Overview of Bioinformatics A Tutorial on Bioinformatics What is ...

Reviews
Shared by: techmaster
Stats
views:
61
rating:
not rated
reviews:
0
posted:
10/28/2008
language:
pages:
0
A Tutorial on Bioinformatics Overview of Bioinformatics A/P Shoba Ranganathan Justin Choo National University of Singapore What is Bioinformatics ? Bioinformatics is “the study of the information content and information flow in biological systems and processes”. - Michael Liebman in “Bioinformatics: An Editorial Perspective” (http://www.netsci.org/Science/Bioinform/feature01.html) • Annotate -> store -> search/retrieve -> analyze -> visualize • Nucleic acid sequence (genes and RNAs), protein sequence and structural information. SARS & Its Implication ... SARS - Bioinformatics In Action Sequencing Of SARS … Photo above shows the sequencing area of the lab. Taken from http://www.bcgsc.ca/bioinfo/SARS/ Partial Sequence of SARS … >gi|30248028|gb|AY274119.3| SARS coronavirus TOR2, complete genome ATATTAGGTTTTTACCTACCCAGGAAAAGCCAACCAACCTCGATCTCTTGTAGATCTGTTCTCTAAACGA ACTTTAAAATCTGTGTAGCTGTCGCTCGGCTGCATGCCTAGTGCACCTACGCAGTATAAACAATAATAAA TTTTACTGTCGTTGACAAGAAACGAGTAACTCGTCCCTCTTCTGCAGACTGCTTACGGTTTCGTCCGTGT TGCAGTCGATCATCAGCATACCTAGGTTTCGTCCGGGTGTGACCGAAAGGTAAGATGGAGAGCCTTGTTC TTGGTGTCAACGAGAAAACACACGTCCAACTCAGTTTGCCTGTCCTTCAGGTTAGAGACGTGCTAGTGCG TGGCTTCGGGGACTCTGTGGAAGAGGCCCTATCGGAGGCACGTGAACACCTCAAAAATGGCACTTGTGGT CTAGTAGAGCTGGAAAAAGGCGTACTGCCCCAGCTTGAACAGCCCTATGTGTTCATTAAACGTTCTGATG CCTTAAGCACCAATCACGGCCACAAGGTCGTTGAGCTGGTTGCAGAAATGGACGGCATTCAGTACGGTCG TAGCGGTATAACACTGGGAGTACTCGTGCCACATGTGGGCGAAACCCCAATTGCATACCGCAATGTTCTT CTTCGTAAGAACGGTAATAAGGGAGCCGGTGGTCATAGCTATGGCATCGATCTAAAGTCTTATGACTTAG GTGACGAGCTTGGCACTGATCCCATTGAAGATTATGAACAAAACTGGAACACTAAGCATGGCAGTGGTGC ACTCCGTGAACTCACTCGTGAGCTCAATGGAGGTGCAGTCACTCGCTATGTCGACAACAATTTCTGTGGC CCAGATGGGTACCCTCTTGATTGCATCAAAGATTTTCTCGCACGCGCGGGCAAGTCAATGTGCACTCTTT CCGAACAACTTGATTACATCGAGTCGAAGAGAGGTGTCTACTGCTGCCGTGACCATGAGCATGAAATTGC CTGGTTCACTGAGCGCTCTGATAAGAGCTACGAGCACCAGACACCCTTCGAAATTAAGAGTGCCAAGAAA TTTGACACTTTCAAAGGGGAATGCCCAAAGTTTGTGTTTCCTCTTAACTCAAAAGTCAAAGTCATTCAAC CACGTGTTGAAAAGAAAAAGACTGAGGGTTTCATGGGGCGTATACGCTCTGTGTACCCTGTTGCATCTCC ACAGGAGTGTAACAATATGCACTTGTCTACCTTGATGAAATGTAATCATTGCGATGAAGTTTCATGGCAG ACGTGCGACTTTCTGAAAGCCACTTGTGAACATTGTGGCACTGAAAATTTAGTTATTGAAGGACCTACTA ... ... ... ... ... The complete genome of SARS, obtained from http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?30248028:NCBI:4812069 1980 Bioinformatics -Timeline Single Structures • Modeling & Geometry • Forces & Simulation • Docking Sequences, Sequence-Structure Relationships • Alignment • Structure Prediction • Fold recognition Genomics • Dealing with many sequences • Gene finding & Genome Annotation • Databases Integrative Analysis • Expression & Proteomics Data • Data mining • Simulation again…(whole cells?). 1985 1990 1995 2000 2005 Biological Databases • Collect, organise and classify data • Query the dataset • Retrieve entries based on keyword search EMBL PDB Genbank Sequence Analysis Software • What is the information contained in a biological sequence? • How can we analyse it to gain knowledge? • Does it contain any functional clues? Sequence Comparison • How can we compare a given sequence to the millions in the database? • Which ones are truly related by evolution? • What can the study of related sequences tell us? Sequence Alignment • After collecting a set of related sequences, how can we compare them as a set? • How should we line up the sequences so that the most similar portions are together? • What do we do with sequences of different lengths? Protein Structure • The function of a protein is a consequence of its folded state: Anfinsen, 1961 • The 3D fold of a protein is called its structure • In 3D, the business end of the protein has contributions from different regions of its sequence Picture taken from http://www.strgen.org/ Visualization • Using graphic tools to view structures • Simple commands to analyse structures and active sites • Different graphic representations and colouring schemes Picture taken from http://www.nature.com/ Careers in Bioinformatics Genomics: • • • • Genome sequencing of – Bacteria, viruses – Animals – Plants Comparative genomics Annotation and Mapping Gene Discovery Careers in Bioinformatics Functional Genomics (Gene Expression and Regulation): • • • • Control Regions – Switches – Circuits – Bypass – Feedback loops Environmental Effects Diseased States Chemical Consequences Careers in Bioinformatics Pharmacogenomics: • • • • SNPs – Regional, ethnic variations – Inheritance patterns – Radiological/ecological modifications Therapeutic target recognition Correlation of drug and expression effects Pathway Effects Careers in Bioinformatics Proteomics: • • Protein Profiling – Alternate splice variants – Orphan genes – Cryptic introns Gene Therapy Careers in Bioinformatics Structural Genomics: • • • • Experimental Protein structures – Apo state – Holo state – Structural modifications Membrane Proteins Homology Modelling Comparative Modelling Careers in Bioinformatics Drug and Vaccine Design: • • • • Screening Natural Products – Plants – Fungi – Bacteria Chemicals In silico modifications of ligands Vaccine design and delivery Job Sectors Academia Research Institutes Biotechnology Bioinformatics Pharmaceutical Agriculture Biodiversity The End

Related docs
Bioinformatics overview
Views: 23  |  Downloads: 3
Bioinformatics FAQ Podcast
Views: 30  |  Downloads: 2
Bioinformatics
Views: 49  |  Downloads: 8
Bioinformatics at Work
Views: 11  |  Downloads: 5
Bioinformatics for Beginners
Views: 61  |  Downloads: 6
1 What is BioInformatics
Views: 80  |  Downloads: 5
Evolution of BINF Bioinformatics Certificate
Views: 4  |  Downloads: 2
Introduction to Structural Bioinformatics
Views: 31  |  Downloads: 8
premium docs
Other docs by techmaster
PGI 242_11
Views: 27  |  Downloads: 0
sb0083-fill
Views: 29  |  Downloads: 0
FAR52.227
Views: 20  |  Downloads: 0
Show Your Intuitive Side
Views: 202  |  Downloads: 7
5301
Views: 195  |  Downloads: 0
Feb-2006 Court Opinion Ruling Case-ANDERSON
Views: 34  |  Downloads: 0
52_215m
Views: 86  |  Downloads: 0
PGI 204_1
Views: 141  |  Downloads: 0
Dfars 242
Views: 149  |  Downloads: 0
Far06
Views: 51  |  Downloads: 0
sb0082
Views: 30  |  Downloads: 0
Touching The Holy Water
Views: 132  |  Downloads: 6
Backing Up Your Data
Views: 258  |  Downloads: 13