Anti bacterial activity of probiotics lactic acid bacteria ANTI B ACTERIAL ACTIVITY OF PROBIOTICS LACTIC ACID
Document Sample


ANTI-B ACTERIAL ACTIVITY OF PROBIOTICS LACTIC ACID BACTERIA ENTEROCOCCUS FAECALIS TH10 AND
TRANSDUCTION OF HUMAN INTESTINAL TRACTS COHESIVE FACTOR TO E. FAECALIS TH 10
By: Iichiroh Ohhira, Ph.D.
Currently, a large number of lactic acid bacteria utilized for live bacterial products are derived from human intestinal bacteria.
Enterococcus faecalis, one of the representative strains, has been utilized as live bacteria products with balancing activity of intestines
since the 1950s. The E. faecalis TH10 used in this study was isolated from traditional fermented food “tempeh” in Malaysia, which main
ingredients are soybeans. This strain does not produce hemolysin but shows protease activity more than six times in comparison to other
ordinary lactic acid bacteria. Also, it revealed its characteristics of probiotics as acid-tolerance and anti-bacterial activity. In this study,
the evaluation was based on an experiment conducted on E. faecalis TH10 as probiotics lactic acid bacteria and enforcement of cohesive
factor to human intestinal tracts with a molecule breeding method. That is, after isolating and identifying anti-bacterial substance that E.
faecalis TH10 produces, cohesive activity of these bacteria to human intestinal tracts model Caco-2 cell was evaluated. Moreover,
cloning of intestinal cohesive factors different from E. faecalis TH10 from genome of Lactobacillus fermentum, other lactic acid bacteria
showing high intestinal cohesive activity was conducted and the appearance of its gene on these bacteria was experimented.
1. Identification of anti-bacterial substance that E. faecalis TH10 produces.
Lactic acid bacteria produce a variety of anti-bacterial substances, such as bacteriocin, and obtain inhibitive mechanism on growth of other microbes.
Since from E. faecalis TH10 found phenomenon of showing anti-bacteria against Staphylococcus aureus, identification of anti-bacterial substance these
bacteria produce was conducted. This substance was considered different from those already known.
METHODS: After inoculating these bacteria in MRS liquid medium (Oxoid), the bacteria was eliminated with centrifugal separation, its supernatant
was extracted by water saturated butanol or ether, and fraction showing antibacterial activity in high speed liquid chro matography was obtained by
reverse phase partition column. After methyl enducing it, isolation and identification were conducted by GC/MS with SPB-Octyl column (60m x
0.25mm- i.d.; Supelco).
RESULTS: As a result from analyzing by GC/MS, anti-bacterial substance, the bacterium produced was identified as phenyl lactic acid. By optical
partition with optical isomer isolation column Nucleosil Chiral-1, found both types D and L in phenyl lactic acid obtained. They were forming racemic
mixture. That is, although there is no report that lactic acid bacteria would produce phenyl lactic acid, it was admitted that these bacteria prod uce 13.4
μM of type-D and 6.7μM of type-L. 0.2% volume of DL-phenyl lactic acid inhibited the growth of entero hemorrhagic E Coli O157:H7 and S. aureus
completely in LB liquid medium (pH7.0).
2. Cohesive activity of E. faecalis TH10 to human intestinal tracts model.
The reason why the most important character of probiotics lactic acid bacteria is said to be intestinal cohesive activity is that this characteristic relates
profoundly to intestinal infection. For cohesive factors of infection, related bacteria are revealed already as lectin-like protein, S-layer protein
lipoteichoic acid that exit in pilus and outer membrane; sugar protein, sugar lipid and out-of-cell matrix (ECM) protein as receptor on intestinal epithelial
cell side. In lactic acid bacteria, also, since there are phenomena animal species which can stay in intestines are different by species and strains; strains set
in intestines would change by aging, it is estimated that there exist factors coherent especially to animal cells. On studying cohesive activity of lactic acid
bacteria to intestinal epithelial, there has been utilized Caco-2, stated as ideal model cells on epithelial cells, or ECM protein, therefore, cohesive activity
of E. faecalis TH10 was investigated.
METHODS: Cohesive test to Caco-2 cells (Gram-stain method).
In culturing Caco-2 cells, we used DMEM medium containing fetal bovine serum which anfotelycin B and streptomycin-penicillin and anti-essential
amino acid were applied. In order to make LAB-TEK chamber-slide, Caco-2 cells were inoculated and cultured in CO2 incubator. Cell layers after
culture was rinsed well with phosphorus acid buffer (PBS), added liquid where sample strains were suspended in a certain amount to DMEM medium,
and kept for 2 hours at 37℃. After cleansing it with PBS twice, Gram-stained and counted cohesive bacterial count.
1) Cohesive test to Caco-2 cells (RI label method).
First, sample strains were RI labeled, as the same condition mentioned above, after having them attached to Caco-2 cells rinsed and evaluated their
settlement on base of count obtained in liquid scintillation counter.
2) Cohesive test to ECM protein.
Laminin, type-I collagen, type-IV collagen, type-V collagen and bovine serum albumin (BSA) were immobilized to become 2.5pmol on a slide glass.
After 2-hour blocking with 2% BSA/PBS, suspended liquid was dropped from each strain at 5 x 10 8/ml concentration and left for 2 hours. After cleansing
it with 0.1%BSA/PBS, Gram-stained cohered bacteria and counted cohesive bacterial count.
RESULTS: Cohesive activity of each sample strain to Caco-2 cells can be shown 23.2±6.0 at E. faecalis TH10, cohesive bacterial count per 100 cells.
The number was higher value than 18.0±4.3 of L. lactis subsp. lactis NIAI 527 that Kimoto et.al (1998) reported with exclusive cohesive activity. Also,
it was admitted that E. faecalis TH10 obtains about 10% higher cohesive activity than E. coli with type-I pilus.
Moreover, cohesive activity to four kinds of ECM protein: laminin, type-I collagen, type-IV collagen, type-V collagen and bovine serum albumin, was
investigated. Although they all varied strong and weak, it showed strong cohesive activity to especially to type-IV collagen and showed higher value than
L. crispatus JCM 5810. Therefore, it was clarified of validity to think that E. faecalis TH10 is a strain with cohesive activity to human intestinal tracts.
3. Transduction of intestinal tract cohesive gene to E. faecalis TH10.
When lactic acid bacteria have exclusive intestinal tracts cohesive activity, they are estimated to trigger antagonism inhibition of cohesive activity by
pathogenic bacteria and to be utilized for prevention from infection and treatment after infected. Then, other intestinal tracts cohesive gene (sugar chain
binding protein) was transducted to E. faecalis TH10 and an experiment was made in aim to measure the increase of strength for cohesive activity by
transduction. That is, in comparison to E. coli with type-1 pilus, from L. fermentum FAF-1 with as high as 1.48-fold cohesive activity in above mentioned
evaluation method, cloning was done on genes in relation to its cohesive activity, we produced these genes with E. faecalis TH10 and studied on
possibility that it might have stronger cohesive activity to transformer obtained.
METHODS AND RESULTS: Cohesive activity of L. fermentum FAF-1 with lectin-like protein was estimated and forward primer
(CAYCARACNCAYTGGTAYATG) and rivers primer (ARYTCDGCYGDATCATCCA) from amino acid sequence of present lectin-like protein
(Yamamoto, 1988) was assembled. By the way, above mentioned are multiple primers as Y:C or T R:A or G N:A or C or G or T D:A or G or T. L.
fermentum FAF-1 genome was PCR widened on template and obtained 370 bp widened fragments. When decided the sequence, lectin-like protein gene
of L. rhamnosus and 82% homology were admitted.
In order to conduct cloning of above gene, assembled genome library of L. fermentum FAF-1. First of all, genome was decomposed into 9 to 23 kb
fragments with Sau3A1, conducted ligation to Bam HI arm of λDASH II and obtained genome library. Having above 370 bp DNA sequence as prove,
up to 3rd screening was done and obtained phage clone No.9-2-1 with lectin-like protein gene ORF from genome library. All DNA sequence integrated
in this clone was decided.
Next, in order to conduct sub cloning to vector pIL253 for lactic acid bacteria of intestinal cohesive gene from L. fermentum, designed forward primer
(GCGAATTCGTCTTCCACGACCAAGCACT) and rivers primer (CGCTCGAGTGGCCCTGAATCACGGTGTC) from sequence contained in phage
clone No.9-2-1. PCR fragment widened from this primer was that contains ORF of intestinal cohesive gene from L. fermentum. Then settled respectively
Eco RI site to forward primer and Xho I site to rivers primer. Both limited enzyme sites in this vector were integrated with its direction decided since
multi cloning site of vector pIL253 for lactic acid bacteria have cleavage parts. After purifying and desalting this plasmid (p921EX), dissolved in 15μL
sterilized distilled water and used it to electro poration method with gene pulser (Bio-Rad Laboratories) to E. faecalis TH10. It was confirmed that
obtained erythromycin resistance transformer (Em r) plasmid was lectin-like protein gene from L. fermentum with PCR method. And this protein was
detected with antibody. Intestinal tracts cohesive activity of Em r transformer of E. faecalis TH10 where p921EX was transducted was evaluated by a
testing method with RI labeled Caco-2 cells mentioned above. As a result, it was admitted that obtained transformer contains 1.83-fold higher cohesive
activity than E. coli with type 1 pilus. In conclusion, by transducing intestinal cohesive gene of L. fermentum FAF-1 to E. faecalis TH10, transformer
1.66-fold stronger than parent strain in intestinal tracts cohesive activity was successfully obtained.
October, 2000 05-01
Shared by: Lingjuan Ma
About
work for China Compulsory Certification. Some of the documents come from Internet, if you hold the copyright please contact me by huangcaijin@sohu.com
Related docs
Other docs by malj