Comparative genomics analysis of NtcA regulons in cyanobacteria

Comparative genomics analysis of NtcA regulons in cyanobacteria: Regulation of nitrogen assimilation and its coupling to photosynthesis Zhengchang Su, Vitctor Olman, Fenglou Mao and Ying Xu Wen-Ting Huang Jau-Chi Huang Outline • • • • Introduction Method Result Conclusion Introduction • DNA transcription 3’ 5’ 5’ 3’ coding region intron coding region • mRNA 3’ 5’ 5’ 5’ 3’ Regulation elements RNA polymerase 3’ Regulatory region RNA polymerase binding site upstream downstream transcription direction • cis-regulation – Regulatory regions of genes and the regulated genes are on the same chromosome • Phylogenetic footprinting – Identifies regulatory elements by finding regions in a set of orthologous non-coding DNA sequences from multiple species. • Cyanobacteria – bacteria – live in the water – Gram-Negative, oxygenic phototrophs – Nitrogen control in cyanobacteria is mediated by NtcA http://www.ucmp.berkeley.edu/bacteria/cyanointro.html • NtcA – A protein which regulates the assimilation of nitrogen. • NtcA binding site – Base Motif “GTAN8TAC” – ~14 bps – Intron – Nitrogen fixation related genes – -31 downstream has -10 σ70like box “TAN3T” High false positive rate • Too short to identify • 3 methods: – Coding region – -10 like box – Othologous genes Materials • Nine sequenced cyanobacteria genomes were downloaded from the GenBank. • ftp.ncbi.nih.gov/genomes/Bacter ia/ Method • Step 1: – Prepare training sets – Get the profiles(GTAN8TAC, TAN3T) • Step 2: – Scan genomic sequences and score each motif. • Step 3: – Decide the cutoff. Known • Possible NtcA binding sites (GTAN8TAC) – Appear in the upstream intergenic regions – In many cases, there is a –10 like box (TAN3T) in the 31bp downstream regions of the NtcA binding site upstream transcription unit 31bp transcription unit Prepare training sets • They chose 11 genes which are known to be regulated by NtcA from the nine cyanobacterial genomes. • They used phylogenetic footprinting and identified 51 putative NtcA binding sites. • These 51 sites constitute the training set A1 for the NtcA binding site. • The –31 bp downstream regions are further searched for a –10 like box and form the training set B1 A1 & B1 A2&B2 • They collected 12 experimentally verified NtcA binding sites and their downstream from seven other cyanobacteria. • They also included the sites that failed to find by phylogenetic footprinting. Profiles • They combined A1 and A2 to construct the profile of NctA binding sites. Profiles • They combined B1 and B2 to construct the profile of –10 like boxes. Scan genomic sequences upstream transcription unit transcription unit GTAAAGTTAAGTTCCTTCAAAGCATTCGTGG TTAAAGTTAAGTTCTTTTAAAGCTTTCGTGG p[i, h(i )] S M 1 (t )  max  I i ln ht q[h(i )] i 1 l Scan genomic sequences upstream transcription unit transcription unit GTAAAGTTAAGTTCCTTCAAAGCATTCGTGG TTAAAGTTAAGTTCTTTTAAAGCTTTCGTGG p[i, h(i)] S M 2 (t )  max  I i ln ht q[h(i)] i 1 l The scoring functions S M 1....Mz (t )   S Mj j 1 z Orthologous genes • The presence of similar motifs in the regulatory regions of the orthologous genes can increase the prediction accuracy. • They predicted two genes in two genomes to be orthologous to each other if they are a pair of reciprocal best hit in BLASTP searches. Orthologous genes upstream transcription unit Cutoff • The largest score for the genome to include all the binding sites from that genome in the training sets. • P-value – p[S(CU)>sc]<0.01 or 0.05 Analysis Analysis “GTA________TAC” “TA___T” Niche of NtcA in cyanobacteria … ? • Some genes bear NtcA promoters might coordinate photosynthesis and nitrogen fixation. • RNA polymerase σ-factor in cyanobacteria might bear an NtcA promoter and regulated by NtcA. Conclusion • The false positive rate is reduced from 8.2 to 90.9 fold. • Some binding sites might be missed due to the lack of orthologues in the other genomes. • NtcA promoters are found for many genes involved in the various stages of photosynthesis process. Thank You

Related docs
Cyanobacteria
Views: 12  |  Downloads: 3
Genomics
Views: 3  |  Downloads: 1
Comparative Genomics Backgrounder
Views: 2  |  Downloads: 0
basics of genomics
Views: 3  |  Downloads: 0
Genomics and Bioinformatics
Views: 20  |  Downloads: 1
Comparative Analysis
Views: 2  |  Downloads: 0
Other docs by larryp
Hess v Pawloski2
Views: 215  |  Downloads: 5
Genetics and the Population History of Europe
Views: 336  |  Downloads: 4
Chase outline from outlinedepot
Views: 321  |  Downloads: 27
Fisher v Carrousel Motor Hotel Inc
Views: 479  |  Downloads: 4
A Mighty Fortress
Views: 168  |  Downloads: 1
de310
Views: 107  |  Downloads: 1
Review of Analytic Geometry
Views: 790  |  Downloads: 57
Intent
Views: 329  |  Downloads: 1
Ideas from High School Geometry
Views: 1628  |  Downloads: 29
cd110
Views: 124  |  Downloads: 0
Angel Ruble Forrest Products Dyer
Views: 310  |  Downloads: 0
Magnet Geometry Review
Views: 645  |  Downloads: 26
Evidence Master
Views: 400  |  Downloads: 14
Create In Me
Views: 197  |  Downloads: 3
de121
Views: 97  |  Downloads: 0