Get documents about "Malignant Pleural Mesothelioma–Targeted CREBBPEP300 Inhibitory
Document Sample
Research Article
Malignant Pleural Mesothelioma–Targeted CREBBP/EP300 Inhibitory
Protein 1 Promoter System for Gene Therapy and Virotherapy
1 1 1 2 3
Takuya Fukazawa, Junji Matsuoka, Yoshio Naomoto, Yutaka Maeda, Mary L. Durbin,
1
and Noriaki Tanaka
1
Department of Gastroenterological Surgery, Okayama University Graduate School of Medicine, Dentistry and Pharmaceutical Sciences,
Okayama, Japan; 2Division of Pulmonary Biology, Cincinnati Children’s Hospital Medical Center, Cincinnati, Ohio; and 3Department of
Ecology and Evolutionary Biology, University of California, Irvine, California
Abstract lioma has proven curative (6, 7). Moreover, the diffuse nature of
pleural mesothelioma, which often covers most of the lung and the
Gene therapy and virotherapy are one of the approaches used
interlobular fissures, is the principal limitation to radiotherapy (8).
to treat malignant pleural mesothelioma. To improve the
Long-term survival (>5 years) with any treatment modality is
efficiency of targeting malignant mesothelioma cells, we
exceedingly rare in malignant pleural mesothelioma. Thus, there is
designed a novel system using the promoter of the CREBBP/
an urgent need for new therapeutic options for mesothelioma.
EP300 inhibitory protein 1 (CRI1), a gene specifically expressed
The first human gene therapy trial approved in the United States
in malignant pleural mesothelioma. Four tandem repeats of
as a primary cancer treatment was aimed at mesothelioma. At least
the CRI1 promoter (CRI1À138 4x) caused significantly high
four gene therapy trials have been carried out in mesothelioma
promoter activity in malignant pleural mesothelioma cells but
patients using different vector systems (adenovirus and vaccinia
little promoter activity in normal mesothelial cells and
virus) and transgenes [herpes simplex virus thymidine kinase (HSV-
normal fibroblasts. The recombinant adenoviral vector
tk) combined with ganciclovir, interleukin-2, and IFN-h; ref. 9].
expressing proapoptotic BH3-interacting death agonist or
However, no significant clinical responses were observed, indicat-
early region 1A driven by the CRI1À138 4x promoter induced
ing that improvements are critically needed in gene therapy
cell death in malignant mesothelioma cells but not in normal
approaches for the treatment of mesothelioma (10).
cells. Moreover, these viruses showed antitumor effects in a
Another attractive method to treat malignant pleural mesothe-
mesothelioma xenograft mouse model. Here, we describe a
lioma is to induce apoptosis by the introduction of proapoptotic
novel strategy to target malignant mesothelioma using the
genes (11, 12) or cell lysis by the replicative oncolytic adenovirus
CRI1À138 4x promoter system. [Cancer Res 2008;68(17):7120–9]
(13). To use these approaches, the development of a specific
promoter system targeting mesothelioma but not normal cells is
Introduction essential considering the side effects of proapoptotic genes and the
Malignant pleural mesothelioma is an aggressive tumor of replicating adenovirus. To design a system for specific gene therapy
mesenchymal origin and is increasing worldwide as a result of and virotherapy to treat malignant mesothelioma, we evaluated the
widespread exposure to asbestos that was widely used in specificity of the promoters of four different mesothelioma-specific
industrialized countries until approximately 1970. There is genes: calretinin (14), Wilms’ tumor suppressor gene (WT1; ref. 15),
substantial interest in this disease because millions of people have mesothelin (16), and CREBBP/EP300 inhibitory protein 1 (CRI1;
been exposed to asbestos fibers, and there are more than 3,000 ref. 17). Transient transfection assay showed that the CRI1
cases of mesothelioma seen annually in the United States (1). The promoter is highly active in malignant pleural mesothelioma cells
median survival of patients with mesothelioma from time of (H2452, MSTO-211H, H2052, and H28) but much less active in
diagnosis ranges between 1 and 2 years (2, 3). The mortality is normal mesothelial cells and pleural cells. However, the other three
expected to increase, at least until 2020, which is mainly due to the promoters of mesothelioma-specific genes (calretinin, WT1, and
long latency (30–50 years) of the disease (4). mesothelin) showed high promoter activity not only in the
Despite considerable advances in the understanding of its mesothelioma cells but also in normal cells.
pathogenesis and etiology, malignant mesothelioma remains In the present study, we have assessed the capability of
largely unresponsive to standard modalities of cancer therapy (5). adenovirus-mediated transgene expression induced by the CRI1
In some cases, extrapleural pneumonectomy can prolong the promoter specifically in mesothelioma cells in vitro and the
median survival time of more than 2 years; however, this approach feasibility of targeting malignant mesothelioma in both in vitro cell
is suitable for only a few patients. Most surgical intervention is culture and in vivo in a mesothelioma xenograft mouse model.
often impossible because of intrapleural spread. Although chemo-
therapy can ameliorate the symptoms of the disease, including pain
and breathlessness with pleural effusion, no regimen for mesothe- Materials and Methods
Tissues and cell lines. The human malignant mesothelioma cells H2452,
MSTO-211H, H2052, and H28, the human lung adenocarcinoma cells H322
Note: Supplementary data for this article are available at Cancer Research Online
and A549, and the human breast cancer cells MCF7 were obtained from the
(http://cancerres.aacrjournals.org/). American Type Culture Collection (ATCC) and grown in Ham’s F12 (A549
Requests for reprints: Takuya Fukazawa, Department of Gastroenterological cells), RPMI 1640 (H2452, MSTO-211H, H2052, H28, and H322 cells), or
Surgery, Okayama University Graduate School of Medicine, Dentistry and DMEM high glucose (MCF7) supplemented with 10% heat-inactivated fetal
Pharmaceutical Sciences, 2-5-1 Shikata-cho, Okayama 700-8558, Japan. Phone: 81-86-
235-7257; Fax: 81-86-221-8775; E-mail: FukazawaT@aol.com.
bovine serum (FBS). Normal pleural rat cells 4/4 R.M.-4 obtained from
I2008 American Association for Cancer Research. ATCC were grown in Ham’s F12 K supplemented with 15% heat-inactivated
doi:10.1158/0008-5472.CAN-08-0047 FBS. The human hepatoblastoma cells Hep3B obtained from ATCC were
Cancer Res 2008; 68: (17). September 1, 2008 7120 www.aacrjournals.org
CRI1 for Gene Therapy and Virotherapy
grown in Eagle’ MEM supplemented with 1 mmol/L sodium pyruvate, 0.1% Ad-CRI1À2586/GFP, Ad-CRI1À138 4x/GFP, Ad-CRI1À138 4x/HA-BID, and Ad-
nonessential amino acids, and 10% heat-inactivated FBS. The normal CRI1À138 4x/E1A were generated by homologous recombination (18, 19).
human lung fibroblasts (NHLF) obtained from Clonetics and the normal The viral titer for each vector was determined by plaque assay and the
human mesothelial cells obtained from Dominion Pharmakine were grown optimal multiplicity of infection (MOI) was determined by infecting each
in culture medium supplied by the manufacturer. All cell lines were cultured cell line with Ad-CMV/GFP and assessing the expression of GFP by flow
in 10% CO2 at 37jC. Additionally, normal human pleura specimens were cytometric analysis. H2452 cells were infected with the recombinant
obtained from a consenting patient undergoing treatment for diseases other adenoviral vectors at a MOI of 50 plaque-forming units (pfu)/cell, and all
than mesothelioma (84-y-old male). The lysates of normal human lung other human cells were infected at a MOI of 20 pfu/cell. For infection of the
protein were obtained from Chemicon International. conditionally replicating adenovirus (CRAd), H2452 cells were infected with
Plasmids. The human CRI1, calretinin, WT1, and mesothelin promoters Ad-CRI1À138 4x/E1A at a MOI of 10 pfu/cell, and all other human cells were
were obtained from purified human genomic DNA (Clontech) by PCR. The infected at a MOI of 4 pfu/cell. Ad-CRI1À138 4x/GFP was used as control. The
position of the transcription initiation site (+1) was determined by the human CRI1 short hairpin RNA (shRNA) lentiviral transfer vector for human
Ensembl Human Genome browser.4 The luciferase reporter construct CRI1 gene was obtained from Sigma (MISSION shRNA Bacterial Glycerol
pGL.CalretininÀ2179 was generated by subcloning the promoter region of Stock). The transformed human embryonic kidney 293T cells (1 Â 106) were
calretinin À2179/+70 from the genomic DNA using PCR primers (5¶- plated in a 10-cm dish and cotransfected the following day with 26 AL of the
tttggtaccKpn Iaatacttttacacaaagcgtggcctg and 5¶-aaaHin dIIIaagcttgagctggtgc- Lentivirus Packaging Mix (Sigma) and the shRNA transfer vector (2.6 Ag) by
cgaccaccacacccgggagccggcgg). The PCR-generated fragment was digested lipofection. Twenty-four and 48 h later, viral supernatants were collected in
with KpnI and HindIII and subcloned directly into the pGL3-Basic luciferase serum-free medium and filtered through 0.45-Am pore size filters. The
reporter construct (Promega). pGL.WT1À1887, pGL.MesothelinÀ2310, and nontarget shRNA lentiviral (Sigma) vector was used as a control. The viral
pGL.CRI1À2586 were constructed in the same manner using the following titer was measured by HIV p24 Antigen ELISA kit (ZeptMetrix; refs. 20–22).
primers: mesothelin, 5¶-tttctcgagggggtcaggcttgtgctcccgggagtcctg and 5¶- Cells were infected with the recombinant shRNA lentiviral vector at a
aaaaagcttggtctgtgtctgtggagggcagtgactcag; WT1, 5¶-tttggtacctgtctcga- concentration of MOI of 2.5 transducing units/cell.
gagtcctttctccactcaaaaa and 5¶-aaaacgcgtttgctgcggctcagacccggacgccccgc; Immunoblot analysis. Tissues and cells were washed once with ice-cold
and CRI1, 5¶-tttacgcgtaacatgtagcaagtggctatctaaca and 5¶-tataagctt- PBS containing 5 mmol/L EDTA and 1 mmol/L sodium orthovanadate,
gagggctgctgggccccc. The CRI1 promoter deletion constructs were generated homogenized, and lysed in ice-cold lysis buffer [1% Triton X-100, 20 mmol/L
by subcloning multiple parts of the CRI1 promoter region À1849/+84, Tris-HCl (pH 8.0), 137 mmol/L NaCl, 10% (v/v) glycerol, 2 mmol/L EDTA,
À1674/+84, À1587/+84, À1083/+84, À766/+84, À567/+84, À366/+84, À296/ 1 mmol/L (v/v) sodium orthovanadate, 1 mmol/L phenylmethylsulfonyl
+84, À138/+84, À74/+84, and +1/+84, amplified from pGL.CRI1À2586, fluoride, 10 Ag/mL aprotinin, 10 Ag/mL leupeptin]. Cell lysates were
using the following oligonucleotides, digested with NheI and XhoI and clarified by centrifugation (10 min at 15,000 Â g at 4jC) and protein
subcloned into pGL3-Basic: 5¶-tttNheI gctagcÀ1849tggaatcatgcgggtgacaa- concentration was determined using the detergent-compatible protein
ataacactgg, 5¶-ttt N h e I gctagc À1 6 7 4 gcacagaactaatggaatatatacatat- assay (Bio-Rad). Equal amounts of protein were separated on a SDS-PAGE
ata, 5¶-tttNhe IgctagcÀ1587tgtatatatatgtaaaggggagttcaataag, 5¶-tttNhe Igct- gel. The gel was electrophoretically transferred to a Hybond polyvinylidene
agcÀ1083gatattgcaaatgacggtggccttaaaagta, 5¶-tttNhe IgctagcÀ752taataataatag- difluoride transfer membrane (Amersham). The membrane was incubated
aaataaagtgcaga, 5¶-ttt Nhe I gctagc À567 atacatgtaaatgcaaataaaaagaatt- with primary and secondary antibodies according to the SuperSignal West
caa, 5¶-tttNhe IgctagcÀ366atatgctgatctgtggttatggatgt, 5¶-tttNhe IgctagcÀ296taaa- Pico chemiluminescence protocol (Pierce) to detect secondary antibody
ttgcccaggggaagaggaa, 5¶-tttNhe IgctagcÀ138cgaatcgatggaaacgtagctcaaaaggcga, binding. Antibody specific for calretinin was purchased from BD
5¶-tttNhe IgctagcÀ73aaccacagtggcgcgccaagtaggag, and 5¶-tttNhe Igctagc+1gccttt- Transduction Laboratories. Antibodies against CRI1 and GFP were obtained
gcgcacgcgcacgaacgcac. The human CRI1 region À138/À1 was generated from Abcam. Antibody specific for WT1 was obtained from Invitrogen Life
from pGL.CRI1À1083 and subcloned into pGL.CRI1À138(À138 1x), termed Technologies. Antibody specific for adenovirus type 5 E1A was obtained
pGL.CRI1À138 2x. The plasmids pGL.CRIÀ138 3x and pGL.CRIÀ138 4x were from PharMingen. Anti-mesothelin was kindly provided by Dr. Ira Pastan
constructed in the same manner. All recombinant plasmids were sequenced (Center for Cancer Research, National Cancer Institute, NIH, Bethesda, MD;
to ensure the identity and proper orientation of the insert. ref. 23). Anti-actin was obtained from Sigma. Secondary horseradish
Transient transfection reporter assays. All transfections were carried peroxidase–conjugated goat anti-rabbit antibody and anti-mouse antibody
out in six-well plates. Cells were seeded 24 h before transfection at the were obtained from Jackson ImmunoResearch Laboratories.
following densities: 5 Â 105 per well for NHLF and normal human Flow cytometric analysis for apoptosis. Cells were plated in 24-well
mesothelial cells and 3 Â 105 per well for all other cells. Transfections plates at a density of 2 Â 105 per well 1 d before the recombinant adenoviral
were carried out with Lipofectin (Invitrogen Life Technologies) in vector infection. After 72 h, cells were harvested and washed once with PBS.
accordance with the manufacturer’s protocol. Transfected cells were Cells were resuspended in PBS containing 0.2% Triton X-100 and 1 mg/mL
harvested 24 h after lipofection. The results of one representative RNase for 5 min at room temperature and then stained with propidium
experiment are presented as fold induction of relative light units iodide at 50 Ag/mL to determine subdiploid DNA content using a FACScan.
normalized to h-galactosidase activity relative to that observed for the Doublets, cell debris, and fixation artifacts were gated out, and sub-G0-G1
control vectors. Each experiment was repeated at least thrice. Error bars DNA content was determined using CellQuest version 3.3 software.
indicate the SD from the average of the triplicate samples in one Animal experiments. The experimental protocol was approved by the
experiment. Ethics Review Committee for Animal Experimentation of Okayama
Construction of the recombinant adenoviral and lentiviral vectors. University Graduate School of Medicine and Dentistry. Human mesothe-
The plasmids pCalretininÀ2179/GFP3, pCRI1À2586/GFP, and pCRI1À2586/HA- lioma xenografts were established in 6-wk-old female BALB/c nude mice
BID were constructed by ligating green fluorescent protein (GFP) or HA-BID (Charles River Laboratories, Inc.) by s.c. inoculation of 2.5 Â 106 MSTO-
into pGL.CalretininÀ2179, pGL.CRI1À2586, and pGL.CRI1À138 4x after excising 211H cells into the dorsal flank. The mice were randomly assigned into four
the luciferase gene. The cDNA of adenovirus type 5 early region 1A (E1A) groups (n = 8 per group). Each group of the mice was injected with 200 AL
was synthesized by reverse transcription-PCR from total cellular RNA of solution containing PBS, Ad-CRI1À138 4x/GFP, Ad-CRI1À138 4x/HA-BID, or
human embryonic kidney 293 cells using specific primers 5¶-tttHin dIII- Ad-CRI1À138 4x/E1A by 27-gauge needle for the first 3 d. Animals were then
aagcttctgaaaatgagacatattatctgccacggaggtgt and 5¶-aaaEco R5gatatcttatggcc- observed closely and survival studies were performed. Tumors were
tggggcgttta. The recombinant adenovirus vectors Ad-CalretininÀ2179/GFP, measured two to three times a week, and tumor volume was calculated
as a  b 2  0.5, where a and b were large and small diameters, respectively.
Histochemical study. Tissue or tumor sectioning and staining were
performed in the Histology Laboratory in the Department of Gastroenter-
4
http://www.ensembl.org/Homo_Sapiens/index.html ological Surgery in Okayama University Graduate School of Medicine and
www.aacrjournals.org 7121 Cancer Res 2008; 68: (17). September 1, 2008
Cancer Research
Figure 1. Analysis of human CRI1,
calretinin, WT1, and mesothelin protein
expression and promoter activities in
thoracic normal and tumor cells. A,
immunoblot analysis of CRI1, calretinin,
WT1, and mesothelin expressions in
indicated cells and tissues. The expression
level of actin is shown as a control. B,
schematic representation of luciferase
reporter construct. The promoters were
cloned upstream of the luciferase (Luc )
gene (pGL ) as shown by nucleotide
positions. The name of each reporter
construct was assigned according to the
5¶-end of the nucleotide number of the
inserted promoter sequences. C, transient
transfection reporter assays in
mesothelioma and pulmonary
adenocarcinoma cells with the indicated
luciferase reporter constructs (2 Ag, pGL)
and pCMV.h-gal (2 Ag). Results are
presented as fold induction of relative light
units normalized to h-galactosidase
activity relative to that observed for control
constructs. D, transient transfection
reporter assays in normal thoracic cells
with the indicated luciferase reporter
constructs (2 Ag, pGL) and pCMV.h-gal
(2 Ag). Results are indicated as in C .
Dentistry. For immunohistochemical analysis of the E1A protein, tumors (H2452, MSTO-211H, H2052, and H28) and A549 pulmonary
were fixed in 20% formalin, embedded in paraffin, and then cut into 4-Am adenocarcinoma cells, whereas no expression was seen in H322
sections. To retrieve antigens, the sections were baked, deparaffinized, and pulmonary adenocarcinoma cells, normal mesothelial cell, normal
heated in citrate buffer [10 mmol/L citric acid (pH 6.0)] in a steamer. After
pleura, or normal lung tissue extracts. Calretinin expression was
endogenous peroxidase was inactivated with 1.5% H2O2/methanol for
detected in H2452, MSTO-211H, and H2052 malignant mesotheli-
10 min, the sections were incubated with rabbit anti-E1A polyclonal
antibody (1:50 dilution; PharMingen) or rabbit anti-GFP polyclonal antibody
oma cells, A549 pulmonary adenocarcinoma cells, and normal
(1:500 dilution; Abcam) for 1 h and then biotinylated goat anti-rabbit IgG mesothelial cells. WT1 expression was strongly detected in all types
antibody (DAKO) for 30 min. The specific binding was visualized with an of malignant mesothelioma cells (H2452, H2052, MSTO-211H, and
avidin-biotin-peroxidase reagent and its substrate diaminobenzidine H28) and normal mesothelial cells. Mesothelin expression was seen
tetrachloride (DAKO) and subsequent counterstaining with Mayer’s in H2052 malignant mesothelioma cells, A549 pulmonary adeno-
hematoxylin. carcinoma cells, normal mesothelial cells, normal pleura, and
Statistical analysis. All of the in vitro experiments in Figs. 1 to 5 were normal lung extracts. Significantly, the expression of calretinin,
performed at least thrice. The results of one representative experiment are WT1, and mesothelin was detectable in normal human mesothelial
presented. For quantitative results, error bars indicate the SD from the
cells and extracts of normal human pleura and lung, whereas the
average of at least triplicate samples in one experiment. For the in vivo
expression of CRI1 was not seen in these normal human cells and
experiments in Fig. 6, statistical differences were determined using unpaired
two-tailed Student’s t tests or ANOVA.
tissues. These results suggest that CRI1 is the most specific
malignant mesothelioma marker that distinguishes malignant
pleural mesothelioma cells from normal mesothelial cells.
Results The human CRI1 promoter generates high promoter activity
Analysis of CRI1, calretinin, WT1, and mesothelin protein in pleural malignant mesothelioma cells. To analyze the
expression in normal cells and in tumor cells. To investigate the promoter activity of the mesothelioma markers and CRI1, 5¶
expression of the mesothelioma markers (calretinin, WT1, and flanking regions of these marker genes were cloned into pGL3-
mesothelin) and CRI1, immunoblot analysis was performed using Basic luciferase reporter constructs (Fig. 1B). The ability of these
nine kinds of thoracic neoplasm, normal cells, and tissues, constructs to promote the expression of the luciferase gene was
including malignant pleural mesothelioma cells. As shown in Fig. measured in four malignant mesothelioma cell lines and two
1A, CRI1 was detected in all types of malignant mesothelioma cells pulmonary adenocarcinoma cells in transient transfection reporter
Cancer Res 2008; 68: (17). September 1, 2008 7122 www.aacrjournals.org
CRI1 for Gene Therapy and Virotherapy
assay (Fig. 1C). The pGL.CRI1À2586/Luc generated significantly high higher promoter activity than that of the other three mesothelioma
transcriptional activity in all kinds of malignant mesothelioma cells marker genes (calretinin, WT1, and mesothelin) in all types of
(H2452, MSTO-211H, H2052, and H28; 42.01- to 86.77-fold) and malignant pleural mesothelioma cells.
A549 pulmonary adenocarcinoma cells (22.79-fold), with low The human CRI1 promoter generates little promoter
activity in H322 pulmonary adenocarcinoma cells (9.22-fold). The activity in normal mesothelial cells and pleural cells. To
pGL.CalretininÀ2179/Luc generated significantly high promoter determine the tumor specificity of the transcriptional activity of
activity in H2452, MSTO-211H, and H2052 malignant mesothelioma the 5¶ flanking region of the mesothelioma marker genes, we also
cells and A549 pulmonary adenocarcinoma cells (15.90- to 45.38- performed a transient transfection reporter assay in normal human
fold). The pGL.WT1À1877/Luc construct generated significant mesothelial cells, normal rat pleural 4/4 R.M.-4 cells, and NHLF
transcriptional activity in all types of malignant mesothelioma cells (Fig. 1D). In these normal cells, the promoter activity of
cells (H2452, MSTO-211H, H2052, and H28; 25.76- to 51.57-fold) pGL.CRI1À2586/Luc was less than (8.29- to 9.02-fold) that of the
with less activity in H322 and A549 pulmonary adenocarcinoma reporter constructs pGL.CalretininÀ2250/Luc, pGL.WT1À2288/Luc,
cells (4.57- to 4.87-fold). The pGL.MesothelinÀ2355/Luc construct and pGL.MesothelinÀ2355/Luc (10.26- to 27.19-fold). These data
showed significantly high promoter activity in H2052 malignant suggest that the 5¶ flanking region of the CRI1 promoter generated
pleural mesothelioma cells and A549 pulmonary adenocarcinoma the least promoter activity in normal mesothelial cells and pleural
cells (22.25- to 47.24-fold) but little activity in other kinds of cells cells among the four different mesothelioma marker genes.
(H2452, MSTO-211H, H28, and H322; 8.29- to 12.74-fold). These CRI1 is involved in cell viability of MSTO-211H mesotheli-
results suggest that the 5¶ flanking region of the CRI gene generates oma cells. To determine the function of CRI1 in mesothelioma
Figure 2. Characterization of human CRI1
promoter. A, schematic representation
of CRI1 promoter deletion reporter
constructs. The name of each reporter
construct was assigned according to the
5¶-end of the nucleotide number of the
inserted promoter sequences. B, transient
transfection reporter assays in
mesothelioma (211H and H2452),
pulmonary adenocarcinoma (A549 and
H322), and normal (mesothelial cell and
NHLF) cells with indicated CRI1 deletion
luciferase reporter constructs (2 Ag, pGL)
and pCMV.h-gal (2 Ag). Results are
indicated as in Fig. 1C .
www.aacrjournals.org 7123 Cancer Res 2008; 68: (17). September 1, 2008
Cancer Research
Figure 3. Analysis of tandem CRI1 À138
promoter. A, schematic representation of
CRI1 tandem copies reporter constructs.
One to three tandem copies of CRI1 promoter
region from À138 to À1 were subcloned
into pGL.CRI1À138 1x. B, transient
transfection reporter assays in thoracic tumor
and normal cells, with indicated luciferase
reporter constructs (2 Ag, pGL) and pCMV.
h-gal (2 Ag). Results are indicated as in
Fig. 1C. C, schematic representation of
Ad-CalretininÀ2179/GFP, Ad-CRI1À2586/GFP,
and Ad-CRI1À138 4x/GFP. D, fluorescent
microscopic analysis of GFP expression
induced by Ad-CalretininÀ2179/GFP,
Ad-CRI1À2586/GFP, and Ad-CRI1À138 4x/GFP
in malignant mesothelioma MSTO-211H
cells, normal human mesothelial cells, and
NHLF.
cells, cell viability was observed in the presence/absence of Identification of the region in the CRI1 promoter that
CRI1. CRI1 expression was suppressed by lentiviral vector confers mesothelioma-specific transactivation. To identify
expressing shRNA for human CRI1 (LV/shCRI1) in MSTO-211H the region of the CRI1 promoter that confers mesothelioma-
mesothelioma. As shown in Supplementary Fig. S1A, immunoblot specific transactivation, we made deletion constructs of the CRI1
analysis showed that endogenous CRI1 expression level was promoter (Fig. 2A) and compared their promoter activities. These
suppressed after 4 days of LV/shCRI1 infection compared with constructs were used in transient transfection reporter assays in
lentiviral vector expressing nontarget shRNA (LV/shNon-target). MSTO-211H and H2452 human mesothelioma cells, A549 and H322
The 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)- human pulmonary adenocarcinoma cells, normal human meso-
2-(4-sulfophenyl)-2H-tetrazolium salt (MTS) assay (24) showed thelial cells, and NHLF (Fig. 2B). The ideal construct would have
that MSTO-211H cells infected with LV/shCRI1 lentivirus minimal activity in nonmesothelioma cells but high activity in
had decreased cell viability compared with control LV/ MSTO-211H and H2452 human mesothelioma cells. In all types of
shNon-target lentivirus (Supplementary Fig. S1B). These data cells, the proximal 1,849-bp fragment of the CRI1 promoter
suggest that CRI1 is essential for MSTO-211H mesothelioma cell exhibited higher activity than the 2,586-bp fragment. The proximal
viability. 1,587-bp fragment showed lower transcriptional activity than the
Cancer Res 2008; 68: (17). September 1, 2008 7124 www.aacrjournals.org
CRI1 for Gene Therapy and Virotherapy
1,674- and 1,083-bp fragment. The proximal 766-bp fragment of the in normal human mesothelial cells, NHLF, nonmesothelioma Hep3B
CRI1 promoter exhibited the highest activity (100.29-fold) in hepatocellular carcinoma cells, and MCF7 breast cancer cells. The
MSTO-211H mesothelioma cells. Promoter deletions of À567, cell death/apoptosis caused by the Ad-CRI1À138 4x/HA-BID con-
À366, À296, À138, and À73 showed stepwise decreases in struct was examined by sub-G0-G1 DNA content using propidium
transcriptional activity in all types of cells indicated. The +1-bp iodide staining and flow cytometry 72 h after Ad-CRI1À138 4x/HA-BID
fragment (pGL.CRI1 +1) conferred no activity above control levels infection. As shown in Fig. 4C, infection with the Ad-CRI1À138 4x/GFP
in all types of cells. The À138 construct showed the most promise control caused little DNA fragmentation (range, 0.50–3.79%)
as a mesothelioma-specific promoter as it had high transcriptional in all types of cells as indicated (top). On the other hand,
activity in mesothelioma cells with little activity in the other types Ad-CRI1À138 4x/HA-BID infection caused a marked increase in sub-
of cells, including normal mesothelial cells. G1 DNA content only in H2452 (25.91%) and MSTO-211H
Analysis of the effect of a tandem human CRI1 promoter. mesothelioma cells (45.77%) but not in the other types of cancer
To enhance the level of transcriptional activity sufficient for the cells or normal cells (1.24–7.62%; bottom). These results are
use of gene therapy, we tested the effect of additional tandem consistent with the BID expression in Fig. 4B. These data suggest
copies of the CRI1 À138/À1 promoter region to the construct that Ad-CRI1À138 4x/HA-BID induces exogenous BID expression
pGL3.CRI1À138/+84 in a transient transfection reporter assay and cell death/apoptosis only in mesothelioma cells.
(Fig. 3A). In MSTO-211H cells, transcriptional activity increased Ad-CRI1À138 4x/E1A induced viral proliferation and cell
significantly (169.7-fold) with the addition of one extra CRI1 death only in mesothelioma cells. The CRAd that spreads and
cassette À138/À1 (pGL.CRI1À138 2x). Moreover, with double to replicates only in cancer cells is suitable for diffused or
triple tandem copies (pGL.CRI1À138 3x to 4x), the activity metastasized pleural mesothelioma (13). To test the applicability
increased up to 216.1- to 251.1-fold. In H2452 mesothelioma cells, of CRAd in combination with the mesothelioma-specific
with single to triple tandem copies (pGL.CRI1À138 2x to 4x), the CRI1À138 4x promoter system, we also made Ad-CRI1À138 4x/E1A
activity increased up to 99.6- to 181.3-fold. However, in H322 and that expresses cytotoxic E1A (adenoviral replication-programming
A549 pulmonary adenocarcinoma cells, normal human mesothelial protein) driven by the CRI1À138 4x promoter system (Fig. 4A). As
cells, and NHLF, these tandem copies showed no enhanced shown in Fig. 5A, Ad-CRI1À138 4x/E1A induced cell death/lysis in
transcriptional activity (1.52- to 8.24-fold; Fig. 3B). These results H2452 and MSTO-211H mesothelioma cells but not in normal
show that four tandem copies of the CRI1 cassette À138/À1 human mesothelial cells or NHLF 4 days after infection. The control
(pGL.CRI1À138 4x) generate the highest mesothelioma-specific vector (Ad-CRI1À138 4x/GFP) did not induce any cell death in these
transactivation. cells. A cell viability assay revealed that Ad-CRI1À138 4x/E1A
Ad-CRI1À138 4x/GFP expresses GFP in MSTO-211H malignant drastically induced cell death/lysis after 3 to 4 days of infection
mesothelioma cells but not in normal human mesothelial cells in H2452 and MSTO-211H cells but not in normal human
or NHLFs. To evaluate gene expression mediated by the CRI1À138 mesothelial cells or NHLF (Fig. 5B). Immunoblot analysis showed
4x promoter in adenovirus-mediated delivery system, we examined that E1A expression was drastically increased in H2452 and MSTO-
GFP expression induced by a recombinant adenoviral vector that 211H mesothelioma cells by Ad-CRI1À138 4x/E1A after 96 h of
expressed GFP driven by the CRI1À138 4x promoter system (Ad- infection. However, E1A expression was minimal in NHLF and
CRI1À138 4x/GFP; Fig. 3C) in MSTO-211H mesothelioma cells, normal human mesothelial cells. No significant increase of GFP
normal human mesothelial cell, and NHLF. Recombinant adeno- expression was seen in MSTO-211H mesothelioma cells between 24
viral vectors that expressed GFP driven by promoters of and 96 h after Ad-CRI1À138 4x/GFP infection (Fig. 5C). These results
cytomegalovirus (CMV), calretininÀ2179, and CRI1À2586 were used suggest that Ad-CRI1À138 4x/E1A (a CRAd) replicates and induces
as controls (termed Ad-CMV/GFP, Ad-CalretininÀ2179 /GFP, cell death/lysis in mesothelioma cells.
and Ad-CRI1À2586/GFP; Fig. 3C). As shown in Fig. 3D, Ad-CMV/ Ad-CRI1À138 4x/E1A or HA-BID suppressed mesothelioma
GFP strongly induced GFP in all three kinds of cells. xenograft tumors and extended the survival of mesothelioma
Ad-CalretininÀ2179/GFP induced GFP not only in MSTO-211H xenograft mice. To analyze the therapeutic efficacy of Ad-
mesothelioma cells but also in normal human mesothelial cells. CRI1À138 4x/E1A or HA-BID against human tumor cells in vivo,
Ad-CRI1À2586/GFP weakly induced GFP in MSTO-211H cells and we established mesothelioma xenograft tumors derived from
little expression was seen in normal human mesothelial cells and MSTO-211H cells in nude mice. After the tumors had reached a
NHLF. On the other hand, Ad-CRI1À138 4x/GFP did not show any diameter of about 0.5 cm, 5 Â 107 pfu of Ad-CRI1À138 4x/E1A,
significant fluorescent population in normal human mesothelial Ad-CRI1À138 4x/HA-BID, Ad-CRI1À138 4x/GFP, or PBS were
cells and NHLF but strongly induced GFP in MSTO-211H administered intratumorally for 3 days. Tumor growth was signifi-
mesothelioma cells. These data suggest that the CRI1À138 4x cantly suppressed by Ad-CRI1À138 4x/E1A or Ad-CRI1À138 4x/HA-BID
promoter is able to induce target gene expression in mesothelioma injection compared with Ad-CRI1À138 4x/GFP or PBS (P < 0.001;
cells and does not target normal cells, including normal Fig. 6A). The mouse group treated with PBS or Ad-CRI1À138 4x/GFP
mesothelial cells, in the adenovirus-mediated delivery system. died within 75 days after tumor inoculations (Fig. 6B), whereas
Ad-CRI1À138 4x/HA-BID induced BH3-interacting death seven of eight mice from the mouse group treated with Ad-
agonist expression and cell death/apoptosis in the malignant CRI1À138 4x/HA-BID and all mice from the mouse group treated
pleural mesothelioma. To induce cell death in the mesothelioma with Ad-CRI1À138 4x/E1A were still alive. Adenoviral E1A expression
by the CRI1 À138 4x promoter system, the proapoptotic was increased and spread in Ad-CRI1À138 4x/E1A–administered
BH3-interacting death agonist (BID) gene was inserted into the tumors, whereas GFP expression was localized (no spread) in Ad-
CRI1À138 4x system in place of GFP (Ad-CRI1À138 4x/HA-BID; CRI1À138 4x/GFP–administered tumors at 14 days after treat-
Fig. 4A; refs. 19, 25, 26). As shown in Fig. 4B, Ad-CRI1À138 4x/HA- ment (Fig. 6C). These results indicate that Ad-CRI1À138 4x/E1A
BID strongly induced exogenous BID in H2452 and MSTO-211H (a CRAd) replicates and induces cell lysis in a mesothelioma-
mesothelioma cells. On the other hand, there was little expression specific manner in vivo.
www.aacrjournals.org 7125 Cancer Res 2008; 68: (17). September 1, 2008
Cancer Research
Discussion mesothelioma (29). However, mesothelin expression was also
Several protein markers for diagnosing mesothelioma have detectable in normal mesothelium (30, 31). Another mesothelioma
recently become available (27). One of the calcium-binding marker, WT1 is a zinc finger DNA-binding protein and acts as a
proteins, calretinin is the most sensitive mesothelioma-positive transcription activator or repressor depending on the cellular or
marker and is frequently expressed in all the logic types of chromosomal context. WT1 is useful to diagnose epithelioid
mesothelioma (27). However, Lugli and colleagues (28) reported mesothelioma (27). However, the expression of WT1 is also seen
that calretinin is also expressed in normal tissues, including Leydig in normal tissues, including normal mesothelium (32, 33). Taken
cells of the testis, neurons of the brain, theca-lutein and theca together, these mesothelioma markers are pathologically important
interna cells of the ovary, and normal mesothelium. The other to distinguish mesothelioma from the other kinds of tumors (e.g.,
mesothelioma marker mesothelin is a 40-kDa cell surface pulmonary adenocarcinoma; ref. 27), but they are also expressed in
glycoprotein that is highly expressed in epithelioid mesothelioma. normal pleura and mesothelium. Gordon and colleagues (17)
Mesothelin is useful to diagnose epithelioid mesothelioma and profiled the gene expression pattern of malignant pleural
sarcomatoid mesothelioma (16, 23). Hassan and colleagues mesothelioma, normal lung, and pleural tissues using cDNA
reported that serum mesothelin levels are elevated in patients microarrays. They reported that the CRI1 gene was one of the
with mesothelioma compared with normal healthy volunteers. malignant pleural mesothelioma-specific markers. In our study,
Serum mesothelin is decreased after surgical dissection of CRI1 protein was observed specifically in mesothelioma cells but
Figure 4. Malignant mesothelioma-
specific proapoptotic BID gene expression
and cell death induced by the CRI1À138 4x
promoter system. A, schematic
representation of Ad-CRI1À138 4x/HA-BID
and Ad-CRI1À138 4x/E1A. B, detection
of HA-BID expression induced by
Ad-CRI1À138 4x/HA-BID. Cells were treated
with the same dosage of Ad-CRI1À138 4x/GFP
or Ad-CRI1À138 4x/HA-BID as described
in Materials and Methods. Expressions of
HA-BID were analyzed by immunoblot
36 h after infections. Exogenous HA-BID
protein expression was detected with
anti-HA antibody. C, flow cytometric
analysis of apoptosis induced by
Ad-CRI1À138 4x/HA-BID. Cells were
infected with Ad-CRI1À138 4x/GFP
(GFP, top ) or Ad-CRI1À138 4x/HA-BID
(HA-BID, bottom ) for 72 h and sub-G0-G1
DNA content was measured by propidium
iodide stain and flow cytometric analysis.
Cancer Res 2008; 68: (17). September 1, 2008 7126 www.aacrjournals.org
CRI1 for Gene Therapy and Virotherapy
Figure 5. Induction of mesothelioma-
specific cell death by CRAd combined with
the CRI1À138 4x promoter system. A,
phase-contrast photomicrographs of
H2452, MSTO-211H mesothelioma cells,
normal human mesothelial cells, and NHLF
infected with Ad-CRI1À138 4x/E1A or
Ad-CRI1À138 4x/GFP. Cell morphology
was evaluated 4 d after infection.
Photomicrographs were taken at a
magnification of Â100. B, oncolytic efficacy
induced by Ad-CRI1À138 4x/E1A infection
in vitro . Cells were plated in 96-well plates
at a density of 2 Â 103 per well 24 h
before infections. Cell viability was
evaluated at 0, 1, 2, 3, and 4 d following
Ad-CRI1À138 4x/GFP or Ad-CRI1À138 4x/E1A
infection by MTS assay (CellTiter 96,
Promega) according to the manufacturer’s
protocol. C, immunoblot analysis of
adenoviral E1A protein or GFP expression at
0, 24, and 96 h after infection of
Ad-CRI1À138 4x/E1A (left) or
Ad-CRI1À138 4x/GFP (right) in indicated
cells. h-Actin was shown as a control.
not in normal mesothelium cells (Fig. 1A), which agrees with the mesothelioma-specific activity is not understood yet. Mesothelio-
microarray data (17). ma-specific transcription factors and/or cofactors might also be
Gene therapy approaches using mesothelioma-specific pro- involved in the CRI1 transcriptional regulation.
moters combined with suicide genes have previously been tried. Mesothelioma cells are more resistant to apoptosis than normal
Inase and colleagues (34) constructed a system that expressed the mesothelial cells, although most of them have the wild-type p53
HSV-tk gene driven by the calretinin promoter. However, in our tumor suppressor (35). To explain this paradox, Cao and colleagues
study, Ad-CalretininÀ2179/GFP expressed GFP in normal human (36) postulate that the antiapoptotic protein Bcl-xL might play a
mesothelial cells. Thus, HSV-tk driven by the calretinin promoter role in increased resistance to apoptosis by mesothelioma cells, as
might be expressed in normal mesothelial cells and induce side Bcl-xL seems to have increased expression in malignant mesothe-
toxicity in normal cells as well as mesothelioma cells. The ideal lioma cells. In this study, overexpression of the proapoptotic BID
promoter system would have minimal activity in nonmesothelioma protein by Ad-CRI1À138 4x/HA-BID induced apoptosis in mesothe-
cells but high activity in mesothelioma cells. In the present study, lioma cells, indicating that the overexpressed BID escaped the
the CRI1À138 4x promoter generated the most specific transcrip- antiapoptotic effect by Bcl-xL in the mesothelioma cells. The use of
tional activity in malignant pleural mesothelioma cells compared BID as a suicide gene may thus be useful for localized
with the other three promoters of calretinin, mesothelin, and WT1 mesothelioma gene therapy.
genes. Thus, the CRI1À138 4x promoter should be useful for A problem for mesothelioma gene therapy is the inefficient vector
targeting mesothelioma cells. The molecular mechanism by which and gene delivery systems. In advanced stages, pleural mesotheli-
the 5¶ flanking region of the CRI1 promoter À138/+84 confers oma invades the chest wall or mediastinal tissues or structures
www.aacrjournals.org 7127 Cancer Res 2008; 68: (17). September 1, 2008
Cancer Research
(e.g., esophagus, trachea, great vessels, and lymph nodes) and could preexisting antivector immunity. In the use of the hexon-chimeric
penetrate diaphragmatic muscle, peritoneum, retroperitoneal adenovirus vector, selected promoters, including the CRI1 promoter
space, opposite pleura, or lymph nodes outside the chest (37). For system, are required to limit the cell killing in mesothelioma but not
the treatment of advanced-stage mesothelioma, the efficiency of surrounding normal cells. The combination of CRI1À138 4x/E1A
nonreplicating adenovirus vector, including Ad-CRI1À138 4x/HA- system with the hexon-chimeric adenovirus would be an attractive
BID, by local injection might be limited. In recent cancer gene approach to treat immunocompetent mesothelioma.
therapy studies, the CRAd has been considered as an approach to To enhance the efficacy of CRAds, the combination of CRAds with
target metastasized cancer, including mesothelioma, because it volume reduction surgery and/or chemotherapy has been reported
replicates and chases the metastasized tumors (38–42). In our study, to be more effective than single treatment of surgery or chemo-
Ad-CRI1À138 4x/E1A, a CRAd, showed mesothelioma-specific cell therapy (44, 45). To reduce the side effect to normal cells by che-
death/lysis in vitro and a strong antitumor effect in a mesothelioma motherapy or surgical stress, the use of Ad-CRI1À138 4x/E1A that
xenograft tumor mouse model, suggesting that Ad-CRI1À138 4x/E1A selectively targets mesothelioma is desirable for the combination
is useful for the treatment of advanced-stage mesothelioma. therapy.
Another problem for mesothelioma gene therapy with viral In this study, a mesothelioma-specific CRI gene promoter was
vectors, including CRAds, is a possibility that the therapeutic virus cloned and characterized as the most mesothelioma-specific
might be removed by host immunity, which might possibly limit promoter compared with the promoters of mesothelioma markers,
CRAd replication. However, Robert and colleagues (43) have recently including calretinin, WT1, and mesothelin. The element of the
reported a new hexon-chimeric adenovirus vector that circumvents promoter that confers mesothelioma specificity (CRI1 À138/À1)
Figure 6. Reduction of mesothelioma
tumor grown in nu/nu mice by CRAd
combined with the CRI1À138 4x promoter
system A, suppression of tumor
growth by Ad-CRI1À138 4x/E1A infection.
Volume of tumor derived from MSTO-211H
malignant mesothelioma cells treated
with PBS (y), Ad-CRI1À138 4x/GFP (n),
Ad-CRI1À138 4x/HA-BID (E), and
Ad-CRI1À138 4x/E1A (Â) is shown. The
volume was monitored over time (days)
after inoculation of tumor cells. Arrows,
time point where treatment was given.
Eight mice were used for each group.
Points, tumor growth expressed as mean
tumor volume; bars, SD. Statistical
significance was defined as P < 0.01 (*)
and P < 0.001 (**). B, survival of xenograft
mice inoculated with mesothelioma cells
after PBS, Ad-CRI1À138 4x/GFP, Ad-
CRI1À138 4x/HA-BID, or Ad-CRI1À138 4x/E1A
infection. At 75 d after mesothelioma cell
inoculation, the number of surviving mice
from the mouse groups administered
with PBS, Ad-CRI1À138 4x/GFP, Ad-
CRI1À138 4x/HA-BID, or Ad-CRI1À138 4x/E1A
was counted. C, amplified E1A
expression in mesothelioma tumors after
Ad-CRI1À138 4x/E1A infection. Paraffin
sections of tumors derived from
MSTO-211H mesothelioma cells 14 d
after Ad-CRI1À138 4x/E1A or GFP infection
were immunostained with anti-E1A or
GFP antibody. Top right, amplified E1A
protein expression was observed in
mesothelioma tumor. Photomicrographs
were obtained at a magnification of Â100.
Cancer Res 2008; 68: (17). September 1, 2008 7128 www.aacrjournals.org
CRI1 for Gene Therapy and Virotherapy
was identified by deletion mapping and the element was tandema- Disclosure of Potential Conflicts of Interest
rized (CRI1À138 4x) to enhance the promoter activity to further target No potential conflicts of interest were disclosed.
mesothelioma by gene therapy. The CRI1À138 4x promoter-driven
E1A or HA-BID in the adenovirus induced cell death only in
Acknowledgments
human mesothelioma cell lines but not in normal mesothelial
cells or NHLF. The efficacy of the mesothelioma cell death was Received 1/8/2008; revised 5/13/2008; accepted 7/2/2008.
Grant support: The Ministry of Education, Science, and Culture, Japan.
further confirmed by an in vivo xenograft model. Thus, our The costs of publication of this article were defrayed in part by the payment of page
adenovirus-mediated gene therapy system expressing HA-BID or charges. This article must therefore be hereby marked advertisement in accordance
E1A gene driven by the mesothelioma-specific CRI1 promoter with 18 U.S.C. Section 1734 solely to indicate this fact.
We thank T. Nakai and T. Yamanishi for technical advice, F. Inoue and M.
(a CRAd) has great clinical potential for the treatment of Takahashi for kindly providing normal human pleura, and Dr. Ira Pastan for providing
mesothelioma. antibody against mesothelin.
References suppressors in malignant pleural mesothelioma using monoclonal antibody K1 present on ovarian cancers and
large-scale transcriptional profiling. Am J Pathol 2007; normal mesothelium. Cancer Res 1992;52:181–6.
1. Enterline PE, Henderson VL. Geographic patterns for 166:1827–40. 32. Gulyas M, Hjerpe A. Proteoglycans and WT1 as
pleural mesothelioma deaths in the United States, 1968- 18. He TC, Zhou S, da Costa LT, Yu J, Kinzler KW, markers for distinguishing adenocarcinoma, epithelioid
81. J Natl Cancer Inst 1987;79:31–7. Vogelstein B. A simplified system for generating mesothelioma, and benign mesothelium. J Pathol 2003;
2. Antman KH. Natural history and epidemiology of recombinant adenoviruses. Proc Natl Acad Sci U S A 199:479–87.
malignant mesothelioma. Chest 1993;103:373–6. 1998;95:2509–14. 33. Gulyas M, Dobra K, Hjerpe A. Expression of genes
3. Aisner J. Current approach to malignant mesothelio- 19. Fukazawa T, Walter B, Owen-Schaub LB. Adenoviral coding for proteoglycans and Wilms’ tumor susceptibil-
ma of the pleura. Chest 1997;107:332–4. Bid overexpression induces caspase-dependent cleavage ity gene 1 (WT1) by variously differentiated benign
4. Robinson BW, Lake RA. Advances in malignant of truncated Bid and p53-independent apoptosis in human mesothelial cells. Differentiation 1999;165:89–96.
mesothelioma. N Engl J Med 2005;353:1591–603. human non-small cell lung cancers. J Biol Chem 2003; 34. Inase N, Miyake S, Yoshizawa Y. Calretinin promoter
5. Nowak AK, Lake RA, Kindler HL, Robinson BW. New 278:25428–34. for suicide gene expression in malignant mesothelioma.
approaches for mesothelioma: biologics, vaccines, gene 20. Ahn KS, Ou W, Silver J. Inhibition of certain strains of Anti Cancer Res 2001;21:1111–4.
therapy, and other novel agents. Semin Oncol 2002;29: HIV-1 by cell surface polyanions in the form of 35. Narasimhan SR, Yang L, Gerwi BI, Broaddus VC.
82–96. cholesterol-labeled oligonucleotides. Virology 2004;330: Resistance of pleural mesothelioma cell lines to
6. Nowak AK, Byrne MJ, Williamson R, et al. A 50–61. apoptosis: relation to expression of Bcl-2 and Bax. Am
multicentre phase II study of cisplatin and gemcita- 21. Layne SP, Merges MJ, Dembo M, et al. Factors J Physiol 1998;275:165–71.
bine for malignant mesothelioma. Br J Cancer 2002;87: underlying spontaneous inactivation and susceptibility 36. Cao XX, Mohuiddin I, Ece F, McConkey DJ, Smythe
491–6. to neutralization of human immunodeficiency virus. WR. Histone deacetylase inhibitor downregulation of
7. Vogelzang NJ, Rusthoven JJ, Symanowski J, et al. Phase Virology 1992;189:695–714. bcl-xl gene expression leads to apoptotic cell death in
III study of pemetrexed in combination with cisplatin 22. Bess JW, Jr., Powell PJ, Issaq HJ, et al. Tightly bound mesothelioma. Am J Respir Cell Mol Biol 2001;25:562–8.
versus cisplatin alone in patients with malignant pleural zinc in human immunodeficiency virus type 1, human 37. Robinson BW, Musk AW, Lake RA. Malignant
mesothelioma. J Clin Oncol 2003;21:2636–44. T-cell leukemia virus type I, and other retroviruses. mesothelioma. Lancet 2005;5:397–408.
8. Baldini EH. External beam radiation therapy for the J Virol 1992;66:840–7. 38. Heise C, Kirn DH. Replication-selective adenoviruses
treatment of pleural mesothelioma. Thoracic Surg Clin 23. Onda M, Willingham M, Nagata S, et al. New as oncolytic agents. J Clin Invest 2000;105:847–51.
2004;14:543–8. monoclonal antibodies to mesothelin useful for immu- 39. Ito H, Aoki H, Kuhnel F, et al. Autophagic cell
9. van der Most RG, Robinson BW, Nelson DJ. Gene nohistochemistry, fluorescence-activated cell sorting, death of malignant glioma cells induced by a con-
therapy for malignant mesothelioma: beyond the infant Western blotting, and ELISA. Clin Cancer Res 2005;11: ditionally replicating adenovirus. J Natl Cancer Inst
years. Cancer Gene Ther 2006;13:897–904. 5840–6. 2006;98:625–36.
10. Albelda SM, Wiewrodt R, Sterman DH. Gene therapy 24. Young N, Hahn CN, Poh A, et al. Effect of disrupted 40. Leja J, Dzojic H, Gustafson E, Oberg K, Giandomenico
for lung neoplasms. Clin Chest 2002;23:265–77. SOX18 transcription factor function on tumor growth, V, Essand M. A novel chromogranin-A promoter-driven
11. Mohiuddin I, Cao X, Fang B, Nishizaki M, Smythe vascularization, and endothelial development. J Natl oncolytic adenovirus for midgut carcinoid therapy. Clin
WR. Significant augmentation of pro-apoptotic gene Cancer Inst 2006;98:1060–67. Cancer Res 2007;13:2455–62.
therapy by pharmacologic bcl-xl down-regulation in 25. Walensky LD, Pitter K, Morash J, et al. A stapled BID 41. Kishimoto H, Kojima T, Watanabe Y, et al. In vivo
mesothelioma. Cancer Gene Ther 2001;8:547–54. BH3 helix directly binds and activates BAX. Mol Cell imaging of lymph node metastasis with telomerase-
12. Pataer A, Smythe WR, Yu R, et al. Adenovirus- 2006;24:199–210. specific replication-selective adenovirus. Nat Med 2006;
mediated Bak gene transfer induces apoptosis in 26. Alemany R, Lai S, Lou YC, Jan HY, Fang X, Zhang 10:1213–9.
mesothelioma cell lines. J Thorac Cardiovasc Surg 2001; WW. Complementary adenoviral vectors for oncolysis. 42. Adusumilli PS, Stiles BM, Chan MK, et al. Imaging
121:61–7. Cancer Gene Ther 1999;6:21–5. and therapy of malignant pleural mesothelioma using
13. Bischoff JR, Kirn DH, Williams A, et al. An adenovirus 27. Ordonez NG. Immunohistochemical diagnosis of replication-competent herpes simplex viruses. J Gene
mutant that replicates selectively in p53-deficient epithelioid mesothelioma: an update. Arch Pathol Lab Med 2006;8:603–15.
human tumor cells. Science 1996;274:373–6. Med 2005;129:1407–14. 43. Roberts DM, Nanda A, Havenga MJ, et al. Hexon-
14. Gotzos V, Vogt P, Celio MR. The calcium binding 28. Lugli A, Forster Y, Haas P, et al. Calretinin expression chimaeric adenovirus serotype 5 vectors circumvent
protein calretinin is a selective marker for malignant in human normal and neoplastic tissues: a tissue pre-existing anti-vector immunity. Nature 2006;441:
pleural mesotheliomas of the epithelial type. Pathol Res microarray analysis on 5233 tissue samples. Hum Pathol 239–43.
Pract 1996;192:137–47. 2003;34:994–1000. 44. Kulklitis RJ, Singhal S, Delong P, et al. Immuno-gene
15. Amin KM, Litzky LA, Smythe WR, et al. Wilms’ tumor 29. Hassan R, Remaley AT, Sampson ML, et al. Detection therapy with interferon-h before surgical debulking
1 susceptibility (WT1) gene products are selectively and quantitation of serum mesothelin, a tumor marker delays recurrence and improves survival in a murine
expressed in malignant mesothelioma. Am J Pathol for patients with mesothelioma and ovarian cancer. Clin model of malignant mesothelioma. J Thorac Cardiovasc
1995;146:344–56. Cancer Res 2006;12:447–53. Surg 2003;127:123–30.
16. Ordonez NG. Value of mesothelin immunostaining 30. Breidenbach M, Rein DT, Everts M, et al. Mesothelin- 45. Hakkarainen T, Hemminki A, Curiel DT, Wahlfors J. A
in the diagnosis of mesothelioma. Mod Pathol 2003;16: mediated targeting of adenoviral vectors for ovarian conditionally replicative adenovirus that codes for a TK-
192–7. cancer gene therapy. Gene Ther 2005;12:187–93. GFP fusion protein (Ad5D24TK-GFP) for evaluation of
17. Gordon GJ, Rockwell GN, Jensen RV, et al. Identifi- 31. Chang K, Pai LH, Batra JK, Pastan I, Willingham MC. the potency of oncolytic virotherapy combined with
cation of novel candidate oncogenes and tumor Characterization of the antigen (CAK1) recognized by molecular chemotherapy. Int J Mol Med 2006;4:751–9.
www.aacrjournals.org 7129 Cancer Res 2008; 68: (17). September 1, 2008
