Docstoc

SVILUPPO DI UN NUOVO SAGGIO PER

Document Sample
SVILUPPO DI UN NUOVO SAGGIO PER Powered By Docstoc
					U N I V E R SI T À DE G L I STU D I DI TR I E ST E


FACOLTÀ DI MEDICINA CORS O DI LAUR EA IN BIOTECNOLOGIE MEDI CHE

T E S I SPE R I M E N T A L E IN
BIOTECNOLOGIE CELLULARI

SVILUPPO DI UN NUOVO SAGGIO PER LO STUDIO DELL’ATTIVITÀ CASPASICA SU SINGOLA CELLULA

Lau reanda : ROSSI Giada

Rel atore: Prof. DEL SAL Giannino Correlato ri: Prof. BRANCOLINI Claudio Dott.ssa PARONI Gabriela

Anno Accademico 2003 – 2004

Al passato, che mi ha reso quella che sono Al presente, che ogni giorno è in grado di stupirmi Al futuro, che attendo con i sensi spalancati

Indice

INDICE
INDICE.................................................................................................I INTRODUZIONE ................................................................................1 1 Apoptosi: morte cellulare programmata ................................1 1.1 2 Caratteristiche generali del suicidio cellulare ...................2

Le caspasi: i principali esecutori dell’apoptosi ......................3 2.1 2.2 Caratteristiche principali delle caspasi..............................4 Modelli di attivazione caspasica .......................................6

2.2.1 Modello di oligomerizzazione .................................................... 6 2.2.2 Modello di regolazione allosterica.............................................. 8

2.3

Vie di attivazione caspasica..............................................8

2.3.1 Via apoptotica estrinseca .......................................................... 9 2.3.2 Via apoptotica intrinseca ......................................................... 11

3

Ruolo del mitocondrio nel processo apoptotico ..................13 3.1 Meccanismi e regolatori della permeabilizzazione della membrana mitocondriale ................................................13 3.2 Meccanismi e regolatori della transizione del potenziale di membrana mitocondriale .............................................17

4 5 6

Meccanismi di inibizione dell’attività caspasica...................20 Principali substrati delle caspasi .........................................22 Analisi dell’attività apoptotica ..............................................25 6.1 6.2 Studio dell’attività caspasica...........................................25 Studio della funzionalità mitocondriale ...........................27

I

Indice

RISULTATI .......................................................................................31 1 2 3 4 Analisi della localizzazione cellulare di GFPDEVDHATM...32 Analisi del processamento di GFPDEVDHATM in vivo ......33 Analisi del processamento di GFPDEVDHATM in vitro ......34 Analisi dell’influenza della sovrespressione di GFPDEVDHATM sul processo apoptotico ......................................................37 5 6 Caratterizzazione dei siti di taglio di GFPDEVDHATM .......40 Analisi dell’attivazione caspasica in vivo su singola cellula 43

DISCUSSIONE .................................................................................55 MATERIALI E METODI ....................................................................60 1 Tecniche di base di manipolazione del DNA ...........................60 1.1 1.2 1.3 1.4 1.5 1.6 1.7 1.8 1.9 2 3 Reazione a catena della DNA-polimerasi (PCR) ................60 Mutagenesi ..........................................................................61 Digestione con enzimi di restrizione....................................61 Preparazione del vettore per la ligazione............................62 Estrazione di DNA da gel di agarosio .................................62 Ligazione vettore-inserto. ....................................................63 Trasformazione batterica.....................................................63 Preparazione plasmidica MINI ............................................64 Preparazione plasmidica MIDI ............................................65

Clonaggio dei costrutti utilizzati ...............................................66 Linee cellulari e condizioni di coltura .......................................70 3.1 Introduzione di DNA esogeno nelle cellule .........................71

3.1.1 Trasfezione tramite calcio-fosfato...................................71

II

Indice

3.1.2 Microiniezione cellulare...................................................72
3.1.2.1 Descrizione del sistema di microiniezione automatizzata .... 73 3.1.2.2 Tecnica della microiniezione ................................................ 73

3.2

Induzione dell’apoptosi mediante trattamento con etoposide, MG-132, TSA ......................................................................74

3.3

Saggio di inibizione dell'attività caspasica in cellule apoptotiche..........................................................................75

4

Tecniche di analisi delle proteine ............................................75 4.1 4.2 Preparazione dei lisati proteici ............................................75 Analisi di proteine mediante Western blotting .....................76

4.2.1 Elettrotrasferimento di proteine su membrana di nitrocellulosa...................................................................76 4.2.2 Rilevamento della banda proteica tramite anticorpi........77 4.3 5 Saggio di immunofluorescenza indiretta .............................79 Analisi della popolazione apoptotica in cellule indotte alla morte cellulare ..........................................................................80 5.1 5.2 6 Utilizzo della citofluorimetria a flusso ..................................80 Conta di cellule vitali mediante colorazione col Trypan Blue....83

Acquisizione delle immagini mediante microscopio confocale ...83 6.1 6.2 Microscopio confocale a luce laser .....................................83 Acquisizione Time-Lapse con il microscopio confocale......84 86 92

BIBLIOGRAFIA APPENDICE

III

INTRODUZIONE

Introduzione

INTRODUZIONE

1 Apoptosi: morte cellulare programmata

In ogni organismo coesistono più popolazioni cellulari, con diversi livelli di specializzazione e differenziamento, che collaborano al mantenimento dell’omeostasi tissutale. In generale, le cellule non hanno caratteristiche permanenti, il tessuto viene continuamente rinnovato e le cellule al termine del loro ciclo vitale muoiono. La morte cellulare è un processo che può essere scatenato da molteplici stimoli differenti: le vie metaboliche attraverso cui si manifesta sono la necrosi, l’apoptosi e l’autofagia. La necrosi è un processo passivo, patologico, scatenato in risposta ad un danno acuto quale l’ipossia, l’ipotermia, le radiazioni, le infezioni virali, la risposta immunitaria, gli agenti chimici e i farmaci. L’autofagia, o ‘morte cellulare lisosomiale’, è un processo importante nel mantenimento dell’omeostasi citoplasmatica, che si concretizza nell’eliminazione selettiva di materiale e organelli citoplasmatici sequestrati in vacuoli autofagici di natura lisosomiale. È possibile che questo meccanismo possa modulare le riserve intracellulari di mitocondri funzionali, e quindi che sia in grado di influenzare gli eventi dipendenti dall’attività mitocondriale, come l’apoptosi (Moreira & Barcinski, 2003). L’apoptosi, o ‘morte cellulare programmata’, è un processo fisiologico attivo. È noto che giochi un ruolo fondamentale nello sviluppo e nell’omeostasi degli organismi multicellulari. Nell’uomo, uno sbilanciamento nell’equilibrio fisiologico di questi eventi può portare a situazioni patologiche: un macchinario

1

Introduzione

apoptotico insufficiente alla sua funzione è spesso causa di disturbi autoimmunitari e dello sviluppo dei tumori; al contrario un eccesso della sua attività è evidente in malattie degenerative acute e croniche, tra le quali alcune di esse colpiscono il sistema nervoso.

1.1 Caratteristiche generali del suicidio cellulare
La cellula che va incontro all’apoptosi ha registrato dei segnali di sofferenza e danno, pertanto utilizza ogni sua risorsa energetica per l’attivazione di questo processo. Diversamente da ciò che accade nella necrosi, la cellula apoptotica è attiva, l’apparato trascrizionale e trasduzionale è integro e viene intensamente sfruttato per garantire una eliminazione organizzata e controllata; pertanto, non viene scatenato nessun tipo di risposta infiammatoria. Gli stimoli lesivi possono essere molteplici: citochine, ormoni, virus e agenti tossici. Anche la deprivazione di fattori di crescita è causa di una situazione di stress cellulare, che porta alla morte per apoptosi. Dal punto di vista morfologico, ciò che si può osservare in una cellula apoptotica è il compattamento del nucleo e della cromatina, la contrazione del citoplasma fino al collasso in numerosi corpi apoptotici, adatti ad essere fagocitati dalle cellule circostanti. Questi fenomeni sono espressione delle molteplici reazioni biochimiche che avvengono nella cellula. Alcune portano alla segnalazione dell’avvenuta morte cellulare, tramite l’esposizione di numerose molecole sulla membrana plasmatica, per promuovere il riconoscimento dei detriti apoptotici da parte dei fagociti o delle cellule vicine. Altre conducono alla degradazione del DNA cromosomico e al processamento di numerosi substrati. Anche gli eventi che coinvolgono il mitocondrio sono critici, proprio per il ruolo che questo organello ha nella gestione delle risorse energetiche della cellula: ciò che si verifica è, in particolare, la permeabilizzazione della membrana mitocondriale e la variazione del gradiente elettrochimico, quindi il rilascio di componenti normalmente non presenti nel citosol; inoltre si ha un’alterazione

2

Introduzione

nella concentrazione di elettroliti ed un’intensa produzione di sostanze tossiche, quali i radicali dell’ossigeno.

2 Le caspasi: i principali esecutori dell’apoptosi

Il fenotipo osservato nell’apoptosi è causato da una classe di proteasi dette caspasi. Il nome deriva dall’inglese caspase, acronimo di cysteindependent aspartate specific protease, che indica come principale caratteristica di questi enzimi la presenza di una Cys nel sito catalitico e la specificità per substrati contenenti un residuo di Asp. Nei mammiferi sono state identificate 14 diverse caspasi, e altrettanti rispettivi ortologhi in altre specie, quali, per esempio, insetti e nematodi: di queste, sette sono coinvolte nel processo apoptotico. Dal confronto tra le numerose varianti, si è visto che possiedono un sito attivo altamente conservato, mentre la sequenza di riconoscimento dei substrati è variabile a seconda della specificità di ogni singolo enzima. In base alle analisi filogenetiche, che rivelano l’omologia di sequenza dei diversi domini caspasici, la famiglia delle caspasi viene suddivisa in due gruppi: la sottofamiglia di caspasi-1 (caspasi-1, -4, -5, -11, -13), coinvolta nel controllo dell’infiammazione, la sottofamiglia di caspasi-3 (caspasi-2, -3, -6, -7, -8, -9, -10), specializzata nel processo apoptotico (Earnshaw & al., 1999). Le proteasi coinvolte nel suicidio cellulare sono distinte in caspasi iniziatrici ed effettrici, classificate in base al loro ruolo nel complesso macchinario apoptotico. Le caspasi iniziatrici (casp-2, -8, -9, -10) sono le prime ad essere responsive allo stimolo nocivo e sono responsabili dell’attivazione delle caspasi effettrici (casp-3, -6, -7), che garantiscono la continuità del processo nei suoi eventi catalitici principali.

3

Introduzione

Fig.1 Caratteristiche principali delle caspasi. A. Analisi filogenetica della famiglia delle caspasi. B. Rappresentazione grafica della loro struttura quaternaria. C. Illustrazione schematica del meccanismo generale di attivazione caspasica. (Tratto da Thornberry & Lazebnik, Science, 1998)

2.1 Caratteristiche principali delle caspasi
Le caratteristiche strutturali delle caspasi sono ancora un interessante oggetto di studio: attraverso le analisi cristallografiche, si sta cercando di trovare la chiave di lettura della loro particolare attività enzimatica. Le informazioni ottenute dagli studi biochimici confermano che, nel citoplasma di ogni cellula, le caspasi sono presenti costitutivamente sotto forma di zimogeni: sono espresse come proenzimi (precursori inattivi) composti da tre domini, uno N-terminale (o prodomain), una subunità maggiore (∼20 amminoacidi) ed una minore (∼10 amminoacidi). Come è stato visto per la caspasi-1, la proteina matura è un tetramero di due eterodimeri, dato dall’associazione tra le due subunità maggiore e minore, che espone due siti catalitici: la struttura quaternaria è mediata da interazioni idrofobiche, in cui i sei β strands antiparalleli di ogni subunità formano un singolo e continuo β sheet; altri piccoli β strands e α eliche contribuiscono al folding globulare (Shi, 2002).

4

Introduzione

La maturazione di queste proteasi è data da un primo taglio, che separa le due subunità maggiore e minore, poi da un secondo a livello del sito specifico a monte della subunità maggiore, responsabile del distacco del prodominio. In generale, questo processamento è comune all’attivazione di tutte le caspasi, anche se per alcune, come le caspasi-8 e -9, si è visto che non sempre è necessario: in queste caspasi, è il meccanismo di oligomerizzazione a diventare fondamentale per produrre un enzima maturo (Stennicke & al., 1999; Boatright & al., 2003). Mentre le due subunità sono responsabili dell’attività catalitica, il dominio N-terminale è coinvolto solo nella loro regolazione e si distingue per essere di lunghezza maggiore nelle caspasi iniziatrici e minore in quelle effettrici. Il sito attivo in cui viene accolto il substrato caspasico è dato da una sequenza di cinque amminoacidi, la cui composizione è QACXG, dove X è R, Q o G. La struttura di un eterodimero è formata da quattro loops (L1, L2, L3, L4), che determinano la specificità del riconoscimento del substrato: L2, contiene il residuo catalitico di Cys. In tutte le caspasi, L1 e L3 sono i domini più conservati per quanto riguarda lunghezza e composizione amminoacidica; invece L2 ed L4 sono altamente variabili. L’Asp contenuto nel sito di taglio della proteina bersaglio viene coordinato da tre residui caspasici, in genere invariati nelle diverse proteasi, presenti in L1 (R), in L2 (Q) e in L3 (R). All’interno di ogni dimero, la tasca che accoglie il substrato è formata dai loop L1 ed L4 posti parallelamente ai lati, mentre L3 ne costituisce la base: L2, che contiene il residuo catalitico di Cys, è posizionato ad una estremità della struttura. I loop L2 ed L4 sono stabilizzati dal segmento N-terminale (loop L2′) della subunità minore dell’altro dimero, formando una struttura intricata, detta “loop-bundle” (Chai & al., 2001). Per la completa attivazione dell’enzima, è necessario il taglio proteolitico di L2′, che ne permette la traslocazione in una conformazione aperta. Poiché le interazioni che stabilizzano il “loop bundle” sono conservate all’interno della famiglia delle caspasi, si ritiene che questo meccanismo sia comune a tutte queste proteasi (Shi, 2002).

Fig. 2 Struttura schematica della tasca che accoglie il substrato caspasico. È evidenziata la posizione reciproca dei loop L1, L2, L3 , L4 e L2′ e la presenza del residuo catalitico di Cys sul loop L2. (Tratto da Shi, 2002)

L4 L1 L3 Cys L2 L2′ 5

Introduzione

2.2 Modelli di attivazione caspasica
Possiamo distinguere due diversi meccanismi di attivazione caspasica: nel caso delle caspasi iniziatrici, basati sull’interazione tra proteine, oppure, per le caspasi effettrici, dipendenti dal processamento dovuto alle caspasi già funzionali. La forma proenzimatica può essere vista come un ‘regolatore citoplasmatico’ dell’apoptosi che, una volta attivato, è libero di traslocare dal citosol in altri compartimenti cellulari, come il reticolo endoplasmatico o il nucleo. In alcuni casi le proforme inattive vengono localizzate già in particolari sedi cellulari, come procaspasi-2 che risiede anche nel nucleo (Paroni & al., 2002).

2.2.1 Modello di oligomerizzazione

Il processo prevede il richiamo di una elevata concentrazione di proteine coinvolte nella trasduzione del segnale apoptotico, che vanno a costituire una piattaforma molecolare adatta a rendere possibile la maturazione delle caspasi iniziatrici da zimogeni ad enzimi attivi. Si pensa che sia sufficiente la attività caspasica basale presente nei proenzimi per processare e attivare completamente un’altra molecola omologa, se entrambe si trovano in prossimità dei macrocomplessi di attivazione (Boatright & al., 2003). Gli esempi di caspasi-8 e -9 costituiscono dei modelli di attivazione molto ben caratterizzati. La caspasi-8 è attivata in risposta al segnale apoptotico trasdotto da ‘recettori di morte’ (death receptors). In seguito al legame di una proteina extracellulare, come FasL, la coda citoplasmatica del recettore Fas/CD95/Apo-1 si associa al dominio DD (Death Domain) dell’adattatore molecolare FADD (Fas-Associated protein with Death Domain): questo quindi recluta la caspasi-8 tramite interazione con i domini DED (Death Effector Domain), posto alle estremità N-terminale (Boatright & Salvesen, 2003). Dall’assemblaggio di

6

Introduzione

queste proteine nasce un complesso chiamato DISC (Death-Inducing Signaling Complex): al suo interno, le molecole di proenzima sono in grado di dimerizzarsi e autoattivarsi, grazie alla loro intrinseca parziale attività proteasica. Ai fini della maturazione di caspasi-8, è stato visto che il taglio proteolitico non è tanto necessario quanto la formazione dell’omodimero: solo in seguito, i domini DED all’estremità N-terminale vengono rimossi (Boatright & Salvesen, 2003). Se lo stimolo apoptotico è dovuto al danneggiamento del DNA, la via coinvolta è quella della caspasi-9. In questo caso, la completa attivazione della proteasi è garantita dall’apoptosoma, un complesso macromolecolare di ∼1.4 MDa che si forma in seguito al rilascio del citocromo C (cytC) dai mitocondri danneggiati. In presenza di dATP (deoxy-Adenosil-Tri-Phosphate), il cytC solubile nel citoplasma causa un cambio conformazionale di una proteina scaffold, Apaf-1 (Apoptotic-proteaseche, in questa

activating-factor-1),

condizione, è in grado di legare la caspasi-9 attraverso i domini di

reclutamento

caspasico

(CARD),

omologhi alle due proteine. La struttura tridimensionale dell’apoptosoma è un complesso eptamerico al cui centro
Fig. 3 Struttura dell’apoptosoma

vengono accolti sette monomeri di caspasi-9. All’interno dell’apoptosoma, la

caspasi-9 si attiva grazie a modificazioni allosteriche e dimerizzazioni, più che a processamenti: l’interazione dei due domini proteasici è un evento critico nell’attivazione di caspasi-9 (Chang & al., 2003). Questa caratteristica sembra sia dovuta alla particolare struttura quaternaria dell’enzima, che contiene un

7

Introduzione

loop L2 più esteso, tale da conferire abbastanza flessibilità alla struttura per rendere accessibile il sito attivo, senza la necessità del taglio proteolitico (Shi, 2002). Quando caspasi-9 lega Apaf-1, aumenta la sua attività enzimatica di mille volte (Rodriguez & Lazebnik, 1999): perciò, il tetramero proteasico non è stabile in assenza di questo adattatore molecolare (Chang & al., 2003). Un’altra caratteristica peculiare della caspasi-9 è che nella sua forma attiva di dimero conserva un solo sito attivo funzionale.

2.2.2 Modello di regolazione allosterica

Le caspasi effettrici -3, -6 e -7 esistono a concentrazioni fisiologiche come dimeri preformati: nonostante siano in grado di autoattivarsi in vitro, non c’è evidenza di questa loro capacità negli esperimenti in vivo. E’ probabile che ciò sia dovuto alle loro caratteristiche strutturali. Infatti, la forma inattiva possiede una conformazione ‘chiusa’, che rende inaccessibile il sito catalitico posto sul loop L2. IL taglio dell’Asp198 permette la trslocazione del loop L2′ e la formazione del ‘loop bundle’, struttura che caratterizza l’enzima attivo. Nonostante il meccanismo di attivazione delle caspasi iniziatrici (dimerizzazione) sembri essere distinto da quello delle caspasi effettrici (taglio proteolitico), il meccanismo su cui si basa l’attivazione è conservato (Boatright & Salvesen, 2003): in entrambi i casi è necessaria la traslocazione del loop L2′ in una conformazione che renda il sito accessibile al substrato (Chai & al., 2001). Nel caso delle caspasi effettrici, è pertanto necessario un taglio proteolitico per liberare l’ingombro sterico e rendere l’enzima funzionale.

2.3 Vie di attivazione caspasica
Due sono le cascate di segnali che conducono alla morte cellulare programmata: una è la via estrinseca, iniziata dalle interazioni di ligandi extracellulari a recettori specifici esposti sulla membrana plasmatica; l’altra è quella intrinseca, determinata dagli eventi apoptotici mitocondriali.

8

Introduzione

E’ importante sottolineare che le caspasi sono suscettibili a segnali apoptotici distinti e che uno stesso stimolo può iniziare processi differenti.

2.3.1 Via apoptotica estrinseca

Questa via è mediata dai ‘recettori di morte’, molecole omotrimeriche appartenenti alla superfamiglia del TNFR (Tumor Necrosis Factor Receptor), di cui fanno parte Fas/Apo-1/CD95, DR4 e 5 (recettori di TRAIL, TNF-Related Apoptosis Inducing Ligand). I recettori di morte presentano una sequenza conservata di cisteine ripetute nel dominio extracellulare (Budihardjo & al., 1999) ed una regione di omologia, chiamata dominio DD (Death Domain) nella parte citoplasmatica. Il legame di F a s al suo recettore di morte induce il richiamo dell’adattatore FADD (Fas Associated Death Domain): questo a sua volta recluta attraverso gli omologhi DEDs (Death Effector Domains) le procaspasi-8 e -10. La vicinanza degli zimogeni promuove la dimerizzazione e la conseguente autocatalisi necessaria a rendere l’enzima funzionale nella forma tetramerica: la piattaforma molecolare di sostegno a queste interazioni prende il nome di DISC (Death Inducing Signalling Complex) e da essa vengono rilasciati nel citosol le caspasi attive. Si è visto che FADD è importante anche per la formazione del TRAIL DISC, il macrocomplesso che si crea in seguito al legame di TRAIL ai suoi recettori DR4 e DR5: la cascata di eventi successivi è simile a quella di Fas, per cui si ha l’attivazione di caspasi-8, ed è indipendente dalla via mitocondriale (Walczak & Krammer, 2000). L’attività di caspasi-8 si riflette sugli effetti a valle, cioè la maturazione di procaspasi-3 e -7, che sono così in grado di processare i loro substrati specifici, e di Bid, un membro della famiglia di Bcl2, che, in seguito alla rimozione dell’estremità N-terminale e alla miristolazione del frammento C-terminale (tBid), può migrare ai mitocondri. Questo evento è un anello di giunzione tra le

9

Introduzione

due cascate apoptotiche, in quanto t-Bid in presenza di Bak o Bax, altre due proteine della stessa famiglia di appartenenza, causa il rilascio del cytC nel citoplasma e quindi la formazione dell’apoptosoma. L’interazione tra TNF e TNFR provoca il distacco del suo inibitore SODD (Silencer Of Death Domains) dal dominio intracellulare, che normalmente interagisce con la porzione intracellulare del recettore. TNFR diventa così disponibile al legame con l’adattatore TRADD (TNFR-Associated Death Domain), attraverso i domini DD. Da questo macrocomplesso si dipartono più cascate di segnali, che coinvolgono da un lato FADD e quindi caspasi-8 e -10, e dall’altro CRADD/RAIDD (Caspase and RIP Adaptor with Death Domain), reclutati dall’interazione di TRADD con un secondo interlocutore, RIP (Receptor-Interacting Protein). CRADD è un adattatore che contiene due domini di interazione proteica: tramite il death domain DD prende contatto con RIP, mentre il suo dominio CARD (CAspase Recruitment Domain) lega l’omologo in caspasi-2, permettendone così la dimerizzazione e l’autocatalisi. Caspasi-2 non presenta la stessa attività di caspasi-8 nel processo apoptotico, poiché non è in grado di processare gli altri zimogeni della famiglia caspasica, nonostante sia appurato il suo ruolo nella via apoptotica mitocondriale (Guo & al., 2001; Paroni & al., 2001). Il meccanismo d’azione di questa proteasi non è ancora del tutto chiaro: da una parte, associandosi con RAIDD e PIDD (p53-Induced protein with a Death Domain), forma un complesso stabile, chiamato PIDDosoma (Tinel & Tschopp, 2004). PIDD è una proteina che contiene un dominio di morte DD e una regione ricca di Leu all’estremità N-terminale: la sua espressione è elevata in cellule in cui il processo apoptotico è p53-dipendente: il PIDDosoma sembra così acquisire importanza nella cascata di segnali attivata da p53. D’altra parte, caspasi-2 è in grado di processare Bid, di promuovere la traslocazione di Bax, e la conseguente fuoriuscita dal mitocondrio del cytC ed altri fattori proapoptotici, come AIF (Apoptosis-Inducing Factor), Smac/Diablo, HtrA/Omi. La sua attività

10

Introduzione

ha come conseguenza la formazione dell’apoptosoma e quindi la maturazione delle caspasi esecutrici. Per tali caratteristiche, si ritiene che l’enzima possa influire direttamente sulla via mitocondriale, indipendentemente dalle altre caspasi. In molti casi caspasi-2 è processata da caspasi-3, suggerendo un coinvolgimento della proteasi anche negli step più tardivi dell’apoptosi ed in un’ulteriore amplificazione del processo di morte cellulare programmata.

2.3.2 Via apoptotica intrinseca

Questo meccanismo di attivazione si fonda sul ruolo dei mitocondri e sulle modificazioni a cui sono interessati durante il processo apoptotico. Lo stress a cui tali organelli sono suscettibili può essere causato dall’azione di radiazioni, di agenti chimici o da deprivazione di fattori di crescita. Come già accennato, gli eventi principali della via intrinseca sono la permeabilizzazione della membrana mitocondriale, il rilascio del cytC e di altri fattori pro-/anti-apoptotici nel citosol. Il cytC libero promuove la formazione dell’apoptosoma, attraverso l’interazione con l’estremità C-terminale di Apaf-1: ciò facilita il legame del dATP ad Apaf-1, rendendo così possibile l’oligomerizzazione della molecola. A questo punto, può avvenire il reclutamento di caspasi-9 tramite i domini CARD comuni ad entrambe le proteine. Il macrocomplesso che si forma è responsabile dell’attivazione di caspasi-9, permettendone l’attività proteasica sulle caspasi effettrici -3 e -7. Altri fattori pro-apoptotici sono rilasciati dal mitocondrio: AIF (apoptosisinducing factor), ed endonucleasi G. Entrambi translocano nel nucleo in seguito a stimolo caspasi-dipendente (Arnoult & al., 2003), dove provocano la frammentazione del DNA (Li & al., 2001; Susin & al., 1999). AIF, una flavoproteina con attività NADH ossidasica, una volta rilasciata nel citosol, entra nel compartimento nucleare, dove induce la condensazione della cromatina in frammenti di 50kbp (Susin & al., 1999). Endonucleasi G è una proteina

11

Introduzione

coinvolta nella replicazione del DNA mitocondriale: nel nucleo causa sia la degradazione del DNA ad alto peso molecolare che il taglio dei frammenti nucleosomiali; inoltre coopera con la Dnasi I e l’esonucleasi per facilitarne l’attività di processamento del DNA. Durante l’apoptosi, dal mitocondrio fuoriescono anche molecole inibitorie, quali Smac/Diablo e HtrA2/Omi, che agiscono in qualità di antagonisti delle IAPs (Inhibitors of Apoptosi Proteins), proteine che legano il sito attivo delle caspasi, inattivandole. Entrambi stimolano il processo apoptotico bloccandone gli inibitori, con un meccanismo che verrà trattato in seguito.

C

B A

Fig. 4 Vie di attivazione apoptotica. A.Via intrinseca, rappresentata con la formazione dell’apopptosoma e con l’attivazione di caspasi-9. B. Via estrinseca, mediata dai recettori di morte (rappresentati in figura da Fas). C. Via apoptotica caspasi-dipendente, stimolata dal granzima B, una proteasi che entra nella cellula attraverso i canali formati dalla perforina e trasloca nel nucleo, dove si occupa della frammentazione del DNA.

12

Introduzione

3 Ruolo del mitocondrio nel processo apoptotico

Il mitocondrio ha un ruolo centrale nella vita di una cellula eucariotica. Negli ultimi anni, è diventata evidente la sua importanza nei processi di morte cellulare: questo ruolo non può essere spiegato unicamente da una perdita di funzione e nel conseguente deficit di riserva energetica, di cui, in condizioni normali, il mitocondrio è il generatore. In realtà, gli eventi che colpiscono questo organello sono il risultato di un processo attivo, mediato da meccanismi effettori, regolati in base alle diverse condizioni cellulari. Nell’apoptosi, i principali effetti sulla funzionalità mitocondriale riguardano la perdita del controllo sulla catena respiratoria e sul mantenimento del volume dell’organello, la permeabilizzazione della membrana esterna ai soluti e alle proteine, il calo della differenza del potenziale transmembranario (∆Ψm ). Tutti questi eventi costituiscono un momento essenziale della cascata apoptotica e contribuiscono alla sua prosecuzione.

3.1 Meccanismi e regolatori della permeabilizzazione della membrana mitocondriale
Il mitocondrio può essere definito come la ‘centrale energetica della cellula’: al suo interno, avvengono diversi processi metabolici, quali la respirazione accoppiata alla sintesi di ATP, il catabolismo degli acidi grassi, il ciclo del citrato e quello dell’urea. Per questo, il trasporto di soluti e proteine attraverso il mitocondrio è regolato da trasportatori e canali, in modo da isolare il compartimento mitocondriale dal resto della cellula e renderne possibili le attività peculiari. Il controllo della permeabilità della membrana mitocondriale è affidato ad una famiglia di proteine eterogenee, che prende il nome dal suo capostipite, Bcl-2. I membri di questo gruppo mostrano una o più regioni di omologia con Bcl-2 (Bcl-2 Homology domains, BH). In base alla loro attività, i membri della

13

Introduzione

famiglia di Bcl-2 sono distinti in due classi: gli antagonisti dell’apoptosi, come Bcl-2, Bcl-xL, Bcl-w, che possiedono fino a quattro domini BH (BH1, BH2, BH3, BH4), e i promotori dell’apoptosi, a loro volta suddivisi in multidomain, quando presentano più domini BH (Bax, Bak), “BH3 only”, quando possiedono solo il dominio BH 3 (Bid, Bad, Bim). Entrambe le componenti pro-apoptotiche sembrano necessarie per iniziare il processo: in particolare, le proteine con un solo BH3 sono sensori del danno e antagonizzano Bcl-2 e simili, mentre Bax e Bak sono importanti nei processi a valle. Nonostante le differenze funzionali, tutte queste proteine hanno una struttura terziaria simile, caratterizzata da una sette od otto α eliche, due delle quali sono idrofobiche e quindi possono essere inserite in un bilayer fosfolipidico (Petros & al., 2001). Il dominio transmembranario (TM) posto all’estremità C-terminale è comune a molti membri della famiglia Bcl-2 ed è responsabile dell’inserzione nelle membrane di vari organelli cellulari (Kaufmann & al., 2003).

Fig. 5 Famiglia delle proteine simili a Bcl-2. Rappresentazione schematica dell’omologia strutturale e dei domini BH posseduti dalle diverse sottofamiglie: Sono distinti i fattori anti-apoptotici (Bcl-2, Bcl-xL), con i quattro domini BH, da quelli proiapoptotici, con un solo BH (Bim, Bid, Bad) o più domini BH (Bax, Bak). (Tratto da Nature ReviewsCancer)

Molti membri di questa famiglia sono stati descritti con diverse localizzazioni subcellulari, compreso il citosol, il reticolo endoplasmatico, la membrana nucleare e mitocondriale. Il controllo di questa distribuzione cellulare avviene attraverso meccanismi di regolazione trascrizionale e posttrascrizionali, di eterodimerizzazione, fosforilazione e proteolisi.

14

Introduzione

Le molecole appartenenti ai due sottogruppi della famiglia di Bcl-2 sono in grado di interagire tra loro e regolare la propria attività in diversi modi (Adams, 2003): Bcl-2 (fattore anti-apoptotico) può sequestrare le proteine con un solo BH3 e bloccare la loro capacità di attivare Bak e Bax (fattori proapoptotici); le proteine con un solo BH3 possono legare Bcl-2 e impedire la sua attività inibitoria su Bak e Bax; oppure può accadere che alcune molecole con un solo BH3 attivino Bak e Bax, mentre altre antagonizzino Bcl-2. Questo intreccio di interazioni rappresenta l’importanza e la complessità insita nell’attività delle proteine della famiglia di Bcl-2 e in particolare delle molecole con un unico BH3, quali sensori del danno cellulare. Importante è anche il ruolo delle proteine della famiglia di Bcl-2 nella via apoptotica del mitocondrio. Esistono tre principali teorie riguardo il loro meccanismo di controllo sulla permeabilità della membrana mitocondriale (Juanita C.Sharpe & al., 2003). La prima afferma che queste proteine sono in grado di formare de novo delle strutture canale sui foglietti fosfolipidici: l’ipotesi è sostenuta dal confronto tra la struttura di alcune proteine della famiglia di Bcl-2 e quella della tossina della difterite, in grado di formare pori nelle membrane lipidiche. In particolare, Bcl-x L possiede una struttura ad α eliche con due domini idrofobici centrali molto simile a quella della tossina batterica (Minn & al, 1997). A sostegno di questa teoria, la forma troncata al C-terminale di Bax mostra la capacità di creare dei pori in condizioni di pH neutro (Antonsson & al. 1997). Inoltre, sembra che la proteina ricombinante di Bax sia in grado di associarsi in una struttura canale di quattro molecole, sufficiente al passaggio del cytC, senza l’ausilio di macrocomplessi preformati (Saito & al., 2000). La seconda ipotesi è che possano regolare dei pori proteici pre-esistenti sulla membrana mitocondriale. Come riportato in alcuni studi, Bcl-xL, Bax e Bak interagiscono con il canale anionico voltaggio-dipendente (VDAC), una proteina presente abbondantemente sulla membrana mitocondriale esterna (S. Shimizu & al., 1999). Da un lato si è visto che Bax stimola il rilascio del cytC, ma non di proteine più grandi, in liposomi ricostituiti con VDAC (Shimizu & al., 1999), una

15

Introduzione

canale voltaggio-dipendente che compone il MTP (Mitocondrial Transition Pore). La terza possibilità nasce dalla capacità delle proteine della famiglia di Bcl-2 di alterare le membrane, per produrre dei pori lipidici. Si è visto che Bax è in grado di formare pori lipidici che causano la rottura della membrana fosfolipidica e può essere ostacolato in questa sua attività da Bcl-xL . Bax interagisce direttamente con i lipidi, provocando una deformazione del bilayer di membrana: agisce preferenzialmente su fosfolipidi in cui la componente polare è predominante su quella acilica, causandone una curvatura positiva, un’alterazione che porta ad una struttura convessa. Al contrario, la forma troncata di Bid, tBid, mostra più affinità per fosfolipidi in cui la porzione acilica è maggiore di quella polare e quindi ha la tendenza opposta ad indurre una curvatura negativa (struttura concava) del doppio strato lipidico (Basanez & al., 2002). La capacità di alterare la permeabilità mitocondriale potrebbe essere causata dalle alterazioni della stessa membrana mitocondriale esterna, da parte di queste proteine. Bid, inoltre, interagisce, attraverso il suo dominio BH3, con Bak e Bax, inducendo nel primo l’oligomerizzazione e nel secondo anche l’esposizione dell’epitopo all’N-terminale, in modo da renderlo adatto all’inserimento e alla permeabilizzazione del mitocondrio (Sharpe & al., 2003).

Fig. 6 Ruolo delle proteine della famiglia di Bcl-2 nella permeabilizzazione della membrana mitocondriale. Queste favoriscono il rilascio di fattori proapoptotici dal mitocondrio attraverso la formazione di pori, l’eterodimerizzazione tra membri pro- ed anti-apoptotici, l’interazione con le caspasi tramite molecole adattatrici, l’interazione con altre proteine mitocondriali, come VDAC e la formazione di canali ionici. (Tratto da Nature, 2000)

16

Introduzione

3.2 Meccanismi e regolatori della transizione del potenziale di membrana mitocondriale
Il rilascio di molecole coinvolte nell’apoptosi dal compartimento mitocondriale è la conseguenza dell’apertura del MTP (Mitocondrial Transition Pore). Questo evento può essere determinato dal rilascio del Ca++ dal reticolo endoplasmatico o dall’interazione delle proteine della famiglia di Bcl-2 con il canale stesso. L’ MTP è un canale proteico voltaggio-dipendente, posto sulla membrana mitocondriale interna, che non è selettivo per alcun catione, a parte per il Ca+ +. La sua apertura determina il passaggio di soluti con massa molecolare maggiore ai 1500Da, che causa una transizione della permeabilità (PT) della membrana mitocondriale interna. La differenza del potenziale transmembranario (∆Ψm ) è un gradiente elettrochimico responsabile della separazione di carica all’interno della membrana mitocondriale interna ed è l’evento iniziale alla base della conservazione dell’energia. Gli elettroni che derivano dall’ossidazione dei substrati sono convogliati all’ossigeno attraverso i complessi redox della catena respiratoria, e questo processo è accoppiato all’espulsione di ioni H+ dalle pompe redox dei complessi I, III e IV. Poiché il trasporto passivo di ioni H+ e di altri cationi ed anioni è generalmente basso, l’eflusso di ioni H+ garantisce il mantenimento del gradiente elettrochimico. Nel processo apoptotico, la capacità del mitocondrio di gestire questo differenziale di potenziale viene meno. Il fenomeno si osserva in seguito all’accumulo del Ca++ nella matrice mitocondriale: certi stimoli apoptotici, come l’acido arachidonico e i radicali dell’ossigeno, inducono la fuoriuscita dello ione dal reticolo endoplasmatico. Se i sistemi di efflusso Na+ + dipendenti o indipendenti sono saturati, la concentrazione citoplasmatica di Ca++ aumenta e lo ione è spinto ad entrare nel mitocondrio attraverso l’MTP (Bernardi & al., 1999): questo evento induce il rigonfiamento della matrice e il conseguente calo del potenziale della membrana mitocondriale. L’entrata di soluti ed acqua nella

17

Introduzione

matrice mitocondriale inducono un aumento della pressione interna al mitocondrio e quindi la rottura della membrana mitocondriale esterna. Attraverso il bilayer fosfolipidico così disgregato, le proteine contenute nel mitocondrio sono libere di diffondere nel citoplasma: in particolare, le riserve di cytC sono fortemente intaccate. Mentre la permeabilizzazione della membrana mitocondriale causa il rilascio di circa il 10-15% del cytC totale, il rigonfiamento dovuto all’entrata del Ca++ ne provoca un rilascio massiccio, con conseguenze importanti sulla respirazione mitocondriale e quindi sul calo del potenziale (Bernardi & al., 1999). La respirazione mitocondriale procede fintanto che il cytC ha una concentrazione sufficiente, nonostante risulti diluito nel volume cellulare totale: nel tempo, la concentrazione di cytC si riduce ulteriormente. A questo punto anche la respirazione non è più funzionale e la concentrazione intracellulare di ATP cala drasticamente: di conseguenza, il differenziale di potenziale mitocondriale non è più mantenuto, e il mitocondrio perde il controllo sull’import proteico (Kuwana & Newmeyer, 2003). Le proteine della famiglia di Bcl-2 (Bax) sono in grado di regolare questa via, proprio grazie alla loro capacità di creare o alterare i pori di membrana e alla loro localizzazione nel reticolo endoplasmatico: tali caratteristiche possono garantire un collegamento tra il segnale dovuto al rilascio del Ca++ e gli eventi che sconvolgono il trasporto proteico del mitocondrio. Bax è presente come monomero, libero nel citosol e parzialmente attaccato alle membrane: si inserisce nella bilayer mitocondriale solo se stimolato da un segnale, via recettori di morte, ad un cambio conformazionale, che porta alla omooligomerizzazione e all’inserzione della sua coda C-terminale idrofobica, prima nascosta in una tasca, all’interno del doppio strato lipidico. Qui, colocalizza assieme a Bak, che normalmente risiede nel mitocondrio in complessi focali, e provoca un aumento dello stress sulla curvatura di membrana e quindi la formazione di pori lipidici: le caspasi, attivate dal cytC e da Smac/Diablo rilasciati, possono entrare nel mitocondrio per processare substrati importanti nella catena di trasporto degli elettroni e causare perciò un calo dell’attività respiratoria mitocondriale ed un aumento di produzione dei radicali dell’ossigeno. Le riserve intracellulari di ATP riescono a mantenere per un certo

18

Introduzione

periodo un livello minimo di potenziale mitocondriale, grazie all’azione dell’ATP sintasi. Con la deplezione dell’ATP, avviene la perdita del differenziale di membrana, le proteine non sono più importate al mitocondrio, ma presumibilmente degradate. In questo caso, il processo è un evento caspasidipendente a valle del rilascio del cytC e non il risultato di una depolarizzazione (Ricci & al., 2003). L’importanza di Bax e Bak nella regolazione della distribuzione del Ca++ durante l’apoptosi è stata dimostrata tramite esperimenti condotti con topi knock out per queste due proteine: l’evidenza è stata di un calo della concentrazione endoplasmatica e di un diminuito importo mitocondriale del Ca++ (Scorrano & al., 2003). Il collegamento tra la via del reticolo endoplasmatico e del mitocondrio sono offerte dall’attività di Bax e delle altre proteine con un solo dominio BH3: queste molecole sono normalmente bloccate dai fattori anti-apoptotici Bcl-2 e Bcl-xL, che le sequestrano in sede citoplasmatica. Studi recenti hanno dimostrato che Bcl-2, se fosforilato, perde affinità per questi substrati e ne facilita l’azione, favorendo la fuoriuscita del Ca++ dal reticolo endoplasmatico e la permeabilizzazione della membrana mitocondriale (Bassik & al., 2004).

Fig. 7 Meccanismo del calo del potenziale mitocondriale di membrana e della fuoriuscita del cyt C dal mitocondrio. A. In condizioni di normale funzionalità del mitocondrio, il cyt C è contenuto nello spazio intermembranario. B. Quando l’MPT si trova nella conformazione aperta, è permesso il flusso di soluti ed H2 O nella matrice mitocondriale. C. L’aumento di pressione idrostatica conseguente, causa la rottura della MME e quindi il rilascio massiccio di cyt C nel citoplasma. (Tratto da Bernardi & al., Eur. J. Biochem., 1999)

19

Introduzione

4 Meccanismi di inibizione dell’attività caspasica

Le caspasi sono costitutivamente espresse dalla cellula, nella loro forma inattiva: in ragione di ciò, è naturale supporre che esista un sistema di regolazione della loro attività, in modo da evitare una morte cellulare indesiderata. Molti processi cellulari intervengono a questo livello: le caspasi sono soggette a modulazione trascrizionale e a modificazioni post-trasduzionali. Inoltre, possono essere eliminate permanentemente attraverso la via di degradazione proteosomica mediata da ubiquitinazione. Sono state identificate molte molecole aventi un ruolo di controllo sulle caspasi, sia in qualità di soppressori che di antagonisti di questa inibizione. La famiglia di inibitori apoptotici più nota è quella delle IAPs (Inhibitors of Apoptosis Proteins). Le IAPs sono state identificate per la prima volta nel genoma dei baculovirus per la loro capacità di bloccare l’apoptosi nelle cellule infettate dal microrganismo. Sono caratterizzate dalla presenza di uno o più domini BIR (Baculovirus IAP Repeat), indispensabili per l’interazione con le caspasi. Sono state isolate nei mammiferi otto diverse IAPs, tra cui XIAP, che hanno come bersaglio le caspasi-3, -7 e -9 (Deveraux & Reed, 1999). Queste interazioni sono altamente specifiche, come appurato tramite diversi studi mutazionali (Sun & al., 1999): inoltre le IAPs non agiscono su altre caspasi, come la caspasi-6 e -8. L’unità funzionale delle IAPs, BIR, è un dominio di 80 amminoacidi al cui interno è ospitato un atomo di Zn++. In XIAP, si trovano tre domini BIR, ognuno dei quali esibisce una funzione diversa: BIR1 e BIR2 inibiscono le caspasi-3 e -7, occupando il sito attivo e bloccando l’accesso ai substrati (Fesik & Shi, 2001). BIR3, invece, blocca potentemente l’attività della caspasi-9, legandosi all’N-terminale della subunità minore, che viene esposto dopo il taglio proteolitico; questo segmento, accessibile al legame con BIR3, contiene una sequenza di quattro amminoacidi, comune anche ad altre due molecole, recentemente isolate come inibitori di XIAP, SMAC/DIABLO e HtrA2/Omi. In seguito alla permeabilizzazione della membrana mitocondriale, queste due proteine vengono rilasciate nel citosol e antagonizzano l’inibizione

20

Introduzione

delle caspasi tramite il loro dominio di interazione con le IAPs (IBM, IAP Binding Motif). Studi strutturali dimostrano che il dimero SMAC lega il dominio BIR2 di XIAP e permette l’attivazione di caspasi-3. La sua forma monomerica spiazza la caspasi-9 dal legame con XIAP utilizzando un IBM simile. Il meccanismo d’azione di HtrA2/Omi per inattivare irreversibilmente le IAPs è invece basato sul loro processamento (Yang & al., 2003). Le IAPs non sono i soli inibitori naturali delle caspasi. In contrapposizione a XIAP, che blocca solo caspasi-3, -7 e -9, la proteina baculovirale p35 è un inibitore generico di queste proteasi. La sua attività è correlata con la traslocazione della sua parte N-terminale all’interno del sito catalitico caspasico, impedendo il legame con i substrati. Un’altra proteina derivata dal cowpox virus, la serpina CrmA, è in grado di inibire molte caspasi tramite un meccanismo simile: in particolare blocca selettivamente sia la maturazione della caspasi-8 (Zhou & al., 1996), che la sua attività su Bid. Esistono anche meccanismi di inibizione dell’apoptosi nella via mediata da recettori di morte: un gruppo di inibitori appartiene ad una famiglia di proteine virali, vFLIPs (viral FADD-Like ICE Inhibitory Proteins), che contengono due domini DEDs, attraverso cui competono con le procaspasi per il legame a FADD. Cellule transfettate con FLIP diventano resistenti all’apoptosi dipendente da questa via. L’omologo di vFlip nell’uomo è cFlip, una proteina che si può trovare in due forme di splicing: la più corta si comporta come vFlip, mentre la più lunga possiede un dominio C-terminale simile a quello di caspasi8. La funzione di cFlip non è del tutto chiara, nonostante la sua attività antiapoptotica sia evidente (Walczak & Krammer, 2000). I recettori TRAIL-R3 e - R4 si comportano come decoy receptors: sono strutturalmente simili a DR4 e DR5, ma con un dominio di morte troncato, tramite cui sottraggono il ligando TRAIL e bloccano la via apoptotica (Walczak & Krammer, 2000). In tessuti umani sani, TRAIL-R3 e -R4 sono presenti più abbondantemente che nei tessuti tumorali, indicando come una maggiore sensibilità all’apoptosi in cellule cancerose possa essere connessa al calo di espressione di questi recettori. Come visto anche in precedenza, nel caso del TNFR, in assenza di TNF,

21

Introduzione

SODD funziona da silenziatore del recettore: lega il suo death domain fintanto che non riceve l’appropriato stimolo extracellulare, che ne induce il distacco e libera il dominio di interazione con gli adattatori molecolari opportuni (Budihardjo & al., 1999).

5 Principali substrati delle caspasi

Le caspasi sono enzimi molto selettivi, nonostante ciò aggrediscono numerosi substrati. Queste proteasi processano componenti strutturali del citoscheletro, del nucleo, così come proteine coinvolte nelle vie di trasduzione del segnale. Occorre sottolineare che alcuni substrati sono degradati in momenti diversi e più o meno completamente di altri; che certi bersagli delle caspasi sono cellulo-specifici; che alcune proteine sono degradate in siti differenti a seconda del tipo cellulare. Tutta questa eterogeneità riflette più evidenze: l’attivazione di molteplici set di proteasi in altrettanti distinti tessuti; la variazione nell’accessibilità di certi substrati caspasici come una conseguenza del differenziamento cellulare; entrambe le cose.

La caratteristica principale dei substrati caspasici consiste nel possedere uno specifico sito di taglio di quattro amminoacidi (P4-P3-P2-P1) del tipo DXXDX, dove X sta per qualsiasi amminoacido. Man mano che sono progrediti gli studi sull’attività proteasica delle caspasi, sono aumentate anche le informazioni sulle loro possibili molecole bersaglio. Le proteine finora identificate sono circa 280, ma non per tutte è ancora chiaro il significato biologico del processamento. Uno studio su una libreria combinatoriale di sequenze substrato, condotto da Thornberry e colleghi, ha permesso di identificare tre gruppi di caspasi distinti per riconoscere in modo specifico dei peptidi diversi. Il gruppo I

22

Introduzione

(caspasi-1, -4 e -5) ha maggiore affinità per il tetrapeptide WEHD. Il motivo peptidico di riconoscimento migliore per il gruppo II (caspasi-2, -3 e -7) è DEXD: la specificità dimostrata da caspasi-3 e -7 per questa sequenza è

particolarmente simile e quasi indistinguibile. Il peptide specifico per il gruppo III (caspasi-6, -8 e -9) è (L/V)EXD (Thornberry & al., 1997). Un paragone tra le sequenze riconosciute da questi enzimi rivela che, a parte il vincolo restrittivo posto dall’Asp in posizione P1 , comune a tutte, è l’amminoacido in P4 a determinare la specificità del riconoscimento peptidico. I membri del gruppo I possono ospitare in questa posizione amminoacidi con gruppi aromatici o idrofobici, mentre quelli del gruppo II richiedono un Asp per una catalisi efficiente. Le caspasi del gruppo III accettano diversi residui in P4, ma preferiscono quelli con una catena laterale alifatica. Tutti questi enzimi accettano, con diversi gradi di permissività, un residuo di Glu in posizione P3. Inoltre, in generale, qualsiasi sostituzione è possibile in P2 (Thornberry & al., 1997). È ragionevole credere che la specificità delle interazioni delle caspasi con i peptidi sia mantenuta anche nel riconoscimento delle macromolecole: infatti molti dei motivi tetrapeptidici si ritrovano in alcuni substrati noti. Le numerose proteine bersaglio dell’attività caspasica si distinguono per attività, funzione e localizzazione subcellulare (Choen, 1997; Chang & Yang, 2000; Fisher & al., 2003). In ragione della diversa distribuzione cellulare delle caspasi e delle loro specificità, i substrati che processano sono molto eterogenei e dimostrano come la funzione di queste proteasi coinvolga l’intero apparato cellulare e ne determini le sorti. Alcuni esempi di proteine substrato delle caspasi sono elencati nella tabella 1 (Tratta da Fisher & al., 1999).

23

Introduzione

Proteina Proteine strutturali
α Fodrina Gas 2 Lamina A/B β catenina

Funzione

Sito di taglio Effetto del taglio

Referenze

Componente del DETD citoscheletro corticale Componente del citoscheletro Componente della lamina nucleare Componente delle giunzioni cellulari SRVD/G VEI/VD DCMD SYLD ADID TQFP

Blebbing della membrana Martin & al., 1996 plasmatica Riordinamento del citoscheletro Disassemblaggio della lamina nucleare Disassemblaggio delle giunzioni cellulari Brancolini C. & al., 1995 Lazebnik & al., 1995 Brancolini & al., 1997

Proteine coivolte nella trasduzione del segnale
MEKK-1 PKCd Rb NF-kB Proteina chinasi Proteina chinasi Regolatore del ciclo cellulare DTVD (mouse) DMQD DEAD Costitutivamente attiva, proapoptotica Chinasi costitutivamente attiva, proapoptotica Promuove l'apoptosi Il taglio genera un frammento proapoptotico Cardone M. H. & al., 1997 Emoto Y. & al., 1995 Janicke & al., 1996 Ravi & al., 1998

Fattore di trascrizione VFTD

Metabolismo del DNA/RNA
DNA-PK PARP Enzima di riparo del DNA Enzima di riparo del DNA DEVD DEVD Cala l'attività C a la l a s i ntes i di po ly ( A D P - r ibo s e) Casciola R. L. & al., 1996 Kaufmann & al., 1993

Proteine coinvolte nell'apoptosi
Bcl-2 Bcl-xL Bid Bax Inibitore dell'apoptosi Inibitore dell'apoptosi Attivatore dell'apoptosi Attivatore dell'apoptosi Inibitore della Dnasi CAD DAGD HLAD/ SSLD LQTD FIQD DETD/ DAVD Si genera un frammento proapoptotico Si genera un frammento proapoptotico Si genera un frammento proapoptotico miristolato Sconosciuto Il taglio libera la CAD attiva Cheng & al., 1997 Bellows & al., 2000 Li & al., 1998 Yanase & al.,2000 Enari & al., 1998

ICAD

Proteine coinvolte nelle patologie neurodegenerative
Huntingtina Proteina coinvolta nel morbo di Huntington DSVD/ DEED/ IVLD Forma degli aggregati Wellington & al., 2000

Tab. 1 Alcuni substrati caspasici. (Tratto da Fisher & al., 1999)

24

Introduzione

6 Analisi dell’attività apoptotica

Nel processo apoptotico, l’attività caspasica ha un ruolo centrale documentato da diverse evidenze: la sovraespressione di queste proteasi induce la morte cellulare in modo efficiente; i loro inibitori naturali o sintetici bloccano l’apoptosi causata da molteplici stimoli; animali knockout per certe caspasi mostrano importanti deficit nel processo di suicidio cellulare. Poiché l’attivazione caspasica è un fenomeno caratteristico del processo apoptotico, è possibile distinguerla dalla necrosi, in cui queste proteasi non hanno nessun ruolo (Kohler & al., 2002). Per questo, lo studio dell’attivazione delle caspasi acquista un significato rilevante per monitorare le condizioni patologiche, in cui il processo apoptotico è deficiente o sovrastimolato: comprendere i meccanismi di regolazione caspasica in maggiore dettaglio ed essere in grado di manipolarli può diventare utile nel trattamento delle malattie in cui le anomalie sono a carico del programma di suicidio cellulare.

6.1 Studio dell’attività caspasica
In vitro, si può studiare il processamento dei pro-enzimi, meccanismo tramite cui le caspasi diventano attive, attraverso la tecnica dell’immunoblotting. I campioni proteici ottenuti da lisati di cellule apoptotiche, opportunamente separati tramite elettroforesi su gel di acrilamide e trasferiti su filtro di nitrocellulosa, vengono ibridati con anticorpi specifici per il riconoscimento delle proteine di interesse, in questo caso le caspasi. I processamento di queste proteasi si può così identificare nella comparsa delle subunità maggiore e minore dell’enzima maturo. Con lo stesso sistema, viene analizzato il processamento di substrati naturali, noti per essere tagliati dalle caspasi. L’uso di substrati ed inibitori marcati radioattivamente è un’alternativa ai saggi di immunoblotting. Ad esempio, la sonda [125I]-M808 è stata utilizzata, in qualità di substrato catalitico delle caspasi, per l’analisi del processamento enzimatico in vitro, su estratti cellulari e tissutali, e in vivo , per visualizzare

25

Introduzione

direttamente l’attività e la localizzazione delle proteasi apoptotiche all’interno delle cellule (Methot & al., 2004). Attraverso tecniche fluorometriche, si può analizzare il processamento di substrati sintetici, peptidi coniugati a fluorocromi, che contengono delle sequenze di taglio riconosciute da una o più caspasi. In questo modo si può monitorare il rilascio della fluorescenza come conseguenza del taglio proteolitico caspasico. È interessante anche l’applicazione di inibitori naturali o sintetici in grado di bloccare selettivamente le caspasi, legandone il sito attivo in modo reversibile o irreversibile. Uno dei metodi da menzionare a questo proposito, è l’utilizzo dell’ELISA (Enzyme-Linked Immunosorbent Assay) e di inibitori irreversibili marcati con biotina. Il peptide biotinilato, legato al substrato adeso alla piastra, viene riconosciuto dalla streptavidina coniugata ad una perossidasi: con l’aggiunta del substrato chemiluminescente, l’interazione si traduce in un segnale che corrisponde al legame tra inibitore e caspasi (Kohler & al., 2002). L’analisi in vivo offre la possibilità di monitorare le differenze nell’attivazione caspasica di ogni cellula e di avere una visione globale della risposta, spesso eterogenea, dell’intera popolazione cellulare allo stimolo apoptotico (Morgan & Thorburn, 2001). Esistono diversi metodi per seguire l’apoptosi in vivo. Alcuni non misurano l’attività caspasica direttamente, ma si limitano all’osservazione delle alterazioni della morfologia cellulare, della frammentazione del DNA, dell’esposizione di molecole sul versante extracellulare della membrana plasmatica o della comparsa di eventi dipendenti dal processamento caspasico. Molti di questi saggi richiedono la fissazione delle cellule e non permettono di seguire con continuità il processo di morte, precludendo così qualsiasi analisi sulla sua cinetica. Recentemente sono stati sviluppati molti sistemi che permettono una misurazione continua dell’attività caspasica su singola cellula. Alcuni utilizzano

26

Introduzione

la tecnica della FRET (Fluorescence Resonance Energy Transfer) per evidenziare le interazioni tra caspasi e substrato. Quando due molecole fluorescenti, con uno spettro di emissione ed eccitazione sovrapposti, come GFP (Green Fluorescent Protein) e i suoi derivati YFP (Yellow Fluorescent Protein) e CFP (Ciano Fluorescent Protein), si trovano ad una distanza ravvicinata di circa 10-50Å, l’energia emessa dalla proteina che viene eccitata ad una lunghezza d’onda inferiore (donatrice), permette all’altra (accettrice) di emettere fluorescenza: quindi il segnale di emissione dovuto alla seconda molecola indica l’avvenuta interazione tra le due proteine fluorescenti. Questo è il meccanismo della FRET, che viene sfruttato nell’utilizzo di proteine chimeriche con doppio spettro di fluorescenza, distanziate da un linker di pochi amminoacidi, di lunghezza tale da permetterne l’interazione e lo scambio di energia. Questo segmento è una sequenza di processamento riconosciuta dalle caspasi: quando avviene il taglio, è impedita l’emissione del segnale dovuto alla FRET, perché le due proteine fluorescenti vengono allontanate. L’attivazione caspasica si traduce nel calo della FRET, in quelle cellule in cui la proteina chimerica espressa viene tagliata (Mahajan & al., 1999; Tyas & al., 2000; Morgan & Thorburn, 2000; Luo & al., 2001). Queste cellule possono essere distinte da quelle non-apoptotiche analizzandone la fluorescenza attraverso la citometria di flusso o la microscopia a fluorescenza e confocale (He & al., 2004).

6.2 Studio della funzionalità mitocondriale
Un altro modo per seguire il processo apoptotico in vivo su singola cellula è quello di seguire gli eventi mitocondriali, in particolare la depolarizzazione della membrana e il conseguente rilascio di fattori proapoptotici. Per questo tipo di analisi, vengono utilizzate delle sonde lipofiliche cationiche, in grado di diffondere nel mitocondrio attraverso il doppio strato lipidico, grazie alla loro carica e solubilità. Appartengono a questa classe la safranina, il tetrafenilfosfonio, la carbocianina e i derivati della rodamina. Per

27

Introduzione

poter misurare le variazioni del potenziale di membrana mitocondriale (Ψ m), questi composti devono possedere determinate caratteristiche: devono essere di dimensioni inferiori ai 1500Da e avere caratteristiche idrofobiche, per poter diffondere attraverso il bilayer lipidico; non devono danneggiare la funzionalità del mitocondrio, per esempio interferendo con la respirazione e il mantenimento del Ψm; devono essere facilmente analizzabili, per valutarne la distribuzione all’interno dell’organello. Le sonde lipofiliche sono accumulate nel mitocondrio con una cinetica che segue l’equazione di Nernst e le loro proprietà di fluorescenza subiscono dei cambiamenti in base alle variazioni del gradiente elettrochimico mitocondriale. Quando questo cala e la sonda viene rilasciato dal mitocondrio all’ambiente esterno, si verifica un calo dell’intensità di fluorescenza. La perdita di questo segnale, dipendente da Ψm , costituisce un modo per misurare la depolarizzazione della membrana mitocondriale (Scaduto & Grotyohann, 1999). Purtroppo, queste sonde manifestano in genere una tendenza a legare le componenti mitocondriali: ciò complica il loro uso, in quanto il legame alla superficie esterna del mitocondrio è un evento Ψm-indipendente e quindi non è significativo per quantificare il calo del potenziale transmembranario. Tra le varie molecole, quella che ha caratteristiche migliori è il metil-estere della tetrametilrodamina (TMRM), un derivato della rodamina. TMRM è considerata la molecola migliore per questo tipo di analisi in quanto, dal confronto con gli altri indicatori fluorescenti, risulta quella che si lega di meno allle componenti mitocondriali, non compromettendo così la correlazione tra intensità di segnale e calo del potenziale mitocondriale, che ha il maggiore accumulo nel mitocondrio, senza causare effetti fototossici ed interferire con le normali funzioni mitocondriali (De Giorgi & al., 2002). La lunghezza d’onda di eccitazione preferibile per questo sonda è 546nm, poiché permette di seguire

28

Introduzione

con maggiore sensibilità i cambiamenti della sua distribuzione (Scaduto & Grotyohann, 1999). Un altro indicatore colorimetrico utilizzato per le sue particolari caratteristiche è JC-1, un derivato della carbocianina. JC-1 possiede uno spettro con due picchi di emissione, a 597nm quando si trova nella conformazione multimerica, a 539 quando è sotto forma di monomero. La fluorescenza rossa (587nm) è osservabile quando la sonda si trova in condizioni di alta stringenza ionica, mentre quella verde-arancio (539) se l’ambiente è idrofobico. Entrambi i segnali si possono visualizzare all’interno del mitocondrio, in particolare il multimero rosso è più sensibile ai valori di Ψm più negativi, quindi colora i mitocondri integri. Con il calo del potenziale mitocondriale, la forma monomerica verde, rilasciata in tutta la cellula, prevale su quella rossa, il cui segnale tende a sparire. Per la natura idrofobica del monomero, la fluorescenza verde dipende dal legame di JC-1 alle varie strutture cellulari, per cui solo il calo della fluorescenza rossa è indicativo della transizione del potenziale di membrana. Il rapporto tra l’intensità dei segnali emessi da questa sonda può correlare attività che avvengono in compartimenti cellulari diversi. L’utilizzo degli indicatori sensibili alle variazioni del potenziale transmembranario mitocondriale trova applicazione nella microscopia confocale (Jones & al., 2002), in particolare se associato all’uso di proteine di fusione con GFP, la cui localizzazione all’interno di una cellula apoptotica può essere facilmente visualizzata. Nello studio del processo di morte cellulare programmata, questa tecnica può essere molto utile per analizzare l’intreccio di eventi che hanno sede nel mitocondrio e chiarire la loro reciproca dipendenza. Si possono condurre degli esperimenti di questo tipo per esaminare la correlazione temporale e causale tra l’attivazione caspasica e il rilascio di fattori apoptotici dal compartimento mitocondriale: monitorando la fluorescenza della sonda TMRM, è stato dimostrato, per esempio, che il rilascio del cytC, espresso in fusione con GFP, coincide con il calo del segnale rosso localizzato nel mitocondrio (Düßmann & al., 2002; Rehm & al., 2003).

29

Introduzione

In altri studi viene associato l’uso del TMRM alla tecnica della FRET, sfruttando proteine chimeriche ottenute con GFP e i suoi derivati, separate da sequenze linker, contenenti siti di riconoscimento specifici per le caspasi. In questo modo, è possibile mettere in evidenza le cellule in cui l’attività caspasica è presente, poiché il taglio allontana le due proteine di fusione e causa la perdita del segnale di fluorescenza in assenza del trasferimento di energia. Inoltre si può stimare la correlazione temporale tra questi eventi enzimatici e la denergizzazione del mitocondrio (Tawa & al., 2000). In conclusione, tali tecnologie, affinate negli ultimi anni, consentono il vantaggio di analizzare due aspetti cruciali del processo apoptotico (l’attivazione caspasica e la funzione mitocondriale) in singole cellule, e cogliere l’eterogeneità comportamentale dell’intera popolazione cellulare. Le potenzialità di questi approcci scientifici sono interessanti ed offrono una prospettiva di osservazione molto ampia su un processo tanto complesso ed importante per lo studio di molte patologie.

30

RISULTATI

Risultati

RISULTATI

L’obiettivo di questa tesi è stato quello di sviluppare un nuovo saggio per lo studio dell’attivazione caspasica in vivo su singola cellula, in prossimità della membrana mitocondriale esterna (MME). Lo studio dell’attività caspasica è stato spesso condotto in vivo utilizzando delle sequenze tetrapeptidiche, riconosciute dalle caspasi in base alla loro specificità di substrato e coniugate a traccianti fluorescenti, come GFP, YFP e CFP (Mahajan & al., 1999; Tyas & al., 2000; Morgan & Thorburn al., 2000; Kathy & al., 2001; Tawa & al., 2001; Liusheng & al., 2004; He & al., 2004). Le analisi condotte utilizzando questo tipo di costrutti vengono effettuate tramite la tecnica della FRET (Fluorescent Resonance Energy Transfer), il cui meccanismo è basato sul trasferimento dell’energia tra due fluorofori, espressi come proteina di fusione. La vicinanza dei fluorofori nella chimera, infatti, consente, una volta eccitato il primo, di eccitare spontaneamente il secondo, sfruttando l'energia di emissione del primo. Se nel linker che separa i due traccianti è contenuta una sequenza di taglio caspasico, la perdita del segnale di fluorescenza da FRET indica l’avvenuta attivazione delle caspasi (Mahajan & al., 1999; Tyas & al., 2000; Morgan & Thorburn al., 2000; Luo & al., 2001; Tawa & al., 2002; Liusheng & al., 2004). Per sviluppare un saggio che permetta l’analisi dell’attività caspasica in prossimità del mitocondrio, utilizzando una tecnica di più semplice gestione rispetto alla FRET, abbiamo progettato una proteina chimerica (GFPDEVDHATM) che contiene (Fig.8a): − un fluoroforo (GFP);

31

Risultati − una sequenza di processamento caspasico (DEVD); − un epitopo (HA), utilizzato come target proteico alternativo al GFP, e che presenta un ulteriore sito di processamento caspasico (DVPD); − un segnale di ancoraggio (TM) alla membrana mitocondriale esterna (MME), identico al dominio transmembranario xTMB di BclxL. BclxL é una proteina dalle funzioni antiapoptotiche, appartenente alla famiglia di Bcl-2, che si trova esposta sul versante citosolico della MME. Il suo dominio di localizzazione mitocondriale è caratterizzato da una regione ad α elica adatta ad inserirsi nelle membrane, seguita da uno o due amminoacidi basici (TMB, Trans-Membran and Basic) e preceduta da una sequenza di amminoacidi basici (x), che ne determinano la localizzazione sulla MME. Lo scopo iniziale degli esperimenti è stato quello di caratterizzare il costrutto ideato, dal punto di vista biologico e biochimico, al fine di ottimizzarne l’utilizzo nel saggio di analisi dell’attività caspasica.

1 Analisi della localizzazione cellulare di GFPDEVDHATM
Il costrutto GFPDEVDHATM è stato ideato per creare una proteina che, grazie al dominio TM, fosse in grado di ancorarsi alla MME. Attraverso l’analisi dell’espressione in vivo della proteina chimerica prodotta, è stato possibile verificarne la corretta localizzazione cellulare. Cellule IMR90E1A trasfettate transientemente con GFPDEVDHATM sono state analizzate tramite saggi di immunofluorescenza (Fig.8a). Si sono sfruttate le caratteristiche colorimetriche del GFP (fluorescenza verde) e l’utilizzo di un anticorpo specifico per l’HA, coniugato ad un tracciante di colore diverso (TRITC, fluorescenza rossa), per seguire la localizzazione del costrutto. L’analisi ha dimostrato la presenza della proteina chimerica nel compartimento mitocondriale, confermato dalla doppia

32

Risultati marcatura con il citocromo C (dato non presentato) ed ha giustificato la possibilità di utilizzare entrambi gli epitopi come ”target” di localizzazione in vivo (Fig.8a).

2 Analisi del processamento di GFPDEVDHATM in vivo
Per dimostrare se la chimera potesse esser utilizzata per monitorare in vivo l’attivazione caspasica durante l’apoptosi abbiamo analizzato la localizzazione sub-cellulare della chimera durante l’induzione dell’apoptosi: l'attività caspasica, infatti, dovrebbe indurre la rilocalizzazione del fluoroforo dal mitocondrio al citoplasma in seguito al taglio della sequenza consensus caspasica ed alla successiva separazione del dominio di transmembrana dalla molecola di GFP. A causa della cinetica veloce che caratterizza gli ultimi eventi della cascata apoptotica, è difficile mettere in evidenza la rilocalizzazione nel citoplasma della proteina chimerica in cellule fissate su vetrino. Per questo motivo, è stata adottata la tecnica del time-lapse, che permette di seguire nel tempo in vivo la localizzazione della proteina chimerica. Parallelamente al monitoraggio della fluorescenza di GFP, è stato scelto di seguire anche il segnale della sonda lipofilica TMRM (Tetra Methyl Rodamine Metyil ester), un sensore delle variazioni del potenziale di membrana mitocondriale (∆Ψm) (Rehm & al., 2003), utile per esaminare la correlazione temporale, durante il processo apoptotico, tra l’attivazione caspasica e la perdita di funzionalità del mitocondrio. A questo scopo, le cellule IMR90E1A sono state microiniettate con il costrutto GFPDEVDHATM e trattate con TMRM. Il processo apoptotico è stato indotto somministrando etoposide ed i dati raccolti hanno dimostrato che in corrispondenza del calo di ∆Ψm, segnalato dalla perdita della fluorescenza rossa mitocondriale, vi è la traslocazione dal mitocondrio al citoplasma della fluorescenza del GFP (Fig.8b).

33

Risultati

3 Analisi del processamento di GFPDEVDHATM in vitro
La rilocalizzazione nel citoplasma della proteina chimerica durante il processo apoptotico suggerisce che effettivamente la sequenza DEVD funzioni come bersaglio caspasico. Per dimostrare che il GFPDEVDHATM è processato dalle caspasi, abbiamo eseguito degli esperimenti di immunoblotting, usando lisati ottenuti da cellule IMR90E1A trasfettate con il costrutto e trattate per 18h con etoposide (Fig.8c). Per evidenziare il processamento della chimera si è deciso di raccogliere separatamente le cellule adese (vitali, V) da quelle non adese (apoptotiche, M), del campione trattato con il farmaco. In questo modo, utilizzando un anticorpo contro il GFP, è stato possibile rilevare la banda attesa di 29kDa, corrispondente alla forma processata della proteina, solo nelle cellule morte per apoptosi. Gli stessi lisati sono stati utilizzati per testare il processamento di un classico marker apoptotico, PARP, il quale a sua volta contiene la sequenza di taglio DEVD, riconosciuta dalle caspasi-3 e -7 (Kaufmann & al, 1993). La comparsa della banda di processamento di PARP (85kDa) nel campione di cellule apoptotiche, ha confermato l’attivazione delle caspasi nelle condizioni sperimentali descritte (Fig.8c). Per seguire nel tempo la dipendenza del processamento di

GFPDEVDHATM dall’attivazione caspasica, è stata condotta un’analisi temporale su cellule IMR90E1A trasfettate con il costrutto e trattate con etoposide (Fig.8d). Anche in questo caso PARP è stato utilizzato come controllo positivo dell’attivazione delle caspasi. Il confronto con l’intensità della banda di 85kDa di PARP indica che l'entità del processamento di GFPDEVDHATM risulta massimamente evidenziabile intorno alle 18h (Fig.8d). L’attivazione delle caspasi-3 e -7 è un evento finale della via apoptotica, punto di connessione tra cascate di segnale indotte da diversi stimoli. L’etoposide, in qualità di inibitore della topoisomerasi II, induce la morte cellulare mediata dalla via intrinseca, che coinvolge il mitocondrio (Robertson & al., 2002). Per confermare il processamento di GFPDEVDHATM durante

34

Risultati l’apoptosi sono stati utilizzati altri stimoli proapoptotici, quali: un inibitore delle deacetilasi degli istoni, la tricostatina A (TSA) (Henderson & al., 2002) ed un inibitore del proteasoma, l’ MG-132 (Huang & Sheikh, 2004). La risposta a questi trattamenti determina, in modo analogo all’etoposide, il processamento della proteina chimerica GFPDEVDHATM (Fig.8e). Gli stessi lisati sono stati utilizzati per esperimenti di immunoblotting su un’altra proteina bersaglio delle caspasi, la deacetilasi degli istoni 4 (HDAC4) (Paroni & al., 2004), utilizzata come controllo dell’avvenuto processo apoptotico e dell’attivazione caspasica (Fig.8e). Per confermare ulteriormente la dipendenza del taglio proteolitico dall’attività caspasica, cellule IMR90E1A trasfettate con GFPDEVDHATM sono state trattate con etoposide e BOC-fmk, un inibitore delle caspasi (Decker & al., 2001; Dai & al., 2002) (Fig.8f). A differenza delle cellule trattate con etoposide in assenza dell’inibitore, in cui è evidente la banda processata, l’attività dell’inibitore riduce notevolmente il processamento di GFPDEVDHATM quando presente (Fig.8f). L’immunoblotting su HDAC4 conferma l’inibizione della funzionalità caspasica da parte del BOC-fmk (Fig.8f). L’azione dell’inibitore e’ stata confermata anche valutando la percentuale di cellule positive alla colorazione con Trypan Blue che, nei campioni trattati con etoposide e BOCfmk, risulta ridotta del 90% rispetto ai campioni trattati solo con lo stimolo proapoptotico. Da questi esperimenti possiamo dire che la proteina chimerica GFPDEVDHATM ha localizzazione mitocondriale e che, in cellule apoptotiche, subisce un processamento, dipendente dall'attività caspasica, rilevabile in vivo nella traslocazione della fluorescenza del GFP dal mitocondrio al citoplasma.

35

Risultati

Fig. 8 GFP DEVD HA TM ha localizzazione mitocondriale. In seguito ad attivazione apoptotica viene processato in maniera caspasi-dipendente ed il fluoroforo diffonde nello spazio periplasmatico. a) Rappresentazione schematica di GFPDEVDHATM, composto dal tracciante fluorescente (GFP), dalla sequenza consensus di taglio caspasico (DEVD), dal target carbossiterminale (HA) e dalla sequenza di ancoraggio alla membrana mitocondriale (TM). b) Alcune immagini di un time laps su cellule IMR90E1A iniettate col costrutto e trattate con etoposide 42,5µM. Le immagini sono mostrare come pseudo-colori. c) Western blot su cellule IMR90E1A trasfettate co.n GFPDEVDHATM trattate con etoposide 42,5µM (18h) e raccolte separando la frazione apoptotica. d)Time course effettuato a 12h, 18h e 24h di trattamento con etoposide 42,5µM. e) Western blot su cellule IMR90E1A trasfettate col costrutto e raccolte dopo 18h di trattamento con diversi stilmoli apoptotici (etoposide 42,5µM, MG-132 2,5µM, TSA 1µM). f) Western blot su cellule IMR90E1A trasfettate col costrutto, trattate con etoposide in assenza o presenza di un inibitore delle caspasi (BOC-fmk 125µM) e relative conte al Trypan Blue. 36

Risultati

4 Analisi dell’influenza della sovrespressione di GFPDEVDHATM sul processo apoptotico
Il costrutto GFPDEVDHATM è stato ideato inserendo come segnale di localizzazione mitocondriale il dominio transmembranario xTMB di BclxL (TM), un membro della famiglia di Bcl2 con funzione antiapoptotica (Kaufmann & al., 2003; Jeong & al., 2004). Allo scopo di studiare se l’espressione della proteina chimerica potesse avere effetto sul processo di morte cellulare programmata, è stata creata una linea cellulare di U2OS esprimente stabilmente GFPDEVDHATM. Inizialmente e’ stato analizzato il processamento della chimera trattando con etoposide cellule U2OS che esprimono in modo stabile GFPDEVDHATM e, come controllo, cellule U2OS che esprimono in modo stabile GFP. I lisati cellulari del campione trattato con lo stimolo apoptotico sono stati raccolti separando le cellule adese (vitali, V) da quelle non adese (apoptotiche, M): questo ha permesso di rilevare il processamento di GFPDEVDHATM, dopo 48h di trattamento con etoposide. La presenza nel lisato di cellule apoptotiche di una scarsa quantità di prodotto di processamento potrebbe essere spiegata con un processo di degradazione dello stesso: eventi di degradazione proteica, infatti, sono tipici di popolazioni cellulari in avanzata apoptosi. Il processamento della proteina chimerica, inoltre, è stato confermato anche dall’analisi, mediante la tecnica dell’immunoblotting, della presenza dell’epitopo HA. I lisati apoptotici non rivelano positività all’anticorpo specifico per il riconoscimento dell’HA: ciò indica che il processamento di GFPDEVDHATM causa anche la perdita di questo epitopo (Fig.9a). Per seguire nel tempo il comportamento delle cellule U2OS, che esprimono stabilmente GFPDEVDHATM e GFP, si è deciso di fare un’analisi

37

Risultati temporale a 6h, 12h, 24h, 36h e 48h. Parallelamente, si è analizzato il processamento di PARP quale controllo dell'attività caspasica (Fig.9b). Questi studi indicano che analogamente a quanto osservato nelle linee cellulari esprimenti in maniera transiente la proteina GFPDEVDHATM, anche nelle linee stabili il processamento della chimera è evidenziabile in risposta ad uno stimolo apoptotico e l'entità di tale processamento aumenta all'aumentare della percentuale di morte cellulare osservata. Lo studio della risposta apoptotica nelle linee di cellule U2OS esprimenti stabilmente il GFPDEVDHATM e il GFP è stato condotto mediante l’utilizzo dell’analisi al citofluorimetro (Fig.9c) e della colorazione vitale con il Trypan Blue (Fig.9d). L’analisi del ciclo cellulare dopo trattamento con etoposide per 24h e 48h, ha permesso di evidenziare un incremento della popolazione di cellule nella fase subG1 (apoptotiche), dipendente dal tempo di somministrazione dello stimolo proapoptotico e paragonabile nei due stabili (Fig.9c). Anche il conteggio delle cellule non vitali mediante colorazione con il Trypan Blue, ha confermato che l’espressione di GFPDEVDHATM non influenza il tasso di morte cellulare indotto da etoposside (Fig.9d).

38

Risultati

Fig. 9 Analisi dell'influenza della sovrespressione di GFP DEVD HA TM sul processo apoptotico. a) Western blot sugli stabili U2OS-GFPDEVDHATM e U2OS-GFP trattati con etoposide (42,5µM; 18h): la frazione di cellule non adese (apoptotiche) é stata raccolta separatamente. b) Time course effettuato sugli stabili a 6h, 12h, 18h, 24h e 48h di trattamento con etoposide 42,5µM. c) Analisi, tramite la tecnica del FACS, del ciclo cellulare ed in particolare della popolazione apoptotica sugli stabili U2OS-GFPDEVDHATM e U2OS-GFP trattati con etoposide 42,5µM. d) Analisi della percentuale di cellule apoptotiche in seguito a trattamento con etoposide 42,5µM, tramite colorazione col Trypan Blue.

Trypan Blue

39

Risultati

5 Caratterizzazione dei siti di taglio di GFPDEVDHATM
Gli studi precedenti avevano indicato che la proteina chimerica progettata potrebbe essere adatta all’analisi dell’attività caspasica su singola cellula. Poiché l’analisi in vivo permette di valutare la rilocalizzazione del GFP nel citoplasma, è di fondamentale importanza dimostrare che questo evento è diretta conseguenza dell’attivazione caspasica e non un effetto dovuto all’alterazione o alla rottura della MME, che potrebbe verificarsi durante l’apoptosi. Pertanto, per confermare che la rilocalizzazione di GFPDEVDHATM nel citoplasma è causa diretta del suo processamento caspasi-dipendente, abbiamo generato dei nuovi costrutti contenenti mutazioni o delezioni in parte della sequenza amminoacidica (Fig.10a): GFPDEVAHATM, contiene il TM, l’epitopo HA ed ha una mutazione nel residuo P1 (D→A) della sequenza di taglio DEVD (vedi MATERIALI
METODI); E

-

GFPDEVDTM, contiene, oltre al TM, solo la sequenza di taglio DEVD (vedi MATERIALI E METODI);

-

GFPHATM, contiene, oltre al TM, solo l’epitopo HA (vedi MATERIALI
METODI);

E

-

GFPTM-D,

contiene

il

segnale

di

inserzione

nella

membrana

mitocondriale (TM) ed ha una delezione di 19 amminoacidi nel linker tra GFP e TM, per escludere la sequenza amminoacidica SAVD, che

40

Risultati potrebbe essere un sito di taglio non canonico riconosciuto dalle caspasi (vedi MATERIALI E METODI); GFPTM, contiene solo il segnale di inserzione nella membrana mitocondriale (TM) (vedi MATERIALI E METODI). Lo studio del processamento di tutti questi costrutti è stato condotto tramite esperimenti di immunoblotting su lisati ottenuti da cellule IMR90E1A trasfettate transientemente e trattate con etoposide (Fig.10b). I lisati cellulari sono stati raccolti separando le cellule adese da quelle non adese. Nella popolazione apoptotica, è stato possibile verificare la presenza di forme processate di peso molecolare differente, giustificate dalla diversa posizione del sito di taglio caspasico all’interno della sequenza amminoacidica nei diversi costrutti. Il differenziale nell’efficienza di processamento delle diverse chimere sembra dipendere della specificità del riconoscimento caspasico: l’attività caspasica si è rivelata essere maggiore per GFPDEVDHATM e praticamente nulla per GFPTM-D. Gli stessi lisati sono stati testati per la presenza della banda di processamento di PARP (85kDa), come controllo dell’avvenuta attivazione caspasica nel campione di cellule apoptotiche (Fig.10b). L’analisi della sequenza dei costrutti ha permesso di identificare alcune sequenze di taglio caspasico non perfettamente canoniche nel GFPHATM e nel GFPTM, che probabilmente costituiscono la ragione del processamento a bassa efficienza delle rispettive proteine chimeriche (Fig.10a). Un’ulteriore conferma che il processamento osservato sia caspasidipendente è stata data dallo studio dell’inibizione dell’attività caspasica tramite l’utilizzo del BOC-fmk (Fig.10c). Cellule IMR90E1A trasfettate con i diversi costrutti e indotte alla morte per apoptosi tramite trattamento con etoposide hanno mostrato, in presenza dell’inibitore caspasico, l’assenza del processamento delle proteine chimeriche espresse. Il controllo effettuato su HDAC4, ha confermato che il BOC-fmk inibisce efficacemente la funzione di queste proteasi (Fig.10c).

41

 

 
  	
	


	
    	       	

	 
  



 


  
	
	

 
 

 	 	
 


	
	


	


	
	
  !"




	








	


#$%&'(!)
	 
 !"




	








	

		

	 


#$%&'(!)		

&*+,-.#!%'



	


Risultati

6 Analisi dell’attivazione caspasica in vivo su singola cellula
L’analisi time-lapse condotta su cellule IMR90E1A microiniettate con alcuni dei costrutti precedentemente descritti ed indotte all’apoptosi è stata utilizzata per studiare la cinetica della diffusione della fluorescenza del GFP, dipendente dal processamento caspasico delle chimere. Per studiare la correlazione causale e temporale tra questo evento e la perdita della funzionalità mitocondriale è stata utilizzata la sonda lipofilica TMRM, la cui fluorescenza rossa, localizzata nei mitocondri, subisce un calo quando si verifica la perdita del potenziale transmembranario (∆Ψm) (Scaduto & Grotyohann, 1999; Düßmann & al., 2002). I dati relativi all’intensità del segnale di GFP e del TMRM sono stati analizzati con Metamorph 6.4 (UNIVERSAL IMAGING CORPORATION), un programma di analisi di immagini. Cellule IMR90E1A sono state microiniettate con la proteina chimerica GFPDEVDHATM, trattate, dopo 2h, con 10nM TMRM e contemporaneamente indotte all’apoptosi utilizzando 50µM etoposide. L’analisi time-lapse è stata condotta per circa 24h dopo il trattamento con il farmaco. Come illustrato nelle immagini in Fig.11a, la fluorescenza del GFP subisce nel tempo una rilocalizzazione all’interno della cellula. Ciò si manifesta in una variazione nella distribuzione del segnale che da inizialmente concentrato in regioni discrete perinucleari rappresentanti i mitocondri (vedi sovrapposizione con il segnale del TMRM in Fig.11a), in seguito, diffonde omogeneamente in tutto il comparto cellulare. Il parametro scelto per l’analisi quantitativa di queste variazioni è stato la deviazione standard (ds) dell’intensità del segnale, misurata in un’area circolare del diametro di 20pixel (cerchio bianco in Fig.11a). La posizione di questa sezione è stata scelta in modo da poter registrare nel tempo la diversa localizzazione del GFP: l’area di

43

Risultati misurazione viene posta tra il compartimento mitocondriale ed il citoplasma, in modo che sia possibile rilevare il cambiamento nella localizzazione del fluoroforo verde, in seguito all’attivazione caspasica (Fig.11a): la ds misurata è molto alta quando il GFP è concentrato nel compartimento mitocondriale, mentre cala bruscamente come conseguenza del rilascio del fluoroforo nel citoplasma. Diverso é il parametro scelto per monitorare la caduta del potenziale di membrana rilevata dal TMRM. Il segnale del TMRM subisce, infatti, un calo di intensità in seguito alla caduta di ∆Ψm dovuto al rilascio della sonda lipofilica dal compartimento mitocondriale (e successivamente da quello cellulare). Tale calo è misurato nel tempo come intensità di fluorescenza integrata su tutta l’area della cellula (II). II è elevata quando la sonda è internalizzata nel mitocondrio, mentre diminuisce quando avviene la perdita del ∆Ψm. L’analisi time-lapse viene eseguita nell’arco di 24h dal trattamento con lo stimolo proapoptotico, acquisendo un’immagine ogni 2 minuti. Per l’analisi quantitativa su singola cellula, un primo studio viene effettuato misurando la ds del GFP e la II di TMRM ogni 20 immagini, al fine di ottenere un profilo grezzo della fluorescenza. Utilizzando i valori di II e dell’inverso della ds, si è ottenuto un grafico che rappresenta in modo approssimativo l’andamento della fluorescenza rossa e verde nel tempo, fino alla morte della cellula (Fig.11b1). Successivamente, l’analisi quantitativa della fluorescenza viene eseguita tenendo conto di tutte le immagini acquisite limitatamente all’arco di tempo in cui avviene il calo della fluorescenza del TMRM. Il grafico ottenuto unendo questi dati a quelli precedentemente raccolti permette di disegnare con più precisione le curve di fluorescenza (Fig.11b2). Il punto di partenza per queste analisi particolareggiate viene determinato dalle prime 10 immagini che presentano un calo continuo del

44

Risultati valore di II misurato per TMRM. A partire da questa serie di 10 immagini, vengono analizzate le 30 precedenti e le 50 immagini successive. Poiché l’apoptosi è un processo asincrono e ciascuna cellula muore a tempi diversi dall’aggiunta al terreno di coltura del farmaco proapoptotico, l’espediente sopra descritto consente di confrontare tra loro cellule diverse limtatamente alla finestra di tempo in cui si realizza il calo del potenziale di membrana mitocondriale. Inoltre, l’analisi effettuata deve tenere conto anche del fatto che l’intensità di fluorescenza sia del TMRM che del GFP variano da cellula a cellula in dipendenza da diversi fattori sia intrinseci allo stato metabolico della cellula stessa che derivanti ad esempio dalla eterogeneità dei livelli di espressione della proteina chimerica. Pertanto si è ricorsi all’applicazione di specifiche strategie di normalizzazione: − per quanto riguarda l’analisi del calo del potenziale di membrana, è stato assegnato un valore pari a 100 al valore di II associato alla prima delle 90 immagini analizzate. I valori associati alle immagini sucessive si sono quindi derivati normalizzando (dividendo) lo specifico valore di II per il valore di II associato alla prima immagine e moltiplicandolo per 100; − per quanto riguarda l’analisi della rilocalizzazione del GFP dal comparto mitocondriale a quello citosolico si è scelto, come già detto, di rappresentare i dati come il reciproco della ds in modo da ottenere un profilo grafico crescente all’aumentare dell’attivazione caspasica. Il valore di ds per ogni immagine analizzata è stato quindi normalizzato dividendolo per il valore di ds associato alla prima delle 90 immagini analizzate (Fig. 11b3). Questa prima normalizzazione tuttavia, benché ben rappresentasse la relazione temporale tra attività caspasica e calo del potenziale di membrana in una singola cellula (Fig. 11b3), non permetteva ancora di confrontare opportunamente i dati ottenuti da cellule diverse in diversi esperimenti. Il calo di ds corrispondente al rilascio del GFP nel citoplasma, infatti, non raggiunge sempre lo

45

Risultati stesso valore per cellule diverse. Si è passati ad un diverso metodo di normalizzazione che potesse tener conto di tale fenomeno (Fig. 11c). Si è pertanto adottata la seguente formula che consente di estrapolare per ogni immagine un valore normalizzato del reciproco della ds, che per semplicità chiameremo y: y
(Vx-1 - Vi-1) x (Vdiff-1 – Vi-1)

=

100

in cui Vx è il valore di ds calcolato per ognuna delle immagini (x), Vi è il valore di ds della prima della 90 immagini, mentre Vdiff è il valore di ds dell’immagine in cui la diffusione del GFP nel citoplasma è massima (Fig.11c). Per i costrutti in cui non avviene il processamento della chimera del GFP, il Vdiff è stato stimato attraverso una retta di taratura ottenuta dal grafico riportante in ascissa la ds associabile alla proteina chimerica processata dalle caspasi ed in ordinata l’intensità di segnale della stessa quando localizza nella MME. E' stato possibile così correlare l’intensita di fluorescenza iniziale con un ipotetico valore Vdiff, che si dovrebbe rilevare se il GFP della chimera non soggetta a proteolisi venisse rilasciato nel citoplasma.

46

Risultati

Fig. 11 Analisi dell'attivazione caspasica attraverso i dati ottenuti dai time laps. a) Alcuni frames di un time lapse su cellule IMR90E1A iniettate con pEGFPC3DEVDHATM e trattate con etoposide (in alto a sinistra è indicato il tempo trascorso dall’addizione di etoposide -50µM). b) Grafici ottenuti misurando il segnale di fluorescenza del GFP e del TMRM in modo grossolano (1), più particolareggiato (2) ed infine normalizzando i dati su una scala da 0 a 100 (3). c) Curva della 47 fluorescenza normalizzata in base al valore di diffusione citoplasmatica del GFP.

Risultati Utilizzando questi parametri, si è analizzata l’attivazione caspasica su quattro costrutti, microiniettati in cellule IMR90E1A, sottoposte a stimolo apoptotico: GFPDEVDHATM, GFPHATM, GFPTM e GFPTM-D. L’analisi time lapse condotta su cellule IMR90E1A, indotte all’apoptosi con 50µM etoposide ed esprimenti GFPDEVDHATM, ha messo in evidenza il rilascio del GFP nel citoplasma, dovuto al processamento della proteina, conseguente all’attivazione della cascata caspasica. Nelle immagini della Fig.12a, sono rappresentate delle immagini di cellule IMR90E1A esprimenti GFPDEVDHATM analizzate tramite la tecnica del time-lapse: si può osservare, a 21h32min dal trattamento con etoposide, la diffusione del GFP nel citoplasma e la perdita del segnale di fluorescenza rossa di TMRM. L’evento visualizzato attraverso la sequenza di immagini acquisite tramite il microscopio confocale, ha trovato riscontro nei grafici che rappresentano il calo dell’intensità di fluorescenza del TMRM (Fig.12b) e la ridistribuzione cellulare del GFP (Fig.12c). In questo caso, sei diverse cellule provenienti da due esperimenti distinti, sono state analizzate tramite time-lapse. La curva del TMRM indica che la perdita di segnale, dovuta al calo di ∆Ψm, è concomitante alla rilocalizzazione del GFP, indice di attivazione caspasica sulla superficie del mitocondrio. Nel caso della chimera GFPDEVDHATM, la cinetica della diffusione del GFP appare molto rapida(Fig.12c). È interessante notare che esiste una certa eterogeneità nella correlazione temporale tra la perdita della funzionalità mitocondriale e l’attivazione delle caspasi. In alcune cellule si può osservare una intensa attività caspasica in presenza di un minimo calo di ∆Ψm, mentre, in altre, solo quando il ∆Ψm è significativamente calato, si rivela l’attivazione delle caspasi. Nella Fig.13a, alcune immagini di un time-lapse su cellule IMR90E1A microiniettate con GFPHATM e trattate con 50µM etoposide, descrivono un comportamento analogo a quello di GFPDEVDHATM. Nelle immagini, viene rappresentata una tipica cellula esprimente GFPHATM: a 12h30min dallo stimolo apoptotico, si vede la diffusione del GFP nel citoplasma ed il calo della

48

Risultati fluorescenza del TMRM (Fig.13a). L’analisi in vivo su singola cellula ha permesso di descrivere la cinetica di processamento per questo costrutto. I grafici sono stati costruiti con i dati ricavati dall’analisi di quattro cellule provenienti dalle stesso esperimento. Come avviene per il GFPDEVDHATM, la curva di localizzazione del GFP raggiunge il valore massimo, indicando la rilocalizzazione del GFP nel citoplasma (Fig.13c), e il segnale di fluorescenza del TMRM raggiunge un valore di intensità minima (Fig.13b), determinato dalla perdita del ∆Ψm. Anche per questa chimera si evidenzia una certa eterogeneità nella rapidità della cinetica di attivazione caspasica, in risposta allo stimolo apoptotico (Fig.13c). L’analisi del processamento caspasico in vivo del GFPTM ha rivelato che il costrutto viene processato con scarsa efficienza. Nella Fig.14a, vengono mostrate delle immagini relative ad un time-lapse effettuato su cellule IMR90E1A esprimenti GFPTM e trattate con 50µM etoposide. In queste cellule, il GFP mantiene nel tempo sempre una localizzazione mitocondriale, ma a 9h50min dal trattamento con lo stimolo apoptotico, si può notare una parziale diffusione del tracciante verde (Fig.14a). L’analisi quantitativa dell’attivazione caspasica durante l'apoptosi, si è ottenuta analizzando quattro cellule appartenenti allo stesso esperimento. Nel grafico riportato in Fig.14b, si può osservare che in alcune di queste cellule avviene una ridistribuzione parziale del GFP: la curva non raggiunge il valore massimo della scala, che indica la localizzazione citosolica del GFP, e la cinetica è molto più lenta (Fig.14c). Come si può considerare, osservando il grafico che descrive la fluorescenza del TMRM, la ridistribuzione del GFP in questo caso non avviene simultaneamente ma in ritardo rispetto alla perdita del ∆Ψm segnalato dal calo del segnale del TMRM (Fig.14b). Nell’analisi time-lapse di GFPTM-D, microiniettato in cellule IMR90E1A trattate con 50µM, non si visualizza nessun rilascio del GFP nel citoplasma (Fig.15a), nonostante venga rilevato il calo della fluorescenza del TMRM e quindi la perdita della funzionalità mitocondriale. Questo indica che il costrutto

49

Risultati non è bersaglio di alcuna attività caspasica. I grafici ottenuti dall’analisi in vivo confermano l’assenza totale del processamento caspasico di GFPTM-D, in quanto la curva di rilocalizzazione del GFP non supera il valore minimo di intensità del segnale (Fig.15c). L’andamento della curva che descrive la fluorescenza del TMRM presenta sempre il caratteristico calo, corrispondente alla perdita di funzionalità mitocondriale (Fig.15b). Questi dati hanno confermato che il saggio sviluppato è adatto allo studio dell’attivazione delle caspasi in vivo: l’utilizzo di proteine chimeriche contenenti almeno un sito di taglio caspasico permette di monitorare facilmente l’attività caspasica poiché il processamento avviene in modo efficiente, mentre, grazie all’uso della sonda mitocondriale TMRM, è possibile correlare temporalmente la perdita di funzionalità del mitocondrio con l’attivazione delle caspasi, due eventi fondamentali del processo di morte cellullare programmata.

50

Risultati

Fig. 12 Analisi dell'attività caspasica su GFP DEVD HA TM. a) Alcuni frames di un time lapse su cellule IMR90E1A iniettate con pEGFPC3DEVDHATM e trattate con etoposide (in alto a sinistra è indicato il tempo trascorso dall’addizione di etoposide -50µM). b) Curva di fluorescenza del TMRM ottenuta normalizzando i dati da 0 a 100. c) Curva di fluorescenza del GFP ottenuta normalizzando i dati da 0 a 100.

51

Risultati

Fig. 13 Analisi dell'attività caspasica su GFPHATM. a) Alcune immagini di un time lapse su cellule IMR90E1A iniettate con GFPHATM e trattate con etoposide (in alto a sinistra è indicato il tempo trascorso dall’addizione di etoposide -50µM). b) Curva di fluorescenza del TMRM ottenuta normalizzando i dati da 0 a 100. c) Curva di fluorescenza del GFP ottenuta normalizzando i dati da 0 a 100.

52

Risultati

Fig. 14 Analisi dell'attività caspasica su GFP TM. a) Alcune immagini di un time lapse su cellule IMR90E1A iniettate con pEGFPC3TM e trattate con etoposide (in alto a sinistra è indicato il tempo trascorso dall’addizione di etoposide -50µM). b) Curva di fluorescenza del TMRM ottenuta normalizzando i dati da 0 a 100. c) Curva di fluorescenza del GFP ottenuta normalizzando i dati da 0 a 100.

53

Risultati

Fig. 15 Analisi dell'attività caspasica su GFP TM-D. a) Alcune immagini di un time lapse su cellule IMR90E1A iniettate con GFPTM-D e trattate con etoposide (in alto a sinistra è indicato il tempo trascorso dall’addizione di etoposide -50µM). b) Curva di fluorescenza del TMRM ottenuta normalizzando i dati da 0 a 100. c) Curva di fluorescenza del GFP ottenuta normalizzando i dati da 0 a 100.

54

DISCUSSIONE

Discussione

DISCUSSIONE

Nella morte cellulare programmata o apoptosi, le caspasi svolgono un ruolo centrale nell’esecuzione del processo apoptotico. In seguito all’attivazione, questi enzimi processano substrati specifici e mediano molte delle alterazioni morfologiche e biochimiche che avvengono nelle cellule apoptotiche, come la contrazione del citoplasma, il compattamento della cromatina, la frammentazione del DNA e la formazione dei corpi apoptotici. L’attivazione delle caspasi è stata rilevata in numerosi sistemi cellulari quale evento cruciale attraverso cui il meccanismo apoptotico opera. Per questo, l’attività caspasica può essere studiata come marker biochimico dell’apoptosi in popolazioni cellulari analizzate in vitro ed in vivo. Visto il ruolo critico delle caspasi quali esecutori del programma apoptotico, l'entità e la cinetica di attivazione di queste proteasi risulta altamente regolata e soggetta a complesse vie di trasduzione del segnale intracellulare dipendenti sia dallo stimolo apoptotico che dalla popolazione cellulare in cui le si analizzano. Lo studio dell’attività caspasica può essere condotto con diverse tecniche, applicate all’analisi in vitro ed in vivo. La complessità del processo apoptotico e la rapidità con cui viene eseguito fa si che le analisi in vivo risultino maggiormente adeguate allo studio approfondito di questo fenomeno. Negli ultimi anni l'aumento delle conoscenze sul processo apoptotico e la disponibilità di "ingegnerizzare" specifici fluorofori ha permesso lo sviluppo di nuove tecniche per lo studio in vivo dell'apoptosi. La tecnologia maggiormente sfruttata è quella che fa uso di traccianti fluorescenti, quali la GFP, la rodamina ed i loro derivati, di cui si ha una visualizzazione semplice nel compartimento cellulare. Un prodotto commerciale di questo tipo è il substrato caspasico fluorogenico PhiPhiLux (OncoImmunin), che viene utilizzato per monitorare e

55

Discussione misurare l’attività caspasica in cellule apoptotiche (Komoriya & al., 2000). PhiPhiLux contiene la sequenza DEVDGI, riconosciuta da caspasi-3 e dalle caspasi del gruppo II, e due rodamine, o suoi derivati. L'attivazione caspasica induce il taglio della sequenza consensus e l'emmissione di un segnale di fluorescenza che si evidenzia quando il substrato viene processato. Tale fluorescenza é rilevabile tramite citometria di flusso o microscopia di fluorescenza. L’attivazione delle caspasi può essere studiata in vivo anche attraverso tecniche di immunochimica, utilizzando inibitori caspasici coniugati a fluorocromi (FAM & FLICA, Alexis; Caspa Tag’s, Intergen), che, legando covalentemente le caspasi attive, permettono di visualizzarne la comparsa e la localizzazione cellulare. Un altro tipo di approccio è quello che utilizza la FRET per monitorare il processamento caspasico di proteine chimeriche, costituite da due fluorofori con spettro di emissione ed eccitazione sovrapponibili, separati da una sequenza di taglio riconosciuta dalle caspasi. La perdita del segnale di fluorescenza da FRET, in seguito al processamento del costrutto, permette di valutare l’attivazione delle caspasi usando la microscopia confocale, la fluorimetria o la citofluorimetria a flusso (Mahajan & al., 1999; Tyas & al., 2000; Morgan & Thorburn al., 2000; Kathy & al., 2001; Tawa & al., 2001; Liusheng & al., 2004; He & al., 2004; Elmore & al., 2004). Un altro sistema di studio dell’attivazione caspasica durante l’apoptosi, è offerto da un nuovo costrutto, prodotto dalla BD Clontech: il pCaspase3 sensor vector, permette di monitorare l’attività di caspasi-3 su singola cellula attraverso la microscopia confocale. Il vettore codifica per la proteina fluorescente YFP, fusa all’estremità carbossiterminale con un segnale di localizzazione nucleare (NLS), e preceduta all’etremità ammino-terminale da una sequenza di esporto nucleare (NES). La sequenza NES è separata de YFP dalla sequenza di taglio riconosciuta da caspasi-3 (DEVD): pertanto, la chimera ha localizzazione nucleare quando il processamento non è rilevato, mentre è diffusa nel citoplasma se avviene il taglio caspasi-3-dipendente della sequenza DEVD. Molti dei saggi sopra descritti, presentano delle limitazioni legate alla scarsa sensibilità o alla complessità della strumentazione, nel caso della FRET,

56

Discussione ed all’impossibilità di monotorare l’attività caspasica in specifici compartimenti cellulari. Queste limitazioni ci hanno suggerito la creazione di un costrutto di facile gestione, che permettesse di valutare l’attivazione delle proteasi apoptotiche in prossimità di un determinato compartimento cellulare, quello mitocondriale. Per ottenere un tale strumento di analisi, abbiamo progettato una chimera, GFPDEVDHATM contenente un tracciante fluorescente, GFP, un segnale di target alla membrana mitocondriale (TM) e due siti di taglio caspasico (DEVD, PVDP). L’espressione di questo costrutto in vivo è stato seguito parallelamente all’analisi della funzionalità mitocondriale, utilizzando una sonda adatta a questo scopo, il TMRM. Le analisi condotte attraverso la microscopia confocale, hanno confermato che l’espressione di GFPDEVDHATM in cellule eucariote indotte all’apoptosi, permette un’analisi semplice dell’attivazione caspasica all’interno di una singola cellula apoptotica. Il processamento della chimera può essere studiato attraverso l’analisi temporale delle variazioni della localizzazione della fluorescenza del GFP: gli studi condotti hanno dimostrato che il processamento di GFPDEVDHATM è un evento efficace che si esaurisce in un breve intervallo di tempo. Nonostante il processo sia veloce, il saggio si dimostra sensibile alle variazioni nella cinetica e permette un’analisi specifica dell’attività caspasica. Infatti, abbiamo evidenziato che, rispetto al calo di potenziale di membrana mitocondriale, esiste una certa eterogeneità nella cinetica di attivazione delle caspasi, con una velocità massima di circa 15 minuti. Questo potrebbe indicare che le differenti cellule possiedono un diverso livello di proenzimi, un diverso livello di inibitori specifici, le IAPs (Inhibitor Apoptosis Proteins) o un diverso livello di attivatori, come per esempio Smac/Diablo e HtrA2/Omi. Utilizzando altri costrutti, derivati da GFPDEVDHATM, abbiamo constatato che la rilocalizzazione del GFP dal mitocondrio al citoplasma, conseguente al processamento caspasico, è evidente nelle chimere che possiedono almeno un sito di taglio riconosciuto dalle caspasi (DEVD, DVPD e SAVD), mentre è assente nella chimera GFPTM, che non possiede tali sequenze. Come si rileva

57

Discussione dai grafici che descrivono le curve di fluorescenza del GFP, ottenute in seguito all’analisi time-lapse su cellule esprimenti la proteina chimerica ed indotte all’apoptosi, la cinetica di ridistribuzione del GFPHATM è paragonabile a quella ottenuta per il GFPDEVDHATM. Negli esperimenti di immunoblotting effettuati sui lisati cellulari, il processamento dei costrutti che possiedono un solo sito di taglio caspasico (GFPDEVDTM, GFPHATM) è meno evidente rispetto a quello di GFPDEVDHATM. Questo dato può sembrare discordante rispetto alle osservazioni suggerite dall’analisi time-lapse: in realtà può essere giustificato dal fatto che le cellule analizzate in vivo dimostrano bassi livelli di espressione delle proteine chimeriche, mentre, nelle cellule trasfettate transientemente, i livelli di espressione sono molto variabili. Una sovrespressione delle proteine chimeriche in tali cellule, può comportare un maggior differenziale tra il processamento di GFPDEVDHATM e dei costrutti con un solo sito di taglio caspasico (GFPDEVDTM, GFPHATM). I risultati ottenuti avvalorano l’ipotesi secondo cui l’attività caspasica risulta più efficiente su un costrutto che contiene due sequenze riconosciute dalle caspasi, poste in tandem (Tawa & al., 2000), come in GFPDEVDHATM. Nel caso del costrutto GFPTM, il parziale processamento rilevato sembra dovuto alla presenza di un sito di taglio caspasico non canonico (SAVD) all’interno della linker amminoacidico: la curva di rilocalizzazione del GFP ottenuta indica che il saggio è sensibile anche ad una attivazione caspasica meno efficiente. Il processamento parziale di GFPTM è rilevabile in un rallentamento della cinetica di attivazione caspasica, che risulta in alcune cellule ritardata di due ore, rispetto al calo del potenziale mitocondriale. L’altra peculiarità di questo saggio è la possibilità, offerta dall’utilizzo della sonda TMRM, di collocare temporalmente l’attivazione caspasica rispetto alla disenergizzazione mitocondriale, che avviene durante il processo apoptotico. L’attivazione delle caspasi è un evento strettamente correlato al calo del potenziale transmembranario, che nel saggio é rilevato dalla perdita del segnale di fluorescenza del TMRM, valutato sincronizzando i dati ricavati dall’analisi di singole cellule in esperimenti diversi. Questa correlazione è

58

Discussione evidente osservando l’andamento delle curve che descrivono le alterazioni delle due fluorescenze verde e rossa; il calo della intensità integrata, misurata per TMRM, e della deviazione standard, misurata per il GFP rilasciato, avvengono in un intervallo di tempo molto breve anche se variabile. Ciò permette di definire la cinetica dell’attivazione caspasica, durante il processo apoptotico, ed in particolare rispetto alla perdita della funzionalità mitocondriale. Queste caratteristiche suggeriscono interessanti applicazioni in campo biologico, ed in particolare nello studio dell’attività proapoptotica dei farmaci chemioterapici, monitorandone l’influenza sul processo apoptotico. Poiché dal mitocondrio si dipartono cascate di segnale fondamentali al processo apoptotico, questo saggio sarebbe utile per studiare la risposta cellulare a trattamento farmacologico, e le conseguenze sugli eventi che coinvolgono la via intrinseca mitocondriale. In conclusione, lo sviluppo di questo saggio ha permesso di creare uno strumento di semplice applicazione e gestione, che garantisce un’analisi sensibile dell’attività caspasica e della sua cinetica di attivazione. Inoltre permette di studiare parallelamente un altro aspetto del processo apoptotico, la perdita della funzionalità mitocondriale, e di valutarne la stretta correlazione con l’attività caspasica.

59

MATERIALI E METODI

Materiali e metodi

MATERIALI E METODI

1

TECNICHE DI BASE DI MANIPOLAZIONE DEL DNA

1.1 Reazione a catena della DNA-polimerasi (PCR)
La reazione a catena della polimerasi permette l’amplificazione di un DNA stampo mediante l’utilizzo di una DNA polimerasi resistente ed in grado di operare ad alte temperature. Essa sfrutta come innesco un oligonucleotide complementare oligonucleotidi complementari, ciascuno su un filamento, alle due estremità opposte della sequenza da amplificare. Ad una prima fase di denaturazione del DNA plasmidico a 95°C segue una fase ad una temperatura ad adeguata stringenza (in genere 55-60°C) per consentire l’appaiamento specifico tra inneschi e stampo, infine, una fase di elongazione è stata condotta alla temperatura ottimale per l'enzima, utilizzato solitamente attorno ai 72°C. La reazione è stata sottoposta a questo ciclo di temperature per 30-35 volte ottenendo un numero di amplificati che aumenta in maniera esponenziale. Nello specifico, la reazione di amplificazione é stata allestita a partire da 30 ng di DNA stampo in 100 µl di volume di reazione contenente 1 µl di ciascun oligonucleotide innesco 50 µM, 10 µl del tampone di reazione (100mM KCl, 100mM (NH4)2SO4, 200 mM Tris HCl pH 8.8, 20mM MgSO4, 1% Triton X-100), 1 µl di dNTPs 10mM e 0.5 µl di Taq DNA Polimerasi (2 U/µl - Vent - New England BioLabs). I campioni così preparati più un controllo costituito dalla miscela di reazione priva del DNA stampo, sono stati trattati per 5 minuti a 95°C in seguito sottoposti a 25 cicli di amplificazione in un termostato Mastercycler personal (Eppendorf): 1 minuto a 94°C per la denaturazione del

60

Materiali e metodi

doppio filamento del DNA plasmidico stampo, 1 minuto a 55-60°C per l’appaiamento dell’oligonucleotide innesco sul filamento di DNA stampo complementare e 1 minuto a 72°C per consentire l’elongazione alla polimerasi. Al termine dei cicli, avviene un trattamento di 5 minuti a 75°C. Gli amplificati sono stati controllati tramite corsa su gel di agarosio-etidiobromuro (5µg/ml) e visualizzazione al transilluminatore.

1.2 Mutagenesi
Per produrre la mutazione DEVD → DEVA nel costrutto pEGFPC3 DEVD HA TM si è utilizzato il kit per mutagenesi in vitro Gene Taylor Kit (Invitrogen). La reazione di mutagenesi è stata eseguita seguendo le istruzioni della ditta produttrice e utilizzando il suddetto plasmide come stampo (maggiori dettagli in CLONAGGIO DEI COSTRUTTI UTILIZZATI).

1.3 Digestione con enzimi di restrizione
Le reazioni di restrizione sono state eseguite secondo le metodiche standard (Maniatis et al. 1989). Esse sono state allestite incubando il DNA con l’enzima di restrizione (5 U/µg di DNA) in un’opportuna soluzione tampone ed alla temperatura consigliata dalla ditta produttrice (New England BioLabs, NEB) per almeno un’ora. Digestioni con due enzimi sono state eseguite in un’unica reazione se entrambi gli enzimi erano attivi nella medesima soluzione tampone e con un periodo di incubazione di almeno due ore. Gli enzimi di restrizione utilizzati in questa tesi sono stati: XhoI (20 U/µl, NEB), BamHI (20 U/µl, NEB), BglI (10 U/µl, NEB), EcoRI (20 U/µl, NEB), SalI (20 U/µl, NEB), HidIII (20 U/µl, NEB) e NotI (10 U/µl, NEB).

61

Materiali e metodi

1.4 Preparazione del vettore per la ligazione
Per evitare che i vettori usati per il clonaggio si richiudessero su se stessi senza aver legato l’inserto, si è rimosso il gruppo fosfato all’estremità 5’ facendo uso dell’enzima fosfatasi alcalina. Nella preparazione di un vettore per la ligazione, la reazione di digestione è stata effettuata in un volume di 50µl con 45 µg di DNA. In seguito il volume è stato aumentato a 60-70 µ l complementando opportunamente la concentrazione dei sali ed è stato aggiunto 1 µl di fosfatasi alcalina (10 U/µl, NEB). Si è lasciato agire a 37°C per circa un’ora e successivamente si è inattivato l’enzima portando la temperatura a 75°C per 10 minuti. Infine il vettore è stato corso su gel di agarosioetidiobromuro ed estratto come descritto di seguito.

1.5 Estrazione di DNA da gel di agarosio
I frammenti di DNA digeriti con enzimi di restrizione sono stati separati e visualizzati attraverso elettroforesi su gel di agarosio-etidiobromuro. L’isolamento dei frammenti è stato ottenuto mediante una metodica di estrazione basata su un Kit commerciale (Prep-A-Gene DNA Purification System, Biorad) che fa uso di una matrice silicea a cui si lega il DNA. Dopo aver recuperato la banda di DNA da gel di agarosio mediante dissezione con bisturi, sono stati aggiunti 3 volumi di tampone di legame (6 M perclorato di sodio, 50 mM Tris HCl pH 8.0, 10 mM EDTA pH 8.0) cui è seguita

un’incubazione di pochi minuti a 37°C per sciogliere il gel. E’ stata aggiunta quindi una quantità di matrice proporzionale all’abbondanza di DNA presente nella banda ed incubando a temperatura ambiente per circa mezz’ora in agitazione si è consentito al DNA di legarsi alla matrice. In seguito sono stati compiuti dei cicli di lavaggio della matrice, prima con il tampone di legame e successivamente con il tampone di lavaggio (400 mM NaCl, 20 mM Tris HCl, pH 7.5, 2 mM EDTA pH 8.0, 50% v/v etanolo). Il DNA infine è stato eluito dalla matrice con 20-30 µl di H2O a 68°C.

62

Materiali e metodi

1.6 Ligazione vettore-inserto.
La reazione di ligazione è stata approntata in un volume finale di 15 µl con 40-45 ng circa di vettore ed una concentrazione molare del frammento (cDNA) che si voleva clonare doppia rispetto a quella del vettore. A vettore e frammento sono stati aggiunti 1.5 µl di un tampone 10x contenente ATP e 0.5 µl dell’enzima (T4 DNA ligasi 0.4 U/µl, NEB), che catalizza la formazione di legami fosfotioestere tra un residuo fosfato al 5’ di un’estremità di DNA e l’ossidrile al 3’ di un’altra estremità. Come controllo negativo la stessa reazione è stata allestita in mancanza del frammento in modo da poter successivamente valutare la frazione di molecole in cui il plasmide si è richiuso su se stesso senza comprendere l’inserto.

1.7 Trasformazione batterica
Per l’amplificazione dei plasmidi si sono utilizzati ceppi di Escherichia coli diversi a seconda della selezione portata dal plasmide utilizzato: cellule DH101 (che presentano resistenza endogena alla kanamicina) sono state utilizzate per amplificare plasmidi recanti la resistenza all’ampicillina, cellule DH5αQ sono state utilizzate per amplificare i plasmidi recanti la resistenza alla kanamicina. Tali ceppi batterici sono stati resi competenti grazie alla permeabilizzazione della membrana batterica con l’uso di cationi bivalenti: i batteri sono stati fatti crescere per 12-14 ore in 5 ml di terreno LB (10 g/l triptone, 5 g/l estratto di lievito, 10 g/l NaCl) con l’aggiunta di kanamicina (25 µg/ml) ed MgCl2 ad una concentrazione finale di 10mM. 2ml di questa coltura sono stati diluiti in 100ml di terreno di crescita SOB (20 g/l bacto-triptone, 5 g/l estratto di lievito, 0.58 g/l NaCl, 18.6 g/l KCl, pH 7.0) addizionato di MgCl2 alla concentrazione finale di 10mM e sono stati fatti crescere a 37°C fino al raggiungimento di una densità ottica pari a 0.35-0.40 a 600 nm. I batteri sono stati quindi centrifugati per 15 minuti a 3500 rpm a 4°C e risospesi in un volume pari ad 1/3 di quello iniziale nella soluzione CCMB80 ( 11.8 g/l CaCl2⋅2H2O pH 6.4, 4.0 g/l MnCl2⋅ 4H2O, 2g/l

63

Materiali e metodi

MgCl2⋅ 6H2O, 100 mM potassio acetato pH 7.0, 10% v/v glicerolo). I batteri sono stati quindi centrifugati come sopra e risospesi in 1/20 del volume iniziale in CCMB80 ed infine sono stati divisi in aliquote di 90 µl e conservati a –80°C. La competenza media ottenuta è stata dell’ordine di 1-106 colonie per µg di plasmide. Per la trasformazione, metà della miscela di ligazione è stata aggiunta a 40 µl di cellule competenti; dopo 20 minuti di incubazione in ghiaccio ed uno shock termico a 42°C per 90 secondi, ai batteri sono stati aggiunti 200 µl di terreno SOC (costituito da SOB con l’aggiunta di glucosio 20 mM finale). Successivamente i batteri sono stati incubati per 45 minuti a 37°C ed infine piastrati su terreno solido di LB (15g di agar a 1l di LB) in presenza di ampicillina (50 µg/ml) o kanamicina (25 µg/ml).

1.8 Preparazione plasmidica MINI
Questa metodica permette di ottenere, in modo semplice e rapido, piccole quantità di DNA plasmidico (dell’ordine di 200-300 ng/µl ) da una coltura batterica. Le colonie cresciute sui piatti LB-Agar ( 15g di agar per 1l di LB) sono state inoculate in 2 ml di terreno liquido LB (Luria-Bertani-medium contenente 10 g/l bacto-triptone; 5 g/l estratto di lievito; 10 g/l NaCl, pH 7), addizionato con kanamicina (50 µg/ml) o ampicillina (100 µg/ml) e lasciate crescere per 8-12 ore a 37°C, in agitazione. I batteri sono stati poi centrifugati e risospesi in 250 µl di una soluzione di risospensione (50 mM Tris HCl, pH 7.5, 10 mM EDTA) e 100 µg/ml RNasi. Successivamente i batteri sono stati lisati aggiungendo 250 µl di una soluzione di lisi (0.2 M NaOH/ 1% w/v SDS). In seguito sono stati aggiunti 250 µl di tampone 2.55 M potassio acetato, pH 4.8 per neutralizzare la soluzione di lisi e permettere la precipitazione del DNA genomico. Dopo aver centrifugato i campioni, è stato recuperato il surnatante con il DNA plasmidico a cui è stato aggiunto 1 ml di una resina in grado di legare il DNA (terra di

64

Materiali e metodi

diatomee all’1.2% w/v in 7 M guanidinio HCl). La sospensione è stata versata in SPIN X (Talent) collegato ad una pompa a vuoto. Il DNA depositato nel filtro assieme alla resina è stato lavato due volte con una soluzione di lavaggio (200 mM NaCl, 20 mM Tris HCl pH 7.5, 5mM EDTA pH 8 e 50% v/v etanolo). Dopo una centrifugazione veloce per eliminare l’etanolo residuo, il DNA è stato risospeso con 30-50 µl H2 O a 68°C ed eluito con un’altra centrifugazione veloce. I campioni sono stati conservati a -20°C.

1.9 Preparazione plasmidica MIDI
Con questa preparazione si ottengono quantità di DNA dell’ordine di centinaia di microgrammi e di purezza tale da poter essere utilizzato in esperimenti di microiniezione. Una singola colonia batterica, trasformata con il plasmide di interesse e cresciuta su terreno solido, è stata inoculata in 50 ml di terreno LB (LuriaBertani:10 g/l di bacto-triptone, 5 g/l di estratto di lievito, 10 g/l di NaCl, pH 7) contenente ampicillina (50 µg/ml) o kanamicina (25 µg/ml) e fatta crescere 1214 ore a 37°C in agitazione. I batteri sono stati centrifugati 5 minuti a 3500 rpm e risospesi in 3 ml di un tampone isotonico (50 mM glucosio, 25 mM Tris pH 8.0 10 mM EDTA) addizionato con lisozima (1mg/ml finale), che digerisce il peptidoglicano della parete (5 minuti in ghiaccio). I batteri sono stati successivamente lisati aggiungendo 6 ml di una soluzione 0.2 M NaOH/ 1% SDS w/v per 5 minuti in ghiaccio. Con l’aggiunta di 4.5 ml di un tampone acido 3M potassio acetato/5% v/v acido formico, pH 4.8 (5 minuti in ghiaccio) è stata neutralizzata la soluzione di lisi. Il DNA genomico e le membrane cellulari sono stati precipitati tramite 15 minuti di centrifugazione a 10.000 rpm a 4°C. Il DNA plasmidico e l’RNA sono stati fatti precipitare con l’aggiunta al surnatante di 8ml di isopropanolo (5 minuti a RT). Dopo centrifugazione (15 minuti a 10.000rpm, a 4°C), il fondello è stato risospeso in 1 ml di H2O sterile e l’RNA è stato fatto precipitare con l’aggiunta di 2 ml di LiCl 5 M (15 minuti in ghiaccio). Dopo centrifugazione (15 minuti a 10000 rpm e a 4°C), il surnatante è stato

65

Materiali e metodi

recuperato, diluito con 2 volumi di etanolo assoluto e incubato per una notte a 80°C, per precipitare il DNA plasmidico. Dopo una centrifugazione di 20 minuti a 120000 rpm e un lavaggio in etanolo-H2O 70% v/v, si è ottenuto un fondello di DNA che è stato risospeso in 250 µl di TE (10mM Tris HCl pH 8.0. 1mM EDTA pH 8.0) e incubato per 30 minuti con RNasi A (100 µg/ml finale), che digerisce l’eventuale RNA rimasto, a una temperatura di 68°C che favorisce l’inattivazione delle proteine, soprattutto delle DNasi. Successivamente è stata aggiunta la proteinasi K (0.2 mg/ml finali) che digerisce le proteine, in presenza di SDS 0.4 % che le denatura e rompe i complessi proteine-DNA (15 minuti a 37°C). È seguita un estrazione fenolo-cloroformio (1 vol. fenolo/0.5 vol. fenolo0.5 vol. cloroformio/1 vol. di cloroformio) che serve per estrarre il DNA dalle proteine. Infine il DNA plasmidico è stato fatto precipitare aggiungendo NaCl (0.2 M finale) e successivamente 2 volumi di etanolo assoluto. Dopo un incubazione di 15 minuti in ghiaccio secco, é centrifugato a massima velocità per 15-30 minuti e il fondello ottenuto, dopo un lavaggio con etanolo 70%, è stato risospeso in H2O sterile.

2

Clonaggio dei costrutti utilizzati

Durante questa tesi sono stati progettati diversi costrutti, ottenuti tramite tecniche di clonaggio e sub-clonaggio. L’obiettivo è stato quello di produrre proteine chimeriche, contenenti il tracciante fluorimetrico GFP e in grado di inserirsi nella membrana mitocondriale, che presentassero o fossero prive di uno o più siti di taglio riconosciuti dalle caspasi. Per ottenere ciò, le chimere sono state costruite a partire dal vettore pEGFP che contenesse il fluoroforo in fusione al carbossi-terminale della mappa di restrizione. I peptidi, codificanti per il dominio transmembranario di BclxL (TM), per l’epitopo HA e per le sequenze di taglio caspasico, sono stati inseriti con gli appositi enzimi di restrizione, rispettando la cornice di lettura opportuna.

66

Materiali e metodi

I vettori utilizzati per i clonaggi possiedono una resistenza per la kanamicina, così da permetterne la selezione dei batteri con essi trasformati nel terreno di coltura. La trasfezione stabile del vettore in cellule eucariote é consentita invece una cassetta di resistenza per la neomocina, che comprende il promotore SV40, il gene di Tn5 per la resistenza alla neomicina e i segnali di poliadenilazione del gene virale della timidina-chinasi (HSV TK), attraverso la selezione con geneticina (Invitrogen).

Fig.16 Mappa del vettore

che esprime GFP in fusione al 5’.

Qui di seguito, è rappresentato schematicamente il procedimento seguito per ottenere i diversi costrutti: sono citati gli enzimi di restrizione opportuni per ogni clonaggio e gli oligonucleotidi usati per l’amplificazione tramite PCR, dove richiesto.

67

Materiali e metodi

Costrutto finale

Costrutto di partenza

Inserto
Frammento ottenuto mediante appaiamento di oligo fosforilati al 5' e clonato sfruttando gli opportuni enzimi di restrizione: Oligo UP TCGAGTCCTCGTCCGAGCTCAGCGGAGATGAGGTCGATGGT ACCAGCGGAAGCGAGTTCA → Xho I Oligo DN AGCTTGAACTCGCTTCCGCTGGTACCATCGACCTCATCTCCG CTGAGCTCGGACGAGGAC → Hind III

pEGFP C3 HA TM

DEVD

pEGFP C3 DEVD HA TM

Xho I

Hind III

DEVD

HA
230pb

Costrutto finale

Costrutto di partenza
pEGFP C3 DEVD HA TM

Mutagenesi
DEVD ↓ DEVA
Costrutto ottenuto mediante mutagenesi: AGCTCAGCGGAGATGAGGTCGCCGGTACCAGCGG GACCTCATCTCCGCTGAGCTCGAGATCTGA

pEGFP C3 DEVA HA TM
Xho I Hind III

HA
230pb

Costrutto finale

Costrutto di partenza

Inserto
Subclonato sfruttando gli opportuni enzimi di restrizione: Bam HI/Bam HI Subclonato in pEGFP C3 DEVD HA TM sfruttando gli opportuni enzimi di restrizione: Hind III/Bam HI

pFLAG CMV 5b TM pEGFP C3 DEVD TM

Nota: il passaggio in pFLAG CMV 5b e' servito per ottenere la giusta cornice di lettura.

pEGFP C3 DEVD TM

Xho I

Hind III

Xho I

Hind III

DEVD

188pb

188pb

68

Materiali e metodi

Costrutto finale

Costrutto di partenza

Inserto
HA
Subclonato sfruttando gli opportuni enzimi di restrizione: Hind III / Eco RI Ottenuto mediante PCR e clonato sfruttando gli opportuni enzimi di restrizione: Oligo UP CATGAATTCCGAAAGGGCCAGGAACGCTTC → Eco RI Oligo DN ATCATGTCGACTGTCATTTCCGACTGAAGAGTGA → Sal I

pEGFP C3 TM

pEGFP C3 HA TM

HA
167pb

Costrutto finale

Costrutto di partenza
pEGFP C1

Inserto
TM
Estratto il frammento da pEGFP C3 DEVD HA TM mediante digestione Bam HI/Bam HI e subclonato sfruttando gli opportuni enzimi di restrizione: Bgl II/Bam HI

Nota: gli enzimi di entrambe le digestioni sono stati scelti in modo da eliminare l'Asp presente nel MCS di pEGFP C1 all'interno della sequenza SAVD.

pEGFP C1 TM- D

Bgl II

135pb

Costrutto finale

Costrutto di partenza
pEGFP C1

Inserto
TM
Subclonato sfruttando gli opportuni enzimi di restrizione: Bam HI/Bam HI

pEGFP C1 TM

Bam HI

135pb

Fig. 17 Rappresentazione schematica dei costrutti. Le sequenze per gli enzimi di restrizione presenti negli oligo di clonaggio ed il codone mutato mediante mutagenesi sono rappresentati con carattere sottolineato.

69

Materiali e metodi

3

Linee cellulari e condizioni di coltura

Le linee cellulare utilizzate negli esperimenti di questa tesi sono state: − IMR90E1A: cellule derivate da una linea stabilizzata di fibroblasti di polmone umano trasformata con l’oncogene adenovirale E1A, che regola il fattore di trascrizione E2F attraverso l’interazione con Rb (Fearnhead H.O. et al. 1998; Evan G. et al. 1998); − U2OS: cellule di osteosarcoma umano; − U2OS GFPDEVDHATM: celulle U2OS che esprimono stabilmente la proteina chimerica GFPDEVDHATM; − U2OS GFP: cellule U2OS che esprimono stabilmente la proteina GFP. Le popolazioni di U2OS che esprimono stabilmente i costrutti pEGFPC3DEVDHATM e pEGFPN1, sono state prodotte trasfettando le cellule con 500ng dei rispettivi DNA plasmidici e mantenute con le normali condizioni di coltura, selezionando i cloni positivi per la trasfezione con l’antibiotico geneticina (Invitrogen), un analogo della neomicina. La selezione è resa possibile dalla presenza nel vettore di una cassetta di resistenza per la neomocina, che comprende il promotore SV40, il gene di Tn5 per la resistenza alla neomicina e i segnali di poliadenilazione del gene virale della chinasi della timidina (HSV TK). Le cellule vengono coltivate in incubatori umidificati ad una temperatura di 37°C con il 5% di CO2 nel terreno di coltura DMEM (Dulbecco’s Modified Eagle’s Medium) addizionato con il 10% di siero bovino fetale (FCS), Lglutammina 2 mM, penicillina e streptomicina 100 U/ml. Il terreno contiene: glucosio, amminoacidi, sali minerali, vitamine, oltre all’indicatore di pH rosso fenolo. Gli antibiotici sono stati aggiunti per evitare contaminazioni batteriche; il siero bovino fetale contiene numerosi fattori di crescita e fattori adesivi, tra cui la fibronectina e la vitronectina.

70

Materiali e metodi

Le cellule crescono aderenti al contenitore di coltura (fiasche e capsule petri) fino a quando raggiungono la confluenza. A questo punto vengono staccate dal substrato tramite incubazione a 37°C con una soluzione salina contenente tripsina al 0.05% w/v e EDTA (acido etilendiaminotetraacetico) al 0.02% w/v, vengono raccolte e centrifugate a 1000 rpm per 5 minuti e il fondello risospeso e diluito fino alla concentrazione necessaria, stabilita dopo aver contato le cellule con una cameretta contacellule di Neubauer. Infine le cellule vengono seminate in DMEM al 10% FCS e lasciate crescere nell’incubatore fino al successivo passaggio.

3.1 Introduzione di DNA esogeno nelle cellule
Per indurre l'espressione delle proteine di interesse nella linea IMR90E1A, i cDNA corrispondenti sono stati introdotti all’interno delle cellule attraverso due metodiche: la trasfezione tramite calcio-fosfato e la microiniezione diretta nel nucleo. Il DNA plasmidico introdotto nelle cellule eucariotiche è stato estratto mediante una preparazione midi, specifica per la microiniezione perché che fornisce una elevata resa e purezza.

3.1.1 Trasfezione tramite calcio-fosfato
La trasfezione è una tecnica che consente l’introduzione di DNA esogeno in cellule eucariotiche. Questa tecnica si basa sulla formazione di microprecipitati, contenenti il DNA, che aderiscono alla superficie cellulare e vengono internalizzati dalle cellule tramite endocitosi. A seconda del tipo cellulare si può trasfettare fino al 20% delle cellule totali. E quindi è il metodo di scelta quando si vuole vedere l’effetto di una determinata proteina su un numero elevato di cellule.

71

Materiali e metodi

Le cellule sono state seminate un giorno prima della trasfezione in petrine da 2 cm contenenti un vetrino coprioggetto. Il terreno delle cellule è stato cambiato con terreno DMEM 10% FCS virato 1 ora circa prima della trasfezione, quando la confluenza delle cellule è approssimativamente del 1020%. Nel frattempo è stata preparata la miscela dei precipitati aggiungendo goccia a goccia una soluzione di 50 µl, contenente 500 ng di DNA plasmidico e 5 µl di CaCl2 in H2 O, a 50 µl di HBS (50 mM Hepes, 280 mM NaCl, 1.5 mM Na2HPO4. pH 7.05-7.15). Per permettere la formazione dei precipitati, la miscela è stata lasciata 40 minuti a RT e poi è stata aggiunta al terreno della petri sempre goccia a goccia. Dopo 6-8 ore le cellule sono state lavate tre volte con PBS allo scopo di rimuovere i precipitati non internalizzati e la coltura cellulare e’ stata quindi lasciata crescere nell’incubatore umidificato (37°C e 5% CO2) in DMEM-10% FCS fresco fino al momento della raccolta per il saggio. Per i saggi di localizzazione mitocondriale in immunofluorescenza, è stato transfettato il costrutto GFPDEVDHATM in cellule IMR90E1A. Nei saggi di processamento tramite Western blot, i costrutti sono stati transfettati in cellule IMR90E1A, utilizzando una concentrazione di DNA plasmidico pari a 500ng.

3.1.2 Microiniezione cellulare
La microiniezione è un metodo per l’introduzione di macromolecole, come DNA, RNA, proteine o polisaccaridi, in cellule eucariotiche. Rispetto ad altre tecniche di trasferimento di DNA, come la trasfezione, questa tecnica permette un’analisi transiente molto più efficiente e omogenea; inoltre il preciso controllo del tempo e della concentrazione del DNA usato in ogni esperimento, permette un’alta riproducibilità ed attendibilità dei risultati ottenuti.

72

Materiali e metodi

3.1.2.1 Descrizione del sistema di microiniezione automatizzata

Per gli esperimenti di microiniezione, è stato utilizzato un sistema automatizzato costituito dai seguenti componenti: un microscopio ottico rovesciato a contrasto di fase (Zeiss Axiovert 10) una videocamera montata sul microscopio e collegata ad un monitor, che permette di osservare le cellule un micromanipolatore (Eppendorf 5176) formato da: un piano mobile lungo gli assi x e y, sul quale è posizionata la petri con le cellule da microiniettare ed un braccio che si muove verticalmente, sul quale è stato fissato il portacapillari; un microiniettore a pressione (Eppendorf 5242), che serve per la regolazione della pressione di microiniezione; un computer, che controlla le parti mobili del sistema, in base alle informazioni ricevute dall’operatore tramite un cursore mobile. 3.1.2.2 Tecnica della microiniezione La petri con le cellule da microiniettare è stata posizionata al di sopra della torretta con gli obiettivi, tra i quali, a seconda delle dimensioni del tipo cellulare, sono stati usati il 20x o il 32x. Quindi è stato selezionato il numero di campi di cellule da microiniettare ed il tempo di permanenza del capillare all’interno delle cellule (circa 0.4 sec). Il capillare è stato quindi caricato con 1 µl del DNA campione da microiniettare, è stato montato sul portacapillari e sistemato nel micromanipolatore. Il campione è stato previamente centrifugato per 30 minuti a 13000 rpm, per permettere la precipitazione di eventuali particolati potenzialmente in grado di occludere il lume del capillare, impedendo il flusso del liquido.

73

Materiali e metodi

Il sistema computerizzato permette di memorizzare il piano delle cellule e la posizione delle cellule da microiniettare, marcate dall’operatore nel campo selezionato. Il capillare è stato abbassato automaticamente in tutte le cellule marcate secondo una velocità e una pressione prestabilita a seconda del tipo cellulare. Il volume di campione iniettato in ogni cellula per una durata di 0.4 s e con una pressione costante di 150 hPa è stato valutato intorno a 0.05 pl; ciò significa che per un campione di DNA plasmidico di circa 5000 bp alla concentrazione di 50 ng/µl, sono state iniettate circa 500 molecole per cellula. Negli esperimenti di microiniezione per gli esperimenti di Time-lapse, cellule IMR90E1A sono state microiniettate con 2 ng/µl dei costrutti utilizzati (GFPDEVDHATM, GFPHATM, GFPTM, GFPTM-D).

1.2 Induzione dell’apoptosi mediante trattamento con etoposide, MG-132, TSA
Le cellule sono state piastrate ad una concentrazione tale da presentare il 70-80% di confluenza al momento dell’induzione del danno. Prima di indurre l’apoptosi, il terreno viene rimosso e sostituito con terreno fresco in cui la droga è stata diluita. I farmaci utilizzati costituiscono degli stimoli apoptotici diversi: Etoposide, un inibitore della topoisomerasi II (Alexis); MG-132, un inibitore del proteosoma (Alexis); TSA (tricostatina A), un inibitore delle deacetilasi degli istoni (Alexis).

Le cellule trattate con etoposide sono state raccolte dopo 18 ore dal trattamento con la droga nel caso del saggio di processamento dei diversi costrutti transfettati in cellule IMR90E1A; le analisi temporali del costrutto GFPDEVDHATM e degli stabili di U2OS, esprimenti GFP e GFPDEVDHATM sono stati condotti a tempi diversi, raccogliendo i lisati cellulari a 6-12-24-36-48

74

Materiali e metodi

ore; infine nei saggi di processamento in relazione a stimoli differenti, la durata del trattamento con etoposide ed MG-132 è stata di 24 ore, con TSA di 48 ore, questo per ottenere una percentuale di morte paragonabile nella popolazione cellulare.

1.3 Saggio di inibizione dell'attività caspasica in cellule apoptotiche
In questi saggi si è potuta testare l’inibizione dell’attività caspasica, conseguente all’innesco dell’apoptosi, utilizzando un inibitore sintetico del gruppo III delle caspasi, BOC-fmk (Alexis). Per permettere un’azione inbitoria più efficace, il BOC-fmk, utilizzato a concentrazione 125µM, è stato aggiunto al terreno di coltura mezz’ora prima del trattamento con lo stimolo apoptotico. Le cellule così trattate sono state raccolte con le stesse modalità già descritte.

4 Tecniche di analisi delle proteine

4.1 Preparazione dei lisati proteici
Negli esperimenti effettutati, i lisati proteici, di cellule apoptotiche, sono stati ottenuti raccogliendo insieme le cellule di ciascun campione oppure separando per ogni campione le cellule vive (adese) da quelle non vitali (non adese). Da qust’ultimo caso, il terreno contenente le cellule morte è stato raccolto mentre le cellule aderenti, dopo un lavaggio in PBS, sono state staccate mediante trattamento con tripsina. Sono state raccolte con lo stesso sistema anche le cellule di controllo non trattate con la droga. Dopo centrifugazione per 5 minuti a 1300 rpm a 4°C e due lavaggi in PBS, le cellule sono state risospese in un opportuno volume di tampone di caricamento Laemmly 1x (60 mM Tris pH 6.8 10% v/v glicerolo, 2% w/v SDS, 1% v/v βmercaptoetanolo) pari a quello del fondello. Al fine di frammentare il DNA genomico, sono state effettuate tre sonicazioni di 20 s. Infine i campioni sono

75

Materiali e metodi

stati bolliti per 5 minuti, in modo da completare il processo di denaturazione delle proteine, e centrifugati per 30 s alla massima velocità (13000 rpm). Al fine di effettuare una analisi quantitativa dei segnali rilevati mediante Western blot, i diversi campioni sono stati tarati e quindi normalizzati. Per fare questo 5 µl di ogni campione sono stati caricati su un gel di acrilammide al 10% che, dopo la corsa elettroforetica, è stato colorato con una soluzione di Coomassie R-250 (0.2% w/v di Coomassie Billiant Blue in 10% acido acetico, 50% metanolo) per 20 minuti e poi decolorato con una soluzione 10% acido acetico, 30% metanolo. Una volta determinate le concentrazioni dei lisati proteici, un altro gel è stato caricato con quantità normalizzate e fatto correre. Successivamente le proteine separate sono state trasferite su una membrana di nitrocellulosa per l’analisi.

1.2 Analisi di proteine mediante Western blotting

4.2.1 Elettrotrasferimento di proteine su membrana di nitrocellulosa
Il Western blot è una metodica che consiste nel trasferire su una matrice immobilizzante una miscela di proteine separate elettroforeticamente su un gel di poliacrilammide. La membrana viene successivamente incubata in presenza di un anticorpo specifico che permette di individuare selettivamente la proteina d’interesse. Le bande proteiche, separate dopo migrazione su gel, possono essere trasferite su una membrana di nitrocellulosa per mezzo di un campo elettrico. A tale scopo è stata utilizzata una cella di trasferimento (NovaBlot della Amersham Pharmacia) che ha due elettrodi di grafite in orizzontale; nella piastra inferiore (catodo) sono stati posti, nell’ordine: − tre fogli di carta forniti dalla stessa ditta produttrice, imbevuti di tampone di trasferimento (48mM Tris HCl pH 7.5. 39 mM glicina, 20%

76

Materiali e metodi

v/v metanolo, 0.0375% w/v SDS) e tagliati dalle stesse dimensioni del gel; − la membrana di nitrocellulosa (Schleicher&Schuell) con pori di 0.2 µm, anch’essa imbevuta di tampone di trasferimento; − il gel contenete le proteine cariche negativamente, risciacquato in tampone di trasferimento; − altri tre fogli di carta imbevuti di tampone di trasferimento. Ogni strato è stato pressato con una pipetta al fine di eliminare le bolle d’aria. Il tutto è stato rinchiuso con la piastra superiore (anodo) e è stato applicato un potenziale di 43 mA per 60 minuti (0.8 mA/cm2 ). Le proteine, trasferite in questo modo, si legano alla superficie del foglio di nitrocellulosa, rimanendo accessibili alle successive interazioni con gli anticorpi. La verifica della qualità del trasferimento è stata eseguita colorando la membrana con Rosso Ponceau (0.1% w/v Ponceau S, 5% v/v acido acetico), un colorante che lega reversibilmente le proteine. La decolorazione è stata effettuata risciacquando la membrana con acqua o PBS.

4.2.2 Rilevamento della banda proteica tramite anticorpi
Il filtro di nitrocellulosa è stato incubato per 1 h, in agitazione, nella soluzione di bloccaggio (PBS1x, 5% w/v latte in polvere Delikat-Gram, 200mM NaCl, 50mM Tris HCl pH 7.5, 0.1% v/v Tween20) al fine di saturare tutti i siti non occupati dalle proteine trasferite ed evitare quindi interazioni aspecifiche degli anticorpi. Successivamente il filtro è stato incubato tutta la notte a 4°C con la soluzione di bloccaggio più l’anticorpo primario, diluito alla concentrazione opportuna. L’anticorpo primario non legato è stato eliminato mediante tre lavaggi di 10 minuti nella soluzione di saturazione. Successivamente la membrana è stata incubata per 1 ora nella soluzione di bloccaggio contenente

77

Materiali e metodi

l’anticorpo secondario, che riconosce il frammento Fc degli anticorpi primari (coniglio o topo). L’anticorpo secondario può essere coniugato con fosfatasi alcalina o con perossidasi. Seguono altri tre lavaggi nella soluzione di bloccaggio. Nei casi in cui si é utilizzata la tecnica di visualizzazione cromogenica con la fosfatasi alcalina (AP), é stato fatto un lavaggio di 5-10 minuti in PBS e poi si è aggiunta la miscela di substrato: 33 µl di NBT (Nitro Blue Tetrazolium), lasciato incubare da 5 a 30 minuti finché le bande presentavano un intensità adeguata. Per bloccare la reazione si è lavato in PBS/2 mM EDTA pH 8.0. Se é stata usata la tecnica di sviluppo con la perossidasi (HPRO o Horseradish Peroxidase), dopo un lavaggio in PBS, si è lasciata incubare la membrana per 3 minuti con un substrato (Pierce) che sviluppa chemioluminescenza a contatto con l’enzima. Poi la membrana è stata esposta ad una lastra fotografica (Kodak) che resta impressionata in corrispondenza della banda proteica riconosciuta dall’anticorpo. Il tempo di esposizione é stato variato da pochi secondi ad alcuni minuti, a seconda dell’intensità del segnale. Nell' immunoblotting condotto per valutare il processamento delle proteine in fusione con GFP è stato utilizzato come anticorpo primario l’antiGFP rabbit (G. Paroni & al., 2004), come anticorpo secondario l’anti-rabbit coniugato con HPRO (Euroclone). Per analizzare il processamento di HDAC4 e PARP sono stati utilizzati come anticorpi primari rispettivamente l’anti-HDAC4 rabbit (G. Paroni & al., 2004) e l’anti-PARP, e come anticorpo secondario l’antirabbit coniugato con HPRO (Euroclone), per entrambi. Inoltre, come marker di taratura dei lisati proteici è stato usato l’anticorpo primario anti-tubulina rabbit e come anticorpo secondario l’anti-rabbit-AP (KPL).

78

Materiali e metodi

1.3 Saggio di immunofluorescenza indiretta
I saggi di immunofluorescenza permettono di analizzare la presenza e la localizzazione di proteine nelle cellule grazie a delle reazioni antigeneanticorpo. In questa tesi i saggi sono stati realizzati 20-24 ore dopo la trasfezione mediante calcio-fosfato. Le cellule adese ad un vetrino coprioggetto, sono state fissate per 20’ in paraformaldeide (PFA) al 3% in PBS. Al termine di questo processo, i siti reattivi della PFA sono stati saturati con glicina 0.1 M, pH 7.5 in PBS e le cellule sono state permeabilizzate con Triton X 100 allo 0.1% in PBS. In seguito le cellule sono state incubate, a 37°C, con l’anticorpo d’interesse per 45’ in camera umida e dopo alcuni lavaggi in PBS sono state incubate per 30 minuti, con un anticorpo diretto contro il primo, coniugato con un fluorocromo TRITC (Tetramethylrhodamine Isotiocyanate, SIGMA) o FITC (Fluorescein

Isotiocyanate, SIGMA); il TRITC assorbe ad un massimo di 543 nm (verde) ed emette nel rosso, il FITC assorbe a 488 nm ed emette nel verde. Dopo un lavaggio in PBS i nuclei sono stati colorati incubando le cellule per 5 minuti con Hoechst (FLUKA). Infine, il vetrino è stato lavato una volta in PBS e una volta in H2O e successivamente montato su un vetrino portaoggetti sopra una goccia di moviol (per 50 ml: 2.4 gr di moviol, 4.7 ml di glicerolo e 12 ml di 0.2 M Tris (pH 8.5 in H2O). Il vetrino è stato successivamente osservato al microscopio a fluorescenza dove le radiazioni che eccitano i fluorocromi sono prodotte da una lampada ai vapori di mercurio e selezionate da opportuni filtri di eccitazione. Dei filtri di sbarramento, invece, eliminano la luce di eccitazione in eccesso non assorbita dal preparato, permettendo il rilevamento della sola luce di fluorescenza. Il saggio di immunofluorescenza su cellule IMR90E1A transfettate con il costrutto GFPDEVDHATM per rilevarne la localizzazione mitocondriale é stato

79

Materiali e metodi

realizzato 24 ore dopo la trasfezione, utilizzando l’anticorpo primario anti-HA (Sigma), seguito da incubazione con anticorpo secondario coniugato con TRITC (Sigma), mentre la fluorescenza verde è possibile monitorarla eccitando il GFP ad una lunghezza d’onda opportuna (488 nm).

5

Analisi della popolazione apoptotica in cellule indotte alla morte cellulare

5.1 Utilizzo della citofluorimetria a flusso
La citometria a flusso è una tecnica che consente di misurare lo scattering di luce e l’emissione di fluorescenza da una singola cellula transitante in una sospensione fluida. Tali parametri permettono di determinare proprietà fisiche e biochimiche della cellula, quali la dimensione, la forma, la rugosità di superficie, la complessità interna, il contenuto in proteine, lipidi, acidi nucleici, flussi ionici. Per ottenere queste informazioni, il citometro a flusso (Becton Dickinson) utilizza: − un sistema di dispensazione del campione, collegato ad una pompa a pressione che ne regola il flusso; − una fonte luminosa ad argon, che, attraverso un sistema ottico di direzione della luce, va a colpire direttamente il campione; − un sistema ottico di rilevazione della fluorescenza emessa dal campione, collegato ad un rilevatore fotografico; − un rilevatore della dispersione della luce (scattering), dovuta al passaggio del laser attraverso il campione;

80

Materiali e metodi

− un sistema di processazione elettronica dei segnali ottenuti dai due rilevatori, collegato ad un sistema di conversione del segnale da analogico a digitale, che renda le informazioni accessibili ai sistemi computerizzati. L’utilizzo di questo strumento può avere diverse applicazioni: nel nostro caso, è stata valutata la percentuale di cellule apoptotiche, all’interno di una popolazione cellulare trattata con uno stimolo proapoptotico, colorando il DNA con il propidio ioduro. L’utilizzo del propidio ioduro, quale intercalante del DNA, permette di misurare la quantità di DNA in ogni singola cellula: esso, infatti, è un fluoroforo che si intercala in maniera stechiometrica al DNA e quindi quanto maggiore è la quantità di DNA maggiori saranno le molecole di fluoroforo intercalate e maggiore sarà la fluorescenza rilevabile dal citofluorimetro. Poiché il contenuto di DNA varia durante il ciclo cellulare essendo N in fase G1, raddoppiando durante la fase S e diventando quindi 2N nelle fasi G2ed M, il segnale emesso dal propidio ioduro in rapporto al numero di cellule analizzate rispecchierà la distribuzione cellulare nelle varie fasi del ciclo. I dati raccolti vengono presentati come grafico bidimensionale in cui in ascissa viene riportata l’intensità di fluorescenza del propidio ioduro ed in ordinata il numero di cellule analizzate. Le cellule apoptotiche, in seguito alla formazione dei corpi apoptotici ed alla frammentazione del DNA rappresenteranno una popolazione di cellule con contenuto di DNA inferiore ad N e quindi sono rilevabili dal citofluorimetro come quella popolazione di cellule che presentano una intensità di fluorescenza inferiore alle cellule in fase G1. Quando la percentuale di cellule apoptotiche è rilevante, il grafico che descrive il ciclo cellulare mostra un picco in fase sub-G1. Selezionando il numero di cellule/eventi analizzati corrispondenti a tale picco rispetto al totale di eventi registrati nel corso dell’analisi si ottiene una misura della percentuale di cellule apoptotiche presenti nel campione analizzato. Mediamente l’analisi assume valore statistico se vengono vagliati almeno 10.000. Si è proceduto alla preparazione dei campioni da analizzare al citofluorimetro nel seguente modo. Le linee cellulari stabili U2OSGFPDEVDHA

81

Materiali e metodi

e U2OSGFP sono state seminate alla concentrazione di 4x104 cellule/ml in piatti da ∅10cm ed il giorno successivo, in condizione di 80-90%confluenza, addizionate con etoposide alla concentrazione di 42,5µM. Le stesse sono state raccolte e trattate per l’analisi al citofluorimetro a 0h, 24h e 48h dall’aggiunta di etoposide secondo la procedura di seguito riportata. Il mezzo di coltura di ciascun campione (contenente le cellule morte in sospensione) è stato conservato e aggiunto alle cellule vitali ancora adese, dopo lavaggio delle stesse in PBS e tripsinizzazione. Dopo un ulteriore lavaggio in PBS e centrifugazione a 1000rpm per 5min le cellule sono state trasferite in eppendorf, fissate e permeabilizzate mediante risospensione del pellet in 70% etanolo freddo ed incubazione a -20°C per circa 18 ore. L’etanolo è stato successivamente eliminato mediante due lavaggi in PBS ed il pellet è stato risospeso in 200µl di PBS contenente TritonX-100 allo 0,01% ed RNAsi A alla concentrazione di 100µg/ml incubando per 10minuti a temperatura ambiente in leggera agitazione. Il detergente non ionico TritonX-100 è stato utilizzato allo scopo di permeabilizzare le cellule mentre l’RNAsi A ha lo scopo di degradare l’RNA presente nel campione. Il DNA presente in ciascun campione è stato quindi colorato con propidio ioduro, mediante addizione di 200µl di PBS contenente l’intercalante alla concentrazione di 50µg/ml ed incubazione per 40 minuti a temperatura ambiente in leggera agitazione. A questo punto è stato possibile analizzare i campioni al citofluorimetro (Becton Dickinson) mediante il programma CELL Quest (Becton Dickinson). Per ogni campione sono stati analizzati 10000 eventi escludendo dall’analisi gli eventi corrispondenti a detriti cellulari o contaminanti inerti. Questi ultimi sono definiti mediante valutazione delle dimensioni delle cellule analizzate tramite l’analisi dei parametri di scattering.

82

Materiali e metodi

5.2 Conta di cellule vitali mediante colorazione col Trypan Blue
Questa tecnica permette di colorare in modo differenziale cellule vive e cellule morte. Il Trypan Blue è un colorante per cellule vitali ed il suo principio di funzionamento si basa sulla presenza di un cromoforo carico negativamente, che interagisce con le cellule solo quando la membrana è danneggiata. Di conseguenza tutte le cellule che non inglobano il colore al loro interno sono vitali. Le cellule sono state raccolte tramite tripsinizzazione in tubi e cenrtifugate a 1000rpm per 5 minuti. Una volta scartato il surnatante, il fondello è stato risospeso in un volume definito di terreno (valutato in base alle dimensioni del pellet) in modo da avere una sospensione cellulare omogenea. Un volume definito di questa sospensione è stata prelevato e addizionato ad un ugual volume di Trypan Blue in un tubo da 1,5ml. Dopo un’incubazione di 5 minuti, si effettua la conta al microscopio ottico, utilizzando una cameretta contacellule di Neubaurer. Il numero di cellule non vitali è stato espresso come percentuale rispetto al numero totale di cellule; la formula utilizzata è la sequenza: % cellule apoptotiche = media delle cellule colorate di blu x 100 numero totale di cellule

6 Acquisizione delle immagini mediante microscopio confocale

6.1 Microscopio confocale a luce laser
Il microscopio confocale LEICA TCS utilizzato per l’analisi delle immagini è costituito da: − un microscopio invertito a fluorescenza convenzionale (LEICA DM IRBE).

83

Materiali e metodi

− una lampada ad alta pressione di mercurio e due diverse fonti di luce laser, una ad argon, per la luce laser di 488 nm, ed una ad helio-neon per la luce laser di 543 nm e 633 nm. − un sistema computerizzato che permette di analizzare le diverse sezioni dei campioni sia parallele sia verticali al piano focale, e di mostrarle in sequenza o di sovrapporle dando un’immagine composita a fuoco o una rappresentazione 3-D della struttura osservata. Questo sfrutta la limitata diffrazione della luce laser e permette di focalizzare sezioni ottiche dei preparati di immunofluorescenza, molto ristrette. La luce proveniente da altri piani è soppressa da un diaframma e non arriva al sistema di rilevamento, costituito dal fotomoltiplicatore. Essendo eliminata l’interferenza della luce di fluorescenza emessa da elementi fuori fuoco, la risoluzione ed il contrasto ottenuti sono nettamente migliori rispetto alla normale microscopia a fluorescenza.

6.2 Acquisizione Time-Lapse con il microscopio confocale
Questo tipo di acquisizione delle immagini permette di seguire in vivo gli effetti di un determinato trattamento su una popolazione di cellule, grazie all’acquisizione di immagini fatte ad intervalli regolari di tempo. Le cellule IMR90E1A sono state microiniettate con i diversi costrutti descritti, lasciate in incubatore a 37°C per 3h per permettere l’espressione della proteina chimerica e quindi trattate con 10nM TMRM. Al momento dell’aggiunta del TMRM, il terreno di coltura è stato addizionato di etoposide 50µM. Dopo 24h, la petrina contenente le cellule trattate è stata trasferita dall’incubatore alla cameretta montata sul piano del microscopio confocale. La cameretta è dotata di un sistema di controllo della temperatura e della concentrazione di CO2, analogamente ad un classico incubatore per colture cellulari. Questo permette di effettuare prolungate analisi time-lapse senza influenzare la vitalità delle

84

Materiali e metodi

cellule. L’analisi time lapse del campo visivo scelto è stata condotta per circa 24h, acquisendo una immagine ogni 2 minuti, con un obiettivo di risoluzione 63x.

85

BIBLIOGRAFIA

Bibliografia

BIBLIOGRAFIA

Adams JM. Ways of dying: multiple pathways to apoptosis Genes Dev. 2003 Oct 15. Antonsson B, Conti F, Ciavatta A, Montessuit S, Lewis S, Martinou I, Bernasconi L, Bernard A, Mermod JJ, Mazzei G, Maundrell K, Gambale F, Sadoul R, Martinou JC. Inhibition of Bax channel-forming activity by Bcl-2 Science. 1997 Jul 18. Arnoult D, Gaume B, Karbowski M, Sharpe JC, Cecconi F, Youle RJ. Mitochondrial release of AIF and EndoG requires caspase activation downstream of Bax/Bak-mediated permeabilization EMBO J. 2003 Sep 1. Basanez G, Sharpe JC, Galanis J, Brandt TB, Hardwick JM, Zimmerberg J. Bax-type apoptotic proteins porate pure lipid bilayers through a mechanism sensitive to intrinsic monolayer curvature J Biol Chem. 2002 Dec 20. Epub 2002 Oct 14. Bassik MC, Scorrano L, Oakes SA, Pozzan T, Korsmeyer SJ. Phosphorylation of BCL-2 regulates ER Ca(2+) homeostasis and apoptosis EMBO J. 2004 Mar 10. Epub 2004 Mar 04. Bernardi P, Scorrano L, Colonna R, Petronilli V, Di Lisa F. Mitochondria and cell death. Mechanistic aspects and methodological issues Eur J Biochem. 1999 Sep;264(3):687-701. Erratum in: Eur J Biochem 1999 Oct. Bernardi P. Mitochondrial transport of cations: channels, exchangers, and permeability transition Physiol Rev. 1999 Oct. Brancolini C, Lazarevic D, Rodriguez J, Schneider C. "Dismantling cell-cell contacts during apoptosis is coupled to a caspase-dependent proteolytic cleavage of beta-catenin" J Cell Biol. 1997 Nov 3;139(3):759-71. Boatright KM, Renatus M, Scott FL, Sperandio S, Shin H, Pedersen IM, Ricci JE, Edris WA, Sutherlin DP, Green DR, Salvesen GS. A unified model for apical caspase activation Mol Cell. 2003 Feb. Boatright KM, Salvesen GS. Mechanisms of caspase activation Curr Opin Cell Biol. 2003 Dec.

86

Bibliografia

Budihardjo I, Oliver H, Lutter M, Luo X, Wang X. Biochemical pathways of caspase activation during apoptosis Annu Rev Cell Dev Biol. 1999. Chang DW, Ditsworth D, Liu H, Srinivasula SM, Alnemri ES, Yang X. Oligomerization is a general mechanism for the activation of apoptosis initiator and inflammatory procaspases J Biol Chem. 2003 May 9. Epub 2003 Mar 13. Chang HY, Yang X. Proteases for cell suicide: functions and regulation of caspases Microbiol Mol Biol Rev. 2000 Dec. Chipuk JE, Kuwana T, Bouchier-Hayes L, Droin NM, Newmeyer DD, Schuler M, Green DR. Direct activation of Bax by p53 mediates mitochondrial membrane permeabilization and apoptosis Science. 2004 Feb 13. Cohen GM. Caspases: the executioners of apoptosis Biochem J. 1997 Aug 15. Cryns V, Yuan J. Proteases to die for Genes Dev. 1998 Jun 1. Danial NN, Korsmeyer SJ. Cell death: critical control points Cell. 2004 Jan 23. De Giorgi F, Lartigue L, Bauer MK, Schubert A, Grimm S, Hanson GT, Remington SJ, Youle RJ, Ichas F. The permeability transition pore signals apoptosis by directing Bax translocation and multimerization FASEB J. 2002 Apr. Dussmann H, Rehm M, Kogel D, Prehn JH. Outer mitochondrial membrane permeabilization during apoptosis triggers caspase-independent mitochondrial and caspase-dependent plasma membrane potential depolarization: a single-cell analysis J Cell Sci. 2003 Feb. Earnshaw WC, Martins LM, Kaufmann SH. Mammalian caspases: structure, activation, substrates, and functions during apoptosis Annu Rev Biochem. 1999. Elmore SP, Nishimura Y, Qian T, Herman B, Lemasters JJ. Discrimination of depolarized from polarized mitochondria by confocal fluorescence resonance energy transfer Arch Biochem Biophys. 2004 Feb 15. Emanuelsson O. Predicting protein subcellular localisation from amino acid sequence information Brief Bioinform. 2002 Dec. Fischer U, Janicke RU, Schulze-Osthoff K. Many cuts to ruin: a comprehensive update of caspase substrates Cell Death Differ. 2003 Jan. Green DR, Reed JC. Mitochondria and apoptosis Science. 1998 Aug 28.

87

Bibliografia

Griffiths EJ. Mitochondria--potential role in cell life and death Cardiovasc Res. 2000 Apr. Guo Y, Srinivasula SM, Druilhe A, Fernandes-Alnemri T, Alnemri ES. Caspase2 induces apoptosis by releasing proapoptotic proteins from mitochondria J Biol Chem. 2002 Apr 19. Epub 2002 Feb 06. He L, Wu X, Meylan F, Olson DP, Simone J, Hewgill D, Siegel R, Lipsky PE. Monitoring caspase activity in living cells using fluorescent proteins and flow cytometry Am J Pathol. 2004 Jun. Hengartner MO. The biochemistry of apoptosis Nature. 2000 Oct 12. C. J. Henderson, M. Mizzau, G. Paroni, R. Maestro. C. Schneider, C.Brancolini. "Role of Caspases, Bid, and Apoptotic Response Triggered by Histone Deacetylase Inhibitors Trichostatin-A (TSA) and Suberoylanilide Hydroxamic Acid (SAHA)" J Biol Chem 2003 Jan 29 Janicke RU, Walker PA, Lin XY, Porter AG. Specific cleavage of the retinoblastoma protein by an ICE-like protease in apoptosis EMBO J. 1996 Dec 16. Jeong SY, Gaume B, Lee YJ, Hsu YT, Ryu SW, Yoon SH, Youle RJ. Bcl-x(L) sequesters its C-terminal membrane anchor in soluble, cytosolic homodimers EMBO J. 2004 May 19. Epub 2004 May 06. Jones RA, Smail A, Wilson MR. Detecting mitochondrial permeability transition by confocal imaging of intact cells pinocytically loaded with calcein Eur J Biochem. 2002 Aug. Joshi SG, Sahni SK. Immunofluorescent detection of activation of initiator caspases-8 and -9 during pharmacologically induced apoptosis of cultured HeLa and endothelial cells Histochem Cell Biol. 2003 Jun. Epub 2003 May 23. Kasili PM, Song JM, Vo-Dinh T. Optical sensor for the detection of caspase-9 activity in a single cell J Am Chem Soc. 2004 Mar 10. Kaufmann SH, Desnoyers S, Ottaviano Y, Davidson NE, Poirier GG. Specific proteolytic cleavage of poly(ADP-ribose) polymerase: an early marker of chemotherapy-induced apoptosis Cancer Res. 1993 Sep 1. Kaufmann T, Schlipf S, Sanz J, Neubert K, Stein R, Borner C. Characterization of the signal that directs Bcl-x(L), but not Bcl-2, to the mitochondrial outer membrane J Cell Biol. 2003 Jan 6. Epub 2003 Jan 06. Kohler C, Orrenius S, Zhivotovsky B. Evaluation of caspase activity in apoptotic cells J Immunol Methods. 2002 Jul 1.

88

Bibliografia

Komoriya A., Packard B.Z., Brown M.J., Wu M and Henkart P.A.. "Assessment of Caspase Activity in Intact Apoptotic Thymocytes Using Cellpermeable Fluorogenic Caspase Substrates . J. Exp. Med. 2000. Kuwana T, Newmeyer DD. Bcl-2-family proteins and the role of mitochondria in apoptosis Curr Opin Cell Biol. 2003 Dec. Li LY, Luo X, Wang X. Endonuclease G is an apoptotic DNase when released from mitochondria Nature. 2001 Jul 5. Luo KQ, Yu VC, Pu Y, Chang DC. Application of the fluorescence resonance energy transfer method for studying the dynamics of caspase-3 activation during UV-induced apoptosis in living HeLa cells Biochem Biophys Res Commun. 2001 May 25. Mahajan NP, Harrison-Shostak DC, Michaux J, Herman B. Novel mutant green fluorescent protein protease substrates reveal the activation of specific caspases during apoptosis Chem Biol. 1999 Jun. Maniatis & al. Molecolar cloning, a laboratory manual . 1989 Minn AJ, Velez P, Schendel SL, Liang H, Muchmore SW, Fesik SW, Fill M, Thompson CB. Bcl-x(L) forms an ion channel in synthetic lipid membranes Nature. 1997 Jan 23. Moreira ME, Barcinski MA. Apoptotic cell and phagocyte interplay: recognition and consequences in different cell systems An Acad Bras Cienc. 2004 Mar. Epub 2004 Mar 04. Morgan MJ, Thorburn A. Measurement of caspase activity in individual cells reveals differences in the kinetics of caspase activation between cells Cell Death Differ. 2001 Jan. Orrenius S, Zhivotovsky B, Nicotera P. Regulation of cell death: the calciumapoptosis link Nat Rev Mol Cell Biol. 2003 Jul. Paroni G, Mizzau M, Henderson C, Del Sal G, Schneider C, Brancolini C. "Caspase-dependent regulation of histone deacetylase 4 nuclearcytoplasmic shuttling promotes apoptosis" Mol Biol Cell. 2004 Jun;15(6):2804-18. Epub 2004 Apr 09. Petronilli V, Penzo D, Scorrano L, Bernardi P, Di Lisa F. The mitochondrial permeability transition, release of cytochrome c and cell death. Correlation with the duration of pore openings in situ J Biol Chem. 2001 Apr 13. Epub 2000 Dec 27.

89

Bibliografia

Petros AM, Medek A, Nettesheim DG, Kim DH, Yoon HS, Swift K, Matayoshi ED, Oltersdorf T, Fesik SW. Solution structure of the antiapoptotic protein bcl-2 Proc Natl Acad Sci U S A. 2001 Mar 13. Epub 2001 Feb 27. Rehm M, Dussmann H, Prehn JH. Real-time single cell analysis of Smac/DIABLO release during apoptosis J Cell Biol. 2003 Sep 15. Ricci JE, Gottlieb RA, Green DR. Caspase-mediated loss of mitochondrial function and generation of reactive oxygen species during apoptosis J Cell Biol. 2003 Jan 6. Epub 2003 Jan 06. Saito M, Korsmeyer SJ, Schlesinger PH. BAX-dependent transport of cytochrome c reconstituted in pure liposomes Nat Cell Biol. 2000 Aug. Salvesen GS, Dixit VM. Caspase activation: the induced-proximity model Proc Natl Acad Sci U S A. 1999 Sep 28. Scorrano L, Oakes SA, Opferman JT, Cheng EH, Sorcinelli MD, Pozzan T, Korsmeyer SJ. BAX and BAK regulation of endoplasmic reticulum Ca2+: a control point for apoptosis Science. 2003 Apr 4. Epub 2003 Mar 06. Sharpe JC, Arnoult D, Youle RJ. Control of mitochondrial permeability by Bcl-2 family members Biochim Biophys Acta. 2004 Mar 1. Shi Y. Mechanisms of caspase activation and inhibition during apoptosis Mol Cell. 2002 Mar. Shimizu S, Narita M, Tsujimoto Y. Bcl-2 family proteins regulate the release of apoptogenic cytochrome c by the mitochondrial channel VDAC Nature. 1999 Jun 3. Stennicke HR, Deveraux QL, Humke EW, Reed JC, Dixit VM, Salvesen GS. Caspase-9 can be activated without proteolytic processing J Biol Chem. 1999 Mar 26. Susin SA, Lorenzo HK, Zamzami N, Marzo I, Snow BE, Brothers GM, Mangion J, Jacotot E, Costantini P, Loeffler M, Larochette N, Goodlett DR, Aebersold R, Siderovski DP, Penninger JM, Kroemer G. Molecular characterization of mitochondrial apoptosis-inducing factor Nature. 1999 Feb 4. Talanian RV, Quinlan C, Trautz S, Hackett MC, Mankovich JA, Banach D, Ghayur T, Brady KD, Wong WW. Substrate specificities of caspase family proteases J Biol Chem. 1997 Apr 11. Tawa P, Tam J, Cassady R, Nicholson DW, Xanthoudakis S. Quantitative analysis of fluorescent caspase substrate cleavage in intact cells and identification of novel inhibitors of apoptosis Cell Death Differ. 2001 Jan.

90

Bibliografia

Thornberry NA, Rano TA, Peterson EP, Rasper DM, Timkey T, Garcia-Calvo M, Houtzager VM, Nordstrom PA, Roy S, Vaillancourt JP, Chapman KT, Nicholson DW. A combinatorial approach defines specificities of members of the caspase family and granzyme B. Functional relationships established for key mediators of apoptosis J Biol Chem. 1997 Jul 18. Tinel A, Tschopp J. The PIDDosome, a protein complex implicated in activation of caspase-2 in response to genotoxic stress Science. 2004 May 7. Epub 2004 Apr 08. Troy CM, Shelanski ML. Caspase-2 redux Cell Death Differ. 2003 Jan. Tyas L, Brophy VA, Pope A, Rivett AJ, Tavare JM. Rapid caspase-3 activation during apoptosis revealed using fluorescence-resonance energy transfer EMBO Rep. 2000 Sep. Walczak H, Krammer PH. The CD95 (APO-1/Fas) and the TRAIL (APO-2L) apoptosis systems Exp Cell Res. 2000 Apr 10. Yang QH, Church-Hajduk R, Ren J, Newton ML, Du C. Omi/HtrA2 catalytic cleavage of inhibitor of apoptosis (IAP) irreversibly inactivates IAPs and facilitates caspase activity in apoptosis Genes Dev. 2003 Jun 15. Zhivotovsky B, Samali A, Gahm A, Orrenius S. Caspases: their intracellular localization and translocation during apoptosis Cell Death Differ. 1999 Jul. Zhou Q, Snipas S, Orth K, Muzio M, Dixit VM, Salvesen GS. Target protease specificity of the viral serpin CrmA. Analysis of five caspases J Biol Chem. 1997 Mar 21.

91

APPENDICE

Appendice

APPENDICE

Acronimo AIF Apaf-1 BH BIR CARD Caspase CFP CRADD/RAIDD C-terminale cytC dATP DD DED DEDs DISC ELISA FADD FasL FRET GFP IAPs IBM MTP N-terminale

Definizione Apoptosis-Inducing Factor Apoptotic-protease-activating-factor-1 Bcl-2 homology Baculovirus IAP Repeat CAspase Recruitment Domain Cystein-dependent aspartate specific protease Ciano Fluorescent Protein Caspase and RIP Adaptor with Death Domain Estremit della sequenza amminoacidica che termina con COOH cytochrome C deoxy-Adenosil-Tri-Phosphate death domain death effector domain Death Effector Domains Death-Inducing Signaling Complex Enzyme-Linked Immunosorbent Assay Fas-Associated protein with Death Domain Fas Ligand Fluorescence Resonance Energy Transfer Green Fluorescent Protein Inhibitors of Apoptosi Proteins IAP Binding Motif Mitocondrial Transition Pore Estremit della sequenza amminoacidica che termina con NH3

92

Appendice

Acronimo NEB PIDD PT RIP SODD TM TMRM TNFR TRADD TRAIL VDAC vFLIPs YFP Ψm ∆Ψm II ds

Definizione New Englan Biolabs p53-Induced protein with a Death Domain Transizione della Permeabilit Receptor-Interacting Protein Silencer Of Death Domains dominio transmembranario Tetra Methyl Rodamine Metyil ester Tumor Necrosis Factor Receptor TNFR-Associated Death Domain TNF-Related Apoptosis Inducing Ligand Voltage Dependent Anionic Chanel viral FADD-like ICE Inhibitory Proteins Yellow Fluorescent Protein potenziale transmembranario differenza del potenziale transmembranario Intensyt di fluorescenza Integrata su tutta la cellula Deviazione Standard

93

Ringraziamenti

Desidero ringraziare il professor Brancolini per avermi permesso di vivere la mia prima esperienza importante sui banchi di laboratorio. Lavorare nel suo gruppo di ricerca mi ha permesso di conoscere l’importanza dell’impegno, della perseveranza e dell’intuito necessari a svolgere le attività di ricerca scientifica. Questo per me ha rappresentato una grande lezione di vita.

Voglio ringraziare davvero il gruppo di persone che mi ha seguito con tanta pazienza e, a volte, spirito di sopportazione, durante tutto questo periodo. In particolare, sono grata a Gabriela, per avermi insegnato e spiegato, per avermi incoraggiato ma anche rimproverato. Ringrazio tutte le ragazze del laboratorio, Michela, Alessandra, Clare, Emanuela, Tamara, Marina ed Eleonora per aver vissuto con me questa esperienza e per la loro amicizia. Che la forza della Pituitary sia sempre con noi!!!.

Inoltre, non posso dimenticare chi mi è stato vicino da sempre, nei momenti sereni e in quelli più difficili, ognuno a modo suo. La mia famiglia, mamma, papà, zia, nonna e Michele. I miei amici, quelli veri, e tutti coloro che mi hanno aiutato anche solo con uno sguardo o una parola, proprio quando ne sentivo il bisogno. Mattia, per esserci.


				
DOCUMENT INFO
Shared By:
Categories:
Stats:
views:687
posted:12/29/2009
language:Italian
pages:106