POLYMERASE CHAIN REACTION (PCR) A PRACTICAL APPROACH IN CLINICAL by dou12761

VIEWS: 16 PAGES: 70

									             POLYMERASE CHAIN REACTION (PCR)
         A PRACTICAL APPROACH IN CLINICAL LABORATORIES

1.   Introduction
2.   Advances in Molecular Biology
3.   Advances in Clinical Microbiology
4.   Practical Approach to PCR
     •    PCR and Clinical Laboratory Testing
     •    PCR and Outbreak Investigation
5. Future of Clinical Laboratory Testing
        POLYMERASE CHAIN REACTION (PCR)
    A PRACTICAL APPROACH IN CLINICAL LABORATORIES

1. Introduction
        POLYMERASE CHAIN REACTION (PCR)
    A PRACTICAL APPROACH IN CLINICAL LABORATORIES

Advances in Molecular Biology Technology
• Fluorescence –based sequencing technology
• Discovery of Taq DNA polymerase
• Discovery of Ribozyme and siRNA
• Pyrosequencing technology
• Microarray technology
• Automation technology
           POLYMERASE CHAIN REACTION (PCR)
     A PRACTICAL APPROACH IN CLINICAL LABORATORIES

Advances in Molecular Biology

•   Human Genome Project
      • Impact on human health
•   Human Proteomics Project
      • Impact on disease treatment
•   Stem Cell Technology
      • Impact on organ regeneration and reproduction
•   Microbial Genome/Metagenomics
      • Impact on disease treatment and environ. sciences
        POLYMERASE CHAIN REACTION (PCR)
    A PRACTICAL APPROACH IN CLINICAL LABORATORIES

Advances in Clinical Microbiology
        POLYMERASE CHAIN REACTION (PCR)
    A PRACTICAL APPROACH IN CLINICAL LABORATORIES

Real-time PCR System
        POLYMERASE CHAIN REACTION (PCR)
    A PRACTICAL APPROACH IN CLINICAL LABORATORIES

Extraction Systems for RNA/DNA
        POLYMERASE CHAIN REACTION (PCR)
    A PRACTICAL APPROACH IN CLINICAL LABORATORIES

PCR Cycle Sequencing System

eg. ABI3130-xl
           POLYMERASE CHAIN REACTION (PCR)
     A PRACTICAL APPROACH IN CLINICAL LABORATORIES

Advances in Clinical Microbiology

•   Mechanism of antibiotic resistance
•   Understanding host pathogen interactions
•   Evolution of pathogenicity
•   New infection control measures
•   Vaccine development
•   New emerging pathogens
               POLYMERASE CHAIN REACTION (PCR)
         A PRACTICAL APPROACH IN CLINICAL LABORATORIES

Practical Approach to PCR
DNA Extraction Methods:
1.   In-house:
2.   Commercial kits – manual:
     •      Qiagen Kit
     •      ABI-PrepMan Kit
     •      Promega Kit
     •      Bio-Rad Kit
     •      Roche Kit
3.       Commercial kits – automated
     –      Biomeurix Nuclisens System;
     –      Roche’s MagnaPure System;
     –      Qiagen’s Qiasymphony System
              POLYMERASE CHAIN REACTION (PCR)
      A PRACTICAL APPROACH IN CLINICAL LABORATORIES

Practical Approach to PCR
Oligonucleotide Primer Synthesis:

   Oligo Synthesis      Purification    Length           Note
        Scale            Methods
 25, 50, 100, nmole;     Desalting     5 – 100 bp   No labeling
 1 umole, 10 umole
                       OPG-cartridge   7 – 60 bp    No labeling

                           HPLC        10-55 bp     No labeling

                           PAGE        7 – 100 bp   No labeling
               POLYMERASE CHAIN REACTION (PCR)
       A PRACTICAL APPROACH IN CLINICAL LABORATORIES

Practical Approach to PCR
Oligonucleotide Primer Synthesis and Probe Labeling:

     Oligo Primer/Probe        Types of Labeling
       Synthesis Scale           (Fluorophore)
25, 50, 100, nmole; 1 umole,     5’-biotin……
10 umole
                                5’-FAM……BHQ

                                  5’-FAM……

                                  5’-JOE……

                                  5’-TET……
               POLYMERASE CHAIN REACTION (PCR)
      A PRACTICAL APPROACH IN CLINICAL LABORATORIES

Practical Approach to PCR
Oligonucleotide Primer Synthesis and Labeling:

  Oligo Synthesis Scale   Types of Labeling

 25, 50, 100, nmole; 1
 umole, 10 umole
                              5’-FAM-
               POLYMERASE CHAIN REACTION (PCR)
      A PRACTICAL APPROACH IN CLINICAL LABORATORIES

Practical Approach to PCR
Oligonucleotide Primer Synthesis and Labeling:

  Oligo Synthesis Scale   Types of Labeling

 25, 50, 100, nmole; 1
 umole, 10 umole
                            Black Hole
                          Quencher (BHQ)
                POLYMERASE CHAIN REACTION (PCR)
       A PRACTICAL APPROACH IN CLINICAL LABORATORIES

Practical Approach to PCR
Oligonucleotide Primer Stock Solution
•      When primer is received from manufacturer, there should be a data sheet included
       indicating the mass of primer synthesized. The figure you need to pay attention to is either
       mol or nmol synthesized.
•      The starting primer concentration for most PCR reactions is ~ 25-50 M (or 25-50 pmol
       primer/50l reaction.


      Oligo     Purification   Length     Amount       H2O         Final Concentration
    Synthesis    Methods                              To add         (nmol or pmol)
      Scale
    50 nmole       HPLC         20 bp    40.5 nmol    100 uL         0.405 nmol/l.

                                                                      405 pmol/l.
             POLYMERASE CHAIN REACTION (PCR)
       A PRACTICAL APPROACH IN CLINICAL LABORATORIES

Practical Approach to PCR
Traditional method for determining DNA/RNA concentration:

At 260 nm   dsDNA 1 O.D.=50 ug/ml

            ssDNA 1 O.D. = 33 ug/ml

            ssRNA 1 O.D.= 33 ug/ml

260/280nm > 1.8, good quality DNA
ratio
            <1.8, poor quality DNA
             POLYMERASE CHAIN REACTION (PCR)
      A PRACTICAL APPROACH IN CLINICAL LABORATORIES

Practical Approach to PCR
Fluorometric Method for determining DNA/RNA concentration:


 PicoGreen dsDNA   0 - 1000 pg/ml



 RiboGreen RNA     0 – 1000 pg/ml



 NanoDrop DNA      0 – 1000 ng/ul
             POLYMERASE CHAIN REACTION (PCR)
       A PRACTICAL APPROACH IN CLINICAL LABORATORIES

Practical Approach to PCR
Master mix preparation: 30 μl final volume
                         1     10X Buffer            3 μl
                         2     MgCl2                 3 μl [1.5 mM]
                         3     dNTP                  3 μl [200 μM]
                         4     Forward primer        1 μl [100-200 μM]
                         5     Reverse primer        1 μl [100-200 μM]
                         6     Taq enzyme          0.5 μl [2-5 units]
                         7     RNA/DNA-free H2O   13.5 μl
                         8     RNA/DNA sample        5 μl [10- 50 ng]
              POLYMERASE CHAIN REACTION (PCR)
       A PRACTICAL APPROACH IN CLINICAL LABORATORIES

Practical Approach to PCR
Thermal cycling conditions (end-point analysis)


         Step 1     940C, 10 min; denature        1 cycle

         Step 2     940C, 15 sec; denature
                    520C, 60 sec; annealing       35 cycles
                    720C, 60 sec; extension
         Step 3     720C, 7 min final extension   1 cycle

         Step 4     40C, hold.
              POLYMERASE CHAIN REACTION (PCR)
       A PRACTICAL APPROACH IN CLINICAL LABORATORIES

Practical Approach to PCR
Thermal cycling conditions (real-time analysis)


         Step 1     940C, 15 min; denature        1 cycle

         Step 2     940C, 15 sec; denature
                                                  45 cycles
                    600C, 60 sec;
                    annealing & extension
                    Signal collection at 60C.
              POLYMERASE CHAIN REACTION (PCR)
        A PRACTICAL APPROACH IN CLINICAL LABORATORIES

Practical Approach to PCR
Thermal cycling conditions (real-time Flu A RT-PCR analysis)


         Step 1      500C, 15 min;                             1 cycle

                     reverse transcription
         Step 2      940C, 15 min; heat-inactivation.          1 cycle

         Step 3      940C, 15 sec; denature
                                                               45 cycles
                     600C, 60 sec;
                     annealing & extension
                     Signal collection at 600C.
                 POLYMERASE CHAIN REACTION (PCR)
         A PRACTICAL APPROACH IN CLINICAL LABORATORIES

Practical Approach to PCR
Thermal cycling conditions (real-time Bordetella pertussis PCR)


Step 1   500C, 2 min; UNG treatment        1 cycle

Step 2   950C, 15 min; heat inactivation   1 cycle

Step 3   950C, 15 sec; denature
                                           45 cycles
         600C, 60 sec;
         annealing & extension
         Signal collection at 60C.
         POLYMERASE CHAIN REACTION (PCR)
 A PRACTICAL APPROACH IN CLINICAL LABORATORIES

PCR and Outbreak Investigation

   •   Severe Respiratory Illness
   •   Food-borne Disease
   •   Water-borne Disease
   •   Bioterrorism
            POLYMERASE CHAIN REACTION (PCR)
     A PRACTICAL APPROACH IN CLINICAL LABORATORIES

Practical Approach to PCR In Clinical Bacteriology
 –   MRSA
 –   VRE
 –   ESBL
 –   CDAD
 –   E. coli O157:H7
 –   Listeria monocytogene
 –   Bordetella pertussis
 –   Legionella pheumonia
 –   Mycobacterium tuberculosis
 –   Group A Streptococcus
              POLYMERASE CHAIN REACTION (PCR)
      A PRACTICAL APPROACH IN CLINICAL LABORATORIES

Practical Approach to PCR In Clinical Bacteriology
   MRSA Multiplex PCR
   Primers
       mecA1 ACA AGC AAT AGA ATC ATC AG
       mecA2 ATC AGT ATT TCA CCT TGT CC
   Amplicon size: 210bp

      femA1 AAA GAA CTA AAC GAA GAG CG
      femA2 TTC AGC ATT GTA ACC TTT TT
   Amplicon size: 420bp

   Stock: 100 µM
   Working: 10 µM
   Store primer solutions at -20°C
          POLYMERASE CHAIN REACTION (PCR)
    A PRACTICAL APPROACH IN CLINICAL LABORATORIES

Practical Approach to PCR In Clinical Bacteriology
  MRSA Multiplex PCR Master Mix
          PCR Reagents            Amount

       Qiagen 2X Master Mix        25 μl
             mecA1                 1μl
             mecA2                 1μl
              femA1                1μl
              femA2                1μl
           DNA sample              5μl
              Water                16μl
           Total volume            50 μl
            POLYMERASE CHAIN REACTION (PCR)
    A PRACTICAL APPROACH IN CLINICAL LABORATORIES

Practical Approach to PCR In Clinical Bacteriology
  MRSA PCR Cycling Protocol
     Cycle Steps                 Amplification Conditions
       1 cycle     Initial denaturation 94°C for 2 min
      35 cycles    Denaturation94°C for 1 min
                   Anneal 55°C for 1 min
                   Extend72°C for 1.5 min
       1 cycle     Extension72°C for 10 min

                   Hold4°C for ∞
        POLYMERASE CHAIN REACTION (PCR)
    A PRACTICAL APPROACH IN CLINICAL LABORATORIES

PCR Detection E. coli O157:H7
          POLYMERASE CHAIN REACTION (PCR)
     A PRACTICAL APPROACH IN CLINICAL LABORATORIES

Practical Approach to PCR during the Walkerton
E. coli O157:H7 Outbreak
   DNA extraction:
     Qiangen DNA Purification Kit
   Master mixture:
     Qiangen 2X Taq master mix
     STX-1/STX2 primer
         – stx1 5'TTTACGATAGACTTCTCGAC3'
         – stx2 5'CACATATAAATTATTTCGCTC3'

      PCR reaction in 50 uL volume
         POLYMERASE CHAIN REACTION (PCR)
     A PRACTICAL APPROACH IN CLINICAL LABORATORIES

Practical Approach to PCR during the Walkerton
E. coli O157:H7 Outbreak
   PCR conditions:
   1 cycle:     94°C for 2 min;
   35 cycles:   94°C for 30 s,
                56°C for 30 s,
                72°C for 60 s;
   1 cycle:     extension at 72°C for 10 min.
    POLYMERASE CHAIN REACTION (PCR)
A PRACTICAL APPROACH IN CLINICAL LABORATORIES

  Practical Approach to PCR during the
  Walkerton E. coli O157:H7 Outbreak
            POLYMERASE CHAIN REACTION (PCR)
      A PRACTICAL APPROACH IN CLINICAL LABORATORIES

Practical Approach to PCR
PFGE analysis of Xba I restricted E. coli O157:H7 DNA
            POLYMERASE CHAIN REACTION (PCR)
      A PRACTICAL APPROACH IN CLINICAL LABORATORIES

PCR Detection of Binary Toxin in C. difficile

C. difficile-associated diarrhea (CDAD)

•   Most strains of Clostridium difficile produce two toxins A and B;
    cause C. difficile-associated diarrhea (CDAD) with symptoms
    ranging from mild diarrhea to pseudomembranous colitis.
•   CDAD is associated mainly with the use of antibiotics that
    reduce the protective microflora, which allows for overgrowth
    and toxin production by C. difficile
         POLYMERASE CHAIN REACTION (PCR)
     A PRACTICAL APPROACH IN CLINICAL LABORATORIES

PCR Detection of Binary Toxin in C. difficile

C. difficile-associated diarrhea (CDAD)

   Binary toxins consist of two independent
   unlinked protein chains, designated CDTa
   (enzymatic component) and CDTb (binding
   component) in C. difficile.
            POLYMERASE CHAIN REACTION (PCR)
      A PRACTICAL APPROACH IN CLINICAL LABORATORIES

PCR Detection of Binary Toxin in C. difficile

C. difficile-associated diarrhea (CDAD)

•   Two large toxin proteins (TcdA [or toxin A] and TcdB [or toxin
    B]) are thought to be the primary virulence factors of C.
    difficile.
•   These toxins are encoded by two separate genes, named tcdA
    and tcdB. Together with three additional genes they form a
    19.6-kb pathogenicity locus called PaLoc.
•   TcdA and TcdB both disrupt the actin cytoskeleton of intestinal
    epithelial cells by the UDP-glucose-dependent glucosylation
    of proteins from the Rho and Ras subfamilies.
         POLYMERASE CHAIN REACTION (PCR)
     A PRACTICAL APPROACH IN CLINICAL LABORATORIES

PCR Detection of Binary Toxin in C. difficile

C. difficile-associated diarrhea (CDAD)
         POLYMERASE CHAIN REACTION (PCR)
     A PRACTICAL APPROACH IN CLINICAL LABORATORIES

PCR Detection of Binary Toxin in C. difficile
        POLYMERASE CHAIN REACTION (PCR)
    A PRACTICAL APPROACH IN CLINICAL LABORATORIES

PCR Detection of Bordetella pertussis
        POLYMERASE CHAIN REACTION (PCR)
    A PRACTICAL APPROACH IN CLINICAL LABORATORIES

PCR Detection of Plasmodium sp.
         POLYMERASE CHAIN REACTION (PCR)
    A PRACTICAL APPROACH IN CLINICAL LABORATORIES

Practical Approach to PCR in Clinical Mycology
              POLYMERASE CHAIN REACTION (PCR)
      A PRACTICAL APPROACH IN CLINICAL LABORATORIES

Fungal ITS PCR
Mater mixture:
   50 uL reaction volume
   1 uL of ITS forward primer
   1 uL of reverse primer
   5 ul of MgCl
   5 uL of dNTP
   5 uL of 10X buffer
   0.5 uL of Taq polymerase
   22.5 uL of H2O
   10 uL of DNA (1:50 dilution)
      POLYMERASE CHAIN REACTION (PCR)
 A PRACTICAL APPROACH IN CLINICAL LABORATORIES

PCR and Fungal Ribosomal RNA Gene Sequencing
            POLYMERASE CHAIN REACTION (PCR)
      A PRACTICAL APPROACH IN CLINICAL LABORATORIES

Fungal ITS Cycle sequencing
>09SF4870
ATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATT
CAGTGAATCATCGAGTCTTTGAACGCAACTTGCGCCCTTTGGTATTCCGA
AGGGCATGCCTGTTTGAGAGTCATGAAAATCTCAATCCCTCGGGTTTTAT
TACCTGTTGGACTTGGATTTGGGTGTTTGCCGCGACCTGCAAAGGACGTC
GGCTCGCCTTAAATGTGTTAGTGGGAAGGTGATTACCTGTCAGCCCGGCG
TAATAAGTTTCGCTGGGCCTATGGGGTAGTCTTCGGCTTGCTGATAACAA
CCATCTCTTTTTGTTTGACCTCAAATCAGGTAGGGCTACCCGCTGAACTT
AAGCATATCAATAAGCGGAGGAA

Idenfied as Cryptococcus neoformans by GenBank BLAST search.
              POLYMERASE CHAIN REACTION (PCR)
       A PRACTICAL APPROACH IN CLINICAL LABORATORIES

Practical Approach to PCR during SARS Outbreak
Case definition of SARS Clinical Criteria
    – Asymptomatic or mild respiratory illness
    – Moderate respiratory illness
        Temperature >38°C, cough, shortness of breath,
        difficulty with breathing, or hypoxia
    – Severe respiratory illness
        Temperature >38°C,
        Radiographic evidence of pneumonia
    – Epidemiological criteria
        Travel within 10 days of onset of symptoms
                  POLYMERASE CHAIN REACTION (PCR)
         A PRACTICAL APPROACH IN CLINICAL LABORATORIES

SARS Coronavirus
      Genome: Plus (+) strand;
      monopartite, 29‘740 base, mRNA
      capped, polyadenylated Virion:
      Spherical, ca. 100 nm in diameter;
      enveloped, large spikes




Stadler K. Nature Rev. Microbiol. 1 (2003) 209-18
            POLYMERASE CHAIN REACTION (PCR)
       A PRACTICAL APPROACH IN CLINICAL LABORATORIES

Practical Approach to PCR during the SARS Outbreak

   –   Total RNA Extraction
   –   Pre-RT-PCR Preparation
   –   RT-PCR Testing
   –   Post RT-PCR Analysis
           POLYMERASE CHAIN REACTION (PCR)
    A PRACTICAL APPROACH IN CLINICAL LABORATORIES

Practical Approach to PCR
  RT-PCR with BNI primers
  Run on 1.5% Agagrose Gel
         POLYMERASE CHAIN REACTION (PCR)
    A PRACTICAL APPROACH IN CLINICAL LABORATORIES

Practical Approach to PCR
   Real-time RT-PCR amplification of SARS-CoV Virus
         POLYMERASE CHAIN REACTION (PCR)
     A PRACTICAL APPROACH IN CLINICAL LABORATORIES

Practical Approach to PCR during the SARS Outbreak
         POLYMERASE CHAIN REACTION (PCR)
    A PRACTICAL APPROACH IN CLINICAL LABORATORIES

Practical Approach to PCR in Virology
           POLYMERASE CHAIN REACTION (PCR)
     A PRACTICAL APPROACH IN CLINICAL LABORATORIES

Practical Approach to PCR during the Human A/H1N1 flu outbreak
           POLYMERASE CHAIN REACTION (PCR)
     A PRACTICAL APPROACH IN CLINICAL LABORATORIES

Practical Approach to PCR during the Human A/H1N1 flu outbreak

•   Evolution of A/H1N1
•   Triple assortment
            POLYMERASE CHAIN REACTION (PCR)
       A PRACTICAL APPROACH IN CLINICAL LABORATORIES

Practical Approach to PCR during the Human A/H1N1 flu outbreak
• RT-PCR and Influenza Typing
• Influenza A/B RT-PCR
• Influenza A Subtyping
   •    (16H x 9N)
   •    H3N2 (Brisben strain)
   •    H1N1
   •    H2N2
   •    H5N1 (Avian)
   •    H1N1 (Swine)
           POLYMERASE CHAIN REACTION (PCR)
      A PRACTICAL APPROACH IN CLINICAL LABORATORIES

Practical Approach to PCR during the Human A/H1N1 flu outbreak
  –   Ontario CPHL (Toronto)
  –   April 24 to date
           POLYMERASE CHAIN REACTION (PCR)
      A PRACTICAL APPROACH IN CLINICAL LABORATORIES

Practical Approach to PCR during the Human A/H1N1 flu outbreak
  –   ezMag Exraction System
        POLYMERASE CHAIN REACTION (PCR)
    A PRACTICAL APPROACH IN CLINICAL LABORATORIES

Practical Approach to PCR
   Real-time PCR System
                         POLYMERASE CHAIN REACTION (PCR)
           A PRACTICAL APPROACH IN CLINICAL LABORATORIES

Practical Approach to PCR Master mix preparation:
 Flu A&B rRT-PCR Worksheet                                                                        7900 File Name:     2009-04-30E&F
                                                                                              1 RUN# 2009-04-30E    2 RUN# 2009-04-30F
                                        Number of Samples (include controls and 10% extra):           52



 1. Prepare Master Mix                                                                             FluA                 GAPDH
                                               2 X Quantitect Multiplex RT-PCR Master Mix:          520    µl               520   µl
                                                                        RNase-Free Water:          301.6   µl             353.6   µl
                                                                         20 X Flu A primer:           52   µl                 -
                                                                        20 X Flu A probes:            52   µl                 -
                                                               GAPDH primer & probe mix:               -                     52
                                                         100 X Quantitect Multiplex RT Mix:         10.4   µl              10.4   µl
                                                                             Final Volume:          936    µl               936   µl
 1. Aliquot 18 µl FluA Master Mix to wells A1-H6.
 2. Aliquot 18 µl GAPDH Master Mix to wells A7-H12.
 3. In sample prep room, add 2 ul RNA to approperiate wells.
                               POLYMERASE CHAIN REACTION (PCR)
                 A PRACTICAL APPROACH IN CLINICAL LABORATORIES

Practical Approach to PCR Master mix preparation:
        1             2            3            4            5            6            7            8            9           10           11           12
                    FLU A-       FLU A-                    FLU A-       FLU A-                   GAPDH-       GAPDH-                    GAPDH-       GAPDH-
A    FLU A-a      09C0108247   09C0108273    FLU A-a     09C0107272   09C0107284   GAPDH-a      09C0108247   09C0108273   GAPDH-a      09C0107272   09C0107284

      FLU A-        FLU A-       FLU A-       FLU A-       FLU A-       FLU A-      GAPDH-       GAPDH-       GAPDH-       GAPDH-       GAPDH-       GAPDH-
B   09C0108236    09C0108248   09C0108277   09C0107256   09C0107274   09C0107285   09C0108236   09C0108248   09C0108277   09C0107256   09C0107274   09C0107285

      FLU A-        FLU A-       FLU A-       FLU A-       FLU A-       FLU A-      GAPDH-       GAPDH-       GAPDH-       GAPDH-       GAPDH-       GAPDH-
C   09C0108237    09C0108251   09C0107347   09C0107258   09C0107275   09C0107286   09C0108237   09C0108251   09C0107347   09C0107258   09C0107275   09C0107286

      FLU A-        FLU A-       FLU A-       FLU A-       FLU A-       FLU A-      GAPDH-       GAPDH-       GAPDH-       GAPDH-       GAPDH-       GAPDH-
D   09C0108238    09C0108252   09C0107348   09C0107259   09C0107276   09C0107289   09C0108238   09C0108252   09C0107348   09C0107259   09C0107276   09C0107289

      FLU A-        FLU A-       FLU A-       FLU A-       FLU A-       FLU A-      GAPDH-       GAPDH-       GAPDH-       GAPDH-       GAPDH-       GAPDH-
E   09C0108241    09C0108253   09C0107370   09C0107263   09C0107279   09C0107290   09C0108241   09C0108253   09C0107370   09C0107263   09C0107279   09C0107290

      FLU A-        FLU A-       FLU A-       FLU A-       FLU A-       FLU A-      GAPDH-       GAPDH-       GAPDH-       GAPDH-       GAPDH-       GAPDH-
F   09C0108244    09C0108264   09C0107371   09C0107265   09C0107281   09C0107293   09C0108244   09C0108264   09C0107371   09C0107265   09C0107281   09C0107293

      FLU A-        FLU A-      FLU A-        FLU A-       FLU A-       FLU A-      GAPDH-       GAPDH-       GAPDH-       GAPDH-       GAPDH-       GAPDH-
G   09C0108245    09C0108265    107243      09C0107266   09C0107282   09C0107363   09C0108245   09C0108265    107243      09C0107266   09C0107282   09C0107363

      FLU A-        FLU A-                    FLU A-       FLU A-                   GAPDH-       GAPDH-       GAPDH-       GAPDH-       GAPDH-
H   09C0108246    09C0108270   FLU A-NTC    09C0107271   09C0107283   FLU A-ntc    09C0108246   09C0108270     NTC        09C0107271   09C0107283   GAPDH-ntc

            1 RUN# 2009-04-30E                      2 RUN# 2009-04-30F                     1 RUN# 2009-04-30E                     2 RUN# 2009-04-30F
              POLYMERASE CHAIN REACTION (PCR)
       A PRACTICAL APPROACH IN CLINICAL LABORATORIES

Practical Approach to PCR
Thermal cycling conditions (end-point analysis)


         Step 1     94 - 950C, 5 – 10 min; denature     1 cycle

         Step 2     940C, 5- 10 sec; denature
                    50 - 600C, 15 – 60 sec; annealing   35 cycles
                    720C, 45- 90 sec; extension
         Step 3     720C, 7- 10 min final extension     1 cycle

         Step 4     40C, hold.
                    POLYMERASE CHAIN REACTION (PCR)
         A PRACTICAL APPROACH IN CLINICAL LABORATORIES

Practical Approach to PCR
Thermal cycling conditions (real-time analysis)
Step   94 - 950C, 5 min;      1 cycle
1      denature

Step   940C, 5- 10 sec;
2      denature               45 cycles

       600C, 45 sec;
       annealing
       Signal collection at
       60C
                    POLYMERASE CHAIN REACTION (PCR)
         A PRACTICAL APPROACH IN CLINICAL LABORATORIES

Practical Approach to PCR
Thermal cycling conditions (real-time analysis)


Step   94 - 950C, 5 min;   1 cycle
1      denature

Step   940C, 5- 10 sec;
2      denature            45 cycles

       600C, 45 sec;
       annealing
       Signal collection
              POLYMERASE CHAIN REACTION (PCR)
      A PRACTICAL APPROACH IN CLINICAL LABORATORIES

Practical Approach to PCR during the Human A/H1N1 flu outbreak
  –       End-point RT-PCR of A/H1N1

      •      Real-time RT-PCR pos for Flu A
      •      Human GAPDH pos
      •      NML RT-PCR
      •      BigDye sequencing
      •      GenBank BLAST search
      •      Lab confirmation
        POLYMERASE CHAIN REACTION (PCR)
    A PRACTICAL APPROACH IN CLINICAL LABORATORIES

RT-PCR Detection of Human A/H1N1 (Swine flu)
        POLYMERASE CHAIN REACTION (PCR)
    A PRACTICAL APPROACH IN CLINICAL LABORATORIES

Practical Approach to PCR
Avian H5N1 virus RT-PCR
         POLYMERASE CHAIN REACTION (PCR)
     A PRACTICAL APPROACH IN CLINICAL LABORATORIES

Practical Approach to qRT-PCR of Avian H5N1 Virus
          POLYMERASE CHAIN REACTION (PCR)
     A PRACTICAL APPROACH IN CLINICAL LABORATORIES

Practical Approach to RT-PCR Subtyping of Influenza Virus
        POLYMERASE CHAIN REACTION (PCR)
    A PRACTICAL APPROACH IN CLINICAL LABORATORIES

Practical Approach to PCR
West Nile Virus EM
        POLYMERASE CHAIN REACTION (PCR)
    A PRACTICAL APPROACH IN CLINICAL LABORATORIES

Practical Approach to PCR
Norovirus RT-PCR
Thermo-cycling conditions
• (1 cycle) 30 min 50°C
• (1 cycle) 15 min 95°C
• (40 cycles): Denaturation for 15 sec at 95°C
   Annealing/extension for 60 sec at 60°C
          POLYMERASE CHAIN REACTION (PCR)
      A PRACTICAL APPROACH IN CLINICAL LABORATORIES

                 Future Development
1.   Automation of specimen processing
2.   High-throughput PCR systems
3.   Integration of LIS with Molecular testing
4.   Regional and International Molecular
     Surveillance Systems
    POLYMERASE CHAIN REACTION (PCR)
A PRACTICAL APPROACH IN CLINICAL LABORATORIES


Thank You All
     for
    Your
 Participation

								
To top