students add one extra base (adenine) after the initiation codon.

Teachers may introduce the difference between missense mutations and nonsense
mutations. Missense mutations occur when the amino acid sequence may still make
sense after a mutation but not necessarily the right sense. Nonsense mutations
occur when a transversion results in a premature termination codon that truncates
the protein and renders it nonfunctional.

Students should discover the degeneracy (redundancy) of the genetic code. (Some
mutations do NOT result in a change in the amino acid sequence since there are
multiple codes for some amino acids.

Activity designed by Gordon Plumblee, Western Alamance High School, Elon
College, NC Adapted by Judy Jones, East Chapel Hill High School, Chapel Hill, NC




Biology- Unit 1                   DRAFT                                   230
Student Activity: What are the Effects of Various Mutations on
Protein Synthesis?

INTRODUCTION: In this activity you will be translating strands of mRNA into
small sequences of amino acids. You will also be experimenting with various types
of mutations and trying to determine which mutations cause the greatest change in
the polypeptide sequence.

STEP 1: Take your strand of mRNA and using a standard “dictionary” of mRNA
codons, translate your mRNA into the correct sequence of amino acids.

Questions:
1. What did you discover about first codon in your sequence?

2. Check with some of the students near you. What is the first codon in their
   sequence?

3. What would you hypothesize about all strands of mRNA that code for proteins?

4. What did you discover about the last codon in your sequence?

5. Check with some of the students near you. What is their last codon and what
   does it do?

6. What would you hypothesize about the last codon for all strands of mRNA that
   code for proteins?



STEP 2: Take another copy of your strand of mRNA and change every C that is
the third base in a codon to a U. Now translate the new mRNA into a polypeptide
sequence.

Example: AUG/ACU/GUC/CAG/UCA/UCC/ACU             (The underlined C’s would be
changed to U’s.)

7. What did you discover about your new polypeptide strand (compared to the
   original)?



Biology- Unit 1                  DRAFT                                 231
Collect some class data:

      Number of strands with premature STOP codon        ________

      Number of strands with no new amino acids          ________

      Number of strands with 1 new amino acid            ________

      Number of strands with 2 new amino acids           ________

      Number of strands with 3 new amino acids           ________

      Number of strands with 4 or more new amino acids ________

8. How do you explain that some students had strands with no new amino acids?



STEP 3: Take another copy of your strand of mRNA and change every C that is
the third base in a codon to an A. Now translate the new mRNA into a polypeptide
sequence.

Example: AUG/UCC/CUU/AUC/ACU/GUC                 (The underlined C’s would be
changed to A’s.)

9. What did you discover about your new polypeptide (compared to the original
   AND to the polypeptide from step 2)?

Collect some class data:

      Number of strands with premature STOP codon        ________

      Number of strands with no new amino acids          ________

      Number of strands with 1 new amino acid            ________

      Number of strands with 2 new amino acids           ________

      Number of strands with 3 new amino acids           ________


Biology- Unit 1                  DRAFT                                  232
      Number of strands with 4 or more new amino acids ________

10. How is the class data from Step 3 different from the class data from Step 2?

11. Which step seemed to result in the greatest number of changes in the
    polypeptide?

12. How do you explain the reason for your answer to question 11?



STEP 4: Take another copy of your mRNA strand. This time add one extra base
(A) immediately after the START codon in your mRNA sequence. Translate this
into a new amino acid sequence (polypeptide).

13. How does this polypeptide differ from the original and the ones you created in
steps 2 and 3?

Collect some class data:

      Number of strands with premature STOP codon        ________

      Number of strands with no new amino acids          ________

      Number of strands with 1 new amino acid            ________

      Number of strands with 2 new amino acids           ________

      Number of strands with 3 new amino acids           ________

      Number of strands with 4 or more new amino acids ________

13. What did you discover about the type of mutation where a single base is
    inserted into the mRNA sequence.

14. What would have happened to the polypeptide if you had deleted a single base
    instead of inserting a base at the same location in the mRNA sequence?




Biology- Unit 1                   DRAFT                                 233
15. What would have been the results if the insertion or deletion of a base had
    happened near the end of the mRNA sequence?

GENERAL QUESTIONS:
16. What effect would these various mutations have on the trait that is controlled
    by the protein that is produced from the mRNA?

17. Summarize what you have learned about mutations and their effect on the
    resulting polypeptide.




Biology- Unit 1                   DRAFT                                  234
1.
AUGCUCUCUGGAUACCGCAAGCGAAACGGCAAUGGGGUAUUGGCACAGGACAAA
GCUUUGUAUGGUUAA



2.
AUGUUUGCUCCGUUUUACCCUUAUUCGAACACAGACUCCGAGUUGACAGGGGG
CUACAAAGAAUAUUAG



3.
AUGCCUCCGUUUAAGUAUCUAAUCCGGUUGAUACCAGACUACGAGAAGUUAGCU
AUAUCUACAGCGUAG



4.
AUGUCGACCCAAUGUCUGUGUAUUACGCAGUCUAUCCAAAACAUUACUCAUGUA
GAUUCUCUGCGGUGA



5.
AUGCUGUGGGGGCCGAUGCGGCAGUGGGAAGACUACGUGGGGCCACUGGGGU
ACGAAUUGAUAACUUAA



6.
AUGAGCACUCCAUCACACUACGUUAGGGGGAGCAGGAGCCUUCGGUAUGUGAU
GGCCGCGAAGGGAUAA



7.
AUGGCACAGGAGAGCCAGCAGACGUUCCCCGUGACUGCCCUCCUAAGUACCCUC
GCCGAGACGGAUUAG



8.
AUGCUGUACCCAGACAAAGAAUUCUUUUACGACAGAGCAGGACAGGGCAGACAG
GCAUGGUUAGAUUAG




Biology- Unit 1       DRAFT                        235
9.
AUGGAUGUUAUUCGUUACCCGAGUGAGACCAAUAGCCAGCAAAACUCUACUUUU
AUGGAUUGGAACUGA



10.
AUGACGUGUACGUACUCGUACAUCCGCCCACGUCGAAACAGAAGUAGCAGUCUG
ACGGGCGUACAAUAA



11.
AUGGUGUCCGCGUCACCUGUGGAUCGGACUCAUGAGUGGAUGGGUACCCAACA
ACACUGGCUCACGUAG



12.
AUGGCUAGGCGGACGGCGCUUACAGUGCCUGUCCAUUACAAUGUGACGUAUGU
AGAACCCGUCAUUUAA



13.
AUGGGGGUGGACCUCAAGAAUUCUCGCAUCACUCAUGAUGGGGCGGCCCUAAA
AACGGGAGACAUUUGA



14.
AUGCCAUGUCCCCAGACGCUCGCCUUUUCGUUACUUAUGGUGUACUUACAUCAU
UCCAUCUCACUCUAG



15.
AUGCACCGCAAAUACUACGCACGAGAUGCAAUGCGCAAAUCUUUGAUCUCUACC
GCUAUCUCUGGGUAG



16.
AUGUCCCGGUUACGUGGCAACGCGAACCCUCCGAACUCUUAUGCAGUGGAGCC
UAGUUCAGCUGUCUAA



17.
AUGGUAGGUCGCAUAGGGGACUUCAAAUAUGCCGGAGAUUCGUUACUGCUGCA
CCGCGCCAUUGCUUGA


Biology- Unit 1       DRAFT                         236
18.
AUGUCACGCAUUACCAAAGCCGUCCAGUCCAAGCGAGACAUCAUACGGAUGCUU
GCGCCAUAUCUUUAA



19.
AUGGAUAGCAUGCUGACCUUACAGCUGGAUACAUCGAACGCACGGAUUUCUGC
GACUCACUUAUUCUAG



20.
AUGCGACUUUACACCAAUGGCUUAAUGCCUGCGUAUAGUUGUAUUGCUGUUGA
GUAUCGCAAAACAUAA



21.
AUGUUCGCAUUCUGUGCCAACGAUGCAAUACCCUUAAGAGGCCACGGCUACUCG
CCUCUGGUCGGAUGA



22.
AUGUCGAGGACCUUCCCUGUCACCUCAAAGAGUUACCCCCUCGAAGUCGUGUCG
AUCGUGAAUCGCUAG



23.
AUGGGUGGAUCGUCCAACAAUAGGACGAAAAACUUGCUCUUUCCCAAUGCUUAC
ACUCGGGGUGCGUAA



24.
AUGGAGGCGUUCCGGAAACACGCAACUAUGCCAUUAGUCUGCGAUCCGGGUCC
CAACAAUAGGAGUUGA



25.
AUGGGUAAUAACUUAUUGCAACAUCCCGUGUUGACUCUAAGGAGUCGUUUGGC
UUAUUCACUGCUCUAA




Biology- Unit 1       DRAFT                        237
26.
AUGGGCUUAACAGGAGACUUUCAGCGCAGCUCAGGCGUCCCGUACAGGCGUCC
CCCUAAUAAAGCAUGA



27.
AUGGCGGGACGCAGUUUCAAAUUUAGGGCGAACCAGACGAGAAUUCGCACAGG
CCGUUCACUGAUGUGA



28.
AUGGAACUGCGUGGGAUAGUCGCGGGGCACUUAGCCCACGUUCAGUGUACAUC
GCACAAAUAUUUAUAA



29.
AUGUCCCGGCGGGCCCGAUGCAGGGCAUCGAAAGACACUAGACCGAAUUUCGA
GUCAAGUGCUGCCUGA



30.
AUGGAUUACAACUUUGAUACCCUGGUAUGGAUCGUACGGAGAUAUUUAGCUCU
CUUAGAUCCGUUAUGA



31.
AUGCUAGUGCCCAUCCCGUUUAUCAACGCCGACAUUCUCUGUGUAGCCCCUCUU
CGUGGCAUGCCAUGA



32.
AUGAACUUUAUCGACCAGGAUCAUUACACAGGCUCUGACAUAUUGCCAAGAGGC
GUUAGAAUAUUAUGA



33.
AUGUCUACCCACUUUUGGGAGAGAACUGGACCUGAGUUACAUCUUGAGGCGCA
CGACCUUGGUCGGUAA



34.
AUGGGACAUUGUAAGGUAUUCUGUGACGGAAUCUGUGUCCUAGUCCAGGCUAU
CUUACAGUCCCACUAG


Biology- Unit 1       DRAFT                        238
35.
AUGUGUCUCAAAAUCAAUACCAAGAGUAGAUGUAAGGCCGAGGCGAUGAAUAUC
ACGUCUAGGACCUUAUAA



36.
AUGCCCACAGAGAUUUCGCACCGUAAGCGGGUGGUGAUCACUGAAGCUAUAAG
GAGAUGGAGUUAUUAG



37.
AUGGAGAUGGCAAAGGCUUACAGGAUACUUGAUACAUCCUUGGGAGCUACGCC
GUCUGGUCACCCAUAA



38.
AUGCAAUACCUUCAGCGCUCCAUUGAUAUUCAAACGCGCACCGCAGUACGGCAG
AUAUCUCCCGUCUAG



39.
AUGCAAUACCUUCAGCGCUCCAUUGAUAUUCAAACGCGCACCGCAGUACGGCAG
AUAUCUCCCGUCUGA



40.
AUGUCGAGUCCCAAUUGCGGUAGUCGCGGUACACUUCAAUCUGAUAGCUCGAU
AAUCAUGCAUAGCUAA




After Activity: Once students have translated the sequences, collect class data.
Discuss with students the types of mutations that cause an amino acid sequence to
change. Reinforce the concepts that were discussed before the activity.

ELABORATE:
Before Activity: The websites on this handout help teach about cell specialization and
gene regulation. Have students think about why one fertilized egg cell can become the
great variety of cells found in human tissues. Also have them think about why only
certain cells produce certain products – for example, why are the cells in the digestive
system the only ones that produce digestive enzymes even though all cells have the



Biology- Unit 1                     DRAFT                                            239
same DNA which carries the information for making all cell products. Explain that
students will be using two websites to explore these questions.

Activity Time: 60 minutes (LEP students will likely require more time and
substantial teacher support)

Preparation: Access to computer and projection device is needed. Again check the
computers in advance to be sure they can run the animations the students will be
directed to.


     Cell Specialization and Control of Gene Expression Web Quest

Topic: Cell Specialization
A. Go to: http://learn.genetics.utah.edu/units/stemcells/
Click on “What is a stem cell?” Follow the animation through to the end.

1.   What is a stem cell?

2. What causes a stem cell to become different kinds of cells?

3. What is the relationship between signals, genes, cell types, and proteins?

4. List all of the different cells that are described and also give their functions.


Topic: Control of Gene Expression
B. Go to:
 http://www-class.unl.edu/biochem/gp2/m_biology/animation/m_animations/gene2.swf
Click the right hand arrow to move through the animation. Answer the following questions.

1. Where does protein synthesis begin?

2. What information do chromosomes contain?

3.   How is this information encoded?

4.   What is the function of mRNA?

5.   What does the promoter do?

6.   What are the three regions of a gene?

7.   What does RNA polymerase do?

8.    Describe the transcription process in terms of the three regions of the gene.



Biology- Unit 1                           DRAFT                                             240
9.     What would happen if there was a molecule that blocked the promoter?

10. What would happen if there was a molecule that unblocked the promoter?

11.    Would there ever be an advantage to blocking a promoter?

12. Describe how cell that is not in the digestive system (for example, a brain cell) might avoid
       producing unnecessary digestive enzymes.




After Activity: Summarize with students that signals cause genes to produce proteins
that lead to differentiation and specialization. Summarize with students the idea that
promoters can turn on genes but that genes can also be blocked by the very products
that they are coding for.


SUMMATIVE EVALUATIONS:

Summary Foldable

Activity Time: 60 minutes

Preparation: Teachers will need to accumulate construction paper, markers and similar
supplies.

Before Activity: Students will do a final foldable that includes all of the concepts from this unit.
Teachers should focus on concepts and objectives from the state biology curriculum. Of
particular importance would be the essential questions at the beginning of the unit and the
guiding questions for each activity.

After Activity: Teachers might want to give a culminating test. Sample assessment items are
provided below.

Unit 1 Wrap-Up---Guiding Questions Presentations
 Language Objectives:                 Students will:
          discuss topics with team members.
          create a presentation.
          orally present their work to the class.



      UNIT 1 WRAP-UP PRESENTATIONS---GUIDING QUESTIONS FROM
                              UNIT 1
Assign a group of questions to each team of 2-3 students. Students should create a
presentation that addresses the concepts in the questions. Presentation ideas include posters,
diagrams, power points, paragraphs, skits, poems, raps, songs, etc.


Biology- Unit 1                            DRAFT                                                    241
Students must be prepared to share their work with the class.

QUESTION SET 1
What are the nutrients that are found in various foods and how do we test for them?
What is the structure and function of each of the essential nutrients?
How do the macromolecules relate to each other?


QUESTION SET 2
What is the connection between nutrient molecules and energy?
Where does energy fit into the concept map?


QUESTION SET 3
Why do cells come in such a great variety?
What happens to the image of an object when viewed through a microscope?
What are some of the differences and similarities between plant and animal cells?


QUESTION SET 4
What are some of the important structures that determine the functions of various cells?
How do the organelles in a cell interact to produce optimal functioning of that cell?


QUESTION SET 5
How do different organisms reproduce?
What is the relationship between cell size and cell division?


QUESTION SET 6
What are the primary stages in the cell cycle?
How is mitosis more like a video rather than a slide show?
What are the similarities and differences between mitosis and meiosis?


QUESTION SET 7
Is DNA found in all species? What does it mean?
What is the basic structure of DNA? What parts are the same and what parts are variable?
What were the major discoveries that led to understanding the structure of DNA?


QUESTION SET 8
What are the major functions of DNA and how do they work?
What is the relationship between DNA, mRNA, proteins, and actual traits?




Biology- Unit 1                         DRAFT                                              242
 UNIT 1 WRAP-UP PRESENTATIONS---GUIDING QUESTIONS FROM
                                         UNIT 1- LEP
Assign a group of questions to each team of 2-3 students. Students should create a
presentation that addresses the concepts in the questions. Presentation ideas include posters,
diagrams, power points, paragraphs, skits, poems, raps, songs, etc.

Students must be prepared to share their work with the class.

QUESTION SET 1
What are the nutrients that are found in various foods and how do we test for them?
What is the structure and function of each of the essential nutrients?
How do the macromolecules relate to each other?


QUESTION SET 2
What is the connection between nutrient molecules and energy?
Where does energy fit into the concept map?


QUESTION SET 3
Why do cells come in such a great variety?
What happens to the image of an object when viewed through a microscope?
What are some of the differences and similarities between plant and animal cells?


QUESTION SET 4
What are some of the important structures that determine the functions of various cells?
How do the organelles in a cell interact to produce optimal functioning of that cell?


QUESTION SET 5
How do different organisms reproduce?
What is the relationship between cell size and cell division?


QUESTION SET 6
What are the primary stages in the cell cycle?
How is mitosis more like a video rather than a slide show?
What are the similarities and differences between mitosis and meiosis?


QUESTION SET 7
Is DNA found in all species? What does it mean?
What is the basic structure of DNA? What parts are the same and what parts are variable?
What were the major discoveries that led to understanding the structure of DNA?


QUESTION SET 8
What are the major functions of DNA and how do they work?
What is the relationship between DNA, mRNA, proteins, and actual traits?



Biology- Unit 1                         DRAFT                                              243
XII. Sample Assessment Questions

Goal 2.01
1. An unknown solution was tested for four nutrients. See Table 1 for the results. Which
nutrient was not present?
        a. glucose
        b. protein
        c. starch
        d. lipid

Nutrient Test            Results
Iodine                   Blue/black color
Benedicts                Orange color
Biuret’s                 No color change
Brown Paper Bag          Spot mark left

2. Which nutrient would be most helpful for an athlete immediately before an event?
     a. carbohydrate
     b. lipid
     c. protein
     d. nucleic acids

Goal 2.02
1. Using a microscope, what happens to the viewed image of a specimen when you change
from low to high power?
       a….less of the specimen is seen but in greater detail
       b. more of the specimen is seen and in greater detail
       c. less of the specimen is seen and in less detail
       d. more of the specimen is seen but in less detail

2. If a disease results in the thickening of the plasma membrane, what function would be
most directly affected?
       a. intake of water
       b. production of proteins
       c. production of ATP
       d. storage of lipids




Biology- Unit 1                       DRAFT                                                244
Questions for 3.02

1. List the correct order for the stages of mitosis shown in the diagram.




       a.      B, E, C, D, A
       b.      C, B, E, A, D
       c.      A, B, C, D, E,
       d.      D, C, B, A, E




Biology- Unit 1                         DRAFT                               245
2. Which of the processes below would produce cells with the greatest variety?




       a.   process on the left
       b.   process on the right
       c.   Neither would produce cells with variety
       d.   Both would produce cells with variety

Questions for 3.01

1.   Given the following DNA strand, what would the mRNA strand be?
            T A C G T T G C A

       a.   T   A   C   G   T T G C A
       b.   A   U   G   C   A A C G U
       c.   A   T   G   C   A A C GT
       d.   U   T   G   C   U U C G T


 2. Using the provided mRNA codon chart, give the correct amino acid sequence for the
following mRNA strand:

       A U G U A C G A G U A G




Biology- Unit 1                         DRAFT                                           246
 a.   Methionine      Tyrosine     Glutamic acid   Stop

 b.   Isoleucine      Tyrosine     Glutamic acid   Cysteine

 c.   Tyrosine        Methionine   Leucine         Phenylalanine

 d.   Glutamic acid   Tyrosine     Methionine      Stop




Biology- Unit 1                  DRAFT                             247

						
Other docs by fjhuangjun
教你看懂内存编码
Views: 27  |  Downloads: 0
How To Select The Right Scale Fo
Views: 1  |  Downloads: 0
Maryland Traumatic Brain Injury
Views: 134  |  Downloads: 0
Gatrell Auction 6-27.pub
Views: 38  |  Downloads: 0
harddisk_ flash drive Easy Rec
Views: 1016  |  Downloads: 5
Dying bamboo plants threaten wil
Views: 26  |  Downloads: 0
Deployment from Ft Lewis Packing
Views: 53  |  Downloads: 0
Festive Decorations License Cond
Views: 23  |  Downloads: 0
Lutador No Gi Rules There is nev
Views: 7  |  Downloads: 0
Lovely Professional University_ - DOC
Views: 130  |  Downloads: 0