Source Population Reference Bureau; and United Nations, World

Document Sample
Source Population Reference Bureau; and United Nations, World Powered By Docstoc
					                                                                 12

                                                                 11
                                                                                                                          2100
                                                                 10

                                                                 9                                                     Modern
                                                                                                                          Age
                                                                  8 Old                                         Iron
                                                                    Stone                             Bronze           Middle




                                               Billions people
                                                                                  New Stone Age         Age     Age     Ages
                                                                  7 Age

                                                                  6                                                      2000       Future

                                                                  5

                                                                  4                                                      1975

                                                                  3
                                                                                                                         1950
                                                                  2
                                                                                                                         1900
                                                                  1                     Black Death   — The Plague      1800


                                                                      1+ million 7000 6000 5000 4000 3000 2000 1000 A.D. A.D. A.D. A.D. A.D. A.D.
                                                                        years B.C. B.C. B.C. B.C. B.C. B.C. B.C. 1 1000 2000 3000 4000 5000

                                                                                                      Source: Population Reference
                                                                                                      Bureau; and United Nations, World
                                                                                                      Population Projections to 2100
                                                                                                      (1998).




Aleklett, K. & Campbell, C.J. "The Peak and Decline of World Oil and Gas Production". Uppsala
University, Sweden. ASPO web site. 2003.
TINY FACTORIES Telles, a joint venture
between Metabolix and Archer Daniels Midland,
will make polyesters in bacteria.(C&EN, Sept.
29, 2008).
                      =


 Cell is like a factory, made up of parts, that can
 be exploited and optimized to convert
 inexpensive raw materials into useful product.

Biological engineers use -
 Biochemistry/Molecular Biology: study of
 individual parts
 Systems Biology: study of how parts interact
 together
 Synthetic Biology: study of using biological parts
 in new ways and/or making new parts
                          (what cell does)
                            Phenotype


                           Genotype
    predict             (Genetic controls)         can’t predict
    genotype                                       genotype


Use rational engineering                     Use Combinatorial or
                                             evolutionary engineering
Examples: want antibiotic resistance
phenotype, insert resistance gene.           Example: want improved growth in
                                             presence of inhibitors, make a
Want more of a metabolite, direct a          diverse library of genotypes and
known metabolic pathway by increasing        select cells with desirable
expression of genes leading to               phenotype.
metabolite, decreasing expression of
genes products that degrade the              Resistance to environmental or
metabolite.                                  metabolic stress in industrial
                                             conditions
  Rational Biological Engineering: Example from Jay
Keasling Lab (Berkeley, slides from his talk on Sept. 11)
Rational Biological Engineering




         Inhibited by products
                                  Potential
                                  Fuels
Keasling lab,
Keasling lab,
Keasling lab,
Keasling lab,
                          (what cell does)
                            Phenotype


                           Genotype
    predict             (Genetic controls)        can’t predict
    genotype                                      genotype


Use rational engineering                 Use Combinatorial or
                                         evolutionary engineering
Examples: want antibiotic resistance
phenotype, insert resistance gene.       Example: want improved growth in
                                         presence of inhibitors, make a
Want more of a metabolite, direct a      diverse library of genotypes and
known metabolic pathway by increasing    select cells with desirable
expression of genes leading to           phenotype.
metabolite, decreasing expression of
genes products that degrade the          Resistance to environmental or
metabolite.                              metabolic stress in industrial
                                         conditions
Slides by Nicholas Sandoval
                                                                                SCALEs
                                                                  • Genomic library
                                                                    –Insert sizes of 1, 2, 4, and 8
                                                                     kb
                                                                    –Entire genome represented
                                                                    –Increased copy number of
                                                                     genetic element changes
                                                                     phenotype
                                                                  • Sequencing and microarray
                                                                    –Identify single genes and
                                                                     operons
Lynch, M.D., T. Warnecke, and R.T. Gill, SCALEs: multiscale
analysis of library enrichment. Nat Meth, 2007. 4(1): p. 87-93.     Slides by Nicholas Sandoval
                       Selection
                Population starts with
                 large genotypic diversity
                Environmental stress
                    Fittest clones grow
                     faster
                Population ends with
                 reduced genetic diversity




Slides by Nicholas Sandoval
         Microarray Studies
 • Harvest sample of culture and
   purify plasmid DNA

 • Affymetrix E. coli antisense gene
   chips used to analyze 2 samples
   – Control
   – 1.75 g/L selection final sample
     @ 72 hours

Slides by Nicholas Sandoval
           Microarray Studies
• 72 hr sample compared to control (0 hr)
               1.75 g/L selection




                     E. coli genomic
                         position




               Slides by Nicholas Sandoval
Blowup Region from SCALEs




       Slides by Nicholas Sandoval
                          (what cell does)
                            Phenotype


                           Genotype
    predict             (Genetic controls)        can’t predict
    genotype                                      genotype


Use rational engineering                 Use Combinatorial or
                                         evolutionary engineering
Examples: want antibiotic resistance
phenotype, insert resistance gene.       Example: want improved growth in
                                         presence of inhibitors, make a
Want more of a metabolite, direct a      diverse library of genotypes and
known metabolic pathway by increasing    select cells with desirable
expression of genes leading to           phenotype.
metabolite, decreasing expression of
genes products that degrade the          Resistance to environmental or
metabolite.                              metabolic stress in industrial
                                         conditions
     Improved complex phenotypes require
     difficult to predict polygenetic changes.



Improved strains are commonly obtained by classical strain
improvement, which is the successive creation of random
diversity by mutation, and selection of desired phenotypes.


Common mutagens include:
 Nitrosoguanidine (NTG)
 UV radiation
 Ethyl methane sulfonate (EMS)
       Limitations of Classical Strain Improvement



Most mutations are neutral or decrease gene activity.
    ~ 90% of the E.coli chromosome is a coding region where
    most mutations have little effect on protein activity. If activity is
    affected, it most likely is decreased.


Beneficial mutations are rare. Therefore, many neutral and
   detrimental mutations are carried along with a beneficial
   mutation, leading to specialized and crippled strains.




               ATG GCC TAC TTG AAC …
    Potential ways to improve evolutionary engineering

•     Optimize effective library by increasing chances of
      making a beneficial mutation.


•     Eliminate hitchhiking of neutral and detrimental
      mutations by selecting after every mutation.


•     Make mutations that have greater effects on
      phenotype.


•     Be able to easily identify mutations that improve
      phenotype.
Direct invivo genetic engineering in E. coli is efficient
with short synthetic DNA and bacteriophage λ Red
proteins.

                                   H1 H2
  chromosome       geneX
                    Gene X                     geneY
                                               Gene Y




                                      Transform DNA:
                                       H1 Insert H2



                                 H1              H2
chromosome      geneX
                 Gene X               Insert            geneY
                                                       Gene Y



          Recombineering reviews: Meth. Enz. (2007) 421, 171-199. Annu. Rev. Genet.
          (2002) 36, 361-388. Nat. Rev. (2001) 2, 769-779.
Direct invivo genetic engineering in E. coli is efficient
with short synthetic DNA and bacteriophage λ Red
proteins.

                                     H1 H2
  chromosome         geneX
                      Gene X                     geneY
                                                 Gene Y




                                        Transform DNA:
                                         H1 Insert H2




      Recombineering reviews: Meth. Enz. (2007) 421, 171-199. Annu. Rev. Genet.
      (2002) 36, 361-388. Nat. Rev. (2001) 2, 769-779.
Singleplex Recombineering



           E. coli
        chromosome
                                        recombinant
                              λRed      chromosome
                   λRed




Multiplex Recombineering




         E. coli
      chromosome

               λRed         λRed




Like a library of programmed gene switches
                  We are inserting into the chromosome
                      the following two cassettes:

+ Transcription/Translation insert
                                                              Synthetic promoter, RBSopt


    chromosome TagY T7 FRT AntibioticR                       FRT   PLtetO-1   Gene Y


TCCCTATCAGTGATAGAGATTGACATCCCTATCAGTGATAGAGATACTGAGCACATCAGCAGGACGCACTGACC TAAGGAGGTAACATATG

                Tet operators                     Promoter                    RBS       start



 - Translation insert
                                                             no ribosome binding site

    chromosome TagY T3 FRT AntibioticR                       FRT   inert Gene Y
             Simultaneous genotyping of mutants


                                                              Selection Results:
                                                              Gene X turned on
                                                              Genes Y and Z turned off



                                                                        TagW

                                                                        TagX TagX
              Genomic DNA is                                            TagY     TagY
              extracted and
              barcodes are cut out                                      TagZ     TagZ
                                      Amplify with
                                      T7, label Red
 TagX T7                                              Tag X
                     TagX T7
    TagX T7
                                                               Hybridize to universal
                                                      Tag Y
Tag
 TagY   T3         TagZ T3                                     barcode microarray
                                     Amplify with     Tag Z
                                     T3, label Blue
Preparation of synthetic DNA pool for Recombineering




                     4,000 different target oligos are
                     synthesized on a chip and cleaved (from
                     Agilent in 8 aliquots of 500).



                     Each oligo contains two homologous
 =
     H2   H1   Tag   sequences to the upstream region of a
                     specific gene in E. coli (H1 and H2) as
                     well as a sequence used to track the
                     recombinant library (Tag).
Preparation of synthetic DNA pool for Recombineering




                           H1




                      H2


                                    Tag
                           Insert



Target oligos are ligated to the Insert DNA that could
subsequently increase or decrease downstream gene
expression
Preparation of synthetic DNA pool for Recombineering




                          H1                  H1




                     H2


                                   Tag




                                                       Tag
                                         H2
                                              Insert
                          Insert




      DNA circles are selectively amplified by
      nuclease degradation of linear DNA and rolling
      circle amplification.
Preparation of synthetic DNA pool for Recombineering




                             H1




                        H2
                                                 H1




                                      Tag




                                                          Tag
                                            H2
                                                 Insert
                             Insert



 Linear DNA is produced by restriction endonuclease
 digestion of the rolling circle products.




        H2   H1   Tag                            H1         Tag   Insert H2
    =                                        =
           lacZ recombinants display desired phenotypes

   Promoter lacZ




   E. coli          Select
chromosome λRed                      streak on
                    AntibioticR
K12 MG1655                           glucose Xgal



                                              Recombinant   WT
   - RBS     lacZ




    E. coli         Select            streak on
 chromosome λRed
 K12 MG1655
                    AntibioticR       IPTG Xgal
 Trackable, Recursive, Multiplex Recombineering “TReMR”


                            E. coli   λRed
                         chromosome




                                                select
λRed


                                        λRed

          select