J. Biol. Chem.-1993-Esteban-2719-26

Document Sample
J. Biol. Chem.-1993-Esteban-2719-26 Powered By Docstoc
					THEJOURNAL BIOLOGICAL
         OF        CHEMISTRY                                                                 Vol. 268,No. 4, Issue of February 5, pp. 2713-27261993
0 1993 by The American Society for Biochemistry and Molecular Biology, Inc.                                                         Printed in U . S A .



Fidelity of $29 DNA Polymerase
COMPARISON BETWEENPROTEIN-PRIMED INITIATION AND DNA POLYMERIZATION*

                                                                                               (Received for publication, May 29,1992)

                Jose A. EstebanS, Margarita $alas$, and Luis Blanco
                                                    (CSIC-UAM), Uniuersidad Autonoma, Cantoblanco, 28049 Madrid, Spain
                From the Centro de Biologia Molecular


  $29 DNA polymerase is able to catalyze two different            elucidate the mechanisms responsible for the fine nucleotide
synthetic reactions: protein-primed initiation and                selection exhibited by most DNA polymerases.
DNA polymerization. We have studied the fidelity of                  Two fidelity mechanisms have been shown to operate dur-
$29 DNA polymerase when carrying out these two                    ing DNA polymerization (for a review, see 13): (a)nucleotide


                                                                                                                                   -
reactions. Global fidelity wasdissected into three steps:         insertion discrimination (DNA polymerases preferentially se-
insertion discrimination, mismatch elongation, and                lect the correct dNTP to catalyze phosphodiester bond for-
proofreading. The insertion discrimination of (629                mation); ( b ) exonucleolytic proofreading (the 3‘ 5’ exonu-
DNA polymerase in DNA polymerization ranged from                  clease activity of DNA polymerases excises noncomplemen-
lo4to lo6. The efficiency of mismatch elongation was              tary nucleotides at the 3’-OH primer terminus more rapidly
10b-106-fold lower than that of a properly paired                 than correctly paired nucleotides). The insertion discrimina-
primer terminus. These factors indicate that DNA po-              tion step can   operate at two levels. First, wrong dNTPs might
lymerization catalyzed by (629 DNA polymerase is a




                                                                                                                                                           Downloaded from www.jbc.org by guest, on February 20, 2010
highly accurate process.                                          be bound withlower affinity than right ones, probably because
   Conversely, the insertion fidelity of protein-primed           of a faster dissociation rate of mispaired dNTPs (3, 4, 7, 11).
initiation was quite low, the insertion discrimination            Second, the rate of phosphodiester bond catalysis can be
factor being about 10’. Mismatch elongation discrimi-             slower for incorrect dNTPs than for correct ones ( 5 , 6, 11).
nation was also rather low: mismatched terminal pro-              In addition, intermediate conformational changes of DNA
tein (TP).dNMP complexes were elongated from 2- to                polymerase can be especially disfavored when a mispaired
6-fold more slowly than the correct TP.dNMP com-                  dNTP is bound ( 5 , 11). The exonucleolytic proofreading is
plex. Even more, the 3’ 4 6’ exonuclease activity of              probably based on two mechanisms. First, a mispaired 3’-
429 DNA polymerase was unable to act on the TP.                   terminus is intrinsically easier to melt and is, therefore, a
dNMP initiation complex, precluding the possibility               better substrate for exonuclease activity, according to the
that a wrong dNMP covalently linked to TP could be                “melt and slide” model for exonucleolysis (14). Second, it has
excised and corrected. Therefore, protein-primed ini-             been proven that the addition of the next nucleotide onto a
tiation can be predicted as a quite inaccurate reaction.          mismatched 3”terminus is an inefficient step, increasing the
The problem of maintaining the’sequence at the DNA                exposure time of the mispaired end to the     exonuclease activity
ends is discussed in the context of a recently described          ( 5 , 11, 15). All of these steps have been analyzed in different
model for protein-primed initiation.                              DNA polymerases, and therelative importance of each one is
                                                                  dependent on the specific DNA polymerase.
                                                                     In thispaper we present thecharacterization of the fidelity
                                       ~    ~~~~~~~~~~~~~~




                                                                  mechanisms exhibited by bacteriophage $29 DNA polymer-
   DNA replication in vivo has been described as a highly ase. Two main points justify the relevance of studying the
accurate process, with error frequencies between lo-’ and errordiscrimination ability of another DNA polymerase.
lo”* (1, 2). This faithful genome duplication relies on multi- First, 429 DNA polymerase is able to use two different mol-
ple sequential steps to discriminate against errors, and the      ecules as primers to catalyze nucleotide incorporation. During
critical role of DNA polymerases in ensuring a precise DNA DNA polymerization, $29 DNA polymerase uses a DNA
synthesis has been clearly established. Inthis sense, the primer as donor of free 3“OH groups, but for the initiation
number of purified DNA polymerases and in vitro studies of replication of the $29 linear genome, the -OH group is
examining their ability for base selection are increasing (3- provided by a serine residue of the $29 terminal protein (for
12). Despite the fact that in vitro studies probably cannot review, see 16). These two reactions are thought to share the
mimic precisely the actual in vivo conditions in which DNA same active center (17, 18), but they show clear biochemical
synthesis occurs, it has proven to be a powerful method to differences (19, 20). Therefore, it is important to elucidate
                                                                  and compare the fidelity mechanisms exhibited in these two
   *This investigationhasbeenaidedbyResearchGrant           5R01 different reactions, trying to correlate thesemechanisms with
GM27242-13 from the National Institutesof Health, by Grant PB90- the specific characteristics of protein-primed or DNA-primed
0091 from Direccibn General de Investigacih Cientifica y Tkcnica,
by Grant BIOT CT91-0268 from European Economic Community,         nucleotide incorporation. For these correlations it is also
and by an institutional grant from Fundacih Ram6n Areces. The important tobear in mind the possibly different physiological
costs of publication of thisarticle were defrayed in part by the relevance of error discriminationat the      two steps of $29 DNA
payment of page charges. This article musttherefore be hereby replication (initiation of DNA replication and subsequent
marked “aduertisement” in accordance with 18 U.S.C. Section 1734 DNA polymerization). On the other hand, these studies rep-
solely to indicate this fact.
   $ Recipient of a fellowship from Plan de Formaci6n de Personal resent the first kinetic characterization of a protein-primed
Investigador.                                                     initiation reaction. Therefore, it has been possible to compare
   3 To whom correspondence should be addressed. Fax: 34-1-91397- not only the fidelity mechanisms operating in protein-primed
4799.                                                             initiation and DNA polymerization but also the kinetic pa-

                                                                              2719
2720                                              Fidelity of 429 DNA Polymerase
rameters of correct nucleotide incorporationinthese       two mixture was tempered to 30 “C, and the reactions were started by
reactions. The fidelity of the initiation reaction was studied adding MgClz or MnC12.The final reaction mixture contained, in 25
                                                                                                  M
separately in three individual steps: insertion discrimination, pl, 50 mM Tris-HC1 (pH 7.5), 1 m dithiothreitol, 4% glycerol, 0.1
                                                                mg/ml bovine serum albumin, 1.5 nM TP.DNA (two origins/mole-
proofreading, and mismatch elongation. In the case of DNA cule), 150 nM TP, 15 nM exonuclease-deficient 429 DNA polymerase,
polymerization, only insertion discrimination and mismatch and 10 m MgCl, or 1 mM MnC12. The final dNTP concentration
                                                                         M
elongation were evaluated; the proofreading ability of 429 was varied keeping constant the [a-”P]dNTP concentration (0.05
DNA polymerase has been the subject of a recent publication p M for dATP or 0.25 p M for wrong dNTPs) and adding different
(21).                                                           concentrations of the corresponding unlabeled dNTP. Incubation was
                                                                        at 30 “C for different times to calculate the reaction velocity, and
                  MATERIALS ANDMETHODS                                  reactions were stopped by the addition of EDTA to 10 m and SDS
                                                                                                                                  M
                                                                        to 0.1%. The samples were filtered through Sephadex G-50-spun
   Nucleotides and Proteins-Ultrapure unlabeled dNTPs were from columns in the presence of 0.1% SDS, and the excluded volume was
                                                  (400 Ci/mmol) and subjected to 10% SDS-PAGE. The TP.dNMP complexes were de-
Pharmacia LKB Biotechnology; [ L Y - ~ * P ] ~ N T P ~
[y3’P]ATP (3,000 Ci/mmol) were obtained from Amersham Inter- tected by autoradiography and quantified by densitometry in the
national PIC. T4 polynucleotide kinase was purchased from New presence of convenient markers. When initiation complexes were
England Biolabs. Wild-type and exonuclease-deficient (D12AD66A; expected to be elongated giving rise to different TP. (dNMP), prod-
22) 629 DNA polymerases were purified essentially as described (23), ucts, electrophoresis was carried out in 12% SDS-PAGE (360 X 280
with modifications to be published elsewhere. 429 TP’ was purified X 0.5 mm). In these conditions, the different TP. (dNMP), complexes
as described (24).                                                      are resolved.
   DNA Templates-TP.DNA complexwas obtained as described                   Misinsertion in the Presence of Different Metal Activators in Pro-
(25). Complementary single-stranded oligonucleotides SP1 (5”GAT- tein-primed Initiation-The reaction mixture was as described in the
CACAGTGAGTAC) andSPlc+6 (5”TCTATTGTACTCACTGT- preceding section but using 0.1 p~ [ u - ~ ’ P ] ~ N T(1 pCi) and 1 m          P               M
GATC) were synthesized in a 391 DNA Synthesizer (Applied Biosys- MnCIZ,1 m FeS04, 2 m ZnClz, 0.5 m coC12 or 10 m MgClz as
                                                                                    M            M               M                M
tems) as described (26), purified by 20% PAGE, ethanol precipitated the metal activator. After incubation for 2 min at 30 ‘C, the reactions
and, in the case of SP1, 5”labeled with [y3’P]ATP and T4polynu- were stopped by the addition of EDTA to 10 m and SDS to 0.1%
                                                                                                                         M
cleotide kinase. Further separation by PAGE was necessary to purify and analyzed as described in the previous section.




                                                                                                                                                  Downloaded from www.jbc.org by guest, on February 20, 2010
the full-size 5”labeled oligonucleotide. The specific activity obtained    Measurement of Mismatch Elongation in Protein-primed Znitia-
was2.5 X IO5 cpm/pmol. The primer/template 5’-32P-SP1/SPlc+6 tion-Mismatched TP.dNMP complexes were formed in the same
molecule was obtained by hybridization between SP1 and SPlc+6.          reaction mixture as described in the previous section, using 0.25 p M
   Measurement of Nucleotide Insertion Rates Using         DNA       as (2.5 pCi) of the wrong nucleotide to be covalently linked to TP. After
                                            to
Primer-629 DNA polymerase was allowed interact with template/           15 min at 30 ”C, the elongation rates of these mismatches were
primer DNA (SPl/SPlc+6) at equilibrium by preincubating for 15 measured by adding various concentrations of dATP (the              next correct
min at 0 “C all of the components of the final reaction except the nucleotide) and further incubating for 5 min a t 30 “C. To avoid the
metal activator. Then, the incubation mixture was tempered to 30 “C interference of initiation complexes synthesized in the second incu-
andthe reactions started by adding MgCIz or MnCI2. The final bation, the labeled dNTP was diluted with its corresponding unla-
reaction mixture contained, in 12.5 &I, 50 m Tris-HC1 (pH 7.51, 1 beled dNTP at 100 p ~ The reactions were stopped by the addition
                                              M                                                   .
  M
m dithiothreitol, 4% glycerol, 0.1 mg/ml bovine serum albumin, 1 of EDTA to 10 m and SDS to 0.1% and analyzed as described for
                                                                                          M
n 5’-32P-SP1/SPlc+6,30 nM exonuclease-deficient 429 DNA po- nucleotide insertion rate measurements.
 M
lymerase, 10 m MgCI, or l m MnCI,, and various concentrations
                M               M
of dNTPs. After 2 s at 30 “C, reactions were stopped with EDTA up                                     RESULTS
to 100 mM. The amount of elongated primers was analyzed by 20%
PAGE, autoradiography, and densitometry. At the highest dATP               Insertion Fidelity of 429 DNA Polymerase during DNA
(correct nucleotide) concentrations all the primers were elongated in Polymerization-The ability of 429 DNA polymerase to dis-
less than 2 s, preventing an estimation of the nucleotide insertion criminate between right and wrong nucleotides at the inser-
rate in linear conditions. In the case of wrong dNTPs, the highest
concentrations produced severe inhibition of nucleotide insertion. tion stepof DNA polymerization was              evaluated using a highly
Therefore, these concentrations were discarded to calculate nucleo- purified exonuclease-deficient mutant (22) t o avoid the inter-
tide insertion rates.                                                   ference of the 3’ -+ 5’ exonuclease activity. The DNA sub-
   Misinsertion in the Presence of Different Metal Activators Using strate was a 5”labeled 15/21-mer (SPl/SPlc+6), which offers
DNA as Primer-The reaction mixture was as described in the a T asfirst nucleotide onthetemplate,andtherate                                   of
previous section but using 25 p~ dATP, 3 nM exonuclease-deficient nucleotide insertion was measured by quantifying the elon-
629 DNA polymerase and, as metal activators, 10 m MgCl,, 1 m
                                                      M              M
MnCI,, 2 m ZnCl,, 1 m CoClz or 0.5 m FeS04. Incubation was gation products of the 5”labeled primer (4)(see “Materials
             M            M                 M
for 5 min at 30 “C, and reactions were directly quenched with 3 pl of and Methods”). These experiments were carried out using
loading buffer. DNA polymerization products were analyzed by Mg’+ or Mn’+ as the metal activator. Mn2+ been described          has
PAGE, autoradiography, and densitometry.                                as an                                                    of
                                                                               efficient activator of the synthetic activities 429 DNA
   Measurement of Mismatch Elongation UsingDNA as Primer-               polymerase (20) although, in general, Mn2+-activated DNA
Primers with 3”terminal mismatches were formed in the same reac- polymerases areerror-prone (6, 27-31). Therefore, it was
tion mixture as described previously but using 60 nM exonuclease-
deficient 629 DNA polymerase and a 100 p~ concentration of the interesting to examine the              influence of the metal activator on
selected wrong nucleotide to be incorporated at theprimer terminus. the insertion fidelity of 429 DNA polymerase.
After 15 min at 30 ”C all of the primer molecules were elongated one       The kinetic studieswere carried out in conditions in which
position, the desired wrong dNMP being at their3’-end (not shown). each DNA polymerase molecule catalyzed a singlebase inser-
Mismatch elongation rate was measured by adding various concen- tion        onto      previously
                                                                                      a         bound          template/primer molecule.
trations of the next correct nucleotide (dATP)and further    incubating These conditions were achieved by preincubating a 30-fold
for different times (depending on the particular mismatch) at 30 ”C.
The reactions were stopped by the addition of EDTA to 100 mM. molar excess of 429 DNA polymerase over template/primer
                                                                                                    by
Mismatch elongation was analyzed by PAGE, autoradiography, and and starting the reaction the addition of the metal-chelated
densitometry.                                                           dNTP (see “Materials and Methods”). This approachallows
   Measurement of Insertion Rates in Protein-primedInitiation-@29       a direct estimation of the true nucleotide incorporation rate,
DNA polymerase was allowedto interact with TP and template (TP. avoiding other possible rate-limiting steps such as DNA as-
DNA) by preincubating for 15 min at 0 “C all of the components of sociation or dissociation.
the final reaction except the metal activator. Then, the incubation
                                                                          ThedNTPinsertionrates          were measured at different
   ’The abbreviations used are: TP, terminalprotein; TP.DNA,            d N T P concentrations and analyzedby linear regression. The
terminal protein-$29 DNA covalent complex; PAGE, polyacrylamide         initial slopeina    plot of rate versus dNTP concentration
gel electrophoresis.                                                    defines the apparent second-order rate constant kCat/Km  (in-
                                                 Fidelity of 429 DNA Polymerase                                                     2721
                                                                 TABLEI
                     Insertion efficiencies and discrimination factors i n Mg2+- and Mn’+-actiuated DNA polymerization
 Insertion rates were measured at different dNTP concentrations within a linear range, and analyzed as described under “Materials and
                                                    and
Methods” to obtain insertion efficiencies(kCac/K,,,) discriminationfactors ( f ) .
                                                   Mg2+                                                 Mn2+
                                                             Discrimination                                       Discrimination
                                      kcat/K
                                                                 factors                   L/Km                       factors
                                     S-l   pM”                                            s-‘ p M - ‘
            T:dAMP”                6.8 f 1.9’                       1                15.1 f 5.1                        1
            TdCMP                 (1.5 t 0.3) X low4            4.5 X 104             (6.2 f 1.8) X                2.5 X 10‘
            T:dGMP                (3.9 f 0.7) X 10-5            1.8X lo5              (1.0f 0.4) X 10-~            1.5 X 10‘
            TdTMP                 (2.8 2 0.4) X                 2.5 X lo6             (3.8 f 0.3) X lo-‘           4.0 X 10‘
   ‘T:dNMP stands for the insertion of a dNMP residue oppositeT on the template, using SPl/SPlc + 6 as primer/template.
   * The errors of the mean were calculatedby standard statistical methods witha confidence intervalof 90%.Only the errors of the insertion
efficiencies are indicated, for simplicity.

sertion efficiency). The   resultsobtained the
                                            with right              the case of 429 DNA polymerase, its strong 3’ + 5’ exonu-
(dATP) and wrong (dCTP, dGTP, and dTTP) nucleotides clease activity has been                                 a
                                                                                             shown to act as proofreadingactivity
using Mg2+or Mn2+ as the metal activator are shown         in Table (21).
I. Individual estimations of kcatand K , for the correctnucleo-        The 15/21-mer primer/template was elongated by the ad-
tide were not possible because of its fast insertion rate (the      dition of onenucleotide formingthethree           possiblemis-
minimalreactiontime,         2 s, was too long t o measure the matches (T:dCMP, TdGMP, and TdTMP). Then, the                    mis-
maximal velocity of correct nucleotide insertion accurately). match       extension     efficiency (kJK,,,) of thesethreemis-




                                                                                                                                              Downloaded from www.jbc.org by guest, on February 20, 2010
In the case of wrong nucleotides, the hyperbolic behavior of matches was estimatedmeasuringtheextensionrateat
insertion rate as a function of dNTP concentration over- differentdATPconcentrations(dATP                       is thenextcorrect
lapped with the inhibition observed at high dNTP concentra- nucleotide), using Mg’’ or Mn2+ as the metal activator (Fig.
                                             of kcat
tions, precluding an accurate estimation and K,. Never- 2a) (see “Materials and Methods”). These experiments were
theless, it is important to point out that   fidelity values can he carried out with a 60-fold molar excess of the exonuclease-
obtained from the ratio of the insertion efficiencies for right deficient $29 DNA polymerase mutant over mismatched
                                                                 As / K , ) ~ .
uersus wrong nucleotides ( f = ( k ~ ~ ~ / K , ) ~ / ( ~ ~ ~ ~ primers. )In these conditions DNA binding is saturated, and
shown in Table I, the discrimination         values obtained with   the elongation rate reflects the nucleotide insertion rate. On
Mg” as the metal activator ranged from 4.5 x lo4 (T:dCMP the other hand, it has been observed in other systems that
mispair)’ to 2.5 X IO6 (T:dTMP mispair). Mn’+, in general, inefficient mismatch extension is mainly because of a slow
reduced the insertion fidelity of 629 DNA polymerase, but nucleotide insertion rather than low affinity for mismatched
                                                                                                      a
the extent of this reduction was dependent on the individual primers (32).
mispair; the formation efficiency of T:dGMP and T:dTMP                 The extension efficiency of the three mismatches, as well
mispairs was increased 10- and     100-fold, respectively,whereas as the elongation discrimination factors, defined by the ratio
the misinsertion efficiency of the T.dCMP mispair was not of these mismatch extensionefficiencies uersus the extension
altered significantly.                                              efficiency of a properly paired DNA primer (unextended 15/
   The insertion fidelity of 429 DNA polymerase was quali- 2 1 primer/template), are shown in Table 11. Using Mg‘+ as
                                       of
tatively evaluated in the presence other metal ions known the metal activator, the discrimination factor for elongating
to support its polymerization activity (20). In this assay we T:dGMP and T:dTMP mismatches was 2.7 X IO5and 4.2 X
examinedtheelongation of the 15/21-mer (SPl/SPlc+G) lo6, respectively. These factors are                comparable to othervalues
with dATP (see “Materials and Methods”). The correct in-            reported in different systems (5, 11, 15). However, the elon-
corporation of two dAMP residues is expected, and further
                                                                    gation efficiency of the T:dCMP mispair was surprisingly
elongation of the primer would imply the formation of an
                                                                    high (only 8-fold lower than the extension efficiency of the
A:dAMP mispair (Fig. 1A).Thisapproach allows a direct
                                                                    correctly paired primer terminus). This   efficiency was so high
comparison between the efficiency of correct uersus wrong
nucleotide insertion. As shown in Fig. l B , all of the metal that it does not seem to reflect the actual mismatch elonga-
activatorstested,except       Zn’+, reduced the fidelityof429       tion. In fact, taking into account the nucleotide composition
DNA polymerase. Thisresult,togetherwiththe                 previous of thetemplatestrand,       we think that the mostplausible
kinetic study (Table I), shows that the insertion fidelity of explanation for this resultwould be a misalignment event, as
429 DNA polymerase is markedly affected by the metal ion depicted in Fig. 2b. The mismatched 3”terminal dCMP resi-
used as activator.                                                  due might pair with the  previous G in the template, dislocating
    Elongation Efficiency of MismatchedDNA PrimerTer-               the primer strand. In this conformation, the 3”primer ter-
mini-Another important fidelity mechanismfor 3’ + 5’ minus would be properly paired and could be efficiently elon-
exonuclease-containing DNApolymerases is the competition gated. Misalignment-mediated mutagenesis has been                    de-
between mismatch extension and exonucleolytic excision. A           scribed in other systems (for a review, see 33). Using Mn2+ as
slow rate of mismatch elongation will stall DNA polymerase the metal activator, the elongation efficiencies of T:dGMP
after misincorporation, increasing the time for proofreading and T d T M P mismatches increased 100- and 10-fold, respec-
t o act. In the absence proofreading, an inefficient extension tively (see Table 11). However, the T:dCMP mismatch was
                        of
of mismatched primers would eventually lead to DNA disso- elongated much moreinefficiently than in the presence of
ciation and abortionof DNA synthesis after misinsertion. In M$+. According tothe previous interpretation,this slow
                                                                    mismatch elongation would indicate that in the presence of
   ‘The first symbol ( N ) stands for the nucleotide present on the Mn’+ the misaligned conformation is disfavored with respect
template; the second symbol ( M P ) represents the nucleotide in- to the extended mismatched conformation (in fact, MnZ+ has
serted at the primer terminus, opposite N .                         been described as stabilizing mismatched duplexes (34)). In
2722                                                                   Fidelity of 429 DNA Polymerase
this sense, the measured efficiency would reflect the actual                                        origin positioning was avoided by preincubating a 10-fold
mismatch elongation efficiency.                                                                     molar excess of TP over $29 DNA polymerase;this TP. DNA
   Insertion Fidelity of $29 DNA Polymerase during Protein-                                         polymerase complex was incubated in a &fold molar excess
primed Initiation-The fact that protein-primed initiation is                                        over template origins, and the reaction was started by the
                                   been
a DNA-instructed reaction, as has demonstrated recently                                             addition of the metal-chelated dNTP. The         reaction time was
(35), offers the possibility of quantifying the fidelity of this                                                                          of
                                                                                                    short enough to ensure that most the origins were not used
reaction and of elucidating the mechanisms responsible for                                          (see "Materials and  Methods"). Under these      conditions, meas-
nucleotide selection when a protein is used as primer.                                                                        at
                                                                                                    uring the insertion rate different dNTP concentrations and
   The kinetic characterizationof the insertionfidelity during                                      by standard double-reciprocal plot analysis, it was possible to
protein-primed initiation was carried out using the natural                                         estimate the K, and kc,,, for correct (dATP) and incorrect
TP-DNA as template (whichoffers a T as first template                                               (dCTP, dGTP, and dTTP) nucleotides (Table 111). In the
nucleotide), TP as primer, and an exonuclease-deficient $29                                         presence of Mn'+, the discrimination factors obtained        ranged
DNA polymerase mutant (see "Materials and Methods"). In                                             from 1.1 X 10' (T:dGMP) to 1.3 X lo3(TdCMP). It can be
this reaction, itwas especially relevant to compare the inser-                                      also observed that the kinetic parameter mainly responsible
tion discrimination obtained with Mg" and with Mn'+ be-                                             for this insertion fidelity is K,. The K, ratio of wrong nucle-
cause Mn'+ is a much better activator the initiation reaction
                                       of                                                           otides uersus dATP varied      between 82(dGTP)and              235
than Mg2+ (20). The interference of other possible rate-lim-                                        (dCTP), whereas the kc,, for dATP was only 1.4 or 5.4 times
iting steps as TPaDNA polymerasecomplex formationor                                                 greater than the kcat for dGTP or dCTP, respectively. The
                                                                                                    misinsertion reactions in thepresence of Mg2+ were so weak
          A                                        B                                                that only the misinsertionefficiency ( kCat/K,,,) indicated. In
                                                                                                                                                        is
                      5    '   z   c
                                                               wz'   m*+
                                                                       l
                                                                       '&    &re2,                  fact, the reaction obtained with dCTP was so low that this
                                   GTTATCT                                                          parameter could not be accurately estimated. The fidelity




                                                                                                                                                                          Downloaded from www.jbc.org by guest, on February 20, 2010
                  Correct
               incorporationi/         * dATP T-
                                              I                                                     factors that could be determined in the presence of Mg2+ were
                                                       A                                                                               in
                                                                                                    quite similar to those obtained the presence of Mn'+.
                      5
                      -I

                          -GTTATCT CAA
                                                       ;-                                              The insertion discrimination of$29 DNA polymerase in
           Misincorporation

                      -
                      0
                      5
                               1a&* F
                               /
                                    i  dATP

                                                         '5'
                                                                                                    protein-primed initiation was also examined qualitatively in
                                                                                                    the presence of other metal ions known to activate the initi-
                          -GTTATCT                                                                  ation reaction (20). As shown in Fig. 3, the initiation reaction
                Mianatch
                extension      1/      dATP
                                                                                                    obtained with dATP was always higherthan the one obtained
                                                                                                    with the other (wrong) dNTPs, and there was no apparent
                  "   5     AA
                          -C h
                           GTTATCT
                                                                                                    stimulation of misincorporation using differentmetal activa-
  FIG.1. Misinsertion in the presence of different metal ions.                                      tors. Therefore, the insertion   fidelity of the initiationreaction
Panel A, diagram showing successive correct incorporation,misincor-                                 does not seem to be severely affected by the metal ion used
poration, and mismatch elongation using dATP as the only nucleo-
tide. Panel B, electrophoretic analysis of SPl/SPlc+6 primer exten-
                                                                                                    as activator.
sion using 25 PM dATP and different metal ions as activators (see                                      Editing on the TPedNMP Complex-The ability of$29
"Materials and Methods"). The asterisk at the 5'-end of the primer                                  DNA polymerase to catalyze DNA polymerization as well as
strand stands for '>P labeling.                                                                     protein-primed initiation using the same active site (17, 18)
                                                                                                    led to the proposal that TP is structurally equivalent to the
 a                                                                                                  double-stranded portionof a template/primer DNA molecule
                                    dAT?
       5"GATCACAGTGAGTACN                                  5"GATCACAGTGAGTACNA
                                                                                                    (36). This                              of
                                                                                                               model poses the question whether the dNMP    TP.
         CTAGTGTCACTCATGTTATCT
          CTAGTGTCACTCATGTYATCT                                                                     complex could be a substrate for the 3' + 5' exonuclease
                                                                                                    activity of 429 DNA polymerase. First, the sensitivity to the
 b                                  dATP                                                            exonucleolytic activity of the phosphodiester bond between
       S'GATCACAGTGAGTgC
          CTAGTGTCACTCATGTTATCT
                                                           5'GATCACAGTGAGTfCA                       Ser2'32 inTP and dAMP (the first 5"nucleotide of the TP.
                                                                                                    DNA) could be different from the standard internucleotidic
 FIG.2. Diagram of the strategyused to measure the rate of
mismatch elongation. Panel a, true mismatch elongation. Panel b,                                    phosphodiester bond. Second,       although  perhaps       formally
primer misalignment leading to elongation of a correctly paired (but                                analogous, TP and a template/primer DNA molecule could
dislocated) primer terminus.                                                                        exhibit structural differences, especially concerning the melt

                                                                 TABLE   I1
                                                                                               DNA polymerization
                    Elongation efficienciesand discrimination factors in Mg2+-and Mn2+-activated
  Elongation rates were measured at different dATP concentrations and analyzed as described for Table I. Elongation efficiencies (kcat/K,,,)
and discrimination factors are shown.
                                    ___       ~~                                     ~~       ~     ~




                                                                            MS2'                                                        Mn2+
                                                                                          Discrimination                                       Discrimination
                                                    L J K m
                                                                                              factors                   L l K m                    factors
                                                   S-I     MM-'                                                         s" pM"
              G:dCMP"                     6.8 1.9*                                             1                   15.1 f 5.1                        1
              TdCMP'                      0.8 f 0.2                                            8.1                 (5.4 2 1.1) X 10-4            2.8 X lo4
              TdGMP                      (2.5 f 0.6) X                                      2.7 X 10%              (7.3 f 0.4) X lo-'            2.1 x lo3
              TdTMP                      (1.6 f 1.1) X                                      4.2 X 10'              (7.3 f 5.7) x lo+             2.1 X 105
   a G:dCMP stands for the elongation of the SPl/SPlc                                +
                                                           6 primer/template with dATP. This DNA molecule has a G:C pair at its primer
terminus, C being on the primer strand.
   * The errors of the mean were calculated as in Table I.
                                                                                                               +
     Mismatches were preformed by adding wrong nucleotide onto the SPl/SPlc 6 primer terminus, opposite T on the template. Hence,
                                           one
TdNMP stands for the elongation of these preformed primer termini (Nbeing on the primer strand) with dATP (see Fig. 2a).
                                                        Fidelity of 429 DNA Polymerase                                                                                                 2723
                                                                   TABLE 111
                                                                     Mg'+- and Mn'+-activated protein-primed insertion
                       Kinetic constants and discrimination factors in
  Insertion rates were measured at different d N T P concentrations and analyzed as described under "Materials and Methods" to obtain
kinetic constants (K,,, and kcat),insertion efficiencies (kCat/Km), discrimination factors.
                                                                 and
                                                  Mg2+                                                                                      Mn2+
                                                                   Discrimination                                                                                      Discrimination
                      Km           kcat            kc.t/Km
                                                                       factors              Km                  kat                              k.JKm                     factors
                      PM           S-1            S-I   pM-l                                PM                  S -1                         s-' pM-'
   TP.~AMP:TQ 3.9
               5.3                (7.4
                                 10-4
                                   X          A 0.3) X IO-S*     1        ..
                                                                         10 2
                                                                           5       X        (7.5 A 1.5) X             1
   TP.dCMP:T
         ND         ND'       ND                                ND       4.28
                                                                          71.      X        (5.9f 0.4)X            .
                                                                                                                  1 3 X lo3
   TP.dGMP:T        ND        ND        (2.1f 0.3)x loe7     3 5 x 1'
                                                              .     0    16.5 1.1 x         (6.7 0.4) x           1 1 x 1'
                                                                                                                   .     0
   TP.dTMP:T        ND        ND        (2.5A 0.5) X         3 0 X 1'
                                                              .     0    20.16.2   X        (3.12 0.6)X l -
                                                                                                          o'      2 4 X 1'
                                                                                                                   .     0
                                                 of                                         opposite T on the 629 DNA template.
    TP.dNMP:T stands for the covalent linking a dNMP residue onto the terminal protein primer,
  * The errorsof the mean were calculated as i i Table I.
    ND, not determined.

                               A          C G T                            A                                                                                  C
                               -
                               .          .
                   Mn2'                                                        77-dAMP-

                                                                                     bmin        6   20 60 3 M l o o 0            6   20 60 3w l o o 0               I,min   D    w    D     w
                                                                                                                                                                             "


                    ZnZ'                                                                                   Wr                              EXO-                                  WT        EXO-


                                                                          B                                                                                   D




                                                                                                                                                                                                  Downloaded from www.jbc.org by guest, on February 20, 2010
                    Fe2   +                                                     dAMP-                                                                             dAMP-



                    Co2   +                                                      oligin-                                                                          otigin-
                                                                                    1,min    6       211   60    3W l o o 0   6       20    60    31yI 1MX)          I,min   6    60   h     M
                                                                                                                                                                             "


                                                                                                            wr                              EXO-                                 WT        EXO-
                    MgZ    +
                                                                             FIG. 4 Comparison between protein-primed initiation cat-
                                                                                   .
   FIG. 3 Protein-primed misinsertion in the presence of dif-
          .                                                               alyzed by wild-type ( WT) and exonuclease-deficient (EXO-)
ferent metal ions. Electrophoretic analysis of protein-primed ini-        mutant 629 DNA polymerases. Panel A , time course of TP. dAMP
tiation showing the TP. [32P]dNMP band obtained with each the    of       formation. Reactions were carried out and analyzed as described for
four [a-"-P]dNTPs and different metal ions as activators (see "Ma-        Fig. 3 but omitting template, using nM either exonuclease-deficient
                                                                                                             65
terials and Methods"). The intensity of the TP. [32P]dAMP band            or wild-type 429 DNA polymerase (as indicated) and 1 mM Mn'+ as
reflects the activation efficiency of each metal at its optimal concen-                                          are
                                                                          the metal activator. Reaction times indicated. The position of the
tration (20).                                                             TP.["P]dAMP hand is       indicated. Panel B, samples of the assay
                                                                                          A
                                                                          shown in panel were subjected to polyethyleneimine-cellulosethin-
                                                                          layer chromatography for dAMPturnover analysis. The position
and slide model for exonucleolytic editing (14).                          expected for [32P]dAMP as well as the chromatographic origin are
   The ability of 429 DNA polymerase to excise the first                  indicated. Panel C, TP .dAMP formation in the   presence of TP. DNA
                                                                          as template. Reactions were carried out for the indicated times using
nucleotide covalently linked to TP was examined comparing                 Mn'+ as the metal activator; analysis was as described for Fig. 3   .
the initiation reaction at low dATP concentration (0.25 PM)               Panel D,dAMP turnover analysisof the samples shown in panel C.
using the wild-type 429 DNA polymerase and the exonucle-
ase-deficient mutant. If the TP. dAMP complex is susceptible              lower exposures, suggesting that several dAMP residues were
to exonucleolytic degradation, wild-type 429 DNA polymerase               covalentlylinked to TP). T o evaluate which isthefirst
is expected to excise the dAMP residue covalently linked to               elongated product that can be substrate for the exonuclease
TP, yielding a lower amount of TP .dAMP complexes than                    activity of 429 DNA polymerase, dAMP incorporation on TP
the exonuclease-deficient mutant, and releasing dAMP. This
                                                                          catalyzed by wild-type polymerase and the exonuclease-defi-
                                            of
experiment was carried out in the absence template (36) to
                                                                          cient mutantwas compared at different dATP concentrations
ensure that only one dAMP residue is inserted on TP. This
caution is necessary because TP. DNA has three consecutive                (Fig. 5 A ) . Thisexperiment was also carriedout with an
Ts at its 3' ends, allowing potential incorporation of several            incorrect nucleotide (dTTP) to test the       validity of these
dAMP residues on TP. As shown in Fig. 4 4 , the amount of                                         TP.
                                                                          results when a wrong dNMP complex is formed (Fig. 5 B ) .
    -
TP dAMP complexes formed by wild-type polymerase or the                   Reactions were analyzed by SDS-PAGE allowing the separa-
                                                                          tion of the differentTP. (dNMP), complexes (see "Materials
exonuclease-deficient mutant was quite similar. In addition,
no [32P]dAMP wasreleasedby the wild-type enzyme (Fig.                     and Methods"). In these conditions, the 3' +5' exonuclease
                                                                                                                if
4B). This result strongly  suggests that there is noexonucleo-            activity of 429 DNA polymerase is able to excise the dNMP
lytic activity on the TP.dAMP       complex. As controls, the             residue at the 3'-end of a TP.(dNMP), complex, the band
results obtained with  TP. DNA as template are shown Fig.  in             corresponding to the     TP. (dNMP),-, complex is expected to
4, C and D. The incorporation of dAMP on TP catalyzed by                  accumulate, taking the exonuclease-deficient mutant as ref-
the wild-type enzyme was much lower than with the exonu-                  erence. As shown in Fig. 5A, the reaction obtained with the
clease-deficient mutant (Fig. 4C), and mostof the input [ 3 '
                                                           a'-            wild-type 429 DNApolymerasemostlycorresponds             to the
P]dATP was turned over to [32P]dAMP after 1 h (Fig. 4 0 ) .               TP .dAMP complex, even at the      highest dATP concentration
Therefore, in the presence of TP DNA as template, dAMP                    tested (1 p ~ ) .On the other hand, the      appearance of the
incorporation proceeds further from initiation,producing                  subsequent elongated products (TP.(dAMP),, TP. (dAMP),
elongated products susceptible to exonucleolytic degradation              . . .) is fairly evident with the exonuclease-deficient mutant
(in fact, the TP. dAMP band obtained with the     exonuclease-            from the lowest dATP concentration tested (0.05 FM) (Fig.
deficient mutant (Fig. 4C) appeared slightly shifted up in                5 A ) . These results strongly suggest that the first elongated
2724                                                        Fidelity of 429 DNA Polymerase
A. Correct                               B. Incorrect                                                             TABLE   IV
                                                                                       Elongation efficiencies and discrimination factors ofTP.dNMP
WT                                        WT                                                                      complexes
                                                                                       Elongation rates were measured a t different dATP concentrations
 TPdAMP-                                   TP-dTMP-      r
                                                        c-         -                as described under “Materials and Methods” and analyzed as de-
  IdATP1,pM   0.05   01
                      .   02   0.5   1     fmLw         1      5   20   100         scribed for Tables I and 11. Elongation efficiencies (kcat/&) and
                                                                                    discrimination factors are shown.
                                                                                                                                    Discrimination
                                                                                                                   %.,/Km
 EXO-                                     EXO-                                                                                          factors

 TPdAMP-      e-                     ”



                                     1
                                          TP-dTMP-
                                          I m L llM                     Im
                                                                                         TP.MMPT
                                                                                                                  s-’ ph4-l
                                                                                                             (8.9 f 1.9) X 10-3*          1
  IdATP1,pM   0.05   01
                      .   02   0.5                      1     5    20         YJJ
                                                                                          TP.dCMP:T                  ND‘                 ND
   FIG. 5. Nucleotide requirements for the formation of the                               TPadGMPT           (3.8? 2.2) X                 2.3
TP-dNMP initiation complex and the first elongated prod-                                  TP.dTMPT           (1.4 A 0.9) X6.3
                                                                                                                            10-3
ucts. Panel A, comparison between protein-primed initiation and                         TP .dNMP:T stands for the elongation of a preformed initiation
elongation catalyzed by wild-type ( WT)429 DNA polymerase or the                    complex (dNMP being covalently bound to the terminal protein)
exonuclease-deficient (EXO-) mutant. Reactions were carried out                     opposite T on the template. These elongations were carried out with
                                                     metal activator
and analyzed as described for Fig. 3, using Mn2+as the                              dATP.
and different concentrations of dATP, as indicated. The position of                    *The errors of the mean were calculated as in Table I.
the TP.[“PIdAMP band is shown with an arrow. P a w l B, compari-                        ND, no elongation was observed at thehighest dATP concentra-
son between protein-primed misinsertion catalyzed by wild-type or                   tion tested (400 pM).
exonuclease-deficient 429 DNA polymerase. Reactions were carried
out and analyzed as described for Fig. 3, using MnZ+as the metal
activator and different concentrations of dTTP, as indicated. The                   TP -dTMP:T, respectively) show that the elongation effi-
position of the T P - [32P]dTMP band is shown with an arrow.                        ciency of a correctly matched initiation complex is not much




                                                                                                                                                          Downloaded from www.jbc.org by guest, on February 20, 2010
                                                                                    higher than theefficiency of mismatched ones.
product susceptible of exonucleolytic degradation is just the
                                                                                          DISCUSSION
TP. (dAMP)2 complex. The TP. (dAMP), complex obtained
with the exonuclease-deficient mutant (Fig. 5A) is probably         In this work we have evaluated the fidelity parameters
mediated by primer slippage on the 3‘-TTT sequence of the governing the error discrimination ability exhibited by 429
template. As shown in Fig. 5B, there was no elongated product DNA polymerase during both DNA polymerization and pro-
when the initiation reaction was carried out with a wrong tein-primed initiation.
nucleotide (its appearancewould imply the elongation of the         Insertion Discrimination-The first direct conclusion that
initial mismatch inserting againa wrong nucleotide), but the can be drawn from these studies is that DNA polymerase
                                                                                                           $29
similar amount of initiation reaction obtained a t different is able to catalyze DNA polymerization with high accuracy,
d T T P concentrations, using either the wild-type protein or comparable to thatof other reportedDNA polymerases (4-6,
the exonuclease-deficient mutant, indicates that there is no 11).With M$+, the errorfrequency (the inverse of the inser-
exonuclease activity on the TP .dNMP initiation complex, tion discrimination factor; see (4))of 429 DNA polymerase
not evenwhen it does not match with the          3’-end of the ranged from 2.2 x lo-‘ ( T d C M P misinsertion) to 4 X
template.                                                        ( T d T M P misinsertion); the T d G M P misinsertion showed
   Elongation Efficiency of Mismatched Initiation Complexes-     a n intermediate frequency (5 X IO-‘). UsingMn2+ as the
After verifying that the initiation complex cannot be proof- metal activator, 429 DNA       polymerase showed a slight increase
read and that the insertionfidelity of the initiation reaction in the insertion efficiency of the correct nucleotide (from 6.8
is rather low(102-10’, see Table 111), mismatch elongation to 15.1 s ” ~ M ” ) , whereas, in general, there was a strong
appeared as a crucial step for error avoidance in the protein- increase of misinsertion efficiencies. The ability of Mn2+ to
primed initiation reaction.                                      increase misinsertion efficiency without alteringsignificantly
   The mismatch elongationefficiency of 429 DNA polymer- the insertionefficiency of correct nucleotides is obviously one
ase when the mismatched nucleotide is directly bound to      TP of the reasonsfor the error proneness Mn2+-activatedDNA
                                                                                                        of
was measured in a pulse-chase experiment (see “Materials                                       it
                                                                 polymerases. In this study was not possible to know if Mn2+
                             pulse,
and Methods”). During the separate initiation reactions increased the affinity for         wrong nucleotidesor accelerated the
                            of
were carried out with each the three different    wrong nucle- mismatch catalytic rate.
otides (a-”P-labeled) to obtain the three possible mismatched       Similar kinetic studies                      for
                                                                                           were also carried out the protein-
TP. dNMP initiationcomplexes. Then, the elongation rate primed initiation reaction, obtaining independent and kc,,
                                                              of                                                      K,,,
these complexes was followed at different dATP concentra- estimations for correct and incorrect dNTPs,using Mn2+ as
tions (the next correct nucleotide). These studieswere carried the metal activator. When comparing the insertion        discrimi-
out using Mn2+ as the metal activator because of the low nation values of DNA polymerization and protein-primed
reaction that can be obtained with M$+. As shown in Table initiation, a t least three conclusions can be drawn. First, the
IV, no elongation of the TP .dCMP:T mismatch was       observed insertion of the correct nucleotide (dATP)is much more
at thehighest dATP concentration tested. This fact can a efficient in DNA polymerization than in the initiation reac-
                                                            be
result of a very low elongation rate of this mismatch and/or tion. Protein-primed initiation was 10‘ or 2 X lo3 times less
dissociation of the complex from the replication  origin. In the efficient than DNA polymerization when the metal activator
other twocases, a high rate of mismatch elongationwas            was Mg2+or Mn2+,    respectively. Specific steps of the protein-
observed, and mostof the complexes were elongated, indicat- primed reaction such as TP.DNA polymerase complex for-
ing that elongation was faster than dissociation. Mismatch mation ororigin recognition cannot be invoked to justify this
elongationefficiencies were compared with the elongation         difference, as these stepswere not rate-limiting in the assay
efficiency of the correctly paired TP -dAMP:T complex (cal- conditions. Therefore, the poor efficiency of the initiation
culated from a  continuous initiation/elongation reaction), and reaction is reflecting the actual low efficiency of nucleotide
the corresponding discriminationfactors       were calculated insertion. Second, theinsertion fidelity of protein-primed
 (Table IV). These factors (2.3 and 6.3 for TP.dGMP:T and initiation is quite low, with a discrimination factor of lo2,
                                                Fidelity of 429 DNA Polymerase                                                        2725
whereas itvaried from IO4to lo6 in DNA polymerization. The nucleotide, reducing its insertion efficiency. This distortion
insertiondiscrimination      of the
                                  Mn2+-activated    protein-       would also explain thelow fidelity exhibited in thisreaction.
primed initiation by 429 DNA polymerase is mainly a “ K , A less precise interaction with template will mask, to some
discrimination,” K , being about 140-fold  lower for the correct extent, thedifferences between correct and incorrect         pairing.
dNTP than for the incorrect ones. On the other hand, the           In other systems, Mn2+ has    been shown t o increase the DNA
catalytic rate of the four dNTPs was rather similar (twice polymerase affinity for improperly paired molecules, as wrong
faster for dATP than the other dNTPs, average). Third, dNTPs or dNTP analogs (28, 39). The structural reason for
                      for                        on
Mn2+ did notdecrease the insertion fidelity of the initiation this behavior is not yet clearly understood, but in some way
reaction, in contrast with the result obtained  for DNA polym- Mn2+improves the matchingof such molecules with the DNA
erization. Mn2+produced a 100-fold increase of misinsertion polymerase. DNA            complex. In protein-primed initiation,    even
efficiency in protein-primed initiation (quite comparable to       the right dNTP is probably not efficiently paired with tem-
the result obtained in DNA polymerization).                                                                          for
                                                 However, Mn2+ plate, allowing Mn2+ to increase the affinity this nucleo-
stimulated the insertion the correct nucleotide t o a similar tide. The same effect would occur for wrong nucleotides, and
                          of
extent, keeping the error frequency at the same level (about therefore, the error       frequency of this reaction is not   increased
4 X IO+). The increased efficiency of dATP insertion in the in the presence Mn2+.   of
                                      g’
presence of Mn2+ with respect toM 2 is mainly a result of            Exonucleolytic Proofreding-Following           misinsertion, a
an increase intheaffinityforthis                                                                             of
                                         nucleotide (a 25-fold DNA polymerase can prevent fixation the error excising     by
increase in affinity versus a 4-fold increase in velocity; see themismatched nucleotide, and obviously, the longer the
also Ref. 20).                                                     mismatched 3”terminus remains unextended the           more likely
   Therefore, the three main characteristicsprotein-primed it will be eliminated. We have clearly shown that 429 DNA
                                              of
initiation which differentiate it from DNA    polymerization a t polymerase extends mismatched primer termini much             slower
the insertionlevel are: poor efficiency of nucleotide insertion, than correctly paired primers (2 X lo6 times in the presence
low discrimination factor, and independence of this value of Mg”, on average, excluding the special T:dCMP mis-




                                                                                                                                             Downloaded from www.jbc.org by guest, on February 20, 2010
from the metal used as activator. As discussed below, these match). The strong + 5’ exonuclease activity of 429 DNA
                                                                                         3‘
properties are self-consistent and induce us to think of pro- polymerase is likely able to take advantageof this mismatch
tein-primed initiation as a mechanistically unfavored reac- elongation discrimination to increase the global fidelity of
tion.                                                              DNA polymerization. Mn2+, in general, decreased these dis-
    429 DNA polymerase has been shown to share significant crimination factors, and          again, this fact is presumably reflect-
 amino acid homology with the Klenow fragment of Esche- ing its ability to improve the fitnessof a mismatched primer
                                                                                                            of 429
 richia coEi DNA polymerase I (37). Based on this homology terminus into the primer binding site DNA polymerase.
 and on site-directed mutagenesis studies (22, 37), 429 DNA It was not possible to measure the mismatch             elongation rates
 polymerase has been proposed to show a structural arrange- of Mg2+-activated protein-primed initiation; but, least with at
 ment similar to the one observed for Klenow (38). In this         Mn2+, mismatch elongation      efficiencies were only moderately
 model, the polymerase active site is located within a binding lower thantheelongation efficiency of a properly paired
 cleft for duplex DNA, inwhich the template/primer structure initiation complex. This poor discrimination factoris consist-
 would be held. The two synthetic reactions carried out 429 ent with the interpretation discussed previously. The same
                                                           by
 DNA polymerase (DNA polymerization and protein-primed distortion that             would mask the    differences betweenthe incom-
 initiation) are proposed to share the same active site, and       ing correct or incorrect nucleotides probably persists after
 therefore, the two different primer molecules used in these       covalently linking TP and dNMP. If this is true, the differ-
 reactions (DNA template/primer and TP) would have to be ences between matched or mismatched dNMP complexes    TP.
 accommodated in the    proposed binding cleft of the 429 DNA would be also diminished. The fact that this distortion still     is
 polymerase. In this sense, the #29 TP has been proposed to present after catalyzing the initiation reaction          is suggested by
 be structurallyanalogous to thedouble-stranded portion of a the low elongation efficiency of a correctly paired initiation
 template/primer molecule (36). However, the interaction be- complex (8.9 X               s” p”’). This efficiency is about 2,000-
 tween TP and 429 DNA polymerase might distort to some             fold lower than the elongation    efficiency of a correctly paired
                                                                                                          fact
 extent its polymerization active site. In addition, in the initi- DNA primer terminus, despite the that theelongation of
 ation reaction, primer (TP) and template are not covalently an initiation complex implies the formation of a standard
 linked, as in DNA polymerization (considering the double- internucleotidic bond. Another factor that would justify the
 stranded region of template/primer as the real primer). These poor elongation of initiation complexes is the absence of a
 different properties of TP compared with DNA template/            stabilizingDNAduplex region upstream from theprimer
 primer arelikely diminishing the stabilization the incoming terminus, which could not be perfectly mimicked by TP.
                                                 of

                                            A                             -
                                                                          R                             C


   FIG. 6. Comparative model for
protein-primed initiation and elon-
                                                e T T TCAT------
                                                 3’
                                                                              e  G T T C A T------
                                                                                3’
                                                                                                            e   T G T C A T------
                                                                                                               3’

                                                                                                                               I
-
Pation on both wild-tvue and mu-
tated templates. Pami ^A, initiation
and elongation on a normal template
                                                              *I                           *I
(adapted from Ref. 35). Panel B, initia-          T T T CAT------                G T T C A T------




                                                .-                                                          .-
                                                                                3‘                             3‘
tion-and elongation on atemplate      mu-        3’
tated atits 3”terminal nucleotide. Panel
C, initiation and elongation on
                       tem- a
plate mutated a t its second position.
                                                                 1                             1                           1
                                                  A A A G


                                                 3‘
                                                             T   A”----
                                                      T T T C A T------       0A A


                                                                                3’
                                                                                     A C   T   A“””
                                                                                  G T T C A T------
                                                                                                               3’
                                                                                                                 C C A 0 T A”””
                                                                                                                 T G T C   A       T-““-
2726                                          Fidelity of 4 2 DNA Polymerase
                                                           .9
    On theother hand, we have shown thatthe 3' + 5'                3"terminal nucleotide is never used as template. In thissense,
exonuclease activity of 429 DNA polymerase cannot take             it is also important to note that a mutation at the second
advantage of this poor mismatch elongation discrimination          position of the template would bemuch more dangerous. After
because of the insensitivity of initiation complexes (mispaired    sliding back, again a mispaired TP-dNMP will be produced
or not) to this exonuclease activity, Assuming that the exon-      on the first position of the template (Fig. 6C), but if this
ucleolytic proofreading model proposed for Klenow (14) is          complex is elongated, the mutation will be fixed and imposed
also valid for 429 DNA polymerase, the inability of its exo-       to the first position. Even more, these double mutants will
nuclease activity to excise the nucleotide covalently bound to     behave as efficient templates both for initiation and elonga-
TP can simply reflect the impossibility of this nucleotide to      tion because the first and second nucleotides would be again
reach the exonuclease active site because of steric hindrance      identical (35). In this sense, the importance of having exon-
imposed by TP. It is also possible that the phosphodiester         ucleolytic proofreading on the second insertion event is clearly
bond linking TP and the first dNMP would be chemically             reinforced, to avoid the formation of templates with the
resistant to theexonuclease activity of $29 DNA polymerase.        second position mutated.
On the other hand, the bond linking the first and second              Thus, it could be considered that thestrategy proposed for
nucleotides was susceptible to the exonuclease action. In the      the replication of TP-containing linear genomes has mini-
absence of structural information, wedo not know if this           mized the potentially deleterious effect of the unfaithful ini-
result indicates a close vicinity between the exonuclease and      tiation event. The low accuracy of protein-primed initiation
the polymerization active sites or the ability of TP to place      would be because of special mechanistic and structural prop-
this second nucleotide into the exonuclease active site, mim-      erties of the initiation reaction which differentiate it from
icking DNA primer melting and sliding.                             DNA polymerization.
   Physiological Implications of Protein-primed Initiation In-                                      REFERENCES
accuracy-After examining thethree discrimination steps              1. Drake, J. W. (1969) Nature 2 2 1 , 1132-1133
presented in this work (insertion, mismatch elongation, and         2. Cox, E. C. (1976) Annu. Reu. Genet. 1 0 , 135-156




                                                                                                                                                        Downloaded from www.jbc.org by guest, on February 20, 2010
exonucleolyticproofreading), protein-primed initiationcan be        3. Clayton, L. K., Goodman, M. F., Branscomb, E. W., and Galas, D. J. (1979)
                                                                         J. Biol. Chem. 2 5 4 , 1902-1912
predicted asaquiteinaccurateDNA-instructed             reaction:    4. Boosalis. M. S.. Petruska. J.. and Goodman. M. F. (1987) J. Biol. Chem.
                                                                                                   ,   I                     .    .
wrong nucleotides are easily inserted, they cannot be proof-             262114689-14696
                                                                         ~




                                                                    5. Kuchta, R. D., Benkovic, P., and Benkovic, S. J. (1988) Biochemistry 2 7 ,
read, andtheir elongation is rather efficient. From these                6716-6725
results, a high mutational rate on the first position of $29        6. El-Deiry, W. S., So, A. G., and Downey, K. M. (1988) Biochemistry 2 7 ,
                                                                         546-553
DNA is likely to be expected. However, 429 and other related        7. Riccheti, M., and Buc, H. (1990) EMBO J. 9, 1583-1593
phages, as $15,PZA, PZE, Nf, M2,B103, or GA-1, have                 8. Eckert, K. A,,and Kunkel, T. A. (1990) Nucleic Acids Res. 18,3739-3744
                                                                    9. Mattila. P.. Komela. P. M., Tenkanen,. T., and Pitkiinen, K. (1991) Nucleic
                                                                                                                 .
inverted terminal repeats which, in addition, are homologous             Acids'Res. 19; 4967-4973
between them (16). Therefore, the terminal sequences of these      10. Maki, H., Mo, J.-Y., and Sekiguchi, M. (1991) J. Biol. Chem. 2 6 6 , 5055-
                                                                             MCl
                                                                             I""



related phages are especially conserved. It can be argued that     11.   Wong, I., Patel, S. S.,and Johnson, K. A. (1991) Biochemistry 30,526-537
in the in vitro system used (TP, 429 DNA polymerase, and           12.   Yu, H., and Goodman, M. F. (1992) J. Biol. Chem. 2 6 7 , 10888-10896
                                                                   13.   Echols, H., and Goodman, M. F. (1991) Annu. Reu. Biochem. 60,477-511
TP-DNA) some factor(s) enhancing the fidelity of the initi-        14.   Joyce, C. M., and Steitz, T. A. (1987) Trends Biochem. Sci. 12,288-292
ation reaction has/have been lost. Although this possibility       15.   Mendelman, L. V., Petruska, J., and Goodman, M. F. (1990) J . Biol. Chem.
                                                                           2 6 5 , 2338-2346
cannot be ruled out, we favor the possibility that therecently     16.   Salas, M. (1991) Annu. Reo. Biochem. 60,39-71
described special mechanism for 429 protein-primed initiation      17.   Bernad, A., Llzaro, J. M., Salas, M., and Blanco, L. (1990) Proc. Natl.
                                                                           Acad. Sci. U. S. A. 87,4610-4614
and elongation (35) can be responsible for maintaining the         18.   Blasco, M. A,, Blanco, L., Par& E., Salas, M., and Bernad, A. (1990)
genetic information of the very terminal nucleotide. It has                Nucleic Acids Res. 18,4763-4770
                                                                   19.   Bernad, A,, Zaballos, A,, Salas, M., and Blanco, L. (1987) EMBO J. 6 ,
been reported that theinitiation reaction actually takes place             4219-4225
opposite the second position from the 3'-end of the TP.DNA         20.   Esteban, J. A,, Bernad, A., Salas, M., and Blanco, L. (1992) Biochemistry
                                                                           31,350-359
template (Fig. 6A). After initiation, transition to elongation     21.   Garmendia,C., Bernad, A,, Esteban, J. A,, Blanco, L., and Salas, M. (1992)
would be mediated by a "sliding-back'' mechanism, producing                J. Biol. Chem. 267,2594-2599
                                                                   22.   Bernad, A.. Blanco, L. Lazaro, J. M., Martin, G., and Salas, M. (1989) Cell
the translocation of the TP. dAMP complex to pair with the                 69,219-228
terminal T residue on the template. Then, the elongation of        23.   Blanco, L., and Salas, M. (1984) Proc. Natl. Acad. Sci. U. S. A. 8 1 , 5325-
                                                                             6299
the initiation complex would be produced using again the            .
                                                                   24 Zaballos, A,, and Salas, M. (1989) Nucleic Acids Res. 17, 10353-10366
                                                                   ~




second 3'-T residue as template (Fig. 6A). Misincorporation        25. Perialva, M. A.. and Salas, M. (1982) Proc. Natl. Acad. Sci. U. A. 7 9 ,
                                                                                                                                          S.
                                                                         5522-5529
during the initiation reaction would produce templates whose       26. Strauss, F. C., Lobori, J. A,, Siu,G., and Hood, L. E. (1986) Anal. Biochem.
 firstand second terminal nucleotides are different. These               164,353-360
                                                                   27. Hihner, U., and Alberts, B. M. (1980) Nature 286,300-304
molecules will serve as normal templates for protein-primed        28. Goodman, M. F., Keener, S., Guidotti, S., and Branscomb, E. W. (1983) J.
 initiation, but after the sliding back of the TP dAMP complex           Biol. Chem. 258,3469-3475
                                                                   29. El-Deirv. W. S.. Downev. K. M., and So, A. G. (1984) Proc. Natl. Acad. Sci.
to allow elongation, a mismatch will be produced with the                U. S.A. 81, 7378-7382
                                                                   30. Beckman. R. A,. Mildvan. A. S.,and Loeb, L. A. (1985) Biochemistry 2 4 ,
terminal 3'-nucleotide on the template (Fig. 6 B ) . Part of             5810-5817 '
these TP. dAMP complexes could dissociate from template            31. Eger, B. T., Kuchta, R. D., Carroll, S. S.,Benkovic, P. A., Dahlberg, M. E.,
                                                                         Joyce, C. M., and Benkovic, S. J. (1991) Biochemistry 30,1441-1448
before elongation, diminishing the efficiency of these mole-       32. Creiehton. S.. Huane. M. M.. Cai. H.. Arnheim, N., and Goodman, M. F.
                                                                        ~~.~  "-    ~~I



 cules as templates and                         a
                          therefore acting as nonexonucleolytic          (1992) J. Bzol. Ch&.,267,'2633-2639
proofreading. If the initiation complex is finally elongated,      33. Kunkel T. A. (1990) Emhemstry 29,8003-8010
                                                                   34. Murra;, M. J., and Flessel, P. (1976) Biachim. Biophys. Acta 425,256-261
 the second 3'-nucleotide of the template would be usedagain,      35. Mendez, J., Blanco, L., Esteban, J. A., Bernad, A., and Salas, M. (1992)
 restoring the two-nucleotides terminal repetition at the end            Proc. Natl. Acad. Sei. U. S. A. 89, 9579-9583
                                                                   36. Blanco, L., Bernad, A., Esteban, J. A,, and Salas,M. (1992) J . Biol. Chern.
 of the molecule (Fig. 6B). Therefore, despite the fact that the         2 6 7 , 1225-1230
                                                                   37. Blanco, L., Bernad, A,, Blasco, M. A., and Salas, M. (1991) Gene (Amst.)
 first replication event is especially inaccurate, these errors           100,27-38
 would not be fixed. According to this model, errors will be       38. Ollis, D. L., Brick, P., Hamlin, R., Xuong, N. G., and Steitz, T. A. (1985)
                                                                         Nature 313,762-766
 counterselected because of a less efficient elongation after      39. Tabor, S., and Richardson, C. C. (1989) Proc. Natl. A d . Sci. U. S. A. 8 6 ,
 sliding back, or forgotten if elongation succeeds, because the          4076-4080

				
DOCUMENT INFO
Shared By:
Categories:
Stats:
views:11
posted:2/22/2010
language:English
pages:8