Docstoc

Apoptosis_ cell growth and differentiation - DOC

Document Sample
Apoptosis_ cell growth and differentiation - DOC Powered By Docstoc
					Supplemental Table 1. Determining the optimal window size for scanning the genome.

Window size = 300 bp k 1 2 3 4 5 STAT1 Random %FDR 84038 90921 108 3971 1235 31 436 11 2.5 73 0.15 0.2 6 0 0 k 1 2 3 4 5

Window size = 500 bp STAT1 Random %FDR 82296 90267 110 5373 1885 35 734 26 3.5 166 0.3 0.2 33 0 0

Window size = 1000 bp k 1 2 3 4 5 6 STAT1 Random %FDR 79461 88701 111 7829 3433 44 1222 79 2.5 297 2 0.6 81 0.1 0.12 27 0 0 k 1 2 3 4 5 6

Window size = 2000 bp STAT1 Random %FDR 75202 85833 114 11418 6291 55 2002 255 1.5 567 8.4 0.6 170 0.3 0.2 64 0.05 0.08

k is the number of single hit tags found within a window. The false discovery rate (FDR) was calculated as (random/STAT1)*100. Supplemental Table 2. RefSeq annotated genes within 20 Kb upstream or downstream to STAT1 binding sites detected in the genome.
Genes Immune response C1S SECTM1 IL18BP STAT3 BST2 IFI35 HLA-E IRF1 CD7 IFI16 IL4R STAT1 PLSCR1 Lipid metabolism Description complement component 1, s subcomponent secreted and transmembrane 1 interleukin 18 binding protein signal transducer and activator of transcription 3 bone marrow stromal cell antigen 2 interferon-induced protein 35 major histocompatibility complex, class I, E interferon regulatory factor 1 CD7 antigen (p41) interferon, gamma-inducible protein 16 interleukin 4 receptor signal transducer and activator of transcription 1 phospholipid scramblase 1 Position of STAT1 binding site UPS UPS EXN UPS UPS EXN UPS UPS DS UPS INT UPS INT 111 5365 527 307 50 35 168 5091, 6761 19119 9910 13152 611 1135

SMPD1 SULT1A1 LRP8 SLC27A4 APOL6 Cell adhesion ITGB3 ICAM1 NID2 FNBP4 COL5A1 ENG

sphingomyelin phosphodiesterase 1 sulfotransferase family, cytosolic, 1A, phenol-preferring, member 1 low density lipoprotein receptor-related protein 8 solute carrier family 27 (fatty acid transporter), member 4 apolipoprotein L, 6

UPS DS DS UPS INT

376 5222 1685 769, 17881 247

integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61) intercellular adhesion molecule 1 (CD54), human rhinovirus receptor nidogen 2 (osteonidogen) formin binding protein 4 collagen, type V, alpha 1 endoglin (Osler-Rendu-Weber syndrome 1)

UPS INT UPS UPS UPS INT

13708 392 2976 875 15031 7660

Cell growth, differentiation and death NRG1 neuregulin 1 TNFAIP2 tumor necrosis factor, alpha-induced protein 2 PHLDA2 pleckstrin homology-like domain, family A, member 2 DAPK3 death-associated protein kinase 3 DAPK3 death-associated protein kinase 3 TNFRSF1A tumor necrosis factor receptor superfamily, member 1A CDC7 CDC7 cell division cycle 7 (S. cerevisiae) CDK6 cyclin-dependent kinase 6 BRCA2 breast cancer 2, early onset RAP1A RAP1A, member of RAS oncogene family TREX1 three prime repair exonuclease 1 MTHFD2 methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2 Protein metabolism TARS DUSP14 EEF2 SURF6 MATN1 EEF2K PSMB3 GFM1 USP48 RPL35 DPP9 SLC9A3R1 PARP14 PTP4A2 ADAM17 VRK3 HSPB1 PTK6 TRIO CARS DTX3L

UPS UPS UPS UPS INT INT UPS DS INT UPS DS DS

15639 8019 11153 14381 777 5733 196 657 465 527 669 7741

threonyl-tRNA synthetase dual specificity phosphatase 14 eukaryotic translation elongation factor 2 surfeit 6 matrilin 1, cartilage matrix protein eukaryotic elongation factor-2 kinase proteasome (prosome, macropain) subunit, beta type, 3 G elongation factor, mitochondrial 1 ubiquitin specific protease 48 ribosomal protein L35 dipeptidylpeptidase 9 solute carrier family 9 (sodium/hydrogen exchanger) poly (ADP-ribose) polymerase family, member 14 protein tyrosine phosphatase type IVA, member 2 a disintegrin and metalloproteinase domain 17 (tumor necrosis factor, alpha, converting enzyme) vaccinia related kinase 3 heat shock 27kDa protein 1 PTK6 protein tyrosine kinase 6 triple functional domain (PTPRF interacting) cysteinyl-tRNA synthetase deltex 3-like (Drosophila)

UPS UPS DS UPS DS INT INT INT UPS UPS DS INT UPS UPS INT UPS UPS UPS INT INT UPS

233 6197 1254, 16412 86 4665 976 93 194 831 1730 10682 9291 19283 1310 342 123 7760 651 13363 7483 195

HS6ST1 Signal transduction SNX27 IPO8 RAB36 GPR37L1 CXXC5 PITPNC1 RHOF ITPK1 GUCA1B RASSF5 Transport ABCC11 SCNN1A VMD2L3 SLC25A1 KCNJ12 SLC22A2 C1QTNF6 CLIC2 SLC25A25 COPG ZNF406 VPS18 HPX SLC35A2 MTCH2

heparan sulfate 6-O-sulfotransferase 1

INT

13493

sorting nexin family member 27 importin 8 RAB36, member RAS oncogene family G-protein coupled receptor 37 like 1 CXXC finger 5 phosphatidylinositol transfer protein, cytoplasmic 1 ras homolog gene family, member F (in filopodia) inositol 1,3,4-triphosphate 5/6 kinase guanylate cyclase activator 1B (retina) Ras association (RalGDS/AF-6) domain family 5

UPS UPS DS UPS UPS INT UPS UPS INT INT

5560 367 7340 15711 12166 12593 1131 5305 3969 6210, 7336

ATP-binding cassette, sub-family C (CFTR/MRP), member 11 sodium channel, nonvoltage-gated 1 alpha vitelliform macular dystrophy 2-like 3 solute carrier family 25 (mitochondrial carrier; citrate transporter), member 1 potassium inwardly-rectifying channel, subfamily J, member 12 solute carrier family 22 (organic cation transporter), member 2 C1q and tumor necrosis factor related protein 6 chloride intracellular channel 2 solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 25 coatomer protein complex, subunit gamma zinc finger protein 406 vacuolar protein sorting protein 18 hemopexin solute carrier family 35 (UDP-galactose transporter), member A2 mitochondrial carrier homolog 2 (C. elegans)

EXN DS EXN UPS UPS DS UPS UPS INT UPS INT UPS DS UPS UPS

321 4824 171 922 4203 19540 671, 9571 366 256 3780 10934, 11357 2668 1813 195 66

Other biological processes C1orf191 chromosome 1 open reading frame 191 BATF2 hypothetical protein BC012330 RND1 Rho family GTPase 1 EIF1 putative translation initiation factor FLJ32926 hypothetical protein FLJ32926 FLJ25660 hypothetical protein FLJ25660 C2orf18 chromosome 2 open reading frame 18 LHFPL5 lipoma HMGIC fusion partner-like 5 PRPF4 PRP4 pre-mRNA processing factor 4 homolog (yeast) C16orf47 FLJ26184 protein PAF1 hypothetical protein F23149_1 ZNF473 zinc finger protein 473 CLPS colipase, pancreatic LONPL peroxisomal lon protease ZNF114 hypothetical protein MGC17986 RPL7A ribosomal protein L7a PUS3 pseudouridylate synthase 3

UPS EXN DS UPS DS DS UPS INT UPS DS UPS UPS UPS UPS DS UPS INT

8524 118 12542, 13750 9819 13806 14356 6304 6227 306 2438, 19985 11736 283 14195 12349 18873 11938 85

LOC441108 VAT1 C9orf88 IXL APBB1 LOC399900 NAGLU BBS4 MGC14327 PTPN21 SEMA3F COQ4 COQ4 SERPINB6 DSCR4 SRMS PLEKHG2 ASB6 APOA1BP TMEM55B NQO2 MGC13168 ICAM4 C1orf147 MCM2 PODXL2 FLJ37078 TRUB2 DKFZp686I15217 ZNF302 C17orf41 SSTR3 C6orf65 SLBP C1orf111 C1orf90 DENND1A SHC1 C9orf32 UBASH3A NUP210 NPFFR1 MCL1 LOC93343 PELI3 TMEM104 HSD17B1

hypothetical protein vesicle amine transport protein 1 homolog (T californica) chromosome 9 open reading frame 88 intersex-like (Drosophila) amyloid beta (A4) precursor protein-binding, family B, member 1 hypothetical protein N-acetylglucosaminidase, alpha- (Sanfilippo disease IIIB) Bardet-Biedl syndrome 4 hypothetical protein MGC14327 protein tyrosine phosphatase, non-receptor type 21 sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3F coenzyme Q4 homolog (yeast) coenzyme Q4 homolog (yeast) serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 6 Down syndrome critical region gene 4 src-related kinase lacking C-terminal regulatory tyrosine and Nterminal myristylation sites pleckstrin homology domain containing, family G (with RhoGef domain) member 2 ankyrin repeat and SOCS box-containing 6 apolipoprotein A-I binding protein chromosome 14 open reading frame 9 NAD(P)H dehydrogenase, quinone 2 vitelliform macular dystrophy 2-like 3 intercellular adhesion molecule 4, Landsteiner-Wiener blood group chromosome 1 open reading frame 147 MCM2 minichromosome maintenance deficient 2, mitotin (S. cerevisiae) podocalyxin-like 2 hypothetical protein TruB pseudouridine (psi) synthase homolog 2 (E. coli) hypothetical protein DKFZp686I15217 zinc finger protein 302 hypothetical protein FLJ12735 somatostatin receptor 3 chromosome 6 open reading frame 65 stem-loop (histone) binding protein hypothetical protein LOC284680 hypothetical protein MGC10820 KIAA1608 SHC (Src homology 2 domain containing) transforming protein 1 AD-003 protein ubiquitin associated and SH3 domain containing, A nucleoporin 210kDa G protein-coupled receptor 147 myeloid cell leukemia sequence 1 (BCL2-related) hypothetical protein BC011840 pellino 3 alpha hypothetical protein FLJ20255 hydroxysteroid (17-beta) dehydrogenase 1

DS DS INT DS UPS DS DS UPS DS UPS DS DS EXN UPS UPS DS UPS DS DS UPS UPS DS UPS UPS DS UPS DS UPS UPS UPS EXN DS UPS UPS UPS UPS UPS UPS INT UPS UPS UPS DS UPS UPS UPS UPS

16654 15536 12964 11453 19736 5254 5397 15058 7245 5222 8681 17256 144 16784 18568 9499 10334 15858 9445 307 11356 10227 15479 16027, 17153 19019 11788 9788 261, 17373 58 292 317 14452 16498 15299 4553 15 3696 9158 152 7729, 8564 581 1091 17076 14477 12477 18599 10636

CRLF3 ANKRD13D C1orf138 ZNF335 FLJ45248 RARRES2 ZC3H3 SNX1 PLXDC1 DSCR8 KIAA0040 LOC284751 C7orf29 TMPRSS3 TMPRSS3 TMEM61 THAP2 MTHFR RARG AEBP2 LCK GPATC4 TMEM50A RND2 CKS1B PPAP2C ELF3 SULT1A2 PCGF2 ZNF367 PSCA MFSD5 PSRC1 C11orf10 LOC153222 NDOR1 CRI1 FOXL2 GOLGA ZNF181 LOC389289 RPL27 SSNA1 JRK KRTHB1 ESPL1 SPINK4 C9orf50 ARL2 HAND1

cytokine receptor-like factor 3 hypothetical protein LOC338692 chromosome 1 open reading frame 138 zinc finger protein 335 FLJ45248 protein retinoic acid receptor responder (tazarotene induced) 2 zinc finger CCCH type domain containing 3 sorting nexin 1 plexin domain containing 1 Down syndrome critical region gene 8 KIAA0040 gene product hypothetical protein chromosome 7 open reading frame 29 transmembrane protease, serine 3 transmembrane protease, serine 3 hypothetical protein LOC199964 hypothetical protein DKFZp564I0422 5,10-methylenetetrahydrofolate reductase (NADPH) retinoic acid receptor, gamma AE binding protein 2 lymphocyte-specific protein tyrosine kinase G patch domain containing 4 small membrane protein 1 ras homolog gene family, member N CDC28 protein kinase regulatory subunit 1B phosphatidic acid phosphatase type 2C E74-like factor 3 (ets domain transcription factor, epithelial-specific ) sulfotransferase family, cytosolic, 1A, phenol-preferring, member 2 ring finger protein 110 zinc finger protein 367 prostate stem cell antigen hypothetical protein MGC11308 p53-regulated DDA3 chromosome 11 open reading frame 10 adult retina protein NADPH dependent diflavin oxidoreductase 1 CREBBP/EP300 inhibitor 1 forkhead box L2 similar to Golgi autoantigen, golgin subfamily A member 6 (Golgin linked to PML) (Golgin-like protein) zinc finger protein 181 hypothetical protein ribosomal protein L27 Sjogren's syndrome nuclear autoantigen 1 jerky homolog (mouse) keratin, hair, basic, 1 extra spindle poles like 1 (S. cerevisiae) serine protease inhibitor, Kazal type 4 hypothetical protein LOC375759 ADP-ribosylation factor-like 2 heart and neural crest derivatives expressed 1

UPS UPS UPS UPS EXN DS UPS UPS DS DS UPS INT UPS DS UPS UPS EXN DS UPS UPS UPS INT DS UPS DS INT EXN UPS UPS EXN INT UPS UPS EXN UPS UPS UPS DS DS UPS UPS DS DS UPS DS UPS UPS UPS UPS DS

7648 1179 469 11289 961 18775 5825 2129 12343 18456 697 236 7006 746 89 7273 145 15179 19431 7648 4113 268 17864 18398 8785 951 2183 7036 4536 313 614 468 2058 10 144 7337 6502 5389 16438 377 175 8414 9713 14561 10462, 10906 17139 5807 5531 17269 6787

HM13 TACC3 TMEM62 P8 MRPL4 MRPL11 CLCN6 FAM96A ZFP36 PREX1 C20orf195 SSH3 APOC2 PIM2 ICAM5 C9orf106 CDC26 LENEP UBR1 ATP5B TMEM129 LOC284912 EDEM2 SURF5 C5orf13 C20orf149 HYLS1 DDX23 DDX23 C9orf75 BAZ2A C10orf47 OSGEP APEX1 LRRC61 WDR34 APOC4 GSDMDC1 NOB1 FEN1 PQBP1 KRT7 KRT7 C14orf79 NAT9 RHOV TIMM17B RTDR1 PARP9 HAPLN2

histocompatibility (minor) 13 transforming, acidic coiled-coil containing protein 3 hypothetical protein FLJ23375 p8 protein (candidate of metastasis 1) mitochondrial ribosomal protein L4 mitochondrial ribosomal protein L11 chloride channel 6 hypothetical protein FLJ22875 zinc finger protein 36, C3H type, homolog (mouse) PREX1 protein hypothetical protein MGC5356 slingshot homolog 3 (Drosophila) apolipoprotein C-II pim-2 oncogene intercellular adhesion molecule 5, telencephalin chromosome 9 open reading frame 106 cell division cycle 26 lens epithelial protein ubiquitin protein ligase E3 component n-recognin 1 ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide hypothetical protein BC009331 hypothetical gene supported by BC001801 chromosome 20 open reading frame 31 surfeit 5 chromosome 5 open reading frame 13 chromosome 20 open reading frame 149 hypothetical protein FLJ32915 DEAD (Asp-Glu-Ala-Asp) box polypeptide 23 DEAD (Asp-Glu-Ala-Asp) box polypeptide 23 chromosome 9 open reading frame 75 bromodomain adjacent to zinc finger domain, 2A chromosome 10 open reading frame 47 O-sialoglycoprotein endopeptidase APEX nuclease (multifunctional DNA repair enzyme) 1 hypothetical protein MGC3036 WD repeat domain 34 apolipoprotein C-IV gasdermin domain containing 1 nin one binding protein flap structure-specific endonuclease 1 polyglutamine binding protein 1 keratin 7 keratin 7 chromosome 14 open reading frame 79 embryo brain specific protein ras homolog gene family, member V translocase of inner mitochondrial membrane 17 homolog B (yeast) rhabdoid tumor deletion region gene 1 poly (ADP-ribose) polymerase family, member 9 hyaluronan and proteoglycan link protein 2

INT DS UPS DS DS UPS UPS EXN UPS UPS UPS UPS DS DS UPS DS EXN UPS UPS DS UPS UPS INT DS DS DS DS EXN UPS INT UPS UPS UPS DS UPS EXN DS UPS UPS UPS DS DS UPS UPS DS UPS UPS UPS INT UPS

345 6064 10223 6914 19531 15616 15357 160 4071 4123 15014 15361 8883 7156 18484 12981 202 10063 17212 9386 6245 13488 281 11842 9040 17226 19512 54 1154 1712 303 12703 6745 6654 673 33 12631 11063 35 74 13590 11172 946 8799 18396 17520 13702 10611 354 18083

DDX25 LTBR NP KRTAP17-1 WWP2 ARPC5L FLAD1 ADAMTSL4 DAB2IP PSRC2 CLPTM1 LY6K FCHO2 FTH1 ANAPC2 FLJ11806 CCNL1 KIAA1618 STOM MRVI1

DEAD (Asp-Glu-Ala-Asp) box polypeptide 25 lymphotoxin beta receptor (TNFR superfamily, member 3) nucleoside phosphorylase keratin associated protein 17-1 WW domain containing E3 ubiquitin protein ligase 2 actin related protein 2/3 complex, subunit 5-like FAD synthetase thrombospondin repeat containing 1 DAB2 interacting protein hypothetical protein MGC23401 cleft lip and palate associated transmembrane protein 1 lymphocyte antigen 6 complex, locus K FCH domain only 2 ferritin, heavy polypeptide 1 anaphase promoting complex subunit 2 nuclear protein UKp68 cyclin L1 KIAA1618 stomatin murine retrovirus integration site 1 homolog

UPS UPS UPS UPS UPS UPS INT DS UPS UPS UPS UPS UPS UPS UPS UPS UPS UPS INT INT

1382 13465 7621 13707 7409 5513 182 13163 5701 179 512 19042 72 5387 9788 2968 14267 6047 7363 17906

UPS: upstream, DS: downstream, EXN: first exon, INT : first intron Supplemental Table 3. Primers used for quantitative PCR analysis.
Locus IRF1-D IRF1-P SLC25A25 STAT3 chr22-34786430 TNFRSF1A DAPK3 C1S APOL6 ADAM17 GAPDH Primer sequence Forward: CTAGAACCCACCAACCTCCA Reverse: TGCCTCGAACTCACCCTACT Forward: CTGAAGCTGGCTGGAAAATC Reverse: AGCACTGGAGCAATTCCTTG Forward: GGCAGCATTTAGGGAACTTG Reverse: CAGGCACAGACAGAGCATGT Forward: ACGCGGGAATCAGCTAGTTA Reverse: TTTTTGTTGTCCCCAGAACC Forward: GGATTTTCACCATCGGACTG Reverse: TCTCCTCCCTTCTCCCTGAT Forward: AGGGGAGAGGGAACTAGCAG Reverse: CCTTCTGCCTTTCTGCTGAC Forward: AACAATTGACCGAGGTTTGG Reverse: GCCCAGCTCTTGGATGTTTA Forward: GAGGACGCTGTCCTTGTTTC Reverse: GGCTGGGAGACCATGACTTA Forward: CCTCCCTTACAGCCATTTCA Reverse: AGTGGAGGGACAAATGCAAC Forward: ATCCAGCCACCCTACTCCTT Reverse: GCTCCCTAGCTTTGTGTTCG Forward: AAAAGCGGGGAGAAAGTAGG Reverse: GTCTTGAGGCCTGAGCTACG

GAPDH indicates the gapdh promoter that was used as a reference for calculating fold enrichment for each locus tested. ADAM17 did not validate as a target.


				
DOCUMENT INFO