Get documents about "HOTS Question Bank Format
Document Sample
HOTS Question Bank Format
Grade : 12 Subject: BIOLOGY
Chapters/Concepts: REPRODUCTION
Se.No Question/s *Apl/An/Sy/EV Value Points Pointswise
. marks
Q1. If the chromosome number in Ophioglossum‟s gamete is analysis 2n number ie.1260 1
630 what would be the chromosome number in its
meiocyte?
2. How many micro sporangia are found in one theca of a An. two 1
typical angiosperm?
3. Why does the pollen grain from a guava flower fail to Ev. the pistil rejects the pollen by 1
germinate on a mango flower? preventing the pollen
germination
4. Why should emasculated flowers have to be covered Ev to prevent contamination of its 1
with a bag? stigma with unwanted pollen
grains
5. Why is womb or the uterus considered as an ideal place Sy the uterus has layers such as the
for the development of the young one instead of the myometrium-muscular layer and 2
ampullary – isthmic junction? the glandular layer called the
endometrium that facilitates the
development of the young one.
6. How are identical twins formed even if there is a release Sy The zygote formed after 1
of only one egg from the ovary? fertilization gets to divide and
form two separate embryos.
7. Why is implantation in the fallopian tube dangerous? 1
Sy
The fallopian tube can get
damaged and is a potential risk
to the mother‟s health as the tube
fails to facilitate the
development of the young one. 1
8. How are multiple entries of sperms into an egg Ap. With the entry of one sperm
prevented? changes are induced in the zona
pellucida of the ovum that
blocks the entry of the sperm.
2
9. Why is it advantageous that during spermatogenesis, Sy. The sperms have to pass through
each spermatogonium gives rise to four spermatids and the cervix and enter in to the
in Oogenesis in most cases a single ovum is formed from uterus and finally reach the
a oogonium? junction of the isthmus-
ampullary junction.not all
sperms are able to accomplish
this and so it is advantageous for
the sperms to be produced in
large numbers. One egg
enhances proper development of
the young one.
Chapters/Concepts: GENETICS AND EVOLUTION Sy. 3‟-5‟ strand is the template 2
10. 3‟ UUUGUGGCGGAGGGGAGUGAC 5‟ strand and the other 5‟-3‟ strand
The above strand shows a stretch of DNA strand, is the coding strand.
a) Identify whether it is the template or coding strand. The template strand is the base
b) Write down the nitrogen bases that form the 5‟-3‟ for the formation of the m-RNA
strand. strand.
c) Write down the nitrogen bases of the m RNA strand.
11. The DNA strand shows the following codons GCG GGA GGC GGC AGC
GCGGGGAGGCGGCAGCAUUCGAAG Sy. AUU CGA AG 2
Show how the reading frame would change by The codons have changed due to
frameshift deletion. the deletion of the 3rd
nitrogenbase of the first codon.
Chapters/Concepts: HUMAN HEALTH AND Also AG does not code for
DISEASE anything.
12. Why is SCP more efficient to meet the demands for Ev. Microbes like spirulina can be
proteins than the conventional sources of eggs fish or grown easily
meat? Rich in proteins, carbohydrates, 2
Reduces environmental pollution
as they are grown on materials
like waste water from potato
processing plants.
13. Why is it better for keeping beehives in crop fields An. Increases pollination efficiency 1
during flowering period? and improves the yield
Chapters/Concepts:BIOTECHNOLOGY
14. Why is it advantageous to use the DNA polymerase Ev. It is thermostable and does
from Thermus aquaticus for PCR? remain active during the high
temperature induced 1
denaturation of double stranded
Milk produced by the first transgenic cow has been used DNA.
15. for the treatment of PKU. Name the protein it contains. Ev. 1-antitrypsin.
Chapters/Concepts:ECOLOGY
When an oxo- biodegradable additive is added to make
16. plastic bottles, it makes it completely biodegradable. An. It helps to reduce the amount of 1
What would be the advantage of such a modification? plastic waste in landfills.
Sl. Questions Apl / An / Value points Point
No: Sy / Ev wise
marks
1. Which are the three 1. Vegetative, reproductive
clear cut phases in the and senescent phase. 1
life of annual and
biennial plants? Why is Analysis 2. Vegetative growth
it difficult to define continues throughout the
these phases in year for many years. ½x4=2
perennial plants? Senescence occurs during
all times of the year.
Flowering occurs at a
season of the year.
More vegetative growth in
favourable seasons.
(3)
2. Suraj wants to Rhizomes are the modified
commercially stems in banana.
propagate banana in his Nodes are present on the
field. Suggest a Application rhizome and when they 1
technique and mention come in contact with damp
the advantage of this soil or water, they produce
process. roots and new plants.
Advantage – offsprings are 1
identical to the parent.
(2)
Chapter / Concepts – Sexual reproduction in flowering plants.
Sl. Questions Apl / An / Value points Point
No: Sy / Ev wise
marks
1. Both water hyacinth In water hyacinth; flowers
and Vallisneria are emerge above the level of 1
hydrophytes. How do water and are pollinated by
their pollinations Analysis insects or wind.
differ? In Vallisneria, the female
flower reach the surface of 1
water and pollen grains are
released on to the surface
of water.
(2)
2. Bring out the Production of hybrid seeds
significance of is costly and is too 1
apomicts in hybrid seed expensive for farmers.
industry. Synthesis In apomicts, no segregation
of characters occur in the 1
hybrid progeny.
So farmer does not have to
buy hybrid seeds every
year.
Name two parasitic Striga, Orobanche. 1
species of plants which
produces fruits with (3)
many seeds.
Chapter / Concepts – Human reproduction.
Sl. Questions Apl / An Value points Point wise
No: / Sy / Ev marks
1. If 20 primary spermatocytes are present, how
many spermatozoa will be produced?
80 spermatozoa 1
How many ova will be produced from 20
primary oocytes?
How many chromosomes will be present in the
second polar body of humans? Synthesis 20 ova 1
23 1
(3)
2. The first trimester of pregnancy is the most All the major organ systems are formed at
important part of the period of gestation. the end of the first trimester of pregnancy. 2
Comment. At that time, the foetus is sensitive to
Applicatio anything that interferes with the cell
n division, cell migration and
differentiation.
The uterine contractions of a woman at the end
of pregnancy are slow. What do you think the Oxytocin 1
doctor will inject to induce delivery? (3)
Chapter / Concepts – Reproductive health.
Sl. Questions Apl / An Value points Point wise
No: / Sy / Ev marks
1. How is the action of Multiload 375 different from Multiload 375 is copper releasing IUD which
that of LNG 20? suppresses sperms mobility and fertilizing 1
capacity of sperms.
Analysis LNG-20 is hormone releasing IUD which
makes the uterus unsuitable for implantation
and cervix hostile to sperms.
1
(2)
2. Identify the techniques of ART mentioned below.
a) Introduction of embryo with 8 blastomeres into the
fallopian tube.
Zygote intra fallopian transfer. (ZIFT) 1
b) Injecting the sperms directly into the ovum.
Applicatio
n
Intra cytoplasmic sperm injection. (ICSI)
1
(2)
Chapter / Concepts – Principles of inheritance and variation.
Sl. No: Questions Apl / An / Value points Point
Sy / Ev wise
marks
Gg When a pea plant with green pod and round Gg Rr and Gg rr (P)
1. seed was crossed with another pea plant with 1
Gametes
green pod and wrinkled seed, the phenotypic Gr gr
ratio obtained was 3:3:1:1. Find the genotype of Application
the parents and represent the cross with a parent
square. GR Gr gR gr
G
g
Gr gR gr 2
GR
Progeny
Gr
GGRr GGRr GgRr Gg rr
GgRr Ggrr ggRr ggrr
gr
3 green pod round seed :3 green pod wrinkled seed: 1
yellow pod round: 1 yellow pod wrinkled seed.
(3)
2. The karyotype of a child showed three copies of
the 21st chromosome. Identify the genetic Down‟s syndrome 1
disorder and enumerate 2 symptoms of the
disorder.
Synthesis Short stature with small round head.
Broad palm with characteristic palm crease. 1
(2)
Chapter / Concepts – Molecular basis of Inheritance
Sl. Questions Apl / An / Value points Pointwise
No: Sy / Ev marks
1. The coding strand of DNA in a transcription unit - AUG GGA AUC UAC UGA -
is as follows 1
5'-ATG GGA ATC TAC TGA-3' Application
4 amino acids 1
Which will be the mRNA transcribed?
How many amino acids will it code for?
(2)
2. A given segment of double stranded DNA has
20% cytosine. What will be the percentage of Guanine – 20% ½x3
other nitrogen bases?
Adenine – 30% 1½
What is the use of Severo Ochoa enzyme? Evaluation
Thymine – 30%
Polymerisation of RNA with defined
sequence in a template independent manner. ½
(2)
Chapter / Concepts – Evolution
Sl. Questions Apl / An / Value points Point
No: Sy / Ev wise
marks
1. Pesticides are effective only for a limited period. Natural selection.
Justify the above statement citing a suitable
example. When DDT was first used many mosquitoes ½x4
Evaluation died.
Those with resistance to DDT survived and
reproduced.
Offsprings were resistant to DDT and were
selected to survive.
(2)
2. What is the evolutionary significance of the
Coelacanth fish caught in South Africa in 1938? Lobe finned fish – Evolved into amphibians. 1
Application (1)
Chapter / Concepts – Human health and disease
Sl. Questions Apl / An / Value points Point
No: Sy / Ev wise
marks
1. a) What type of treatment is given to a patient Passive immunization. 1
suffering from tetanus?
b) Where does the fertilization and development of Synthesis 1
malarial parasite occur?
Intestine of female mosquito.
c) Identify 2 species of Fungi causing ring worm.
1
Trichophyton and Microsporum (3)
2. In your opinion, which are the factors that Stress from pressures to excel in
contribute to alcohol or drug abuse among Evaluation academics. ½x4
adolescents?
Peer pressure
Curiosity and experimentation.
Television, movies, newspapers, internet.
(2)
Chapter / Strategies for Enhancement in Food Production.
Sl. Questions Apl / An / Value points Point wise
No: Sy / Ev marks
1. Rama observed a few virus affected potato plants 1. In vitro culturing of virus free meristems
in a vegetable garden. Can you suggest a suitable 1
method to obtain healthy virus free plants from 2. Tissue culture
such diseasd ones. Name the technique employed Applicaton 1
in this method.
(2)
2. Insect resistance in host crop may be plants may 1)Solid stems of wheat lead to non
be due to morphological, biochemical or preference by stem sawfly
physiological characteristics. 1
1)How wheat is able to resist stem sawfly? Analysis 2)Himgiri
2)Which is the wheat variety developed by plant 1
breeding that is resistant to leaf stripe rust and hill
bunt.
(2)
Chapter / Microbes in Human Welfare.
Sl. Questions Apl / An / Value points Point wise
No: Sy / Ev marks
1. The doctor prescribed cyclosporin A for a patient 1)Cyclosporin A is used as an
who have undergone kidney transplantation. immunosuppressive agent in organ 1
Why? Mention the source of industrial production transplant patients.
of this biomolecule. Application
2)This bioactive molecule is produced by
the fungus 1
Trichoderma polysporum
(2)
2. Bacillus thuringiensis can be introduced to
control butterfly caterpillars. This is an 1) Biological control ½
ecofriendly method that can be used in agriculture
for pest control. Evaluation 2) Natural predation ½
1) Identify the method
2) Which is the biological principle behind this
method
(1)
Chapter / Biotechnology: Principles and Processes.
Sl. Questions Apl / An / Value points Point wise
No: Sy / Ev marks
1. In a bacterial culture some of the colonies
produced blue colour in presence of chromogenic 1)Those which developed
substrate and some did not developed colour. colour are the non recombinant colonies and 1
those which did not develop any colour are
1) What do you infer from this? the recombinants
2) Mention the mechanism 2) Insertional inactivation
Synthesis 1
(2)
2. Agrobacterium tumifaciens is known as natural
genetic engineer of plants. Gene transfer is happening in nature without 1
Give reason human interference.
Evaluation
(1)
Chapter / Biotechnology and its Applications.
Sl. Questions Apl / An / Value points Point wise
No: Sy / Ev marks
1. A blood test done for a 2 year old girl showed a 1) Adenosine deaminase deficiency
genetic disorder with decreased number of ½
circulating lymphocytes. 2) Gene therapy.
Identify the disorder and suggest a suitable Application ½
therapeutic measure for this.
(1)
A multinational company outside India tried to 1) Biopiracy ½
sell new varieties of ginger without proper patent
rights. What is such an act referred to ? Explain 2) Foreign companies using local resources
it. or traditional knowledge without paying any
remuneration.
Application
½
(1)
Chapter / Organisms and Populations.
Sl. Questions Apl / An / Sy Value points Point wise
No: / Ev marks
1. Barnacles are seen growing on the back of a 1) Commensalism- an interaction in which 1
whale. one species benefits and the other is neither
How do you describe this interaction.? Synthesis harmed nor benefited.
Barnacle is benefited in this interaction.
(1)
2. Consider a pond having 30 lotus plants last year .
Through reproduction 8 new plants are added Analysis Birth rate 1
taking the current population to 38. Which
population attribute is described here ? (1)
Chapter / Ecosystem.
Sl. Questions Apl / An / Value points Pointwise
No: Sy / Ev marks
1. Fill in the missing stages in the primary xerarch
succession. a. Lichens 1
Analysis c. Herbs
a Mosses c d e
d. Shrubs
e. Trees
(1)
2.
In a food chain the producer is a huge tree. The
primary and secondary consumers are many small
birds and many parasites of birds respectively. Parasites 1½
Construct a suitable pyramid of number for the Analysis
given food chain. What kind of pyramid of Birds
energy would it have ? ½
Tree
(2)
2) Pyramid of energy is upright
Chapter / Biodiversity and Conservation.
Sl. Questions Apl / An / Value points Point wise
No: Sy / Ev marks
1. There is an urgent need to save Indian cheetah Ex Situ conservation where threatened
from extinction which is considered as an species are conserved outside their natural
endangered species. Which is the most desirable habitat. 1
conservation method you can adopt here ? Evaluation
(1)
2. Amazonian rain forest in South America is called
the „lungs of the plant‟ Why ? Analysis 1) It is so huge having the greatest 1
What is its present condition ? biodiversity on earth harbouring millions of
species.
2) The forest is being cleared for cultivating 1
soya beans or for conversion to grass lands
for raising beef cattle.
(2)
Chapter / Environmental Issues.
Sl. Questions Apl / An / Value points Point wise
No: Sy / Ev marks
1. A factory drains its waste water containing Application These are toxic substances which undergo 1
mercury and cadmium into nearby lake. How biological magnification
does it affect the aquatic food chain ?
(1)
2. Sample A has more amount of organic
You are provided with two water samples A and Application matter. 1
B . Sample A is found to have higher BOD value. The BOD test measures the rate of uptake of
Which water sample has more amount of organic oxygen by micro organisms in a sample of
matter ? Why ? water and thus, indirectly, BOD is a
measure of organic matter present in the
water.
(1)
Chapters / Concepts : Unit I – Sexual Reproduction
S. Question/s *Apl/An/ Value Points Points
No. Sy / Ev Wise
Marks
1. Why are some seeds exalbuminous while some are Ap Ex-albuminous seeds have no residual endosperm an it
albuminous Give reason. is completely consumed during embryo devpt. 1
Albuminous seeds retain a part of endosperm as it is not
completely used up.
1
2. Why does corpus lecteum secrete large quantities of An Corpus leteum secretes large amounts of progestrome
progesterone during the luteal phase of the for the maintenance of the endometrium, which is 1
menstrual cycle? necessary for implantation and pregnancy; in the
absence of fertilization. Corpus leteum degenerates
1
Chapters / Concepts : Genetics
1. A male child was born with 47 chromosomes. Write any Apl XXY - Klienfelter‟s syndrome symptoms. 1½
two possible conditions chromosomal of abnormatition. Trisomy of 21st chromosome – downs
Mention symptoms. syndrome
1½
2.a) Describe the experiment conducted by A Hershy and M An Explain the experiment in the correct sequence 3
chase for identification of genetic material.
Significance.
Why is it considered pathbreaking in the field of molecular 2
biology?
b)
Chapters / Concepts : Biology in Human Welfare
1. Memory is a property of our immune system. How has man Apl - In vaccination, a preparation of antigenic
made use of it to control diseases? proteins of pathogens or inactivated
pathogen (vaccine are introduced into the
body 1
- The antibodies produced in the body against
these antigens would neutralize the
pathogens.
- Also generate T-cells and B-cells.
1
1
2. How are biofertilizers different from fertilizers such as NPK An - Biofertilisers are organisms that enrich the 1
that we buy in the market? Justice the role of Rhizobium as a nutrient content of the soil.
biofertiliser. - Main sources are bacteria fungi, blue green
algae chemical fertilizer causes pollution
problem.
- Rhizobium – a symbiotic association with 1
legume roots – fix N into usable form.
-
1
Chapters / Concepts : Biotechnology And Its Applications
1. How is PCR used to detect gene mutations in case of An - A single stranded DNA or RNA tagged with a
suspected cancer patients? radioactive molecule (probe) is allowed to
hybridise to its complementary NA in a clone of
cells followed by detection using 1½
autoradiography .
- The clone having the mutated gene will hence
not appear on the photographic film, because the 2½
probe will not have complimentarily with the
mutated gene.
2. Describe the importance of cloning site in a vector with Apl In order to link the alien DNA, the vectors need to 1
suitable examples. have cloning sites.
Ex: Bam H1 site
Explain.
2
Chapters / Concepts : Ecology
1. With the help of a flow chart depict the occurrence of Sy Bio magnification refers to increase in conc. of 1
the phenomenon of Biomagnification. the toxicant at successive trophic levels.
Flowchart – (page 276)
2
2. How is the “6th epidose of extinction” of species on earth, Ev - The current species extinction rates are
now currently in progress different from the fire earlier estimated to be 100 to 1000 times faster than
episodes? What is it due to. in the pre human times. 1
- Human activities are responsible for the faster
rates.
1
Apl – Application, An – Analysis, Sy – Synthesis, Ev – Evaluation
UNIT: ECOLOGY
Sr. Question Type Value Points Point
No wise
marks
1 Two different species A and B were inhabiting a particular habitat. SAII Competitive Exclusion principle by Gause. 1
After sometime species A got eliminated. Which principle is Two closely related species competing for the
involved in this? Explain. How nature adapts to this phenomenon? same resource cannot coexist indefinitely; the
weaker one will get eliminated at some point of
time.
It is not fully supported because the weaker one 1
will evolve some mechanism that promote
coexistence.
One such mechanism is resource partitioning. Eg:
5 different species of Warblers co-exist by 1
behavioural differences in their foraging
activities.
2 Name the major conduits of energy transfer in: SAII 1)Detritus food chain 1
1) A terrestrial ecosystem 2)Grazing food chain
2) An aquatic ecosystem. -More energy flows through DFC.
3) Which of these shows more energy flow? Give an example -e: DFC-organic 1
each. matterdecomposersplantsman
GFC-phytoplanktonzooplanktonfishes 1
crane
1 GENETICS SA1 Aminoacylation of t RNA is essential as the 1
Aminoacylation is an important step in translation. Why? formation of peptide bond between the amino
acid is favoured energetically, when they are
brought together
1
Activation of amino acid by ATP provides energy
for the formation of peptide bond.
2 Give an example for linkage in Drosophila. SA Gene for eye colour and gene for body colour 1
BIOTECHNOLGY
3 Give reason for the following SAII 1) DNA is hydrophilic and hence cannot pass 1
1) DNA cannot pass thro‟ the cell membrane thro‟ the phospholipid layer of the cell
2) The cloning should have selectable marker. membrane.
3) Single cloning site is preferred. 2) It is useful in seperating the recombinants. 1
3)Presence more than one restriction site
in a vector will generate a no. of fragments 1
and complicate the process of gene cloning.
4 REPRODUCTION SAII .(a)The 2 phenomenon are 1
(a)Describe 2 phenomena which can prevent both autogamy and 1. Dioecy
geitonogamy and ensure xenogamy that would lead to genetic When a plant bears
variation. exclusively either male or
female flowers it is said to
(b) How does the endosperm of angiosperms become triploid? be dioceius; since pollen
comes from a different
plant it ensures genetic
variation.
2. Self-incompatibility
It is a genetic
mechanism that does not
allow the self pollen (or
genetically similar
pollen) to fertilize the
ovule either by preventing
the germination of pollen
or by retarding the growth
of pollen tube
(b)
During the development of
embryo sac, 2 haploid polar
nuclei fuse in the centre of the
central cell, to form a diploid
secondary nucleus.
During fertilization, 1 of the male
gametes fuses with the diploid
secondary nucleus to form a
triploid primary endosperm
nucleus i.e the primary endosperm
nucleus is the product of triple
fusion. (2 polar nuclei and 1 male
gamete).
5 Certain phrases given in the following table are pertaining to the SAII . (1) A --- Coleorhiza
technical terms of embryo of grasses. B --- Cotyledon
Write the corresponding technical terms. C --- Coleoptile
D --- Shoot apex
Part Technical terms
(2) (a) --- Perisperm refers to the recidual,
persistent nucellus in the seed.
(b) --- Funiculus is the stalk of the
ovule.
(c) --- Pollen robbers are those floral
1. Protective sheath of radicle A visitors which consume the pollen,
without bringing about
2. cotyledon in grass family Scutellum pollination.
3. Protective sheath of shoot tip C
4. Plumule Plumule
(2) What is meant by each of the following
(a) Perisperm
(b) Funiculus
(c) Pollen robbers
6 You have studied that in pea plants, a single gene controls the size SAII In pea plants, size of starch grains and the
of the starch grains and the seed shape. What is the phenotype shape of seeds are controlled by single
produced by the genotype Bb. Why? gene.
The round seeds are dominant over
wrinkled seeds, but big starch are not
completely dominant over the small starch
grains.
When the starch grains are large, the seed
is round in shape and when the starch
grains are small the seed is wrinkled.
But under heterozygous condition, the
seed is round, but the starch grains are
intermediate in size.
So the phenotype produced by Bb is round seeds
with intermediate starch grains.
7 In an experiment, a phenotypic ratio of 3:3:1:1 was obtained on LA IiGg x Iigg 1
crossing a pea plant IG,Ig,ig,iG X Ig,ig 1
with inflated green pods with another pea plant having inflated Punnet square
yellow pods. Judge the accuracy of this result using a punnet square. 3:3:1:1 prooved 3
Write the genotypes of the parents.
8 What forms the basis of acquired immunity? SAI 1)Memory forms the basis.
Describe the two corollaries of this system. The two corollaries are:
1)Higher vertbrates are able to distinguish the
foreign microbes and immune response are due to
that.
2)Due to genetic and other unknown reasons;the
body attacks self cells and leads to
damage/disorders: this aspect is called
autoimmunity.
9 Following are two important features required to facilitate cloning in SAI - Helps to link the alien DNA 1
a vector. - Enable the particular restriction enzyme to cut -
(i) cloning sites (ii) small size if the vector Facilitates easy introduction of DNA into the
What is the importance of the above features in a cloning vector? host. 1
10 A sequence of mRNA is as follows. SAI GAG GGC AGA 1
CAG CCA GAA Frame shift mutation
If a base G is added between two Cs what will be the new codons?
What is this phenomenon called? 1
11 Why do RNA viruses mutate faster than DNA viruses? SAI -OH‟ group of RNA makes RNA more reactive
-RNA is also catalyst 1
- RNA has uracil instead of thymine.RNA IS
single
Stranded.
- this makes easily degradable. 1
12 Resistance to yellow mosaic virus is developed in moong bean by a SAI Mutation breeding 1
particular technique. Name and explain this. Seeds were exposed to chemicals/radiation to
induce mutation in genes and develop resistance 1
to mosaic disease.
