Efficacy of MAR Inhibitors in a Pseudomonas aeruginosa Pneumonia

Document Sample
Efficacy of MAR Inhibitors in a Pseudomonas aeruginosa Pneumonia Powered By Docstoc
					F1-3958                                                                                                                                                                                              Efficacy of MAR Inhibitors in a Pseudomonas aeruginosa
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          75 Kneeland Street
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          Boston, MA 02111


                                                                                                                                                                                                                       Pneumonia Model
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          t: 617 - 275 - 0040
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          f: 617 - 275 - 0039

                                                                                                                                                                                                                                                    Raina Gay; Lynne K. Garrity-Ryan; Oak K. Kim; Mark Grier; Beth Hanley; Peter Donovan; Michael P. Draper; S. Ken Tanaka; Stuart B. Levy                                                                                                                                                                                                                          rgay@paratekpharm.com
                                                                                                                                                                                                                                                                                               Paratek Pharmaceuticals, Inc., Boston MA 02111                                                                                                                                                                                                                                                                        www.paratekpharm.com



                                                            ABSTRACT                                                                                                 MAR Inhibitor Activity in vitro – Potential for a                                                                                                                    Lead ExsA Inhibitors                                                                  ExsA Inhibitors Reduce Mortality in a Lethal                                                         P005784 Prevents P. aeruginosa Dissemination in Mice
                                                                                                                                                                             Broad Spectrum Inhibitor                                                                                                                                                                                                                                 P. aeruginosa Pneumonia Model                                                                            Following Intranasal Infection
Background: Multiple Adaptation Response (MAR) proteins are a family of
                                                                                                                                                                                                                             O H                                      X                                                                                                             ExsA                                                                                                                                                                  LUNG                                                             BLOOD
bacterial transcription factors that regulate the expression of antibiotic resistance                                                                                                                   O2N                 N                         H                                                                  Compound                       Structure                                          METHODS AND RESULTS                                                                                                   1.2E+07
and virulence determinants. In P. aeruginosa (PA), the MAR protein ExsA is an                                                                                                                                                                                                                                                                                                     EC50 (µM)                                                                                                                                                                                                               1.2E+05




                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     cfu/mL whole blood
                                                                                                                                                                                                                                                  N
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 1.0E+07




                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               cfu/whole organ
important virulence regulator of the type III secretion (TTS) system. Treatment                                                                                                                                             N
                                                                                                                                                                                                                                                                              Y                                                                                                                                             o     Female Swiss Webster mice (18-22 grams)                                                                                                                                 1.0E+05
                                                                                                                                                                                                                                                                                                                                              O
with small molecule inhibitors of ExsA reduces infection and mortality in a PA                                                                                                                                                                    O                                                                                                 O         O                                                                                                                                                                  8.0E+06                                                                  8.0E+04
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            **          **
                                                                                                                                                                                                                                                                                                                                              +
                                                                                                                                                                                                                                                                                                                                              N
pneumonia model.                                                                                                                                                                                           P. aeruginosa                  E. coli           Y. pseudotuberculosis         (non-MAR)                        P005784        O         N
                                                                                                                                                                                                                                                                                                                                                                                        3.0                                                                                                                                      6.0E+06
                                                                                                                                                                                                                                                                                                                                                    N
                                                                                                                                                                                                                                                                                                                                                              N
                                                                                                                                                                                                                                                                                                                                                                             O
                                                                                                                                                                                                                                                                                                                                                                                                                            o     Mice were infected intranasally (i.n.) with P. aeruginosa at ~1 x 106 cfu                                                                                               6.0E+04
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  *         **
                                                                                                                                                                                                              ExsA                        SoxS                       LcrF                   SlyA                                                                                                                                  in 50µl sterile PBS                                                                            4.0E+06                                                                  4.0E+04
Methods: An in vitro DNA-protein binding assay was used to identify compounds                                                                 Compound                                     X/Y
                                                                                                                                                                                                            EC50 (µM)                   EC50 (µM)                  EC50 (µM)              EC50 (µM)                                                 O H       O
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 2.0E+06                                                                  2.0E+04
with potency against the ExsA protein as well as MAR proteins from other bacteria.                                                                                                                                                                                                                                         P005707        N         N
                                                                                                                                                                                                                                                                                                                                                              N
                                                                                                                                                                                                                                                                                                                                                                                        6.6                                 o     Compounds were administered intraperitoneally (i.p.) at 25 mg/kg at
Compounds were further screened for inhibition of TTS dependent cytotoxicity                                                                     P005375                                   4-CH3                    2.5                    3.6                          1.6                 >57                                                                                                                                                                                                                                  1.0E+02                                                                  0.0E+00
                                                                                                                                                                                                                                                                                                                                                    N                        O                                                    -18, -0.5, 2, 5, 20, 26, 44 and 48 hours post-infection                                                       PA103 +    PA103 +   PA103∆ExsA +                                     PA103 +   PA103 +   PA103∆ExsA +
toward infected J774.1 cells. A murine model of PA pneumonia was used to assess                                                                  P005389                                   2,4-F,F                  3.1                    1.8                          5.0                 >48                                                                                                                                                                                                                                                 Vehicle    P005784      Vehicle                                       Vehicle   P005784      Vehicle
the efficacy of the compounds.
                                                                                                                                                 P005784                              4-COCH3                       3.0                    18.3                         5.8                 >38                                                                                                                             o     Mice were observed for up to 5 days post infection                                                                  LIVER                                                               SPLEEN
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 6.0E+04                                                                  7.0E+03
Results: Selected benzimidazole derivatives exhibited good in vitro potency and




                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     cfu/whole organ
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               cfu/whole organ
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 5.0E+04                                                                  6.0E+03
activity in cytotoxicity assays. Several ExsA inhibitory compounds also showed                                                                                                               ExsA Regulates Expression of the                                                                                                                                                                                               100                                                              Vehicle                                                                                                      5.0E+03
low micromolar potency against MAR proteins from E. coli (SoxS) and
                                                                                                                                                                                                Type III Secretion System                                                                                                      ExsA Inhibitors are Non-Antibacterial                                                         90
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 4.0E+04
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            **          **                                4.0E+03                 *         **
Y. pseudotuberculosis (LcrF) in DNA-protein binding assays. In the PA pneumonia                                                                                                                                                                                                                                                                                                                                                                                                              P005784                             3.0E+04
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          3.0E+03
                                                                                                                                                                                                                                                                                                                                                                                                                             80                                                                                                  2.0E+04
model, survival increased (4-fold, p<0.05) in mice treated daily IP for four days                                                                                                 P. aeruginosa                                                       Host (macrophage)                                                                                                                                                                                                                                                                                                                                   2.0E+03
                                                                                                                                                                                                                                                                                                                                              MIC Values (µg/mL)                                                             70                                                                                                  1.0E+04




                                                                                                                                                                                                                                                                                                                                                                                                           Survival (%)
post infection with compound P005784 or P005707 compared to vehicle alone. A                                                                                                                                                                                          PM                                                                                                                                                                                                                                                                                                                                  1.0E+03
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          0.0E+00
significant reduction in the bacterial load in the lungs (63%) and liver (75%) was                                                                                                                             IM          OM                                    Phospholipase                                                    E. coli          P. aeruginosa      S. aureus       S. pneumoniae                          60                                                                                                  0.0E+00
                                                                                                                                                                                                                                                                                                      Compound                                                                                                                                                                                                                                  PA103 +    PA103 +   PA103∆ExsA +                                     PA103 +   PA103 +   PA103∆ExsA +
observed in mice treated with P005784 compared to vehicle alone (p<0.05).                                                                                                                                                                                           cyotoxin                                                    ATCC 25922        K201 PAO6609         RN450               157E                              50                                                                                                                 Vehicle    P005784      Vehicle                                       Vehicle   P005784      Vehicle
                                                                                                                                                                                              ExoU
                                                                                                                                                                                                            Psc            Psc                        ExoU                     Adenyl                 P005784                       >64                 >64              >64                  >64                            40                                                                                                  P. aeruginosa PA103 or PA103∆ExsA was inoculated i.n. (~5 x 105 cfu in 50µl sterile PBS). Drugs
Conclusion: Targeting MAR proteins with small molecule drugs represents a new                                                                                             ExsA                ExoY                                                                 ExoY        cyclase                                                                                                                                                                                                                                           were administered i.p. at 25 mg/kg at -18, -1, 2, 5 hours post-infection. Mice were sacrificed at 18
paradigm for anti-infective chemotherapy, namely disease prevention. These data                                                                                                                             Psc            Psc                            ExoT
                                                                                                                                                                                                                                                                              cytotoxin               P005707                       >64                 >64              >64                  >64                            30                                                                                                  hours post infection and the bacterial loads in the blood and whole organs were determined. Group
demonstrate the conceptual validity of this approach including the potential for the                                                                                                          ExoT                                                                                                                                                                                                                           20                                                                                                  median, ** P<0.05, * P<0.1 by a Kruskal-Wallis Test with a ChiSquare Approximation, n = 5 mice/
development of broad spectrum agents.                                                                                                                                                                                                                            GAP & ADPRT                                                                                                                                                                                                                                                     group.
                                                                                                                                                                                                                                                                 activity - block                                                                                                                                            10
                                 Identification of MAR Inhibitors                                                                                                                                                                                                phagocytosis
                                                                                                                                                                                                                                                                                                                                                                                                                              0                                                                                                                                       CONCLUSIONS
o         MAR proteins are members of the AraC family of transcription regulators -                                                                                                                                                                                                                          ExsA Inhibitors Reduce P. aeruginosa Cytotoxicity                                                                    0       4     8   12    16   20    24    28    32    36     40    44    48
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 o     The MAR family transcription factor ExsA is required
                                                                                                                                                                                             Ca++/
                                                                                                                                                                                                                                                                                                                           Toward J774.1 Cells
                                                                                                                                                                          stimuli (low               host cell contact)                      Local tissue damage & dissemination
          defined by 2 conserved helix-turn-helix DNA binding domains                                                                                                                                                                                                                                                                                                                                                                                    Hours Post Infection                                                          for full virulence in tissue culture and animal models of P.
                                                                                                                                                       ExsA Mutants are Avirulent in a Whole Cell Assay                                                                                                                                                                                                                                                                                                                                aeruginosa infection.
o         MAR proteins regulate virulence factor expression in bacterial pathogens, but                                                                                                                                                                                                                                                                                                                                     100                                                             Vehicle
                                                                                                                                                                                                                                                                                                                         120
          are not found in eukaryotes                                                                                                                          and Animal Model of Infection                                                                                                                                                                                                                                 90
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            P005707                              o     ExsA inhibitors are non-antibacterial and thus not under the
                                                                                                                                                                                                                                                                                                                         100                                                                                                 80
o         A cell free DNA binding assay was used to identify small molecule inhibitors                                                                                                                                                                                                                                                                                                                                                                                                                                                 same selection pressure for resistance as traditional antibiotics.




                                                                                                                                                                                                                                                                                                        % Cytotoxicity
                                                                                                                                                                              Whole Cell Cytotoxicity Assay
                                                                                                                                                                                                                                                                                                                          80                                                                                                 70




                                                                                                                                                                                                                                                                                                                                                                                                             Survival (%)
          of the MAR proteins ExsA (P. aeruginosa), SoxS (E. coli), and LcrF                                                                                        100
          (Y. pseudotuberculosis)                                                                                                                                                                                                                                                                                                                                                                                            60
                                                                                                                                                                                                                                                                                                                          60                                                                                                                                                                                                     o     Treatment with the ExsA inhibitors P005784 and P005707,
                                                                                                                                                   % Cytotoxicity




                                                                                                                                                                     80                                                                  Whole Cell Cytotoxicity Assay: J774.1 cells were
                                                                                                                                                                     60
                                                                                                                                                                                                                                         infected for 1.75 hours with PA103 or PA103∆ExsA
                                                                                                                                                                                                                                         bacteria at an MOI of ~10. Lactate dehydrogenase
                                                                                                                                                                                                                                                                                                                                                                                                                             50                                                                                                        attenuated virulence and protected animals from mortality
                                                                                                                                                                                                                                                                                                                          40
                                     Cell Free DNA Binding Assay                                                                                                     40                                                                  (LDH) released into the culture media was measured
                                                                                                                                                                                                                                         using a standard kit. Cytotoxicity results are expressed
                                                                                                                                                                                                                                                                                                                                                                                                                             40                                                                                                        due to P. aeruginosa pneumonia.
                                                                                                                                                                     20
                                                                                                                                                                                                                                         as a percentage of the total LDH released from                                   20                                                                                                 30
    Streptavidin
                                                                                   Streptavidin                                                                                                                                          uninfected wells lysed with detergent.
    coated well
                   biotin
                      CTAAAATAGCAACCACAGGCTAAAATTATCTGTTTTTT
                                                                                   coated well
                                                                                                  biotin
                                                                                                                                                                      0
                                                                                                                                                                              lysed        uninfected     PA103           PA103                                                                                            0                                                                                                 20                                                                                                  o     P005784 was effective in significantly reducing the bacterial
                      GATTTTATCGTTGGTGTCCGATTTTAATAGACAAAAAA

                                   MAR       6-His
                                                                                                     CTAAAATAGCAACCACAGGCTAAAATTATCTGTTTTTT
                                                                                                     GATTTTATCGTTGGTGTCCGATTTTAATAGACAAAAAA                                                                               ∆ExsA                                                                                                 PA103 +           PA103 +          PA103 +        PA103∆ExsA                                 10                                                                                                        load of P. aeruginosa in the lungs of infected mice and
                                                     Primary antibody
                                                     mouse α His
                                                                                  MAR                                                                               100
                                                                                                                                                                                                                                                                                                                                Vehicle           P005784          P005707                                                    0                                                                                                        significantly reducing the dissemination of bacteria to the
                                                     Secondary antibody
                                                     α mouse – HRP
                                                                                inhibitor
                                                                                                                                                                     80                                                                       PA103
                                                                                                                                                                                                                                                                                                                                                                                                                                  0   8       16 24 32 40 48 56 64 72 80 88 96 104 112 120                                             blood, liver and spleen.
                                                                                                                                              % Survival




                                         HRP         (horseradish peroxidase)                                     MAR       6-His                                                                                                                                                                     J774.1 cells were infected with vehicle or ExsA inhibitor-treated PA103 (wild type) or vehicle-
                                                                                                                                                                     60                                                                       PA103∆ExsA
                                                                                                                                                                                                                                                                                                      treated PA103∆ExsA P. aeruginosa. Bacteria were cultured under Type III Secretion inducing                                                         Hours Post Infection
                                                                                         Reduced MAR-DNA binding                                                     40                                                                                                                               conditions with ExsA inhibitor or equal volume of vehicle. Lactate dehydrogenase (LDH) release                                                                                                                             o     Inhibitors that act against multiple members of the
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       MAR family of transcription factors may further inhibit
                   HRP substrate
                                                                                         Reduced luminescence                                                                                                                            Murine Pneumonia Model: Groups of 6 Swiss Webster            was measured. Results are expressed as a % of the LDH released by infection with the vehicle-        Kaplan Meier analysis revealed a significant difference in survival between vehicle-treated and
                                            luminescence
                                                                                         Dose response curve – EC50                                                  20
                                                                                                                                                                                                                                                                                                      treated PA103 control. Infection with untreated wild type PA103 bacteria typically resulted in the   P005784 or P005707-treated groups (P<0.05 by a Wilcoxon Test), n = 30 or 10-11 mice/group,
                                                                                                                                                                      0
                                                                                                                                                                                                                                         mice were infected intranasally with ~1 x 106 cfu of
                                                                                                                                                                                                                                         either PA103 or PA103∆ExsA in 50µL of sterile PBS.           release of 75-90% of the total LDH activity.                                                         respectively.
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       P. aeruginosa virulence and could be used as broad spectrum
                                                                                                                                                                          0           24        48        72          96          120                                                                                                                                                                                                                                                                                                  agents against multiple bacterial pathogens.
                                                                                                                                                                                       Hours Post Infection