Supplementary Information for JB00834-04 Version 2 by tyndale

VIEWS: 4 PAGES: 8

									                   Supplementary Information for JB00834-04 Version 2



                      Nature of the Promoter Activated by C•PvuII,

   an Unusual Regulatory Protein Conserved among Restriction-Modification Systems



       Dieter Knowle, Robert E. Lintner, Yara M. Touma, and Robert M. Blumenthal*



        Department of Microbiology & Immunology and Program in Bioinformatics &

                                  Proteomics/Genomics

                    Medical College of Ohio, Toledo, Ohio 43614-5806




*Corresponding author. Mailing address: Department of Microbiology & Immunology, Medical

College of Ohio, 3055 Arlington Ave., Toledo, OH 43614-5806. Phone: (419) 383-5422. Fax:

(419) 383-3002. E-mail: rblumenthal@mco.edu.
       Promoter clones and their derivatives. Sources of C.PvuII or C.PvuIIEsp19. pDK74 and

pDK80 were generated by excising the intact PvuII restriction-modification system from

pPvuRM3.4, or its derivative containing a pvuIIC Esp19 null allele (2), using EcoRV and EcoRI

and ligating into the ScaI and EcoRI sites of pACYC184. Derivatives were made defective for

pvuIIM, by removing an SpeI-SpeI fragment, and pvuIIR, by excising a BaeI-EcoRI segment.

The resulting plasmids were named pDK200 (pvuIIC+) and pDK201 (pvuIICEsp19).

       pvuIICR promoter plasmids. The longest promoter clones extended from –93 to +88

relative to the start codon of pvuIIC (see Fig. 1). The –93 position corresponds to a native SpeI

site (ACTAGT) at nt 1341-1346 in the pPvu1 sequence (accession # gi11995221), while +88 is a

native HindIII site (nt 1156-1161 in pPvu1). To construct plasmid pDK2, oligonucleotides DK1

and DK2 (Table S1) were hybridized, extended with Klenow DNA polymerase, cleaved at the

ends with BamHI and HindIII, and ligated into BamHI- and HindIII-cut pKK232-8. Next, the

region from -27 to +88 was PCR-amplified from pPvuRM3.4 using primers DK3 and DK4

(Table S1) and Taq DNA polymerase, digested with HindIII, and ligated into HindIII-cut pDK2

yielding pDK58. Both pDK2 and pDK58 were verified by DNA sequencing using primer DK5.

       pBH403 and derivatives. The lacZ gene was amplified as a promoterless 3107-bp

fragment from E. coli W3110 chromosomal DNA, using primers B14 and B15 (Table S1) and

PFU turbo DNA polymerase (Stratagene), and given TA-cloning overhangs with Taq

polymerase. The PCR product was gel purified, subcloned into the TOPO TA 2.1 vector and

excised as a HindIII fragment that was ligated into HindIII-cut pKK232-8. The promoterless

lacZ and cat genes are transcribed in the same direction, with lacZ upstream of cat.

       The pvuIICR promoter (-59 to +88 relative to the initiation codon of pvuIIC) was

amplified from pPvuRM3.4 using primers DK12 and DK13 and Taq polymerase. The PCR
product was digested with SalI and ligated into SalI-digested pBH403. Similarly, the pvuIICR

promoter (-93 to +88) was amplified using primers DK14 and DK15, digested with BamHI and

SalI and ligated into BamHI- and SalI-digested pBH403.

       pvuIICR 3' deletions. The pvuIICR promoter region (-93 to +88 relative to the initiation

codon of pvuIIC) was amplified from pDK58 using primers DK16 and DK13, digested with

BamHI and SalI, and ligated into BamHI- and HindIII-cut pKK232-8, yielding pDK148. The

insertion was sequence confirmed using primer DK5. Downstream of +88, BglII, Sac I and SalI

sites were incorporated via the PCR primer. The Erase-a-Base system (Promega) was utilized to

make nested 3' deletions from the BglII site after pDK148 was cut with BglII and SacI (the 3'

overhang from SacI is resistant to exonuclease III digestion). The manufacturer's instructions

were followed. Transformants were screened by colony PCR (1) using primers DK5 and DK16.

The PCR products were resolved on a 6% polyacrylmide gel, and plasmid DNA was isolated

from those colonies yielding PCR products smaller than the WT. These plasmids were

sequenced using primer DK5. The resulting plasmids had a fixed upstream pvuIICR promoter

end (-93), with downstream ends at +88 (pDK153), +68 (pDK155), +38 (pDK157), +23

(pDK150), +19 (pDK154), +18 (pDK152), -2 (pDK151) and -24 (pDK156), relative to the

initiation codon of pvuIIC. Plasmids with shorter segments were prepared by PCR using primer

DK39 and one of the primers DK40-43 (Table S1); the resulting plasmids had 1 (pDK525), 10

(pDK526), 16 (pDK527) or 24 (pDK528) bp downstream of the C boxes, corresponding to 3’

endpoints at –24, –15, –9, and –1 relative to the initiation codon of pvuIIC.

       Replacements in region downstream of C boxes. Oligonucleotides DK18 and DK19 were

mixed, yielding a dsDNA fragment with 4-nt extensions at each end respectively compatible

with cleaved SalI and HindIII sites. This fragment was ligated into SalI- and HindIII-cut
pDK156, yielding plasmid pDK178 with a –41 to +1 insertion. This strategy was used with

additional oligonucleotide pairs DK20 – 25 having replacements in the DSR sequence to produce

the 5'- (pDK179), 3'- (pDK180) and 5+3'- (pDK181) substituted promoters.

        C box / –10 hexamer spacing variants. Self-complementary oligonucleotide DK26 was

annealed, yielding dsDNA with 4-nt SalI-compatible extensions. This DNA was ligated into

SalI-cut pDK151, resulting in a net insertion of 10 bp just downstream of the C boxes (pDK227).

This strategy was also used, with pairs of complementary oligonucleotides DK27/28 and

DK29/30, to produce the +15 and +20 spacing mutants (pDK228 and pDK229). The -4 spacing

mutant was made by digesting pDK151 with SalI and treating with S1 nuclease before religation.

The +4 spacing mutant was made by end-filling the SalI-cut pDK151with Klenow polymerase

before religation. All spacing variants were sequence confirmed.

        Methyltransferase promoter plasmid. Oligonucleotides DK33 and DK34 were

hybridized, yielding a duplex -61 to +5 relative to the start of transcription for pvuIIM promoter

M82 (3). This was digested with BamHI and HindIII and ligated into BamHI- and HindIII-cut

pKK232-8. The pvuIIM promoter together with the region between the C boxes and pvuIIC

initiation codon (-61 to +46 relative to pM82) was PCR amplified from pPvuRM3.4 using

primers DK3 and DK4, digested with HindIII, and ligated into HindIII-cut pKK232-8. The

resulting clones were analyzed using primer DK5 to verify their sequence and orientation

relative to cat.
               TABLE S1. Oligonucleotides used in this study a



B14 TCCCCCCGGGAAGCTTAAATAAATAAAACACAGGAAACAGCTATGACCATGATTACG

B15 TCCCCCCGGGAAGCTTTTATTTTTGACACCAGACCAACTGGTAATGG

DK1 TGGGGATCCTTGTGTAGGCAGGTTTTTTTCCAAAATTCAACATATCATTGCGACT

    CATAGTCTGTAGACTCAAAGTCAAAGCTTGGGGG

DK2 CCCCCAAGCTTTGA

DK3 CCCCCAAGCTTCATCATTATCCCGTCTATGAGCAGAA

DK4 CCCCCAAGCTTTCTTGGGATAGACCTAGCTCGC

DK5 CAACGGTGGTATATCCAGT

DK6 TGGGGATCCTTGTGTAGGCAGGTTTTTTTCCAAAATTCAACATATCATTGCGACT

    CATCTGATGTAGACTCAAAGTCAAAGCTTGGGGG

DK7 TGGGGATCCTTGTGTAGGCAGGTTTTTTTCCAAAATTCAACATATCATTGCGACT

    CATAGTCTGTAGACTCAACTGAAAAGCTTGGGGG

DK8 TGGGGATCCTTGTGTAGGCAGGTTTTTTTCCAAAATTCAACATATCATTGCGACT

    CATCTGATGTAGACTCAACTGAAAAGCTTGGGGG

DK9 TGGGGATCCTTGTGTAGGCAGGTTTTTTTCCAAAATTCAACATATCATTGCGACT

    CATATTCTGTAGACTCAAAGTCAAAGCTTGGGGG

DK10 TGGGGATCCTTGTGTAGGCAGGTTTTTTTCCAAAATTCAACATATCATTGCGACT

    CATAGTCTGTAGACTCAAATTCAAAGCTTGGGGG

DK11 TGGGGATCCTTGTGTAGGCAGGTTTTTTTCCAAAATTCAACATATCATTGCGACT

    CATATTCTGTAGACTCAAATTCAAAGCTTGGGGG

DK12 ACGCTGTCGACATCATTGCTACTCATAGT

DK13 ACGCGTCGACGAGCTCAGATCTTCTTGGGATAGACCTAGCTCG

DK14 CGCGGATCCACTAGTTGTGTAGGCAGGTTTT

DK15 ACGCGTCGACGTCTCAGCTAAGCTTTCTTGGGATAGA
DK16 CGCGGATCCTTGTGTAGGCAGGTTTTTTTC

DK17 AACAGCAACTGATGGAAAC

DK18 TCGACCCATCATTATCCCGTCTC

DK19 AGCTGAGACGGGATAATGATGGG

DK20 TCGACCGGGCCCTATCCCGTCTC

DK21 AGCTGAGACGGGATAGGGCCCGG

DK22 TCGACCCATCATCCCGGGGTCTC

DK23 AGCTGAGACCCCGGGATGATGGG

DK24 TCGACCTTGCGGCCGCTTGTCTC

DK25 AGCTGAGACAAGCGGCCGCAAGG

DK26 TCGAACGCGT

DK27 TCGAACTAGTACGCG

DK28 TCGACGCGTACTAGT

DK29 TCGACACTAGTACGCGTAGA

DK30 TCGATCTACGCGTACTAGTG

DK31 GGGGTCGACCNNNNNNNNNCCCGCGAAGCTTTTT (N= mix of A, C, G, and T)

DK32 AAAAAGCTTCGCGGG

DK33 GGGCGGATCCTAAGCTCTCTTGGGATAGACCTAGCTCGCCTCGCATTTTTTTTA

     CATTCTTTGCAAGGGTTAATCGGGCAAGCTTTTTT

DK34 AAAAAAGCTTGCCCGATTAACCCTTGCAAAGAATGTAAAAAAAATGCGAGGCG

     AGCTAGGTCTATCCCAAGAGAGCTTAGGATCCGCCC

DK35 CATTCTTTGCAAGGGTTAATCGGGCT

DK36 AGACCTAGCT

DK37 GGCTGATAAAGGATTTGTATTTCTGCTCATAGACGGGATAATGATGGTATGATGAC

     TTTGAATCTACAGACTATGAG

DK38 GGGATAATGATGGTATGATGACTTTGAATCTACAGACTATGAGTAGCAATG
DK39 CGCGGATCCACTAGTTGTGTAGGCAGG

DK40 ACGCGTCGACTGACTTTGAATCTACAGAC

DK41 ACGCGTCGACATGGTATGATGACTTTGAATC

DK42 ACGCGTCGACATAATGATGGTATGATGAC

DK43 ACGCGTCGACTAGACGGGATAATGATGGTATG

RV1 TCGGGCTGATAAAGGATTT From (3)



a
    All are shown 5’  3’
                                      REFERENCES

1.   Dallas-Yang, Q., G. Jiang, and F. M. Sladek. 1998. Avoiding false positives in colony

     PCR. Biotechniques 24:580-2.

2.   Tao, T., J. C. Bourne, and R. M. Blumenthal. 1991. A family of regulatory genes

     associated with type II restriction- modification systems. J Bacteriol 173:1367-75.

3.   Vijesurier, R. M., L. Carlock, R. M. Blumenthal, and J. C. Dunbar. 2000. Role and

     mechanism of action of C.PvuII, a regulatory protein conserved among restriction-

     modification systems. J Bacteriol 182:477-487.

								
To top