Your Federal Quarterly Tax Payments are due April 15th Get Help Now >>

Oil bodies in Theobroma cacao seeds - cloning and characterization of by b3t4l1n1

VIEWS: 283 PAGES: 10

									Plant Science 164 (2003) 597 Á/606 www.elsevier.com/locate/plantsci

Oil bodies in Theobroma cacao seeds: cloning and characterization of cDNA encoding the 15.8 and 16.9 kDa oleosins
Martine Guilloteau a, Maryse Laloi b, David Blais a, Dominique Crouzillat a, James Mc Carthy a,*
b a Department of Plant Science, Nestle Research Centre, 101 Avenue Gustave Eiffel, BP9716, 37097 Tours, France ´ Department of Biosciences, Nestle Research Centre, Vers-chez-les-Blancs, PO Box 44, CH-1000 Lausanne 26, Switzerland ´

Received 17 October 2002; received in revised form 27 December 2002; accepted 31 December 2002

Abstract Highly purifed oil bodies have been isolated from mature seeds of Theobroma cacao . Characterization of the proteins by SDSPAGE analysis indicated that the purified oil bodies contain a minimum of seven polypeptides, with a polypeptide of approximately 16.1 kDa being the most abundant. At least five of the oil body proteins were in the size range for oleosin proteins (15 Á/30 kDa). Peptide sequencing showed that the approximately 16.1 kDa polypeptide and an approximately 15.0 kDa polypeptide were in fact oleosins, and indicated that an approximately 26.5 kDa polypeptide was probably a caleosin. cDNA encoding the 16.1 kDa polypeptide (TcOleo 16.9) and the 15.0 kDa polypeptide (TcOleo 15.8) were isolated and characterized. Analysis of the protein sequences encoded by these two cDNA indicate that they belong to two different classes of oleosin proteins. Northern blots showed that TcOleo 16.9 and TcOleo 15.8 have relatively similar expression patterns during seed development, although the overall expression of TcOleo 16.9 was significantly higher than that of TcOleo 15.8, in agreement with the observation that the 16.1 kDa polypeptide is more abundant than the 15.0 polypeptide in purified seed oil bodies. The expression of both genes was also induced briefly in the cotyledons during germination. Southern blot analysis showed that TcOleo 16.9 and TcOleo 15.8 were probably single copy genes in the cacao genome. Because the data presented here shows that the oil bodies of T. cacao seeds contain oleosin proteins, it is unlikely that the ‘recalcitrant’ nature of these seeds is due to the absence of oleosin proteins in cacao seed oil bodies as previously proposed. # 2003 Elsevier Science Ireland Ltd. All rights reserved.
Keywords: Oleosin; Caloleosin; Oil bodies; Theobroma cacao ; Recalcitrant seeds

1. Introduction Significant quantities of triacylglycerols (TAGs) are synthesized and stored during seed development. These stored lipids are mainly destined to be used as food reserves during seed germination, and the level of seed oil depends on the energy storage mechanism used by the particular seed. Most of the stored lipid is partitioned in intracellular oil particles called ‘oil bodies’ and

The nucleotide sequences reported in this paper have been submitted to GenBank under accession numbers: TcOleo15.8, AF466103; TcOleo 16.9, AF466102. * Corresponding author. Tel.: '/33-2-4762-8383; fax: '/33-2-47491414. E-mail address: james.mccarthy@rdto.nestle.com (J. Mc Carthy).



in seeds with high lipid content, oil bodies constitute an important percentage of the seed content [1,2]. A small number of other specialized cells also contain significant levels of lipid containing particles. For example, the tapetum, a structure involved in the development of pollen, also has specific oil body-like lipid particles called the ‘tapetosomes’. These oil body-like particles are involved in providing the functional components required for microspore and pollen development [3,4]. Oil bodies of seeds are in the range of 0.5 and 2 mM in diameter [5], and consist of a matrix of TAGs covered by a layer of phospholipids which is embedded by a set of proteins called ‘oleosins’ [1,2]. The function of the oleosin proteins is to maintain the oil reserves of seeds, and other plant cells, in small stable droplets that have a high surface to volume ratio. This large surface area is

0168-9452/03/$ - see front matter # 2003 Elsevier Science Ireland Ltd. All rights reserved. doi:10.1016/S0168-9452(03)00011-6

598

M. Guilloteau et al. / Plant Science 164 (2003) 597 Á/606

believed to facilitate the rapid conversion of the TAGs into free fatty acids via lipase mediated hydrolysis at the oil body surface [2]. Seeds containing a high level of lipids generally have significant amounts of oleosin proteins, with estimates for the oleosin content of oil seeds being as high as 2 Á/8% of total seed protein [2,6]. Oleosin proteins are small alkaline proteins (15 Á/26 kDa) that are characterized by an unusually long (/70 amino acids), highly conserved, central hydrophobic region containing a proline knot motif. The bulk of this hydrophobic region has been proposed to reside in the TAG matrix and this arrangement functions to anchor the oleosin proteins in the oily central matrix [2]. The Nterminal region of oleosin proteins are relatively diverse in sequence and length, while the C-terminal regions have an amphipathic alpha helical stretch [2]. More recently, another oleosin like protein called caleosin has also been shown to be a minor component of seed oil bodies [7,8]. This calcium binding protein also has a central hydrophobic region with a proline knot motif and hydrophilic N-terminal and C-terminal regions. The presence a calcium binding site, plus the presence of several potential phosphorylation sites, has led to the suggestion that this protein is involved in the control of oil body formation and/or degradation [7,8]. It has recently been found that ‘recalcitrant’ seeds (seeds which cannot be stored at ambient temperature), such as those of Theobroma cacao , appear to have little or no oleosin proteins in the oil bodies isolated from these seeds [6]. Using scanning electron microscopy, these workers showed that the oil bodies present in T. cacao were stable during drying, but that upon imbibition of the artificially dried seeds, they found that the oil bodies became fused concomitant with a loss of cellular integrity. From these observations, Le Prince et al. [6] proposed that the oil body fusion upon imbibition was caused by the absence of oleosin proteins to stabilize the oil bodies, and suggested that this feature of T. cacao seeds contributes significantly to their ‘recalcitrant’ properties. Due to our interests in the lipids of T. cacao seeds and abundant cacao seed proteins which are rich in hydrophobic amino acids (such as oleosins), we have carried out an investigation of oil storage bodies of T. cacao . Here, we describe the isolation of T. cacao seed oil bodies and the characterization of several of the proteins present in these particles. We show that the urea washed oil bodies contain at least six polypeptides in the range of 15 Á/30 kDa and peptide sequence data for three of these polypeptides (approximately 15.0, 16.1, and 26.5 kDa, respectively) demonstrate they represent two oleosins and a caleosin. We also describe the isolation and characterization of cDNA clones encoding the 15.0 and 16.1 kDa oleosins.

2. Methods The cacao seeds used were from immature or ripe pods of EET-95 grown in the green house at Tours or from an experimental farm in Quevedo, Equador (exNestle R&D Center, Quito; see [9] for details). The ´ mRNA used for the cDNA library construction was isolated from seeds of an immature mostly green pod of Tenguel 33-3 grown in the green house at Tours under open pollination conditions. For the germination experiment, fresh seeds were washed with water and germinated on vermiculite. Cotyledons were harvested after 2, 4, 7, 10, 15 and 49 days after imbibition. 2.1. Isolation of cacao seed oil bodies The procedure used was a modified version of a previously described oil body isolation protocol [10]. Briefly, eight mature and ungerminated Tenguel 33-3 seeds were taken from greenhouse grown pods and their testa and radical were removed. The remaining seed material (approximately 6 Á/7 g) was then chopped into small pieces and immediately put into 60 ml of grind buffer on ice (grind buffer: 0.1 M potassium phosphate buffer pH 7.2, 25 mM beta mercaptoethanol, 10 mM ascorbic acid, 0.3 M sucrose). This mixture was homogenized for 45 s on ice, and then quickly filtered through a 500 mM mesh screen at 4 8C. The material remaining on the screen was washed twice with 20 ml of grind buffer. The filtrate was centrifuged at 20 000 )/g for 20 min at 10 8C. After centrifugation, the top 30Á/40% of the tube containing all the ‘floating material’ (oil bodies) was recovered and added to fresh grind buffer. This material was resuspended by homogenization in a total volume of approximately 30 ml to produce the ‘crude preparation’, which was then centrifuged as above. The top layer was again harvested and placed into a new tube containing urea wash buffer (50 mM Tris Á/HCl pH 7.2, 9 M urea, 10 mM beta mercatoethanol) followed by homogenization and centrifugation as in the previous wash steps. The partially urea washed ‘floating’ material was then recovered and transferred to a new tube containing urea wash buffer and was again resuspended by homogenization. This, and the later steps, were all done at room temperature unless noted otherwise. The homogenized material was shaken at high speed for 5 min, then centrifuged for 20 min at 20 000 )/g at 20 8C. After the centrifugation step, the relatively clear solution was removed from the corex tube with minimal loss of floating material and fresh urea wash solution added to the same tube. The floating material was again homogenized, shaken strongly for 15 min, and then centrifuged for 20 min at 20 000 )/g at 20 8C (called the ‘first’ 100% urea wash). This wash step with 100% urea wash buffer was repeated three times.

M. Guilloteau et al. / Plant Science 164 (2003) 597 Á/606

599

Following the last wash, the floating material that remained in the tubes after removing the clear urea wash buffer was resuspended by homogenization in 10 ml of urea wash buffer plus 0.025% triton X-100 and then aliquoted into 2 ml microcentrifuge tubes. These tubes were spun at 10 000)/g for 10 min and the solution below the ‘floating’ oil bodies was removed. To eliminate the fat from the oil body preparation, 1 ml of acetone was added to each microcentrifuge tube. This mixture was vortexed vigorously and then sonicated 2Á/4 min at room temperature. The tubes were subsequently spun at room temperature for 5 min at 10 000 )/g . The supernatants were removed and the acetone extraction procedure was repeated 4 times. Finally, the protein pellets recovered were dried under vacuum in a speedvac. 2.2. Isolation and analysis of oil body proteins by SDSPAGE and peptide sequence analysis SDS-PAGE gel loading buffer (62.5 mM Tris Á/HCl pH 6.8, 12.5% glycerol, 2% SDS, 715 mM betamercaptoethanol, 0.025% bromophenol blue) was added to two microcentrifuge tubes of acetone extracted oil bodies prepared as described above. This material was heated to 50 8C, sonicated 2 )/5 min, vortexed, and then centrifuged. The two supernatants were combined and then run on a freshly prepared 20 cm 15% SDS-PAGE gel. After migration, the gel was fixed 2 )/20 min in 50% methanol, 10% acetic acid, and water. The gel was stained over night with a solution of 45% methanol, 10% acetic acid, and water with 3 mg amido black per 100 ml. Subsequently, the gel was rinsed with Milli Q water several times, and bands in the size range of oleosins were cut out and partially dried. The gel slice was later incubated with 200 ml Tris Á/HCl 0.05 M pH 8.6, 0.01% Tween 20 and 0.2 mg sequencing grade trypsin for 18 h at 30 8C. The peptides obtained were separated on a DEAE-C18 HPLC column using a gradient of acetonitrile/TFA 0.1%. One large peptide peak for each polypeptide of interest was chosen for N-terminal sequence analysis. 2.3. Preparation of Cacao seed mRNA for library construction The seeds to be used for the RNA isolation were taken from an immature pod (just beginning to change from green to yellow) grown in the greenhouse at Tours. The matrix surrounding these seeds was solid and the seeds displayed two very distinct developmental stages (the more mature group was purple, while the other group was partially light pink and partially white). For RNA isolation, approximately 100 mg was taken from three of the more mature seeds and from two of the less mature seeds and immediately frozen in liquid nitrogen.

This material was then ground to a powder using a mortar and pestle in the presence of liquid nitrogen. The liquid nitrogen and cacao powder was put in a 50 ml falcon tube and the liquid nitrogen was allowed to evaporate. As the powder warmed towards 0 8C, 28 ml solution A was added (14 ml 100 mM Tris Á/HCl pH 8'/ 14 ml Aqua phenol {Appligene/Oncor}'/0.1% hydroxyquinoline'/140 ml 10% SDS, '/110 ml betamercaptoethanol). This mixture was homogenized on ice and the resulting solution was spun 10 min at 5000)/g . The aqueous phase was recovered and mixed by shaking with 7 ml phenol'/7 ml chloroform/isoamyl alcohol (Ready Red, Appligene/Oncor). The mixture was then spun at 5000 )/g for 10 min. The aqueous phase recovered was re-extracted twice more with 14 ml chloroform/isoamyl alcohol. The final aqueous phase obtained was made 0.3 M Na acetate and 2 volumes of ETOH was added to precipitate the nucleic acid. The nucleic acid pellet recovered after centrifugation was resuspended in 10 ml of 100 mM Tris Á/HCl pH 8 and then the RNA was precipitated using 3 ml of 8 M lithium chloride (2 M final) followed by 2 volumes of ethanol and the RNA was precipitated for 1 h at (/ 20 8C followed by 15 min at (/80 8C. The nucleic acid precipitate was recovered by centrifugation at 5000 )/g for 30 min. This pellet was resuspended in 600 ml RNase free H2O and aliquoted into small samples and frozen at (/80 8C. The purity of the isolated RNA was verified by spectral analysis between 220 and 300 nm and its integrity was demonstrated by running a sample on a denaturing RNA gel. 2.4. Preparation and screening of cDNA library from Cacao seed mRNA Poly A'/ RNA was prepared from the total cacao seed RNA described above using the Oligotex kit from Qiagen. The synthesis of cDNA from the poly A'/ mRNA was carried out using the SMART PCR cDNA synthesis kit from Clontech according to the kit instructions. For the first strand cDNA synthesis step, 4 ml (20 Á/40 ng) of poly A'/ mRNA and 200 U of Gibco BRL Superscript II MMLV reverse transcriptase were used. The PCR amplified cDNA produced was blunt end ligated into the PCR-Script Amp SK('/) cloning vector (Stratagene) after cDNA polishing with pfu DNA polymerase. The ligated DNA was finally transformed into Stratagene Ultracompetent cells XL-2 Blue cells as described in the instruction manual for these cells. The plasmid library was screened with two degenerate oligonucleotides cotol1 dCCIYTITTYGTIATITTY and cacol1 dITAICCIGCCATITCITGCAT. The PCR used Taq polymerase, and the amplification conditions were 94 8C 2 min., 35 cycles of 94 8C 1 min, 52 8C 1 min, 72 8C 1 min, and a final cycle of 94 8C 1 min, 52 8C 1 min, 72 8C 7 min.

600

M. Guilloteau et al. / Plant Science 164 (2003) 597 Á/606

2.5. Northern blot analysis Total RNA for this experiment was prepared in a similar fashion to that described above except that the pods were from Equador and the RNA produced was further purified using the Rneasy Mini kit from Qiagen† . Total RNA samples were separated on a 1.5% agarose gel containing 6% formaldehyde and MOPS buffer under standard conditions. After electrophoresis, the RNA were blotted onto nylon membranes (Appligene) and hybridized with 32P-labeled TcOleo15-8 or TcOleo16-9 probes. The blots were hybridized overnight with labelled probe at 65 8C in 250 mM Naphosphate buffer pH 7.2, 6.6% SDS, 1 mM EDTA and 1% BSA and the blots were then washed three times at 65 8C for 30 min in 2)/SSC'/0.1% SDS, 1 )/SSC'/ 0.1% SDS, and in 0.5 )/SSC'/0.1% SDS, respectively. Alternatively, the blots were hybridized over-night with labelled probe at 65 8C in 5% w/v SDS, 5)/SSC, 5 )/ Denhardt’s solution, 40 mg/ml of heterologous DNA, and the blots were then washed three times at 65 8C for 30 min in 2 )/SSC'/0.1% SDS, 1 )/SSC, '/0.1% SDS, and 0.2 )/SSC'/0.1% SDS, respectively. Probes were prepared either by PCR amplification using the Advantage 2 polymerase mix (Clontech, USA) and the following primers: TcOleo15-8, (5?GGCAACCGTCTTCCATTTTC) and (5?-GAAACGAGATTTTCGAAGCC), or TcOleo 16-9, (5?CGGGGACCTCTCTTTCTCTC), and (5?-AGAGGTTCAAAGCTGAAGGG), or by PCR amplification of the complete inserts from the appropriate cDNA clones using the reverse and forward M13 primers. In each case, the amplified fragments were labeled by the random priming procedure (redi primeTM II, Amersham Pharmacia Biotech).

3. Results Oil bodies were isolated from mature cacao seeds using the technique of Millichip et al. [10]. Fig. 1 shows a silver stained SDS-PAGE gel of the different fractions produced during the purification procedure. The protein profile of the final acetone extracted oil body preparation (lanes 7 and 8) shows that the purified cacao seed oil bodies contain at least seven major polypeptides. Two of the bands seen in Fig. 1 (lane 7) correspond to proteins larger than 31 kDa, exhibiting molecular weights of approximately 100 and 40.5 kDa, respectively. The remaining five are between 31 and 15.0 kDa. The most abundant polypeptide of this size range was the approximately 16.1 kDa polypeptide, with the others being present in substantially lower amounts. Three of the polypeptides in this latter region, with approximate mobilities of 26.5, 16.1, and 15.0 kDa, respectively, were cut out of an SDS-PAGE gel and trypsin digested. The peptides generated were separated by HPLC and one HPLC purified peptide of each polypeptide was chosen for N-terminal sequence analysis. The peptide sequence obtained from an internal peptide of the 26.5 kDa polypeptide is shown in Fig. 2. This peptide exhibits strong homology with an internal peptide sequence found in an oil body protein from sesame seed (Sesamum indicum L.) which contains a calcium binding site and has been named caleosin [7]. The peptide sequence from the 26.5 kDa oil body polypeptide also shows a strong homology with other putative Ca2' binding proteins from several other plants (Fig. 2). The N-terminal sequence obtained for the internal peptide sequence of the approximately 16.1 kDa polypeptide was MQDMVGYVGQK. Apart from a valinealanine change, this peptide sequence was identical to a sequence found in the 16.4 kDa oleosin of Gossypium hirsutum (accession number P29528), demonstrating that this cacao oil body protein was likely to be an oleosin protein. The N-terminal sequence of an internal peptide sequence of the 15.0 kDa polypeptide produced the sequence KHPPGADQ which is identical to an internal peptide sequence of the polypeptide encoded by a 15.2 oleosin cDNA from Sesamum indicum (accession number AF091840). Two other minor polypeptides were seen between 31 and 15.0 kDa. One, at approximately 30 kDa, appears rather smeared, and on other gels appeared to consist of two different polypeptides. The remaining polypeptide had an approximate molecular weight of approximately 18.4 kDa. In fact when high levels of protein were loaded (Fig. 1, lane 8), a weak smeared band at approximately 19.0 kDa was also seen. These latter oil body associated polypeptides were not analysed further due to their low quantities. To obtain a cDNA encoding the approximately 16.1 kDa putative cacao seed oleosin discussed above, a cDNA library was generated using mRNA isolated from

2.6. Southern blot analysis Total genomic DNA was extracted from green fresh mature T. cacao leaves of the varieties EET-95 (National x Venezolano amarello), BCH6 (National), UF168 (Trinitario), GU 275 (Forestero) following the method of Crouzillat et al. [11]. Five micrograms of DNA were digested overnight with Kpn I, Hinc II, Pvu II, and Rsa I (10 U/mg) according to the supplier’s recommendations and the products were separated on 0.8% agarose gels. Southern blotting and hybridizations were carried out as described previously [11]. The probes were prepared by PCR amplifying the inserts of the appropriate cDNA clones using the forward and reverse M13 primers. The amplified DNA was then labelled with 32P using redi primeTM II kit (Amersham Pharmacia Biotech).

M. Guilloteau et al. / Plant Science 164 (2003) 597 Á/606

601

Fig. 1. SDS PAGE gel analysis of fractions obtained during the purification of T. cacao oil bodies. Aliquots taken at different stages of the oil body purification procedure were loaded on a 10 Á/20% SDS-PAGE gel and silver stained. Lanes: 1, crude preparation; 2, floating material after first spin; 3, floating material after partial urea buffer wash; 4, floating material after first 100% urea wash; 5 and 6, floating material from two subsequent urea washes; 7 and 8, protein recovered from the purified oil bodies after acetone extraction. For lanes 1 Á/6, 0.5, 0.5, 3.3, 7.5, 15 and 15 ml of the appropriate fractions were loaded on the gel respectively. For lanes 7 and 8, 4 and 16 ml of an aliquot containing the final acetone extracted protein preparation diluted in SDS gel loading buffer were added respectively. TI, trypsin inhibitor protein.

Fig. 2. Sequence alignment of an internal peptide sequence from the 26.5 kDa oil body polypeptide of T. cacao with four other homologous data bank caleosin, or putative caleosin sequences. Darkly shaded boxes are residues identical to the T. cacao peptide, lightly shaded boxes are residues which have conservative changes. The numbers to the right represent the position of the peptides in their respective polypeptide sequences. The accession numbers of the data bank sequences are: Arabidopsis thaliana , BAB16823; Oryza sativa , T03731; Sesamum indicum , AAF13743 (caleosin); and Glycine max , AF004809.

seeds of an immature pod and this library was screened by PCR (see Section 2). For the screening step, several degenerate primers were designed using the cotton 16.4 kDa oleosin protein sequence and the peptide sequence obtained from the T. cacao 16.1 kDa oil body protein. One set of these degenerate primers (cotol1/cacol1) was found to specifically amplify a fragment of the expected size (300 Á/400 bp) from the cacao seed cDNA. Screening of the immature cacao seed cDNA library using this degenerate primer pair indicated that the cacao oleosin cDNA clone was highly represented in this library, and resulted in the isolation of three clones for further screening. Two of these clones had inserts of approximately 0.850 Á/0.950 kb and one clone had an insert of

approximately 1 Á/1.1 kb. DNA sequencing of the longest clone, 1cdtc-42 showed that it contained a cDNA insert of 903 base pairs. The open reading frame of the insert was 483 nucleotides and encoded a polypeptide of 160 amino acids with a predicted molecular weight of 16 885 Da. This polypeptide sequence was found to contain an exact match to the internal peptide sequence obtained from the approximately 16.1 kDa cacao oil body protein, demonstrating that the cDNA clone 1cdtc-42 encodes the oil body protein migrating with an apparent molecular weight of 16.1 kDa. This clone was renamed TcOleo 16.9. A Blast analysis indicated that the protein sequence of TcOleo 16.9 had the highest sequence identity (75%) with the 16.4 kDa cotton oleosin cDNA and slightly lower identities (62 Á/57% identity) with several other oleosin proteins (Fig. 3). This observation confirms that the TcOleo 16.9 cDNA encodes an oleosin protein. Like other oleosin sequences, the amino acid sequence of the 16.9 kDa cacao oleosin exhibits a very long central hydrophobic domain surrounded by hydrophilic Nterminal and C-terminal regions (Fig. 4A) and the polypeptide is very basic, with a isoelectric point of 9.73. Sequencing other cDNA clones from the seed cDNA library led to the discovery of another cDNA clone (1cdtc-14) harboring an oleosin like sequence. This cDNA clone contained an insert sequence of 742 base pairs encoding an open reading frame of 147 amino

602

M. Guilloteau et al. / Plant Science 164 (2003) 597 Á/606

Fig. 3. Optimized amino acid sequence alignment of 16.9 kDa cacao oil body protein with oleosin sequences from various plant species. Identical amino acids are shown in black and conserved substitutions are shaded. The Genbank accession numbers are: Arabidopsis thaliana , AY057590; Perilla frutescens , AF311746, Sesamum indicum , AF302807; and Gossypium hirsutum , P29528.

acids and a calculated molecular weight of 15 803 Da. The amino acid sequence of this clone was found to contain an exact match to the internal peptide sequence obtained from the 15.0 kDa cacao oil body protein, demonstrating that the cDNA clone 1cdtc-14 encodes the cacao oil body protein migrating with an apparent molecular weight of 15.0 kDa and the clone was renamed TcOleo 15.8. The amino acid sequence encoded by TcOleo 15.8 showed 43.9% sequence identity with the coding sequence of 16.9 kDa cacao oleosin cDNA clone. A Blast analysis of the protein sequence encoded by TcOleo 15.8 indicated that it was most similar (58%

identity) to the protein encoded by the 15.2 kDa oleosin cDNA from Sesamum indicum (Fig. 5). Like the 16.9 kDa cacao protein sequence, the 15.8 kDa sequence also has a very long central hydrophobic domain surrounded by hydrophilic N-terminal and C-terminal regions (Fig. 4B), and it is a very basic protein with an isoelectric point of 9.34, indicating it is another oleosin protein. In order to determine the developmental expression of the two characterized oleosin cDNA sequences during cacao seed development, RNA was extracted from EET95 seeds at four different times during seed development and analyzed by Northern blotting. Fig. 6A shows that

Fig. 4. Hydrophobicity profiles of the 16.9 kDa (A) and 15.8 kDa (B) cacao oil body proteins. The hydropathy analysis was performed according to the method of Kyte and Doolittle (1982) using the Lasergene software (DNASTAR). Positive values indicate hydrophobic regions.

M. Guilloteau et al. / Plant Science 164 (2003) 597 Á/606

603

Fig. 5. Optimal amino acid sequence alignment of the 15.8 kDa cacao oil body protein with oleosin sequences from various plant species. Identical amino acids are shown in black and conserved substitutions are shaded. The Genbank accession numbers are: Brassica napus , P29109; Sesamum indicum , AF091840; and Prunus dulcis , X78118.

Fig. 6. Northern blot analysis of the expression of the 15.8 kDa (Panel A) and 16.9 kDa (Panel B) cacao oleosin transcripts during cacao seed development. The lower section of each panel is the ethidium bromide stained gel showing the equivalent loading of the lanes.

the 15.8 kDa oleosin cDNA hybridizes to an mRNA of approximately 890 bp. This mRNA is weakly expressed at 104 days, and is strongly expressed at days 125 and 146. By seed maturity, which was 160 days for the variety EET-95, the expression of the 15.8 kDa transcript had fallen to a relatively low level. A similar pattern of developmental expression was seen for another cacao variety (ICS-95; data not shown). Another blot was prepared with the same RNA and hybridized with the 16.9 kDa oleosin cDNA. This experiment showed that the 16.9 kDa probe hybridizes to an mRNA of approximately 900 bp and that the expression patterns of this mRNA is relatively similar to that demonstrated for the 15.8 kDa cacao oleosin mRNA (Fig. 6B). However, one difference was noted between the expression patterns of these two genes during seed maturation; the hybridization signal for TcOleo 16.9 was much higher than that for TcOleo 15.8, suggesting that the latter gene has a significantly higher transcript level. Unfortunately, it has not been possible to determine the expression of these two oleosin genes in other tissues such as leaves and roots by northern blotting, because, to date, we have not been able to

produce RNA samples of sufficient qualities from these tissues. We also examined the expression of the 15.8 and 16.9 kDa oleosin genes in the cotyledons during germination. The data obtained (Fig. 7) demonstrates that the expression of both oleosin genes is induced at 7 days post imbibition. However, an increase in the levels of TcOleo 15.8 transcripts was also detected at day 4 suggesting that this gene may be induced slightly earlier than the 16.9 kDa gene. In contrast to the observation that very different levels of mRNA accumulate for these two genes during seed development, the mRNA for both genes appear to accumulate at relatively similar levels when induced in the cotyledons during germination. To examine the genomic organization and copy number of the two cacao oleosin genes, a Southern blotting experiment was carried out. The southern blot data indicates that both genes are single copy genes and because the sizes of the fragments obtained are similar to those expected from the cDNA sequence, both genes are unlikely to contain an intron (Fig. 8). To confirm the absence of an intron in the genes, genomic clones of each gene were obtained by PCR. DNA sequencing of the PCR amplified genomic sequences showed a one base difference in the 3’ untranslated region of the 15.8 kDa genomic clone and a one base difference in the 5? untranslated region of the 16.9 kDa genomic clone (D. Blais, unpublished results) indicating these genes do not contain any introns. Finally, the discovery of a restriction fragment length polymorphism (RFLP) associated with the single 16.9 kDa oleosin gene (Fig. 8) allowed the position of this gene to be mapped. However, with the probe used, and the four enzymes tested, no RFLP was found for the 15.8 kDa oleosin gene, and therefore its map position remains to be determined.

4. Discussion The work presented here describes the isolation of oil bodies from mature seeds of T. cacao using the urea

604

M. Guilloteau et al. / Plant Science 164 (2003) 597 Á/606

Fig. 7. Northern blot analysis of the 15.8 kDa (Panel A) and 16.9 kDa (Panel B) cacao oleosin transcripts in the cotyledons during cacao seed germination. Fresh cacao seeds were germinated and RNA was prepared from the cotyledons as described in Section 2. The lower section of each panel is the ethidium bromide stained gel showing the equivalent loading of the lanes. M, mature seed, 2, 4, 7 and 10 days after imbibition.

Fig. 8. Southern blot analysis of the 15.8 kDa (Panel A) and 16.9 kDa (Panel B) cacao oleosin genes. The DNA in each lane were: 1, EET 95; 2, BCH 6; 3, UF168; and 4, GU 275. The genomic DNA was isolated and digested as described in Section 2. The additional bands seen in lanes 2 and 4 using the 16.9 kDa oleosin probe, 3.2 kb for the Hinc II digestion and 2.2 kb for the Pvu II digest corresponded to RFLPs that were utilized to map this gene.

wash procedure of Millichip et al. [10]. At least seven polypeptides remained after the urea treatment, indicating their strong association with the oil body particles. Five of these bands represent polypeptides with sizes ranging from 15 to 30 kDa. Internal peptide sequence data from the approximately 16.1 and 15.0 kDa polypeptides indicated that both polypeptides were oleosins. In addition, internal peptide sequence data from the approximately 26.5 kDa polypeptide was nearly identical to an internal sequence present in the caleosins [7,8]. Based on this peptide sequence data, plus the size and location of this polypeptide, it is proposed that the 26.5 kDa cacao oil body protein is a cacao caleosin. The remaining distinct bands in the 15 Á/30 kDa range include one polypeptide with an approximate molecular weight of 18.4 kDa and a diffuse band at approximately 30 kDa (which appeared as a doublet on higher resolution gels). No peptide sequence information was generated for these latter polypeptides, and thus their identity remains to be determined. Interesting, Chen et al. [7] also found two minor polypeptides around 30 kDa in purified oil bodies of sesame, and supports the

data presented here indicating that several minor oil body polypeptides remain to be identified in the 15Á/30 kDa range. The identities of the two distinct large oil body polypeptides with molecular weights of approximately 40.5 and 100 kDa are not yet known. However, a minor oil body protein with a predicted molecular weight of 39.57 kDa, called steroleosin, has recently been characterized from sesame seed [12]. The steroleosin protein has a short N-terminal anchoring hydrophobic domain and a large soluble domain with a sterol dehydrogenase activity, and it appears to be a core component of plant seed oil bodies because proteins of a similar size have been detected in isolated oil bodies from several other plant seeds with a steroleosin specific antibody [12]. Therefore, it is possible that the cacao oil body polypeptide at approximately 40.5 kDa is a steroleosin. Future protein sequencing of the 40.5 kDa polypeptide, and also the larger approximately 100 kDa polypeptide, should help clarify the identities of the two large molecular weight oil body proteins. Two cDNA clones encoding the oleosin polypeptides of approximately 15.0 and 16.1 kDa, and called TcOleo 15.8 and TcOleo 16.9, respectively, were isolated from an immature seed cDNA library. The oil bodies of angiosperms have previously been found to contain two immunologically distinct groups of oleosins, which have been classified as high and low molecular weight isoforms according to their different molecular weights [13]. For example, in rice seed oil bodies, 16 and 18 kDa oleosins are found in relatively similar amounts, and their corresponding RNAs are expressed with the same pattern, and to similar levels, in developing rice seeds [14]. This group also demonstrated by immunofluorescence microscopy that the two rice oleosins are colocalized on the surface of individual oil bodies, indicating that they function together to form the surface of the oil body [15]. Interestingly, although there is some variation in the sizes of the two main oleosins in different seeds, for several well-characterized seed oil bodies, the main high and low molecular weight oleosins differ in size by 2 kDa. For example, as

M. Guilloteau et al. / Plant Science 164 (2003) 597 Á/606

605

discussed above, rice has 16 and 18 kDa oleosins [14], sesame has 15 and 17 kDa oleosins [16], arabidopsis has 19 and 21 kDa oleosins [17], and maize has a 16 kDa oleosin plus a pair of oleosins at 17 and 18 kDa [18]. It is also noted that the levels of the high and low molecular weight oleosins is relatively similar in the oil bodies isolated from these organisms. The results presented here show that T. cacao oil bodies also contain high and low molecular weight oleosins by sequence homology with other oleosins (Figs. 3 and 5), but they differ in size by only approximately 1 kDa. Furthermore, in contrast to the oleosins of the plant seeds described above, the high molecular weight cacao oleosin, TcOleo 16.9, is expressed at a significantly higher level than the low molecular weight oleosin TcOleo 15.8. During germination, however, both genes were found to be briefly induced at more similar levels in the cotyledons between day 4 and day 7 after imbibition. This short induction of oleosin expression suggests that there may be a short burst of oil synthesis in the cotyledon tissue during the early stages of germination. Alternatively, the brief increase in the level of oleosin transcripts seen during germination may be involved in the production of new oleosin proteins for the structural maintenance of preexisting oil bodies [16]. The hydrophobicity plots of TcOleo 16.9 and TcOleo 15.8 shows they both exhibit typical characteristics of oleosin proteins, that is, they have hydrophilic Nterminal and C-terminal regions and one very long hydrophobic central region, which is 74 amino acids for TcOleo 16.9 and 67 amino acids for TcOleo 15.8. The hydrophobicity patterns are relatively similar for the two polypeptides except for a slight difference in the hydrophobicity pattern around the junction between the two N-terminal hydrophilic regions and the central core hydrophobic regions. Whether there is any functional significance associated with this difference is not currently known. Both sequences also contain the conserved proline knot motif found in many oleosin sequences (Fig. 9). The proline knot motif is apparently required for oil body targeting, possibly by a direct involvement in the ER-oil body transition, but is not required for endoplasmic reticulum (ER) membrane integration [19]. More recently, it has been proposed that the primary role of the very long hydrophobic

Fig. 9. Sequence conservation of the proline knot region within the two classes of oleosin. Regions in grey denote conservative amino acid substitutions. Amino acids above and below the sequences denote amino acid differences in other oleosins of the same class from Figs. 3 and 5.

domains of oleosins is to specifically localize these proteins in a membrane environment [20]. Cacao seeds are among a group of seeds termed ‘recalcitrant’ [21]. Recalcitrant seeds cannot be stored because they lose viability rapidly when kept under routine seed storage conditions. Although a precise explanation for the recalcitrant nature of cacao seeds is not currently available, this property is presumably partially due to the fact that these seeds do not undergo a significant dehydration step at the end of maturation. Recently, it has been reported that cacao seeds do not have significant levels of oleosins, although they do contain significant levels of oil in the form of small intracellular droplets [6]. These workers noted that the oil droplets in cacao seeds were relatively stable during partial seed drying, but that the droplets began to fuse when water was re-added to these artificially dried seeds, suggesting that a massive loss in cellular integrity and cell death was induced when water was re-added to the dried seeds. These observations led to the proposal that the oil droplet fusion and cell destruction detected during the hydration of the artificially dried seeds was due to the absence of oleosins in the cacao seeds. Therefore, they proposed that the absence of oleosins contributes significantly to the recalcitrant nature of cacao seeds [6]. Importantly, the results presented here demonstrate that cacao seed oil bodies contain oleosins, and thus, the recalcitrant nature of cacao seeds is not due to an absence of oleosins. However, our current data can not completely rule out the possibility that cacao seeds may have a lower level of oleosins than other oil seeds, thereby causing cacao seeds to be recalcitrant. However, two observations argue against this possibility. First, the data in Fig. 1 (lane 1) shows that bands with identical mobilities to the purified 15.8 and 16.9 oleosins (15.0 and 16.1 kDa, respectively) are detected in the cacao seed crude extract, suggesting that these oleosin proteins are moderately abundant cacao seed proteins. Second, the fact that oleosin containing oil bodies can actually be purified from cacao seeds using the 9 M urea wash conditions suggests that these oil bodies contain a ratio of oleosin protein/oil that is sufficient to maintain the oil body structure during the repeated harsh urea washes. The only potentially unusual feature of the cacao oleosins we have found to date is that the ratio of high to low molecular weight cacao oleosins (15.8 and 16.9 kDa oleosins) is different to that seen for oil bodies from several other oils seeds as discussed earlier. However, rape seeds also have unequal amounts of high and low oleosin proteins [16], making it is less likely that the unequal levels of the two cacao oleosins contribute markedly to the recalcitrant nature of these seeds. It is interesting to note that cacao seeds have an unusually high level of an aspartic proteinase in the mature seed [22,23]. Because it is known that the cacao seed aspartic protease causes massive degradation

606

M. Guilloteau et al. / Plant Science 164 (2003) 597 Á/606 developing cotyleydons of sunflower (Helianthus annuus L.), Biochem. J. 314 (1996) 333 Á/337. D. Crouzillat, E. Lerceteau, V. Petiard, J. Morera, H. Rodriguez, D. Walker, W. Phillips, C. Ronning, R. Schnell, J. Osei, P. Fritz, Theobroma cacao L.: a genetic linkage map and quantitative trait loci analysis, Theor. Appl. Genet. 93 (1996) 205 Á/214. L.-J. Lin, S.S.K. Tai, C.-C. Peng, J.T.C. Tzen, Steroleosin, a sterol binding dehydrogenase in seed oil bodies, Plant Physiol. 128 (2002) 1200 Á/1211. J.T.C. Tzen, Y.K. Lai, K.L. Chan, A.H.C. Huang, Oleosin isoforms of high and low molecular weights are present in the oil bodies of diverse seed species, Plant Physiol. 94 (1994) 1282 Á/ 1289. L.S.H. Wu, L.D. Wang, P.W. Chen, L.J. Chen, J.T.C. Tzen, Genomic cloning of 18 kDa oleosin and detection of triacylglycerols and oleosin isoforms in maturing rice and post-germinative seedlings, J. Biochem. 123 (1998) 386 Á/391. J.T.C. Tzen, R.L.C. Chuang, J.C.F. Chen, L.S.H. Wu, Coexistance of both oleosin isoforms on the surface of seed oil bodies and their individual stabilization to the organelles, J. Biochem. 123 (1998) 318 Á/323. J.T.C. Tzen, C.-C. Peng, D.-J. Cheng, E.C.F. Chen, J.M.H. Chiu, A new method for seed oil body purification and examination of oil body integrity following germination, J. Biochem. 121 (1997) 762 Á/768. G.J.H. van Rooijen, L.I. Terning, M.M. Moloney, Nucleotide sequence of an Arabidopsis thaliana oleosin gene, Plant Mol. Biol. 18 (1992) 1177 Á/1179. J.T.L. Ting, K. Lee, C. Ratnayake, K.A. Platt, R.A. Balsamo, A.H.C. Huang, Oleosin genes in maize kernals having diverse oil contents are constitutively expressed independent of oil contents, Planta 199 (1996) 158 Á/165. B.M. Abell, L.A. Holbrook, M. Abenes, D.J. Murphy, M.J. Hills, M.M. Moloney, Pole of proline knot motif in oleosin endoplasmic reticulum topology and oil body targeting, Plant Cell 9 (1997) 1481 Á/1493. B.M. Abell, S. High, M.M. Moloney, Membrane protein topology of oleosin is constrained by its long hydrophobic domain, J. Biol. Chem. 277 (2001) 8602 Á/8610. E.H. Roberts, R.H. Ellis, Water and seed survival, Ann. Bot. 63 (1989) 39 Á/52. B. Biehl, J. Voigt, G. Voigt, H. Heinrichs, V. Senyuk, G. Bytof, pH dependent enzymatic formation of oligopeptides and amino acids, the aroma precursors in raw cocoa beans. In: J. Lafforest (Ed.), XIth International Cocoa Research Conference, Cocoa Producers’ Alliance, Yamassoukro, Ivory Coast, 1993, pp. 717 Á/ 722. M. Laloi, J. Mc Carthy, O. Morandi, C. Gysler, P. Bucheli, Molecular and biochemical characterization of two aspartic proteinases TcAP1 and TcAP2 from Theobroma cacao seeds, Planta 215 (2002) 754 Á/762. J. Voigt, B. Biehl, H. Heinrichs, S. Kamaruddin, G. GaimMarsoner, A. Hugi, In-vitro formation of cocoa-specific aroma presursors: aroma-related peptides generated from cocoa-seed protein by co-operation of an aspartic endoproteinase and a carboxypeptidase, Food Chem. 49 (1994) 173 Á/180. J. Voigt, B. Biehl, Precursors of the cocoa specific aroma components are derived from the vicilin-class (7S) globulin of the cocoa seeds by proteolytic processing, Bot. Acta 108 (1995) 283 Á/289.

of cacao seed proteins under acid conditions [24,25], it is possible that the cellular destruction seen by Leprince et al. [6] after adding water to partially dehydrated cacao seeds was at least partially due to the mobilization/ activation of this aspartic protease. Thus, perhaps the high activity associated with the major cacao seed aspartic proteinase contributes to the recalcitrant nature of cacao seeds.

[11]

[12]

[13]

Acknowledgements We wish to thank Pierre Marracini for his advice during this work and J. d’Alayer of the Institut Pasteur for the N-terminal peptide sequencing. We would also like to thank Peter Bucheli and Vincent Petiard for their helpful comments and support.

[14]

[15]

[16]

References
[17] [1] D.J. Murphy, Structure, function and biogenesis of storage lipid bodies and oleosins in plants, Prog. Lipid Res. 32 (1993) 247 Á/280. [2] A.J. Huang, Oleosins and oil bodies in seeds and other organs, Plant Physiol. 110 (1996) 1055 Á/1061. [3] D.H. Murphy, J.H.E. Ross, Biosynthesis, targeting, and processing of oleosin-like proteins, which are major pollen coat components in Brassica napus , Plant J. 13 (1998) 1 Á/16. [4] I. Hernandez-Pinzon, J.H.E. Ross, K.A. Barnes, A.P. Damant, D.J. Murphy, Composition and role of tapetal lipid bodies in the biogenesis of the pollen coat of Brassica napus , Planta 208 (1999) 588 Á/598. [5] J.T.C. Tzen, Y. Cao, P. Laurent, C. Ratnayake, A.H.C. Huang, Lipids, proteins, and structure of seed oil bodies from diverse species, Plant Physiol. 101 (1993) 267 Á/276. [6] O. Leprince, A.C. van Aelst, H.W. Pritchard, D.J. Murphy, Oleosins prevent oil-body coalescence during seed imbibition as suggested by a low-temperature scanning electron microscope study of desiccation tolerant and sensitive oil seeds, Planta 204 (1998) 109 Á/119. [7] J.C.F. Chen, C.C.Y. Tsai, J.T.C. Tzen, Cloning and secondary structure analysis of caleosin, a unique calcium-binding protein in oil bodies of plant seeds, Plant Cell Physiol. 40 (1999) 1079 Á/1086. [8] H. Naested, G.I. Frandsen, G.Y. Jauh, I. Hernandez-Pinzon, H.B. Neilsen, D.J. Murphy, J.C. Rogers, J. Mundy, Caleosins: Ca2' binding proteins associated with lipid bodies, Plant Mol. Biol. 44 (2000) 463 Á/476. [9] P. Bucheli, G. Rousseau, M. Alvarez, M. Laloi, J. Mc Carthy, Developmental variation of sugars, carboxylic acids, purine alkaloids, fatty acids, and endoproteinase activity during maturation of Theobroma cacao L. seeds, J. Agric. Food Chem. 49 (2001) 5046 Á/5051. [10] M. Millichip, A.S. Tatham, F. Jackson, G. Griffiths, P.R. Shewry, A.K. Stobart, Purification and characterization of oil bodies (oleosomes) and oil-body boundary proteins (oleosins) from the

[18]

[19]

[20]

[21] [22]

[23]

[24]

[25]


								
To top