BAHAN BAKU PERIKANAN

Document Sample
BAHAN BAKU PERIKANAN Powered By Docstoc
					BAHAN BAKU PERIKANAN I. PENDAHULUAN

1.1. Latar belakang Bahan baku hasil perikanan adalah bahan atau hasil-hasil perikanan yang dapat dijadikan sumber bahan baku yang dapat dimanfaatkan sebagai bahan industri hasil perikanan. Perairan umum Indonesia yang meliputi dua pertiga wilayah tanah air Indonesia memiliki Potensi sumber daya hayati perikanan yang besar dan belum seluruhnya dapat dikelola. Mengingat sangat mendesaknya kebutuhan akan protein hewani yang berasal dari ikan, maka sudah seharusnya memanfaatkan sumber-sumber hayati perairan yang ada dan dimanfaatkan semaksimal mungkin karena akan dapat menunjang perluasan kesempatan kerja, meningkatkan pendapatan nelayan dan perbaiakan gizi masayarakat. Keadaan ini sejalan dengan pertambahan penduduk serta kondisi geografis Indonesia yang mutlak memerlukan pelaksanaan peningkatan dalam bidang perikanan. Usaha perikanan yang ada di Indonesia merupakan perpaduan antara usaha perikanan darat dan perikanan laut. Ikan merupakan sumber protein yang paling murah dibanding dengan sumber protein yang lainnya seperti telur, susu dan daging (Dinas Perikanan Kabupaten Bengkalis, 1996/1997). Propinsi Riau merupakan salah satu propinsi yang memiliki wilayah daratan 94.561 km2 dan 3.241 pulau-pulau yang memiliki empat satuan wilayah sungai yaitu sungai Rokan, siak, Kampar dan sungai Indragiri yang merupakan perairan yang potensial untuk pembangunan usaha perikanan (Yuniarti, 2000). Untuk propinsi Riau produksi perikanan umum adalah sebesar 12.706,6 ton atau 7% dari seluruh produksi prikanan Riau, dimana produksi perikanan tersebut berasal dari kabupaten indragiri hulu, Kampar, Bengkalis dan Indragiri hilir (Evy, Mujianti Dan Sujono, 2001). Indonesia merupakan salah satu negara yang memiliki lautan yang sangat luas sehingga memiliki kekayaan alam yang cukup banyak. Salah satu kekayaan yang ada di perairan indonesia itu adakah kerang darah. Hal ini disebabkan karena kondisi perairan indonesia banyak mempunyai dasar lumpur (Moeljanto dan heruwati, 1995). Beberapa jenis karang- kerangan yang mempunyai nilai ekonomis tinggi dan bayak digemari masyarakat diantaranya adalah kerang darah, kerang buluh dan kerang kelagik. Pada tahun 1989 produksi kerang darah di Riau baru mencapai 5.871,7 ton, sedangkan pada tahun 1993 sudah mencapai 10.544,1 ton. Ini berarti terjadi peningkatan produksi kerang darah pertahun sebesar 16,6 % (D.P.P.R. 1994) Menurut Moeljanto (1979) limbah perikanan adalah ikan yang terbuang tercecer dan sisa olahan yang pada suatu saat tertentu belum dapat dimanfaatkan secara ekonomis. Limbah perikanan selalu terjadi dalam proses penangkapan, penanganan, pengangkutan, pengolahan dan distribusi serta pemasaran ikan. Limbah perikanan dikelompokkan berdasarkan jenisnya ada 4 yaityu : hasil sampingan berupa ikan mentah utuh yang merupakan hasil dari usaha penangkapan, limbah pengolahan yang terdiri atas kepala, isi perut, kulit, tulang, sirip dan lain-lain, limbah surplus berupa ikan utuh, limbah industri berupa ikan utuh potongan atau hancuran sisa pengolahan dan pemasaran (Winarno,1997). Dalam Industri pengolahan perikanan limbah yang paling utama antara lain kepala, bagian isi perut, ekor, sirip, tulang, dan lain-lain yang biasa di buang pada

pembuatan illet ikan. Banyak metoda telah dilakukan manusia untuk mengolah berbagai bahan hasil perikanan menjadi produk yang berasal dari limbah perikanan. Berdasarkandari statistik jumlah ikan yang tidak dapat dikonsumsi lagi oleh manusia dapat mencapai lebih dari 500 ton/tahun (Afrianto dan Liviawati, 1984). 1.2. Tujuan dan manfaat 1.2.1.Pasta kerang Tujuan untuk mengetahui pembuatan pasta kerang dengan memanfaatkan limbah cangkang kerang dara sebagai upaya diversifikasi hasil samping pengolahan perikanan menjadi bahan tambahan dalam produk pembuatan odol (pasta gigi). Manfaatnya adalah mengetahui pemanfaatan limbah pasta kerang untuk bahan baku odol dan dapat membuatnya sendiri.

1.2.2. Gelatin Tujuan untuk mengetahui pembuatan Gelatin dengan memanfaatkan limbah tulang ikan patin sebagai upaya diversifikasi hasil samping pengolahan perikanan menjadi bahan tambahan dalam produk pangan maupunm non pangan. Manfaatnya adalah mengetahui cara pembuatan gelatin dengan memanfaatkan limbah tulang ikan. 1.2.3. Fish Protein Concentrate(FPC) Tujuan untuk mengetahui pembuatan FPC dengan memanfaatkan daging ikan patin sebagai upaya diversifikasi hasil samping pengolahan perikanan menjadi bahan tambahan dalam produk pangan maupunm non pangan. Manfaatnya adalah mengetahui cara pembuatan FPC dengan memanfaatkan daging ikan. 1.2.4. Kitosan Tujuan untuk mengetahui pembuatan Kitosan dengan memanfaatkan kulit udang sebagai upaya diversifikasi hasil samping pengolahan perikanan menjadi bahan tambahan dalam produk pangan maupunm non pangan. Manfaatnya adalah mengetahui bahwa kulit udang dapat dibuat jadi kitosan yang dapat dimanfaatkan dalam berbagai industri seperti industri kertas dan textile, sebagai koagulan, pensuspensi dan sebagai perekat serta protein sel tunggal.

II. TINJAUAN PUSTAKA 2.1. Pasta kerang Kerang dara (Anadara granosa) termasukhewan lunak yang hidup pada perairan yang berlumpur. Menurut Boom (1985) klasifikasi kerang darah adalah sebgai berikut : Phylum : Moluska Kelas : Bivalva Ordo : Arcoida Famili : Arcidae Subfamili : Anadarinae Genus : Anadara Spesies : Anadara granosa Menurut Moeljanto dan Heruwati (1975), kerang dara merupakan salah satu jenis kerang yang mempunyai nilai ekonomis penting dan disukai masyarakat. Selanjutnya Ismail (1971) mengatakan kerang darah mempunyain rasa yang guring karena mengandung lemaj dan kadar protein yang tinggi. Komposisi kimia kerang dara (Anadara granosa) adalah air 83%, lemak 0.91%, protein 10.33% dan kadar abu 1.84% (Moeljanto dan Heruwati ,1975). Kerang darah yang telah dewasa yang berukuran diameter 4 cm dapat memberikan sumbangan energi sebesar 59 kalori serat mengandung 8 gram protein, 1,1 gram lemak, 3,6 gram karbohidrat, 133mg kalsium, 170 mg phosfor, 300 SI vitamin A dan 0,01 mg vitamin B1 (Karnadi,1991). Kerang merupakan mahkluk ―filter feeder‖ yang mengakumulasi bahan-bahan yang tersaring di dalam insangnya. Dalam prosesnya bakteri dan mikroorganisme lain yang ada di sekelilingnya dapat terakumulasi dan mencapai jumlah yang membahayakan untuk dikonsumsi (Leslie dan lee,1984). Budiman (1975) menyatakan bahwa tercatat 20 jenis kerang dari famili Acidae, sedangkan yang dimanfaatkan untuk di ambil dagingnya masih terbatas pada kerang dara (Anadara granosa), kerang bulu (Anadora inflata) dan kerang gelatik (Anadora antiquata). Pemanfaatan kerang saat ini masih terbatas pada konsumsi, dalam hewan segar atau diawetkan dengan penggaraman dan penyaringan. Pengawetan tersebut bertujuan untuk menghambat dan mencegah terjadinya kerusakan/mempertahankan muru, menghindari terjadinya keracunan dan mempermudah penanganan serta penyimpanan(Winaryo dan laksmi,1974). 2.2. Gelatin Nama gelatin berasal dari bahasa latin ―gelare‖ berarti membuat beku dan merupakan senyawa yang tidak pernah terjadi secara alami. Gelatin adalah hidrokoloid yang berasal dari hewan yang berfungsi untuk menigkatkan kekentalan dan membentuk gel dalam berbagai produk pangan(Bennion dalam Hadi,2006). Gelatin merupakan senyawa turunan yang dihasilkan dari serabut kolagen jaringan penghubung yang dihidrolisis dengan asam basa(Charley dalam Wiratmaja,2006). Gelatin sangat kaya dengan asam amino glisin (gly) (hamper sepertiga dari total asam amino), prolin (pro) dan 4-hidroksiprolin (4Hyd). Struktur gelatin yang umumadalah : Ala-Gly-Pro-Arg-

gly-Glu-4hyp-Gly-Pro. Satu hal yang perlu dicatat adalah kandungan 4Hyd juga berpengaruh pada kekuatan gelatin. Makin tinggi asam amino ini, kekuatan gel juga lebih baik. Meskipun mayoritas diturunkan dari hewan, gelatin sebenarnya tergolong memiliki nilai biologis yang rendah dan sering juga dianggap protein tidak lengkap. Pasalnya, gelatin kekurangan kandungan triptophan (Trp) yang merupakan salah satu asam amino esensial, serta rendah dalam sistein (Cys) dan tirosan (Tyr) (www.Artikel Iptek:Berit@iptek.com). Gelatin mempunyai titik leleh 350C, dibawah suhu tubuh manusia. Titik leleh inilah yang membuat gelatin mempunyai karateristik yang unik bila dibandingkan dengan bahan pembentuk gel lainnya seperti pati, alginat, pectin, agar-agar, karaginan tang merupakan senyawa karbohidrat (Gomez dan Montero, 2001). Secara fisik dan kimia, gelatin berwarna kuning cerah atau trnsparan, berbentuk serpihan atau tepung, berbau dan berasa, larut dalam air panas, gliserol, dan asam asetat serta pelarut organik lainnya. Gelatin dapat mengembang dan meyerap air 5-10 kali bobot asalnya(Raharja,2004). Menurut deMan (1997), gelatin adalah protein larut yang diperoleh dari kolagen tak larut. Gelatin juga didefinisikan sebagai produk yang diperoleh dari jaringan kolagen hewan yang dapat didispersi dalam air dan menunjukkan perubahan sel-gel yang reversible seiring perubahan suhu. Proses perubahan kolagen menjadi gelatin melibatkan tiga perubahan yaitu : 1). Pemutusan sejumlah ikatan peptida untuk memperpendek rantai, 2). Pemutusan/pengacauan sejumlah ikatan samping antar rantai, ). Perubahan konfigurasi rantai merupakan satu-satunya perubahan penting untuk mengubah kolagen menjadi gelatin. Kondisi yang dipergunakan selama proses produksi gelatin menentukan sifat-sifatnya. 2.3. Fish Protein Concentrate (FPC). Fish Protein Concentrate (FPC) mengandung protein sebesar 60-80% dengan persentase atau jumlah yang dapat dicerna oleh ikan 80-95%, serta memiliki kandungan lisin dan methiosin ( asam amino yang jumlah sedikit pada bahan pakan yang berasal dari tumbuhan) yang cukup tinggi (Lovell, 1989). Tepung ikan mengandung asam amino esensial yang tinggi dengan kandungan lemak berkisar antara 4-20% dan abu berkisar antara 10-23% bergantung dari bahan baku pembuat ikan tersebut ( Halver, 1989). Protein tepung ikan mengandung 10 macam asam amino esensial yang dibutuhkan olahan dimana umumnya mengandung lysine yang relatif tinggi. Tepung ikan merupakan sumber asam amino lysine dan methionin yang dapat melengkapi kekurangan asam aminotersebut yang sedikit terdapat pada tambahan pakan sumber protein nabati. Adapun kualitas protein tepung ikan terutama ditentukan oleh jumlah dan kualitas asam amino sedangkan komposisi asam amino tepung ikan ditentukan oleh inangnya (lovell, 1989).

2.4. Khitosan Kitosan adalah suatu selulosa alam yang tersusun dari gugus-gugus glukosa beramin, yang

bermuatan berlawanandengan selulosa alam lainnya (yaitu bermuatan positif), dalam bentuk kristal khitosan mempunyai struktur seperti mamtrik berpori yang kompak, sehingga khitosan dapat atau baik digunakan sebagai absorben dan sebagai matriks amobil (Subtijah,2005). Sumber khitosan adalah kitin, yang merupakan biopolymer yang terdapat dalam eksoskeleton invertebrate dan polisakarida terbesar kedua setelah selulosa. Khitosan merupakan seyawa golongan karbohidrat yang dihasilkan dari limbah hasil laut khususnya golongan udang, kepiting, ketam, dan kerang(Angka dan Suhartono,2000). Khitosan merupakan produk deasetilasi khitin adalah polimer glukosamin yang larut dalam asam tetapi tidak larut asam sulfat pada suhu kamar, juga tidak larut dalam pelarut organik, tetapi larut baik dalam poliol dengan suasana asam. Pelarut khitosan yang baik adalah asam format dengan konsentrasi 0,2 sampai 100%, namun demikian khitosan sering dipakai dengan dilarutkan terlebih dahulu pada asam asetat(Filter dan Wiring, 1997). Khitosan mempunyai sifat mudah mengalami degradasi secara biologis, tidak beracun, mempunyai berat molekul yang tinggi, tidak larit pada pH 6,5(Potan Laboratories, 1997). Berat molekul rata-rata 120.000 (Mujarelli).

III. BAHAN DAN METODE

3.1. Waktu dan Tempat 3.1.1. Pasta Kerang Praktikum Bahan Baku Hasil Perikanan tentang Pasta Kerang dilaksanakan pada hari Senin tanggal ..November 2008 dari pukul 13.00-15.00 WIB. Praktikum ini dilaksanakan di Laboratorium Teknologi Hasil Perikanan (THP) Fakultas Perikanan dan Ilmu Kelautan, Universitas Riau. 3.1.2. Gelatin Praktikum Bahan Baku Hasil Perikanan tentang Gelatin dilaksanakan pada hari Senin tanggal ..November 2008 dari pukul 13.00-15.00 WIB. Praktikum ini dilaksanakan di Laboratorium Teknologi Hasil Perikanan (THP) Fakultas Perikanan dan Ilmu Kelautan, Universitas Riau. 3.1.3. Fish Protein Concentrate (FPC) Praktikum Bahan Baku Hasil Perikanan tentang Fish Protein Concentrate (FPC) dilaksanakan pada hari Senin tanggal ..Desember 2008 dari pukul 13.00-15.00 WIB. Praktikum ini dilaksanakan di Laboratorium Teknologi Hasil Perikanan (THP) Fakultas Perikanan dan Ilmu Kelautan, Universitas Riau. 3.1.4. Khitosan

Praktikum Bahan Baku Hasil Perikanan tentang Kitosan dilaksanakan pada hari Senin tanggal ..Desember 2008 dari pukul 13.00-15.00 WIB. Praktikum ini dilaksanakan di Laboratorium Teknologi Hasil Perikanan (THP) Fakultas Perikanan dan Ilmu Kelautan, Universitas Riau. 3.2. Bahan dan Alat 3.2.1. Pasta Kerang Bahan yang digunakan selama praktikum mengenai Pasta Kerang adalah Cangkang Kerang Dara dan Tempurung. Alat-alat yang dipergunakan selama praktikum berlangsung adalah gilingan, saringan, serbet, timbangan, dan sikat pembersih. 3.2.2. Gelatin Bahan yang digunakan selama praktikum mengenai Gelatin terdiri dari bahan baku yaitu limbah tulang ikan patin dan bahan kimia yaitu asam klorida (HCL) pekat dan Aquades . Alat-alat yang dipergunakan selama praktikum berlangsung adalah Kompor, pisau, panci, pan aluminium, blender, toples kaca ukuran besar, pengaduk dan sikat pembersih. 3.2.3. Fish Protein Concentrate (FPC) Bahan yang digunakan selama praktikum mengenai Fish Protein Concentrate (FPC) adalah daging ikan patin . Alat-alat yang dipergunakan selama praktikum berlangsung adalah pisau,oven, blender, kain saring. 3.2.4. Khitosan Bahan yang digunakan selama praktikum mengenai Kitosan adalah kulit Udang.. Alat-alat yang dipergunakan selama praktikum berlangsung adalah blencer, saringan, Asam Klorida (HCL) 1 N 1:7, Natrium Hidroksida (NaOH) 3,5 % 1:20 dan Natrium Hidroksida (NaOH) 50% 1:20. 3.3. Metode Praktikum Metode Praktikum yang di gunakan adalah metode pengamatan langsung, di mana bahan baku yang sudah tersedia langsung di lakukan pengolahan demi mendapatkan hasil yang di inginkan di bantu dengan asisten. 3.4. Prosedur praktikum 3.4.1. Pasta Kerang Prosedur yang harus dilakukan oleh praktikum adalah sebagai berikut : - Praktikum mempersiapkan sejumlah cangkang kerang dara - Cangkang kerang dara kemudian dicuci dan dikeringkan - Dibakar dengan menggunakan bara dari tempurung. - Setelah itu digiling hingga halus, kemudian disaring dan jadi pasta kerang 3.4.2. Gelatin. Prosedur yang harus dilakukan oleh praktikum adalah sebagai berikut : - Ambil Tulang ikan Patin dengan cara membersihkan semua kulitnya - Tulang tersebut dicuci dan dibersihkan - Direbus pada suhu 800C - Dibersihkan dengan menggunakan sikat gigi - Dipotong-potong ukuran 1-3cm - Direndan dengan HCL

- Setelah menjadi Ussein selanjutnya di ektraksi dan digiling halus atau di blender hingga halus dan akhirnya menjadi Gelatin. 3.4.3. Fish Protein Concentrate (FPC) Prosedur yang harus dilakukan oleh praktikum adalah sebagai berikut : - Sediakan daging ikan patin dan dicuci - Kemudian digiling dan di pres dengan menggunakan saring/serbet - Di oven selama 24 jam - Setelah itu di blender dan akhirnya menjadi FPC 3.4.4. Khitosan Prosedur yang harus dilakukan oleh praktikum adalah sebagai berikut : - Sediakan kulit udang - Dicuci dan dikeringkan - Penghancuran dengan blencer - Demineralisasi dengan HCL 1 N 1: 7 pada suhu 900C selam 1 jam - Penyaringan dan pencucian - Deproteinasi dengan NaOH 3,5% 1:20 pada suhu 900C selama 1 jam - Penyaringan dan pencucian - Deasetilasi dengan NaOH 50% 1:20 pada suhu 1400C selama 3 jam - Pencucian - Kemudian dikeringkan dan akhirnya menjadi Khitosan

IV. HASIL DAN PEMBAHASAN 4.1. Hasil 4.1.1. Pasta Kerang

Gambar 1.1. Pasta kerang Setelah diolah cangkang kerang dara tadi menjadi Pasta kerang dengan warna putih keabuabuan. Pasta kerang ini dapat dimanfaatkan sebagai bahan tambahan dalam pembuatan obat gigi (odol) karena adanya kandungan kalsium dalam cangkang yang dapat memperkuat gigi. 4.1.2. Gelatin

Gambar 1.2. Gelatin Tulang ikan patin mengandung kolagen, dan setelah di oven atau di didihkan di dalam air yang dikombinasikan dengan perlakuan asam akan mengalami transformasi menjadi ghelatin. 4.1.3. Fish Frotein Concentrate

Gambar 1.3. Fish Pretein Concentrate

FPC yang dihasilkan dari daging ikan ini mempunyai warna kuning kecoklatan. 4.1.4. Khitosan

4.2. Pembahasan 4.2.1. Pasta kerang Anadara granosa adalah spesies dari tiram perahu yang dikenal dengan kerang darah. Kerang ini pertama kali ditemukan disepanjang daerah Indo-Pasifik, Afrika timur, Australia, Austria dan Jepang. Kerang ini tinggal di daerah yang sebagian besar intertidal (sekitas dua meter kedalaman air), biasnya menengelamkan dirinya di pasir atau lumpur. Ukuran dewasa kira-kira 5-6 cm dan lebar 4 5 cm. Kerang darah ini mempunya nilai ekonomis yang tinggi sebagai makanan, dan selama ini terus dibudidayakan. Kerang ini paling baik jika dihidangkan dalam keadaan direbus atau dipanggang. Kerang ini bercangkang ganda banyak ditemukan di wilayah dasar perairan. Pigmen merah di Anadara adalah berasal dari hemoglobin, biasanya dihubungkan dengan penyakit hepatitis, kolera, dan dysenteri. Dimana kerang-kerangan meracuni setelah dikonsumsi, karena sifatnya yang filder, sehingga mampu menyerap segala kotoran dan zat-zat berbaya yang tertinggal di dasar perairan.. kerang darah selain memakan hewan-hewan kecil juga sering ditemukan daging kepiting-kepiting kecil didalam cangkangnya (Pathansali 1966). 4.2.2. Gelatin Gelatin merupakan suatu jenis protein yang di ektraksi dari serabut kolagen yang terdapat pada kulit, tulang hewan (jaringan pengikat). Menurut Hinterwaldner (1997), terdapat tiga tahap proses pembuatan gelatin. Tahap pertama, tahap persiapan bahan baku antara lain penghilangan kompenen non kolagen dari bahan. Tahap kedua, tahap konversi kolagen menjadi gelatin. Tahap ketiga, tahap pemurnian gelatin dengan penyaringan dan pengeringan. Persiapan dilakukan dengan pencucian pada tulang ikan. Tulang dibersihkan dari sisa-sisa daging dan kotoran lain yang mengandung deposit-dposit lemak yang tinggi. Untuk memudahkan pembersihan maka sebelumnya dilakukan pemanasan dengan air panas selama 25 menit. Proses penghilanga lemak ini disebut degreasing dengan tujuan untuk menghilangkan lemak-lemak yang masih terdapat

dalam tulang. Pada prinsipnya proses pembuata gelatin dapat dibagi menjadi dua yaitu proses asam dan basa. Perbedaan kedua ini terletak pada perendamannya. Berdasarkan kekuatan ikatan kovalen silang protein dan jenis bahan yang diekstrak, maka penerapan jenis asam maupun basa organik dan metode ekstraksi lain nya seperti lama hidrolisis, pH dan suhu akan berbeda-beda. Gelatin dapat dimanfaatkan dalam industri pangan seperti pembentuk busa, pengikat, penstabil, pembentuk gel, perekat dan pengental sedangkan dalam bidang farmasi dimanfaatkan untuk bahan pembuat kapsul, pengikat tablet, dalam industri kertas gelatin dapat dimanfaatkan sebagai sizing paper. Penggunan gelatin dalam pengolahan pangan lebih disukai disebabkan oleh sifat fisik dan kimia gelatin yang khas daripada gizinya sebagai protein. Asam amino yang ditemukan pada gelatin tidak lengkap, yaitu tidak terdapat asam-asam amino triptopan (http://www.gelatin.co.za/gltn.html,2008). 4.2.3. Fish Protein Concentrate Fish Protein Concentrate (FPC) adalah bentuk produk yang dibuat dengan cara memisahkan lemak dan air dari tubuh ikan. FPC merupakan Stable Protein dari ikan yang dimakan untuk konsumsi manusia, dimana kandungan proteinnya lebih dipekatkan dari pada aslinya. Fish Protein Concentrate (FPC) mengandung asam amino esensial yang tinggi dengan kandungan lemak berkisar antara 4-20% dan abu berkisar antara 10-23% bergantung dari bahan baku pembuat ikan tersebut ( Halver, 1989).

4.2.4. Khitosan Kitin adalah polimer organik yang terbanyak terdapat didalam selulosa. Kitin banyak ditemukan pada binatang tingkat rendah, terutama pada invertebrata kitin membentuk kerangka luar yang berfungsi sebagai penunjang struktur tubuh dan pelindung dari serangan mangsanya. Khitosan dapat dihasilkan dari kitin dengan melakukan proses ‖deastilasi‖ (penghilangan gugus asetil). Penghilangan gugus asetil dari kitin dapat dilakukan dengan menambahkan natrium hidroksida dengan konsentrasi 40-50 persen pada kitin. Khitosan dapat diproduksi dengan menambahkan kalium hidroksida pada kitin, kemudian dilakukan pencucian dan penirisan serta penggilingan hingga diperoleh khitosan. Khitosan sedikit lebih stabil terhadap asam.( Halver,.1989).

V. KESIMPULAN DAN SARAN 5.1. Kesimpulan Bahan baku hasil perikanan adalah bahan atau hasil-hasil perikanan yang dapat dijadikan sumber bahan baku yang dapat dimanfaatkan sebagai bahan industri hasil perikanan. Jadi limbah canakang kerang dara, tulang ikan patin, rucah ikan dan kulit udang selama ini hanya dibuang oleh masyarakat yang mengkonsumsinya dapat diolah menjadi Pasta kerang, Gelatin, Fish Protein Concentrate dan Khitosan yang mempunyai nilai ekonomis tinggi yang digunakan dalam berbagai bidang seperti bidang industri pangan, pabrik kertas, farmasi dan produk lainnya. 5.2. Saran Perlu dilakukan penyuluhan kepada masyarakat akan pentingnya limbah perikanan yang mempunyai nilai ekonomis tinggi jika diolah agar pemanfaatan olahan perikanan dapat ditingkatkan dan kalau bisa peralatan laboratorium THP lebih ditingkatkan demi kemajuan praktikum berikutnya. Diposkan oleh iptek di 08:34 0 komentar Label: THP

MIKRODAS GENETIKA
I. PENDAHULUAN 1.1. Latar belakang Genetika ialah telaah mengenai pewarisan dan keragaman ciri ciri suatu organisme, baik organisms itu uniselular maupun multi¬selular. Penelitian dalam bidang genetika pada taraf molekular telah mengenali asam deoksiribonukleat (DNA), yaitu substansi kimiawi yang

membangun kromosom, sebagai substansi yang tu¬run-temurun. Banyak yang telah ditemukan mengenai struktur molekul DNA dan juga replikasinya. Sandi genetis yang terkan¬dung di dalamnya telah pula diungkapkan artinya. Kini kita me¬miliki pengetahuan mengenai bagaimana informasi genetis diterus¬kan untuk mengendalikan pertumbuhan dan aktivitas selular. Pengetahuan ini juga telah menuntun kepada pemahaman bahwa cacat molekular pada informasi yang disandikan di dalam DNA merupakan penyebab banyak penyakit genetis. Penyakit¬penyakit ini meliputi albinisme (tidakadanya pigmen ketika lahir), anemia sel sabit (anemia hemolitik), xeroderma pigmentosum (penyakit kulit akibat terkenai cahaya matahari), dan alkoptonuria dan fenilketonuria (penyakit metabolik). Seperti halnya prinsip-prinsip biokimiawi, prinsip-prinsip genetika itu universal. Telaah mengenaigenetika itsikrobe telahme- Banyak sumbangannya terhadap apa yang kita ketahui mengenai genetika semua organisme. Sel-sel prokariotik, terutama bakteri, telah terkenal sekali kegunaannya di dalatn hal ini; karena prokariota adalah organisme berkromosom tunggal, perubahan¬perubahan dalarrl bahan genetisnya mengakibatkan perubahan ciri yang diekspresikan dengan segera dan mudah diamati. Tidak ter¬dapat efek menutupi terhadap perubahan yang dialami kromosom yang disebabkan adanya anggota pasangan kromosom yang tidak mengalami perubahan, yaitu suatu keadaan yang dapat terjadi pada organisme yang kromosomnya berpasangan. Keuntungan nyata lainnya bila bekerja dengan mikrobe untuk menelaah gene¬tika meliputi mudahnya menyediakan kondisi terkendali yam konstan terhadap mikrobe, laju petumbuhan mikrobe yang cepat, dan besarnya populasi mikrobe yang berkembang dalam biakan. Plasmid, sepotong DNA bundar kadang-kadang dijumpai di surnping DNA kromosom pada bakteri. Struktur berlingkar ini adalah gelembl ng'ata mata replikasi pada DNA. Plasmid bakteri memainkan peranan penting di dalam bidang rekayasa genetika yang sedang berkembang sekarang ini. Pembesara x 2.1.000. (Atas kebaikan.JA. Hassel, McGill University). 1.2. Tujuan dan Manfaat Adapun tujuan dari makalah ini adalah untuk menyelesaikan tugas yang diberikan demi memperlancar proses pembelajaran dasar – dasar mikrobiologi, sedangkan manfaatnya adalah menambah pengetahuan di bidang mikrobiologi khususnya‖ Genetika Mikrobial ―. II. PEMBAHASAN 2.1. Sifat Bahan Genetis • Struktur Asam Deoksiribonukleat Asam deoksiribonukleat (deoxyribonucleic acid atau DNA) acla¬lah substansi kimiawi yang berperanan dalam penerusan infor¬masi yang turun-temurun. Tetapi bagaimanakah caranya? Kromo¬som sel dibentuk dari DNA. Di dalam struktur DNA terkodekan (tersandikan) informasi bagi sintesis semua protein sel. Segmen¬segmen yang diskrit (mempunyai ciri-ciri tersendiri) pada DNA atau kromosom, disebut gen, menyandikan masing-masing pro¬tein. Informasi ini diteruskan dari sel ke sel melalui proses repli¬kasi DNA. Asam nukleat tipe laih, yaitu asam ribonukleat (RNA), juga ada dalam setiap sel. RNA menyerupai DNA tetapi tidak sama dan kerjanya ialah mengolah informasi yang disandikan di dalam DNA bagi sintesis protein melalui transkripsi dan tranlasi.

DNA adalah sebuah molekul yang panjang menyerupai tali Gambar 1-1. Sel Escherichia coli yang dibuat pecah menunjukkan DNA menyerupai tali yang tercecer keluar. Perhatikanlah plasmid (tanda panah pada bagian tengah atas), yaitu potongan DNA bundar yang tidak merupakan bagian kromosom E. coil dan yang bereplikasi terpisah dari padanya (Dengan izin dari J.D. Griffith, The University of North Carolina).

Gambar 1-2. Diagram suatu segmen pendek DNA, memperlihat¬kan bagaimana kedua utasannya membelit sehingga membcntuk heliks ganda. Kedua pita seba¬gaimana yane terlihat menggambarkan tulang punggung gula (g) fosfat (f) dan garis-garis horison¬tal menggambagkan pasangan-pasangan basa (A, adenin; G, gua¬nin; C, sitosin; T, timin) yang dihubungkan oleh ikatan hidrogen. (Gambar 1-1), biasanya terdiri dari dua utas, saling membelit membentuk bentuk heliks Banda (Gambar 1-2). Setiap utas heliks DN terdiri dari nukleotide-nukleotide yang tergabung membentuk rantai polinukleotlde. Setiap nukleotide dibentuk tiga bagian : 1. Sebuah senyawa cincin yang mengandung nitrogen, disebut basa bernitrogen yang dapat berupa purin atau pirimidin, 2. Sebuah gugusan gula berkarbdn-lima (pentose), disebut biroksiribose. 3. Sebuah molekul fosfat. Bagian-bagian ini terhubungkan bersama-sama dalam urutan beri¬kut: basa bernitrogendeoksiribose-fosfat. Pada DNA dijumpai dua macam purin, yaitn adenin dan gua¬nin, dan dua macam pirimidin, yaitu sitosin dan timin. Struktur basa-basa ini dan juga struktur deoksiribose Serta fosfat, diperlihat¬kan pada Gambar 1-3. Karena ada empat jenis basa, maka pada DNA dijumpai empat jenis nukleotide:

Gambar 1-3. Bahan pembangun nukleotide pada DNA dan RNA. Perhatikan bahwa 2deoksiribose, gula yang dijumpai pada DNA, berbeda dengan ribose, gula yang dijumpai pada RNA disebabkan oleh tidak adanya gugusan –OH pada karbon 2. RNA menggunakan urasil sebagai bahan pembangun dan bukan timin sebagaimana yang dijumpai pada DNA. Deoksiadenosin-5'-monofosfat (adenin + deoksiribose + fosfat) Deoksiguanosin-5'-monofosfat (guanin + deoksiribose + fosfat), Deoksitidin-5'-monofosfat (sitosin + deoksiribose + fosfat) Timidin-5'-monofosfat (timin + deoksiribose + fosfat). Keempat jenis nukleotide ini dihubungkan bersama-sama menjadi utasan polinukleotide DNA oleh ikatan-ikatan fosfodiester; yaitu setiap gugusan fosfat menghubungkan atom karbon nomor3 pada deoksiribose sebuah nukleotide dengan atom karbon nomor-5 pada deoksiribose nukleotide berikutnya, dengan gugusan fosfat terletak di luar rantai (Gambar 1-4). Hasilnya ialah suatu rantai yang mengandung gugusan fosfat berselang-seling dengan gugusan _gula dengan basa-basanya yang mengandung nitrogen menonjol dari gugusan gula (lihat Gambar 164).

Ikatan-ikatan lemah, yang dikenal dengan ikatan hidrogen, menghubungkan basa dari satu rantai dengan basa dari rantai yang lain. Dua basa yang terhubung¬kan dengan cars demikian disebut pasangan basa komplementer. Karna sifat ikatan hidrogen basa-basa tersebut, pada DNA ber¬utasan-ganda hanya dijumpai dua macam pasangan basa komple¬menter, yaitu adenin (A) dan timin (T) atau guanin (G) dan sito¬sin (C, "cytosin"). Akibatnya perbandingan adenin terhadap timin atau guanin terhadap sitosin pada DNA berutasan-panda ialah selalu 1:1. Perbandingan-perbandingan lainnya, seperti adenin/sitosin, sitosin/timin, atau adenin + timin/guanin + sitosin tidak selalu 1: 1 ; melainkan nilai-nilainya bersifat khas bagi jenis organisme masing-masing. Nilai-nilai tersebut digunakan di dalam ' identifikasi atau pengelompokkan taksomik bakteri. Tidak dijumpainya perbandingan 1:1 antara adenin dan timin atau guanin dan sitosin pada virusvirus tertentu telah menuntun kepada penemuan DNA berutasan-tunggal pada organismeorganis¬me ini. Kasus semacam ini merupakan kekecualian yang jarang, yang umum dijumpai ialah DNA berutasan ganda. Pasangan-pasangan basa komplementer itulah yang menyatu¬kan kedua utasan heliks ganda melalui ikatan hidrogen. Antara se¬tiap pasangan A-T terbentuk dua ikatan hidrogen, sedangkan 'intara setiap pasangan G-C terbentuk tiga ikatan hidrogen. Kom¬plementaritas purin dan pirimidin berarti bahwa urutan basa pada satu utas mendikte urutan basa pada utasan lainnya. Hal ini amat penting dalam replikasi (sintesis) utasan-utasan baru DNA selama pembelahan sel. Akibat pembentukan pasangan-pasangan A-T dan G-C ialah bahwa kedua utasan heliks DNA dikatakan ber Gambar 1-4. Lokasi DNA di dalam sel, konfigurasi molekular, dan struktur kintiawi sebagaimana dilihat dengan makin terperinci. sifat anti paralel, yang berarti bahwa setiap utas menuju arah yang berlawanan sehingga yang satu diakhiri dengan gugusan hidroksil¬3' bebas dan lainnya dengan gugusan fosfat-5'. Dapat juga kita katakan bahwa satu utas menjurus dari ujung 3' ke ujung 5', dan utasan lainnya dari ujung 5' ke ujung 3'. Angka-angka tersebut menunjukkan atom-atom karbon pada gugusangugusan gula (lihat Gambar 1-4). Hubungan DNA terhadap komponen-komponennya yang mempunyai berat molekul rendah tampak pada Gambar 1-5. Dibuangnya gugusan fosfat dari nukleotide menghasilkan nukleo¬side yang terdiri dari sebuah gugusan gula pentose yang terhubung¬kan pada sebuah basa bernitrogen.

Gambar 1-5. Perombakan asam deoksiribonukleat menjadi komponen-komponen dengan berat molekul lebih rendah. DNA tersusun dari nukleotide-nukleotide rang bila gugusan fosfatnya dibuang, menjadi nukleoside. Nukleoside dapat diuraikan menjadi basa dan gula (2deoksiribose).

• Struktur asam ribonukleat Asam nukleat lainnya yang dijumpai secara alamiah ialah asam ribonukleat (RNA). Bedanya dari DNA ialah : 1. Biasanya berutasan-tunggal. 2. 2 Komponen gula pada nukleotide yang membentuk RNA adalah ribose, dan bukan deoksiribose. Ribose adalah lama de¬ngan deoksiribose kecuali adanya gugusan hidroksil pada atom 3. Basa bernitrogen pirimidin yang dijumpai pada nukleotide yang membentuk RNA ialah urasil dan bukan timin (lihat Gambar 16-3). • Biosintesis DNA Biosintesis nukleotida Sebelum rantai polinukleotide DNA dapat disintesis oleh bak¬teri (atau organisme lain), harus tersedia sekumpulan nukleotide selular. Pada bakteri-bakteri tertentu, nukleotide harus disuplai dalam medium dalam bentuk jadi. Tetapi bakteri-bakteri lain da¬pat mensintesis nukleotide dari nutrien yang sangat sederhana seperti glukose, amonium sulfat, dan mineral. Perubahan nutrien sederhana menjadi nukleotide bagi sintetis DNA menyangkut sederetan reaksi yang rumit, beberapa di antaranya memhutult¬kan energi dalam bentuk ATP. Salah satu dari reaksi-reaksi ini ialah pembentukan bentuk teraktivasi nukleotide sebagai prekur- sor langsung bagi'sintesis rantai polinukleotide DNA berutasan¬ganda : Nukleotide + ATP kinase nukleotide-fosfat + ADP (1) Nukleotide-fosfat + ATP kinase Nukleotide-difosfat + ADP (2) Energi dalam bentuk ATP disediakan. Pada setiap nukleoti¬de teraktivasi terikat dua gugusan fosfat yang berasal dari peru¬raian dua ATP. Replikasi DNA. Kromosom suatu bakteri yang khas ialah sebuah molekul DNA berutasan-ganda, yang mempunyai berat molekul kira-kira 2,5 x 109 dalton (satu dalton sama dengan massa satu atom hidrogen). J umlah pasangan basanya kurang lebih 4 x 106. Bila kromosom tersebut ditarik secara linear dalam bentuk heliks-ganda, ukuran¬nya akan mencapai-kira-kira 1250 ,um (1,25 mm), yaitu beberapa ratus kali lebih panjang daripada sel bakteri yang memilikinya. Replikasi dimulai pada suatu situs tertentu yang sudah pasti pada kromosom bakteri yang disebut titik pangkal (Gambar 1-¬6) Kedua utas DNA memisah pada situs ini membentuk struktur berbentuk Y, titik persimpangannya disebut titik tumbuh. Replikasi bergerak berurutan dari titik tumbuh, baik pada satu, arah (replikasi satu-arah) atau dua arah (replikasi dua-arah) (Gambar 16). Titik asal dan titik tumbuh terikat pada membran sel dan di situlah kedua utasan tersebut diduplikasi. Masing-masing utasan mempunyai urutan basa yang komplementer terhadap urutan basa pada utasan-utasan DNA yang mula-mula. Molekul kromosom sirkular (DNA berutasan-ganda) Gambar 1-6. Replikasi kromosom sirkular (DNA berutasan-Banda) dalam suatu bak¬teri. Sintesis DNA pada titik tumbuh diper¬lihatkan dengan lebih terperinci pada Gambar 1-7. Enzim DNA polimerase menambahkan nukleotide pada ujung hidroksil-3' utasan atau utasanutasan DNA yang sedang berepli¬kasi, jadi mensintesis utasan-utasan DNA dengan arah 5' ke 3'

(Gambar 1-7). Sejauh ini belum ditemukan polimerase yang me¬replikasi 'dengan arah 3' ke 5'. Karenanya, bagaimanakah Sintesis DNA dapat berlangsung berurutan dari satu titik pangkal di sepan¬jang kedua utasan DNA? Sintesis DNA bersifat tidak sinambung; artinya, utasanutasannya direplikasi dalam bentuk segmen-segmen kecil yang disebut fragmen Okazaki, dengan arah 5' ke 3'. Fragmen-fragmen ini kemudian digabungkan menjadi satu oleh enzim DNA ligase sebagaimana diperlihatkan pada Gambar 1-7. Selain mekanisme replikasi DNA yang baru saja diuraikan, inisiasi (pengawalan) replikasi DNA membutuhkan suatu pan¬cing atau pemula ("primer") yaitu sepotong pendek RNA yang disintesis oleh RNA polimerase dan komplementer terhadap DNA. Dengan adanya pemula ini, DNA polimerase dapat mu¬lai mensintesis deoksiribonukleotide. Sekali pancingan mengena, DNA polimerase lalu mencerna RNA tersebut dan menggantikan¬nya dengan DNA. Berpartisipasinya RNA sebagai pancing tampak¬nya ekstensif karena setiap fragmen Okazaki juga mengandung sebagian RNA sebagai pancing.

Gambar 1-7. Sintesis DNA secara tak sinambung. Segmcn-segmen pendek DNA, yaitu fragmenfragmen okazaki, disintesis dengan arah 5' ke 3' oleh DNA polimerase: Fragmen-fragmen ini digambarkan dengan garis terputus-putus berpanah. Kernudian fragmen-fragmen tersebut dihubung-hubungkan oleh ligase sehingga membentuk utasan, sementara titik tumbuh bergerak lebih lanjut di sepanjang DNA. Bila titik-titik tumbuh telah bergerak di seluruh panjang mole¬kul DNA, maka terbentuk dua molekul DNA yang lengkap (lihat Gambar 1-6). Setiap molekul berutasan-gan.da mengandung salah satu dari utasan asli dan satu utasan baru; Cara replikasi ini disebut semikonservatif. • Biosintesis protein Bahan pembangun protein Sama halnya seperti nukleotide merupakan bahan pembangun DNA, asam amino adalah bahan pembangun protein. Tetapi, DNA terdiri dari hanya empat jenis nukleotide, sedangkan protein terdiri dari lebih kurang 20 macam asam amino (Tabel 1-1). Mikoorganisme sangat berbeda dalam kemampuannya mensintesis asam amino. Misalnya, Escherichia coli dapat mensintesis semua asam amino yang dibutuhkannya untuk sintesis protein, tetapi bakteri asam laktat tidak dapat dan harus diberi asam-asam amino siap-pakai. Dalam suatu sel bakteri terdapat beribu-ribu protein yang berbeda-beda. Setiap tipe protein mempunyai urutan asam amino sendiri yang spesifik serta struktur tiga-dimensi. Asam-asam amino tersebut dihubungkan bersama-sama oleh ikatan-ikatan peptide membentuk rantai yang panjang.Ikatan peptide yang terbentuk adalah sebagai berikut : Bila sejumlah besar asam amino tergabungkan bersama-sama oleh ikatan peptide, maka tabentuk rantai asam amino yang disebut rantai polipeptide. Protein terdiri dari satu atau lebih rantai poli¬peptide. Transkripsi Sintesis protein terjadi pada ribosom, yaitu partikel-partikel RNA-protein berukuran besar di dalam sitoplasma sel bakteri. (Pada sel-sel eukariotik ribosom melekat pada retikulurn endo¬plasma). Sekitar 90 person dari jumlah RNA selular total ada¬lah RNA ribosomal (rRNA).

Sebelum sintesis protein dapat ber¬langsung, pertama-tama sandi-sandi pada DNA harus dipindahkan ke suatu substansi yang melalukan informasi dari DNA di daerah inti ke ribosom di dalam sitoplasma. Substansi ini dikenal dengan nama asam ribonukleat kurir (messenger ribonucleic acid atau m RNA). Proses atau langkah disintesisnya m RNA berutusan-tung¬gal dan komplementer terhadap salah satu utasan DNA disebut transkripsi, sintesis rantai polinukleotide m RNA dikatalisis oleh enzim RNA polimerase. Sarna halnya seperti pada sintesis DNA, enzim ini membutuhkan ribonukleotide teraktivasi sebagai sub¬stratnya. Transkripsi adalah langkah pertama dalam ekspresi genetis. Proses ini sebagaimana diperlihatkan pada Gambar 16-8, me- nyangkut pemisahan kedua utasan DNA, salah situ di antaranya berfungsi sebagai acuan bagi sintesis utasan m.KNA yang komple¬menter oleh RNA polimerase yang bergantung pada DNA. Utasan DNA yang dipilih untuk transkripsi ialah yang mengandung situs awal (inisiasi) yang spesifik dan disebut utasan yang "berarti". Penghentian sintesis mRNA adalah pada titik tertentu di sepanjang molekul DNA yang dikenali oleh RNA polimerase. Gambar 1-8. Transkripsi DNA dan RNA polimerase yang bergantung paa DNA Rantai mRNA sedang disintesis dari informasi pada DNA. Perhatikan bagaimana caranya komplementaritas dipertahankan. Misalnya, pada tempat-tempat dijumpai¬nya sebuah G pada DNA, disisipkan sebuah C pada mRNA dan bila ada A pada DNA, disisipkan U pada mRNA. mRNA akan berfungsi sebagai suatu pola untuk sintesis protein (lihat Gambar 16-9). Pertumbuhan rantai mRNA berlangsung dengan arah 5' → 3‘ dengan cara serupa dengan replikasi DNA. (A. adenin; T, timin; C, sitosin; G, guanin; U, urasil). Translasi Translasi (penerjemahan), yaitu langkah berikutnya di dalam ekspresi gen, adalah proses pengarahan sintesis protein oleh in¬formasi genetis yang sekarang ada pada molekul mRNA. Tabel 1-1 Sandi genetis bagi triplet-triplet basa mRNA dan asam-asam amino yang disandikannya* Basah peratma Basah kedua Basah ketiga UCAG U UUU Phenilalanin UCU Serin UAU Tirosin UGU Sistein U UUC UCC UAC UGC C UUA Leusin UCA UAA ―Oker‖ ―Amber‖ UGA ―Umber‖ A UUG UCG UAG UGG Triptofan G C CUU Leusin CCU Prolin CAU Histidin CGU Arginin U CUC CCC CAC CGC C CUA CCA CAA Glutamin CGA A CUG CCG CAG CGG G A AUU Isoleisin ACU Thereonin AAU Asparagin AGU Serin U AUC ACC AAC AGC C AUA ACA AAA Lisin AGA Arginin A AUG Metionin ACG AAG AGG G G GUU Valin GCU Alanin GAU Asam asparatat GGU Glisin U GUC GCC GAC GGC C GUA GAA GAA Asam glutamat GGA A

GUG GUG GAG GGG G *Kodon-kodon pada mRNA dibaca dengan arah 5‘ dan 3‘ (dari kiri ke kanan). Kodon-kodon UUA (oker), UAG (amber), da UGA (umber) menyebabkan terhentinya sintesis protein. AUG dan GGUG merupakan kodon yang mengawali rantai. Perhatikan bahwa asam amino yang sama dapat disandikan oleh lebih dari satu kodon (sandi semacam itu disebut turun derajat). Namun tidak ada kodon yang menyandikan lebih dari satu asam amino. Bila keempat basa yang berbeda-beda pada nukleotide-nukleo¬tide m RNA itu ditata dalam suatu deretan, maka setiap deret yang terdiri dari 3 basa (triplet)-disebut kodon, mampu menetapkan suatu asam amino tertentu. Karena ada empat macam basa yang berbeda-beda, jumlah deret berbasa tiga tersebut yang mungkin terbentuk adalah 43, atau 64 macam. Triplet-triplet basa ini, ma¬sing-masing menetapkan suatu asam amino tertentu, merupakan sandi genetis (Tabel 1-1). Sandi ini mungkin bersifat universal bagi semua spesies organisme hidup. Bagaimanakah sandi ini ditranslasikan? Dengan menggunakan Tabel 1-1, andaikanlah urutan basa mRNA ialah : CUUAGAAAAUUUAGUGGGACUUCU Maka penerjemahan sandi ini menjadi asam amino dalam rantai polipeptide pada ribosom'ialah Leu-Arg-Lis-Phe-Se r-Gli-Thr-Ser Lima dari keenampuluh empat macam triplet atau kodon tersebut tidak menunjuk pada asam amino apa pun. Kelima kodon tersebut ialah AUG dan GUG, yaitu kodon-kodon yang mengawali rantai polipeptide, serta UAA, UAG, dan UGA, yaitu kodon¬kodon yang mengakhiri rantai polipeptide. Ketiga kodon yang disebut terakhir ini disebut kodon nonsens atau kodon tak berarti. Sifat lainnya yang nyata mengenai sandi genetis ini ialah bah- wa asam amino yang sama dapat disandikan oleh lebih dari satu kodon, artinya, sandi tersebut turun derajat (degenerate). Tam¬bahan pula, tidak diperlukan adanya "tanda baca" atau sinyal untuk menunjukkan akhir suatu kodon dan permulaan kodon berikutnya. Karena itu kerangka pembacaan atau urutan diurai¬kannya sandi genetis harus diatur dengan tepat pada permulaan pembacaan suatu molekul mRNA. Pembacaan kemudian bergerak berurutan dari satu triplet ke triplet berikutnya tanpa istirahat. Bila kerangka pembacaan tidak diatur dengan baik dari permulaan, maka semua kodon akan salah langkah dan menuju pada pemben¬tukan protein salah-arti (missense protein) dengan urutan asam amino yang kacau (lihat Bab 17). Peristiwa-peristiwa yang terjadi dari DNA ke RNA ke protein diperlihatkan pada Gambar 1-9. Ini akan membawa kita pada suatu pembahasan yang lebih terperinci mengenai sintesis protein, yaitu suatu proses biosintetik yang sangat rumit. • Proses sintesis protein Langkah pertama dalam sintesis protein ialah aktivasi asam-asam amino. Proses ini dilakukan oleh enzim-enzim pengaktivasi asam amino yang disebut aminoasil-tRNA sintetase. Reaksi aktivasi ini membutuhkan energi dalam bentuk ATP : Asam amino + ATP + E Enzim peneaktivasi Asam amino asam amino — AMP — E + P — P Aminoasil-adenilat-E, Pirofosfat

Bagi setiap macam asam amino tertentu ada enzim pengaktiva¬si tertentu pula. Setelah aktivasi, asam-asam amino teraktivasi te¬tap terikat kuat pada enzim yang bersangkutan. Selanjutnya, asam amino teraktivasip terikat pada sebuairrno- lekul RNA yang disebut RNA transfer {transfer RNA atau tRNA) proses ini dikatalisis oleh enzim yang sama yang kini terikat pada asam amino : Asam amino-AMP-E + tRNA asam-amino-tRNA + AMP + E RNA transfer berfungsi dalam sintesis protein untuk membawa asam-asam amino ke, dan mengenali kodon-kodon pada, mRNA Gambar 1-9. Peristiwa-peristiwa dari DNA ke m RNA ke protein. RNA transfer adalah suatu rantai tunggal yang mengandung sekitar 80 nukleotide dan melipat diri sehingga membentuk susun¬an daun semanggi melalui ikatan hidrogen antara pasanganpasang- an basa komplementer. Struktur umum tRNA diperlihatkan pada Gambar 16-10. Tiga dari basa yang tidak mempunyai pasangan pada., tRNA membentuk suatu triplet antikodon yang secara khu¬sus megenali kodon yang komplementer terhadapnya pada mRNA untuk suatu asam amino tertentu. Urutan nukleotide yang terakhir ialah adenilat-sitidilat-sitidilat (ACC) dan dijumpai pada semua tRNA. Asam amino yang akan dibawanya akan terikat pada nukleotide terminal yang mengandung adenin. Seperti mRNA, tRNA ditranskripsikan dari suatu daerah ter¬tentu pada molekul DNA oleh RNA polimerase. Molekul-molekul tRNA berfungsi sebagai "penyesuai" (adapters), yang kepada nya dapat "ditancapkan" asam-asam amino tertentu sehingga da¬pat disesuaikan dengan bahasa triplet nukleotide sandi genetic yang ditranskripsikan pada mRNA. Sekarang tRNA membawa asam amino yang terikat padanya ke mRNA yang terikat pada permukaan ribosom. Di sini asam amino tersebut ditambahkan pada rantai polipeptide yang sedang tumbuh. Permukaan ribosom dapat dipandang sebagai titik penyu¬sun bagi sintesis protein. Gambar 1-10. Struktur daun-semanggi tRNA Penyusunan rantai protein pada ribosom. Sebagaimana telah disebutkan sebelumnya, ribosom adalah situs sintesis protein. rRNAnya ditranskripsikan Bari bagian-bagian tertentu DNA me lui proses yang sama yang membutuhkan energi yang digunakan. untuk sintesis m RNA dan t RNA. Ribosom dapat diibaratkan sett*, gai mesin yang memainkan pita rekaman, seperti halnya me tersebut akan mengalunkan macam suara atau bunyi-bunyian yang bergantung pada pita rekaman yang€limainkan, ribosom akan membuat protein yang macamnya bergantung, pada jenis mRNA yang disediakan Ribosom Esciaerichia coli telah dipelajari secara luas dan dike¬tahui terdiri dari dua subunit, masing-thasing dikenali melalui konstanta sedimentasinya (S) yang ditentukan melalui penelitian¬penelitian ultrasentrifugasi. Subunit yang lebih besar ialah parti¬kel 50-S. sedangkan subunit yar lebih kecil ialah partikel 30-S. Subunit-subunit ribosom tersebut dapat berasosiasi dan berdiso¬ siasi dengan sesamanya. Sebuah subunit 30-S dan sebuah subunit 50-S berasosiasi membentuk ribosom 70-S. (S- ialah unit Svedberg, suatu ukuran yang menyatakan berapa cepatnya suatu part, kel mengendap selama ultrasentrifugasi. Penggabungan subunit 30-S dan 50-S untuk membentuk ribosom 70-$ menunjukkan bahwa perilaku sedimentasi ribosom 70-S bukanlak semata-mata ¬penjumlahan sederhana unit-unit partikel yang lebih kecil. Sintesis rantai protein pada ribosom berlangsung stbagai beri- kut (Gambar 1-11): Langkah 1 : Ribosom terikat pada salah satu ujung molekul mRNA pada suatu situs tertentu

(spesifisitas di sini penting artinya karena inilah yang me¬mulai translasi mRNA menurut urutan pembacaan yang benar. Lihat Gambar (1-11). Langkah 2 : tRNA bermuatan yang membawa molekul asam amino yang pertama kemudian terikat pada kodon yang mengawali rantai (X) pada m RNA. Langkah 3 : tRNA lain yang membawa asam amino yang kedua kemudian terikat pada kodon berikut¬nya (Y). Langkah 4 : Gugusan amino dari asam amino pada tRNA yang kedua bereaksi dengan gugussan karbiksil terminal yang aktif pada asam amino dai tRNA yang pertama untuk membentuk dipeptide; tRNA yang pertama lalu dilepaskan. M RNA digerakkan di sepanjang ribosom untuk menempatkan kodon berikutnya (z) supaya siap menerima tRNA yang membawa asam amino ketiga Gambar. 1-11. Sintesis rantai protein pada ribosom Proses ini diteruskan sampai rantai peptide menjadi lengkap. Penghetian terjadi pada salah satu kodon nonsens yaitu UAA, UAG, atau UGA dan rantai pun berdisosiasi dari molekul t RNA yang terakhir. Satu molekul tunggal mRNA cukup panjang untuk dibaca oleh beberapa riboson pada waktu yang sama. Bila sejumlah ribosom 70-S secara aktif terlibat dalam sintesis protein pada seutas mRNA, maka disebut polisom (lihat gambar 1-12) Gambar 1-12. penyajian skematik sebuah polisom selama sintesis protein mRNA bergerak dari kanan ke kiri. Ribosom bergerak dari ujung 5‘ ke ujung 3‘ (kiri ke kanan) mRNA, semuanya membaca dengan serentak. Pada prokariota, masa hidup mRNA amat pendek, hanya sekitar 2 menit. 2.2. Pewarisan Ciri dan Keragaman • Rekayasa Genetika dengan Mikroorganisme Ringkasan dan prospek Genetika adalah suatu cabang ilmu yang dinamis dan berkem¬bang dengan cepat. Penelaahannya dilakukan oleh beribu-ribu ilmuwan di seluruh dunia. Rekayasa genetika ("genetic engineer¬ing"), suatu segi baru studi genetika, menjanjikan pada masyara¬kat baik perkembangan yang menguntungkan maupun kemung¬kinan timbulnya akibat-akibat yang mernbawa bencana. Renung¬kanlah, misalnya, harapan untuk menaklukkan semua penyakit menurun dan kemungkinan terubahnya suatu mikrobe yang umum dan tidak berbahaya menjadi bentuk yang amat patogenik. Hanya seratus tahun lebih sedikit yang lalu penelaahan menge¬nai genetika pertama kalinya dilakukan dengan sungguh-sungguh oleh seorang botaniwan berkebangsaan Austria, Gregor Mendel pada sebidang kecil tanaman kacang polongnya. Pada tahun 1860-an ia menyilangkan galur-galur kacang polong dan mempelajari akibat-akibatnya — perubahan-perubahan dalam hal warna, ben¬tuk, ukuran serta sifat-sifat lain kacang polong tersebut. Dari penelitiannya ini ia mengembangkan hukum-hukum dasar keba¬kaan. Pada kira-kira waktu yang sama seorang penyelidik alam ber¬kebangsaan Inggris bernama Charles Darwin memperkenalkan teorinya mengenai evolusi. Teori tersebut didasarkan pada prinsip¬prinsip seleksi alamiah dan kelangsungan hidup yang terkuat. Jelaslah bahwa di dalam lingkungan yang berubah-ubah, dengan berla¬lunya waktu hanya organisme-organisme yang

dapat beradaptasi secara genetis terhadap lingkungan yang selalu berubah itulah yang akan dapat sertahan hidup. Karena itu, kemampuan untuk mem¬peroleh ciri pembawaan genetis yang barn memberikan keuntung¬an pada organisme tersebut untuk mempertahankan kelangsungan hidupnya. Hukum kebakaan itu umum bagi semua bentuk kehidupan. Hukum tersebut berlaku bagi manusia dan bagi organisme perco¬baan yang dulu amat populer dalam penelitian genetika, yaitu lalat buah Drosophila. Serangga yang amat kecil ini amat mudah dipe¬lajari. Perubahanperubahan warna matanya banyak menghasilkan keterangan mengenai letak gen-gen di dalam kromosomnya. Namun, kira-kira tigapuluh tahun yang lalu, Drosophila diganti dengan bakteri Escherichia coli sebagai organisme riset genetis yang disukai karena lebih mudah lagi untuk mempelajarinya. Seka¬rang ini, di antara semua organisme yang ada, Escherichia coli ada¬lah yang paling dipahami pada taraf molekular dan merupakan organisme pilihan bagi banyak ahli genetika. Hal ini membantu berkembangnya bidang genetika mikrobe. Jasad-jasad renik yang diselidiki dalam bidang ini meliputi bakteri, khamir, kapang, dan juga virus. Bab ini hanya akan membahas genetika bakteri. • Pewarisan ciri dan keragaman Ciri khas semua bentuk kehidupan, dari segi pandangan gene¬tika; adalah kemantapan umum atau "kesamaan" ciri-ciri progeni dan tetuanya. Dengan mudah kita amati dalam spesies kita sendiri, milsalnya, bahwa beberapa keluarga secara teratur mempunyai rambut hitam, mata coklat, dan bentuk hidung serta dagu tertentu, sedangkan keluarga lain mempunyai rarnbut pirang mata biru, dan struktur muka yang berbeda. Dengan cars yang sama sekalipun ukurannya kecil, bakteri dan protista lain juga meneruskan ciri¬-cirinya kepada keturunannya. Kenyataan bahwa kita dapat meng¬identifikasi spesies dan. bahkan galur bakteri menunjukkan bahwa jasad renik tersebut mampu meneruskan informasi genetis dari ge¬nerasi ke generasi dengan amat tepat. Tetapi, di samping pewarisan ciri-ciri, yang menyebabkan ada¬nya sifat-sifat yang tetap sebagaimana diperlihatkan oleh spesies-¬spesies biologis, progeni mengekspresikan keragaman atau peru¬bahan. Perubahan-perubahan ini berkaitan dengan dua sifat asasi sel atau organisme, yaitu genotipe dan fenotipe. Genotipe menga¬cu pada komposisi genetis sel. Fenotipe ialah ekspresi genotipe dalam bentuk sifat-sifat yang dapat diamati yang khas bagi sel atau organisme yang bersangkutan. Genotipe suatu biakan sel relatif konstan selama pertumbuh¬an, tetapi dapat berubah melalui mutasi. Perubahan ini dapat mengakibatkan berubahnya sifat-sifat yang dapat diamati, atau fenotipe sel. Jadi genotipe merupakan ciri-ciri potensial total suatu sel yang bersifat temurun, sedangkan fenotipe adalah ciri¬ciri yang diekspresikan • Perubahan fenotipe, akibat perubahan lingkungan Bakteri, seperti halnya sel-sel organisme tingkat tinggi, mem¬bawa lebih banyak informasi genetis — genotipenya — daripada yang dipergunakannya atau diekspresikannya pada suatu waktu tertentu. Sampai sejauh mana informasi ini diekspresikan tergan¬tung kepada lingkungannya. Misalnya suatu bakteri anaerobik fakultatif akan menghasilkan produk-produk akhir metabolisms, tergantung pada ada tidaknya oksigen selama pertumbuhan. Ada tidaknya oksigen menentukan enzim-enzim mana yang berfungsi dan mana yang tidak. Sesungguhnya di suatu lingkungan tertentu pengetahuan mengenai faktor-faktor yang mengatur aktivitas gene¬tis merupakan aspek yang amat penting untuk memahami metabo¬lisme sel.

Segi yang menonjol pada tips perubahan fenotipe ini -ialah bahwa hal ini melibatkan sebagian besar sel di dalam biakan. Peru¬bahan fenotipik macam ini tidak diwarisi-, melainkan terjadi bila beberapa keadaan dalam lingkungan berubah. Kembalinya pada fenotipe astinya terjadi bila keadaan lingkungan yang semula pulih kembali. Gambar 1-13. memperlihatkan beberapa perubahan fenotipe yang disebabkan oleh perubahan kondisi lingkungan. • Perubahan genotipe Genotipe suatu sel ditentukan oleh informasi genetis yang di¬kandung dalam koromosomnya. Kromosom terdiri dari gen-gen. Gen ialah suatu satuan fungsional yang temurun, menentukan pembentukan suatu polipeptide tertentu dan juga berbagai tipe RNA. Setiap gen terdiri dari beratus-ratus pasangan nukleotide. Gambar 1-13. Perubahan morfologis pada suatu galur Bacillus subtilis. Perubahan feno¬tipe ini merupakan akibat digesernya suhu tumbuh dari 30 menjadi 450C.,(A) 0 menit pada 450C. (B) setelah 80 menit pada 450C. (C) setelah 265 menit pada 450C. (x 3.280). (Atas kebaikan H.J. Rogers. "The National Institute of Medical Research", Mill Hill, England). Misalnya, bila sebuah rantai polipeptide mengandung 300 asarn amino maka gen yang menyandikan polipeptide harus mengan¬dung 900 pasang bass (tiga basa untuk setiap asam amino). Ini adalah dasar bagi hubungan satu gen — satu polipeptide. Telah di¬perkirakan bahwa kromosom bakteri mempunyai kapasitas untuk menyandikan kira-kira 3.000 protein yang berbeda-beda. Tetapi, gen manapun dapat berubah atau bermutasi menjadi bentuk lain sehingga akan memerintahkan pembentukan suatu protein yang berubah atau baru yang pada gilirannya dapat meru¬sak kekhasan selnya (kadang-kadang menyebabkan kematian). Sebagai contoh, substitusi hanya satu asam amino sekalipun di antara beberapa ratus di dalam sebuah rantai polipeptide dapat menyebabkan protein tersebut tidak berfungsi. Mutasi ialah peru¬bahan di dalam rangkaian nukleotide suatu gen. Ini menimbulkan ciri genetis yang baru, atau genotipe yang berubah. Suatu sel atau organisms yang memperlihatkan efek suatu mutasi disebut mutan. Jadi kita sewaktu-waktu melihat perubahan mendadak pada tum¬buh-tumbuhan dan hewan-hwan yang kita kenal. Sekali-sekali seekor kucing albino muncul di antara saUdara-saudara seperin-. dukannya yang berwarna hitam, atau sebiji kacang polong ber¬warna kuning di antara kacangkacang polong berwarna hijau. Fenomena yang serupa terjadi di antara mikroorganisme. Mutasi adalah peristiwa yang jarang, terjadi secara acak dan timbul secara spontan tanpa memperhatikan persyaratan ling¬kungan. Mutasi bakteri secara spontan dapat terjadi pada laju 1 mutasi saja di dalam 1 juta sel bakteri sampai kepada laju 1 mutasi di dalam 10 milyar sel bakteri. Biasanya mutan-mutan di dalam suatu populasi sel tertutupi (tersembunyikan) oleh selsel yang tidak mengalami mutasi yang jumlahnya lebih besar. Mengisolasi sebuah sel mutan ialah seperti kata pepatah mencari jarum dalam setumpuk jerami. Namun, para mikrobiologiwan telah mengem¬bangkan teknik-teknik yang mempermudah isolasi mutan yang hanya sedikit saja jumlahnya itu dari suatu populasi besar sel-sel yang tidak bermutasi (tipe liar). Sebagai contoh, sejenis antibiotik dapat dicampurkan dalam medium pertumbuhan untuk mendapat mutan yang resisters terhadap antibiotik tersebut. Gambar 17-2 memperlihatkan suatu metode yang unik yaitu teknik pencawanan replika untuk mengisolasi mutan-mutan nutrisi.

Gambar 1-14. Pencawanan replika digunakan untuk mengisolasi mutan-mutan nutri¬si E. colt., (A) Suspensi bakteri ditaruh dalam sebuah cawan petri terbuka dan di¬kenai bahan mutagenik, seperti radiasi ultraviolet. (B) Sampel dari (A) dicawankan pada permukaan medium "lengkap" seperti agar nutrien. Cawan ini diinkubasi¬kan, setelah inkubasi, letak koloni-koloni yang pasti pada cawan itu dicatat. (C) Suatu unit pencawanan replika yang steril dengan hati-hati ditekankan pada per¬mukaan cawan (B), Wu diangkat (D), dan kemudian ditekankan pada permukaan suatu cawan medium agar "minimum" (E). Peletakan unit pencawanan replika pada agar minimal itu harus tepat, sehingga letak setiap koloni dapat dibandingkan pada masingmasing cawan tersebut. Cawan-cawan itu akan merupakan replika dari se samanya. Agar minimum di dalam cawan pada (E) terdiri dari garam-garam anor¬ganik dan glukose, yaitu nutrien yang biasanya menunjang pertumbuhan E. coli.- Setelah inkubasi (F), muncul kolonikoloni pada cawan yang barn itu pada keln¬nyakan, tetapi tidak semua posisi sesuai dengan letak koloni-koloni pada cawan asli¬nya. Dapatlah dianggap bahwa organisms yang tidak berhasil berkembang adalah mutan nutrisi, yaitu tidak mampu tumbuh pada medium garam-garam, anorga¬nik-glukose, suatu ciri yang semula mereka miliki. • Tips-tips mutasi Pada taraf molekular, perubahan-perubahan dalam rangkaian basa purin-pirimidindapat terjadi dengan beberapa cara sehingga meng¬akibatkan-,,mutasi. Dua tips yang umum ialah mutasi titik dan mutasi pergeseran kerangka. Mutasi titik. Mutasi Aitik terjadi sebagai akibat tersubstitusinya satu nukleotide oleh yang lain di dalam rangkaian nukleotide tertentu suatu gen. Substitusi satu purin oleh purin yang lain atau satu pirimidin oleh pirimidin yang lain disebut mutasi titik tipe transist Sedangkan penggantian suatu purin oleh pirimidin atau sebaliknya disebut transverse. Substitusi pasangan basa ini dapat mengakibatkan salah satu dari tiga macam mutasi yang mempe¬ngaruhi proses translasi : 1. Triplet gen yang berubah itu menghasilkan sebuah kodon pada mRNA yang menetapkan asam amino yang berbeda dari yang ada di dalam protein yang normal. Mutasi ini disebut mutasi salah arti (missense mutation). Protein semacam itu dapat menjadi tidak berfungsi atau kurang aktif ketimbang protein yang normal. Sebuah contoh yang baik mengenai mutasi salah arti pada manusia ialah penyakit anemia sel-sabit ("sikle-cell anemia"). Penggantian satu basa tunggal pada ko¬don bagi asam amino keenam dalam hemoglobin A mengubah asam amino keenam itu dari asam glutamat menjadi valin, sehingga membentuk ciri-ciri hemoglobin S pada anemia sel sabit. Yaitu, GAG, yang menyandikan asam glutamat, dapat berubah menjadi GUG yang menyandikan valin. Di bawah konsentrasi oksigen yang rendah, molekul-molekul hemoglo¬bin S yang berubah itu bertumpuk menjadi kristal, sehingga bentuk sel-sel darah merah menjadi seperti sabit. 2. Triplet gen yang berubah itu menghasilkan sebuah kodon pada mRNA yang mengakhiri rantai, mengakibatkan berakhirnya pembentukan protein sebelum waktunya selama translasi. Ini disebut mutasi nonsens. Hasilnya ialah suatu polipeptide tak lengkap yang tidak berfungsi. 3. Triplet gen yang berubah itu menghasilkan sebuah kodon mRNA yang menetapkan asam amino yang sama karena ko¬don yang dihasilkan dari mutasi merupakan sinonim dari ko¬don aslinya. Ini adalah mutasi netral. Mutasi pergeseran kerangka. Mutasi ini merupakan akibat pe¬nambahan atau kehilangan satu atau lebih nukleotide di dalam suatu gen. Hal ini mengakibatkan bergesernya kerangka pembaca¬an. Kita lihat pada Bab 16 bahwa selama berlangsungnya sintesis protein, pembacaan

Sandi genetic dimulai dari satu ujung acuan protein yaitu mRNA, dan dibaca sebagai satuan tiga basa secara berurutan. Karena itu mutasi pergeseran kerangka pada umumnya menyebabkan terbentuknya protein yang tidak berfungsi sebagai akibat disintesisnya rangkaian asarn arnino yang sama sekali barn dari pembacaan rangkaian nukleotide mRNA yang telah bergeser kerangkanya (yal.-Ig ditranskripsikan dari mutasi pada DNA sel) Tipe mu tali ini digambarkan pada Gam bar 1-15. Gambar 1-15. Mutasi pergeseran kerangka, sebagai akibat penyisipan satu nukleotide pada suatu gen. Penyisipan satu nukleotide pada suatu gen mengakibatkan trans¬kripsi satu nukleotide tambahan pada mRNA. Ini mengakibatkan pergeseran ke¬rangka ketika kodon-kodon dibaca selama berlangsungnya translasi sehingga semua kodon setelah penyisipan menjadi berubah dan semua asam amino yang disandikan menjadi berubah pula. Mutasi pergeseran kerangka sebagai akibat delesi (hilangnya) satu nukleotide pada pokoknya akan mempunyai efek yang sama. • Terjadinya mutasi Mutasi paling umum terjadi selama replikasi DNA. Beberapa mu¬tasi terjadi sebagai akibat kerusakan yang ditimbulkan oleh cahaya ultraviolet atau sinar X. Karena unsur-unsur ini merupakan bagian yang tak terhindarkan dari lingkungan (misalnya, cahaya UV adalah komponen cahaya matahari), maka mungkin inilah yang menyebabkan banyaknya mutasi spontan. Namun, laju mutasi dapat ditingkatkan secara nyata dengan cara menyinari biakan dengan sinar-sinar tersebut. Unsur mana saja yang dapat mem¬pertinggi laju mutasi disebut mutagen. Mutasi yang diperoleh dengan menggunakan mutagen dikatakan terinduksi, dan bukan spontan, sekalipun bedanya mungkin hanya pada frekuensinya, bukan pada macamnya. Sebagai contoh, cahaya UV menyebabkan mutasi pada kondisi-kondisi baik alamiah m;itil)im laboralo ris. Tetapi, jumlah mutan yang diperoleh dengan kondisi kondisi laboratoris lebih tinggi, karena tingginya dosis UV yang digunakan. Tidak satu pun mekanisme tertentu yang dapat ditisulkan untuk menerangkan pengaruh mutagenik sinar X. Karena sinar X dapat menyebabkan pecahnya banyak ikatan kimiawi yang her¬beda-beda macamnya, maka mungkin merusak DNA dengan ber¬bagai cara. Pengaruh utama cahaya UV ialah menyebabkan pem¬bentukan dieter dengan ikatan silang antara pirimidin-pirimidin yang bersebelahan, terutama timin. Dieter ini mengacaukan pro¬ses replikasi yang normal. Penemuan yang paling banyak membuka rahasia mutasi pada tahun-tahun belakangan ini datang dari penelitian mengenai pe¬ngaruh mutagenik berbagai bahan kimia. Ada dua tipe senyawa kimia yang mutagenik. Yang pertama terdiri dari senyawa-senya¬wa yang dapat bereaksi secara kimiawi dengan DNA. Karena ke¬khususan replikasi DNA bergantung pada ikatan purinpirimidin, yang diakibatkan oleh ikatan hidrogen antara gugusan-gugusan amino dan hidroksil pada purin dan pirimidin, maka modifikasi kimiawi gugusan-gugusan amino dan hidroksil ini dapat menye¬babkan mutasi. Asam nitrous, yang dapat membuang gugusan amino dari purin dan pirimidin, adalah mutagen semacam itu. Tipe zat kimia mutagenik yang kedua terdiri dari analog-analog basa. Ini adalah zat-zat kimia yang strukturnya cukup menyamai basa-basa pada DNA yang normal sehingga dapat menggantikan¬nya selama berlangsungnya replikasi DNA (Gambar 17-4). Meski¬pun strukturnya mirip, analog basa tidak mempunyai sifat ikatan hidrogen yang sama seperti basa yang normal. Karena itu dapat menyebabkan terjadinya kesalahan dalam replikasi yang mengaki¬batkan mutasi.

• Reparasi mutasi Telah disebutkan bahwa kerusakan DNA dapat disebabkan oleh radiasi UV, sinar X, dan zat-zat kimia tertentu. Untungnya, sel mengandung enzim-enzim khusus yang dapat mereparasi DNA yang rusak. Dengan cara ini, beberapa sel yang terpengaruh dapat melanjutkan fungsinya dengan normal. Gambar 1-16. Dua basa DNA yang normal dan dua mutagen analog basa. 2-Aminopurin adalah analog adenin dan dapat berpasangan dengan timin atau sit"n. 5-Bromou¬rasil adalah analog timin dan dapat berpasangan dengan adenin atau guanin. Yang dikurung dalam kotak dengan garis terputus-putus menyoroti bagian analog yang berbeda dari basa yang normal. Banyak macam sel bakteri dan khamir telah diperlihatkan memiliki mekanisme fotoreaktivasi yang efisien untuk merepara¬si kerusakan yang disebabkan oleh radiasi UV. Fotoreaktivasi ini terjadi ketika sel-sel yang terkenai dosis cahaya UV yang memati¬kan segera dikenai cahaya kasatmata. Suatu enzim khusus, yang di¬giatkan oleh cahaya kasatmata, memotong atau menguraikan ikat¬an antara dimer-dimer yang terbentuk akibat terkenai cahaya UV dan memulihkan aktivitas normal sel-sel yang rusak itu. Beberapa bakteri mempunyai enzim yang disebut endonu¬klease dan eksonuklease, yang memotong segmen DNA yang rusak. Kemudian enzim-enzim yang lain, polimerase dan ligase, memperbaiki bagian yang pecah itu dengan cara mengisi celah-¬celah itu dan menggabunggabungkan potongan-potongan tersebut - menjadi satu. Mekanisme ini digambarkan pada Gambar 17-5. Beberapa penyakit tipe reparasi terjadi pada manusia. Yang paling terkenai ialah xeroderma pigmentosum. Pada penyakit menurun ini, kulit sangat peka terhadap cahaya UV. Pada orangorang ini, cahaya matahari sedikit saja bila mengenai kulitnya akan menyebabkan luka-luka bakar yang gawat yang pada akhirnya dapat menyebabkan kanker. Cacat yang dideritanya ialah pada mekanisme reparasi pemotongan yaitu tidak mempunyai memotong dimer-dimer pirimidin yang terbentuk akibat terkenai cahaya UV. Gambar 1-17. Reparasi. eksisi pada DNA yang rusak karena cahaya UV yang mengan¬dung dimer timin-timin. Perlu diperhatikan bahwa bila DNA yang mengandung dim- dimer pirimidin bereplikasi pada bakteri dengan kemampuanrepa¬rasi eksisi yang cacat, maka sintesis utasan yang baru akan berhen¬ti pada posisi dimer tersebut tetapi berlanjut pada jarak tertentu setelah itu. Jadi terbentuk celah pada utasan DNA yang baru disin¬tesis itu. Celah tersebut dapat terisi dengan cara menukar dan menggabungkan fragmen-fragmen yang mengandung utasan-utasan DNA yang menumpuk yang celah-celahnya tidak berimpit. Selan¬jutnya, karena replikasi terinterupsi dan dengan demikian terha¬langi pada celah ini, maka utasan-utasan dengan celah yang jumlahnya lebih sedikit bereplikasi dengan lebih cepat dan pada akhirnya dapat mempersedikit jumlah DNA yang rusak. Laju mutasi Laju mutasi ialah peluang bagi suatu sel untuk bermutasi ketika terjadi pembelahan sel. Jadi laju mutasi pada umumnya didefinisikan sebagai jumlah rata-rata mutasi per sel per pembelahan, dan dinyatakan sebagai pangkat negatif per pembelahan sel. Sebagai contoh, bila ada satu peluang dalam sejuta bahwa suatu gen akan bermutasi ketika selnya membelah, maka laju mutasi bagi

satu gen tunggal mana pun sama dengan 10-6 per pembelahan sel. Pada umumnya, laju mutasi bagi satu gen tunggal berkisar antara 10-3 dan 10-9 per pembelahan sel. Laju mutasi mempunyai implikasi praktis. Karena gen bermu¬tasi secara acak dan tidak bergantung satu dengan lainnya, maka peluang terjadinya dua mutasi di dalam sel yang sama merupakan produk dari masing-masing laju mutasi tunggalnya. Jadi, misalnya, bila laju mutasi untuk resistensi terhadap penisilin ialah 10-8 per pembelahan sel dan untuk resistensi terhadap streptomisin ialah 10-6 per pembelahan sel, "maka peluang terjadinya kedua mutasi tersebut di dalam sel yang sama ialah 10-6 X 10-8 , atau 10-14 Laju mutasi ini amat rendah. Karena alasan inilah maka umum se¬kali dilakukan pemberian dua antibiotik sekaligus dalam peng¬obatan beberapa penyakit.,Sebagai contoh, kombinasi penisilin G dan streptomisin telah terbukti ampuh untuk mengobati infeksi oleh streptokokus. Sel yang telah menjadi resisten terhadap satu antibiotik rnasih bisa dihambat atau dibunuh oleh antibiotik yang lain. Tipe-tipe mutan bakteri Karena semua sifat sel-sel hidup pada akhirnya dikendalikan oleh gen, maka ciri sel yang mana pun dapat berubah karena mutasi. Berbagai ragam mutan bakteri telah diisolasi dan dipelajari secara intensif. Beberapa dari tipe-tip,- utama mutan adalah sebagai berikut : 1. Mutan yang memperlihatkan toleransi yang meningkat terha¬dap unsur-unsur pengliambat, terutama antibiotik (mutan yang resisten terhadap antibiotik atau obat•-obatan). 2. Mutan yang menunjukkan kemampuan fernrientasi yang beru¬bah, atau menin-katnya atau berkurangnya kapasitas untuk beberapa produk akhir. 3. Mutan yang mempunyai defisiensi akan nutrisi, yaitu membutuhkan medium yang lebih konipleks untuk tubuhnya ketimbang biakan aslinya 4. Mutan yang memperlihatkan perubahan dalam bentuk koloni atau kemampuan untuk menghasilkan pigmen 5. Mutan yang menunjukkan perubahan pada struktur permukaan dan komposisi selnya (mutan antigenik). 6. Mutan yang resisten terhadap aksi bakteriofage. 7. Mutan yang memperlihatkan beberapa perubahan pada cir-ciri morfologis, misalnya hilangnya kemampuan untuk menghasilkan spora, kapsul, atau flagela (Gambar 1-18).

Gambar 1-18. Beberapa mutan memperlihatkan perubahan morfologis. Mutan-mutan Bacillus subtills yang Pyata sekah kekurangan enzirn-enzim yang diperlukan untuk mernisahkan sel-sel anak setelah pembelahan, tumbuh pada laju yang normal seba¬gai rantai amat paniang yang terdiri dari sel-sel yang tidak memisah. Pada kondisi pertumbuhan tertentu mutan-mutan ini jugs membentuk struktur helikal. (A) Tipe liar, sketsa fotomikrograf kontras-fase; (B) mutan, sketsa fotomikrograf kontxas¬fase; (C) mutan, sketsa mikrograf elektron payar. Perhatikan struktur helikal ada 13 Dan C.'(Atas kebaikan Jared E Fein, McGill Urziversity). Dari-daftar ini jelaslah bahwa semua ciri khas bakteri dapat berubah melalui proses mutasi. Juga jelas bahwa beberapa dari perubahan-perubahan khusus yang, disebabkan oleh mutasi ternyata serupa atau sama dengan yang diakibatkan oleh perubahan kondisi lingkungan. Maka dari itu perlu dipastikan secara eksperimental bahwa suatu perubahan itu benar-benar disebabkan oleh mutasi dan bukanlah merupakan tanggapan terhadap lingkungan. Ada banyak implikasi praktis yang berkaitan dengan terjadinya mutan. mikrobe. Hal ini digambarkan oleh contoh – contoh berikut :

1. Diketahui ada beberapa mikroorganisme yang menggambarkan resistensi terhadap antibiotikantibiotik tertentu akibat mu¬tasi. Kenyataan ini sangat penting dalam pengobatan penyakit, karena antibiotik yang pada mulanya efektif untuk mengenda¬likan suatu infeksi bakterial menjadi kurang atau tidak lagi efektif ketika muncul mutan-mutan yang resisten terhadap an¬tibiotik yang bersangkutan. 2. Dapat diisolasi mutan biokimiawi.yaiig mamput menghasilkan suatu produk akhir dalam jumlah besar. Hal ini penting dalam industri. Sebagai contoh, jumlah penisilin yang dihasilkan da¬lam produksi komersial meningkat. secara dramatis cricialui seleksi galur-galur mutan Penicillium. 3.Pemeliharaan biakan murni spesies-spesies jasad renik yang tipikal mensyaratkan tercegahnya mutasi, kalau tidak, maka biakan tersebut tidak akan tipikal lagi. 4.Mutan mikrobe telah digunakan secara meluas di dalampenye¬lidikan berbagai proses biokimiawi, terutama reeksi-roaksi bio¬sintetik. Sebagai contoh, mutan-mutan yang terhalang atau rusak pada langkah-langkah enzimatik yang berbeda-beda telah digunakan untuk menyingkapkan seluk-beluk rangkaian meta¬bolik. Banyak mutan, mungkin sebagian besar, dapat balik ke kondisi liar melalui mutasi batik, yaitu kembalinya sel-sel mutan, ke feno¬•pe asainy'a. Akan tetapi, hat ini tidak, mesti disebabkan .oleh pem¬balikan mutasi aslinya secara tepat. Kadang-kadang, pengaruh mu¬tasi asli dapat ditekan sebagian atau seluruhnya oleh mutasi.kedua pada situs yang berbeda pada kromosom. • Rekombinasi bakteri Rekombinasi genetis ialah pembentukan suatu genotipe bare melalui pemilihan kembali gen-gen setelah terjadinya pertukaran bahan genetis antara due kromosom yang berbeda yang mempu¬nyai gen-gen serupa pada situs-situs yang bersangkutan. Kromosom semacam ini disebut kromosom homologus. Progeni. yang, dihasil¬kan dari rekombinasi mempunyai kornbinasi gen-gen yang berbeda dari yang ada pada tetuanya. Pada bakteri, rekombinasi genetis dihasilkan dari tiga tipe pemindahan gen: 1. Konjugasi. Pemindahan gen antara sel-sel yang kontak satu de¬ngan yang lain secara fisik. 2. Transduksi. Pemindahan gen dari satu sel ke sel yang lain oleh bakteriofage. 3. Transformasi. Pemindahan DNA bebas-sel atau "bugil" dari satu sel ke sel yang lain. Ketiga tipe pemindahan gen ini diperlihatkan pada Gambar 17-8. Pada rekombinasi bakteri, sel tidak melebur dan biasanya hanya sebagian saja dari kromosom sel donor Oantan) dipindahkan ke sel resipien (betina). Maka sel resipien ini menjadi merozigot. suatu zigot yang diploid sebagian. Begitu terjadi pembentukan me¬rozigot, maka rekombinasi dapat berlangsung. Mekanisme umum bagi rekombinasi bakteri diduga terjadi sebagai berikut. Di dalam sel resipien fragmen DNA donor diletak¬kan di sepanjang DNA resipien sedemikian rupa sehingga gen-gen yang homologus terletak bersebelahan. Enzim-enzim bekerja pada DNA resipien, menyebabkan terguntingnya dan tereksisinya suatu fragmen. Kemudian DNA donor dipadukan ke dalam kromosom resipien di tempat DNA yang tereksisi. Sel resipien lalu menjadi sel rekombinasi karena kromosomnya mengandung DNA dari kedua sel, baik donor maupun resipien. (Potonganpotongan DNA yang tereksisi dari kromosom resipien mungkin dirombak atau diurai¬ka oleh enzim-enzim khusus). Mekanisme rekombinasi yang umum ini dapat dilihat pada Gambar 17-9. Konjugasi Konjugasi, salah satu dari tiga mekanisme untuk pemindahan bahan genetis dari satu bakteri ke

yang lain, bergantung kepada kontak sel dengan sel. Sementara pada transduksi dan transformasi hanya fragmen-fragmen amat kecil kromosom bakteri yang dipin¬dahkan (akan dibahas kemudian), pada konjugasi mungkin dipin¬dahkan fragmen, besar, dan pada kasus-kasus khusus bahkan selu¬ruh kromosom. Konjugasi bakteri pertama kali dipertunjukkan oleh Leder- berg dan Tatum pada tahun 1946. Mereka menggabungkan dua galur mutan Escherichia coli yang berbeda yang tidak mampu mensintesis satu atau lebih faktor tumbuh esensiil dan memberinya kesempatan untuk kawin. Kemudian mereka mencawankan biakan campuran tersebut pada medium minimal yang hanya me¬nunjang pertumbuhan galur-galur tipe liar. Ketika mereka mene¬mukan koloni-koloni tipe liar, mereka tahu bahwa mestinya koloni-koloni tersebut merupakan hasil rekombinasi genetik mela¬lui konjugasi antara galur-galur mutan. Gambar 17-10 memper¬lihatkan prinsip percobaan mereka dalam bentuk yang disederha¬nakan. • Faktor seks. Konjugasi pada bakteri dipahami dengan lebih je¬las ketika ditemukan bahwa ada diferensiasi seksual pada E. coli, dengan perkataan lain, ada tipe-tipe perkawinan yang berbeda¬-beda pada bakteri tersebut. Sel jantan mengandung sepotong DNA yang kecil dan bundar (sirkular), di dalam sitoplasma dan tidak merupakan bagian dari kromosom, disebut faktor seks, atau faktor F (faktor kesuburan atau fertility factor). Sel ini disebut sebagai F+ dan merupakan donor dalam perkawinan. Sel betina disebut F— dan tidak memiliki faktor ini, mereka adalah sel resi¬pien. Persilangan antara dua galur F— tidak menghasilkan rekombi¬nan. Pada persilangan F+ x F—, yang jantan mereplikasikan faktor seksnya, dan satu kopi dari padanya hampir selalu dipindahkan ke resipien betina. Sel F- diubah menjadi sel F+ dan mampu berfung¬si sebagai donor (lihat 17-11). Karena itu, selama sel-sel itu tumbuh, proses konjugasi dapat berlanjut melalui penularan dengan pemindahan faktor seks secara berulang-ulang. Pemindahan faktor F di dalam suatu persilangan F+ x F- terjadi dengan frekuensi yang mendekati 100 persen. Tetapi pembentukan rekombinasi di dalam persilangan F+ x F- terjadi pada frekuensi yang rendah¬sekitar satu rekombinan per 104 sampai 105 sel. Jadi jelaslah bah¬wa pemindahan faktor F tidak tergantung kepada pemindahan gen-gen kromosomal. Karena pemindahan faktor F itu mandiri, maka DNA faktor F itu melangsungkan replikasi tanpa bergantung kepada kromosom normal sel donor. DNA faktor F hanya cukup untuk menspesi¬fikasikan kira-kira 40 gen yang mengendalikan replikasi faktor seks dan sintesis pili seks. Setiap sel F+ menghasilkan satu atau lebih pili seks (Gambar 17-12). Peranan pili seks tampaknya ialah mengikatkan sel F- ke sel F+ dan kemudian menarik diri ke dalam sel F+, membuat sel F tertarik sampai kontak secara dekat sekali . Jugs ada beberapa bukti bahwa pili seks adalah tubul-tubul yang dilalui DNA dari sel F+ ke sel F- selama konjugasi. Gambar 1-19. Pilus seks menghubungkan pasangan perkawinan E. coll. Sel yang jan¬tan (sebelah kanan) juga mempunyai pili tipe lain di camping pilus seks. Bakterio¬fage RNA kecil yang menempel pada pilus seks dapat dilihat sebagai titik-titik (x 25.000).(Atas kebaikan C. Brinton Jr., University of Pittsburg). Galur-galur rekombinasi berfrekuensi tinggi. Penelitian menge¬nai konjugasi pada bakteri menjadi dipermudah ketika galur-galur baru terisolasi dari biakan-biakan F+ yang mengalami rekombinasi seksual dengan sel-sel F- pada laju 103 kali lebih besar dari sel-sel F+ x F-. Maka galur-galur donor yang baru ini disebut galur rekombinasi berfrekuensi tinggi (high frequency recombination atau Hfr). Sel-sel Hfr muncul dari sel-sel F+ yang di dalamnya faktor F menjadi

terpadu ke dalam kromosom bakteri. Bedanya dengan sel-sel F+ ialah bahwa faktor F. dari Hfr jarang sekali ter¬pindahkan selama rekombinasi. Jadi di dalam suatu persilangan Hfr x F-, frekuensi kombinasinya tinggi dan pemindahan faktor F-nya rendah (Gambar 17-13); pada persilangan F+ x F-, fre¬kuensi rekombinasinya rendah dan pemindahan faktor F nya tinggi. Urutan dipindahkannya bahan kromosom dari satu donor Hfr ke suatu resipien F- ditentukan oleh percobaan perkawinan yang diganggu ciptaan Elie Wollman dan Francois Jacob. Suatu galur Hfr dicampur dengan suatu galur F-, dan konjugasi tersebut di¬ganggu pada berbagai waktu dengan cara memisah-misahkan sel-col itu di dalam blender berkecepatan tinggi. Sel-sel tersebut kemu¬dian dicawankan pada bermacam-macam tipe media-agar yang se¬lektif untuk memperoleh sel-sel rekombinan yang telah menerima gen donor sebelum perkawinannya diganggu. Percobaan perkawinan yang diganggu itu menyingkapkan urut¬an gen-gen kromosom menurut saat masuknya Serta frekuensi re¬kombinasi setiap penanda (marker), yang merupakan mutasi Yang dapat dikenali yang berfungsi untuk mengidentifikasi gen pada lokus atau situs tempat terjadinya. Setiap gen memasuki sel F pada waktu yang khan, dan dengan menggunakan waktu masuk sebagai ukuran maka pets pertautan (linkage map) kromosom Hfr dapat dibangun. Ini adalah metode utama untuk mengetahui letak gen pada kromosom bakteri. Hal ini di¬mungkinkan karena kromosom Hfr dipindahkan ke sel F secara linear meskipun kromosom itu bundar. Selama pemindahan, kromosom Hfr mulai bereplikasi pada titik disisip¬kannya faktor F. Karena faktor F dapat terpadu pada posisi seks dipindahkan dengan sangat efisien bersama-sama dengan gen¬gen bakteri yang terbawa tadi. Set resipien itu kemudian menjadi set P sekunder; merupakan diploid sebagian bagi gen-gen yang di¬terimanya dari set F' primer. Proses dipindahkannya gen-gen bak¬teri dari donor ke resipien sebagai bagian dari faktor seks diistilah¬kan sebagai seksduksi oleh Jacob dan Wollman. • Unsur genetis ekstrakromosomal Selain kromosom DNA yang normal, pada bakteri seringkali di¬jumpai unsur genetis ekstrakromosomal (ekstrakromosomal = di luar kromosom). Unsur ini disebut plasmid dan dapat melang¬sungkan replikasi secara swatantra di dalam sitoplasma set bakteri. (Gambar 16-1 dan 17-17). Plasmid adalah potongan bundar DNA yang merupakan gen tambahan. Bila unsur ekstrakromo¬somal dapat bereplikasi secara swantantra dan terpadu ke dalam kromosom DNA bakteri, maka disebut episom. Perilaku ini mem¬bedakan episom dari plasmid, karena yang terakhir ini tidak ter¬padu ke dalam kromosom. Jadi faktor F E. coli adalah suatu epi¬som karena dapat secara bergantian ada dalam status F+ atau Hfr. Beberapa bakteri mempunyai plasmid yang merupakan faktor bakteriosinogenik. Faktor ini menentukan pembentukan bakterio¬sin, yaitu protein yang membunuh spesies bakteri yang sama atau yang berkerabat dekat. Bakteriosin E. coli disebut kolisin; yang dihasilkan oleh Pseudomonas spp. disebut piosin, dan seterusnya. Gambar 1-20. Plasmid bakteri diperlihatkan sebagai sebuah molekul DNA melingkar ("looped DNA"). Plasmid tahan obat-obatan yang diperlihatkan disebut R28K, membawa sifat resisters terhadap ampisilin, dan paniangnya 21,um. (Alas kebaikan Michiko Egel–Mitanij. Bakteriosin telah terbukti bermanfaat untuk membedakan galur-galur tertentu dari spesies bakteri yang mana dalam diagnosis bakteriologis medis. Bakteri mempunyai jenis-jenis plasmid lain yang disebut faktor pemindah resistensi atau faktor R yang mem¬berikan resistensi terhadap

sejumlah antibiotik. Beberapa dari faktor R tersebut dapat dipindahkan pada sel-sel yang lain melalui konjugasi, karena itulah maka diistilahkan sebagai resistensi yang menular. • Transduksi Transduksi ialah proses pemindahan gen dari satu bakteri ke bak¬teri lain oleh bakteriofage. Beberapa bakteriofage tenang (tempe¬rate) (lihat Bab 11), yang biasanya tidak melisis sel inang, mem¬bawa DNA yang dapat berperilaku sebagai episoin di dalam bak¬teri. Bila DNA virus ini terpadu di dalam kromosom bakteri, maka disebut. profage. Bila bakteri lisogenik memasuki siklus litik, entah secara spontan ataupun karena induksi oleh cahaya UV, maka sekali-sekali sebagian dari kromosom bakteri secara tidak sengaja dapat terkait ke dalam kepala fage. Bila kemudian virus tersebut menginfeksi bakteri lain, maka fragmen kromo¬som bakteri tadi dari sel yang pertama jugs diinjeksikan sebagai bagian dari DNA virus. Fragmen kromosom ini menjalani perpa¬sangan basa dengan kromosom inang, akan terpadu dan menjadi bagian yang tetap dari kromosom bakteri yang terinfeksi itu. Transduksi umum. Transduksi tipe ini terjadi bila suatu fage "tenang" memindahkan gen yang mana pun dari koromosom bakteri atau plasmid. (Gambar 17-20). Proses ini berbeda dari transduksi khusus, yaitu galur-galur fage tenang tertentu dapat memindahkan hanya beberapa gen terbatas dari kromosom bak¬teri. Dalam transduksi umum, pada saat fage memulai siklus litik, enzim-enzim virus menghidrolisis kromosom bakteri menjadi ba¬nyak potongan kecil DNA. Bagian mana pun dari kromosom bakteri itu dapat digabungkan ke dalam kepala fage selama per¬akitan fage. Sebagai contoh, fagekoli P1 dapat mentransduksi berbagai gen di dalam kromosom bakteri. Setelah infeksi, sejum¬lah kecil dari fage-fage itu membawa hanya DNA bakteri (lihat Gambar 17-20). Karena DNA ini cocok dengan DNA bakteri baru yang diinfeksi itu, bakteri yang kedua ini tidak akan menjadi lisogenik bagifage P1. Melainkan, DNA yang diinfeksikan itu akan terpadukan ke dalam kromosom sel resipien. Gambar 1-21. Transduksi. Kromosom fage PI, setelah injeksi ke dalam sel inang, me¬nyebabkan perombakan kromosom inang menjadi fragmen-fragmen kecil. Selama pematangan partikel virus, beberapa kepala fage dapat membungkus fragmen-frag¬men DNA bakteri dan bukannya DNA fage. KeSka DNA bakteri ini memasuki sel inang yang baru, dapat menjadi terpadu ke dalam kromosom bakteri, dengan demi¬kian memindahkan beberapa gen dari satu inang ke yang lain. Transduksi telah dipertunjukkan pada beberapa spesics bak¬teri. Proses ini menyajikan suatu alai yang ampult untuk mengem¬bangkan galur-galur bakteri baru, memetakan kromosom bakteri, dan untuk banyak percobaan genetis lain. • Rekayasa genetika dengan mikroorganisme Rekayasa genetika, atau manipulasi gen secara biokimiawi, men¬jadi kenyataan dalam tahun 1973 ketika dikembangkan teknik untuk mengisolasi dan menggabungkan potongan-potongan DNA yang tak sama sehingga dapat dihasilkan molekul DNA rekombinan yang aktif. Molekul ini, sekali dihasilkan, dapat di¬masukkan ke dalam sel bakteri, seperti E. soli, dan mereka dapat bereplikasi di dalamnya. Bagaimanakah terjadinya hal ini?. Enzim endonuklease dapat digunakan untuk memotong bagian-bagian DNA khusus yang pen¬dek, biasanya mengandung beberapa gen, dari kromosom sel tipe apa pun — tumbuhan, hewan, atau bakteri — ataupun virus. Po¬tongan-potongan ini

mempunyai ujung yang "lengket" atau kohe¬sif yang akan dengan mudah digabungkan dengan cara perpasang¬an basa pada daerah-daerah berutasan tunggal dengan utasan-utas¬an DNA lain. Dengan cara ini, fragmen-fragmen yang diperoleh dari kromosom sel apa pun atau virion dapat disambungkan ke plasmid bakteri atau genom fage dengan bantuan enzim lain, se¬perti polinukleotide ligase. Plasmid atau fage tersebut kemudian dapat bereplikasi di dalam bakteri inangnya. Kadang-kadang bahan genetis baru di dalam plasmid atau DNA fage juga dapat terpadu¬kan ke dalam kromosom sel inang dan bertindak sebagai kompo¬nen normal dari padanya. Pada pokoknya sel-sel bakteri semacam itu telah menerima gen acing dan merupakan organisme baru; sifat serta kemampuannya bisa amat berbeda dari baik inang maupun donornya. Mereka juga memperbanyak diri dan dapat membuat kopi-kopi bahurangkap diri mereka sendiri dalam waktu yang amat pendek. Ciri-ciri utama manipulasi gen secara bioki¬miawi itu diperlihatkan pada Gambar 1-21. Pentingnya teknologi baru ini ialah bergeraknya gen melintasi garis species, seperti dari hewan dan lalat-lalat buali ke bakteri. Ini mengakibatkan terciptanya organisme baru yang telah direka kem¬bali. Ada kekhawatiran bahwa produksi molekul-molekul DNA rekonibitian yang fungsional in vivo dapat terbukti berbahaya se¬cara biologic—Bila mereka dibawa di dalatn mikrobe seperti E. coli, yang mempakan bakteri kornensal di dalam usus manusia dan dapat mempertukarkan informasi genetic dengan tipe-tipe bakteri lain, mereka mungkin bisa menjadi tersebar Was di antara populasi manusia, bakteri, tumbuhan, atau hewan, dengan akibat yang tidak dapat diduga. Gambar 1-22. "Rekayasa genetika" ("genetic engineering") dengan plasmid bakteri Pembungkus sel bakteri mula-mula dilarutkan di dalam larutan seperti deterjen dan DNA-nya keluar. Plasmid bakteri lalu diisolasi dari DNA kromosom dengan sentri¬fugasi. Plasmid ini dipotong dengan enzim-enzim restriksi dan plasmid yang terbuka ini kemudian dicampurkan di dalam suatu larutan dengan gen-gen (jugs dipisahkan dengan menggunakan enzim-enzim restriksi) dari DNA tumbuhan, hewan, virus, atau bakteri yang juga telah diekstraksi dan dibuka. Di dalam larutan, DNA ligase melekatkan gen-gen acing itu pada tempatnya pada bagian plasmid yang terbuka sehingga terbentuk plasmid bakteri rekombinan (sosok atau "loop"). Plasmid bak¬teri rekombinan yang telah dirakit ini lalu ditaruh di dalam larutan kalsium kloride dingin yang mengandung sel-sel bakteri. Bila larutan itu tiba-tiba dipanaskan, pem¬bungkus sel bakteri itu menjadi permeabel sehingga memungkinkan plasmid bak¬teri rekombinan untuk masuk. Sekali berada di dalam sel bakteri, mereka dapat te¬tap ada sebagai plasmid atau dapat terpadu dengan kromosom sel inang. (Diambil dari Bio Science 24 (12): 692, 1974). Kekhawatiran yang khusus ialah terbentuknya plasmid-plasmid bakteri barn yang dapat bereplikasi secara swantantra yang bila tidak diawasi dengan ketat, dapat memasukkan determinan genetic untuk resistensi antibiotik atau pernbentukan toksin bakteri ke dalam galurgalur bakteri yang pada waktu ini tidak membawa determinan semacam itu. Percobaan untuk menghubungkan semua segmen DNA virus onkogenik ataupun virus hewani yang lain menjadi unsur-unsur DNA yang melangsungkan replikasi se¬cara swatantra, seperti plasmid bakteri atau. DNA viral lainnya, juga merupakan ancaman. Penyebaran molekul DNA rekombinan semacam itu mungkin dapat meningkatkan terjadinya kanker atau penyakit-penyakit lain. Namun teknik-teknik rekombinasi yang baru itu, bila dilaku¬kan dengan aman, dapat juga memecahkan masalah-masalah biolo¬gic teoretis maupun praktis. Sebagai contoh, metode DNA rekom¬binan dapat digunakan untuk mengembangkan bakteri yang dapat mensintesis bermacam-macam substansi biologic dan kimiawi yang sekarang ini belum tersedia pada Skala

industri. Bakteri yang mampu menghasilkan kromosom insulin telah dilaporkan. Bakteri lain, suatu species Pseudomonas, telah dikembangkan dan dipaten¬kan karena bisa amat berguna untuk membersihkan tumpahan minyak. (Tetapi bagaimana bila bakteri itu tersasar ke dalam su¬mur minyak?). Pengaruhnya pada pertanian juga dapat dipikirkan. Kita mengetahui pentingnya penambatan nitrogen oleh prokariota dalam peningkatan kesuburan tanah. Gen untuk fiksasi nitrogen (nif) membentuk tandan pada kromosom Klebsiella pneumoniae dan dapat dipindahkan. Gen-gen tersebut dapat terpadu ke dalam atau bersegregasi dari DNA kromosom maupun plasmid, dan plas¬mid yang mengandung nif dapat memperoleh sifat-sifat baru mela¬lui rekombinasi. Karena itu kini terbuka kemungkinan-kemung¬kinan yang amat menarik untuk mempersiapkan bakteri penambat nitrogen yang baru, dengan menggunakan gen nif yang didasarkan pada plasmid yang dikaitkan dengan aktivitas faktor seks. Selan¬jutnya, bahkan mungkin dapat mengubah genom tumbuh-tumbuh¬an yang ada dengan memanfaatkan gen bakteri pada plasmid dan membuat tumbuh-tumbuhan itu sendiri mampu menambat nitro¬gen. Beberapa ilmuwan bahkan sedang memikirkan dengan sung¬guh-sungguh untuk mengobati penyakit-penyakit temurun pada manusia dengan cara mengganti gen-gen yang "jelek" dengan yang normal. Kisaran yang lugs penyakit temurun dapat diobati dengan mengganti gen selagi penyakit tersebut menampakkan diri pada berbagai tingkatan kehidupan. Bahkan jika suatu penyakit temurun didiagnosis in utero (ketika dikandung), maka sel-sel janin mungkin dapat diprogramkan kembali di dalam kandungan. Jadi, kita lihat bahwa prospek masa depan rekayasa genetika bisa menjadi amat gemilang, sekalipun berbahaya bila tidak diawasi. Bagaimanapun juga bidang ini harus dijelajahi dengan disertai tindakan-tindakan pencegahan yang semestinya. Banyak negara kini mempunyai garis-garis pedoman mengenai pengurungan re¬kombinan secara biologic dan fisik, banyak mikrobiologiwan menganggap garis-garis pedoman semacam itu memberikan taraf keamanan yang cukup bagi percobaan-percobaan DNA rekombi¬nan.

III. KESIMPULAN Sandi genetis dibawa oleh DNA dan dihantarkan dari generasi ke generasi melalui.Teplikasi DNA. Pengungkapan arti dan penggu- naan sandi genetisldi dalam produksi protein, yang esensial bagi pertumbuhan dan kegia-tan sel, menyangkut dua tahap yaitu transkripsi dan translasi. Transkripsi ialah pemindahan informasi dari DNA ke RNA, data translasi adalah penerjemahan informasi ini dari RNA menjadi protein. Masih banyak : lagi yang harus ditemukan mengenai proses- \proses yang lebih-rumit yang berkenaan dengan replikasi DNA, transkripsi,, dart translasi misalnya saja fungsi yang tepat beberapa enzim. Setiap asam amino di dalam suatu protein disandikan oleh sebuah triplet basa atau kodon, dan sebelum ini kita yakin bahwa setiap untai kodon hanya dibaca satu arah. Tetapi, telah ditemukan sebuah: gen di dalam kromosom bakteriofage OX 174 yang dibaca dua arah dan dengan demikian menghasilkan dua protein yang sama sekali berbeda. Penemuan ini didorong oleh adanya perbedaan antara jumlah DNA yang dikandung di dalam bakteriofage dari jumlah protein yang disintesisnya. Dengan per¬kataan lain, jurnlalt DNA yang ada tidak cukup untuk mensintesis sepuluh protein berbeda yang disandikan oleh virus, menurut kaidah tradisional ―satu gen-sane protein‖. Ternyata bahwa gen untuk satu protein seluruhnya terkemas di dalam gen yang menja¬dikan protein lain. Tegasnya, gen pertarna itu sama dengan 60 per¬son terakhir gen keduai, Kedua gen tersebut juga dibaca menurut urutan yang berbeda. Gen yang lebih kecil dibaca dalam suatu urutan yang tergeser sebanyak satu kerangka. Ditemukannya gen-gen bertumpang-tindih ini meruntuhkan konsepsi satu gen satu protein. Masih harus diamati seberapa luasnya penyebaran gen-gen bertumpang-tindih ini di antara sePsel hidup dan virus, Penemuan-penemuan semacam akan membawa kepada pengetahuan yang lebih dalam mengenai bagaimana akti¬vitas selular dikendalikan. Transformasi Transformasi ialah proses pemindahan DNA bebas sel atau "bugil" yang mengandung sejumlah terbatas informasi DNA, dari satu set ke set yang lain. DNA tersebut diperoleh dari set donor melalui lisis set alamiah atau dengan cara ekstraksi kimiawi. Begitu DNA diambil oleh set resipien, maka terjadilah rekombinasi- Bakteri yang telah mewarisi penanda dari set donor tersebut telah tetrans¬formasi. Jadi, bakteri-bakteri tertentu, bila ditumbuhkan dengan diberi selsel coati, filtrat biakan, atau ekstrak set suatu galur yang berkerabat dekat, maka akan memperoleh dan Uu memindah¬sebarkan ciri-ciri dari galur yang sekerabat tersebut. Fenomena ini digambarkan pada Gambar 17-18, yang memperlihatkan trans¬formasi pneumokokus tipe II menjadi pneumokokus tipe II. "Penyebab transformasi" ini dikenali sebagai DNA oleh Avery, Macleod, dan McCarty dalam tahun 1944. Mereka mendefinisikan DNA sebagai substansi kimiawi yang menyebabkan sifat menurun..Bakteri yang telah ditransformasikan meliputi spesies-spesies dalam genus Bacillus, Haemophilus, Neisseria, dan Rizobium. Setelah masuknya DNA ke dalam sel, satu utas dengan segera dirombak oleh enzim

deoksiribonuklease, sedangkan utasan lain¬nya mengalami perpasangan basa dengan bagian yang homologue pada kromosom set resipien, lalu menjadi terpadu ke dalam DNA resipien Karena perpasangan basa komple¬menter berlangsung antara satu Was fragmen DNA donor dan suatu daerah khusus pada kromosom resipien, maka banyalah ga¬lur-galur bakteri yang berkerabat dekat dapat ditransformasikan. Sifat sel resipien. Kondisi yang sesuai untuk pengambilan DNA donor ke dalam sel-sel resipien terjadi hanya selama Ease pertumbuhan logaritmik. Selama periode ini, bakteri yang dpat ditransformasikan itu disebut kompeten untuk mengambil dan menggabungkan DNA donor. Biakan yang kompeten mungkin menghasilkan faktor protein ekstraseluler yang rupanya bertindak dengan cara mengikat atua menjerat fragmen-fragmen DNA donor pada situs-situs khusus pada permukaan bakteri. Pentingnya transformasi sebagai mekanisme perubahan gene¬tic secara alamiah diragukan. Mungkin proses tersebut terjadi me¬nyusul terjadinya lisis suatu mikrobe dan penglepasan DNAnya ke lingkungan sekitarnya. Boleh jadi transformasi antara galur¬galur bakteri dengan virulensi rendah dapat menyebabkan timbul¬nya sel-sel tertransformasi dengan virulensi tinggi. Dalam hal yang many pun, fenomena transformasi telah terbukti sangat ber¬guna dalam penelitian-penelitian genetic bakteri di laboratorium, terutama dalam memetakan kromosom bakteri (karena frekuensi transformasi dua gen pada waktu yang sama merupakan peturijuk Bakteri mampu menyimpan dan meneruskan informasi genetic kepada keturunannya seperti halnya organisme lain. Disamping mewariskan ciri-cirinya, bakteri juga mempertunjukkan keragaman yang berkaitan dengan genotipe dan fenotipenya. Perubahan fenotipe dapat disebahkan oleh pengaruh lingkungan atau mutasi di dalarn genomnya. Mutasi pada peringkat molekular misalnya ialah mutasi titik dan mutasi pergeseran kerangka. Set mengan¬dung enzimenzim khusus yang dapat memperbaiki DNA yang rusak. Ada tiga tipe utama pemindahan gen pada rekombinasi bak¬teri, yaitu konjugasi, transduksi, dan transformasi. Konjugasi bergantung pada kontak antar set dan diatur oleh faktor seks, yaitu episom. Unsur-unsur ekstrakromosom lain meliputi plasmid seperti misalnya faktor pemindah resistensi. Transduksi adalah semacam pernindahan gen, dalam hal ini DNA donor dibawa dari set donor ke set resipien di dalam faga. Pada transformasi, sepotong DNA bugil diambil oleh set resipien. Sejak 1973 telah tersedia teknik-teknik untuk melakukan rekayasa genetika Bel-Bel bakteri. Dengan teknik-teknik ini, gen dapat dipindahkan melintasi jalur spesies dan mengakibatkan terciptanya mikroorganisme baru yang telah mengalami peran¬cangan kembali. Masa depan genetika molekular tetap menggairahkan seperti yang telah terjadi selama sertahuntahun. Misalnya Baja, dite¬mukannya gen-gen yang bertumpang-tindih. Sembilan tahun, Har Gobind Khorana dan kawan¬kawan berhasil mensintesis gen DNA pertama yang lengkap (tan berfungsi, yang menggabungkan tirosin dalam sintesis protein di laboratorium. Selanjutnya, para peneliti kini telah menemukan bukti bahwa pada molekul DNA terdapat "kerja dari kejauhan". Artinya, suatu protein akan terikat pada DNA di satu tempat, dan hat ini akan mempengaruhi, ekspresi gen pada posisi yang berjauhan. Dengan demikian, DNA merupakan molekul yang jauh lebih "aktif" daripada konsepsi yang sekarang ada dan mekanisme pengendalian ekspresi gen mungkin lebih tidak kentara daripada yang dibayangkan sebelumnya. Dalam rekayasa genetika, teknologi DNA rekombinan menempatkan pada lengan manusia kemampuan untuk merancang kembali organisme hidup, yang sampai sekarang ini hanya mungkin terjadi melalui proses evolusi yang sangat lambat. Organisme-organisme baru hasil ciptaan semacam itu akan memperbanyak diri dan permanen. Sejauh ini, hanya set bakteri yang merupakan resipien bagi

gen-gen baru dari spesies lain. Pada masa yang akan datang mungkin sekali molekul DNA virus hewan yang sederhana akan digunakan untuk memindahkan DNA baru ke. dalam set hewan. Semua kemungkinan ini mempu¬nyai implikasi yang dahsyat Serta akibat-akibat yang tidak dapat diramalkan.

MAKALAH DASAR – DASAR MIKROBIOLOGI GENETIKA MIKROBIAL

OLEH : ILHAM FAUZI M.SRG/ 0704121063

DESLI ANGGUN/0704121201 KRISMAN ALBERTO GINTING/070412 ANDIT/070412

FAKULTAS PERIKANAN DAN ILMU KELAUTAN UNIVERSITAS RIAU PEKANBARU 2008 Diposkan oleh iptek di 08:33 0 komentar Label: S

LAPORAN DINPOP
I. PENDAHULUAN 1.1. Latar Belakang Indonesia adalah negara maritim yang membentang luas di khatulistiwa dari 94o BT-141o BT dan 6o LU-11o LS, dengan karakteristik sebagai negara kepulauan yang terdiri dari 17.508 pulau besar dan kecil serta memiliki garis pantai 81.000 km yang merupakan garis pantai terpanjang ke dua di dunia setelah Kanada. Wilayah laut Indonesia mencakup 12 mil dari garis pantai, selain itu Indonesia memiliki wilayah yuridiksi nasional yang meliputi Zona Ekonomi Eksklusif (ZEE) sejauh 12 mil dan landas kontingen sampai 350 mil dari garis pantai. Dengan ditetapkannya konvensi PBB tentang hukum laut Internasional 1982 wilayah laut yang dapat dimanfaatkan diperkirakan dapat mencapai 5,8 juta km2 merupakan perairan ZEE (Dahuri, 2003). Indonesia memiliki perairan yang sangat luas dengan garis pantai sepanjang 95.181 km sehingga memiliki potensi sumberdaya, terutama sumber daya perikanan laut yang cukup besar, baik dari kuantitas maupun dari segi diversitas sehingga menjadi modal dalam pembangunan bangsa dan negara Indonesia. Selain itu, Indonesia merupakan Negara kepulauan terbesar di dunia, dengan jumlah pulau-pulau sekitar 17.504 pulau (Departemen Kelautan dan Perikanan, 2003). Laut penting artinya untuk menjadikan bumi sebagai tempat kehidupan beranekanragam makhluk hidup, karena tergantung sumberdaya hayati dan non hayati yang sangat dibutuhkan, terutama untuk kelangsungan hidup organisme dan pemanfaatannya secara langsung maupun tidak langsung. Mengingat urgensi laut dimasa sekarang ini peranan daerah pesisir dan lautan dengan cara membudidayakan dan masyarakat teknik pendayagunaan.

Indonesia merupakan negara kepulauan dengan potensi perikanan melimpah, namun baru sebagian kecil dimanfaatkan dengan baik. Di samping itu, Indonesia juga mempunyai potensi perikanan darat yang baik dikembangkan untuk budidaya, penangkapan, pengolahan serta pemasaran. Selanjutnya dengan diakuinya Zona Ekonomi Ekslusif Indonesia telah menambah potensi perikanan laut. Sumatera Barat merupakan salah satu wilayah Negara Republik yang sebagian besar wilayahnya sekitar 329.867,61 km dengan luas lautnya 2 35.306 km (71,33%) sedangkan daratan hanya sekitar 94.561,6 km (28,67%) .Kondisi perairan yang sangat menjadikan sektor perikanan dapat menjadi sektor andalan setalah sektor migas.Pada akhir tahun 2004 dicatat hasil produksi perikanan budi daya berupa Tambak sebanyak 1.050,6 ton, kolam 15.974,9 ton, keramba 2.362,6 ton dan perikanan sawah mencapai 9,4 ton (Dinas Perikanan dan Kelautan Provinsi Sumatera Barat, 2004) Perikanan merupakan salah satu kegiatan manusia untuk memanfaatkan sumberdaya hayati perairan (aquatic resources) yang berada di perairan tawar, payau maupun laut. Pembangunan perikanan bertujuan untuk meningkatkan perekonomian nelayan, namun diperlukan berbagai cara untuk memperbaiki usaha perikanan yang masih tradisional agar menjadi usaha perikanan modern. Pembangunan sumberdaya perikanan laut yang merupakan sumber utama pemenuhan kebutuhan protein bagi masyarakat, ternyata belum di rasakan memadai. Hal ini disebabkan karena pemanfaatan yang kurang optimal. Sumber daya ikan mempunyai sifat tidak terlihat (invisble), hidup dan dapat memperbaharui dirinya (renewable), dengan demikian bila dinamika populasinya dapat diketahui, maka manusia dapat memperoleh hasil tangkap yang optimal dan berkelanjutan. Masalah yang ada terdapat dalam identifikasi parameter populasi, yakni laju pertumbuhan (growth rate) dan laju kematian (mortality rate) yang tidak mudah diperoleh karena memerlukan data dan informasi tentang sebaran frekuensi ukuran secara runtun waktu (time series), hal ini berakibat pada terbatasnya aplikasi model dinamik dalam pengkajian stok sumber data ikan. Alternatif upaya pengkajian stok yang biasa digunakan adalah model produksi surplus, yang menggunakan data‖catch‖ (upaya) yang selama ini bisa dikumpulkan.( Badruddin, B. Sumiono dan B. Iskandar ps.1992). Berdasarkan data Statistik Perikanan yang dikeluarkan oleh Dinas Perikanan dan Kelautan Propinsi Sumatera Barat sekitar 81% produksi perikanan Sumatera Barat dihasilkan dari perikanan tangkap, baik dari perikanan tangkap perairan laut (74.85%), maupun dari perikanan tangkap perairan umum (6.15%). Sisanya sebesar 19% dihasilkan dari perikanan budidaya di perairan Tawar. Dilihat dari jenis-jenis ikan yang dihasilkan, lebih dari 64% (66 jenis) dihasilkan dari perikanan tangkap, dan hanya sekitar 34% (12 jenis) yang dihasilkan dari perikanan budidaya. Potensi sumberdaya perikanan tangkap yang dimiliki propinsi Sumatera Barat meliputi sumberdaya ikan pelagis (besar dan kecil), ikan demersal, ikan karang (ikan konsumsi dan ikan hias), udang penaid dan krustase lainnya serta penyu laut. Semua sumberdaya perikanan tangkap tersebut merupakan potensi yang sangat dihandalkan di Sumatera Barat, karena mempunyai nilai ekonomis yang cukup tinggi dan banyak ditemukan di perairan Sumatera Barat. Pelabuhan Perikanan Bungus merupakan salah satu pelabuhan yang terletak di Jl.Raya PadangPainan KM.16 Bungus, Padang. Pelabuhan bungus ini merupakan salah satu pelabuhan terbesar di pantai barat Sumatera. Pelabuhan bungus ini merupakan bagian dari Propinsi Sumatera Barat yang memiliki laut sebagai lahan untuk dikembangkan dalam bidang perikanan tangkap, alat tangkap yang digunakan dipelabuhan ini bermacam-macam yaitu berupa pukat pantai, pukat cincin, jaring

insang, jaring lingkar, bubu, jaring insang tatap, bagan, serok, long line, dan tonda. Dari keterangan diatas pelabuhan Bungus dijadikan sasaran untuk dilakukannya praktikum Dinamika Populasi yaitu sesuai antara potensi umum pelabuhan tersebut dengan harapan seluruh mahasiswa dapat mengetahui tentang studi mempelajari stok ikan yang ada di suatu perairan khususnya di pelabuhan Bungus. 1.2 Tujuan dan Manfaat Praktikum Tujuan melakukan praktikum dinamika populasi adalah untuk mengetahui stok serta gambaran populasi ikan yang terdapat di perairan pelabuhan bungus dan untuk mengetahui sifat-sifat sosial di daerah tersebut. Manfaat praktikum adalah untuk menambah pengetahuan dan wawasan praktikan, untuk mendapatkan data dan informasi mengenai perikanan.

II. TINJAUAN PUSTAKA 2.1. Sumberdaya Perairan Menurut Kasry (2003) menyatakan bahwa perairan umum adalah bagian dari permukaan bumi yang secara permanen atau berkala digenangi air, baik air tawar, air payau, maupun air laut. Perairan tawar menyebar mulai dari air laut surut terendah kearah daratan dan badan air tersebut terbentuk secara alami atau buatan (waduk/ kolam). Laut mempunyai berbagai fungsi diantaranya adalah sebagai sarana transfortasi, usasaha budidaya, aktivas penduduk seperti MCK, usaha penangkapan dan lain sebainya. Selain itu perairan laut merupakan lingkungan hidup yang berfungsi sebagai media tempat tumbuh organisme, tempat berkembang biak, untuk pergerakan pembawa zat hara serta pelarut gas-gas dan mineral (Soesono, 1977). Sedangkan menurut Odum (1971), sungai dapat menerima bahanbahan asing dari luar yang menyebabkan berubahnya kualitas air, sehingga hidro-biota yang hidup di dalamnya mengalami gangguan. Perikanan merupakan suatu usaha atau kegiatan manusia untuk memanfaatkan sumberdaya hayati perairan. Ditinjau dari kegiatan pemanfaatan sumberdaya perikanan pada umumnya dapat dibagi atas dua, yaitu : 1) penangkapan ikan dan binatang lainnya yang dilakukan oleh para nelayan di laut, rawa, sungai dan danau yang dikenal dengan usaha penangkapan ikan, dan 2) pemeliharaan ikan dan binatang lainnya yang dilakukan oleh petani ikan di kolam, sawah, perairan umum dan di tepi pantai. Usaha ini lebih dikenal dengan usaha budidaya perikanan (Effendi, 1979). Laut di daerah Bungus ini sebagaimana pelabuhan laut lainnya banyak dimanfaatkan oleh penduduk sekitar diantaranya sebagai sarana transportasi, tempat mencari nafkah untuk kehidupan sehari-hari, dan aktivitas perkapalan dan perikanan Sihotang (1998) menyatakan bahwa perairan laut umumnya dalam dan cukup keruh sehingga mencegah penetrasi cahaya matahari masuk ke dalam laut dengan demikian bersama pengaruh arus bisa mengatasi pertumbuhan organisme. 2.2. Perikanan Perikanan adalah salah satu usaha manusia untuk memanfaatkan sumber hayati perairan bagi kepentingan hidupnya baik itu sumber hayati hewan maupun sumber hayati tumbuh-tumbuhan. Usaha ini hanya mempergunakan taktik dan cara yang sederhana sehingga hasil yang didapat

pada umumnya untuk memenuhi kebutuhan hidup sehari-hari. Pengelolaan perikanan di Indonesia secara garis besar dapat di bagi dua, yaitu perikanan budidaya dan perikanan tangkap (Syamsuddin, 1980). Fauzi (1985) menyatakan bahwa secara umum usaha perikanan selalu didefenisikan sebagai suatu kegiatan ekonomi yang menyangkut : 1) kegiatan produksi yang bersifat mengadakan atau menghasilkan ikan, baik dengan cara penangkapan maupun budidaya, 2) kegiatan pengolahan yaitu melakukan sesuatu terhadap ikan yang telah dihasilkan sehinggga merubah keadaan, bentuk dan nilai ekonomisnya, dan 3) pemasaran ikan yang menyangkut segala kegiatan memperdagangkan ikan mulai dari produsen sampai ke konsumen. Sedangkan Arisman (1982) menekankan bahwa untuk meningkatkan hasil tangkapan perlu adanya manajemen penangkapan yang baik. Keberhasilan usaha penangkapan ikan ditentukan oleh keseimbangan antara manajemen usaha perikanan, sarana penunjang keperluan penangkapan dan usaha penangkapan yang meliputi beberapa faktor seperti unit penangkapan yang digunakan (kapal, alat tangkap) serta mental dan keterampilan penggunaan alat tersebut. Dirjen Perikanan (1978) menyatakan bahwa yang menjadi dasar utama dalam memajukan dan mengembangkan perikanan adalah dengan peningkatan pengenalan jenis- jenis ikan serta pengetahuan tentang habitat, penyebaran dan biologinya. Salah satu usaha memajukan dan mengembangkan perikanan adalah dengan melakukan penelitian tentang biologi ikan. Perikanan Sumatera Barat yang memiliki kekuatan potensial dalam bidang perikanan dan kelautan, dimana sumberdaya perairannya sangat luas baik untuk penangkapan ikan maupun budidaya. Sumatera Barat daratan sesuai dengan wilayahnya terdiri dari sungai, danau, dan rawa berpotensi untuk pengembangan budidaya, kolam, keramba, minapadi dan longyam. 2.3. Penangkapan Usaha penangkapan ikan merupakan suatu usaha manusia untuk menghasilkan suatu hasil tangkapan baik itu berupa ikan maupun organisme lainnya di suatu perairan. Ayodhyoa, (1981) . Faktor-faktor yang mempengaruhi efisiensi suatu alat penangkapan ikan adalah juga merupakan faktor yang mempengaruhi keberhasilan suatu usaha penangkapan ikan, sehingga dengan demikian dapat dikatakan bahwa faktor-faktor yang mempengaruhi usaha penangkapan ikan adalah : 1) Konstruksi alat penangkapan ikan yang cocok, 2) Keterampilam nelayan dan 3) Bahan yang dipergunakan. Berdasarkan metode penangkapan yang ada di dunia dapat diklasifikasikan kedalam 16 golongan yakni: 1) Penangkapan dengan tanpa menggunakan alat (fishing without gear), 2) Penangkapan dengan melukai sasaran (fishing with wounding gear), 3) Penangkapan dengan cara membius (fishing by stpyeing), 4) Penangkapan dengan menggunakan tali atau benang (line fishing), 5) Penangkapan dengan perangkap (fishing with trap), 6) .Penangkapan dengan memerangkap di suatu areal penagkapan (fishing with areal traps, 7) Penangkapan dengan jaring berkantong dan memiliki mulut (fishing with net bag with fixed mouth), 8) Penangkapan dengan alat yang ditarik di dasar pantai (fishing with dragged gear), 9) Penangkapan dengan teknik melingkari setengah pantai (seiring), 10) Penangkapan dengan teknik melingkari gerombolan ikan (fishing with serounding nets), 11) Penangkapan dengan dengan cara alat di perairan (fishing with drived in method), 12) Penangkapan dengan teknik mengangkat alat di perairan (fishing with lift net), 13) Penangkapan dengan menjatuhkan alat tangkap ke perairan ( fishing with falling gear), 14) Fishing with gill net, 15) Fishing with tangle nets, 16) Harvesting machines (Brandt, 1984). Gill net merupakan alat tangkap yang banyak dipakai nelayan di Sumatera Barat, dan alat penangkapan ini mengalami perkembangan dari tahun ke tahun. Hal ini disebabkan karena gill net disesuaikan dengan jenis ikan komersial yang tertangkap di perairan Sumatera Barat, di

tambah lagi alat penangkapan ini mudah dan relatif murah serta dicapai nelayan secara teknis maupun ekonomis. Alat tersebut dalam pengoperasiannya tidak hanya untuk penangkapan di laut tapi juga dapat digunakan di perairan umum seperti danau, sungai dan lain- lainnya. Sadhori (1984) mengatakan rawai adalah salah satu alat penangkapan ikan dan udang terdiri dari rangkaian dari tali–temali yang bercabang- cabang dan pada tiap jaring ujung cabang diikat sebuah pancing. Sedangkan pancing adalah alat tangkap yang sederhana yang fungsinya hanya bisa melakukan operasi penangkapan kecil. 2.4. Pengolahan Ikan. Ikan merupakan salah satu sumber protein yang sangat dibutuhkan oleh manusia, karena kandungan proteinnya yang tinggi dan mengandung asam amino esensial yang diperlukan oleh tubuh, disamping itu nilai biologisnya mencapai 90% dengan jaringan pengikat sedikit sehingga mudah dicerna, dan harganya murah dibandingkan dengan sumber protein lainnya. Namun, disamping kelebihan yang dimiliki oleh ikan terdapat juga kelemahan – kelemahan diantaranya adalah ikan sangat cepat mengalami kerusakan atau pembusukan (Adawiyah, 2006) Ikan segar atau ikan basah adalah ikan yang mempunyai bentuk maupun sifat yang hampir sama dengan ikan yang masih hidup di dalam air atau belum sama sekali mengalami usaha penanganan. Penanganan hasil perikanan adalah salah satu usaha yang dilakukan oleh manusia baik dengan cara pengolahan dan pengawetan untuk mempertahankan mutu ikan agar tetap dapat bertahan sampai pada tangan konsumen. Dalam perindustrian perikanan, penanganan (handling) ikan segar bertujuan untuk mempertahankan kesegaran ikan dalam waktu selama mungkin. Hal ini karena kesempurnaan dari penaganan ikan tersebut menentukan baik atau buruknya mutu ikan (Moeljanto, 1992). Kemunduran mutu ikan berawal dari adanya kerusakan atau pembusukan ikan. Menurut Murniyati dan Sunarman (2000) secara umum kerusakan atau pembusukan ikan dan hasil-hasil olahannya dapat digolongkan pada: 1) kerusakan-kerusakan biologi, 2) kerusakan-kerusakan enzimatis, 3) kerusakan-kerusakan fisika, dan 4) kerusakan-kerusakan kimiawi. Ditekankan pula oleh Afrianto dan Liviawaty (1989) bahwa biasanya pada tubuh ikan yang telah mengalami proses pembusukan akan terjadi perubahan, seperti timbulnya bau busuk, daging menjadi kaku, sorot mata pudar, serta adanya lender pada insang mapun tubuh bagian luar. Oleh karena itu, perlu dilakukan usaha untuk meningkatkan daya simpan dan daya awet produk perikanan pada pascapanen melalui proses pengolahan maupun pengawetan. Adapun tujuan utama proses pengolahan dan pengawetan ikan yaitu mencegah proses pembusukan pada ikan, terutama pada saat produksi melimpah, meningkatkan jangkauan pemasaran ikan, melaksanakan diversifikasi pengolahan produk-produk perikanan, dan meningkatkan pendapatan nelayan atau petani ikan, sehingga mereka terangsang untuk melipatgandakan produksi. Proses pengolahan dan pengawetan ikan ini dapat dilakukan dengan menggunakan suhu rendah, suhu tinggi, dan mengurangi kadar air salah satunya dengan menggunakan panas maupun udara panas. Dan dijelaskan oleh keduanya pula prinsip-prisip dalam pencegahan pembusukan, yaitu dengan mengurangi jumlah bakteri dan enzim, membunuh atau menghambat kegiatan bakteri dan enzim serta melindungi ikan dari pencemaran pada saat ikan masih hidup pada habitatnya maupun pada saat pasca panen. Adapun pengolahan hasil perikanan yang dilakukan diantaranya adalah secara tradisional seperti pembuatan ikan asin, ikan asap, dan hal itu dilakukan secara sederhana. Selain secara tradisional, pada saat ini pengolahan ikan sudah banyak mengalami kemajuan seperti pengawetan ikan.

2.5. Pemasaran Perikanan Pemasaran (marketing) menurut Manulang (1980) adalah segala aktivitas yang dikerjakan orangorang atau bagian untuk memindahkan barang dan jasa dari tangan produsen ke tangan konsumen. Sedangkan menurut Ganda dan Alfonsus (1992) menyatakan bahwa pemasaran dapat dikatakan sebagai kajian terhadap aliran produk secara fisik dan ekonomik dari produsen melalui pedagang perantara ke konsumen, pemasaran melibatkan banyak kegiatan yang berbeda yang menambah nilai produk pada saat produk bergerak melalui sistem pemasaran tersebut. Hermanto (1979) mengatakan pemasaran ikan merupakan suatu rantai yang panjang karena berfungsinya lembaga pemasaran pasar-pasar yang bersifat monopoli, biaya tata niaga yang tinggi, sarana dan prasarana serta informasi yang kurang baik mengakibatkan harga yang diterima konsumen sangat tinggi. Kemudian Satwiko (1984) menambahkan bahwa untuk menunjang kesuksesan suatu usaha perikanan harus didukung oleh sistim pemasaran yang baik. Untuk itu kebijaksanaan yang ditempuh adalah meningkatkan pembinaan dan sistim pemasaran yang dapat menguntungkan para nelayan dan petani ikan sekaligus tidak memberatkan para konsumen. Faktor-faktor yang mempengaruhi pemasaran antara lain : mutu, produk, jumlah produk, jauh dekatnya sumber produk dengan konsumen, sarana angkut dari produsen dan jumlah konsumen dari produk. Sementara itu pedagang yang membeli barang dari pihak produsen (dalam partai besar) disebut sebagai pedagang besar (grosir atau wholeseller) yang kemudian menjual kembali barangnya (partai kecil) kepada pedagang eceran yang kemudian berhadapan langsung dengan konsumen (Hidayat, 1987). Hambatan dalam pemasaran hasil perikanan disebabkan oleh : 1) Sifat ikan yang cepat kehilangan mutu dan pengawetan yang kurang sempurna, 2) produksi yang dipengaruhi oleh fluktuasi musim, 3) transportasi yang kurang memadai, 4) Jauhnya jarak antara produsen (petani ikan) dengan pasar sehingga mengakibatkan kedudukan nelayan atau petani ikan pada posisi yang sulit dan lemah sehingga pedagang perantara lebih berperan dalam menentukan harga (Eddiwan, 1983). Menurut Malik (1998), tantangan-tantangan yang dihadapi nelayan dan petani ikan skala kecil masih dicirikan dengan masalah-masalah sosial ekonomi seperti tingginya biaya produksi, tidak meratanya kepemilikan, rendahnya nilai investasi, lemahnya kelembagaan nelayan, konflik dengan usaha perikanan padat modal dan ketidak sempurnaan pasar. Rendahnya produksi perikanan mempengaruhi pendapatan rumah tangga masyarakat nelayan juga menjadi rendah. Besar kecilnya anggota keluarga akan mempengaruhi secara langsung terhadap pendapatan perkapita keluarga. Makin besar anggota keluarga maka makin besar pula beban yang harus dipikul oleh kepala keluarga dalam memenuhi kebutuhan hidup. Oleh karena itu Mubyarto (1997) mengatakan bahwa sumberdaya perikanan di Indonesia mempunyai arti sosial yang penting bagi masyarakat mengingat : a) Besarnya jumlah penduduk maupun nelayan, b) Sebagian besar dari wilayahnya adalah laut ditambah perairan darat, c) Rendahnya konsumsi protein berpengaruh pada kemampuan untuk pertumbuhan dan kecerdasan, d) Keterbatasan dan keterlambatan peningkatan produksi. 2.6. Permasalahan dalam Perikanan Menurut Syamsuddin (1980) ada beberapa faktor yang mempengaruhi perikanan Indonesia antara lain: (1) usaha masih bersifat sambilan, (2) terbatasnya modal memiliki, (3) kurangnya bimbingan dari pihak yang berwenang, (4) terbatasnya pendidikan yang dimiliki oleh petani ikan. Oleh karena pemerintah perlu memperhatikan beberapa hal diantaranya adalah: (1) pengadaan dan penyediaan serta penyederhanaan sarana dan prasarana usaha perikanan, (2)

sarana perkreditan bagi petani, dan (3) pendidikan, latihan dan penyuluhan dalam rangka alih teknologi bagi petani. Pembangunan perikanan pada dasarnya merupakan proses upaya manusia untuk memanfaatkan sumber dayahati perikanan dan sumberdaya perairan melalui kegiatan ikan, pembudidayaan ikan, seiring dengan pengembangan sumberdaya manusia, pemanfaatan modal, pengembangan dan kesejahteraan, peningkatn kerja dan berusaha serta peningkatan devisa Negara, disertai upayaupaya pemeliharaan dan pelestarian sumberdaya hayati dan lingkungan secara alami (Malik, 1998). Sensus Pertanian (1983) dalam Indrawati (2006) membuktikan bahwa permasalahanpermasalahan yang terdapat pada masyarakat pedesaan pada umumnya sama di Indonesia, yakni menyangkut segi social ekonomi. Indikator social meliputi pendidikan, kesehatan, rumah dan jumlah tanggungan keluarga merupakan faktor yang menjadi perhatian demi meningkatkan taraf hidup, sedangkan indikator ekonomi menyangkut pendapatan dan pengeluaran rumah tangga. III. METODE PRAKTIKUM 3. 1. Waktu dan Tempat Praktikum lapangan dinamika populasi ini dilaksanakan pada hari Sabtu-Minggu, tanggal 16-17 Mei 2009 yang bertempat di Pelabuhan Perikanan Samudera Bungus Sumatera Barat. 3. 2. Bahan dan Alat Peralatan yang digunakan dalam praktikum Dinamika Populasi ini adalah lembaran kuisioner , kamera untuk mendokumentasikan gambar, alat-alat tulis untuk mencatat data primer dan data sekunder yang didapat dari lokasi praktikum. 3. 3. Metode Prakikum Metode praktikum yang digunakan adalah metode survey yaitu melakukan pengamatan langsung ke lokasi praktek serta wawancara dengan beberapa orang masyarakat perikanan atau nelayan yang ada di lokasi tersebut. Data yang dikumpulkan terdiri dari: 1) data primer yaitu data hasil observasi di lokasi dan wawancara langsung dengan para petani ikan yang mencakup, penangkapan, pengolahan, dan penjual ikan. 2) data sekunder yaitu data yang diperoleh dari Dinas Kelautan dan Perikanan atau instansi yang terkait. 3.4. Prosedur Praktikum Adapun prosedur dari praktikum ini yaitu untuk data primer praktikan melakukan wawancara atau tanya jawab kepada masyarakat perikanan atau para nelayan yang ada disekitar pelabuhan perikanan samudera bungus seputar aktivitas perikanan yang mereka lakukan. Sedangkan untuk data sekunder praktikan memperolah data dari pegawai dinas terkait. Pada hari pertama, semua praktikan mengikuti seminar atau presentasi seputar kegiatan perikanan yang ada di Pelabuhan Perikanan Samudera Bungus Sumatera Barat oleh salah seorang pegawai Dinas Kelautan dan Perikanan. Melalui seminar yang dilengkapi dengan diskusi ini, para praktikan memperoleh data sekunder yang cukup lengkap dan memuaskan. Selanjutnya seluruh praktikan mulai berinteraksi dengan para nelayan yang kapalnya sedang bersandar di pelabuhan untuk mendapatkan data primer. Secara bergantian praktikan menanyakan banyak hal seputar aktivitas mereka ketika melakukan penangkapan. Mulai dari persiapan, anggaran, bahan logistik, waktu penangkapan, lama penangkapan, alat penangkapan dan lain-lain. Pada malamnya praktikan disuruh ke dermaga untuk melihat bongkar muat hasil tangkapan. Pada hari kedua kembali praktikan melengkapi data primer dengan mewawancarai pedagang pengumpul, pedagang pengecer di Pasar Gaung Teluk Bayur . Tetapi pada saat tiba di lokasi

pasar, ikan yang dijual sedikit karena ikan hasil tangkapan sedikit akibat terang bulan.

IV. HASIL DAN PEMBAHASAN

4.1. Hasil Data Primer Pelabuhan Perikanan Samudera Bungus ini merupakan salah satu pelabuhan di pantai barat Sumatera Barat dan terletak di jalan lintas Padang-Painan Km 16 Bungus Padang. Berada pada 16 km sebelah selatan Padang atau 1,5 jam perjalanan. Lokasi pantai ini mudah dicapai dengan transportasi darat. Bentuk pantainya menyerupai bulan sabit. Air lautnya hangat dan aman untuk berenang. 4.1.1. Data primer untuk kegiatan penangkapan yang diajukan kepada nelayan tangkap di sekitar Pelabuhan dan Perairan Pantai Bungus. a. Identitas Responden Nama : Rian Jenis Kelamin : Laki-laki Agama dan Etnis : Islam dan Minang Umur : 21 tahun Alamat : Batang kapas, pesisir, Padang Tahun mulai bermukim : 2000 Pendidikan : SMP Mata pencaharian pokok : Nelayan Mata pencaharian sampingan : Mengojek Anggota Keluarga : 5 orang Rian menjadi Nelayan mulai tahun 2000, pekerjaan ini tidak turun temurun dari keluarga tetapi dari diri sendiri. Jumlah tanggungannya 2 orang. Melaut ikut sama orang lain. Pekerjaan sebelum menjadi nelayan adalah pengangsur. Pekerjaan sampingan yaitu mengojek. b. Alat Penangkapan

Alat tangkap yang digunakan Saudara Rian untuk menangkap ikan yaitu pancing, wareng, dan kapal. Jenis ikan yang tertangkap pada saat melakukan penangkapan yaitu ikan tuna, ikan tete, ikan sala, ikan sisik, ikan nyarang dan ikan bolo. Hasil tangkapan dijual ke TPI, Tauke, Pedagang dan Gauang. Alat tangkap yang digunakan 2 unit. Ada milik sendiri yang di beli di pasar secara tunai dan ada yang bukan milik sendiri dari induk samang/tauke. Modal dalam operasi penangkapan merupakan milik sendiri dan biaya dalam satu kali operasi sebesar Rp, 15.000.000. Waktu operasi pada malam hari. Dalam seminggu melakukan penangkapan sebanyak 3 kali, dan daerah penangkapan di tengah laut. Musim penangkapan tidak ada di daerah ini. Perahu yang digunakan terbuat dari kayu, dan hasil tangkapan sekali menangkap mencapai 15 ton. Kesulitan yang sering dialami saat menangkap ikan adalah badai dan ombak besar. Cara mengatasi kesulitan tersebut pergi ke tepi. Para nelayan tidak mendapat bantuan dari pemerintah setempat. Pendapatan rata-rata saudara Rian adalah Rp, 1.000.000 dari sektor perikanan dan Rp, 600.000 dari sektor lainnya. Pengeluaran untuk kebutuhan keluarga dalam sebulan Rp, 500.000. Saudara Rian maupun keluarganya tidak ada yang ikut menjadi anggota koperasi.

4.2.2. Data primer untuk kegiatan pemasaran yang diajukan kepada pedagang ikan disekitar pelabuhan dan perairan Pantai Bungus serta Pasar gauang Teluk Bayur. a. Identitas Responden Nama : Candra Jenis Kelamin : Laki-laki Agama dan Etnis : Islam Umur : 39 tahun Alamat : Bungus Tahun mulai bermukim : 2002 Pendidikan : SMA Mata pencaharian pokok : Nelayan Mata pencaharian sampingan : Anggota Keluarga : 7 orang 1.Pedagang Pengumpul Ikan yang dijual dibeli dari ikan hasil tangkapan nelayan. Ikan yang di beli kemudian dijual langsung di pasar kepada konsumen yang datang membeli dengan harga Rp 5000/kg karena tidak mempunyai pelanggan tetap. Ikan yang dijual berupa ikan segar. Usaha saudara Candra ini sudah berlangsung 4 tahun dengan modal yang diperoleh dari tauke. Ikan yang dibeli dalam satu kali penjualan sebanyak 60 kg dengan modal awal Rp, 400.000. Keuntungan yang diperoleh dalam satu kali penjualan adalah Rp, 100.000. Permasalahan yang sering dihadapi dalam pemasaran ikan adalah kondisi ikan dan cara yang digunakan untuk mengatasinya baru dengan menggunakan es.

2.Pedagang pengecer Ikan yang dijual dibeli dari nelayan. Kemudian ikan tersebut di jual di TPI, Pasar, dan komplek rumah. Modal merupakn modal sendiri. Jumlah ikan yang dijual perhari 35 kg dengan sistem penjualan tunai. Jenis ikan yang dijual yaitu ikan tongkol, ikan maco dan ikan taneman. Ikan yang dijual merupakan ikan segar, ikan asin dan ikan kering. Bentuk ikan yang paling banyak diminati konsumen adalah ikan segar. Harga ikan dibeli sebesar Rp,10.000/kg untuk ikan segar, Rp, 10.000/kg ikan asin dan Rp, 13.000/kg untuk ikan kering. Dan ikan tersebut dijual kepada konsumen dengan harga Rp, 15.000/kg ikan segar, Rp, 13.000/kg ikan asin dan Rp, 25.000/kg untuk ikan kering. Permasalahan yang dihadapi adalah pada saat musim hujan sehingga tidak jualan. 3.Jenis dan Teknis pengolahan Jenis ikan yang diolah adalah ikan tongkol yang diperoleh dari hasi tangkapan sendiri. Pengolahannya dengan cara Viber menggunakan teknologi mesin. Ikan yang diperlukan dalam sekali pengolahan adalah 1000 kg dengan hasil setelah diolah menjadi 800 kg. Ikan hasil olahan ini dijual sebesar Rp, 3.000.000. Konsumen biasanya langsung datang ke pabrik untuk membeli ikan olahan ini. 4.Pemasaran Hubungan dengan pedagang pengumpul dan pembeli tergantung. Ikan segar maupun olahan dijual di pasar, TPI, dan komplek rumah. Pembelinya berasal dari Bungus, Painan dan Solok. Pembayaran dilakukan secara tunai. Bila ikan tidak terjual habis maka selebihnya di eskan dan kalau suda busuk dibuang. Data Sekunder Diperoleh dari Dinas Perikanan dan Kelautan pelabuhan perikanan samudera bungus adapun data-datanya sebagai berikut : Tabel 1. Jenis produksi ikan yang dominan di Sumatera Barat No Jenis ikan Ton 1 Kembung 10.159 2 Teri 7,766 3 Tongkol 4,478 4 Japuh 3,072 5 Cakalang 2,690 6. Tuna 1,537 7 Layur 869 8. Tenggiri 823 9 Lembong 673 10 Lobster 426 Lain-lain, Udang, Kepiting, Cruscea 53,252 Tabel 2. Potensi, produksi dan rata-rata pemanfaatan ikan tuna diluar ZEE wilayah Sumatera No Ikan Potensi (ton/tahun) Produksi (ton) Pemanfaatan rata-rata (%) 1 Tuna ekor kuning 23.000 4.800 20

2 Tuna mata besar 19.330 4.000 20,7 3 Tongkol bojo 65.000 10.000 15,4 4 Situhuk 17.300 3.300 19,1 Total 124.630 22.100 18,8

Tabel 3. Data aktivitas PPS Bungus Tahun 2006 No Bulan Jumlah kunjungan kapal Produksi ikan tuna ekspor (kg) Nilai produksi Ikan Tuna Ekspor (Rp) 1 Januari 208 - 2 Februari 393 7.200 93.6000 3 Maret 225 32.339 598.271.500 4 April 169 97.990 4.409.550.000 5 Mei 322 110.780 7.200.700.000 6 Juni 474 172.900 16.425.500.000 7 Juli 559 88.300 8.388.500.000 8 Agustus 972 74.840 7.858.200.000 9 September 1.400 46.390 4.407.050.000 10 Oktober 1.583 64.922 6.167.590.000 11 November 1.505 50.392 4.283.320.000 12 Desember 1.252 969 92.055.000 Jumlah 9.172 747.022 59.924.336.500 Tabel 4. Jumlah Kunjungan Kapal di PPS Bungus Tahun 2007 No Bulan GT Jumlah <10 11 – 30 31 – 50 50 – 100 101 - 200 1 Januari 332 394 93 212 172 1.203 2 Februari 189 174 77 130 118 688 3 Maret 237 21 54 68 128 506 4 April 226 23 14 128 110 501 5 Mei 267 27 33 182 107 616 6 Juni 420 27 29 80 160 716 7 Juli 420 27 33 69 90 639 8 Agustus 372 47 31 82 118 650 9 September 475 50 22 92 122 761 10 oktober 315 31 31 89 152 618 11 Nopember 200 142 28 105 125 600 12 Desember 341 62 31 84 122 640 Total 3.794 1.025 476 1.321 1.522 8.138 Tabel 5. Volume dan Nilai Produksi Ikan di PPS Bungus Tahun 2007

No Jenis ikan Volume (kg) Nilai produksi 1 Big eye 500 6.000.000 2 Yellow fin 147.770 1.993.265.000 3 Cakalang 317.710 2.114.968.500 4 Kembung 20.775 89.188.500 5 Tongkol 258.960 1.694.884.500 6 Layaran 580 4.000.000 7 Lemadang 650 3.575.000 8 Selar kuning 5.810 50.811.250 9 Tenggiri 200 3.400.000 10 Banyar 5.020 37.612.500 11 Lemuru 240 1.260.000 12 Slengseng 12.740 64.890.000 13 Alu-alu 30 200.000 14 Layur 21.350 97.925.000 15 Kerapu 4.113 54.110.000 16 Teripang 400 25.400.000 17 Lobster 230 34.925.000 Total 797.078 6.276.415.250 Tabel 6. Jenis Alat tangkap Di Pelabuan Perikanan Bungus No. Jenis alat Jlh alt Hasil/ ton Rata hsl alat Ratio hsl/hr Bagan Effort Covertion 1 Bagan 50 6.0 0.1200 1.000 50 2 Purseine 20 4.0 0.2000 1.667 33 3 Tonda 1200 0.5 0.0004 0.003 4 4 Jaring 2000 9.0 0.0045 0.038 75 5 Long Line 4000 40.0 0.0100 0.083 333 6 Bubu 180 20.0 0.1111 0.926 167 Total 7450 663 Konversi alat kebagan = Total Jumlah Alat : Total E Convertion = 7450 : 663 = 11,245 Tabel 7. Hasil tangkapan dikali dengan konversi alat ke bagan No. Jenis alat Hasil / ton Konversi alat ke Bagan Hsl tangkapan dari Konversi alt ke Bagan (ton/tahun) 1 Bagan 6.0 11.245 67.472 2 Purseine 4.0 11.245 44.981 3 Tonda 0.5 11.245 5.623 4 Jaring 9.0 11.245 101.208 5 Long Line 40.0 11.245 449.811 6 Bubu 20.0 11.245 224.906 Total 79.5 894

Dari table diatas dapat diketahui bahwa total kelimpahan ikan yang terdapat di Pelabuhan Perikanan Samudra bungus pada tahun 2007 ± 894 ton. 4.2. Pembahasan Pemakaian dermaga di PPS Bungus sangat diminati oleh kapal-kapal yang akna berlabuh untuk memperbaiki kapal yang rusak pada saat berlayar. Seperti halnya pada demaga bunker dimana fungsinya adalah sebagai fasilitas untuk tempat memperbaiki kapal-kapal yang rusak. Dari data yang diperoleh pada bulan januari selalu ada banyak kapal yang berlabuh di PPS Bungus sekitar 1.203 dan jeins kapal yang banyak berlabuh yaitu antara 11-30 GT. Di PPS Bungus memiliki produksi iakn tuna yang besar, beberapa jenis ikan tuna yang diperoleh Tuna Ekor Kuning, Tuna Mata Besar, Tongkol Bojo, Situhuk. Dari berbagai macam jenis ikan tuna yang di produksi salah satunya yang terbesar jenis ikan tuna ekor kuning mencapai 23.000 ton/tahun. Tempat perdagangan yang banyak dilakukan pada daerah jepang. Jepang pernah menolak pemasaran ikan tuna dari Indonesia, karena jenis ikan tuna pada saat itu dagingnya mengandung bahan merkuri dan pencemar yang lain. Itu terjadi karena tingginya bahan pencemar diperairan laut sehaingga salinitas itu sendiri tidak mampu untuk mendaur ulang. 4.2.1. Sumberdaya Perikanan Dari hasil wawancara yang dilakukan dengan nelayan di pelabuhan perikanan samudera Bungus, pekerjaan nelayan merupakan pekerjaan utama untuk menghidupi kebutuhan sehari-hari. Meski banyak juga diantara nelayan yang masih lajang. Waktu nelayan melakukan penangkapan tergantung kepada jenis kapal atau alat tangkapnya. Ada yang hanya 3 hari, 4 hari bahkan seminggu lebih. Tetapi ada juga yang menangkap ikan pada pagi dan sore hari. 4.2.2. Alat Tangkap Hal-hal yang harus diperhatikan dalam melakukan usaha penangkapan adalah pemilihan alat tangkap, pemakaian metode penangkapan spesies yang ditangkap, keahlian nelayan, kedalam perairan dan karakteristik perairan (Sainbury, 1986). Sedangkan masing-masing alat tangkap memiliki kelebihan dan kekurangan. Dalam penerapannya diperlukan pertimbangan dari berbagai segi, antara lain aspek teknik penangkapan ikan itu sendiri serta harus dapat dipertanggungjawabkan secara teknis, social ekonomi maupun ekologi. Di Pelabuhan Perikanan Samudera Bungus jenis alat tangkap yang digunakan nelayan adalah Dengan alat tangkap dan armada yang beroperasi terdiri dari bagan purseine, tonda, jaring insang, long line, bubu, pukat cincin, pukat pantai.

A. Bagan Bagan Menurut Ayodhyoa (1978) bagan adalah alat tangkap yang berbentuk empat persegi panjang, mempunyai mata jaring yang sama ukurannya, lebar lebih pendek dibandingkan dengan panjangnya, dengan perkataan lain, jumlah mesh dept lebih sedikit jika dibandingkan dengan jumlah mesh length pada arah panjang jaring. Bahan yang yang digunakan adalah bahan transparan berupa nilon (monofilamen) dan pinggirannya menggunakan tali yang besar (tali ris). Jaring ini dipasang pada permukaan beragam dengan pancang atau tiang yang sengaja dipasang. Alat ini dioperasikan pada pagi atau sore hari. B. Purse Seine Nelayan bungus menggunakan Purseini sebagai alat untuk menangkap ikan, selain modalnya sedikit cara pengoperasiannya juga mudah.

Jenis pancing yang biasa digunakan adalah pancing purseini dengan ukuran mata pancingnya adalah 2 inc umpan yang digunalan adalah lipas batang dalam satu rawai itu terdapat 40 buah mata pancing. Biasanya setiap nelayan memiliki lebih dari satu pancing rawai dan dipasang pada pagi hari dan dibiarkan baru kemudian diangkart pada pagi harinya lagi. Biasanya hasil tangkapan tidak terlalu banyak cukup untuk dikomsumsi keluarga saja tapi semua pancing rawai yang diletakkan tidak pernah penuh mengait ikan.

C. Tonda Tonda adalah jenis alat penangkapan ikan yang terdiri dari seutas tali utama berpancing umpan buatan atau seutas tali utama tanpa jarak dan 2 – 3 tali cabang berpancing umpan buatan. Pengoperasiaannya dengan menggunakan kapal motor yang dilengkapi sepasang batang kayu atau bamboo (out riggers/booms) yang dipasang pada kedua sisi lambung kapal. Pada out riggers dan belakang/buritan kapal diikatkan beberapa pancing tonda, selanjutnya ditarik di belakang kapal. Agarpancing tetap melayang (tidak terapung) di dalam perairan, maka ujung ikatan tali cabang pada setiap tali utama dilengkapi dengan papan meluncur. D. Jaring Jaring adalah salah satu alat tangakap fishing with traps yang berbentuk empat panjang bujur sangkar dimana disalah satu sisinya dibuat sedemikian rupa sehingga ikan yang sudah masuk tidak dapat keluar lagi (Von Brandt, 1984). E. Pukat Pantai Pukat pantai adalah jenis pukat pantai yang terbukanya mulut jaring tanpa adanya otter board atau bentangan bingkai. Operasi penangkapannya ditarik ke pantai/darat melalui kedua bagian sayapnya dan kedua utas tali selambar yang panjang.. Pengoperasiaannya dengan cara menurunkan pukat pantai ke perairan laut dengan menggunakan perahu atau kapal, kemudian menarik kedua tali selambar dan dan bagian sayap jarring kea rah darat/pantai yang dilakukan oleh beberapa orang penarik. F. Bubu Bubu adalah alat penangkap ikan yang terbuat dari jarring atau bamboo sebagai perangkap ikan. Mempunyai pintu masuk yang berjumlah satu atau dua. Bubu mempunyai bermacam-macam bentuk. Alat penangkapan ikan ini dapat diangkat dan dipindahkan dengan mudah ke daerahdaerah penangkapan lainnya tanpa menggunakan perahu/kapal sebagai alat pengangkut. Pemasangannya di dasar atau di dekat permukaan perairan selama jangka waktu tertentu. Sering kali di dalam bubu dipasang umpan atau manik-manik dan di luarnya dipasang daun kelapa sebagai alat penarik ikan. G. Long Line Long line adalah alat penangkapan ikan berupa serangkaian tali yang terdiri dari tali utama (main line) terbuat dari polyester atau kuralon, yang pada setiap jarak tertentu terpasang tali cabang (branch line) yang panjangnya 20 – 25 meter terbuat dari bahan yang sama dengan tali utama tetapi dengan diameter lebih kecil. Yang ujungnya diikatkan pancing berumpan ikan segar. 4.2.3. Pemasaran Pemasaran yang dilakukan di Pelabuhan Perikanan Samudera Bungus adalah pemasaran ikan segar dari hasil tangkapan. Khusus ikan tuna dan ikan-ikan besar diolah dulu pada dua

perusahaan besar yang ada di pelabuhan Bungus hingga dipasarkan keluar kota maupun diekspor. Sedangkan ikan lain ada yang langsung dijual di pasar terdekat.

V. KESIMPULAN DAN SARAN

5.1. Kesimpulan Pelabuhan Perikanan Samudera Bungus merupakan pelabuhan terbesar yang ada di Sumatera Barat. Kegiatan perikanan di pelabuhan ini meliputi usaha penangkapan, pengolahan ikan, perbengkelan kapal, jasa docking dan penjualan air bersih, penyaluran bahan bakar minyak, pabrik es dan sebagainya. Jenis ikan yang tertangkap diantaranya ikan ikan tuna yellow fin & big eye, cakalang, kembung, tongkol, layaran, bawal, sunglir, lemadang, selar kuning, kerapu, teripang, dan lobster. Dengan alat tangkap dan armada yang beroperasi terdiri dari bagan purseine, tonda, jaring insang, long line, bubu, pukat cincin. 5.2. Saran Melalui praktikum yang telah dilakukan diketahui bahwa perlunya penyesuaian harga jual ikan tuna antara harga jual ikan tuna di pelabuhan Bungus dengan pelabuhan yang ada diluar Bungus, karena harga jual yang sangat murah. Selain itu perlu ditekankan kepada praktikan agar lebih aktif melakukan wawancara kepada para nelayan agar informasi yang dibutuhkan tentang gambaran stok ikan di perairan Bungus.

DAFTAR PUSTAKA Adriman et al. 2005. Penuntun Praktikum Ekologi Perairan. Pekanbaru. 30 hal (tdk diterbitkan) Afrianto, E dan Liviawaty, E. 2000. Pengawetan dan Pengolahan Ikan. Kanisius. Yogyakarta. 124 hal Arisman. 1982. Perikanan Laut. Penerbit Angkasa Bandung. Bandung 98 halaman. Ayodhyoa., 1981. Metode Penangkapan Ikan. Penerbit Yayasan Dewi Sri. Bogor. 97 hal.

Badruddin, B. Sumiono dan B. Iskandar ps.1992. Dugaan prospek pemanfaatan sumber daya ikan demersal di perairan Nusa Tenggara Barat. Jrnn. Pen. Perik. Laut. No. 66 :29-36 Boyd, C.E. and F. Litchoper. 1982. Water Quality Managemen in Pond Fish Culture. Reasarch and Development Series no.22. International Center for Aquaculture Experiment. Auburn Universiti. Auburn. 23-26 hal. Brandt, A, Vont. 1984. Fishing methode of the World 3nd. Action fishing new book, ltd. London. 418 hal. Dahuri, R., 2003. Keanekaragaman Hayati Laut: Aset Pembangunan Berkelajutan Indonesia. PT Gramedia Pustaka Utama, Jakarta. 412 hal. Dinas Perikanan dan Kelautan, 2004. Pokok-pokok Pengembangan Perikanan Pekanbaru. 8 halaman. Dirjen Perikanan., 1978. Pedoman Pengenalan Sumber Perikanan Laut, bagian I. Jenis-jenis Ikan Ekonomis Penting. Departemen Pertanian. Jakarta. 170 hal. Dirjen Perikanan Tangkap Departemen Perikanan dan Kelautan. 2005. Klasifikasi Alat Penangkapan Ikan. Eddiwan. 1983. Peranan Koperasi dalam pemasaran Hasil dan Pengembangan Kelurahan Nelayan. Prosiding Workshop Sosial Ekonomi Perikanan Indonesia. Pusat Perkembangan Pertanian. Jakarta. Hal 145-150. Fauzi. 1985. Pendekatan Lintas Sektoral Untuk Pencegahan Masalah Perikanan Pada symposium HUT XXI FAPERI Dies Natalis XXIII UNRI dan Hari Sumpah Pemuda LVII halaman 1-7 (tidak diterbitkan). Ganda, R. S. dan S. Alfonsus. 1992. Manajemen Agribisnis. Penerbit Erlangga. 278 halaman Hanafsiah, A.M. saefudin. 1983. Tata Niaga Hasil Perikanan, Universitas Indonesia. Jakarta, 208 hal. Hermanto, S., 1979. Pengembangan Sisitem Pemasaran Untuk Menekan Peningkatan Harga Ikan Sampai ke Tingkat Konsumen. Dalam Pusat Agro ekonomi. Departemen Pertanian, Jakarta. Hal 181 – 184. Hidayat, 1987. Peranan dan Profil Serta Prospek Perdagangan Eceran (Formal dan Informal) dalam Pembangunan, hal. 3-18. Dalam Prisma No. 7 tahun XVI LP3ES. Kasry.A., 2003. Manajemen Sumberdaya Perairan dalam Pengantar Perikanan dan Ilmu Kelautan. Feliatra dan I. Syofyan. Fakultas Perikanan dan Ilmu Kelautan Universitas Riau. Universitas Raiau Press. 75 hal.

Malik, B.A., 1998. Prospek Pembangunan Perikanan di Daerah Riau, hal 158 – 185. dalam Feliatra (editor) Strategi Pembangunan Perikanan dan Kelautan Nasional Dalam Meningkatkan Devisa Negara. Universitar Riau Press, Pekanbaru Manulang, 1980. Pengantar Ekonomi Perusahaan. Ghalia Indonesia, Jakarta. 221 hal. Murniyati, A. S dan Sunarman., 2000. Pendinginan, Pengawetan dan Pembekuan. Penerbit Kanisius, yogyakarta. 220 hal. Moeljanto., 1992. Pengawetan dan Pengolahan Hasil Perikanan. Penerbit Swadaya, Jakarta. 259 hal. Mubyarto. 1997. Nelayan dan Kemiskinan. Studi Ekonomi di Dua Kelurahan Pantai. C.V. Rajawali. Jakarta. 195 hal. Nurdin , S. 1998. Kumpulan Bahan-bahan Kuliah Manejemen Sumberdaya Perairan. Pekanbaru. 56 hal (tdk diterbitkan) Nurdin. S dan M. ahmad., 1982. Jarring Insang di Riau. Diktat Kuliah Tekhnologi Penangkapan Ikan. Seri I. Fakultas Perikanan. Pekenbaru. 43 hal (tidak diterbitkan). Sadhori. N., 1984. Teknik Penangkapan Ikan. Angkasa. Bandung. 488 hal. Satwiko., 1984. Prospek Pembangunan Indonesia. Makalah pada Symposium Perikanan Indonesia Tahun 2000. Menciptakan Perikanan Tangguh. Fakultas Perikanan Universitas Riau Pekanbaru. 31 hal. Siagian, M. 2004. Diktat Ekologi Perairan. Pekanbaru. 77 hal (tdk diterbitkan) Sitepoe. 1997. Air Untuk Kehidupan. Jakarta : PT. Grasindo Swingle. A. S. 1968. Standardization of Chemical and Analisys for Water and Pond Muds. FAO World a Symposium on Warm Water Pond Fish Culture. Fishery Report 44 (4) 397-421 pp. Syamsuddin, A. R., 1980. Pengantar Perikanan. Karya Nusantara. Jakarta.58 halaman. Wardoyo, S. T. 1981. Kriteria Kualitas Air untuk Keperluan Pertanian dan Perikanan. Trainning Analisa Dampak lingkungan PDLH-UNDP-PUSDI-PSL dan IPB Bogor 40 hal (tidak diterbitkan). Diposkan oleh iptek di 08:27 0 komentar Label: iptek

LAPORAN BIOLA
I. PENDAHULUAN

1.1. Latar Belakang Secara geografi Indonesia merupakan suatu Negara kepulauan dengan kekayaan sumber daya alam laut yang berpotensi untuk dimanfaatkan secara lestari. Sumber daya alam laut tersebut antara lain terdiri atas berbagai jenis ikan, moluska,dan krustase. Masyarakat pesisir sejak lama telah memanfaatkan sumber daya alam laut tersebut sebagai sumber makanan, mineral, obatobatan, dan energi (Gordon 2000,South & Skelton 2000). Lautan di dunia merupakan kesatuan ekosistem dimana serangkaian komunitas dapat mempengaruhi faktor-faktor fisik dan kimia air laut di sekelilingnya. Ekosistem yang besar ini dapat dibagi menjadi daerah-daerah kecil dimana parameter fisika dan kimia mempunyai pengaruh yang berbeda terhadap populasi dari daerah tersebut (Nybakken, 1998). Laut, seperti halnya daratan, dihuni oleh biota, yakni tumbuhan-tumbuhan hewan dan mikroorganisme hidup. Biota Laut menghuni hampir semua bagian laut, mulai dari pantai permukaan laut sampai dasar laut yang terjeluk sekalipun. Keberadaan biota laut ini sangat menarik perhatian manusia, bukan saja karena kehidupannya yang penuh rahasia, tetapi juga karena manfaatnya yang besar bagi kehidupan manusia. Pemanfaatan biota laut yang makin hari makin meningkat dibarengi oleh kemajuan pengetahuan tentang kehidupan biota laut yang tertampung dalam ilmu pengetahuan alam laut yang dinamakan biologilaut (marine biology). Biologi laut, yakni ilmu pengetahuan tentang kehidupan biota laut, berkembang begitu cepat untuk mengungkap rahasia kehidupan berbagai jenis biota laut yang jumlah jenisnya luar biasa besarnya dan keanekaragaman jenisnya luar biasa tingginya.Tingginya, keanekaragaman jenis biota di laut barangkali hanya dapat ditandingi oleh keanekaragaman jenis biota di hutan hujan tropik di darat. Tidak kurang dari 833 jenis tumbuh-tumbuhan dilaut (alga, lamun dan mangrove), 910 jenis karang (Coelenterata), 850 jenis spon (Porifera), 2500 jenis kerang dan keong (Mollusca), 1502 jenis udang dan kepiting (Crustacea), 745 hewan berkulit duri ( Echinodermata), 2000 jenis ikan ( Pisces), 148 jenis burung laut (Aves), dan 30 jenis hewan menyusui (Mammalia), diketahui hidup di laut. Di samping itu tercatat juga tujuh jenis penyu dan tiga jenis buaya (Reptilia). ((Romimohtarto, 2005) Laut adalah bagian dari bumi kita yang tertutup oleh air asin. Kata laut sudah dikenal sejak dulu kala oleh bangsa kita dan bahkan oleh bangsa-bangsa di beberapa Negara di Asia Tenggara. Laut lepas yang luas dibatasi oleh benua-benua kita kenal sebagai samudra. Secara ekologis terdapat fenomena dinamis seperti: abrasi, akresi, erosi, deposisi dan intrusi air laut. Di samping itu, masih terdapat juga fenomena nonalamiah seperti: pembabatan hutan mangrove untuk pertambakan, pembangunan dermaga/jetty untuk pendaratan ikan dan reklamasi pantai. Gejala yang umum terjadi di wilayah kepesisiran adalah interaksi faktor alam dan aktivitas manusia secara bersamaan, sebagai penyebab adanya ketidakseimbangan siklus biogeokimia (Cook dan Doornkamp, 1990). Untuk itu dengan berkembangnya ilmu pengetahuan dan tekonologi manusia mulai menyadari pentingnya laut dan potensi sumber daya di dlamnya. Birowo (1991), mengemukakan bahwa laut bermanfaat sebagai sumber atau media seperti sebagai pangan, transportasi, sumber mineral, bahan baku, industri, bahari, tambang, pertahanan dan keamanan, sumber energi, pemukiman, pariwisata dan tempat limbah. 1.2. Tujuan Dengan dilaksanakannya praktikum lapangan tersebut, diharapkan mahasiswa tidak hanya dapat mengenal berbagai objek studi dalam mata kuliah Biologi Laut tersebut secara teoritis (baik

morfologi maupun anatominya) tetapi juga secara langsung (melalui identifikasi langsung). Ditambah juga dapat mengenal habitat dan kebiasaan hidup objek tersebut di alam. Ini sangat penting, mengingat dalam penelitian akhir mahasiswa dituntut mampu melakukan berbagai prosedur penelitian secara mandiri. 1.3. Manfaat Manfaat praktikum adalah untuk menambah pengetahuan dan wawasan praktikan, untuk mendapatkan data dan informasi mengenai organisme laut terutama yang hidup di daerah pantai.

II. TINJAUAN PUSTAKA Biologi laut yakni ilmu pengetahuan tentang kehidupan biota laut, berkembang begitu cepat yang mengungkap kehidupan berbagai jenis biota laut yang jumlah dan jenisnya cukup banyak. Tingginya keanekaragaman jenis biota laut hanya dapat ditandingi oleh keanekaragman jenis biota di hutan hujan tropik di darat. (Romimohtarto, 2005). 2.1 Daerah Intertidal atau Litoral Menurut J. C. Bribbs (1974) zona interdal atau zona litoral adalah daerah kawasan pantai yang terletak antara pasang laut tertinggi dan pasang surut terendah. Litoral adalah daerah yang terletak diantara daratan dan lautan yang masih dipengaruhi oleh air pasang yang dikenal sebagai pantai laut (sea shore). Pantai laut ini bentuknya bermacam-macam. Pada beberapa tempat ada lereng pantainya membentuk landai di sini terdapat jarak yang besar antara tanda-tanda air pasang tertinggi dan air pasang terendah. Selain bentuk landai ini ada juga lereng panytainya yang berbentuk curam. Pada pantai yang demikian tanda-tanda air pasangnya akan kelihatan saling berdekatan. Pada daerah pantai yang terdiri dari pasir atau kerikil yang berssih daerah intertidalnya (daerah pasang surut) dapat mendukung sejumlah besar dan berjenis-jenis organisme. Contohnya : pantai yang terdiri dari batu-batuan (rocky shore) merupakan tempat yang sangat baik untuk hewanhewan atau tumbuh-tumbuha yang dapat menepel diri pada batu-batuan yang ada. Organisme yang dapat hidup pada areal ini adalah gastropoda, mollusca dan tumbuhan rumput laut. Daerah pantai ini kaya akan jenis-jenis organisme, namun demikian kehidupan di pantai ini mengalami beberapa masalah, diantaranya organisme yang ada harus dapat menyesuaikan diri atau menghindar dengan membuat lobang atau membenamkan diri dalam keadaan bahaya akibat kuatnya sinar matahari pada waktu air surut. 2.2 Organisme Epifauna dan Infauna Epifauna adalah semua hewan yang hidup di atas substrat dasar lautan atau perairan, misalnya kepiting, siput laut, bintang laut, timun laut, dll. Infauna adalah semua hewan yang hidupnya di bawah substrat yaitu dengan cara menggali lubang atau membenamkan diri pada substrat dasar lautan (perairan), misalnya cacing, tiram, remis, bivalva, dll. Odum (1971) menyatakan bahwa perkembangan maksimum dari epifauna dijumpai di daerah pasang surut, tetapi dapat juga meluas di daearah yang lebih dalam. Sedangkan infauna mencapai perkembangan yang maksimum di daerah yang lebih dalam dari epifauna. in-fauna yaitu yang

hidup didalam sedimen; dan epi-fauna yaitu yang hidup menempel pada daun-daun/ rumput laut dan di atas dasar laut. 2.3 Organisme Bentik Komunitas fauna bentik terdiri dari lima kelompok, yaitu Mollusca, Polychaeta, Crustacea, Echinodermata dan kelompok lain yang terdiri dari beberapa takson kecil Sipunculidae (owakowak ), Pognophora dan lain-lain. 2.4. Fungia danai Fungia danai adalah pertapa karang, sering ditemukan dengan diameter melebihi kaki yang melintasi. Fungia yang dirancang unik, berbentuk kubah sedikit alami yang mungkin ada "peot" atau dilipat ujungnya. Semua pada umumnya cembung di atas dan agak cekung di bagian bawah. Sebagian besar ditemukan pada puing-tercakup dalam air dangkal. Berwarna dalam hampir setiap warna cerah dari pelangi,. fungia ada polyps yang biasanya tetap sepanjang hari di alam, baru memberi makan pada malam hari. Polyps memperpanjang secara acak (Chadwick, Nanette, 1988). Gerakan Fungia danai biasanya phototaxic, artinya mereka bergerak menuju cahaya. Hal ini tampaknya menjadi perilaku adaptif karena photosynthetic dan memerlukan cahaya. Kemampuan luar biasa untuk gerakan tidak diakhiri dengan sederhana (Eric Hugo@aol.com) 2.5. Nerita costata Nerita costata adalah bahasa Yunani yaitu Nereites atau nerites adalah kata siput laut dari berbagai jenis. Costata berasal dari bahasa Latin kata Costa, memiliki tampilan ribs, atau tulang rusuk. Nerita costata tumbuh dengan panjang antara 20 - 35 mm.. Di luar bibir dan ujung yang tajam (Wilson, B. 1993). Inner lip dari sel telah membuka gundukan disebut gigi kuat, dengan satu besar satu di belakang akhir Yang abu-abu atau hijau operculum yang ditandai dengan sangat halus granules.dan operculum berfungsi mencegah kehilangan air. Sel adalah puntul eksterior hitam, dengan garisgaris putih ke kuning antara ribs. Sel interior adalah putih.

2.6. Scylla serrata Scylla serrata hidup pada daerah berlumpur, mangrove marshes, dan di mulut sungai estuarine lingkungan (Motoh 1979). Spesies ini asli dengan Indo-Pasifik dan telah diperkenalkan ke Florida, Hawaii, dan di tempat lain, paling sering sengaja dalam upaya untuk membentuk populasi ini spesies komersial penting. Studi menunjukkan Scylla serrata dewasa menjadi reproductively mulai dari sekitar 90 mm carapace lebar, sering dalam tahun pertama kehidupan (Robertson dan Kruger 1994, Knuckey 1996) Pada molting, laki-laki perempuan lebih menghidupkan dan melakukan persetubuhan, pengiriman spermatozoa non-mobil yang dapat disimpan oleh perempuan sampai ke beberapa bulan ke bulan sebelum digunakan untuk membuahi beberapa kuku-kuku sampai dengan 2 juta telur (Chen 1976).

III. METODE PRAKTIKUM

3. 1. Waktu dan Tempat Pratikum lapangan biologi laut ini telah dilaksanakan pada tanggal 18 Mei di pantai Cerocok Painan Sumatera Barat. 3. 2. Bahan dan Alat Peralatan yang digunakan dalam praktikum biologi laut ini adalah jaring untuk menangkap biota laut, formalin untuk mengawetkan biota yang tertangkap, kamera untuk mendokumentasikan kegiatan serta gambar biota laut, plastik untuk tempat biota laut, alat-alat tulis untuk mencatat hasil tangkapan. 3. 3. Metode Praktikum Metode praktikum yang digunakan adalah metode survey yaitu melakukan pengamatan atau mencari langsung biota laut ke lokasi yang ditentukan. 3.4. Prosedur Praktikum Adapun prosedur praktikum ini adalah praktikan langsung turun ke lokasi yang telah ditentukan. Secara kelompok mencari dan mengumpulkan organisme laut yang memungkinkan dapat diambil dan diamati. Khususnya yang berukuran makro. Semua hasil biota laut yang diperoleh kemudian dimasukkan ke dalam plastik dan diberikan formalin secukupnya untuk mengawetkan biota laut.

IV. HASIL DAN PEMBAHASAN 4.1. Hasil Melalui identifikasi yang dilakukan di laboratoium ekologi perairan, didapatkan hasil organisme sebagai berikut : 4.1.1. Morula granulata Klasifikasi Phylum : Molusca Class : Gastropoda Ordo : Neogastropoda Family : Thaididae Genus : Morula Spesies : Morula granulata MORFOLOGI Morula granulata adakah seekor keong ditutupi oleh spiral-spiral dari benjolan- benjolan disekililig kulitnya . Seekor keong dewasa memiliki sebuah bibir luar yang tebal yang terus

menerus hitam, coklat atau hitam margarine. Morala mengalami pertumbuhan sekitar 15 mm, dan melekat pada batu- batu yang basah ditempat yang rendah dan terbuka. 4.1.2. Holothuria marmonata Klasifikasi Phylum : Echinodermata Class : Thaepicea Ordo : Phyrosoma Family : Holothuridae Genus : Holothuria Spesies : Holothuria marmonata Morfologi Tubuh memanjang seperti ketimun yang sering disebut timun laut, mulut terdapat diujung dan yang satu lagu anus. Ada kaki tabung di tiga bagian ventral yang digunakan untuk berjalan dan mempunyai alat hisap seperti bintang laut. Tubuh seperti kulit dapat memanjang dan dapat mengkerut, sebagian besar teripang bernafas melalui pohon respirasi, sebuah alat bercabang terdiri dari banyak tabung. Dalam phylum Echinodermata terdapat berbagai kelas diantaranya kelas Crinoidea,kelas Echinodea, kelas Holothurioidae, kelas Ophiuroideayang semuanya berhabitat diair laut yang berpasir halus 4.1.3. Fungia danai Klasifikasi Phylum : Echinodermata Class : Anthozoa Ordo : Fungiadiae Genus : Fungia Spesies : Fungia danai Morfologi Tubuh berbentuk lingkaran, ditengah-tengah tubuhnya terdapat lekukan , tubuhnya tidak, hidupnya menempel dan warnanya bermacam-macam.

4.1.4. Nerita costata Klasifikasi Phylum : Molusca Class :Gastropoda Ordo : Caenogastropoda Famili : Neritidae Genus : Nerita Spesies : Nerita costata Morfologi Tubuhnya terdiri dari empat bagian utama yaitu: kepala, kaki, isi perut, dan mantel. Pada bagian

kepala terdapat dua mata ,dua tantakel, sebuah mulut,dan sebuah siphon. Tubuhnya yang lunak dilindungi oleh cangkang yang keras dan berwarna dasar coklat dan hijau tua. Nerita sp merupakan keong berukuran besar, cangkanya berbentuk membulat. Perputaran seluk (whort) berbentuk spiral yang jelas. Seluk akhir (bodywhort) berbentuklingkaran yang cembung dan membesar. 4.1.5. Scylla Serrata klasifikasi Phylum : arthropoda Kelas : crustacea Sub kelas : malacostraca Super ordo : eucarida Ordo : decapada Sub ordo : pleocyemata Famili : scylladae Genus : scylla Spesies : Scylla Serrata Morfologi Kepiting Bakau mempunyai bentuk karapas oval melebar, cembung pada kedua sisinya. karapas dibagian punggung sébelah atas dipenuhi oleh tonjolan – tonjolan seperti kutil dalam berbagai ukuran, sedangkan pada punggung bagian bawah terdapat tonjolan – tonjolan berbentuk lajur – lajur melintang yang memanjang dengan enam duri di bagian samping belakang( posterolateral). Kerapas lebih besar dari pada panjangnya sehingga bentuknya menyurupai telur. Panjang karapas sedikit lebih panjang dari setengah lebarnya pada bagian tepi dari karapas bentuknya agak melengkung, dengan lebih kurang terdapat 10 gigi kecil yang tersembunyi da bawah bulu pendek. Di bagian tepi belakang dari karapas pada jenis ini, terdapat bagian yang melebar seperti sayap yang menutupi sabagian besar kaki – kakinya dsan dilengkapi dengn 5 gigi, bergirigi disebelah atas, sedangkan di sébelah bawah tanpa duri atau gigi. 4.1.6. Torinia variegata klasifikasi Kelas : gastropoda Ordo : mesogatropoda Famili : areolteatonicidae Genus : torinia Spesies :Torinia variegata Morfologi Morfologi spesies Torinia variegata ini mudah dikenali, seperti jenis siput yang lain Torinia variegata juga mempunyai cangkang yang keras yang berpilin berguna sebagai rumah sekaligus sebagai pertahanan terhadap predator, mempunyai sepasang antena dan sepasang mata yang dapat disembunyikan, warnanya relatif terang perpaduan antara coklat dan putih. 4.1.7. Pisania striata

Klasifikasi Kelas : Gastropoda Sub kelas : Proso branchia Ordo : Neogastropoda Famili : Margellietae Genus : Pisania Spesies : Pisania striata Morfologi Pada dasarnya kelas gastropoda ini mempunyai bentuk pigmen yang sangat berbeda, yaitu dengan bentuk warna penampang cangkangnya seperti batik yang mempunyai dua sisi corak waena yaitu putih dan coklat, dan jenis gastropoda ini memiliki panjang antara 15-30 mm. Selain itu bentuk cangkangnya yang agak begitu runcing dan hampir mirip seperti bekicot. 4.1.8. Drupa morum Klasifikasi Pilum : Molusca Kelas : Gastropoda Ordo : Caenogastropoda Superfamili : Muricacae Famili : Muricidae Genus : Drupa Spesies : Drupa morum Morfologi Cangkang asimetris dan biasanya menggulung seperti ular memutar kekanan dan mempunyai bungkulanyang berwarna hitam, cangkang bagian dalam berwarna ungu, hanya memiliki satu buah insang, terdapat operculum yang terbuat dari zat kapur atau zat tanduk, garis-garis pada operculum kadang dapat menentukan umur, memiki kaki besar dan lebar untuk merayap dan mengeruk pasir dengan pergerakan yang cukup lamban. 4.1.9. Pinctada fucata Klasifikasi Filum : Molusca Kelas : Bivalva Famili : Petriidae Genus : Pinctada Species : Pinctada fucata Morfologi Tiram mutiara adalah salah satu dari molusca laut yang tertutup dua cangkang atau katup, digabungkan oleh perekat dari bahan serat laut, selama cangkang itu masih tumbuh, terbentuknya alur-alur yang jumlahnya menunjukkan umur molusca tersebut. Cangkang tersebut dapat

membuka (saat istirahat), namun dapat pula menutup dengan cepat dengan gerakan otot engsel yang kuat. Molusca memiliki insang sebagai alat pernafasan terdapat di rongga kaki. 4.1.10. Litorina scabra Klasifikasi Kelas : Gastropoda Ordo : Mesogosteropoda Famili : Litorinidae Genus : Litorina Spesies : Litorina scabra Morfologi Pada spesies jenis Litorina sp memiliki ciri morfologi yaitu warna cangkang ada dua jenis, yaitu berwarna merah tua dan ada juga yang berwarna kecoklatan, cangkang seperti kurucut. 4.1.11. Sacculina sp Klasifikasi Pilum : Artrhopoda Kelas : Entomostraca Ordo : Cirripedia Genus : Sacculina Spesie : Sacculina sp

4.2. Pembahasan Filum Molusca meliputi keong, tiram, cumi-cumi, gurita, sotong dan sebangsanya. Bentuknya simetri bilateral, tidak beruas, dan banyak diantara mereka mempunyai cangkang dari kapur. Tubuh biasanya pendek, terbungkus dalam mantel dorsal tipis yang mengeluarkan bahan pembentuk cangkang berupa satu, dua atau delapan bagian. Saluran pencernaan lengkap, sering berbentuk U atau melingkar. Mulut dengan radula yang mempunyai deretan-deretan gigi kitin kecil melintang. Sistem sirkulasi mencakup jantung sebelah punggung dengan satu atau dua aurikel atau rongga atas dan satu ventrikel atau rongga bawah. Pernapasan dilakukan oleh satu atau banyak insang yang disebut ctenidium. Ekskresi oleh ginjal yang disebut nefridia, terdiri dari satu atau dua atau hanya satu saja. ((Romimohtarto, 2005). Gastropoda adalah hewan berukuran relatif besar yang menarik. Pada kelas hewan ini terjadi reduksi menjadi satu ginjal, beberapa jenis hanya memiliki satu insang. Cangkang limpet tidak kelihatan mengulir, meskipun pada tingkat larva, cangkangnya ulir yang kemudian hilang setelah menjadi dewasa. Filum Echinodermata bentuk simetri meruji hanya terdapat pada dewasa, pada larva, bentuknya simetri bilateral. Arthropoda merupakan kelompok terbesar diantara seluruh dunia hewan. Namanya berasal dari kakinya yang bersendi. Sifat umum kelas ini mencakup kerangka luar keras dari kitin, yakni

polisakarida majemuk, suatu jenis karbohidrat. Cangkang ini dihasilkan oleh epidermis dan karena sifatnya yang tak elastis jika mengeras, ia harus ditanggalkan secara berkala untuk memungkinkan hewan tumbuh. Sifat umum yang terpenting yang berlaku untuk semua anggota kelompok Arthropoda dan khas filum ini ini ialah adanya embelan tubuh yang bersendi dan bebas dari bulu getar. Bentuk tubuhnya simetri bilateral dan tubuhnya terdiri dari ruas-ruas yang tersusun secara linier berurutan. 4.2.1. Morula granulata Keong laut (Morula granulata) dapat ditemukan di sekitar kolam. Batu karang yang datar dengan kedalaman dari intertidal hingga 5 kaki. Kebanyakan menumpuk pada batu gamping darat yang berada di aliran air lancar. Melekat pada batu-batu yang basah di temapat yang rendah dan terbuka secara sempurna. Salah satu sumber daya alam laut ialah keong laut darikelas Gastropoda. Daerah penyebaran keong laut terutama meliputi wilayah Indo-Pasifik termasuk Indonesia dan umumnya ditemukan hidup di perairan dangkal di daerah tropik (Robert et al. 1982). Keong laut memiliki kandungan asam lemak omega-3 dan omega 6 yang bermanfaat bagi perkembangan otak dan untuk mencegah penyakit jantung. Ada dua jenis asam lemak omega-3 yaitu docosahexaenoic acid (DHA) dan eiocosapentatonoicacid (EPA). (NaturalHub 2000). 4.2.2. Holothuria marmonata Di Indonesia banyak terdapat didaerah Manado, Pulau Bangka, Lampung, Kepulauan seribu dan Indonesia timur. Teripang adalah hewan avertebrata yang memilki bentuk dan jenis beraneka ragam dengan nama daerah yang berbeda-beda hidup dilaut dangkalyang berpasir halus dan ada juga dibatuan karang. Teripang (holothurians) adalah kelompok hewan invertebrata laut dari kelas Holothuroidea (Filum Echinodermata), tersebar luas di lingkungan laut (marine) diseluruh dunia, mulai dari zona pasang surut sampai laut dalam terutama di lautan India dan lautan Pasifik Barat. Tidak kurang sekitar 1250 jenis teripang telah didiskripsikan, dibedakan dalam enam bangsa (ordo) yaitu Dendrochirotida, Aspidochirotida, Dactylochirotida, Apodida, Molpadida, dan Elasipoda. Beberapa jenisnya hidup mebenamkan diri dalam pasir dan hanya menampakan tentakelnya. Sedang jenis-jenis teripang komersil biasanya hidup pada substrat pasir, substrat keras, substrat kricak karang dan substrat lumpur. Sekitar 25 jenis teripang berpotensi komersil diidentifikasikan berasal dari perairan karang di Indonesia (Darsono,1995). 4.2.3. Fungia danai Hidupnya didasar laut dan ada juga yang di air tawar hidupnya selalu menempel pada batubatuan dan biasanya berkelompok (koloni) dan berkembang biak sangat cepat. Dari sekian banyak atribut unik yang fungiids, termasuk fungia, mereka luar biasa adalah kemampuan terbatas untuk bergerak.. Melalui asymmetrical inflasi atau deflasi mereka di sel-sel jenis gerak peristaltik, fungia dapat bergerak di seluruh substrat. Hal ini terlihat pada gerakan yang maksimal hingga 30 cm per hari! Karena itu, ia mungkin tidak mengejutkan untuk menemukan fungia berlawanan sepenuhnya di samping akuarium. Karakteristik lain dari fungia yang cukup fenomenal adalah mantel lendir. Hal ini sangat berat, dan memungkinkan mereka dengan mudah dan cepat menolak sedimen didepositkan di atas permukaan.Tapi, yang adaptif kualitas lendir mantel mereka tidak berhenti dengan tugas yg sederhana.Berisi sejumlah besar nematocysts yang menggunakan karang tidak hanya dalam pertahanan, namun efektif untuk membantu dalam mengambil makanan dari plankton. 4.2.4. Nerita costata

Spesies ini banyak hidup di zona intertidal dan subtidal. Dan ada juga yang ditemukan pada hutan bakau dan sekitarnya, dibawah dan dibalik koral, terumbu karang, di pasir maupun lumpur. Banyak tersebar hampir diseluruh perairan Asia pasifik di Cina, Taiwán, Beijing, Australia, Meksiko, Indonesia, Philiphina dan lain- lain. Nerita costata sepertinya akan sedikit dibandingkan jenis lainnya nerite. Karena rentang yang terbatas hanya terjadi di pantai dan bersembunyi di balik batu pulau Great Barrier Reef di sepanjang pantai timur Queensland, dan nampaknya jarang seluruh nya jangkauan, dapat memiliki dampak yang terancam oleh minyak yang tumpah meluas. 4.2.5. Scylla Serrata Carapace yang memiliki empat tumpul frontal gigi dan setiap anterolateral margin telah sembilan berukuran hampir sama luas gigi. Claws yang kuat dengan, Kepiting besar ini dapat melebihi 18 cm lebar carapace. Scylla serrata adalah hewan karnivor, dideskripsikan sebagai aktif, agresif spesies dan beberapa derajat persaingan dengan rekan-spesies asli yang terjadi adalah kemungkinan besar. Scylla serrata adalah ekonomis penting karena keduanya yang liar-panen dan stok produk budidaya komersial dan komersial dipanen di tempat-tempat yang telah diperkenalkan dan sengaja didirikan di mana penduduk telah dihasilkan. (Samonte dan Agbayani 1992, Perry 2006). 4.2.6. Torinia variegata Hewan ini banyak ditemukan pada daerah pantai terutama pantai Afrika selatan dan Indonesia. 4.2.7. Pisania striata Untuk sebarannya gastropoda ini hidup pada perairan subtropis yang kaya akan bahan makanan, dan gstropod ini selalu bereproduksi tergantung pada keadaan kondisi lingkungan yang baik, tidak ada gangguan dari pengaruh lingkungan disekitarnya dan kondisi memungkinkan. 4.2.8. Drupa morum Terdapat pada daerah pantai berbatu, hidup dengan habitat dilingkungan yang cukup lembab, berpasir, maupun pada liang-liang yang gelap, banyak dijumpai disepanjang pantai Pasifik barat dan Samudra Hindia. 4.2.9. Pinctada fucata Pinctada fucata terdapat pada daerah yang memilki terumbu karang, dengan demikian Pinctada fucata terdapat seperti di negara Indonesia, Jepang, Amerika, Australia, dan lain sebagainya. Tiram biasanya simetri bilateral, mempunya cangkang setangkup dan sebuah mantel yang berupa dua daun telinga atau cuping. Tiram mempunyai dua cangkang di kedua sisi tubuh hewan. Karena cangkangnya ini disebut tangkup (valve) dan dua buah jumlahnya maka kelas ini dinamakan Bivalva. Bentuk cangkangnya digunakan untuk identifikasi. Sebagian besar hidup di laut, hanya sedikit yang hidup di darat. Sebagian besar mempunyai kelamin terpisah dan menyebar telur dan sperma ke air untuk pembuahan. 4.2.10. Littorina scabra Spesies ini hidup pada daerah estuaria, pada daerah yang tembus sinar matahari yang berpasir dan koral yang airnya jernih. Litorina scabra adalah Gastropoda yang terbanyak ditemukan. Mereka hidup di mintakat air pasang. Hewannya agak kecil dan tahpatzan kekeringan karena dapat menutup rapat cangkangnya dan menggunakan air didalamnya.

V. KESIMPULAN DAN SARAN 5.1. Kesimpulan Pengamatan yang telah dilakukan membuktikan bahwa lokasi penelitian yaitu pantai Painan, masih tergolong daerah yang kondisif untuk tinggal berbagai jenis makhluk laut terutama dari famili mollusca. Keanekaragaman yang tinggi dari biota yang ditemukan sekaligus menjadi pertimbangan kita tentang ekosistem seperti apa yang mampu menjadi pendukung kehidupan makhluk-makhluk laut itu dan perkembangannya. Dari hasil yang diperoleh pantai Painan juga sangat potensial untuk dijadikan tempat wisata dan penelitian mahasiswa. 5.2. Saran Dengan keterbatasan hasil yang diperoleh maka hasil praktikun ini belum bisa dijadikan referensi akhir mengenai biota pantai yang dapat di temukan di pantai-pantai Sumatera. Karenanya untuk memperkaya sampel biota laut ini diperlukan kegiatan serupa yang dilakukan di pantai lain di daerah Sumatera. Dan identifikasi biota yang didapatkan sebaiknya di identifikasi langsung dilapangan oleh setiap kelompok praktikum.

DAFTAR PUSTAKA Birowo, s. 1991. Pengantar Oseanografi dalam J. H. KUNARSO dan RUYITNO (eds). Status pencemaran laut di Indonesia dan teknik pemantauannnya. LIPI-Jakarta. Chadwick, Nanette.1988. Competition and locomotion in a free-living fungiid coral. J. Exp. Mar. Biol. Mar Biol. Ecol 123: 189-200. Chen TP 1976. Chen TP 1976. Aquaculture Practices In Taiwan.. Fishing News Books Limited, 1 Long Garden Walk, Farnham, Surrey, England., 162 p. 162 hal Cooke, R.U. and J.C. Doornkamp. 1990. Geomorphology in Environmental Management. 2nd ed. New York, USA: Oxford Univ. Press, inc. (Eric Hugo@aol.com) GordonAL.2000.―Ocean‖Discoverychannelschool.http://www.discoveryschool.com/homeworkh elp/worldbook/atozgeography/o/3987.html, diakses 10 Mei 2002. Motoh H. 1979. Motoh H. 1979. Edible crustaceans in the Philippines, 11th in a series. Edible crustaceans di Filipina,. Asian Aquaculture 2:5. Nybakken, j. W., 1988. Biologi Laut suatu pendekatan ekologis. Terjemahan penernit PT. Gramedia. Jakarta. Rimimohtartao, Kasijian. 2001, Biologi Laut, Pengetahuantentang biota laut, Djambatan, Jakarta. 540 hal Robert D, Soemodihardjo S, Kastoro W. 1982. Shallow Water Marine Molluscof North-West Java: Jakarta: Lembaga Oseanologi Nasional, LIPI.hlm 1-103. Samonte G.PB., dan RF Agbayani. 1992. Pond culture of mud crab ( Scylla serrata ) and economic analysis.SEAFDEC Asian Akuakultur 14:3-5. Wilson, B. (1993). Australian Marine Shells. Australia Marine Shells. V.1. V.1. p.40. p.40

Lampiran. 2. Gambar biota yang ditemukan

Sacculina sp Morula granulata Nerita costata

Drupa morum Fungia lanai Torina variegata

Scylla striata Holthurina marmonata Litorina scabra

Pinctada fucata Pisania striata Pinctada fucata Pisania striata

KATA PENGANTAR Segala puji bagi Allah SWT yang telah memberikan Rahmat dan Hidayah-Nya kepada saya, sehingga saya dapat menyelesaikan laporan ini dengan baik dan tepat pada waktu yang telah ditentukan. Shalawat dan salam kepada Rasulullah SAW yang telah menyelamatkan umat manusia dari alam kegelapan kealam yang di ridhoi Allah dan berilmu pendidikan seperti yang kita rasakan pada saat ini. Penulis mengucapkan terima kasih kepada teman-teman saya yang telah membantu saya dalam penulisan laporan ini. Semoga laporan ini dapat membantu pembaca dalam menambah referensi bacaan ataupun pengetahuan dalam bidang perikanan dan kelautan. Penulis mengharapkan saran dan kritik dari pembaca yang sifatnya membangun untuk kesempurnaan tulisan ilmiah ini. Pekanbaru, Mei 2009

ILHAM FAUZI M. SIREGAR Diposkan oleh iptek di 08:19 0 komentar

Kamis, 2009 Juni 18
IMAN
BERIMAN DAN BERAMAL SHALIH DENGAN SEBENARNYA Bagian Pertama dari Dua Tulisan [1/2]

Sarana yang paling agung yang merupakan sarana pokok dan dasar bagi tergapainya hidup bahagia ialah : beriman dan beramal shalih. Allah Azza wa Jalla berfirman: "Artinya : Barangsiapa yang mengerjakan amal shalih[1], baik laki-laki maupun perempuan, sedangkan ia beriman, maka sesungguhnya akan Kami karuniakan kepadanya kehidupan yang baik dan sesungguhnya akan Kami beri balasan kepada mereka dengan pahala yang lebih baik dari apa yang telah mereka lakukan." [An-Nahl: 97] Kepada orang yang memadukan antara iman dan amal shalih, Allah Ta‘ala memberitahukan dan menjanjikan kehidupan yang baik di dunia dan pahala yang baik di dunia dan akhirat. Sebabnya jelas. Karena, orang-orang yang beriman kepada Allah dengan iman yang benar lagi membuahkan amal shalih yang mampu memperbaiki hati, akhlak, urusan duniawi dan ukhrawi, mereka memiliki prinsip-prinsip mendasar dalam menyambut datangnya kesenangan dan kegembiraan, ataupun datangnya keguncangan, kegundahan dan kesedihan. Mereka menyambut segala hal yang menyenangkan dan menggembirakan dengan menerima, mensyukurinya dan mempergunakannya untuk seeuatu yang bermanfaat. Jika mereka menggunakannya demikian, maka niscaya hal itu akan melahirkan nilai-nilai agung di balik kegembiraan karenanya, pendambaan kelanggengan dan keberkahannya, dan keberharapan pahala seperti pahala yang diperoleh para hamba yang bersyukur. Nilai-nilai itu, dengan setumpuk buah dan keberkahannya, justru mengungguli wujud kegembiraan-kegembiraan itu, yang itupun bagian dari buahnya. Mereka hadapi cobaan, mara bahaya, kegundahan dan kesedihan dengan melawan apa yang mungkin dilawannya, menepis sedikit apa yang mungkin ditepis, dan bersabar terhadap apa yang harus terjadi tidak boleh tidak. Dengan demikian, dibalik cobaan cobaan itu lahirlah nilai-nilai agung berupa sikap melawan yang penuh arti, pengalaman dan kekuatan serta kesabaran dan ketulusan untuk hanya berharap pahala Ilahi. Dengan meletakkannya nilai-nilai agung itu di hati, kecillah di mata mereka aneka cobaan berat. Sedangkan yang bersemayam di hati justeru kesenangan, cita-cita mulia dan dambaan untuk menggapai karunia dan pahala dari Allah. Dalam hadits shahih, Rasulullah Shallallahu ‗alaihi wa sallam menggambarkan ini, beliau bersabda.

―Artinya : Sunnguh mengagumkan perihal mu‘min. Semua hal yang dialaminya adalah baik. Jika ia mendapat hal yang menyenangkan, ia bersyukur. Maka hal itu menjadi suatu kebaikan baginya. Jika ia tertimpa hal yang menyakitkan, ia bersabar. Maka hal itu menjadi suatu kebaikan baginya. Sifat itu tidak dimiliki siapapun kecuali oleh seorang mu‘min‖ [Imam Ahmad bin Hanbal, Al-Fathur Rabbani Lil Tartibi Musnadil Imam Ahmadabni Hanbal AS-Syaibani, Kitab Al-Qadar. Muslim, Shahih Muslim, Kitan Az-Zuhud Wa Ar-Raqaiq] Rasulullah menerangkan bahwa keberuntungan, nilai kebaikan dan buah prilaku mu‘min berlipat ganda pada saat mengalami kesenangan ataupun cobaan. Oleh sebab itu, bisa jadi anda jumpai dua orang yang sama-sama mengalami ujian berupa keberuntungan dan bencana. Namun, antara satu dan yang lain berbeda jauh dalam menghadapi ujian itu, sesuai dengan kadar iman dan amal shalih yang ada pada diri masing-masing. Orang yang beriman dan melakukan amal shalih menghadapi keberuntungan dengan rasa syukur dan sikap prilaku yang membuktikan kesungguhan syukur itu, dan menghadapi bencana dengan bersabar dan bersikap prilaku yang membuktikan kesungguhan kesabaran itu. Dengan demikian, hal itu dapat membuahkan di hatinya kesenangan kegembiraan dan hilangnya kegundahan, kesedihan, kegelisahan, kesempitan dada dan kesengsaraan hidup. Selanjutnya, kehidupan bahagia akan benar-benar menjadi realita baginya di dunia ini. Sedangkan yang lain menghadapi kesenangan hidup dengan kcongkakan, kesombongan dan sikap melampui batas. Lalu, melencenglah moralnya. Ia menyambut kesenangan hidup seperti halnya binatang yang menyambut kesenangan dengan serakah dan rakus. Seiring itu, hatinya tidak tenteram. Bahkan, hatinya bercerai berai oleh berbagai hal. Hatinya bercerai-berai oleh kekhawatirannya terhadap sirnanya segala kesenangan dan banyaknya benturan-benturan yang pada umumnya, muncul sebagai dampaknya. Harinya bercerai berai tak menentu, karena memang hasrat jiwa tidak mau berhenti pada suatu batas. Bahkan, terus gandrung kepada keinginan-keinginan lain, yang kadangkala dapat terwujud dan kadangkala tidak dapat terwujud. Andaikan di bayangkan dapat terwujud, ia pun tetap gelisah oleh hal-hal tadi. Ia pun menyambut cobaan yang sulit dengan rasa gelisah, keluh kesah, khawatir dan gusar. Tidak usah anda bertanya tentang dampak buruk dari itu semua, yang berupa kesengsaraan hidup, teridapnya penyakit jiwa maupun syaraf dan rasa kekhawatiran bercampur ketakutan yang bisa jadi, pada gilirannya akan menyeret ke kondisi yang paling buruk dan malapetaka yang paling mengerikan. Karena ia tidak mempunyai harapan pada pahala Ilahi dan tidak memiliki kesabaran yang mampu melipur hatinya dan meringankan beban yang dirasakannya.

[Disalin dari kitab Al-Wasailu Al-Mufidah Lil Hayatis Sa'idah, edisi Indonesia Dua Puluh Tiga Kiat Hidup Bahagia, Penulis Asy-Syaikh Abdur Rahman bin Nashir As-Sa'di, Penerjemah Rahmat Al-Arifin Muhammad bin Ma'ruf, Diterbitkan Kantor Atase Agama Kedutaan Besar Saudi Arabia Jakarta] _________ Foote Note [1] Ibnu Katsir, dalam Tafsiru l Qur'an-l Azhim, mengatakan : man 'amila shalihan, wa huwa al-

amalu-l-mutabi; li Kitabillahi Ta'ala wa sunnati Nabiyyihi Shallallahu 'alaihi wa sallam. Maksudnya, yaitu amal (perbuatan) yang mengikuti kitab Allah dan Sunnah Nabi-Nya Shallallahu 'alaihi wa sallam. [2] Yaitu keberuntungan dengan memperoleh pahalaNya dan keselamatan dari siksaNya (Taisiru-l-Mannan). Diposkan oleh iptek di 09:09 0 komentar Label: iptek

LAP. BAHAN BAKU IKAN
BAB I. PENDAHULUAN 1.1 Latar belakang Seiring dengan meningkatnya kesadaran masyarakat pada berbagai tingkat umur akan pentingnya kesehatan, meningkat pula kebutuhan akan asupan nutrisi seperti vitamin, mineral, serat, dan asam lemak. Sebagai refleksi dari kecenderungan tersebut, meningkat pula di dipasaran jenis produk baru dan produk-produk hasil pengembangan maupun produk-produk suplemen nutrisi. Produk-produk ini mengandung bahan-bahan tambahan yang memiliki pengaruh terhadap peningkatan kesehatan, sebagai contoh; produk sereal yang ditambahkan dengan vitamin dan mineral, roti dengan tambahan serat dan susu bayi dengan bahan tambahan asam amino dan asam linoleat. Jenis nutrien baru yang terbukti mempunyai manfaat tinggi bagi manusia adalah asam lemak tak jenuh ganda berantai panjang omega-3 yang berasal dari ikan laut. Telah dipasaran produkproduk yang diperkaya dengan minyak ikan yang didukung dengan hasil penelitian mengenai kegunaan asam lemak bagi kesehatan. Minyak ikan sangat mudah teroksidasi oleh karena banyaknya ikatan rangkap pada gugus rantai asam lemaknya. Hal ini berarti bahwa harus diberikan perhatian yang lebih apabila minyak ikan ditambahkan pada produk makanan, jika tidak akan menyebabkan timbulnya bau atau rasa yang tidak enak dan senyawa-senyawa hasil oksidasi yang berpengaruh buruk bagi kesehatan. Mikroenkapsulasi terhadap minyak ikan akan menghilangkan kendala-kendala tersebut yang memungkinkan para produsen makanan memasukkan minyak ikan bagi peningkatan nilai tambah produk tampak adanya perubahan penampakkan dan usia simpan produk. Hasil samping olahan dari industri produk perikanan cukup beragam, tetapi secara garis besar dapat dibedakan atas hasil samping dalam bentuk cair dan hasil samping dalam bentuk padat. Salah satu hasil samping olahan dalam bentuk cair adalah minyak ikan. Minyak ikan merupakan hasil samping dari pengolahan ikan kaleng dan tepung ikan. Minyak ikan tersebut dapat ditingkatkan mutunya agar layak dikonsumsi manusia dengan memurnikannya menggunakan metoda alkali. Minyak ikan memiliki nilai manfaat kesehatan/pengobatan dan gizi. Dengan demikian, minyak ikan dapat dimanfaatkan untuk keperluan industri farmasi dan pangan Masyarakat Indonesia termasuk bangsa yang sedikit mengkonsumsi ikan atau hasil olahannya. Saat ini tingkat konsumsi ikan nasional hanya 19 kg/kapita/tahun, lebih rendah dari Vietnam maupun Malaysia yang tingkat konsumsinya mencapai 33 kg/kapita/tahun. Tahun depan diupayakan tercapai target konsumsi 23kg/kapita/tahun. Salah satu kemungkinan penyebab rendahnya tingkat konsumsi itu adalah minimnya keragaman

hasil olahan ikan yang memiliki daya tarik bagi konsumen lintas usia, suku, dan tingkat sosial. Disamping dipasarkan dalam bentuk segar, ikan juga dipasarkan dalam bentuk produk olahan. Produk olahan ikan khas Indonesia yang telah terindustrialisasi dengan mapan saat ini tercatat meliputi kerupuk, ikan asin, terasi, pindang, peda, minyak ikan dan beberapa yang lain, yang daya tariknya bagi konsumen anak-anak relatif rendah. Barangkali diantara produk tersebut hanya kerupuk yang mudah diterima konsumen anak-anak. Dengan introduksi produk nugget, ikan mulai luas dikonsumsi masyarakat konsumen. 1.2 Tujuan Penulisan makalah ini bertujuan untuk mempelajari, pengertian, cara pembuatan, manfaat, tantangan, dan strategi pengembangan industri pengolahan minyak ikan khususnya di Indonesia

BAB. II. TINJAUAN PUSTAKA

Minyak ikan dapat diolah menjadi kapsul konsentrat asam lemak omega-3. Dengan teknik mikroenkapsulasi, minyak ikan dapat diproses menjadi tepung minyak ikan yang memudahkan di dalam penanganan, penyimpanan dan pemanfaatannya (Irianto dan Giyatmi, 2003). Tepung minyak ikan digunakan sebagai ingredien pada berbagai produk makanan, seperti roti, makanan bayi, soup, fruit/health bars dan frozen pizza (Andersen, 1995), serta susu untuk ibu hamil. Pemanfaatan minyak ikan di dalam industri pangan dengan tujuan untuk pengganti fungsi minyak nabati/lemak hewani dan memperkaya nilai gizi makanan dalam rangka mendapatkan makanan sehat. Untuk maksud tersebut, minyak ikan dikembangkan pemakaiannya pada produk margarine dan table spread, hard fat, shortening, pastry fat, adonan biskuit, lemak dan emulsi untuk roti, adonan roti, minyak goreng, biscuit filling, minyak salad/sayur, emulsifier, fish spread, peanut butter, mayonaise, coleslaw, yoghurt, salami dan sosis (Bimbo, 1989; Barlow et al 1990) Selain dari badan ikan, minyak ikan juga dapat dihasilkan dari organ hati ikan, terutama hati ikan hiu. Minyak hati ikan hiu, di samping memiliki kandungan skualen yang tinggi juga dapat dipakai sebagai sumber vitamin A dan D yang banyak diperlukan untuk memenuhi kebutuhan vitamin manusia Minyak ikan termasuk senyawa lipida yang bersifat tidak larut dalam air (Winarno, 1995 dalam Purbosari, 1999). Minyak ikan ini dibagi dalam dua golongan, yaitu minyak hati ikan (fish liver oil) yang terutama dimanfaatkan sebagai sumber vitamin A dan D, dan golongan lainnya adalah minyak tubuh ikan (body oil) seperti halnya minyak ikan lemuru (Moeljanto,1982) Minyak ikan lemuru mengandung asam lemak berikatan rangkap, misalnya Eicosa Pentanoat Acid (EPA), dan Deocosa Hexaenoat Acid (DHA), dengan nama populernya asam lemak omega3( Purbosari, 1999). Sifat minyak ikan yang telah dimurnikan secara organoleptik, yaitu cairan yang berwarna kuning muda, jernih dan berbau khas minyak ikan. Sifat fisiknya berbentuk cair dengan berat jenis

sekitar 0,92 gr/ml dan sifatnya yaitu angka iod lebih dari 65 gr/100 gr, angka penyabunaan 185195 mg/gr, asam lemak bebas 0,1-13 %, dan angka tidak tersabunkan 0,5-2,0 mg/gr.(Murtini et al., 1992 dalam Purbosari, 1999). Minyak ikan yang diperoleh sebagai hasil samping dari pengolahan tepung ikan dan ikan kaleng sering banyak mengandung banyak kotoran. kotoran pada minyak ikan dapat dikelompokan menjadi tiga, yaitu pertama adalah kotoran yang tidak larut dalam minyak (kotoran fisik, air dan protein), kedua adalah kotoran yang berbentuk susupensi koloid dalam minyak (fosfatida dan karbohidrat) dan ketiga adalah kotoran yang terlarut dalam (asam lemak bebas, pigmen, mono dan digliserida, senyawa hasil oksidasi, logam dan bahan-bahan yang tak tersabunkan (Irianto,2002). Menurut Kayama (1990), asam lemak tidak jenuh pada minyak ikan umumnya mempunyai panjang rantai karbon antara C12 (lauric acid) sampai C24 (lignoceric acid) dan pada beberapa minyak ikan didapat sedikit C8 dan C10. Panjang rantai karbon asam lemak tak jenuh umumnya berkisar antara C14 sampai C22. Secara keseluruhan, komposisi utama minyak ikan adalah trigliserida, sedangkan komposisi lainnya adalah fosfolipida, lemak dengan group eter dan wax ester (Singh dan Chandra, 1988). Senyawa lain yang terdapat pada minyak ikan adalah sterol, vitamin dan pigmen (Standsby, 1982).

BAB. III. PEMBAHASAN

3.1. Pengertian minyak ikan Minyak ikan adalah salah satu zat gizi yang mengandung asam lemak kaya manfaat itu, karena mengandung sekitar 25% asam lemak jenuh dan 75% asam lemak tidak jenuh. Asam lemak tak jenuh ganda (polyunsaturated fatty acid/PUFA ) di dalamnya akan membantu proses tumbuhkembang otak (kecerdasan), serta perkembangan indera penglihatan dan sistem kekebalan tubuh bayi dan balita. Minyak ikan sangat berbeda dengan minyak lainnya, yang dicirikan dengan : variasi asam lemaknya lebih tinggi dibandingkan dengan minyak atau lemak lainnya, jumlah asam lemaknya lebih banyak, panjang rantai karbon mencapai 20 atau 22, lebih banyak mengandung jenis asam lemak tak jenuh jamak (ikatan rangkap sampai dengan 5 dan 6), dan lebih banyak mengandung jenis omega-3 dibandingkan dengan omega-6. Walaupun tergolong keluarga minyak-minyakan, minyak ikan bukan untuk menggoreng namun merupakan ―makanan‖ tambahan sumber zat gizi. Bahkan, minyak ikan termasuk bahan makanan sumber lemak yang rendah kolesterol, sehingga para ahli gizi dan kesehatan sepakat

untuk memberikan label ―aman‖ untuk dikonsumsi oleh bayi, balita, maupun orang dewasa. Minyak ikan sangat mudah teroksidasi oleh karena banyaknya ikatan rangkap pada gugus rantai asam lemaknya. Hal ini berarti bahwa harus diberikan perhatian yang lebih apabila minyak ikan ditambahkan pada produk makanan, jika tidak akan menyebabkan timbulnya bau atau rasa yang tidak enak dan senyawa-senyawa hasil oksidasi yang berpengaruh buruk bagi kesehatan. Perlakuan terhadap minyak ikan yang dapat menghilangkan kendala-kendala tersebut yang memungkinkan para produsen makanan memasukkan minyak ikan bagi peningkatan nilai tambah produk tampak adanya perubahan penampakkan dan usia simpan produk Asam lemak yang berasal dari ikan pada prinsipnya ada 3 jenis yaitu jenuh, tidak jenuh tunggal dan tidak jenuh jamak. Asam lemak tak jenuh tunggal mengandung satu ikatan rangkap dan asam lemak tak jenuh jamak mengandung banyak ikatan rangkap per molekul. Minyak ikan juga mengandung vitamin A dan D –dua jenis vitamin yang larut dalam lemak– dalam jumlah tinggi. Manfaat vitamin A membantu proses perkembangan mata, sementara vitamin D untuk proses pertumbuhan dan pembentukan tulang yang kuat. Nah, kadar kedua vitamin ini dalam tubuh ikan akan meningkat sejalan dengan bertambah umurnya. Minyak ikan mempunyai pengaruh yang lebih cepat dibanding dengan makan ikan. Namun demikian, beberapa manfaat makan ikan terhadap beberapa penyakit tidak dapat diperoleh dengan mengkonsumsi minyak ikan. Bagi penderita tekanan darah tinggi misalnya, akan lebih berman-faat makan ikan daripada minyak ikan karena penurunan tekanan darah disebab¬kan oleh tingginya proporsi DHA dan EPA. Ikan lebih banyak mengandung DHA dan EPA dibandingkan minyak ikan Berbeda dengan golongan minyak yang lain, minyak yang berasal dari suplemen minyak ikan tidak digunakan untuk menggoreng makanan melainkan merupakan asupan minyak essential yang mengandung banyak nutrisi penting yang dibutuhkan oleh tubuh manusia.

3.2. Proses pembuatan minyak ikan Minyak ikan diperoleh dengan cara ekstraki. Ekstraksi minyak adalah suatu cara untuk mendapatkan minyak atau lemak dari bahan. Cara ekstraksi yang biasa dilakukan, yaitu metode ekstraksi dengan aseton, metode ekstraksi dengan hidrolisa, metode Dry Rendering, metode Wet Rendering dan ekstraksi dengan silase. Pada praktikum minyak ikan dilakukan metode Wet Rendering, yaitu proses yang umumnya digunakan untuk membuat tepung ikan. Tahap proses ini meliputi kombinasi pemasakan dan pengeringan dengan mengguanakan uap panas pada keadaan hampa. Pengadukan secara lambat dilakukan selama pengeringan tepung ikan dan dilakukan pengepresan untuk memisahkan tepung dan minyak ikan. Bahan baku industri minyak ikan adalah minyak ikan dari ikan-ikan pelagis dengan kadar lemak yang tinggi. Sumber minyak ikan tersebut dapat dari : a. Hasil ekstraksi yang khusus untuk diambil minyaknya b. Hasil ekstraksi dari pengolahan tepung ikan c. Hasil samping dari pengolahan ikan kaleng Ketiga sumber pasokan tersebut dapat digunakan namun akan mempengaruhi kepada mutu minyak, harga bahan baku, dan jumlah ketersediaan pasokan. Untuk menanggulangi kemungkinan kekurangan pasokan bahan baku maka perhitungan jumlah ketersediaan pasokan tidak hanya berasal dari domestik tetapi juga berasal dari luar negeri (import).

Penanganan Bahan Mentah Ikan setelah ditangkap, diambil hatinya, cuci dengan air laut, kemudian masukkan kedalam kantong plastik. Kantong-kantong plastik itu kemudian dimasukkan kedalam peti berinsulasi dan dies dengan menggunakan es hancuran yang perbandingannya 1 : 1. Pengesan ini dilakukan selama penangkapan hingga saat hati ikan tersehut diekstraksi minyaknya.Untuk memperoleh minyak, maka dilakukan ekstraksi dengan mencampur hati cucut botol dengan asam formiat teknis sebanyak 1% dari berat hati cucut botol (proses silase). Setelah 3 hail proses silase, kemudian dilakukan penyaringan hasil silase melalui kain blacu untuk memperoleh minyak kasar. Setelah itu dilakukan pemurniaan minyak ikan. Tahapan-tahapan pemurnian minyak ikan, yaitu a. Penyaringan, b. Degumming, c. Nertlasisasi, d. Pemisahan sabun, e. Pemucatan dan Deodorisasi Tujuan dari pemurnian minyak ikan adalah untuk menghilangkan rasa dan bau yang tidak enak, warna yang tidak menarik, dan memperpanjang masa simpan minyak sebelum dikonsumsi dan digunakan sebagi bahan mentah dalam industri. Kualitas minyak ikan yang dihasilkan pada proses pemurnian tergantung pada cara penyimpanan dan penanganan ikan sebelum dimurnikan Pada tahap penyaringan, minyak ikan yang diperoleh sebagai hasil damping pengolahan tepung ikan atau ikan kaleng disaring terlebih dahulu dengan penyaring kawat untuk memisahkan kotoran-kotoran visual seperti sisa daging dan gumpalan protein. Minyak yang telah bebas dari kotoran visual ditentukan kandungan asam lemak bebasnya (free fatty acid/FFA). Deguming merupakan proses pemisahan getah dan lender yang terdiri Dri fosfatida, protein, residu karbohidrat, air, dan resin tanpa mengurangi jumlah asam lemak bebas dalam minyak Degumming dilakukan dengan penambahan NaCl 8% kedalam minyak ikan pada suhu 60oC selama 15 menit. Larutan NaCl yang ditambahkan sebanyak 40% dari volume minyak yang dimurnikan dan selama degumming dilakukan pengadukan atau proeses degumming juga dapat dilakukan dengan menambahkan NaOH 2-3% air atau larutan NaCl, atau menambahkan larutan firofosfatida pada minyak, kemudian disentrifugas pada suhu 30-50oC. Getah fosfatida akan terpidahkan pada sentrifuse sebanyak 3,5% dari minyak asal. Netralisasi adalah suatu prosesuntuk memisahkan asam lemak bebas dari mynak atau lemak dengan cara mereaksikan asam lemak bebas dengan basa atau pereaksi lainnya sehingga membentuk sabun (soap stoc) Netralisasi dilakukan dengan menambahkan larutan NaOH 1N ke dalam minyak yang sudah mengalami proses degumming. LArutan NaOH 1N ditambahkan dalam minyak ikan pada suhu 60oC selama 15 menit. Jumlah NaOH yang ditambahkan ditentukan dengan rumus sebagai berikut: %NaOH = %FFA x 0,142 Sedangkan menurut Windsor dan Barlow (1981) dalam Purbosari (1999), proses netralisasi dilakukan dengan menambahkan larutan alkali atau pereaksi lainnya untuk membebaskan asm lemak bebas dengan mempentuksabun dan membantuk mengkoagulasikan bahan-bahan yang tidak diiingainkan. Penambahan larutan alkali ke dalam minyak mentah akan menyebabkan reaksi kimia maupun fisik (Stansbay, 1990 ) yaitu :

a. Alkali akan bereaksi denag asam lemak bebas dan membantu sabun. b. Gum menyerap air dan menggumpal melaliu reksi hidrasi. c. Bahan-bahan warna terdegradasi, terserap oleh gum atau larutan oleh alkali. d. Bahan-bahan yang tidak terlatur yang terdapat dalam minyak akan menggumpal. Faktor –faktor yang mempengaruhi proses netralisasi adalah konsentrasi alkali, suhu, pengadukan dan pencucian. Selanjutnya minyak yang telah dinetralkan dibiarkan beberapa saat supaya terjadi pemisahan sabun yang terbentuk. Lapisan sabun berada pada lapisan bawah dan lapisan minyak pada bagian bawah. Kemudian sabun tersebut diambil. Untuk menghilangkan sabun-sabun yang masih tersisa, pada minyak ikan ditambahkan air panas sambil diaduk dan kemudian dibiarkan supaya terjadi pemisahan minyak dan air. Setelah itu air yang terpisah dibuang (Irianto, 2002). Pemucatan ialah suatu proses pemurnian minyak yang bertujuan untuk menghilangkan atau memucatkan warna yang tidak disukai dan menghilangkan getah (gum) yang ada dalam minyak (Windsor dan Barlow, 1981 dalam Charita, 1995). Pemucatan dilakukan dengan penambahan adsorben, umumnya dilakukan dalam ketele yang dilengkapi dengan pipa uap dan alat penghampa udara. Minyak dipanaskan pada suhu 105oC selam 1 jam. Adsorban ditambahkan saat minyak mencapai suhu 70-80 oC sebanyak 1-1,5% dari berat minyak. Selain warna, diserap pula suspensi koloid dan hasil degradasi minyak seperti peroksida (Irianto, 2002). Faktor yang mempengaruhi pemucatan adalah suhu, waktu, tekanan. Deodorasai adalah suatu tahap proses pemurnian minyakyang bertujuan untuk menghilankan bau dan rasa yang tidak enak dalam minyak. Prinsip proses deodorasi, yaitu penyulinagan minyak dengan uap panas pada tekana atamosfer atau keadaan hampa. Proses deodorasi dilakukan dengan cara memompa minyak ke dalam ketelen deodorasi. Kemudian minyak tersebut dipanaskan pada suhu 200-250 oC pada tekanan 1 atmosfer dan selanjutnya pada tekanan rendah (kursng lebih 10 mmHg), sambil dialiri uap panas selama 4-6 jam untuk mengankut senyawa yang dapat menguap. Setelah proses deodorisasi selesai, minyak ikan kemudian didinginkan sehingga suhu menjadi kurang lebih 84 oC dan selanjutnya minyak ikan dikeluarkan (Irianto,2002). 3.3. Manfaat dan Peranan Minyak Ikan

Setelah mengetahui ikan mempunyai kandungan gizi sangat banyak, maka ikan perlu diperhitungkan sebagai sumber zat gizi yang penting. Pola kebiasaan makan ikan seperti pada masyarakat Eskimo dan Jepang memberi petunjuk kuat atas sangat rendahnya kejadian penyakit jantung dan penyakit degeneratif lainnya pada masyarakat tersebut Kebiasaan mengonsumsi minyak ikan menurut hasil beberapa penelitian memang memiliki khasiat bagi kesehatan khususnya jantung. Namun, ternyata tak hanya itu, mengonsumsi minyak yang kaya akan kandungan asam lemak omega-3 itu juga mampu membantu menghindari resiko gangguan penglihatan. Minyak ikan merupakan asupan yang mengandung banyak nutrisi penting yang dibutuhkan oleh tubuh manusia. Suplemen minyak ikan biasanya berasal dari ikan laut perairan dalam dan dingin yang diekstrak dari jaringan hati ikan Seperti dalam edisi terbaru jurnal The Annals of Ophthalmology, tinjauan riset para ahli Australia menyatakan bahwa omega-3 dapat menekan risiko seseorang menderita gangguan penglihatan degeneratif yang disebut age-related macular degeneration (AMD) hingga 30 persen

lebih. Namun demikian, para peneliti sama sekali tidak menganjurkan setiap orang untuk banyak mengonsumsi omega-3 jika hanya ingin terhindar dari ancaman tersebut. Para ahli dari Universitas Melbourne mencoba membuat tinjauan atas hasil sembilan penelitian mengenai kaitan omega-3 dan AMD. Sembilan riset ini secara total melibatkan 88.974 partisipan dan lebih dari 3.000 diantaranya mengidap AMD. Hasil tinjauan tersebut menyimpulkan bahwa mengonsumsi ikan sekurangnya dua kali dalam satu pekan berpotensi menurunkan risiko menderita AMD. Sejumlah riset selama ini juga sering menghubungkan asam lemak omega-3 dengan beragam manfaat kesehatan. Salah satu yang paling signifikan adalah rekomendasi penelitian bahwa omega-3 dapat membantu penderita sakit jantung. Berdasar riset, konsumsi suplemen minyak ikan secara teratur mampu menurunan ketidakstabilan elektris pada jantung, khususnya pada pasien yang mengidap kelainan detak atau ritme jantung. Minyak ikan mempunyai konsentrasi kandungan omega-3 yang lebih tinggi dibanding ikan utuh, sehingga dapat dijadikan pilihan alternatif khususnya bagi orang yang bermasalah untuk makan ikan atau orang yang memerlukan asupan omega-3 dalam jumlah banyak. Sebagai contoh, untuk memperoleh efek omega 3 dalam menurunkan konsentrasi triglyceride (lemak dalam darah), mengurangi resiko denyut jantung yang tidak normal dan mengoreksi depresi diperlukan asupan omega 3 dalam jumlah tertentu. Untuk memperoleh efek tersebut diatas, sebagian orang harus makan ikan setara 2 - 3 kali dengan 100 gram per sekali makan dalam sehari atau sekitar 6-9 gram minyak ikan per hari (rata rata 100 gram ikan mengandung minyak ikan sekitar 3 gram). Omega 3 yang terdapat pada ikan mencegah penyakit jantung dan penyakit degeneratif lainnya. Bahkan ada indikasi masyarakat yang gemar mengkonsumsi ikan memiliki umur harapan hidup rata-rata lebih panjang daripada masyarakat yang kurang mengkonsumsi ikan. Secara sederhana dapat dijelaskan, karakteristiknya yang unik menyebabkan omega 3 mampu mencegah dan mengurangi penumpukan kolesterol dan melekatnya bintik-bintik darah pada dinding pembuluh darah yang merupakan sebab utama timbulnya serangan jantung dan stroke yang mematikan. Omega 3 selain bisa menurunkan kadar kolesterol darah juga bisa mengatasi beban penderita penyakit asma, rematik, penyakit kulit, komplikasi diabetes dan kanker payudara. Bahkan pertumbuhan sel otak manusia sangat tergantung pada kadar omega 3 secara cukup sejak bayi dalam kandungan sampai balita. Bila pada masa tersebut cukup tersedia omega 3 maka anak tersebut akan tumbuh dengan potensi kecerdasan maksimal. Karena alasan itu, sejak ibu hamil perlu mengkonsumsi ikan dalam jumlah cukup sampai bayi yang dikandungnya lahir. Namun, minyak ikan mempunyai kelebihan dan keunikan terutama pada kasus kadar lemak darah tinggi yaitu bisa menurunkan lemak darah tersebut. Selain ikan bermanfaat untuk kesehatan jantung, ikan juga mengandung kalori rendah sehingga bagi orang-orang yang sedang mengikuti program diet penurunan berat badan mengkonsumsi ikan bermanfaat ganda asal diolah dengan sedikit lemak. Selain manfaat ikan untuk kesehatan, perlu diketahui pula kandungan histamin pada jenis ikan seperti tongkol, kembung, cakalang, dan tuna secara alami yang bisa menyebabkan keracunan. Keracunan itu tidak hanya disebabkan oleh kelompok ikan yang secara alami sudah mengandung histamin tetapi juga bisa disebabkan oleh ikan lain yang kurang segar mutunya. Makin tinggi tingkat kerusakan ikan, makin banyak histamin yang terbentuk pada ikan. Konsumsi histamin dalam jumlah rendah (8-10 mg) tidak membahayakan. Gejala keracunan akan timbul apabila mengkonsumsi 70 sampai 1000 mg histamin. Gejala keracunan yang tampak adalah muntah-muntah, bibir bengkak, sakit kepala, mual, muka

kemerah-merahan, gatal-gatal, dan badan lemas. Meskipun histamin bisa membuat keracunan, namun belum ada kejadian keracunan bisa mematikan. Karena itu perlu upaya makan ikan yang kesegarannya terjamin. Jangan disamakan alergi terhadap ikan dengan keracunan oleh ikan karena munculnya gejala yang sama. Keracunan bisa dihindari tetapi alergi tidak bisa dihindari. Karena itu biasanya orang yang alergi ikan setelah makan ikan menelan pil antihistamin supaya tidak ada reaksi alergi. Untuk menghindari keracunan ikan, belilah ikan yang segar, segera buang isi perut sebelum diolah dan bila tidak segera dikonsumsi simpan di freezer. Secara keseluruhan protein, vitamin, mineral dan asam lemak omega-3 yang dikandung dalam ikan mempunyai peran dalam kesehatan tubuh manusia baik di bagian otak, mata, jantung, paruparu, otot, pencernaan, kulit maupun persendian

BAB. IV KESIMPULAN Suplemen minyak ikan biasanya berasal dari ikan laut perairan dalam dan dingin yang diekstrak dari jaringan hati ikan. Suplemen minyak ikan adalah salah satu zat gizi yang mengandung asam lemak kaya manfaat seperti Omega 3 (EPA & DHA), Vit A dan Vit D. Salah satu sumber DHA & EPA ALAMI adalah suplemen minyak ikan dari hati ikan cod atau sering disebut Cod Liver Oil. Minyak ikan diperoleh dengan cara ekstraki. Ekstraksi minyak adalah suatu cara untuk mendapatkan minyak atau lemak dari bahan. Kemudian dilakukan pemurnian minyak ikan, yaitu penyaringan, degumming, nertlasisasi, pemisahan sabun, pemucatan dan deodorisasi. Tujuan dari pemurnian minyak ikan adalah untuk menghilangkan rasa dan bau yang tidak enak, warna yang tidak menarik, dan memperpanjang masa simpan minyak Manfaat makan ikan antara lain menurunkan kadar kolesterol darah, menurunkan kadar trigliserida darah, meningkatkan kecerdasan anak dan meningkatkan kemampuan akademik, menurunkan risiko kematian karena penyakit jantung, mengurangi gejala rematik, dan menurunkan aktivitas pertumbuhan sel kanker. Secara umum ikan tetap lebih bermanfaat dibandingkan minyak ikan, kecuali bagi orang tertentu yang mempunyai masalah makan ikan dan bagi orang yang memerlukan asupan omega-3 dalam jumlah besar. Bagi orang tersebut maka minyak ikan dapat dijadikan alternatif dalam menjaga kesehatan. Namun demikian, perlu adanya pengawasan medis yang ketat apabila minyak ikan tersebut digunakan dalam jumlah banyak Nah, marilah kita manfaatkan ikan dalam menu sehari-hari dengan motto ―tiada hari tanpa ikan‖ supaya keluarga sehat Diposkan oleh iptek di 09:06 0 komentar Label: iptek

BIOPER AKHIR
I.PENDAHULUAN 1.1 Latar Belakang Perikanan adalah suatu usaha manusia untuk dapat memanfaatkan sumber daya hayati perikanan (baik nabati maupun hewani) sedemikian rupa sehingga diperoleh hasil yang lebih baik dari pada dibiarkan tumbuh secara alami guna memenuhi kebutuhan manusia. Ikan adalah salah satu diantara organisme pada kelompok vertebrata dan yang paling besar jumlahnya. Ikan mendominasi kehidupan di air seluruh permukaan bumi, sangat beragam dalam adaptasi morfologi, fisiologi dan tingkahlakunya. Jumlah spesies ikan yang telah berhasil dicatat adalh 21.000 spesies dan diperkirakan akan berkembang mencapai 28.000 spesies. Jumlah spesies yang hidup di muka bumi adalah 21.723 spesies, semantara jumlah spesies vertebrata yang ada di permukaan sekitar 43.173 spesies (Nelson, 1984). Propinsi Riau memiliki keanekaragaman sumberdaya perikanan yang cukup besar baik itu perikanan air tawar maupun air laut. Ikan air tawar sebagian diproduksi dari hasil tangkapan diperairan umum, yaitu sekitar 13.807 ton atau sekitar 97,01 % dari potensi keseluruhan sebesar 14.232 ton/tahun yang telah dimanfaatkan. Sementara produksi perikanan dari hasil budidaya baru mencapai 3,1 % dari potensi yang ada sebesar 36.835 Ha (Dinas Perikanan Tingkat I Riau, 2001). Dari jumlah tersebut antara satu spesies dengan spesies lainnya sudah tentu memiliki beberapa persamaan dan perbedaan. Saanin (1984) mengatakan bahwa untuk mengidentifikasi ikan harus diperhatikan tanda-tanda, bentuk dan bagian dari tubuh ikan yaitu rumus sirip,perbandingan panjang dengan tinggi, bentuk garis rusuk dan jumlah sisik yang meliputi garis rusuk tersebut, bentuk sisik dan gigi beserta susunannya, tulang-tulang insang. Oleh karena satu macam ikan berbeda besarnya disebabkan oleh umur atau kadang-kadang oleh tempat hidupnya, maka tidak mungkin memberikan ukuran, ukuran yang diberikan hanyalah perbandingan saja. Pengetahuan tentang kehidupan ikan terdapat dalam ilmu Biologi Perikanan yang merupakan ilmu untuk mempelajari ikan secara ilmiah, namun penekanan dan tinjauannya mengenai ikan sebagai sumber yang dapat dipanenen oleh manusia. Biologi perikanan mencakup ikan dimana penekanannya terhadap spesies penting sebagai sumberdaya, spesies lain dalam komunitas itu dipelajari juga tetapi yang diindahakan kemungkinan pengaruhnya terhadap spesies yang penting. Jadi ruang lingkup biologi perikanan akan menjadi lebih jelas apabila diperhatikan prinsip– prinsip pengelolaan perikanan seperti telah dikemukakan diatas, dimana biologi perikanan diperlukan untuk melengkapi bimbingan dalam pengelolaan. Dalam laporan ini dibahas beberapa aspek yang dipelajari dalam biologi perikanan yang sangat penting untuk diketahui dan di pelajari mahasiswa perikanan. Penampakan ciri–ciri seksual ini pada beberapa spesies ikan baru nyata apabila individu ikan sudah mengalami matang gonad (kelamin), akan tetapai pada beberapa spesies ikan lainnya ciriciri seksual itu dapat terlihat dengan jelas walaupun individu ikan tersebut belum matang gonad ataupun sudah selesai mijah. Ini dapat diketahui dengan melihat organ reproduksi atau cirri-ciri pada permukaan tubuhnya. Dengan dikenalinya penampakan ciri–ciri seksual dari setiap individu pada spesies ikan maka akan sangat membantu bagi orang–orang yang berusaha di bidang budidaya perikanan dan juga para peneliti di bidang biologi perikanan. Sedangkan penentuan jenis kelamin ikan dapat dilakukan dengan memperhatikan ciri seksusl

pimer (dengan cara membedah bagian abdominal tubuh ikan dan dilihat bentuk gonad nya, apakah ovari atau testes) dan ciri seksual sekunder, meliputi seksual dimorphisme (memperhatikan benda–benda yang terdapat pada tubuh ikan, atau morphologi) dan seksual dichromatisme (memperhatikan warna yang terdapat pada tubuh dan bagian–bagian tubuh ikan). Oleh karena itu sangat diperlukan pengetahuan tentang tingkat kematangan gonad dari setiap individu ikan sehingga membantu mereka yang berkecimpung di bidang budidaya perikanan dan biologi perikanan untuk menghitung jumlah ikan dewasa yang siap bereproduksi dan memijah, kapan mereka akan memijah dan bertelur serta kapan dan berapa telur yang akan dibuahi dan menetas serta perbandingan antara ikan yang belum matang gonad dengan yang sudah matang, ikan yang belum dewasa dengan yang sudah dewasa dan ikan yang belum bereproduksi dengan yang sudah. Sumantadinata (1983) menyatakan gonad ikan adalah sebagai kelenjar biak. Gonad ikan betina dinamakan ovari dan gonad ikan jantan dinamakan testes. Ovari dan testes ikan dewasa biasanya terdapat pada individu yang terpisah, kecuali pada beberapa ikan, kadang-kadang gonad jantan dan betina ditemukan dalam satu individu (ovotestes). Tingkat kematangan Gonad adalah tahap tertentu gonad sebelum dan sesudah ikan itu memijah. Pulungan et. al (2005) menjelaskan bahwa tahap-tahap perubahan perkembangan gonad dari suatu individu ikan adalah sangat penting. Data perkembangan gonad dapat dibandingkan antara ikan yang belum dan yang sudah dewasa, antara ikan yang sudah matang gonad dan yang belum, antara yang akan bereproduksi dengan yang sudah bereproduksi serta dapat diketahui pada ukuran berapa individu dari spesies ikan itu pertama kali mengalami matang gonad dan memijah. Kematangan gonad dari suatu spesies ikan ada kaitannya dengan pertumbuhan ikan itu sendiri dan faktor lingkungan. Sehingga tahap–tahap perubahan perkembangan gonad dari suatu individu lainnya adalah pengetahuan yang penting sekali dalam biologi perikanan. Gonad sebagai penentu jenis kelamin ikan atupun hewan aquatik lainnya akan memiliki bentuk dan ukuran yang bervariasi. Hal itu sesuai dengan kapasitas rongga yang tersedia dan bentuk tubuh ikan itu sendiri. Pengetahuan tentang fekunditas dalam bidang budidaya perikanan sangat penting artinya untuk memprediksi berapa banyak jumlah larva / benih yang akan dihasilkan jika individu ikan mijah didalam biologi perikanan adalah untuk memprediksi berapa jumlah stok suatu populasi ikan yang hidup di suatu lingkungan perairan. Secara garis besar susunan saluran penernaan pada ikan terdiri dari mulut, oseaphagus, lambung, intestenum, anus. Di dalam mulut ikan terdapat gigi yang berperanan membantu mendapatkan makanan sama juga halnya dengan bentuk dan ukuran lambung serata intestenum yang dimiliki setiap jenis ikan bervariasi, maka menyebabkan setiap spesies ikan cara mengambil makanan nya juga bervariasi. Makanan dapat merupakan faktor menentukan populasi dan pertumbuhan. Jenis makanan suatu spesies ikan tergantung pada umur dan waktu (Effendie, 1979). Dari banyaknya ikan yang hidup pada daerah ini, maka setidaknya para ilmuwan yang bergerak dalam bidang biologi perikanan meneliti jenis makanan apa yang dimakan oleh ikan tersebut atau yang sering kita sebut dengan menganalisa isi saluran pencernaannya. Pencernaan adalah proses penyederhanaan makanan melalui mekanisme fisik, kimiawi sehingga makanan menjadi bahan yang mudah diserap dan diedarkan ke seluruh tubuh melalui sistem peredaran darah. Uktolseja dan Purwasamita (1987) mengemukakan bahwa pengetahuan mengenai fekunditas merupakan tahap yang penting untuk mengetahui dinamika populasi dan pada akhirnya dapat memperkirakan populasi ikan yang memijah jika telah dapat ditentukan jumlah telur yang

dihasilkan setiap tahunnya dan perbandingan ikan jantan dan betina dalam populasi tersebut. Nilai fekunditas suatu spesies ikan dalam bidang akuakultur berperan untuk memperkirakan jumlah anak–anak ikan yang akan di hasilkan pada setiap kali pemijahan. Kemampuan untuk menentukan umur dari suatu individu ikan adalah suatu pengetahuan yang penting dalam bidang biologi perikanan. Usaha untuk mempelajari penentuan umur suatu individu telah dimulai beberapa ratus tahun yang lalu. Penentuan umur ikan dapat dilakukan melalui dua cara yaitu mempelajari tanda tahunan yang ada pada tubuh ikan serta dengan cara frekuensi panjang. Bagian – bagian tertentu dari tubuh ikan yang memiliki tanda–tanda tahunan adalah Tulang Vertebrae, Tukang Overculum, Duri sirip dan Tulang otolith. Dengan diketahuinya umur suatu individu ikan dari suatu spesies ikan maka kita akan dapat mengetahui pada umur berapa pertama kali ikan belajar mencari makan sendiri di alam, mencari makanan sesuai dengan kebiasaan kedua induknya, dan kapan ikan tersebut matang gonad. Pendugaan populasi pada ikan dapat digunakan sebagai parameter populasi, jumlah individu ikan di dalam populasi dari suatu spesies ikan di lingkungan parameter tertentu selalu berubah karena dipengaruhi oleh banyak factor, dengan mengetahui keberadaan jumlah individu ikan di dalam suatu perairan maka akan dapat mendukung untuk mengetahui potensi di lingkungan perairan tersebut. Populasi ikan disuatu perairan sangat penting untuk diketahui karena dengan mengetahui jumlah polasi disuatu perairan maka kita akan mengetahui batas tangkap ikan yang boleh diambil agar tidak terjadi over fishing yang lama kelamaan akan menyebabkan kepunahan pada ikan–ikan yang ada, di perairan seperti kita ketahui bahwa kebutuhan gizi dari ikan lama–kalamaan semakin meningkat, dengan mengetahui pendugaan popalsi suatu perairan kita juga dapat mengetahui pada daerah mana yang terdapat banyak ikan namun kita tidak mengambilnya melebihi batas maksimum ikan yang boleh ditangkap agar kelestarian ikan diperairan tetap selalu terjaga. Telur-telur ikan yang telah dibuahi maka di dalam telur ikan itu akan terjadi proses embriologis hingga terbentuknya individu ikan lalu menetas dan keluar dari cangkang telur. Lamanya proses inkubasi yang terjadi pada telur – telur yang dibuahi bervariasi antara spesies ikan yang satu dengan spesies ikan lainnya, karena dipengaruhi oleh kondisi perairan lingkungan dan kandungan kuning telur yang terdapat dalam telur itu sendiri. Larva yang baru keluar dari cangkang telur digolongkan sebagai prolarva dimana pada massa ini larva masih memiliki cadangan makanan berupa kuning telur dan organ-organnya belum terbentuk sempurna. Sesudah habis cadangan makanan berupa kuning telur maka larva akan memasuki periode postlarva dan pada saat ini beberapa organ tubuh sudah mulai terbentuk senpurna serta mulai difungsikan (Pulungan et al, 2005). 1.2 Tujuan dan Manfaat Biologi perikanan dipelajari untuk mengetahui aspek–aspek perikanaan dan juga untuk menegetahui sebagaimanan sumberdaya yang dapat dipanen oleh manusia, serta merupakan suatu usaha agar orang yang mempelajarinya mengerti dan memahami sumberdaya perikanan serta bagaimanan pemanfaatan sumberdaya tersebut secara optimum dan membuat rekomendasi dalam pemanfaatan serta perbaikananya. Manfaat yang diperoleh dari biologi perikanan ini adalah kita dapat mengetahui aspek–aspek biologi perikanan, dan mengetahui aplikasi pengetahuan biologi perikanan, dimanan pengelolaan perikanan ini berhubungan dengan sumberdaya masyarakat.

II. TINJAUAN PUSTAKA 2.1. Pengenalan Jenis Ikan dan Identifikasi Jumlah spesies ikan yang telah berhasil diidentifikasi para ahli Ichthyologi ada sekitar 20.00040.000 spesies. Puluhan spesies diantaranya telah memiliki varietas atau strain yang mencapai puluhan dan ratusan varietas. Terutama sekali ikan yang telah berhasil dibudidayakan dan telah popular didunia sebagai ikan hias (Pulungan et.al., 2004). Untuk mengenal secara jelas jenis ikan yang diamati dan dapat diketahui secara pasti nama spesies ikan yang diamati maka terlebih dahulu perlu dilakukan pendeterminasian agar didapatkan data meristik dan morphometriknya (Pulungan et.al., 2004). 2.2. Seksualitas Ikan Saanin (1986) Mengklasifikasikan ikan Motan yaitu termasuk Kelas Pisces, Ordo Ostariophysi, Sub Ordo Cyprinoidea, Family Cyprinidae, Sub Famiily Cyprininae, Genus Thynnichthys dan termasuk kedalam species Thynnichthys thynnoides. Ciri – ciri dari ikan motan adalah badan berbentuk compresed dan panjang mulut terminal dan protactile. Tidak bersungut dan mulut sempit, bibir tebal, posisi sirip perut terhadap sirip dada adalah abdominal, jumlah jari – jari sirip punggung dengan rumus D.8 dada P. 13, perut V. 12 anus A. 5. 59 sisik pada gurat sisi, 13 sisik antar sirip punggung dan gurat sisi, 11 antar sirip anus dengan gurat sisi. Batang ekor dikelilingi 22 sisik, ekor bercagak, warna badan putih mengkilat agak gelap dibagian punggung, garis linnea lateralis sempuran, sisik halus (Kottelat, et. al 1993).

Gambar 1. Morfologi Ikan Motan (Thynnichthys thynnoides) Seksual dichromatisme adalah suatu cara untuk membedakan suatu individu ikan merupakan ikan jantan atau betina berdasarkan warna yang dimiliki tubuh dan organ pelengkap lainnya. Sedangkan seksual dimorphisme adalah suatu cara untuk membedakan suatu ikan jantan atau betina berdasarkan morphometrik yang dimiliki seperti ukuran tubuh atau bentuk sirip punggung (Manda Putra, 2006) Beberapa jenis ikan juga memiliki dua alat kelamin pada tubuhnya yang sering disebut dengan ikan hermafrodit. Ikan hermafrodit dibagi menjadi tiga bagian yaitu hermafrodit sinkroni, hermafrodit protandri, dan hermafrodit protogini. Hermafrodit sinkroni yaitu apabila di dalam gonad individu terdapat sel sex betina dan sel sex jantan yang dapat masak bersama-sama, misalnya pada ikan famili Serranidae. Hermafrodit protandri yaitu ikan yang dalam tubuhnya mempunyai gonad yang mengadakan proses diferensiasi dari fase jantan ke fase betina, misalnya pada ikan Kakap (Lates calcarifer). Sedangkan ikan hermafrodit protogini yaitu ikan yang dalam tubuhnya mempunyai gonad yang mengadakan proses diferensiasi dari fase betina ke fase jantan, misalnya pada ikan belut sawah (Monopterus albus) (Effendie Ichsan, 2002) Selain hermafroditisme, pada ikan juga terdapat Gonokhorisme, yaitu kondisi seksual berganda dimana pada ikan bertahap juvenile gonadnya tidak mempunyai jaringan yang jelas status jantan dan betinanya. Gonad tersebut akan berkembang sebagian menjadi ovarium dan sebagian lagi menjadi testes tapi tidak terjadi masa diferensiasi atau intersex yang spontan. Misalnya pada ikan Anguila anguila dan Salmo gairdneri irideus adalah gonokhoris yang tidak berdeferensiasi. Faktor yang mempengaruhi komponen reproduksi atau kematangan gonad diantaranya umur dan fisiologi induk ikan itu sendiri. Secara umum spesies ikan dari ukuran ,maksimum terkecil dan

mempunyai siklus hidup yang pendek, mencapai kematangan gonad pada usia lebih muda dari pada spesies ikan maksimum besar Lagler et,al.,(1977). Effendi (1992) pada proses reproduksi sebelum terjadi pemijahan sebagian besar hasil metabolisme tertuju untuk perkembangan gonad, gonad semakin bertambah berat diimbangi dengan bertambah ukurannya. Perkembangan gonad ikan secara garis besar dibagi atas dua tahap perkembangan utama yaitu pertumbuhan gonad sehingga ikan mencapai tingkat dewasa kelamin (sexually mature) dan tahap pematangan produk seksual/gamet. 2.3. Tingkat Kematangan Gonad Gonad adalah organ reproduksi yang berfungsi menghasilkan sel kelamin (gamet). Gonad yang terdapat ditubuh ikan jantan disebut testis berfungsi menghasilkan spermatozoa, sedangkan gonad yang terdapat dalam ikan betina dinamakan ovari berfungi menghasilkan telur (ovum) (Pulungan, 2004). Menurut Pulungan (2005) pengamatan tentang tahap-tahap kematangan gonad ikan dapat dilakukan secara morfologi dan secara histologi. Pengamatan secara morphologi dapat dilakukan di lapangan dan di laboratorium, sedangkan pengamatan secara histologi hanya dapat dilakukan di laboratorium dan sangat memerlukan peralatan yang canggih serta teliti dan memerlukan dana yang cukup besar. Bila pengamatan dilakukan pada testes maka yang diamati adalah bentuk testes dan kedua sisinya, ukuran (panjang dan diameter ) testes, perbandingan panjang testes dan rongga tubuh, warnanya serta pembuluh darah pada permukaan testes. Demikian juga halnya bila pengamatan dilakukan pada ovari tetapi yang perlu diamati lagi adalah diameter beberapa butir telur. Rahardjo (1980) saat pertama ikan mempunyai kemampuan bereproduksi (kematangan seksual ) dipengaruhi oleh beberapa faktor. Terdapat perbedaan antara masing-masing spesies pada umur dan ukuran yang sama. Secara umum dapat dikatakan bahwa ikan-ikan yang mempunyai ukuran maksimum kecil dan jangka waktu hidup yang pendek akan mencapai kedewasaan pada umur yang lebih muda daripada ikan yang mempunyai ukuran maksimum lebih besar. Tang (2000) pematangan gonad untuk merangsang proses perkembangan telur sangat penting pada kegiatan budidaya ikan. Karena salah satu masalah utama yang dihadapi dalam produksi benih secara buatan adalah minimnya ketersediaan induk matang gonad. Induk matang gonad dapat diperoleh atau dipacu dengan berbagai cara misalnya dengan memanipulasi faktor lingkungan, makanan dan penggunaan hormon. Lam (1985) menyatakan proses pembelahan sel-sel bakal telur secara mitosis sampai oosit primer atau fase pembentukan folikel dapat dipercepat dengan mengoptimalkan kondisi lingkungan misalnya suhu, periode cahaya dan penggunaan makanan berprotein tinggi dengan penambahan vitamin E, C atau asam lemak esensial untuk proses vitelogenesis karena dikendalikan oleh kelenjar hypofisa dan estrogen. Maka fase ini sering digunakan hormonhormon tertentu untuk mempercepat pematangan. Nikolsky (1969) menggunakan tanda utama untuk membedakan kematangan gonad berdasarkan berat gonad. Secara alamiah hal ini berhubungan dengan ukuran dan berat tubuh ikan keseluruhannya tanpa berat gonad. Perbandingan antara berat gonad dengan barat tubuh, Nikolsky menamakannya ―coefficient kematangan‖ yang dinyatakan dalam persen. Menurut Effendie (1999) mengatakan bahwa ciri induk ikan betina yang telah matang gonad dapat dilihat dari bentuk perut sangat lembut, dapat juga dengan mengurut perut ikan tersebut. Bila telur yang keluar secara pengurutan berbentuk bulat utuh, berwarna agak kecoklatan maka induk dalam kondisi siap pijah. Pada gonad ikan jantan dapat dilihat dari papilla genitalnya yang

terletak dibelakang dan mendekati sirip anus, berwarna merah dan menyebar kearah pangkalan, makan ikan tersebut telah matang kelamin. Menurut Trenggana (dalam Yuniarti, 1995) bahwa seksualitas, indeks kematangan gunad, tahap kematangan gonad, dan fekunditas sangat berperan dalam proses reproduksi. Dengan mengetahui hal tersebut dapat diperoleh antara lain, yaitu pada umur berapa suatu spesies ikan akan mulai memijah, apakah induk-induk ikan sudah memijah atau belum, banyaknya ikan-ikan tertentu serta frekuensi dan lama pemijahan. Lagler et al., (1977) melaporkan bahwa tingkat kematangan gonad ialah tahapan perkembangan gonad sebelum dan sesudah ikan memijah. Semakin meningkat kematangan gonadnya, telur dan sperma ikan semakin berkembang. Garis telur pada ikan semakin besar pula, ukuran, berat gonad dan garis tengah telur bervariasi sesuai dengan kondisi tingkat kematangan gonad ikan betina. Terjadinya perbedaan awal mula suatu individu ikan mengalami matang gonad disebabkan oleh umur, ukuran dan faktor fisiologis ikan itu sendiri (Pulungan, 1990) Effendie (1978) mengemukakan bahwa Indeks Kematangan Gonad antara satu spesies ikan dengan spesies lainnya akan saling berbeda. Hal ini disebabkan karena indeks kematangan gonad suatu spesies ikan dipengaruhi oleh berat gonad dan berat tubuh ikan itu sendiri. Selanjutnya dia menambahkan pada ikan betina nilai Indeks kematangan gonad lebih besar dibandingkan dengan ikan jantan dan ikan dengan indeks kematangan gonad 19 % ada yang sanggup mengeluarkan telur. 2.4. Fekunditas dan Diameter Telur Fekunditas merupakan salah satu fase yang memegang peranan penting untuk melangsungkan populasi dengan dinamikanya. Dari fekunditas kita dapat menaksir jumlah anak ikan yang akan dihasilkan dan akan menentukan jumlah ikan dalam kelas umur yang bersangkutan. Fekunditas adalah semua telur-telur yang kan dikeluarkan pada waktu pemijahan (Effendie, 1978) Menurut William (dalam Jones, 1978) fekunditas sangat tergantung pada suplai makanan, terutama untuk mempertahankan musim pemijahan dan ukuran tubuh ikan betina. Selain itu, ikan-ikan yang hidup di sungai mempunyai hubungan dengan tinggi air. Apabila sampai pada tahun-tahun tertentu permukaan air sungai selalu tinggi, fekunditas ikan tinggi pula, bila dibandingkan dengan tahun lain yang permkaan airnya rendah. Kejadian yang sama dapat terjadi pula untuk ikan-ikan yang hidup di rawa, karena sering pula permukaan air rawa dari tahun ke tahun tidak sama sebagai akibat pemasukan air yang tidak tetap (Effendie, 1978) Umumnya fekunditas realtif lebih tinggi dibandingkan dengan fekunditas individu. Fekunditas relatif maksimal dijumpai pula pada golongan ikan yang masih muda (Nikolsky dalam Effendie, 1978). Selanjutnya Effendie (1978) mengemukakan bahwa kapasitas reproduksi dari pemijahan populasi tertentu untuk mengetahui harus menggunakan fekunditas pipulasi relatif. Fekunditas ini dapat berbeda dari tahun ke tahun karena banyak individu yang memijah tiap-tiap tahun. Untuk mengetahui penyebaran diameter telur dilakukan pengukuran diameter telur dengan mengambil butiran pada bagian anterior, tengah, dan posterior pada ovarium sebelah kanan dan kiri. Serta perkembangan telur ditandai denganukuran diameter telurnya. (Uktoseja dan Purwasasmita, 1987). Untuk menghitung telur ada beberapa metoda yang dapat digunakan. Setiap metoda memiliki kelebihan dan kekurangan, oleh karena itu sebelum memutuskan untuk memilih metoda dalam menghitung nilai fekunditas ikan harus dikenali dengan baik sifat dari setiap spesies ikan yang diteliti agar pada pelaksanaan menghitung nilai fekunditas ikan tidak terjadi kesalahan (Pulungan, 2005).

Ikan-ikan yang tua dan besar ukurannya mempunyai fekunditas relative yang lebih kecil. Umumnya fekunditas relative lebih tinggi dibandingkan dengan fekunditas individu. Fekunditas relative akan menjadi maksimum pada golongan ikan yang masih muda (Nikolsky,1969) Fekunditas merupakan salah satu fase yang memegang peranan penting untuk melangsungkan populasi dengan dinamikanya. Dari fekunditas kita dapat menaksir jumlah anak ikan yang dihasilkan dan akan menentukan jumlah ikan dalam kelas umur yang bersangkutan. Fekunditas adalah semua telur – telur yang akan dikeluarkan pada waktu pemijahan (Effendie, 1979).

2.5. Analisa Isi Saluran Pencernaan Ikan lele dumbo ini termasuk ke dalam Phylum Chordata, Subphylumnya Craniata, Superkelas Gnathostomata, Kelas Pisces, Subkelas Teleostei, Ordo Ostariophysi, Sub ordo Siluroidea, Famili Clariidae, Genus Clarias, dan Spesiesnya adalah Clarias gariepinus (Saanin, 1986)

Gambar 2. Ikan lele dumbo (Clarias gariepinus) Menurut Suyanto, S.R., (1993) dan Nijayanti (1992) ikan lele dumbo (Clarias gariepinus) memiliki bentuk tubuh pipih dengan kepala picak, banyak memiliki lendir, mulutnya lebar dan mempunyai 4 macam sungut, insangnya berukuran kecil, dan terletak pada bagian belakang, dibagian atas rongga pernafasan terdapat alat pernafasan tambahan yang berbentuk seperti batang pohon dan penuh dengan kapiler-kapiler darah. Ikan lele dumbo merupakan jenis ikan air tawar yang baru dibudidayakan di Indonesia. Kendungan protein ikan lele dumbo mencapai 37 %. Suyanto (1986) mengemukakan Lele Dumbo merupakan hasil persilangan antara betina asli Taiwan (Clarias fucus) dengan lele jantanasal afrika (Clarias mussmbicus). Keadaan morfologi ikan tersebut badan tidak bersisik, ukuran perbandingan panjang batok kepala dibandingkan panjang badan adalah 1:5. lele dumbo ini mirip dengan Clarias mussambicus dilihat dari perbandingan batok kepala. Warna tubuh gelap pada bagian punggung dan sisi tubuh. Mulutnya lebar dan terdapat delapan buah sungut nasal, maxilari, mandibula dalam dan luar yang terletak berdekatan dengan sungut nasal, oleh karena itu penglihatan baginya kurang penting. Memiliki sirip tunggal dan ganda, pada pektoral terdapat duri yang kuat dan tidak beracun. Memiliki alat pernafasan tambahan yang disebut arborescen. Ikan lele dumbo sejak tahun 1986 sudah populer di Indonesia. Jenis ikan lele ini di introduksi ke Indonesia dari negara Taiwan, tepatnya pada bulan Nopember 1986 dengan nama populernya King catfish yang berarti raja ikan lele (Suyanto, 1993). Pada mulanya nama ilmiah ikan lele dumbo adalah Clarias fuscus dan kemudian diganti menjadi Clarias gariepinus. Penggantian nama ini berdasarkan atas sifat – sifat induk jantan yang dominan diturunkan kepada anaknya. Dari hasil penyilangan itu ternyata keturunan ikan lele dumbo yang dihasilkan mempunyai sifat – sifat yang unggul. Mujiman (1987) mengemukakan bahwa urutan saluran pencernaan ikan terdiri dari mulut, kerongkomgan, esofagus, lambung, usus sampai anus. Kemudian Ichwan (1997) yang mengatakan bahwa kualitas dan kuantitas makanan ikan juga tergantung pada ukuran makan yang cocok untuk mulut ikan. Pada umumnya esofagus ikan pendek dan bisa membesar agar makanan yang agak besar dapat ditelan, dinding – dinding esofagus dilengkapi dengan lapisan otot circular dan memanjang. Pada ikan – ikan tertentu esofagus bersambung dengan usus. Lalu ditambahkan lambung berfungsi

untuk menyimpan makanan melalui proses pencernaan dengan mencampurkan bahan makanan yang ditelan dengan lelehan gastrik.(Bond ,1979) Usus merupakan segmen terpanjang dari saluran pencernaan. Menurut Affandi et al (1992), panjang usus sangat bervariasi dan berhubungan erat dengan kebiasaan makan ikan. Kebiasaan makan ikan (food habits) adalah kualitas dan kuantitas makanan yang dimakan ikan. Kebiasaan makan ikan diperlukan untuk mengetahui gizi alamiah ikan tersebut sehingga dapat dilihat hubungan ekologi diantara organisme diperairan itu, misalnya bentuk – bentuk pemangsaan, saingan dan rantai makanan. Jadi makanan dapat merupakan faktor yang menentukan bagi populasi pertumbuhan dan kondisi ikan. Jenis makanan dari spesies ikan biasanya tergantung umur, tempat dan waktu (Effendie, 1979). 2.6. Penentuan Umur Ikan Ikan selar tergolong kedalam kelas Osteichtyes, subordo Percomorphi, sub ordo Percoidea, Divisi Perciformes, famili Carangidae, genus Caranx dan spesies Caranx leptolepis (Saanin, 1984)

Gambar 3. Morfologi Ikan Selar (Caranx leptolepis) Ikan Selar Kuning tergolong ikan pelagis yang suka bergerombol (schooling) ikan ini berkerabat dengan ikan pelagis lainnya seperti golongan famili scombridae, clupeidae dan golongan ikan pelagis lainnya. Ikan Selar Kuning hampir serupa dengan ikan selar biasa dan selar mata besar yang menjadi ciri khas dari ikan ini adalah garis pewarnaan yang berwarna kekuningan mulai dari bagian abdominal sampai pada bagian batang ekor. Pada bagian otak ikan ini terdapat tulang otholit yang mampu merekam segala aktivitas kejadian yang dialami oleh ikan ini semasa hidupnya. Suku besar ikan yang terutama hidup di laut dikenal dengan nama kuweh, angara atau selar. Hidup di laut kawasan sedang dan tropis. Bentuk badannya bervariasi tetapi kebanyakan memiliki barisan sisik berduri sepanjang batang ekor (Kottelat et al, 1993). Menurut (Djuhanda, 1981), ikan selar tergolong kedalam keluarga carangidae. Tubuh dari ikan ini bentuknya ada yang sedikit gepeng, ada yang lonjong dan ada juga yang tinggi. Umur merupakan salah satu penduga terbaik dalam menentukan tingkat pertumbuhan relatif pada ikan, walaupun pertumbuhan sebenarnya sangat dipengruhi oleh faktor-faktor lingkungan (Moyle dan Cech, 1988). Selanjutnya Effendie (1992) menjelaskan tanda tahunan pada tubuh ikan tercatat pada sisik, tulang oprculum, duri sirip punggung atau dada, tulang punggung otolith (batu telinga). Hoffbaur (dalam Effendie, 1992) juga menerangkan bahwa tanda tahunan yang terdapat pada sisik dikenal dengan annulus. Otolith terbentuk dari kalsium karbonat yang mengeras didalam saluran kanal dari sirkulasi pada tulang ikan yang menonjol, berperan membantu dalam keseimbangan dan menanggapi bunyi (Victor, 1982). Sebagian diatom berbeda nyata pada diatom morfologi otolith yang terjadi diantara ikan-ikan bertulang sejati yang memberi kesan bahwa otolith ini mempunyai peranan penting untuk pendengaran. Otolith terutama tambahan dari kristalisasi kalsium karbonat, dalm bentuk magnetik dan berserabut. Kolagen yang mempunyai protein otoline (Morals.nin, 1992) Pertumbuhan otolith mempunyai permukaan dan endapan material, suatu proses yang

berhubungan dengan masa peredarannya bergantung pada laju dalam metabolisme kalsium dan pada asam amino sintesis. Hasil tersebut merupakan formasi tambahan dari pertumbuhan harian dalam otolith tersebut, tersususn secara kontingen atau penambahan unit dan suatu unit pengawasan (Morales.nin, 1992). Penelitian tentang umur dari suatu individu ikan yang berasal dari perairan sudah dilakukan sekitar 100 tahun yang lalu (Ricker dalam Pulungan, 2006). Untuk menentukan umur suatu individu ikan maka kita dapat juga melihat pada bagian-bagian tubuh yang keras. Bagian-bagian tubuh yang keras untuk pembacaan umur suatu individu ikan tersebut menurut (Lagler et al dalam Pulungan, 2006) yaitu sisik kunci, tulang vertebrae, tulang operculum, pangkal duri sirip dada, dan tulang otholit. Sisik kunci pada ikan bersisik cycloid terletak di atas garis linea lateralis 3 baris sisik di depan pangkal dasar sirip punggung bagian depan dan pada ikan bersisik ctenoid terletak di bawah garis linea lateralis di belakang ujung dasar sirip dada. Arah ke posterior tubuh. Tulang otholit terletak di bawah otak, berjumlah sepasang. 2.7. Mortalitas Ikan Saanin (1984) mengklasifikasikan ikan lele dumbo ke dalam kelas Pisces, Sub kelas Teleostei, Ordo Ostariophysi, Sub ordo Siliraodae, Family Clariidae, Genus Clarias, Spesie Clarias gariepinus.

Gambar 4. Morfologi Lele dumbo (Clarias gariepinus) Ciri – ciri bentuk ikan lele menurut Weber dan Baufort (dalam Pulungan, 2005) adalah sebagai berikut badan memanjang, tidak bersisik, tidak bersirip lemak dan kepala gepeng, sirip punggung (D) 60 – 70. panjang nya hampir mencapai pangkal sirip ekor. Sirip dada (P) I,8 – 11, jari – jari keras sirip dada licin dan sedikit bergerigi dan tidak tajam. Sirip perut (V) 6, sirip anus (A) 47 – 58. warna tubuh bagian atas gelap, daerah perut dan sisi bawah kepala terang, kadang – kadang terdapat baris bintik – bintik terang sepanjang sisi badan dan ekor. Perubahan jumlah individu dalam populasi dari suatu spesies ikan dapat berubah – ubah dari waktu ke waktu. Terjadinya perubahan itu dipengaruhi oleh keberhasilan atau kegagalan produksi selanjutnya dapat mempengaruhi rekuitment ke dalam populasi ikan yang telah ada. Selain itu juga dipengaruhi oleh angka mortalitas yang terjadi. Angka mortalitas agak sukar untuk ditetapkan karena banyak factor yang mempengaruhi ( Bailey,.k.m. And e.d. Honde,1989) Bailey,.k.m. And e.d. Honde. (1989) menyatakan bahwa penyebab kematian indivu ikan secara masal yang berada di suatu habitat tertentu adalah predasi, penyakit, pencemaran, pemusnahan secara fisik oleh mesin atau manusia dan gejala alam. Sedangkan penyebab kematian yang pengaruhnya tidak langsung kepada individu antara lain makanan, kondisi lingkungan yang kurang menyenangkan, beberapa jenis parasit dan tekanan sosial. Pencemaran didefenisikan sebagai dampak negatif (pengaruh yang membahayakan) bagi kehidupan biota, sumber daya, kenyamanan ekosistem, serta kesehatan manusia, dan nilai guna lainnya dari ekosistem, baik disebabkan secara langsung maupun secara tidak langsung oleh pembuangan bahan-bahan atau limbah ke dalam perairan yang berasal dari kegiatan manusia. (Dahuri, 2002) Klein (1962) Mengemukakan bahwa pencemaran air dapat disebabkan oleh padatan maupun cairan, pencemaran dalam bentuk cair ditentukan oleh bahan tersuspensi atau bahan terlarut

didalamnya seperti Peptisida, Randap, selanjutnya dikatakan pula penyebab utama pencemaran air oleh limbah cair yang berasal dari limbah industri, pemukiman dan pertambangan. Menurut Djajasewaka (1985), kematian individu ikan di dalam populasi pada habitat tertentu dapat terjadi mulai dari telur ikan yang baru dilepas ke perairan atau yang telah dibuahi, di masa larva, ikan dewasa dan ikan yang tua siap untuk mati secara alami. Menurut Paling (1971), sebagian besar bahan pencemar yang ditemukan di perairan berasal dari kegiatan manusia. Pada umumnya bahan pencemar tersebut berasal dari berbagai kegiatan industri, pertanian dan rumah tangga. Salah satu sumber bahan pencemar yang berasal dari limbah pertanian adalah DDT yang terkandung dalam Roundoup. Secara umum dampak negatif dari pemakaian pestisida maupun insektisida sintesis adalah : 1) pencemaran air dan tanah yang akhirnya akan kembali lagi kepada manusia dan makhluk hidup lainnya dalam bentuk makanan dan minuman yang tercemar. Bahkan untuk beberapa jenis pestisida sintesis, residunya dapat bertahan di tanah dan air hingga puluhan tahun; 2) matinya musuh alami dari organisme pengganggu tanaman (OPT); 3) kemungkinan terjadinya serangan hama sekunder; 4) kematian organisme yang menguntungkan, seperti lebah yang sangat berperan dalam penyerbukan bunga; 5) timbulnya kekebalan OPT terhadap pestisida sintesis. (Novizan, 2002) 2.8. Pendugaan Populasi Klasifikasi Ikan Nila yaitu Ordo Perciformes, Family Chiclidae, Genus Oreochromis, Spesies Orechromis niloticus (Kottelat et.all. 2003)

Gambar 5. Morfologi Ikan Nila (Oreochromis niloticus) Ikan Nila bentuk tubuhnya pipih compressed, badan tinggi, kepala besar, sisik besar-besar, gurat sisi terputus di bagian tengah-tengah badan. Sirip punggung dan sirip dubur memiliki jari-jari keras seperti duri. Warna tubuh cerah dibandingkan ikan Mujair. Tubuhnya simetris bilateral, sirip ekor berpinggiran tegak, termasuk kedalam kelas Osteichthyes. Hidung monorhinous. Linea lateralis tidak sempurna karena terputus. Bibir tebal, mulut lebar, moncong panjang, bibir atas berhubungan dengan bibir bawah. Letak mulut tegak lurus didepan bola mata. Tubuh dipenuhi sisik dan bagian ekornya/sirip ekornya terdapat 5 garis hitam. Hidup diperairan tawar. Ikan Nila bentuk tubuhnya seperti ikan mujair, tetapi warnanya lebih cerah, dan dapat tumbuh lebih besar, panjangnya dapat mencapai sampai 50 cm. Ikan ini tersebar di Afrika Timur, Afrika Barat dan Syria. Di Indonesia belum lama dikenal. Tubuhnya jelas lebih besar dari pada ikan Mujair yang sudah ada, tetapi berkembang biaknya lebih lambat (Djuhanda, 1993). Effendie (1997) menyatakan bahwa populasi ikan yang akan dipelajari sebaiknya memperlihatkan satuan usaha dari populasi tersebut, yang baik hasilnya dari hasil ini apabila jumlah ikan yang tertangkap seleruhnya sekurang – kurangnya sepertiga dari jumlah di dalam populasi, satuan usaha maksudnya seperti hasil tangkapan kapal tertenty pada tiap hari atau minggu dan bulan. Krebs (1972) menyatakan bahwa densitas atau abudance adalah jumlah perunit area atau per unit volume yang dinamakan kepadatan mutlak, sedangkan kepadatan nixbi dari suatu populasi misalnya membandingkan keberadaan populasi spesies ikan tetentu di perairan habitat A lebih banyak dari perairan habitat C.

Pemberian tanda secara marking adalah dengan cara tidak menempelkan benda asing ketubuh ikan akan tetapi dengan cara pemotongan salah satu sirip ikan atau sirip lainnya, dengan syarat setelah sirip dipotong maka tidak akan mengganggu aktivitas ikan sehingga memudahkan untuk menangkap kembali. Pemberian tanda tato pada overculum ikan, pemberian lubang pada overculum ikan. (Effendie, 1997) Sebenarnya populasi mengikuti labih dari satu sifat yaitu : 1. Populasi yang terpisah secara geografi dengan yang lainnya mempunyai kesempatan walaupun sedikit untuk tukar genetis. 2. Dari populasi yang berkelompok yang dinamakan off nes terdapat satu seri perubahan yang gradual. 3. Populasi yang berkelompok harus disertai dengan perbedaan yang tajam dengan daerah hibridasi diantaranya (Royce dalam Pulungan et al, 2006). Faktor-faktor yang menentukan hadirnya suatu individu di suatu lokasi perairan menurut (Mcnoughton dan Wolf, 1990) adalah distribusi spesies, distribusi lokal akan diatur oleh keseragaman perairan dan predator. Distribusi spesies pada habitatnya mengelompok menandakan ada faktor kecil yang dominan berfungsi sebagai pembatas. (Odum, 1971) menyatakan bahwa mengelompoknya individu dalam suatu populasi disebabkan oleh respon terhadap lokasi yang berbeda, cuaca dan hasil dari proses reproduksi. Selanjutnya (Tee, 1992) menyatakan penyebaran fauna umumnya terjadi secara mendatar tergantung pada jaraknya dari perairan utama (laut) serta adaptasi fauna terhadap perubahan lingkungan. Keberadaan suatu populasi dalam perairan dapat diduga melalui metode pendugaan populasi yang terbagi dua yaitu : 1) Secara langsung yang dilakukan dengan pengeringan pada suatu kolam yang luarnya terbatas dan dihitung satu per satu, selain itu dapat dilakukan dengan pemotretan gerombolan ikan-ikan pelagis yang hidup di laut dan dapat mengetahui kepadatannya. 2) Secara tidak langsung, dengan memperhatikan pengurangan ―Catch per Unit Effort―. Dalam perhitungan menggunakan metode regresi dari De Lury, Leslie dan Davis. Dan dapat juga dengan metode penandaan (marking dan tagging). (Pulungan, 2006). Selanjutnya dikatakannya bagian-bagian tubuh ikan yang diberi tag adalah : a) Kepala yang meliputi tulang rahang, dan tutup insang, b) Bagian tubuh yang meliputi bagian depan sirip punggung, bagian belakang sirip punggung, sirip lemak (adipose fin) dan batang ekor. Effendie (1997) menyatakan bahwa populasi ikan yang akan dipelajari sebaiknya memperlihatkan satuan usaha dari populasi tersebut, yang baik hasilnya dari hasil ini apabila jumlah ikan yang tertangkap seleruhnya sekurang – kurangnya sepertiga dari jumlah di dalam populasi, satuan usaha maksudnya seperti hasil tangkapan kapal tertentu pada tiap hari atau minggu dan bulan Pemberian tanda secara marking adalah dengan cara tidak menempelkan benda asing ketubuh ikan akan tetapi dengan cara pemotongan salah satu sirip ikan atau sirip lainnya, dengan syarat setelah sirip dipotong maka tidak akan mengganggu aktivitas ikan sehingga memudahkan untuk menangkap kembali. Pemberian tanda tato pada overculum ikan, pemberian lubang pada overculum ikan. (Effendie, 1997) 2.9. Larva Ikan Ikan betina yang telah matang gonad dan siap untuk memijah sebelumnya akan dibuahi oleh spermatozoa maka di dalam sel telur akan terjadi peleburan dan penyatuan kedua inti sel. Pada saat ini mulai terbentuk zygot yang kemudian diikuti dengan pembelahan hingga terbentuknya individu ikan lalu menetas dan keluar dari cangkangnya yang disebut dengan larva (Pulungan et

al, 2005) Effendie (1997) menyatakan bahwa anak ikan yang baru menetas disebut dengan larva dimana tubuhnya belum dalam keadaan sempurna, baik organ dalam maupun organ luarnya. Dibidang budidaya larva yang baru keluar dari telur disebut hatchling. Semasa perkembangannya larva terdiri dari prolarva dan postlarva. Prolarva ialah larva yang masih memiliki kantung kuning telur berbentuk bundar, oval atau oblong, tubuhnya tran sparan dengan beberapa butir pegment. Sirip dada dan ekor sudah ada tetapi belum sempurna bentuknya, sedangkan sirip perut berupa tonjolan, mulut dan rahang belum berkembang, usus masih berupa tabung lurus. Sistem pernafasan dan peredaran darah tidak sempurna, makanan dari kuning telur yang dibawa oleh telur. Sedangkan postlarva yaitu larva yang mulai kehilangan kantung kuning telur, mata berpigment, gelembung udara gelap, mulut terbentuk, sirip dada membesar,bntuk badan silinder atau pipih maupun bervariasi, sebagian besar organ sudah terbentuk sehingga diakhir postlarva secara morfologi hampir menyerupai bentuk ikan dewasa (Permana, 1987). Jhingran (1975) menerangkan bahwa tahap larva adalah tahap paling kritis dalam kehidupan ikan karena banyak faktor penyebab mortalitas mulai dari larva, menetas ke alam sampai dapat mencari makanan sendiri. Terjadinya mortalitas itu karena faktor lingkungan dan diri larva itu sendiri. Kematian larva karena lingkungan disebabkan oleh beberapa faktor yaitu faktor biologi diantaranya makanan, predator dan kanibal, faktor kimia diantaranya pencemaran, oksigen terlarut, derajat keasaman, dan salinitas, sedangkan faktor fisika diantaranya suhu perairan, arus, dan turbiditas. Larva yang organ – organ tubuhnya mulai terbentuk secara sempurna dan mulai berfungsi akan memasuki masa juvenil dan akhirnya menyerupai bentuk ikan dewasa ( Blaxter, 1969). III. METODE PRAKTIKUM 3.1 Waktu dan Tempat Praktikum Biologi Perikanan dilaksanakan mulai tanggal 19 September sampai tanggal 19 Desember 2006. Bertempat di Laboratorium Biologi Perikanan Fakultas Perikanan dan Ilmu Kelautan, Universitas Riau. 3.2. Bahan dan Alat Bahan yang digunakan setiap praktikum Biologi Perikanan adalah berupa ikan-ikan segar (baik yang hidup maupun yang mati). Sedangkan alat-alat yang digunakan selama praktikum seperti baki untuk meletakkan ikan, gunting bedah untuk membedah bagian-bagian tertentu ikan, scapel untuk memotong daging ikan, pinset untuk mengambil organ yang akan diamati, timbangan Sartorius untuk menimbang berat, mikroskop untuk melihat organ-organ kecil, serbet untuk membersihkan, alat-alat tulis untuk mencatat hasil praktikum. 3.3. Metode Praktikum Metode yang digunakan selama praktikum Biologi Perikanan menggunakan metode/pengamatan secara langsung terhadap objek atau ikan sampel. 3.4 Prosedur Praktikum 3.4.1. Seksualitas Ikan

Adapun prosedur praktikum yang dilakukan yaitu setibanya di Laboratorium praktikan langsung mempersiapkan alat dan bahan, setelah itu melakukan pengamatan terhadap bahan praktikum diantaranya menimbang berat ikan, mengukur panujang total (TL), panjang baku (SL),panjang fork (FL), panjang kepala (HdL), tinggi badan (BdH), setelah itu menentukan jenis kelamin dari individu ikan dengan cara membedah bagian abdominal ikan, dan mengamati ciri seksual primer. Setelah ikan telah dibedah maka perhatikan antara ikan jantan dan ikan betina terhadap cirri seksual sekunder yang dimiliki meliputi seksual dimorphisme maupun seksual dichromatisme. Data yang didapat dijadikan sebagai laporan kerja sementara. Setelah itu dibuat dalam laporan individu dari setiap praktikan. [ 3.4.2. Kematangan Gonad Adapun prosedur praktikum yang dilakukan yaitu setibanya di Laboratorium praktikan langsung mempersiapkan alat dan bahan, setelah itu melakukan pengamatan terhadap bahan praktikum diantaranya menimbang berat ikan, mengukur panujang total (TL), panjang baku (SL),panjang fork (FL), panjang kepala (HdL), tinggi badan (BdH), setelah itu menentukan jenis kelamin dari individu ikan dengan cara membedah bagian abdominal ikan, dan mengamati ciri seksual primer. Selanjutnya, gonad yang ditemukan pada setiap ikan yang telah dibedah tadi, tentukan tingkat kematang gonadnya menurut Nikolsky (1963) dan Kesteven (Begenal dan Bram 1968). Ukur panjang gonad tersebut dengan penggaris dan ukur juga panjang rongga tubuh pada setiap ikan untuk menghitung perbandingannya. Kemudian gonad tersebut ditimbang dengan menggunakan timbangan sartorius. Apabila terdapat ovari yang telah matang gonad, maka disimpan dengan menggunakan botol yang telah berisi formalin untuk digunakan pada praktikum fekunditas yaitu menghitung jumlah telur yang terdapat pada setiap kantong ovari. Setelah kita mendapatkan data dari pengukuran tadi, maka data yang didapat dijadikan sebagai laporan kerja sementara. Setelah itu dibuat dalam laporan individu dalam bentuk paper untuk setiap praktikan dan dikumpul sebelum masuk praktikum sebelumnya. Praktikum selesai dilaksanakan, cuci nampan dan keringkan kemudian bersihkan meja praktikum. 3.4.3. Fekunditas dan Diameter Telur Adapun prosedur praktikum yang dilakukan yaitu setibanya di Laboratorium, praktikan langsung mempersiapkan alat dan bahan, setelah itu melakukan pengamatan terhadap bahan praktikum diantaranya mengambil telur pada bagian anterior, tengah, dan posterior baik pada sisi kanan maupun sisi kiri. Letakkan sebanyak 5 telur yang telah diambil dari tempat tadi pada objek glass untuk dilihat nilai sebaran telur pada ovari ikan tersebut. Kemudian setelah diukur berapa diameter telur masukkan kedalam table dengan syarat nilai yang telah didapat dikalikan dengan perbesarannya yaitu 40x10 (0,025). Pengamatan selanjutnya menghitung fekunditas ikan dengan menggunakan metode gabungan yaitu menghancurkan telur yang telah diberikan formalin ke dalam sebuah cawan Petri dengan menggunakan air 10 ml. Setelah hancur, telur ikan dimasukkan ke dalam gelas ukur setinggi 0,5. Kemudian, timbang berat ikan tersebut didalam timbangan sartorius. Telur yang ditimbang tadi dihitung satu persatu untuk mendapatkan nilai x. Jika telah didapat semua nilai, masukkan kedalam rumus dan hitung nilai fekunditasnya. Data yang diperoleh dijadikan laporan sementara dan nanti akn dipindahkan ke dalam laporan individu dalam bentuk paper.

3.4.4. Analisa Isi Saluran Pencernaan Adapun prosedur praktikum yang dilakukan yaitu setibanya di Laboratorium praktikan langsung mempersiapkan alat dan bahan, setelah itu melakukan pengamatan terhadap bahan praktikum diantaranya membedah bagian abdominal ikan untuk mengambil lambung ikan ikan Lele dumbo (Clarias gariepinus) tersebut, menghitung volume lambung berisi maupun volume lambung kosong dengan menggunakan gelas ukur, mengamati isi dari lambung ikan dengan menggunakan mikroskop dan menentukan makanan yang paling dominan dimakan oleh ikan ikan Lele dumbo (Clarias gariepinus) dan data yang diperoleh dijadikan laporan sementara. 3.4.5. Penentuan Umur Ikan Melakukan pengamatan dengan mengiris bagian kepala ikan Selar (Caranx leptolepis), kemudian mengambil tulang otolithnya dengan cara mengiris bagian kepalanya.. Lalu diamati dengan menggunakan mikroskop, kemudian data yang diperoleh dijadikan laporan sementara 3.4.6. Mortalitas Ikan Prosedur yang dilaksanakan dalam praktikum ini adalah sebagai berikut dua buah akuarium yang telah disediakan yang berukuran 60 x 30 x 30 diisi dengan air sebanyak 20 liter. Setelah terisi, air dibiarkan selama ± 10 menit. Setelah itu masukkan 3 ekor ikan ke dalam salah satu akuarium, ikan ini merupakan ikan uji. Sedangkan untuk yang dua ekor lagi masukkan dijadikan kontrol normal yang tidak diberi perlakuan insektisida. Setelah itu, ikan diaklimatisasi selama ± 15 menit, selama proses aklimatisasi catat tingkah laku ikan baik ikan uji maupun ikan kontrol mulai dari gerakan, jumlah bukaan mulut dan tutup insang dan gerakan sirip. Setelah 15 menit pertama, masukkan 15 ml baycline ke dalam akuarium ikan uji, amati tingkah lakunya seperti 15 pertama. Kemudian setelah 15 menit, ambil satu ikan uji bedah dan amati warna isang serta jantungnya. Selanjutnya masukkan lagi i5 nl baycline pada ikan uji amati selama 15 menit, setelah 15 menit ambil ikan untuk dibedah. Perlakuan tersebut terus diulang sampai semua ikan yang ada dalam akuarium mati. Catat berapa ml baycline yang digunakan sampai ikan yang terakhir mati dan hitung juga konsentrasinya, serta catat waktu kematian masing-masing ikan uji. Setelah semua selesai diamati bersihkan semua alat-alat yang digunakan selama praktikum. Kemudian buat laporan dalam bentuk paper yang akan dikumpulkan sebagai syarat untuk mengikuti praktikum minggu berikutnya. 3.4.7. Pendugaan Populasi Prosedur yang digunakan pada praktikum Pendugaan Populasi ini adalah, benih ikan nila dimasukkan ke dalam ember hitam, kemudian ditangkap dengan menggunakan saringan. Penangkapan dilakukan secara acak. Ikan yang sudah tertangkap, di beri tanda dengan memotong sirip ekornya untuk membedakan dengan ikan yang belum diberikan tanda. Kemudian dilakukan lagi penangkapan secara acak, dan di catat ikan yang sudah di beri tanda apabila tertangkap kembali dan ikan yang belum diberi tanda yang tertangkap juga dicatat kemudian beri tanda pada ikan yang belum diberi tanda. Dilakukan berulang-ulang sampai 10 kali. Hitung dengan menggunakan metode Petersen, Zoe Scehnebel, Schumecher dan Eschmeyer berikut nilai biasnya. Pindahkan di laporan sementara.

3.4.8. Larva Ikan Adapun prosedur praktikum yang dilakukan yaitu pengamatan terhadap bahan praktikum dengan melihat larva dibawah mikroskop untuk melihat periode yang sedang dialaminya serta melihat organ-organ yang telah terbentuk, setelah itu gambar bentuk objek yang terlihat dan dilakukan berulang-ulang sebanyak larva yang telah disiapkan. Kemudian dibuat laporan sementara.

IV. HASIL DAN PEMBAHASAN 4.1. Hasil 4.1.1. Seksualitas Ikan Dalam praktikum pengenalan dan identifikasi terhadap jenis-jenis ikan diperoleh hasil dengan melakukan perhitungan dan pengukuran terhadap objek prakrikum tersebut. Dimana hasil yang diperoleh berupa datadata morphometrik dan data meristik yang meliputi TL, SL, FL, HdL, BdH, jumlah jari-jari sirip pada setiap sirip yang terdapat pada spesies ikan tersebut, jumlah sisik, bentuk mulut, bentuk ekor serta klasifikasi dari spesies ikan yang dipraktikumkan. Dari praktikum yang telah dilakukan maka diperoleh data sebagai berikut : Tabel 1. Penentuan seksualitas ikan No. Berat Ikan (gram) TL (mm) SL (mm) BdH (mm) HdL (mm) FL (mm) Jenis Kelamin 1. 50 180 140 40 35 150 Jantan 2. 50 180 140 40 40 150 Jantan 3. 60 185 145 45 40 153 Betina 4. 60 185 145 45 40 153 Jantan 5. 48 170 130 40 35 140 Jantan 6. 49 175 135 40 37 143 Jantan 7. 50 180 140 45 43 150 Jantan 8. 60 185 145 40 40 153 Jantan 9. 50 165 145 45 40 153 Jantan 10. 50 188 145 45 40 155 Betina 11. 47 175 135 45 40 145 Jantan 12. 47 175 138 45 40 145 Jantan 13. 50 180 140 45 40 145 Jantan 14. 45 165 125 40 35 135 Betina 15. 45 160 125 35 30 130 Betina 16. 20 170 135 35 30 140 Jantan 17. 60 190 145 45 42 155 Betina 18. 50 190 145 45 42 155 Jantan 19. 50 180 140 40 30 150 Betina 20. 40 165 130 45 40 135 Betina 21. 35 160 120 40 38 125 Jantan 22. 50 180 136 45 42 146 Betina

23. 50 178 135 40 42 145 Jantan 24. 40 145 116 35 35 126 Jantan 25. 30 162 127 37 30 136 Jantan Data diatas didapat pada saat melakukan pembedahan ikan dan langsung melihat gonad yang dimiliki oleh setiap ikan secara langsung atau juga disebut dengan seksual primer. Sehingga dapat diketahui bahwa ikan jantan sebanyak 17 ekor, sedangkan betina sebanyak 8 ekor. Sedangkan seksual sekunder dimorphisme maupun seksual dichromatisme yang dimiliki ikan motan ini adalah sebagai berikut : Tabel 2. Seksual dimorphisme dan seksual dichromatisme a. Seksual dimorphisme Jantan Betina Permukaan kepalan halus Permukaan kepala kasar Bentuk abdominal tidak membundar Bentuk abdominal membundar b. Seksual dichromatisme Jantan Betina Warna tubuh lebih cerah Warna tubuh tidak begitu cerah Warna sirip punggungnya lebih cerah Warna sirip punggung tidak begitu cerah Warna testes ikan jantan putih susu, sedangkan warna ovari ikan betina adalah hijau pekat, ini dipengaruhi oleh makanan yang makan oleh ikan motan ini. 4.1.2. Kematangan Gonad Dari praktikum yang telah dilakukan mengenai Tingkat Kematangan Gonad ikan, dihasilkan klasifikasi dan data morphometrik dan berat tubuh ikan rata-rata sebagai berikut: Tabel 3. Morfometrik ikan motan jantan dan betina serta berat ikan tersebut No. Berat Ikan (gram) TL (mm) SL (mm) BdH (mm) HdL (mm) FL (mm) Jenis Kelamin 1. 50 180 143 43 40 154 Jantan 2. 50 172 137 40 35 147 Jantan 3. 50 172 134 40 40 146 Jantan 4. 50 173 140 41 37 149 Jantan 5. 40 164 132 37 38 138 Jantan 6. 50 185 145 40 40 155 Jantan 7. 50 175 130 35 35 145 Jantan 8. 50 175 130 45 45 145 Jantan 9. 50 165 125 40 35 135 Jantan 10. 50 170 135 40 40 145 Jantan 11. 60 180 145 45 40 155 Jantan 12. 50 175 140 45 40 145 Jantan 13. 50 170 135 45 40 145 Jantan 14. 40 170 130 40 40 135 Jantan 15. 70 190 145 45 40 150 Betina 16. 50 165 130 40 35 140 Jantan 17. 50 180 140 40 35 150 Jantan 18. 50 180 140 40 35 150 Jantan 19. 50 180 140 45 40 150 Betina 20. 50 175 135 40 35 145 Jantan 21. 50 175 135 40 30 145 Jantan

22. 50 170 132 40 30 140 Jantan 23. 50 170 130 40 30 135 Jantan 24. 48 165 130 40 35 135 Jantan 25. 48 165 127 40 30 135 Jantan Tabel 4. Tabel Perbandingan/Ratio Perbandingan antara Panjang Gonad dengan Panjang Rongga Tubuh NO. Pjg Rongga Tubuh (mm) Pjg Gonad (mm) Ratio Perbandingan (mm) Jenis Kelamin Jantan Betina 1. 45 65 0,85 Jantan 2. 50 60 1,2 Jantan 3. 50 60 1,2 Jantan 4. 55 65 1,18 Jantan 5. 50 60 1,2 Jantan 6. 55 65 1,18 Jantan 7. 50 60 1,2 Jantan 8. 50 60 1,2 Jantan 9. 50 55 0,9 Jantan 10. 45 55 0,81 Jantan 11. 50 60 0,83 Jantan 12. 47 58 0,81 Jantan 13. 48 60 0,8 Jantan 14. 45 55 0,81 Jantan 15. 60 75 0,8 Betina 16. 60 75 0,8 Jantan 17. 65 80 0,81 Jantan 18. 60 75 0,8 Jantan 19. 70 85 0,82 Betina 20. 65 80 0,81 Jantan 21. 50 60 0,83 Jantan 22. 48 60 0,8 Jantan 23. 55 65 0,85 Jantan 24. 50 60 0,83 Jantan 25. 53 65 0,82 Jantan Tabel 5. Tabel Indeks Kematangan Gonad Ikan Motan No. Berat IKG (%) Tingkat Kematangan Gonad Brt tbh+gonad Brt Gonad Nikolsky Kesteven 1. 50 gr 0,4458 gr 0,8916 % I II 2. 50 gr 0,1365 gr 0,2730 % I II 3. 50 gr 0,2808 gr 0,5616 % II III 4. 50 gr 0,3985 gr 0.7790 % II III 5. 40 gr 0,3235 gr 0,8087 % II III

6. 50 gr 0,4138 gr 0,8276 % II III 7. 50 gr 0, 2501 gr 0,5002 % II III 8. 50 gr 0,2510 gr 0,2020 % II III 9. 50 gr 0,0744 gr 0,1488 % II III 10. 50 gr 0,5048 gr 1,0096 % III IV 11. 60 gr 0,3962 gr 0,6603 % II III 12. 50 gr 0,5560 gr 1,1120 % III IV 13. 50 gr 0,7122 gr 1,4244 % II III 14. 40 gr 0,3392 gr 0,8480 % III IV 15. 70 gr 6,0583 gr 8,6547 % IV V 16. 50 gr 0,2257 gr 0,4514 % III IV 17. 50 gr 0,6080 gr 1,2160 % III IV 18. 50 gr 0,3645 gr 0,7290 % III IV 19. 50 gr 7,0266 gr 14,0532 % IV V 20. 50 gr 0,2720 gr 0,5440 % II III 21. 50 gr 0,3130 gr 0,6260 % III IV 22. 50 gr 0,1902 gr 0,3804 % I II 23. 50 gr 0,2902 gr 0,5804 % III IV 24. 48 gr 0,2838 gr 0,5913 % III IV 25. 48 gr 0,1488 gr 0,3100 % III IV Dari Tabel 5 diambil data ikan sampel yaitu untuk ikan jantan adalah ikan no. 5 dan ikan betina adalah ikan no. 19, gonad pada ikan motan . Dari data ini dilakukan penimbangan terhadap masing-masing gonad ikan dan penghitungan IKG (Indeks Kematangan Gonad) atau sering disebut Coeffisien Kematangan Gonad atau Gonado Somatic Index, yaitu suatu nilai dalam persen sebagai hasil dari perbandingan berat gonad dengan berat tubuh ikan termasuk gonad dikali dengan 100 %. Rumus IKG : Bg IKG = X 100 % Bt Keterangan : IKG = Indeks Kematangan Gonad Bg = Berat Gonad dalam gram Bt = Berat tubuh dalam gram a. IKG untuk Testes (Sampel no. 1) Dik : Berat testes = 0,3235 gr Berat ikan = 40 gr Dit : IKG ? 0,4458 IKG = X 100 % = 0,8916 % 50 b. IKG untuk Ovari (Sampel no. 19)

Dik : Berat ovari = 7,0266 gr Berat ikan = 50 gr Dit : IKG ? 7,0266 IKG = X 100 % = 14,0532 % 50 4.1.3. Fekunditas dan Diameter Telur Pada praktikum kali ini, fekunditas dihitung dengan menggunakan metode gabungan. Metode gabungan adalah metode yang menggabungkan metode-metode sebelumnya yaitu metode volumetric, gravimetrik, dan metode jumlah. Adapun rumus pada metode gabungan ini adalah sebagai berikut : F= Keterangan : F : Fekunditas G : Berat gonad (gr) V : Volume pengenceran (ml) X : Jumlah butir telur setelah ditimbang dengan menggunakan timbangan sartorius. Q : Berat telur contoh (sub-sampel) pada tabung ukur 0,5 Dengan menggunakan rumus metode gabungan tadi, maka dapat dihitung nilai fekunditas ikan Motan (Thynnichthys thynnoides) Diketahui : Berat gonad (G) = 7,0266 gr Volume pengenceran (V) = 10 ml Jumlah butir telur (x) = 1882 butir Berat telur (Q) = 0,8398 gr Ditanya : Fekunditas (F) ? Jawab : F = F= F= F = 157466,792 F = 157467 Telur yang telah diambil dari bagian anterior, tengah, posterior kemudian dijajarkan pada objek glass dan dilihat serta ditentukan diameter telurnya dengan menggunakan mikroskop mikrookuler, maka didapat ukuran sebagai berikut : Tabel 6. Diameter telur ikan motan (Thynnichthys thynnoides) Ket. Kiri Kanan Anterior 25 20 30 25 20 33 27 25 30 25 Tengah 25 20 25 30 30 27 33 30 25 30 Posterior 30 25 28 25 20 25 29 20 20 23 Karena pembesaran yang digunakan adalah 40x10, maka nilai diatas dikalikan dengan 0,025. Sehingga didapat hasil pada tabel berikut : Tabel 7. Diameter telur ikan yang dikalikan dengan perbesaran 40x10 (0,025) Ket Kiri Kanan Anterior 0,625 0,5 0,75 0,625 0,5 0,825 0,675 0,625 0,75 0,625 Tengah 0,625 0,5 0,625 0,75 0,75 0,675 0,825 0,75 0,625 0,75

Posterior 0,75 0,625 0,7 0,625 0,5 0,625 0,725 0,5 0,5 0,575 Setelah didapatkan nilai diatas, kemudian ditabulasikan ke dalam tabel berikut. Tabel 8. Ukuran diameter telur dari keenam bagian ovari ikan Diameter telur (mm) Frekuensi (butir) Kiri Kanan Anterior Tengah Posterior Anterior Tengah Posterior 0,5 II I I II 0,575 I 0,625 II II II II I I 0,675 I I 0,7 I 0,725 I 0,75 I II I I II 0,825 I I Jumlah = 5,375 5 5 5 5 5 5 Dari data diatas, dilanjutkan dengan menghitung jumlah (∑) diameter telur rata-rata dengan menggunakan rumus sebagai berikut : telur rata-rata = Keterangan : telur rata-rata : diameter telur dibagi jumlah telur (mm) : diameter telur ikan n : jumlah telur ikan yang diamati Diket : = 5,375 n = 30 Ditanya : telur rata-rata? Jawab : telur rata-rata = = 0,1792 Jadi, pada ke 30 diameter yang diambil dari 6 tempat bagian ovari memiliki diameter telur sebesar 0,1792 mm. 4.1.4. Analisa Isi Saluran Pencernaan Tabel 9. Morfometrik , mulut, dan susunan insang ikan Lele dumbo ( Clarias garipinus) Ikan Morfometrik Bukaan mulut Posisi mulut Jenis gigi Susunan insang TL SL Bdh HdL I 270 230 35 65 25 Lebar dan berada tegak lurus dibelakang bola mata Vilivorm Tidak rapat II 260 225 35 60 20 III 250 220 35 55 20 Setelah diukur data diatas, ketiga ekor ikan dibedah dan diambil saluran pencernaannya yaitu lambung dan intestine. Ketiga lambung tersebut yang masih berisi makanan dimasukkan ke dalam tabung ukur 10 ml. Lambung beserta usus ketiga ikan lele tersebut kemudian dikeluarkan semua isinya dan dimasukkan ke dalam cawan Petri. Setelah semua isi lambung dan intestine dikeluarkan, maka usus dan lambung tadi dimasukkan ke dalam tabung ukur 10 ml air. Kemudian hitung berapa selisih volume air yang dimasukkan lambung berisi dan lambung yang kosong. Tabel 10. Volume kenaikkan lambung berisi dan lambung kosong beserta selisihnya.

Ikan Volume lambung dan usus berisi dalam 10 ml air Volume lambung dan usus kosong dalam 10 ml air Selisih 1. 10 ml air  14 ml 10 ml air  13,5 ml 0,5 ml 2. 10 ml air  13 ml 10 ml air  12,5 ml 0,5 ml 3. 10 ml air  12,5 ml 10 ml air  12 ml 0,5 ml Isi lambung yang dimasukkan ke dalm cawan Petri tadi kemudian diencerkan dengan air 10 ml. Setelah encer, ambil cairan tersebut ke dalam pipet tetes dan diletakkan pada objek glass untuk diamati di bawah mikroskop. Pengamatan dalam mikroskop sebanyak 3 kali ulangan / 3 tetes dan dari 3 sudut pandang. Lihat jenis makanan dan dimasukkan ke dalam table. Tabel 11. Jenis makanan Ikan Lele dumbo (Clarias gariepinus) Jumlah makanan Ikan Jumlah Persentase I II III 1.

Anabaeropsis raciborskii wal 6 3 5 14 x100%=18,42% 2.

Lyngbya spirulinoides Gom 4 5 3 12 x100%=15,79% 3. Gomphosphaeria aponina Kg 18 10 8 36 x100%=47,37% 4. Cylendrocystis brebissoni Menegh - 6 - 6 x100%=7,89% 5. Glococystus vesiculosa Naeg - - 8 8 x100%=10,53%

4.1.5. Penentuan Umur Ikan Hasil yang didapat pada praktikum kali ini sebagai berikut: Tabel 12. Ukuran Morphometrik No. TL SL HdL BdH FL 1. 180 150 45 55 160 2. 190 155 43 50 170 3. 195 160 45 45 165

Gambar 6. Otolith Ikan Selar (Selaroides leptolepis)

Perhitungan berat otolith ikan Caranx leptolepis: 1) Kanan = 0,0001g Kiri = 0,0009 g 4.1.6. Mortalitas Ikan 4.1.6.1. Deskripsi Ikan Lele dumbo Saanin (1984) mengklasifikasikan ikan Nila kedalam kelas Pisces, subkelas Teleostei, ordo Ostariphysi, subordo Siluridea, famili Claridae, genus Clarias, species Clarias gariepinus.

Gambar 7. Morfologi Ikan Lele dumbo (Clarias gariepinus) 4.1.6.2. Perhitungan Volume Air Aquarium. V = p x l x t Dimana: V = Volume air (liter) 20 = 60 x 30 x t p = Panjang aquarium (cm) 20.000 = 1800 t l = Lebar aquarium (cm) t = t = Tinggi Air (cm) t = 11,1 cm

4.1.6.3. Reaksi Ikan Terhadap Zat Pencemar Setelah dilakukan proses pengamatan selama lima belas menit, ikan uji diberi perlakuan berupa pemberian detergen sebanyak 20 gr setiap 15 menit, kemudian diamati bukaan mulut, bukaan operculum serta tingkah laku ikan. Tabel 13. Hasil Pengamatan Reaksi Ikan Lele dumbo (Clarias gariepinus) terhadap bahan pencemar baycline. Waktu Bukaan Bukaan Operculum Detak Jantung Pergerakan Ikan Ikan Kontrol 15 menit 82 96 98 Ikan berenang dengan arah teratur Ikan Uji 1 15 menit 124 133 73 Ikan berenang dengan tak teratur Ikan Uji 2 15 menit 30 menit 121 129 132 146 69 Ikan melompat keatas perairan

Ikan Uji 3 15 menit 30 menit 45 menit 121 136 138 129 135 142 70 Ikan membenturkan tubuhnya kedinding Insang pada ikan kontrol terlihat berwarna merah, sedangkan ikan uji 1 yang sudah tercemar insang berwarna sedikit lebih gelap. Begitu juga dengan ikan uji 2 yang berada 15 menit lebih lama dari ikan uji 1, warna insang lebih merah hati sampai pada ikan uji 3, insang berwarna merah hati dan warna tubuh ikan secara keseluruhan menjadi lebih pucat. 4.1.7. Pendugaan Populasi Adapun data yang didapatkan dari praktikum adalah sebagai berikut: Tabel 14. Pendugaan populasi pada ikan Nila Penangkapan u r u+r m m.r m(u+r) m2(u+r) 13030000 2 7 0 7 0+3=3 0 21 63 3 4 1 5 3+7=10 10 50 500 4 4 6 10 10+4=14 84 140 1.960 5 1 6 7 14+4=18 108 126 2.268 6 2 9 11 18+1=19 171 209 3.971 7 1 8 9 19+2=21 168 189 3.969 8 3 5 8 21+1=22 110 176 3.872 9 5 9 14 21+3=25 225 350 8.750 10 2 5 7 25+5=30 150 210 6.300 Jumlah 30 49 71 162 1.026 1.471 31.653 1. Metode Petersen Dilakukan pada penangkapan ke-III karena pada penangkapan kedua ikan yang bertanda tidak dapat ditangkap (r = 0). P^ = P^ = = 50 Bias = Bias = Bias = 0 % (tidak terhingga) 2. Metode Zoe scahnabel P^ = = = 30,0204 Bias = x100% Bias = Bias = 39, 96%

3. Metode Schumecher dan Eschmeyer P^ = = = 30,8509 Bias = x100% Bias = Bias = 38,30% Kesimpulan : melihat dari perhitungan indeks bias yang relatif kecil adalah metode Petersen sebesar 0 % sehingga kebiasan pendugaan populasi semakin kecil artinya mendekati tingkat kebenaran. 4.1.8. Larva Ikan Ikan lele dumbo diklasifikasikan ke dalam kelas Pisces, Sub kelas Teleostei, Ordo Ostariophysi, Sub ordo Siliraodae, Family Clariidae, Genus Clarias, Spesie Clarias gariepinus (Saanin, 1984).

Gambar 8. Morfologi Prolarva Ikan Lele dumbo (Clarias gariepinus)

Gambar 9. Morfologi Postlarva Ikan Lele dumbo (Clarias gariepinus) Adapun hasil yang diperoleh dalam praktikum ini yaitu antara larva yang satu dengan yang lain mempunyai ciri-ciri morfologi yang berbeda, hal ini dapat dikarenakan oleh perbedaan usia larva walaupun hanya berbeda beberapa jam. Tabel 15. Data Larva Ikan Lele (Clarias gariepinus) No. Prolarva Postlarva Ciri - Ciri 1  Kuning telur sedikit, belum ada bukaan mulut, sirip belum terbentuk 2  Sudah terdapat bukaan mulut, sirip sudah hampir berbentuk sempurna 3  Sudah terdapat bukaan mulut, sirip sudah hampir berbentuk sempurna 4  Sudah terdapat bukaan mulut, sirip sudah hampir berbentuk sempurna 5  Sudah terdapat bukaan mulut, sirip sudah hampir berbentuk sempurna 6  Sudah terdapat bukaan mulut, sirip sudah hampir berbentuk sempurna 7  Kuning telur sedikit, belum ada bukaan mulut, sirip belum terbentuk 8  Sudah terdapat bukaan mulut, sirip sudah hampir berbentuk sempurna 9  Sudah terdapat bukaan mulut, sirip sudah hampir berbentuk sempurna 10  Sudah terdapat bukaan mulut, sirip sudah hampir berbentuk sempurna 4.2. Pembahasan

4.2.1. Seksualitas Ikan Gonad yang berkembang didalam tubuh individu ikan akan mempengaruhi pertambahan berat tubuh. Individu – individu ikan yang sudah matang gonad sempurna berat testes mempengaruhi pertambahan berat tubuh ikan jantan sekitar 10 – 15%, sedangkan pada ikan sekitar 15 – 25% (Pulungan, 2006) Ciri seksual ikan dapat dibagi menjadi dua, yaitu ciri seksual primer dan ciri seksual sekunder. Ciri seksual primer adalah alat atau organ yang berhubungan langsung dengan proses reproduksi. Sedangkan ciri seksual sekunder berguna dalam membedakan ikan jantan dengan ikan betina dan dapat dilihat dari luar, meskipun kadang kala tidak memberikan hasil yang positif (Bond, 1979). Testes dan salurannya pada ikan jantan serta Ovari dan salurannya pada ikan betina merupakan ciri seksual primer. Ikan Motan yang diamati ialah ikan Motan jantan. Menurut (Pulungan, 2006) pada ikan Motan jantan terdapat testes. Testes pada ikan terdapat dalam tubuh ikan jantan. Bentuknya juga bergantung pada rongga tubuh yang tersedia. Tetapi pada umumnya mempunyai bentuk tubuh yang memanjang. Jumlahnya sepasang dan menggantung pada mesenteries (mesorchia). Posisinya persis di bawah tulang punggung dan ginjal serta di samping gelembung udara. Warnanya bervariasi mulai dari transparan sampai berwarna putih susu. Sedangkan pada ikan Motan betina terdapat ovari yang terletak di samping kanan dan kiri gelembung renang, dibawah ruas-ruas vertebrae, di atas saluran pencernaan dan menggantung pada mesovaria, warnanya bervariasi mulai dari orange sampai kuning keemasan (Pulungan,2006) Alat pengeluaran atau organ uropoetica pada ikan Motan terdiri atas tiga bagian, antara lain : 1) mesonephros, terdapat sepasang berwarna merah tua dan terletak di antara gelembung renang dan tulang punggung. Mempunyai bentuk yang bervariasi, agak memanjang dan mempunyai bagian yang membesar yang terjepit di antara kedua bagian pneumatocyt. 2) ureter (ductus mesonephridicus), merupakan saluran keluar dari mesonephros 3) gelembung kencing (vesica urinaria), merupakan persatuan ureter kanan dan kiri (Pulungan, 2006). 4.2.2. Kematangan Gonad Gonad adalah organ reproduksi yang berfungsi menghasilkan sel kelamin (gamet). Gonad yang terdapat pada tubuh ikan jantan disebut testes berfungsi menghasilkan spermatozoa sedangkan gonad yang terdapat pada ikan betina disebut ovari yang nantinya akan menghasilkan telur (ovari). Gonad yang ada dalam tubuh ikan umumnya berjumlah sepasang. Gonad yang sepasang berfungsi untuk keseimbangan badan dalam bergerak. Tidak selamanya gonad yang disebelah kanan sama ukurannya dengan gonad disebelah kiri namun yang ukurannya lebih pendek akan menyeimbangkan diri dengan berat. Testes pada ikan terdapat dalam rongga tubuh, bentuknya sangat tergantung pada rongga tubuh yang tersedia tetapi umumnya berbentuk panjang, jumlahnya sepasang dan tergantung di sepanjang mesenteries pada rongga atas bagian tubuh. Posisinya persis di bawah tulang punggung di samping gelembung udara. Warna bervariasi mulai dari transparan sampai warna putih susu. Ovari pada ikan terdapat dalam tubuh, bentuknya juga tergantung pada rongga tubuh. Namun pada umumnya memanjang, jumlahnya sepasang dan menggantung kepada mesenteries (mesovaria). Posisinya persis di bawah tulang punggung dan ginjal serta di samping gelembung udara. Warnanya bervariasi mulai dari transparan sampai kuning emas dan keabu-abuan. (Pulungan et all, 2006) Untuk mempermudah mengetahui perkembangan gonad maka oleh para peneliti dilakukan

pentahapan terhadap perkembangan gonad yang bervariasi. Hal ini disesuaikan dengan kondisi jenis ikan yang dianalisa dan digunakan. Gonad yang terdapat di dalam tubuh mengalami perkembangan dari bentuk sehelai benang berisi cairan bening kemudian berkembang dan membesar sesuai dengan kapasitas rongga perut yang dimiliki individu ikan. Perkembangan gonad ini dipengaruhi oleh adanya perkembangan gamet yang diproduksi oleh gonad itu sendiri. Semakin matang gonad suatu individu ikan maka semakin besar bentuk dan berat gonad serta tubuh individu ikan. Beberapa peneliti memperkirakan pertambahan berat gonad ikan berkisar 10-25 % dari berat tubuh. Akan tetapi pada jenis ikan tertentu pertambahan gonad dapat mencapai 50 % dari berat tubuh. (Pulungan, 2005) Effendi (1997) pada proses reproduksi sebelum terjadi pemijahan sebagian besar hasil metabolisme tertuju untuk perkembangan gonad, gonad semakin bertambah berat diimbangi dengan bertambah ukurannya. Kemudian (Siregar, 1989) menyatakan bahwa perkembangan gonad ikan secara garis besar dibagi atas dua tahap perkembangan utama yaitu pertumbuhan gonad sehingga ikan mencapai tingkat dewasa kelamin (sexually mature) dan tahap pematangan produk seksual/ gamet. Tahap kematangan gonad yang umum digunakan menurut Kesteven yaitu 1) dara, 2) dara berkembang, 3) perkembangan I, 4) perkembangan II, 5) Bunting, 6) Mijah, 7) Mijah/salin, 8) salin/spent dan 9) pulih salin. Sedangkan menurut Nikolsky,tahap perkembangan gonad pada ikan terdiri dari 1) tidak masak, 2) tahap istirahat, 3) pemasakan, 4) masak, 5) reproduksi, 6) kondisi salin, 7) tahap istirahat. Selama proses reproduksi, sebagian besar hasil metabolisme tertuju pada perkembangan gonad. Hal ini menyebabkan terjadinya perubahan dalam gonad itu sendiri. Umumnya pertamabahan bobot gonad pada ikan betina 10 – 25 % dan pada ikan jantan 5 – 10 % dari bobot tubuh. Pengetahuan tentang perubahan/tahap-tahap perkembangan gonad diperlukan untuk mengetahui kapan ikan akan/tidak melakukan reproduksi. Dengan mengetahui tingkat-tingakat kematangan gonad, kita akan dapat mengetahui kapan ikan akan memijah, baru memijah atau sudah selesai memijah. Ukuran ikan saat pertama sekali gonadnya masak ada hubungannya dengan pertumbuhan ikan serta faktor lingkungan yang mempengaruhinya. (Tang, 2000) Tiap-tiap spesies ikan pada ukuran pertama kali gonadnya matang tidak sama ukurannya. Demikian juga pada ikan yang spesiesnya sama. Faktor utama yang mempengaruhi kematangan gonad ikan antara lain : suhu, makanan dan faktor keberadaan hormon. Pengetahuan tentang kematangan gonad tidak akan sempurna apabila tidak diiringi dengan pengetahuan tentang anatomi, histologi alat reproduksi baik jantan maupun betina. Demikian juga proses-proses pembentukan sel kelamin sampai terjadinya kematangan gonad. Berdasarkan hal tersebut, kajian mengenai perkembangan gonad perlu diungkapkan (Affandi, 2000) 4.2.3. Fekunditas dan Kematangan Telur Menurut Bagenal (1967) menerangkan bahwa fekunditas adalah jumlah telur yang dikeluarkan oleh ikan dalam rata-rata masa hidupnya. Parameter ini relevan untuk studi populasi, karena kematangan ikan pada waktu pertama kalinya dapat diketahui dan juga statistik kecepatan mortalitas dapat ditentukan dengan pengelolaan perikanan yang baik. Nilai fekunditas suatu individu ikan selalu bervariasi, karena dipengaruhi oleh umur atau ukuran individu ikan, jenis dan jumlah dari makanan yang dimakan, sifat ikan, kepadatan populasi, lingkungan hidup dimana ikan itu berada dan factor fisiologi tubuh. Untuk menghitung fekunditas (butiran telur) pada ikan dapat dilakukan dengan lima cara yaitu, : 1) Metoda jumlah (menjumlahkan secara langsung), 2) Metoda volumetrik, 3) Metoda

gravimetric, 4) Metoda gabungan volumetrik, gravimetric, dan jumlah, 5) Metoda Von Bayer (Effendie, 1992). Namun pada praktikum yang dilakukan menggunakan gabungan yaitu menghitung secara langsung dengan menggabungkan metode sebelumnya diantaranya metode jumlah, metode gravimetrik, dan metode volumetrik. Dengan menggunakan metode ini, maka kita melakukan semua metode baik itu dengan teknik pemindahan air, teknik penimbangan berat telur serta menghitung satu persatu-satu telur ikan yang kemudian akan dimasukkan ke dalam rumus yang telah diterngkan sebelumnya. Suandson (1949) menyatakan bahwa jumlah telur di dalam ovari ikan secara umum akan bertambah sesuai dengan pertambahan ukuran tubuhnya, dan perkembangan telur ditandai dengan ukuran diameter telurnya. Semakin matang gonad ikan tersebut maka semakin besar pula diameter telur ikan itu. Kemudian Effendie (1992) mengemukakan bahwa semakin berkembang gonad, telur yang terkandung didalam semakin membesar garis tengahnya, sbagai hasil dari pengendapan kuning telur, hidrasi dan pembentukan butir – butir minyak berjalan secara bertahap terliput dalam perkembangan tingkat kematangan gonad. Semakin meningkat tingkat kematangan diameter telur semakin membesar, sebaran diameter telur pada TKG akan mencerminkan pola pemijahan ikan tersebut. 4.2.4. Analisa Isi Saluran Pencernaan Setelah dilakukan pembedahan pada bidang abdominalnya, maka terdapat 5 jenis mikroorganisme yang dimakan oleh ikan lele ini antara lain yaitu Anabaeropsis raciborskii wal, Lyngbya spirulinoides Gom, Gomphosphaeria aponina Kg, Cylendrocystis brebissoni Menegh, Glococystus vesiculosa Naeg. Dalam menganalisa isi lambung ikan serta mempelajari kebiasan makan ikan dapat dilakukan dengan beberapa metode diantaranya yaitu dengan metode jumlah, metode frekwensi kejadian, metode perkiraan tumpukan dengan persen, metode volumetrik, metode gravimetrik dan metode gabungan. Namun pada praktikum kali ini untuk melihat ataupun mempelajari kebiasaan makan ikan Lele dumbo (Clarias gariepinus) dilakukan dengan menggunakan metode gabungan. Dimana metode jumlah ini dilakukan dengan jalan memperhitungkan individu organisme serta benda-benda lain yang terdapat di dalam alat-alat pencernaan makanannya, dengan menentukan Indeks Relatif penting (IRP). Apabila masing-masing jumlah sudah diketahui maka dapatlah dibandingkan yang satu dengan yang lainnya dan dapat ditarik kesimpulan dari macam-macam isi yang terkandung dalam alat pencernaan makanannya (Lagler. 1977). Zonnefeld, Hiusman dan Bonn (1991) menyatakan bahwa panjang usus relatif tidak menunjukkan secara tepat tentang kebiasaan makan ikan. Walaupun usus relatif lebih panjang. Menurut pendapat Bond (1979) yang menyatakan bahwa bentuk usus yang bergulung – gulung dimaksudkan untuk menambah masa penahanan dan pencernaan makanan yang sulit dicerna. Asmawi (1983) menyatakan bahwa suatu makanan ikan minimal harus mengandung protein, karbohidrat, dan lemak. Ketiga zat tersebut masing – masing akan dirubah menjadi energi yang sangat diperlukan untuk melakukan aktivitas – aktivitas hidup dan biasanya ikan cenderung memilih protein sebagai sumber energi yang utama. Kualitas makanan baru dapat mempengaruhi pertumbuhan apabila jika makanan yang tersedia dalam jumlah yang banyak dan berkualitas baik. Sebaliknya jika makanan yang tersedia dalam jumlah sedikit maka makanan tidak akan mempengaruhi dalam kecepatan pertumbuhan ikan.

4.2.5. Penentuan Umur Ikan Dalam praktikum penentuan umur ikan ini, sampel yang digunakan dengan mengambil tulang otolith yang terletak dibagian dalam kepala ikan. Perhitungan umur ikan ini harus dapat dikatakan kurang berhasil dikarenakan garis-garis annulusnya kurang jelas dan terlalu rapat sehingga hanya dapat dibuat gambar otolithnya saja. Panjang baku dihubungkan dengan panjang otolith, karena setiap pertambahan panjang baku maka panjang kepala akan bertambah sehingga pertumbuhan otolith akan bertambah juga. Tanda tahunan pada otolith ada yang dapat dibaca langsung dibawah mikroskop tetapi kebanyakan tidak, melainkan harus meratakan permukaan agar dapat dilihat dengan hasil yang baik. Tanda tahunan terjadi karena adanya kelambatan pertumbuhan yang disebabkan oleh musim dingin atau kekurangan makanan atau faktor lain (Effendie, 1997) Menurut Saanin (1984), karena satu jenis ikan berbeda besarnya disebabkan karena lebih umur atau keadaan tempat hidupnya, maka tidaklah mungkin memberikan ukuran bagian-bagian ikan sebagai tanda untuk identifikasi dalam ukuran mutlak; misalnya cm yang merupakan ukuran dalam mengidentifikasi. Kiemudian Effendie (1997) mengatakan pengukuran waktu yang baik sehubungan dengan pertumbuhan pada ikan adalah umur ikan tersebut. Bila umur ikan diketahui dengan tepat maka analisa pertumbuhan dapat dilkakukan dengan baik. Cara lain untuk menentukan umur ikan dengan menggunakan mtode Petersen yaitu dengan menggunakan frekuensi panjang ikan. Ikan mempunyai satu umur tersendiri membentuk suatu distribusi normal. Sektor panjang rata-ratanya, bila frekuensi panjang tersebut digambarkan dengan grafik akan membentuk beberapa puncak. Puncak inilah yang dipakai tanda kelompok umur ikan. Untuk ikan yang lain masa pemijahan panjang menyebabkan terdapat pertumpuan ukur dari umur yang berbeda. 4.2.6. Mortalitas Ikan Dari praktikum yang telah dilaksanakan sebelumnya untuk melihat gejala yang timbul akibat pencemaran yang terjadi di suatu perairan digunakan sampel dimana bahan pencemar yang dipilih yaitu detergen sebanyak 60 gr dalam jangka waktu 45 menit sehingga dapat dilihat dengan jelas gejala – gejala yang timbul baik berupa gerakan ikan maupun gejala yang timbul pada permukaan tubuh ikan. Pada ikan sample yang digunakan termasuk ikan yang tidak begitu kuat pertahanan tubuhnya karena tepat pada 45 menit terakhir ikan itu mati dan pada permukaan tubuhnya banyak terdapat lendir – lendir.. Dari hasil di atas ternyata ikan yang hidup pada suatu perairan ditentukan oleh faktor-faktor lingkungan sekitarnya. Apabila lingkungan sekitar perairan tersebut tidak tercemar maka ikan yang hidup pada perairan tersebut akan berkembang dan tumbuh, namun sebaliknya apabila lingkungan perairan tersebut tercemar baik itu melalui industri dan bahan-bahan lainnya yang berasal dari rumah tangga seperti deterjan dan sebagainya maka ikan yang hidup pada perairan tersebut akan cepat mengalami kepunahan. Moyle dan Cech (1988) mengatakan kepunahan populasi ikan yang hidup di suatu perairan dipengaruhi oleh beberapa faktor. Kepunahan dapat terjadi apabila kematian secara masal berkelanjutan sepanjang tahun dan dari tahun ke tahun. Faktor yang mendorong suatu populasi ikan cepat mengalami kepunahan antara lain :  Perburuan/penangkapan yang dilakukan berkelanjutan terhadap populasi ikan yang sedang melakukan ruaya pemijahan. Sehingga tidak bisa meneruskan regenerasi berikutnya.

 Perburuan / penangkapan yang terus berkelanjutan pada jenis – jenis ikan tertentu yang mempunyai nilai ekonomis tinggi di pasaran.  Pencemaran yang berkelanjutan pada lingkungan peraiaran yang tertutup  Perusakan lingkungan habitat tertentu seperti penimbunan atau pengeringan perairan rawa – rawa, pengeboran habitat karang dan penimbunan perairan danau-danau berukuran kecil.  Penangkapan ikan yang berkelanjutan dengan menggunakan tuba atau putas pada lingkungan perairan yang tertutup dan terbatas. 4.2.7. Pendugaan populasi Untuk memahami dinamika populasi kita harus memahami dulu tentang histori atau aspek – aspek biologi dari suatu spesies fauna serta memahami parameter dari populasi serta aspek – aspek yang berhubungan satu dengan lainnya. Jumlah individu dalam populasi dari suatu spesies ikan di lingkungan perairan tertentu dalam hal ini benih ikan Patin yang dimasukkan ke dalam ember hitam, selalu berubah karena dipengaruhi banyak factor. Diketahuinya jumlah individu dalam suatu populasi dari setiap jenis fauna yang berada dalam perairan lingkungan tertentu maka akan dapat mendukung untuk mengetahui potensi suatu perairan tertentu, dengan diketahuinya jumlah individu dalam populasi dari spesies ikan yang bernilai ekonomis tinggi dari waktu ke waktu maka akan dapat diperkirakan berapa banyak individu dari spesies tersebut untuk di eksploitasi agar keberadaan populasinya di lingkungan perairan itu dapat dipertahankan (Pulungan, 2004). Dalam pendugaan populasi dapat digunakan metode yaitu: secara langsung dan tidak langsung sedangkan dalam perhitungan populasi digynakan tiga metode yaitu: 1) Metode Petersen, 2) Metode Schumacher dan Eschemeyer, 3)Metode Zoe Scahnebel. Dari sejumlah hasil ikan tangkapan kembali akan didapatkan pula ikan yang bertanda. Dengan demikian parameter yang akan didapatkan dalam sensus ini adalh jumlah ikan yang diberi tanda, jumlah ikan tangkapan untuk disensus jumlah ikan yang tertangkap ada tanda, populasi ikan pada waktu pemberian tanda (Effendie, 1979) Pada praktikum Pendugaan populasi ini menggunakan 50 benih ikan Patin yang dimasukkan ke dalm ember hitam. Dilakukan penangkapan, dan ikan yang sudah tertangkap diberi tanda dengan pemotongan pada ekornya. Kemudian dilakukan penangkapan lagi, apabila ada ikan yang bertanda yang tertangkap di catat. Lalu data tersebut dihitung dengan menggunakan Metode Petersen, Metode Zoeschabel, Metode Schumacher dan Eschmeyer. Indeks bias masing – masing metode juga dihitung. 4.2.8. Larva Ikan Sebelum embrio menetas, maka embrio akan sering merubah posisinya karena kekurangan ruang gerak di dalam cangkang, sehingga dengan adanya pergerakan tersebut bagian cangkang telur akan menjadi lunak dan akhir nya telur akan pecah. Pada bagian cangkang yang pecah ujung ekor embrio akan dikeluarkan terlebih dahulu, sedangkan bagian kepalanya akan dieluarkan pada bagian akhir, karena bagian kepala ini paling besar jika dibandingkan dengan bagian tubuh lainnya (Effendie, 1997). Larva yang baru keluar dari cangkang telur digolongkan sebagai prolarva dengan ciri-ciri larva belum memiliki bukaan mulut, sirip belum terbentuk sempurna, membawa kuning telur sebagai cadangan maknan selama masa pro larva. Lamanya masa menjadi prolarva atau sampai habis kuning telur bervariasi untuk setiap spesies ikan, biasanya sekitar 3-7 hari. Cepat lambatnya habis cadangan makanan berupa kuning telur dapat dipengaruhi oleh : jumlah kuning telur yang

dibawa telur, factor fisiologis selama masa embriologi, kondisi lingkungan seperti suhu perairan, dan sifat spesies itu sendiri. Sesudah habis cadangan makanan berupa kuning telur maka larva memasuki periode post larva dan pada saat ini bukaan mulut sudah terbentuk dan beberapa organ tubuh mulai terbentuk sempurna serta mulai difungsikan (Permana, 1987). Individu ikan yang masih berada pada vase larva akan mengalami rona kehidupan yang penuh resiko atau merupakan masa yang paling kritis dalam kehidupannya, karena pada masa ini individu ikan masih berada dalam fase peralihan dari bentuk yang primitif menjadi bentuk yang definitif. Bentuk primitif yaitu sebagian organ-organ tubuhnya belum terbentuk secara sempurna dan belum dapat melaksanakan fungsinya secara baik. Sedangkan bentuk definitif adalah bentuk individu baru yang sudah memiliki bentuk tubuh secara sempurna dan semua organ tubuh telah berfungsi seperti pada kedua induknya.

V. KESIMPULAN DAN SARAN 5.1. Kesimpulan Dengan diperolehnya data-data morphometrik dan meristik diketahui bahwa setia spesies ikan mempunyai ukuran tubuh yang berbeda antara satu dengan yang lainnya dan juga didapat perbandingan antara panjang tubuh dengan panjang bagian tubuh lainnya. Kemudian dengan melakukan pendeterminasian untuk memperoleh data kita dapat menentukan spesies dari objek praktikum yang kita lakukan yang sering dikenal dengan pengidentifikasian. Tingkat Kematangan Gonad (TKG) adalah tahap tertentu perkembangan gonad sebelumdan sesudah ikan memijah. Pengamatan tahap-tahap kematangan gonad dapat dilakukan secara morfologi dan histologi. Pengamatan morfologi dapat dilakukan di laboratorium dan dilapangan, sedangkan histologi dilakukan dilaboratorium. Nilai Indeks Kematangan Gonad (IKG) yaitu suatu nilai dalam persen sebagai hasil dari perbandingan berat gonad dengan berat tubuh ikan termasuk gonad dikali 100 %. Nilai fekunditas suatu individu ikan selalu bervariasi, karena dipengruhi oleh umur atau ukuran individu ikan, jenis dan jumlah dari makanan yang dimakan, sifat ikan, kepadatan populasi, lingkungan hidup dimana ikan itu berada dan faktor fisiologi tubuh. Jumlah telur di dalam ovari ikan akan mengalami penambahan sesuai dengan pertambahan ukuran tubuh ikan tersebut dan perkembangan telur ditandai dengan ukuran diameter telur yang semakin besar. Keberadaan jenis makanan dan jumlah makanan yang tersedia diperairan sangat dipengruhi oleh faktor biotik dan abiotik pada perairan dimana tempat ikan itu hidup.

Dalam menentukan umur individu ikan dapat diamatiberdasarkan tanda-tanda tahunan (Annulus) yang dimiliki oleh ikan tersebut. Dengan mengamati sisik kunci, tulang vertebrae, tulang operculu, duri sirip dan tulang otolith. Dari hasil yang termudah untuk mengetahui berapa umur suatu spesies ikan dapat dilihat dari lingkaran harian atau tahunan yang terdapat pada tulang otolith. Pertumbuhan tulang otolith melalui permukaan dan endapan material suatu proses yang berhubungan dengan massa. Otolith tersusun dari kontraksi kalsium karbonat dalam bentuk organic dan berserat, kolagen yang menyerupai protein otolith. Ikan yang hidup pada suatu perairan ditentukan dengan faktor-faktor lingkungan sekitarnya. Apabila lingkungan sekitar perairan tersebut tidak tercemar maka ikan yang hidup pada perairan tersebut akan berkembang dan tumbuh, namun sebaliknya apabila lingkungan perairan tersebut tercemar baik itu melalui industri dan bahan-bahan lainnya yang berasal dari rumah tangga seperti deterjan dan sebagainya maka ikan yang hidup pada perairan tersebut akan cepat mengalami kepunahan. Ikan–ikan yang habitatnya terkena pencemaran akan mengalami kematian dengan memperlihatkan gejala – gejala yang ditimbulkannya seperti pergerakan ikan yang lambat ataupun hanya diam di dasar perairan dan terkadang bergerak sangat lincah dan pada permukaan tubuhnya banyak terdapat lendir. Mortalitas ikan sangat ditentukan oleh beberapa faktor misalnya suhu, makanan, letak lintang dan umur ikan tersebut. Manfaatnya dalam penanganan populasi ini perlu diperhatikan parameter—perameter yang terdapat dalam populasi tersebut baik itu parameter pada individu ikan maupun parameter pada populasinya. Pemberian tanda pada ikan dapat dilakukan secara marking dan tagging. Marking adalah pemberian tanda pada tubuh ikan tetapi tidak menggunakan benda asing hanya memotong pada sirip perut ikan dan pemberian tato pada ikan tersebut sebagai tanda bahwa ikan tersebut telah diberi tanda. Sedangkan Pemberian secara tagging adalah dengan cara menempelkan benda asing ketubuh ikan (benda yang tidak berkarat, seperti : perak, almunium, plastik, ebonut dan selulloid. Ikan yang baru keluar dari cangkangnya tergolong pada fase pro larva yaitu larva ikan yang masih memiliki cadangan makanan berupa kuning telur dan sebagian organ-organ tubuhnya belum terbentuk secara sempurna dan belum berfungsi. Setelah masa ini larva ikan memasuki fase post larva, dimana pada fase ini larva ikan sudah mulai kehilangan cadangan makanannya berupa kuning telur dan sebagian organ-organ tubuhnya sudah mulai terbentuk dan mulai difungsikan secara baik. Cepat lambatnya habis cadangan makanan berupa kuning telur dipengaruhi oleh jumlah kuning telur yang tersedia di bawah telur, factor fisiologis selamam periode embriologis, kondisi lingkungan seperti suhu perairan, serta sifat spesies ikan itu sendiri. 5.2 Saran Alat-alat praktikum saat ini sudah cukup tersedia, namun diharapkan untuk yang akan datang agar alat-alat praktikumnya bisa lebih dilengkapi agar lebih bisa mendapatkan hasil yang kita inginkan dalam praktikum Biologi Perikanan ini.

DAFTAR PUSTAKA Asmawi, S. 1983. Pemeliharaan Ikan Dalam Keramba. Gramedia, Jakarta. 82 hal. Bagenal, t.b. and e. braum. 1967. Eggs and Early Life History. In W. E. Ricker (ed) Methode for Assesment of Fish Production In Freshwater, IPB Hanbook No. 3. International Biological Programme, London. P 166-198 Bailey, k. M. And e. D. Honde. 1989. Predation on Eggs and Larvae of Marine Fishes and the Recruitment Problem, In Marine Biology Vol 25 Ed. JHS Blaxter and Djajasewaka, h. 1985. Pakan Ikan. Jasaguna. Jakarta. 42 hal.Aj sout hward. Academic Press, p 1-83. Klein. L. 1962. Rever Pollution II: Causes And Effecttens. Butterwouth and Cc. Ltd, London, 293 pp. Bond, C.E. 1979. Bioloby Of Fishes. WB Saunders Company, London. 512p Dahuri, R. 2002. Keanekaragaman Hayati Laut Aset Pembangunan Berkelanjutan Indonesia. PT. Gramedia Pustaka Utama. Jakarta. Damanik, Ningse. 2001. Inventarisasi Ikan Ordo Cypriniformes yang terdapat di Waduk Koto Panjang. Laporan Praktek Lapangan Fakultas Perikanan dan Ilmu Kelautan Universitas Riau, Pekanbaru. 27 hal. (tidak diterbitkan) Dinas Perikanan Tingkat I Riau. 2001. Buku Tahunan Statistik Perikanan Provinsi Riau, Pekanbaru. Djuanda T., 1981. Dunia Ikan . Armico . Bandung . 191 halaman Effendie,M.I.,1992. Metode Biologi Perikanan. Yayasan Agromedia. 112 hal Effendie, M .I., 1978. Biologi Perikanan – bagian I : study Natural History. Fakultas Perikanan Institut Pertanian Bogor, bogor. 105 hal (tidak diterbitkan). Effendie, M. I. 1979. Metode Biologi Perikanan. Yayasan Dwi Sri, Bogor. 112 hal . Effendie, M. I. 1997. Metode Biologi Perikanan. Yayasan Pustaka Nusantara, Yogyakarta. 163 hal . Hardjamulia,A dan S, rabegnator,1991. Penelitian perikanan air tawar: Hasil dan dampaknya bagi pengembangan perikanan rakyat, hal 63-67. Jhingran, V. 1975. Fish and Fisheries of India. Hindustan Publishing Corp (India) 6-U. B, Jawahar nagar, Delhi. 954 p. Jones, R. E. 1978. The Vertebrata Ovary Comparative Biology and Evolution. University of

Colombo. New york and London. 63 P. Katrini, 1995. Tingkat Kematangan Gonad dan Perbandingan Jenis Kelamin Ikan Selais (K. apogon Blkr) yang tertangkap di sungai Kampar kiri, Kecamatan Kampar Kiri, Kabupaten kampar. Skripsi Fakultas Perikanan. Universitas Riau. Pekanbaru. 61 hal (tidak diterbitkan) Kottelat, M. Whitten. S.N. Kartikasari dan S. Wirjoatmodjo, 1993. Ikan- ikan Air Tawar Indonesia Bagian Barat dan Sulawesi. Periplus Edition Limited. Jakrta. 243 hal Klein. L. 1962. Rever Pollution II: Causes And Effecttens. Butterwouth and Cc. Ltd, London, 293 pp. Krebs, C.J.1972. Ecology the Experimentel Analysis of Distribution and Abudance, Harper and Rowws. 694 p. Lagler, K.F ; J. E. Badach; R.R Miller and D,R. Masyarakat Passino., 1977.Ichtiologi. Jonh Willey and Sons. Inc. Toronto, 506 p. Lam, T. J. 1985. Induced Spawning in Fish. Oceanic Institut and Tungkang Marine Laboratory. Manda, Ridwan. dkk. 2006. Kumpulan Istilah dalam Materi Kuliah Biologi Perikanan. Fakultas Perikanan dan Kelautan UNRI. Morales. nin, B., 1992. Determination of Growth in Bony fisher from Otolith Microstructure. FAO Fisheries Tehnical Paper. 110.332, Rome 51 page. Moyle, P.B. and J.J. CECH, 1988. Fisher and Introduction to Ichtiology, 2 edition, Prentice Hall. Englewood Cliffs, New Jersey. 559 p. Mujiman, A. 1987. Makanan Ikan. Penebar Swadaya, Jakarta. 239 hal Nelson, 1984. Pengawetan Ikan dan Hasil Perikanan. CV, Aneka Solo, 169hal Nelson, J. S. 1984. Fishes of the world 2nd edition. Jhon wiley and sons. New york, 524 P. Nikolsky (1969). Tingkat Kematangan Gonad Pada Ikan Air Tawar Novizan. 2002. Membuat dan Memanfaatkan Pestisida Ramah Lingkungan. PT Agromedia Pustaka. Jakarta. Paling. J.E. 1971. Causes of Mortality. In Metode for Assessment of Fish Production in Freshwater. ED. W. E. RICKER. IPB Handbook No. 3 Blackwell Scientific Publication. Oxford. 226-235. Permana, E. 1987. Perkembangan Larva Ikan. Karya Ilmiah, Faperika IPB, Bogor (Tidak diterbitkan) Pulungan, C. P. 1985. Morphometrik Ikan Selais Siluroidea dari perairan kecamatan Kampar Kiri, Kabupaten Kampar, Riau. Pusat Penelitian UNRI, Pekanbaru. 54 hal (tidak diterbitkan) Pulungan, 1990. Fekunditas dan Seberan Diameter Telur dari Beberapa enis Ikan Cyprinid dari Danau Lubuk Siam, Riau. Pusat Penelitian Universitas Riau, pekanbaru. 57 hal (tidak diterbitkan) Pulungan. 2004. Hand Out Kuliah Mata Kuliah Biologi Perikanan. Fakultas Perikanan dan Ilmu Kelautan. UNRI. Pekanbaru. Saanin, H. 1986. Taksonomi dan Kunci Identifikasi Ikan Jilid 1 & 2. Bina Cipta. Jakarta.

Suandson, B. 1949. Natural Selektion and Eggs Fish Freshwater. Drottingholn. 115 :122 P Syamsudin, A.R, 1980. Pengantar Perikanan. Karya Nusantara, Jakarta. Syandri, H. 1996. Aspek Reproduksi Ikan Bilih (Mystacoleusus padangensis Blkr) dan Kemungkinan Pembenihannya di Danau Singkarak. Tesis Program Pasca Sarjana. Institut Pertanian Bogor. Bogor 99 hal (tidak diterbitkan) Tang, U. M. dan Affandi. 2001. Biologi Reproduksi Ikan, Penerbit Pusat Penelitian Kawasan Pantai dan Perairan. Universitas Riau. Pekanbaru. 153 hal Tee, G. A. C. 1982. Some Aspect of the Ecology of the Mangrove Forest of Sungai Buloh. Selangor II : Distribution Pattern and Population Dynamic of Three Dwelling Fauna. Malay. Nat. Jurn. 35 : 267 – 277. Uktolseja, J.C.B dan Purwasamita, 1987. Fekunditas dan Diameter telur Ikan Cakalang (Katsuwanus pelamis lineus) di Perairan sekitar Ambon, Jurnal Penelitian Perikanan Laut, 44 – 76. Weber dan Beaufort, 1931. The Fishes of Indonesia-Australia Archipelogo. Laiden. Weber, M and L. F. De Beaufort, 1965. The Fishes Of The Indo Australian Archipelago III, Brill Ltd. Leaden. 455 p. Yuniarti. R. 1995. Perkembangan Telur dan Fekunditas Ikan Selais Yang tertangkap di Sungai Kampar Kiri. Kecamatan Kampar Kiri. Kabupaten Kampar, Skripsi Fakultas Perikanan, Universitas Riau. Pekanbaru. 57 hal (tidak diterbitkan) Znnofeld, N., E.A. Huisman dan J.H Bonn, 1991. Prinsip – Prinsip Budidaya Ikan. Gramedia, Jakarta. 318 hal.

LAMPIRAN

Lampiran 4. Alat-alat yang digunakan dalam Praktikum

Baki Serbet

Pena Pensil

Penghapus Penggaris

Buku penuntun praktikum Laporan sementara

Jarum Mikroskop

Gunting Timbangan

Sartorius Cawan Petri

Gelas ukur Pipet tetes

Cawan Petri Ember

Saringan Toples Diposkan oleh iptek di 08:41 0 komentar Label: iptek

BIOPER 6

I. PENDAHULUAAN

1.1 Latar Bekang Pencernaan adalah proses penyederhanaan makanan melalui mekanisme fisik, kimiawi sehingga makanan menjadi bahan yang mudah diserap dan diedarkan ke seluruh tubuh melalui sistem peredaran darah. MUJIMAN (1987) mengemukakan bahwa sistem pencernaan ikan terdiri dari saluran pencernaan dan kelenjar pencernaan. Secara garis besar susunan saluran penernaan pada ikan terdiri dari mulut, oseaphagus, lambung, intestenum, anus. Di dalam mulut ikan terdapat gigi yang berperanan membantu mendapatkan makanan. Susunan saluran pencernaan, bentuk mulut dan gigi, bentu dan ukuran lambung serata intestenum yang dimiliki setiap jenis ikan bervariasi, maka menyebabkan setiap spesies ikan cara mengambil makanan nya juga bervariasi. Semua organisme untuk kelangsungan hidupnya butuh akan makanan, makanan diambil dari bahan – bahan yang telah tersedia. Bardasarkan makanan yang dimakan kita dapat membedakan adanya ikan karnivora, herbivora, ikan pemakan kotoran dan ikan omnivora. Macam makanan untuk ikan dapat dikatakan tidak terbatas, tetapi pada umumnya kebanyakan ikan bersifat karnivora sedangkan ikan herbivora sedikit sekali jenisnya. (DJUHANDA, 1981). Makanan dapat merupakan faktor menentukan populasi dan pertumbuhan. Jenis makanan suatu spesies ikan tergantung pada umur dan waktu (EFFENDIE,1979). Sedangkan MUJIMAN (1984) mengemukakan bahwa berdasarkan jenis makanannya, ikan dapat dibedakan menjadi lima golongan yaitu: 1) pemakan tumbuh – tumbuhan (herbivora dan vegetaris), 2) pemakan daging (karnivora), 3) pemakan segala atau campiran (omnivora), 4) pemakan plankton, 5) pemakan detritus (hancuran dan bahan organik). 1.2 Tujuan dan Manfaat Tujuan dari praktikum Analisis Isi Saluran Pencernaan ini adalah untuk mengetahui isi dari saluran penceraan ikan yang terdiri dari mulut, oseaphagus, lambung, intestenum, anus. Di dalam mulut ikan terdapat gigi yang berperanan membantu mendapatkan makanan. kemudian membedah bagian perutnya dan dibuka ususnya untuk mengetahui jenis makan yang dimakan. Dari jenis makanan yang dimakan dan panjangnya usus kita dapat mengetahui ikan tersebut tergolong ikan apa. Manfat yang di dapat adalah dapat mempelajari isi dari saluran pencernaan ikan dan dapat menggolongkan ikan tersebut berdasarkan makanan yang di makannya.

II. TINJAUAN PUSTAKA

Ikan paweh termasuk ke dalam filum Chordata, kelas Pisces, sub kelas Teleostei, ordo Ostariophisi, sub ordo Cyprinoidae, family Cyprinidae, genus Osteochilus, spesies Osteochilus hasselti (SAANIN, 1968). Ciri – ciri paweh menurut SUSANTO, H (1996) adalah badannya memanjang pipih kesamping (compressed). Bentuk punggung merupakan busur moncong runcing, mulut terletak di ujung tengah (terminal), mempunyai dua pasang sungut, permulaan sirip punggung berhadapan dengan sisik linnea lateralis yang kesepeluh. Sirip punggung berbentuk sirip tiang. Jari – jari keempat kuat dan gigi kebelakang. Sisik berwarna keperak – perakan, bagian punggung warnanya gelap. Sedangkan bagian perut nya ebih putih. MUJIMAN (1987) mengemukakan bahwa urutan saluran pencernaan ikan terdiri dari mulut, kerongkomgan, esofagus, lambung, usus sampai anus. ICHWAN (1997) yang mengatakan bahwa kualitas dan kuantitas makanan ikan juga tergantung pada ukuran makan yang cocok untuk mulut ikan. Menurut NORMAN (1937), ikan – ikan keluarga Cyprinidae dikenal dengan mulutnya yang tidak bergigi, tetapi gigi faring berkembang dengan baik dan berfungsi khusus. Menurut BOND (1979) pada umumnya esofagus ikan adalah pendek dan bisa membesar agar makanan yang agak besar dapat ditelan, dinding – dinding esofagus dilengkapi dengan lapisan otot circular dan memanjang. Pada ikan – ikan tertentu esofagus bersambung dengan usus. Menurut BOND (1979) menyatakan bahwa lambung berfungsi untuk menyimpan makanan melalui proses pencernaan dengan mencampurkan bahan makanan yang ditelan dengan lelehan gastrik. Usus merupakan segmen terpanjang dari saluran pencernaan. Menurut AFFANDI et al (1992), panjang usus sangat bervariasi dan berhubungan erat dengan kebiasaan makan ikan. ZNNOFELD, HUISMAN dan BOON (1991), menyebutkan rasio perbandingan usus perpanjang tubuh sebagai berikut: 1) Karnivora 0,2 sampai 2,5 perpanjang tubuh, 2) Herbivor 0,8 - 15,0 perpanjang tubuh, 3) Omnivora 0,6 – 8,0 perpanjang tubuh. Kebiasaan makan ikan (food habits) adalah kualitas dan kuantitas makanan yang dimakan ikan. Kebiasaan makan ikan diperlukan untuk mengetahui gizi alamiah ikan tersebut sehingga dapat dilihat hubungan ekologi diantara organisme diperairan itu, misalnya bentuk – bentuk pemangsaan, saingan dan rantai makanan. Jadi makanan dapat merupakan faktor yang

menentukan bagi populasi pertumbuhan dan kondisi ikan. Jenis makanan dari spesies ikan biasanya tergantung umur, tempat dan waktu (EFFENDIE, 1979).

III. METODE PRAKTIKUM

3.1 Waktu dan Tempat Praktikum Analisa Isi Saluran Pencernaan ini dilaksanakan pada tanggal 1 november 2004. Di laboratorium Biologi Perikanan Fakultas Perikanan dan Ilmu Kelautan Universitas Riau. 3.2 Bahan dan Alat Bahan yang digunakan pada praktikum Anlisa Isi saluran Pencernaan ini adalah spesies ikan paweh (Osteochilus hasselti) sebanyak 3 ekor, beserta isi saluran pencernaannya. Alat yang digunakan adalah pisau untuk membedah bagian abdominal perut ikan, jarum penunjuk untuk mengeluarkan isi usus, cawan petri untuk tempat isi usus yang telah dikeluarkan dan telah diencerkan, pipet tetes untuk menyedot isi usus yang telah diencerkan yang kemudian diletakkan diatas objek glass, mikroskop untuk mengamati isi usus, nampan untuk tempat ikan paweh, serta serbet untuk lap tangan. 3.3 Metode Praktikum Metode yang digunakan adalah Metode frekwensi Kejadian yaitu tiap – tiap isi alat pencernaan ikan dicatat masing – masing organsme yang terdapat sebagai bahan makanannya demikian juga alat pencernaan yang sama sekali kosong haris dicatat juga. Masing – masing organisme yang terdapat dodalam alat pencernaan makanan yang berisi dan dinyatakan dalam persentase dari seluruh alat pencernaan yang diteliti, tetapi tidak termasuk alat pencernaan yang tidak berisi. Dengan metode ini didapatkan macam organisme yamg dimakan, tetapi segi kuantitasnya tidak

dapat ditentukan. 3.4 Prosedur Praktikum Ikan paweh sebagai objek praktikum, dibedah bagian abdominal perutnya. Kemudian keluarkan isi saluran pencernaannya. Setelah itu ukur panjang usus, keluarkan isi usus dengan bantuan jarum penunjuk. Kemudian letakkan di cawan petri, lakukan pengenceran dengan 10 ml air. Amati dibawah mikroskop, dan pakai buku pedoman untuk membedakan organisme – organisme yang ada di dalam saluran pencernaannya sebagai bahan makanannya.

IV. HASIL DAN PEMBAHASAN 4.1 Hasil Hasil yang didapat selama praktikum adalah sebagai berikut: Panjang usus ikan A adalah 185 cm Panjang usus ikan B adalah 126 cm Panjang usus ikan C adalah 105 cm Jenis makanannya Usus Ikan A Usus Ikan B Usus Ikan C Nostoc planctohicum Nostoc planctohicum Lynogbya spirulinoides Diatome vulgare Diatome vulgare Diatome vulgare Anabaenopsis circulariswa Gomphos phaeria aponina Gomphos phaeria aponina Gomphos phaeria aponina Aphanotheca stagnino Aphanotheca stagnino Charachium longipes Rab Cheolosphaerium minutafritis

Perhitungan nya: 1) Nostoc planctohicum

= 66,6 2) Lynogbya spirulinoides = 33,3 3) Diatome vulgare = 100 4) Anabaenopsis circulariswa = 33,3 5) Gomphos phaeria aponina = 100 6) Aphanotheca stagnino = 66,1 7) Charachium longipes Rab = 33,3 8) Cheolosphaerium minutafritis = 33,3 4.2 Pembahasan Dari ketiga spesies ikan paweh yang menjadi objek praktikum, didapat panjang usus mencapai 105 sampai 185 cm.dari panjang nya usus ikan tersebut dapat diketahui bahwa ikan tersebut dapat digolongkan sebagai ikan herbivora yaitu pemakan tumbuh – tumbuhan. PUSPOWARDOYO dan DJARIJAH (1992) mengatakan bahwa jenis ikan herbivora adalah jenis ikan pemakan tumbuh – tumbuhan. Sifat ini telihat dari anatominya. Terutama pada usus yang panjang. Enzym yang dikeluarkan melalui kelenjar – kelenjar dalam ususnya mempunyai fungsi sebagai pencernaan unsur – unsur makanan yang bersal dari tumbuh – tumbuhan. ZONNEFELD, HIUSMAN dan BOON (1991) menyatakan bahwa panjang usus relatif tidak menunjukkan secara tepat tentang kebiasaan makan ikan. Walaupun usus relatif lebih panjang. Usus ikan paweh berbentuk lingkaran yang memenjang dan bergulung gulung.ini menyebabkan makanan ikan paweh tertahan lebih lama dalam saluran pencernaan sehingga memungkinkan tercernanya makanan yang sulit dicerna. Menurut pendapat BOND (1979) yang menyatakan bahwa bentuk usus yang bergulung – gulung dimaksudkan untuk menambah masa penahanan dan pencernaan makanan yang sulit dicerna. Hasil pengamatan terhadap jenis – jenis makanan paweh, diketahui bahwa makanan ikan paweh bervariasi. Ini dapat terlihat pada saat bagian abdominal perut nya dibedah dapat terlihat adanya: Nostoc planctohicum, Lynogbya spirulinoides, Diatome vulgare, Anabaenopsis circulariswa, Gomphos phaeria aponina, Aphanotheca stagnino, Charachium longipes Rab, Cheolosphaerium minutafritis. Tetapi yang dominan terdapat pada saluran pencernaan ikan paweh adalah Diatome vulgare dan Gomphos phaeria aponina. ASMAWI (1983) menyatakan bahwa suatu makanan ikan minimal harus mengandung protein, karbohidrat, dan lemak. Ketiga zat tersebut masing – masing akan dirubah menjadi energi yang sangat diperlukan untuk melakukan aktivitas – aktivitas hidup dan biasanya ikan cenderung memilih protein sebagai sumber energi yang utama. Kualitas makanan baru dapat mempengaruhi pertumbuhan apabila jika makanan yang tersedia dalam jumlah yang banyak dan berkualitas baik. Sebaliknya jika makanan yang tersedia dalam jumlah sedikit maka makanan tidak akan mempengaruhi dalam kecepatan pertumbuhan ikan.

V. KESIMPULAN DAN SARAN 5.1 Kesimpulan Ikan paweh termasuk ke dalam filum Chordata, kelas Pisces, sub kelas Teleostei, ordo Ostariophisi, sub ordo Cyprinoidae, family Cyprinidae, genus Osteochilus, spesies Osteochilus hasselti Ciri – ciri paweh adalah badannya memanjang pipih kesamping (compressed). Bentuk punggung merupakan busur moncong runcing, mulut terletak di ujung tengah (terminal), mempunyai dua pasang sungut, permulaan sirip punggung berhadapan dengan sisik linnea lateralis yang kesepeluh. Sirip punggung berbentuk sirip tiang. Jari – jari keempat kuat dan gigi kebelakang. Sisik berwarna keperak – perakan, bagian punggung warnanya gelap. Sedangkan bagian perut nya lebih putih. Hasil pengamatan terhadap jenis – jenis makanan paweh, diketahui bahwa makanan ikan paweh bervariasi. Ini dapat terlihat pada saat bagian abdominal perut nya dibedah dapat terlihat adanya: Nostoc planctohicum, Lynogbya spirulinoides, Diatome vulgare, Anabaenopsis circulariswa, Gomphos phaeria aponina, Aphanotheca stagnino, Charachium longipes Rab, Cheolosphaerium minutafritis. Yang dominan terdapat pada saluran pencernaan ikan paweh adalah Diatome vulgare dan Gomphos phaeria aponina 5.2 Saran Adanya peningkatan dalam hal fasilitas – fasilitas laboratorium.

DAFTAR PUSTAKA AFFANDI, R., SUBARDJA, D.S., RAHARDJO, M. F., dan SULISTIONO. 1992. Fisiologi Ikan Pencernaan. IPB Bogor ASMAWI, S. 1983. Pemeliharaan Ikan Dalam Keramba. Gramedia, Jakarta. 82 hal.

BOND, C.E. 1979. Bioloby Of Fishes. WB Saunders Company, London. 512p DJUHANDA, T. 1981. Dunia Ikan. Armico, Bandung. 191 hal. EFFENDIE, M. I. 1979. Metode Biologi Perikanan. Yayasan Dwi Sri, Bogor. 112 hal . ICHWAN, M. 1997. Hubungan Makanan yang Dimakan Ikan Motan (T. vaillanti nsp) dalam Lingkugan Alamnya di Danau Desa Buluh Cina Kecamatan Siak Hulu Kabupaten Kampar, Propinsi Riau. 64 hal (tidak diterbitkan). MUJIMAN, A. 1987. Makanan Ikan. Penebar Swadaya, Jakarta. 239 hal MUJIMAN, A. 1984. Makanan Ikan. Penebar Swadaya. 239 hal. NORMAN, J.R. 1937. A History of Fishes. London. 463 pp. SAANIN, H., 1968. Taksonomi dan Kunci Identifikasi Ikan. Cetakan ke –2. Binacipta. Jakarta. 508 hal. SUSANTO, H. dan K. AMRI, 1997. Budidaya Ikan Patin. Penebar Swadaya, Jakarta. 90 hal. ZNNOFELD, N., E.A. HUISMAN dan J.H BONN, 1991. Prinsip – Prinsip Budidaya Ikan. Gramedia, Jakarta. 318 hal. Diposkan oleh iptek di 08:34 0 komentar

BIOPER 5
I. PENDAHULUAAN 1.1. Latar Belakang Salah satu usaha yang dilakukan untuk memajukan dan mengembangkan perikanan adalah dengan melakukan penelitian tentang umur ikan, dimana penelitian ini merupakan sesuatu yang sangat penting dalam bidang biologi perikanan. Karena data umur ikan yang dihubungkan dengan data yang lainnya dapat berupa data panjang atau berat tubuh dapat memberikan keanekaragaman mengenai umur ikan pada waktu matang gonad untuk pertama kalinya, lama hidup, mortalitas dan pertumbuhan serta reproduksi. Menurut Effendie (1997) ikan-ikan berumur pendek adalah ikan yang tidak memiliki alat pernafasan tambahan, pergerakan cepat, sedangkan ikan berumur panjang adalah ikan yang tergolong primitif, pergerakan lambat, mempunyai alat pernafasan tambahan, penghuni dasar atau perairan dangkal dan luwes terhadap lingkungan. Kemampuan untuk mengetahui umur dari suatu individu ikan telah dimulai beberapa ratus tahun yang lalu. Dengan mengetahui umur ikan dan komposisi jumlahnya yang ada atau berhasil hidup dapat diketahui keberhasilan atau kegagalan reproduksi, dan bila umur ikan diketahui dengan tepat maka analisa pertumbuhan ikan dapat dilakukan dengan baik (Effendie, 1997). Meskipun pertumbuhan setiap individu ikan selanjutnya dipengruhi oleh faktor-faktor lingkungnnya. Penentuan umur suatu individu ikan dapat dilakukan melalui 2 cara yaitu : (1) Cara langsung, cara ini hanya dapat dilakukan pada individu spesies ikan budidaya, (2) Cara tidak langsung yaitu pada individu spesies ikan yang masih hidup diperairan alami. Penentuan umur ikan secara

tidak langsung dapat dilakukan melalui 2 cara yaitu : (1) Dengan mempelajari tanda-tanda tahunan (Annulus) atau harian (Sirkulus) pada bagian-bagian tubuh yang keras, (2) Metoda prekuensi panjang (metoda petersen) yaitu melalui pengukuran panjang tubuh ikan, metoda ini biasanya diterapkan pada individu-individu spesies ikan yang hidup didaerah tropis (Pulungan, 2006) Metoda penentuan umur dengan memperhatikan tanda-tanda tahunan pada bagian tubuh yang keras ini selalu dilakukan pada daerah subtropis (4 musim). Karena ikan-ikan yang hidup didaerah subtropis sangat dipengaruhi oleh suhu lingkungannya, dimana pada musim dingin pertumbuhan tubuh ikan hampir terhenti atau lambat sama sekali. Sehingga mempengaruhi pertumbuhan pada sisik, vertebrae, tulang, operculum, duri sirip dan tulang otolith yang menyebabkan terbentuknya susunan sirkulasi yang sangat rapat dan akhirnya membentuk annulus. Pada ikan di daerah tropis walaupun mengalami hidup di dua musim, kenyataannya suhu lingkungan sekitar tidak begitu mempengaruhi pertumbuhan sirkulasi pada bagian tubuh yang keras. Jadi tanda tahunan dari hasil susunan sirkuli yang rapat tidak begitu nyata bentuknya. Penentuan umur ikan yang mungin untuk dipraktekkan saat ini adalah dengan menggunakan metode frekwensi panjang (metode petersen) yang tergantung pada sifat reproduksi dan pertumbuhan ikan. Oleh karena itulah mahasiswa perikanan diwajibkan untuk mengikuti praktikum tentang penentuan umur ikan ini. 1.2. Tujuan dan Manfaat Tujuan dari praktikum Penentuan Umur Ikan ini adalah untuk mengetahui perkiraan umur ikan Selar (Caranx leptolepis) dengan melihat tulang otolith yang ada dibagian kepala ikan. Manfaat yang di dapat adalah dapat mempelajari bagaimana proses bertambahnya umur ikan dengan melihat pada tulang otolithnya.

II. TINJAUAN PUSTAKA Ikan selar tergolong kedalam kelas Osteichtyes, subordo Percomorphi, sub ordo Percoidea, Divisi Perciformes, famili Carangidae, genus Caranx dan spesies Caranx leptolepis (Saanin, 1984)

Gambar 1. Morfologi Ikan Selar (Caranx leptolepis) Ikan Selar Kuning tergolong ikan pelagis yang suka bergerombol (schooling) ikan ini berkerabat dengan ikan pelagis lainnya seperti golongan famili scombridae, clupeidae dan golongan ikan pelagis lainnya. Ikan Selar Kuning hampir serupa dengan ikan selar biasa dan selar mata besar yang menjadi ciri khas dari ikan ini adalah garis pewarnaan yang berwarna kekuningan mulai dari bagian abdominal sampai pada bagian batang ekor. Pada bagian otak ikan ini terdapat tulang otholit yang mampu merekam segala aktivitas kejadian yang dialami oleh ikan ini semasa hidupnya. Suku besar ikan yang terutama hidup di laut dikenal dengan nama kuweh, angara atau selar. Hidup di laut kawasan sedang dan tropis. Bentuk badannya bervariasi tetapi kebanyakan memiliki barisan sisik berduri sepanjang batang ekor (Kottelat et al, 1993). Menurut (Djuhanda, 1981), ikan selar tergolong kedalam keluarga carangidae. Tubuh dari ikan ini bentuknya ada yang sedikit gepeng, ada yang lonjong dan ada juga yang tinggi. Umur merupakan salah satu penduga terbaik dalam menentukan tingkat pertumbuhan relatif pada ikan, walaupun pertumbuhan sebenarnya sangat dipengruhi oleh faktor-faktor lingkungan (Moyle dan Cech, 1988). Selanjutnya Effendie (1992) menjelaskan tanda tahunan pada tubuh ikan tercatat pada sisik, tulang oprculum, duri sirip punggung atau dada, tulang punggung otolith (batu telinga). Hoffbaur (dalam Effendie, 1992) juga menerangkan bahwa tanda tahunan yang terdapat pada sisik dikenal dengan annulus. Otolith terbentuk dari kalsium karbonat yang mengeras didalam saluran kanal dari sirkulasi pada tulang ikan yang menonjol, berperan membantu dalam keseimbangan dan menanggapi bunyi (Victor, 1982). Sebagian diatom berbeda nyata pada diatom morfologi otolith yang terjadi diantara ikan-ikan bertulang sejati yang memberi kesan bahwa otolith ini mempunyai peranan penting untuk pendengaran. Otolith terutama tambahan dari kristalisasi kalsium karbonat, dalm bentuk magnetik dan berserabut. Kolagen yang mempunyai protein otoline (Morals.nin, 1992) Pertumbuhan otolith mempunyai permukaan dan endapan material, suatu proses yang berhubungan dengan masa peredarannya bergantung pada laju dalam metabolisme kalsium dan pada asam amino sintesis. Hasil tersebut merupakan formasi tambahan dari pertumbuhan harian dalam otolith tersebut, tersususn secara kontingen atau penambahan unit dan suatu unit pengawasan (Morales.nin, 1992). Penelitian tentang umur dari suatu individu ikan yang berasal dari perairan sudah dilakukan sekitar 100 tahun yang lalu (Ricker dalam Pulungan, 2006). Untuk menentukan umur suatu individu ikan maka kita dapat juga melihat pada bagian-bagian tubuh yang keras. Bagian-bagian tubuh yang keras untuk pembacaan umur suatu individu ikan tersebut menurut (Lagler et al dalam Pulungan, 2006) yaitu sisik kunci, tulang vertebrae, tulang operculum, pangkal duri sirip dada, dan tulang otholit. Sisik kunci pada ikan bersisik cycloid terletak di atas garis linea lateralis 3 baris sisik di depan pangkal dasar sirip punggung bagian depan dan pada ikan bersisik ctenoid terletak di bawah garis linea lateralis di belakang ujung dasar sirip dada. Arah ke posterior tubuh. Tulang otholit terletak di bawah otak, berjumlah sepasang.

III. METODE PRAKTIKUM

3.1 Waktu dan Tempat Praktikum mata kuliah Biologi Perikanan dilaksanakan pada hari Selasa, 28 November 2006 pukul 14.00 – 17.00 wib. Bertempat di Laboratorium Biologi Perikanan Fakultas Perikanan dan Ilmu Kelautan, Universitas Riau. 3.2 Bahan dan Alat Bahan yang digunakan dalam praktikum ini adalah ikan Selar (Caranx leptolepis) yang dibeli di Pasar Kodim, Pekanbaru. Sedangkan alat yang digunakan sewaktu praktikum ini adalah jarum untuk mengambil tulang otolith ikan yang menjadi objek praktikum, nampan sebagai tempat untuk meletakkan ikan tersebut, mikroskop untuk mengamati bentuk dan annulusnya, pisau untuk memotong ikan, serta serbet dan alat tulis. 3.3 Metode Praktikum Metode yang digunakan dalam praktikum yang dilakukan yaitu dengan pengamatan secara langsung terhadap objek praktikum dengan menggunakan mikroskop dalam mengamatinya dan mencatat seluruh hasil yang diperoleh. 3.4 Prosedur Praktikum Melakukan pengamatan dengan mengiris bagian kepala ikan Selar (Caranx leptolepis) tersebut, kemudian mengambil tulang otolithnya. Lalu diamati dengan menggunakan mikroskop, kemudian data yang diperoleh dijadikan laporan sementara

IV. HASIL DAN PEMBAHASAN 4.1. Hasil Tabel 1. Ukuran Morphometrik No. TL SL HdL BdH FL 1. 180 150 45 55 160 2. 190 155 43 50 170 3. 195 160 45 45 165

Gambar 2. Otolith Ikan Selar (Selaroides leptolepis) Perhitungan berat otolith ikan Caranx leptolepis: 1) Kanan = 0,0001g Kiri = 0,0009 g

4.2. Pembahasan Dalam praktikum penentuan umur ikan ini, sampel yang digunakan dengan mengambil tulang

otolith yang terletak dibagian dalam kepala ikan. Perhitungan umur ikan ini harus dapat dikatakan kurang berhasil dikarenakan garis-garis annulusnya kurang jelas dan terlalu rapat sehingga hanya dapat dibuat gambar otolithnya saja. Panjang baku dihubungkan dengan panjang otolith, karena setiap pertambahan panjang baku maka panjang kepala akan bertambah sehingga pertumbuhan otolith akan bertambah juga. Tanda tahunan pada otolith ada yang dapat dibaca langsung dibawah mikroskop tetapi kebanyakan tidak, melainkan harus meratakan permukaan agar dapat dilihat dengan hasil yang baik. Tanda tahunan terjadi karena adanya kelambatan pertumbuhan yang disebabkan oleh musim dingin atau kekurangan makanan atau faktor lain (Effendie, 1997) Menurut Saanin (1984), karena satu jenis ikan berbeda besarnya disebabkan karena lebih umur atau keadaan tempat hidupnya, maka tidaklah mungkin memberikan ukuran bagian-bagian ikan sebagai tanda untuk identifikasi dalam ukuran mutlak; misalnya cm yang merupakan ukuran dalam mengidentifikasi. Kiemudian Effendie (1997) mengatakan pengukuran waktu yang baik sehubungan dengan pertumbuhan pada ikan adalah umur ikan tersebut. Bila umur ikan diketahui dengan tepat maka analisa pertumbuhan dapat dilkakukan dengan baik. Cara lain untuk menentukan umur ikan dengan menggunakan metode Petersen yaitu dengan menggunakan frekuensi panjang ikan. Ikan mempunyai satu umur tersendiri membentuk suatu distribusi normal. Sektor panjang rata-ratanya, bila frekuensi panjang tersebut digambarkan dengan grafik akan membentuk beberapa puncak. Puncak inilah yang dipakai tanda kelompok umur ikan. Untuk ikan yang lain masa pemijahan panjang menyebabkan terdapat pertumpuan ukur dari umur yang berbeda.

V. KESIMPULAN DAN SARAN 5.1 Kesimpulan Dalam menentukan umur individu ikan dapat diamati berdasarkan tanda-tanda tahunan (Annulus) yang dimiliki oleh ikan tersebut. Dengan mengamati sisik kunci, tulang vertebrae, tulang operculum, duri sirip dan tulang otolith. Dari hasil yang termudah untuk mengetahui berapa umur suatu spesies ikan dapat dilihat dari lingkaran harian atau tahunan yang terdapat pada tulang otolith. Pertumbuhan tulang otolith melalui permukaan dan endapan material suatu proses yang berhubungan dengan massa. Otolith tersusun dari kontraksi kalsium karbonat dalam bentuk organic dan berserat, kolagen yang menyerupai protein otolith. 5.2. Saran Selama berlangsungnya praktikum hendaknya para praktikan melaksanakan tugasnya dengan tertib dan serius serta dapat menjaga kebersihan dari ruangan yang dipergunakan sebagai tempat praktikum yang mana nantinya akan dapat menambah semangat dari praktikan itu sendiri untuk melaksanakan tugasnya dan praktikum pun dapat berjalan dengan lancar dan efesien.

DAFTAR PUSTAKA Djuhanda, T., 1981. Dunia Ikan. Armico. 191 hal. Effendie, M. I. 1992. Metode Biologi Perikanan. Yayasan Agro media, Fakultas Perikanan IPB. 112 hal . Effendie, M. I. 1997. Metode Biologi Perikanan. Yayasan Pustaka Nusantara, Yogyakarta. 163 hal . Kottelat, M., et al. 1993. Freshwater Fishes of Western Indonesia and Sulawesi (Ikan Air Tawar Indonesia Bagian Barat dan Sulawesi. Periplus Edition Limited. Munich. Germany. 293 hal. Lagler, K. F et al. 1970. Freshwater Fishery Biology. W. M. C. Brown Company Publisher, Dubuque Iowa. 421 pp. Morales. NIN, B., 1992. Determination of Growth in Bony fisher from Otolith Microstructure. FAO Fisheries Tehnical Paper. 110.332, Rome 51 page. Moyle, P.B. and J.J. Cech, 1998. Fisher and Introduction to Ichthyology edition. Practise Hall, Englewood Cerffa, New Jersey. 55 page. Pulungan, C. P., et al. 2006. Biologi Perikanan. Fakultas Perikanan dan Ilmu Kelautan. Univesitas Riau. Pekanbaru. 80 hal. (tidak diterbitkan. Hanya untuk kalangan sendiri). Ricker, W. E. 1971. Methods for Assesment of Fish Production in Freshwater. Blackwell Scientific Publication. Oxford and Edinberg.

Saanin, H. 1984. Taksonomi dan Kunci Identifikasi Ikan. Binacipta. Jakarta. 520 hal Victor, B.C., 1982. Daily Otolith Increments and Recruitment in Two Coral-Reef Wrasses. Thalassoma bifasciatum and Halichoeres bivittalus. Marine Biology (71); 203-208. Diposkan oleh iptek di 08:33 0 komentar

BIOPER 4
I. PENDAHULUAN 1.1. Latar Belakang Ketersediaan air baik secara kuantitatif maupun kualitatif, merupakan persyaratan untuk berlangsungnya kehidupan organisme di perairan. Air merupakan media hidup ikan untuk menjalankan hidup, tumbuh dan berkembangbiak. Dewasa ini telah terjadi penurunan mutu sumber daya air, baik perairan tawar, perairan payau maupun perairan laut. Sebagai contoh adalah penurunan mutu air sungai. Sungai yang dulu berfungsi untuk mengalirkan air dari hulu ke hilir atau menyalurkan air hujan yang jatuh di daratan ke lautan, sekarang berubah fungsi menjadi tempat pembuangan berbagai macam sampah dan bahan pencemar. Sampah dan bahan pencemar yang masuk ke sungai berasal dari limbah yang dihasilkan oleh berbagai jenis industri yang umumnya berlokasi di sepanjang aliran sungai. Limbah ini dapat berasal dari industri pertanian, rumah tangga, dan lain sebagainya (EFFENDIE, 2002). Salah satu bahan pencemar yang dibuang ke perairan adalah limbah yang berasal dari industri pertanian berupa penggunaan insektisida yang digunakan untuk membasmi hama yang menyerang tanaman pertanian. Limbah ini akhirnya terbawa aliran air dan memasuki perairan umum sebagai bahan pencemar. Oleh sebab itu untuk melihat pengaruh bahan pencemar yang berasal dari industri pertanian dalam hal ini bahan pencemar round doup terhadap biota perairan khususnya ikan, maka praktikum biologi perikanan mengenai mortalitas ikan ini dilaksanakan. 1.2. Tujuan dan Manfaat Pelaksanaan praktikum ini bertujuan untuk mengetahui sejauh mana pengaruh bahan pencemar yang terkandung dalam detergen yang digunakan sebagai pembersih pakaian yang digunakan manusia, mempengaruhi hidup dan kehidupan biota perairan khususnya ikan. Praktikum ini juga bertujuan untuk mengetahui konsentrasi bahan pencemar yang dapat menjadi racen bagi ikan dalam skala laboratorium serta bagaiman tingkah laku ikan yang mengalami keracunan bahan perncemar secara visual maupun secara fisiologis. Dengan mengetahui pengaruh dan konsentrasi bahan pecemar serta ciri-ciri ikan yang terkena bahan pencemar itu sendiri, diharapkan kita dapat lebih berhati-hati dalam menggunakan bahanbahan tersebut atau paling tidak sedikit-demi sedikit mulai mengurangi penggunaan bahan-bahan tersebut dalam industri pertanian dengan memberi penyuluhan kepada masyarakat di sekitar kita tentang bahaya penggunaanya serta berusaha untuk memberi solusi bahan isektisida lain yang ramah lingkungan. II. TINJAUAN PUSTAKA 2.1. Biologi Ikan Nila (Oreochromis niloticus) SAANIN (1984) mengklasifikasikan ikan Nila kedalam kelas Pisces, subkelas Teleostei, ordo Percomorphi, subordo Percoidea, famili Cischlidae, genus Oreochromis, species Oreochromis niloticus. DJARIJAH (1994) mengatakan ciri-ciri umum ikan nila antara lain terdapat garis-garis warna ke arah vertical pada badan dan ekor serta sirip punggung dab sirip dubur. Warna kemerah-merahan atau kekuning-kuningan atau keputih-putihan (albino). Tubuh memanjang dan ramping, sisik

berbentuk stenoid berukuran besar dan kasar. Gurat sisi terputus di bagian tengah badan, jumlah sirip pada gurat sisi 34 buah. Siri punggung dan sirip perut mempunyai jari-jari lemah dan keras yang tajam seperti duri. Untuk memudahkan pengenalan ikan, dapat dilihat dengan memperhatikan ciri-ciri yang dimiliki, antara lain : ukuran panjang tubuhnya lebih besar dari tinggi tubuhnya, badannya ditutupi sisik cycloid atau sisik ctenoid. Sirip dubur dan sirip punggung ada yang pendek, ada juga yang panjang. Sirip dada jauh di depan sirip perut pada bagian depan badan, kedua-duanya tumbuh dengan baik. Gurat sisinya sempurna, tidak terpatah-patah, celah insang terletak dibelakang tutup insang. Mulutnya terletak di ujung depan kepala atau agak ke bawah. (LAGLER, et al., 1977; WEBER dan DE BEAUFORT, 1965). 2.2. Pengaruh Bahan Pencemar Terhadap Mortalitas Ikan Pencemaran didefenisikan sebagai dampak negatif (pengaruh yang membahayakan) bagi kehidupan biota, sumber daya, kenyamanan ekosistem, serta kesehatan manusia, dan nilai guna lainnya dari ekosistem, baik disebabkan secara langsung maupun secara tidak langsung oleh pembuangan bahan-bahan atau limbah ke dalam perairan yang berasal dari kegiatan manusia. (DAHURI, 2002) Menurut PALING (1971), sebagian besar bahan pencemar yang ditemukan di perairan berasal dari kegiatan manusia. Pada umumnya bahan pencemar tersebut berasal dari berbagai kegiatan industri, pertanian dan rumah tangga. Salah satu sumber bahan pencemar yang berasal dari limbah pertanian adalah DDT yang terkandung dalam Roundoup. Secara umum dampak negatif dari pemakaian pestisida maupun insektisida sintesis adalah : 1) pencemaran air dan tanah yang akhirnya akan kembali lagi kepada manusia dan makhluk hidup lainnya dalam bentuk makanan dan minuman yang tercemar. Bahkan untuk beberapa jenis pestisida sintesis, residunya dapat bertahan di tanah dan air hingga puluhan tahun; 2) matinya musuh alami dari organisme pengganggu tanaman (OPT); 3) kemungkinan terjadinya serangan hama sekunder; 4) kematian organisme yang menguntungkan, seperti lebah yang sangat berperan dalam penyerbukan bunga; 5) timbulnya kekebalan OPT terhadap pestisida sintesis. (NOVIZAN, 2002)

III. BAHAN DAN METODE 3.1. Waktu dan Tempat Praktikum Biologi Perikanan mengenai mortalitas ikan ini dilaksanakan pada tanggal 4 Agustus 2005. Praktikum dilaksanakan di Laboratorium Biologi Perikanan Fakultas Perikanan dan Ilmu Kelautan, Universitas Riau. 3.2. Bahan dan Alat Bahan yang digunakan pada praktikum ini adalah lima ekor ikan Nila (Oreochromis niloticus). Untuk bahan pencemar yang diujikan adalah detergen. Sedangkan alat-alat yang digunakan adalah dua buah akuarium sebagai tempat ikan uji dan ikan kontrol serta alat-alat tulis yang

digunakan sebagai tempat mencatat seluruh hasil pengamatan. 3.3. Metode Praktikum Metode yang digunakan dalam praktikum mortalitas ikan ini adalah dengan pengamatan (observasi) langsung terhadap objek yang akan dipraktikumkan. 3.4. Prosedur Praktikum Prosedur yang dilaksanakan dalam praktikum ini adalah sebagai berikut dua buah akuarium yang telah disediakan yang berukuran 60 x 30 x 30 diisi dengan air sebanyak 20 liter. Setelah terisi, air dibiarkan selama ± 10 menit. Setelah itu masukkan 3 ekor ikan ke dalam salah satu akuarium, ikan ini merupakan ikan uji. Sedangkan untuk yang dua ekor lagi masukkan dijadikan kontrol normal yang tidak diberi perlakuan insektisida. Setelah itu, ikan diaklimatisasi selama ± 15 menit, selama proses aklimatisasi catat tingkah laku ikan baik ikan uji maupun ikan kontrol mulai dari gerakan, jumlah bukaan mulut dan tutup insang dan gerakan sirip. Setelah 15 menit pertama, masukkan 20 gr detergen ke dalam akuarium ikan uji, amati tingkah lakunya seperti 15 pertama. Kemudian setelah 15 menit, ambil satu ikan uji bedah dan amati warna isang serta jantungnya. Selanjutnya masukkan lagi 20 gr detergen pada ikan uji amati selama 15 menit, setelah 15 menit ambil ikan untuk dibedah. Perlakuan tersebut terus diulang sampai semua ikan yang ada dalam akuarium mati. Catat berapa gr detergen yang digunakan sampai ikan yang terakhir mati dan hitung juga konsentrasinya, serta catat waktu kematian masing-masing ikan uji. Setelah semua selesai diamati bersihkan semua alat-alat yang digunakan selama praktikum. Kemudian buat laporan dalam bentuk paper yang akan dikumpulkan sebagai syarat untuk mengikuti praktikum minggu berikutnya.

IV. HASIL DAN PEMBAHASAN 4.1. Hasil 4.1.1. Deskripsi Ikan Nila (Oreochromis niloticus) SAANIN (1984) mengklasifikasikan ikan Nila kedalam kelas Pisces, subkelas Teleostei, ordo Percomorphi, subordo Percoidea, famili Cischlidae, genus Oreochromis, species Oreochromis niloticus. Ciri-ciri umum ikan nila seperti adanya garis-garis warna ke arah vertical pada badan dan ekor serta sirip punggung dab sirip dubur. Warna kemerah-merahan atau kekuning-kuningan atau keputih-putihan (albino). Tubuh memanjang dan ramping, sisik berbentuk stenoid berukuran besar dan kasar. Gurat sisi terputus di bagian tengah badan, jumlah sirip pada gurat sisi 34 buah. Siri punggung dan sirip perut mempunyai jari-jari lemah dan keras yang tajam seperti duri (DJARIJAH, 1994) Adapun gambar ikan Nila (Oreochromis niloticus) ini secara morfologi sebagaimana terlihat

pada gambar di bawah ini

Gambar 1. Morfologi Ikan Nila (Oreochromis niloticus) 4.1.2. Perhitungan Volume Air Aquarium. V=pxlxt 20 = 60 x 30 x t 20.000 = 1800 t t= t = 11,1 cm Dimana: V = Volume air (liter) p = Panjang aquarium (cm) l = Lebar aquarium (cm) t = Tinggi Air (cm) 4.1.3. Reaksi Ikan Terhadap Zat Pencemar Setelah dilakukan proses pengamatan selama lima belas menit, ikan uji diberi perlakuan berupa pemberian detergen sebanyak 20 gr setiap 15 menit, kemudian diamati bukaan mulut, bukaan operculum serta tingkah laku ikan. Tabel 1. Hasil Pengamatan Reaksi Ikan Nila (Oreochromis niloticus) terhadap bahan pencemar detergen. Waktu Bukaan Mulut Bukaan Operculum Detak Jantung Pergerakan Ikan Ikan Uji 1 15 menit 30 menit 45 menit

Ikan Uji 2 15 menit 30 menit 45 menit

Insang pada ikan kontrol terlihat berwarna merah, sedangkan ikan uji 1 yang sudah tercemar insang berwarna sedikit lebih gelap. Begitu juga dengan ikan uji 2 yang berada 15 menit lebih lama dari ikan uji 1, warna insang lebih merah hati sampai pada ikan uji 3, insang berwarna merah hati dan warna tubuh ikan secara keseluruhan menjadi lebih pucat.

4.2. Pembahasan Dari praktikum yang telah dilaksanakan sebelumnya untuk melihat gejala yang timbul akibat pencemaran yang terjadi di suatu perairan digunakan sampel dimana bahan pencemar yang dipilih yaitu detergen sebanyak 60 gr dalam jangka waktu 45 menit sehingga dapat dilihat dengan jelas gejala – gejala yang timbul baik berupa gerakan ikan maupun gejala yang timbul pada permukaan tubuh ikan. Pada ikan sample yang digunakan termasuk ikan yang tidak begitu kuat pertahanan tubuhnya karena tepat pada 45 menit terakhir ikan itu mati dan pada permukaan tubuhnya banyak terdapat lendir – lendir.. Dari hasil di atas ternyata ikan yang hidup pada suatu perairan ditentukan oleh faktor-faktor lingkungan sekitarnya. Apabila lingkungan sekitar perairan tersebut tidak tercemar maka ikan yang hidup pada perairan tersebut akan berkembang dan tumbuh, namun sebaliknya apabila lingkungan perairan tersebut tercemar baik itu melalui industri dan bahan-bahan lainnya yang berasal dari rumah tangga seperti deterjan dan sebagainya maka ikan yang hidup pada perairan tersebut akan cepat mengalami kepunahan. (MOYLE dan CECH, 1988) .kepunahan populasi ikan yang hidup di suatu perairan dipengaruhi oleh beberapa faktor. Kepunahan dapat terjadi apabila kematian secara masal berkelanjutan sepanjang tahun dan dari tahun ke tahun. Factor yang mendorong suatu populasi ikan cepat mengalami kepunahan antara lain :  Perburuan/penangkapan yang dilakukan berkelanjutan terhadap populasi ikan yang sedang melakukan ruaya pemijahan. Sehingga tidak bisa meneruskan regenerasi berikutnya.  Perburuan / penangkapan yang terus berkelanjutan pada jenis – jenis ikan tertentu yang mempunyai nilai ekonomis tinggi di pasaran.  Pencemaran yang berkelanjutan pada lingkungan peraiaran yang tertutup  Perusakan lingkungan habitat tertentu seperti penimbunan atau pengeringan perairan rawa – rawa, pengeboran habitat karang dan penimbunan perairan danau-danau berukuran kecil.  Penangkapan ikan yang berkelanjutan dengan menggunakan tuba atau putas pada lingkungan perairan yang tertutup dan terbatas.

V. KESIMPULAN DAN SARAN 5.1. Kesimpulan Ikan yang hidup pada suatu perairan ditentukan dengan faktor-faktor lingkungan sekitarnya. Apabila linkungan sekitar perairan tersebut tidak tercemar maka ikan yang hidup pada perairan tersebut akan berkembang dan tumbuh, namun sebaliknya apabila lingkungan perairan tersebut tercemar baik itu melalui industri dan bahan-bahan lainnya yang berasal dari rumah tangga seperti deterjan dan sebagainya maka ikan yang hidup pada perairan tersebut akan cepat mengalami kepunahan.

Ikan – ikan yang habitatnya terkena pencemaran akan mengalami kematian dengan memperlihatkan gejala – gejala yang ditimbulkannya seperti pergerakan ikan yang lambat ataupun hanya diam di dasar perairan dan terkadang bergerak sangat lincah dan pada permukaan tubuhnya banyak terdapat lendir. Mortalitas ikan sangat ditentukan oleh beberapa faktor misalnya suhu, makanan, letak lintang dan umur ikan tersebut 5.2. Saran Didalam praktikum tingkat mortalitas ini diharapkan harap semua pratikan dan asissten melakukan praktikum ini dengan sungguh-sungguh karena praktikum ini sangat penting sekali untuk mentukan mortalitas ikan pada ikan, sebab dari praktikum ini lah kita tahu apa sebenarnya yang dikatakan dengan mortalitas ikan.

DAFTAR PUSTAKA

DAHURI, R. 2002. Keanekaragaman Hayati Laut Aset Pembangunan Berkelanjutan Indonesia. PT. Gramedia Pustaka Utama. Jakarta. DJRIAJAH. 1994. Biologi Ikan. Pusat Penelitian Kaswasan Pantai dan Perairan. Universitas Riau. Pekanbaru. 155 hal EFFENDIE, I. 2002. Pengantar Akuakultur. Penebar Swadaya. Jakarta. LAGLER, K. F., J. E. BARDECH, R. R. PILLER, D. R. PASSINO. 1965. Ichthyologi. John Wiley and Sons, Inc. New York. 506 p. MOYLE, P.B and J.J. CECH, 1988. Fisher and Introduction to Ichthyology,2 nd edition .Prentice Hall, Englewood Cliffs, new jersey.559 p NOVIZAN. 2002. Membuat dan Memanfaatkan Pestisida Ramah Lingkungan. PT Agromedia Pustaka. Jakarta. PALING. J.E. 1971. Causes of Mortality. In Metode for Assessment of Fish Production in Freshwater. ED. W. E. RICKER. IPB Handbook No. 3 Blackwell Scientific Publication. Oxford. 226-235. SAANIN, H. 1986. Taksonomi dan Kunci Identifikasi Ikan Jilid 1 & 2. Bina Cipta. Jakarta. Diposkan oleh iptek di 08:29 0 komentar

Label: IP

Bioper 3
I. PENDAHULUAN 1.1. Latar belakang Perairan umum indonesia yang meliputi dua pertiga wilayah tanah air Indonesia memiliki Potensi sumber daya hayati perikanan yang besar dan belum seluruhnya dapat dikelola. Mengingat sangat mendesaknya kebutuhan akan protein hewani yang berasal dari ikan, maka sudah seharusnya memanfaatkan sumber-sumber hayati perairan yang ada dan dimanfaatkan semaksimal mungkin karena akan dapat menunjang perluasan kesempatan kerja, meningkatkan pendapatan nelayan dan perbaiakan gizi masayarakat. Keadaan ini sejalan dengan pertambahan penduduk serta kondisi geografis Indonesia yang mutlak memerlukan pelaksanaan peningkatan dalam bidang perikanan. Usaha perikanan yang ada di Indonesia merupakan perpaduan antara usaha perikanan darat dan perikanan laut. Ikan merupakan sumber protein yang paling murah dibanding dengan sumber protein yang lainnya seperti telur, susu dan daging (Dinas Perikanan Kabupaten Bengkalis, 1996/1997). Luas perairan umum Riau adalah 62.648,53 Ha, terdiri dari luas perairan umum Indragiri Hilir 2.600 Ha, luas perairan umum Indragiri hulu 33,164 Ha, luas perairan umum kuansing singingi 23.086 ha, luas perairan umum Pekanbaru 85 Ha, luas perairan umum Siak 764 Ha, luas perairan umum Bengkalis 70 Ha, dan luas perairan umum Kampar 2.795,99 Ha (Dinas Perikanan Dan Kelautan Propinsi Riau, 2001). Propinsi Riau merupakan salah satu propinsi yang memiliki wilayah daratan 94.561 km2 dan 3.241 pulau-pulau yang memiliki empat satuan wilayah sungai yaitu sungai Rokan, siak, Kampar dan sungai Indragiri yang merupakan perairan yang potensial untuk pembangunan usaha perikanan (Yuniarti, 2000). Untuk propinsi Riau produksi perikanan umum adalah sebesar 12.706,6 ton atau 7% dari seluruh produksi prikanan Riau, dimana produksi perikanan tersebut berasal dari kabupaten indragiri hulu, Kampar, Bengkalis dan Indragiri hilir (Evy, Mujianti Dan Sujono, 2001). Salah satu jenis ikan air tawar yang potensial untuk dikembangkan ialah ikan Palau bujap yang hampir mirip dengan ikan paweh. Ikan ini merupakan salah satu spesies yang mampu beradaptasi terhadap kondisi perairan yang marginal, seperti derajad keasaman perairan yang relatif rendah dan adanya dominasi ikan-ikan yang yang sering menimbulkan masalah di perairan umum. Disamping itu ikan Palau bujap umumnya jarang terserang penyakit atau parasit. Kalaupun ada pen7yakit yang menyerang tidaklah berbahaya (Hardjamulia, 1978). Ikan ini juga merupakan salah satu ikan ekonomis penting yang ada di perairan tawar (Djajadirredja, Et Al., 1977. Ikan merupakan organisme tingkat tinggi yang memiliki nilai ekonomis dan ekologi penting. Mengingat pentingnya keberadaan ikan dalam suatu ekosistem, maka diperlukan pengetahuan tentang beberapa aspek biologi, antara lain tingkat kematangan gonad, fekunditas, hubungan panjang berat, seksualitas ikan, ruaya, pemijahan, awal daur hidup, kebiasaan makanan dan cara memakan, persaingan dan pemangsaan, pertumbuhan ikan, umur ikan, analisis populasi dan analisa saluran pencernaan yang merupakan kunci penting dan harus diperhatikan untuk menjamin kelestarian sumberdaya dan usaha budidaya ikan tersebut.

1.2. Tujuan dan Manfaat Adapun tujuan dari pelaksanaan pratikum ini adalah untuk mengenal tingkat kematangan gonad baik berupa gonad yang berbentuk testes maupun yang berbentuk ovary , dengan cara melihat seksual primer dan seksual sekunder, secara morfologi yang dimiliki ikan tersebut. Manfaat dari praktikum ini adalah untuk mengenal lebih jauh lagi tentang tingkat kematangan gonad dan nilai indeksnya yang kita amati dengan menggunakan data mertistik dan morphometrik serta suatu informasi tentang keberadaan habitat ikan tersebut.

II. TINJAUAN PUSTAKA

Ikan adalah hewan bertulang belakang yang berdarah dingin, hidup di air, pergerakan dan keseimbangan tubuhnya menggunakan sirip dan bernafas dengan insang ( Raharjo, 1980) Menurut Mudjiman (2001) setiap ikan mempunyai makanan yang berbeda. Jika dilihat dari jenis makanannya maka ikan dapat dibagi menjadi tiga golongan yaitu herbivor, karnivora dan omnivora. Berdasarkan cara makannya ikan dibedakan menjadi lima golongan yaitu pemangsa (predator), penggerogot (grazer), penyaring (strainer), penghisap (sucker) dan parasit. Berdasarkan macam makanannya, ikan dapat kita bedakan menjadi lima macam golongan yaitu pemakan tumbuh-tumbuhan (herbivor atau vegetaris, pemakan hewan (karnivor), pemakan tumbuhan dan hewan (omnivor), pemakan plankton dan detritus (hancuran bahan organic) dan pemakan dasar (Effendi 1997 Dan Pulungan, Putra, Efriyeldi Dan Efizon, 2001). Menurut Susanto (1987) ciri-ciri dari ikan Palau bujap panjang tubuh 15 cm. Sirip punggungnya mempunyai 3 jari-jari keras dan 10-11 jari-jari lunak. Sirip dubur mempunyai 3 jari-jari keras dan 5 jari-jari lunak. Warna tubuh hitam kecoklat-coklatan, pada punggung dan pangkal sirip punggungnya ada serangkaian binti-bintik hitam. Menurut (Kottelat et. al. 1993, Saanin, 1984 dan Djuhanda ,1981). Ciri-ciri ikan Palau bujap adalah tidak ada tubus keras pada moncong, 6-9 baris bintik-bintik berwarna pada sepanjang barisan (walaupun tidak terlalu jelas), terdapat bintik bulat besar pada batang ekor, batang ekor dikelilingi 16 sisik dan bagian depan sirip punggung dikelilingi 26 sisik, letak mata lebih tinggi, jari keras sirip dubur tidak bergigi sebelah ke belakang, permukaan sirip punggung dimuka, diatas atau sedikit dibelakang sirip perut, sirip ekor bercagak dua, bentuknya simetris, dekat sudut rahang atas ada dua sungut peraba Djuhanda (1981) mengklasifikasikan ikan Palau bujap ke dalam, ordo Cypriniformes, famili Cyprinidae, genus Osteochillus , dan spesies Osteochillus kahajanensis.

Ikan jantan mempunyai kelenjar yang berwarna putih yang permukaan licin, berisi sel-sel kelamin jantan (sperma) dan saluran pelepasan disebut vasdeferens. Saluran ini bertemu dan bersatu dengan saluran kencing. Sedangkan pada ikan betina kelenjar kelaminnya mempunyai permukaan kasar, berbintik bintik, berisi sel telur dan saluran pelepasan disebut dengan oviduct. (Suripto 1982) Ukuran warna gonad bervariasi tergantung kematangan sel telur tersebut. Beratnya bisa mencapai 12% dari berat tubuhnya. Kebanyakan testes transparan dan putih. Sedangkan ovari kuning. (Ridwan, 1980) Berdasarkan tempat pemijahan. Ikan dapat dimasukkan kedalam beberapa golongan, yaitu golongan ikan phytopil yang memijah pada tanaman. Golongan psamopil memijah dipasir. Golongan ikan pelagopil memijah pada kolam air diperairan dan golongan ikan ostracopil pada cakang yang telah mati (Raharjo, 1980). Effendie (1979) menyatakan bahwa sifat seksualitas primer pada ikan ditandai dengan adanya yang secara langsung berhubungan dengan proses reproduksi, yaitu ovarium dan pembuluhnya. Sifat seksual sekunder adalah tanda-tanda luar yang dipakai untuk membedakan jantan dan betina. Apabila suatu spesies ikan mempunyai sifat morfologi yang dapat dipakai untuk membedakan jantan dan betina, maka spesies itu mempunyai seksual dimorphisme. Dan apabila yang menjadi tanda itu adalah warna, maka ikan tersebut mempunyai sifat dicromatisme. Pada ikan jantan mempunyai warna yang lebih cerah dan mebarik dari pada ikan betina. Lagler et al., (1977) menyatakan bahwa perbedaan antara ikan jantan dan ikan betina pada jenis ikan yang sama dapat dilihat pada ukuran kepala, bentuk kepala, permukaan tengkorak kepala, bentuk sirip ekor, bentuk badan, bentuk perut, bentuk sirip anus, dasar sirip dada, bentuk sirip perut dan sirip aus, bentuk serta ukuran lubang pelepasan alat kelamin. Tingkat kematangan gonad dari suatu spesies ikan ada kaitannyua dengan pertumbuhan ikan itu sendiri dan faktor lingkungan. Tahapan-tahapan perubahan dan perkembangan gonad dari suatu individu ikan adalah pengetahuan yang sangat penting dalam biologi perikanan. Dari data perubahan perkembangan ovari dan tetstes dapat dibandingkan antara ikan yang belum dewasa dan ikan sudah dewasa, antara ikan yang sudah matang gonad dan yang belum, antara ikan yang akan bereproduksi dengan yang sudah bereproduksi. Bahkan dapat diketahui pada ukuran berapa pertama kali ikan itu mulai matang gonad, memijah dan bisa pula diketahui saat ikan itu selesai memijah (Lagler et al., 1997). III. BAHAN DAN METODE 3.1. Waktu dan tempat Pratikum Biologi perikanan tentang seksualitas ikan ini dilaksanakan pada tanggal 14 Maret 2005 setiap hari Senin pada pukul 14.00 – 17.00 WIB. Yang bertempat di Laboratorium Biologi Perikanan Fakultas Perikanan dan Ilmu Kelautan Universitas Riau. 3.2. Bahan dan Alat Adapun bahan yang digunakan dalam pratikum ini adalah ikan Palau bujap yang satu genus dengan ikan paweh. Sebagai objek yang diamati selama pratikum. Sedangkan alat yang digunakan dalam pratikum adalah baki atau nampan, kain lap, laporan sementara, buku pratikum, alat untuk menghitung sisik, timbangan, gunting, pisau dan alat tulis.Sebagaimana terlampir pada (lampiran 1).

3.3. Metode Penelitian Metode yang digunakan dalam pratikum Biologi perikanan dengan judul seksualitas ikan ini adalah metode dengan pengamatan langsung terhadap objek pratikum yang diteliti atau yang diamati, yang tetap berpegang pada buku panduan pratikum dan didukung beberapa literature tertentu. Objek pratikum yang diteliti dan diamati adalah tingkat kematangan gonad suatu jenis ikan dan nilai indeks kematangan gonadnya apakah berbentuk testes atau ovari.

3.4. Prosedur Pratikum Di dalam prosedur pratikum ini, yang pertama dilakukan adalah identifikasi ikan yang menjadi objek praktikum, kemudian ukur panjang total (TL), panjang baku (SL), tinggi badan (Bd h), panjang kepala (Hd L), panjang fork (FL). Setelah dilakukan pengukuran secara morphometrik selanjutnya ditimbang. Amati perbedaan antara ikan ikan jantan dan betina dengan seksualitas sekunder dan untuk memastikan jenis kelamin ikan tersebut dengan seksualitas primer dengan cara membedah tubuh ikan bagian abdominal. Dan setelah itu apabila ikan tersebut gonadnya berbentuk testes maka amati bentuk testes, ukuran testes, perbandingan panjang testes dengan panjnag rongga tubuh, warana testes dan cari nilai indeks kematangan IV. HASIL DAN PEMBAHASAN 4.1. Hasil Berdasarkan hasil pengamatan selama praktikum diperoleh data yaitu ikan jantan sebanyak 15 ekor dan betina sebanyak 10 ekor. Tingkat kematangan gonad menurut Nikolsky pada ikan jantan untuk tahap I yaitu tidak masak sebanyak 2 ekor, tahap II masa istirahat sebanyak 5 ekor, tahap III yaitu hampir masak sebanyak 3 ekor, tahap IV yaitu masak sebanyak 2 ekor dan yang tidak terlihat sebanyak 3 ekor. Dan untuk ikan betina tahap I sebanyak 1 ekor, tahap II sebanyak 3 ekor, tahap III sebanyak 4 ekor, tahap IV sebanyak 2 ekor dan yang tidak terllihat tidak ada. Tingkat kematangan gonad menurut Kesteven untuk ikan jantan tahap I yaitu dara sebanyak 4 ekor, tahap II yaitu dara berkembang sebanyak 6 ekor, tahap III yaitu perkembangan I sebanyak 1 ekor, tahap IV yaitu perkembangan II sebanyak 2 ekor dan yang tidak terlihat ada 2 ekor. Sedangkan untuk ikan betina tahap I ada 1 ekor, tahap II ada 1 ekor, tahap III yaitu 3 ekor, tahap IV yaitu sebanyak 5 ekor dan yang tidak terlihat tidak ada. Sebagaimana (lampiran 2). 4.1.1. Klasifikasi dan Morfologi ikan Palau bujap (Osteochilus kahajanensis) Adapun klasifikasi dari pada ikan Palau bujap menurut Saanin (1981) adalah : Ordo : Ostariophysi Famili : Cyprinidae Genus : Osteochilus Spesies : Osteochilus kahajanensis Untuk menentukan ciri seksual primer pada ikan dengan penentuan berdasarkan gonadnya, pada ikan jantan testes bewarna putih dan pada ikan betina ovarynya bewarna kuning. Pada seksual sekunder dibagi atas seksual dirmophisme dan dicromatisme. Ciri seksual dirmophisme yang diamati adalah bentuk tengkuk kepala ikan jantan tumpul dan ikan betina lancip, warna ujung sirip punggung pada ikan jantan terang dan pada ikan betina pudar, bentuk

abdominal pada ikan jantan berbentuk datar dan untuk ikan betina bulat, bentuk papilla genital pada ikan jantan berbentuk lonjong dan ikan betina berbentuk bulat, jumlah lubang papilla genital pada ikan jantan berjumlah satu dan pada ikan betina juga satu, bentuk salah satu sirip anal untuk ikan jantan keras dan begitu juga pada ikan betina. Bentuk sirip perut sebelah kiribaik pada ikan jantan dan ikan betrina berbentuk bulat. Ciri-ciri dari pada seksual dicromatisme yang diamati adalah warna tubuh pada ikan jantan bewarna putih keperakan, terang sedangkan pada ikan betina putih keperakan, pudar. Warna pada sirip punggung dan ekor pada ikan jantan kemerahan dan hitam merah (terang), untuk ikan betina bewarna keabu-abuandan hitam merah (pudar), garis warna pada sirip ekor dan tubuh untuk ikan jantan merah terang dan kehitaman sedangkan pada ikan betina merah pudar dan keperakan, warna noktah pada batang ekor untuk ikan jantan hitam pudar dan ikan betina hitam terang dan warna pada dasar sirip dada pada ikan jantan bewarna putih dan ikan betina bewarna hitam. 4.1.2. Gambar bentuk ovary dan testes 4.2. Pembahasan Berdasarkan hasil pengamatan selama praktikum bahwa dalam tingkat kematangan gonad pada beberapa spesies ikan tertentu dapat terlihat apabila ikan sudah mengalami matang gonad (kelamin), akan tetapi pada beberapa spesies ikan lainnya ciri-ciri seksual itu dapat terlihat dengan jelas walaupun individu ikan tersebut belum matang gonad ataupun sudah selesai mijah. Penampakan ciri seksual yang dimiliki pada setiap individu spesies ikan terdiri dari seksual primer dan seksual sekunder. Pada pengamatan ciri seksual primer pada individu ikan dilakukan dengan membedah tubuh ikan pada bagian abdominal. Pada penampakan sekunder dilakukan dengan memperhatikan penampakan ciri yang terlihat pada permukaan tubuh. Seksual sekunder dibagi atas seksual dimorphisme dan seksual dicromatisme. Pada seksual dirmophisme yaitru dengan melihat bentuk atau ukuran tubuh serta bagian-bagian tertentu dan organ-organ pelengkapnya seperti ukuran tubuh, bentuk tengkuk kepala, bentuk abdominal. Dan pada seksual dicromatisme yaitu pengamtan berdasarkan warna pada permukaan tubuh dan organ-organ pelengkapnya seperti warna pada badan, warna pada sirip punggung dan ekor, warna noktah pada batang ekor, garis-garis warna pada sirip ekor dan tubuh dan warna pada dasar sirip dada dan perut. Gonad ikan disebut juga sebagai kelen jar biak. Gonad ikan betina dinamakan ovarium, sedangkan gonad ikan jantan dinamakan testes. Ovarium terletak memanjang didalam ronngga badan dan biasanya terdapat sepasdang yang masing-masing berada di kiri dan kanan antara geelembung renang. Ovarium menggantung pada rongga badan dengan pertolongan sepadsang mesentrium (mesovarium). Testes ikan berbentuk memanjang dalam rongga badan dibawah gelembung renang diatas usus. Biasnya tetstes pada ikan ada sepasang, dapat sama panjang dan ada pula yang satu lebih panjang dari yang lainnya Sumantadinata (1983). Berdasarkan data tingkat kematangan gonad yang sudah mencapai masak atau sudah siap untuk melakukan pemijahan, menurut Nikolsky ikan jantan yang sudah mengalami tahap masak sebanyak 2 ekor begitu juga pada ikan betina. Yang hampir masak pada ikan jantan ada 3 ekor dan ikan betina ada 4 ekor. Masa istirahat sebanyak 5 ekor dan ikan betina 3 ekor dan tidak masak pada ikan jantan 2 ekor dan ikan betina 1 ekor. Menurut Kesteven yang sudah mencapai tahap perkembangan II pada ikan jantan ada 2 ekor dan ikan betina ada 5 ekor. Perkembangan I untuk ikan jantan ada 1 ekor dan ikan betina ada 3 ekor, untuk dara berlembang pada ikan jantan

ada 6 ekor dan ikan betina 1 ekor dan masih tahap dara untuk ikan jantan ada 4 ekor dan ikan betina ada 1 ekor. Dan untuk nilai indeks kematangan gonad adalah 10,74 %. Menurut rumus yaitu IKG = Bg/Bt X 100% = 8,59/80 X 100% = 10,74%. V. KESIMPULAN DAN SARAN 5.1. Kesimpulan Dari hasil pratikum yang dilakukan maka dapat disimpulkan bahwa dalam tingkat kematangan gonad ikan dilakukan melalui dua data yaitu dengan seksual primer denga memperhatikan gonad yang dimilikinya dan seksual sekunder yang dibagi atas seksual dimorphisme (secara morfologi) dan seksual dicromatisme (warna) yang dilakukan dengan metode survey atau pengamatan langsung terhadap objek praktikum. Pada ciri seksual primer pada setiap individu ikan dilakukan melalui beberapa cara membedah tubuh bagian abdominal individu ikan, kemudian amati gonad yang dimiliki apakah berbentuk testes atau ovary. Sedangkan ciri seksual sekunder dengan pengamatan pada bagian morfologi (seksual dimorphisme) dan pengamatan berdasarkan bentuk warna (seksual dicromatisme). Setelah dilakukan identifikasi dari masing-masing ikan, maka dilakukan tahap-tahap kematangan gonad dan selanjutnya hitung nilai indeks kematangan gonadnya. .2. Saran Agar pratikum Biologi perikanan ini dapat berjalan dengan lancar dan baik dimasa yang akan datang diharapkan ikan yang menjadi sampel adalah ikan yang masih segar dan kalau bisa ikan yang sudah matang gonad, biar lebih memudahkan dalam pengamatan dalam praktikum.

DAFTAR PUSTAKA DINAS PERIKANAN KABUPATEN BENGKALIS. 1996/1997. Kebijaksanaan umum tentang perikanan dan kelautan. Bengkalis. 27 hal DINAS PERIKANAN dan KELAUTAN PROPINSI RIAU, 2001. Potensi dan tingkat pemanfaatan sumber daya perikanan dan kelautan propinsi Riau. 45 hal (tidak diterbitkan). DJUHANDA, T. 1981.Dunia ikan. Bagian I. Kehidupan ikan dalam ekosistem perairan di Indonesia. 20 hal. DJAJADIREJA, R., S. HATIMAH dan Z. ARIFIN. 1977. Buku pedoman pengenalan

sumberdaya perikanan darat bagian I. Dtjen perikanan. Jakarta. 96 hal. EVY,R., ENDANG MUJIANI dan K. SUJONO.2001. Usaha Perikanan di Indonesia. Mutiara Sumber Widya. Jakarta. 96 hal. EFFENDIE, M. I., 1979. Metode biologi perikanan. Yayasan Dwi Sri, Bogor. 122 hal. EFEENDIE., M. I., D. J. SJAFEI.; M. RAHARJO; R. AFFANDI dan SULISTIONO., 1979. Ichthyology Fakultas Perikanan Institut Pertanian Bogor, Bogor. 183 hal (tidak diterbitkan). HARDJAMULIA, A., 1978. Budidaya perikanan. Departemen Pertanian. BPLPP. Sekolah usaha perikanan, Bogor. 58 hal. KOTTELAT, M., A. J. WHITTEN., S. N Kartika sari., dan R.WIJOATMOJO. 1993. Freshwater Fishes of Western Indonesia and Sulawesi. Gajah Mada Press. 293 hal. LAGLER, K. F; J. E. BAARDACH; R. R. MILLER and D. R. M PASSINO., 1977. Ichthyology. Jhon Willey and Sons. Inc. Toronto, 506 pp. RAHARJO. 1980. Sistem morfologi dan anatomi ikan. Bandung. 21 hal.

SUSANTO. 1987. Budidaya ikan dipekarangan. Penerbit Penebar Swadaya. Jakarta. 152 hal. YUNIARTI. 2000. inventarisasi dan identifikasi ikan Channidae yang terdapat di Sungai Kampar Propinsi Riau. Laporan Praktek lapang. Fakultas perikanan dan ilmu kelautan, Universitas Riau, Pekanbaru. 32 hal (tidak diterbitkan) Diposkan oleh iptek di 08:28 1 komentar Label: iptek

Bioper 2
I. PENDAHULUAN 1.1. Latar belakang Perairan umum indonesia yang meliputi dua pertiga wilayah tanah air Indonesia memiliki Potensi sumber daya hayati perikanan yang besar dan belum seluruhnya dapat dikelola. Mengingat sangat mendesaknya kebutuhan akan protein hewani yang berasal dari ikan, maka sudah seharusnya memanfaatkan sumber-sumber hayati perairan yang ada dan dimanfaatkan semaksimal mungkin karena akan dapat menunjang perluasan kesempatan kerja, meningkatkan pendapatan nelayan dan perbaiakan gizi masayarakat. Keadaan ini sejalan dengan pertambahan penduduk serta kondisi geografis Indonesia yang mutlak memerlukan pelaksanaan peningkatan dalam bidang perikanan. Usaha perikanan yang ada di Indonesia merupakan perpaduan antara usaha perikanan darat dan perikanan laut. Ikan merupakan sumber protein yang paling murah dibanding dengan sumber

protein yang lainnya seperti telur, susu dan daging (DINAS PERIKANAN KABUPATEN BENGKALIS, 1996/1997). Luas perairan umum Riau adalah 62.648,53 Ha, terdiri dari luas perairan umum Indragiri Hilir 2.600 Ha, luas perairan umum Indragiri hulu 33,164 Ha, luas perairan umum kuansing singingi 23.086 ha, luas perairan umum Pekanbaru 85 Ha, luas perairan umum Siak 764 Ha, luas perairan umum Bengkalis 70 Ha, dan luas perairan umum Kampar 2.795,99 Ha (DINAS PERIKANAN DAN KELAUTAN PROPINSI RIAU, 2001). Propinsi Riau merupakan salah satu propinsi yang memiliki wilayah daratan 94.561 km2 dan 3.241 pulau-pulau yang memiliki empat satuan wilayah sungai yaitu sungai Rokan, siak, Kampar dan sungai Indragiri yang merupakan perairan yang potensial untuk pembangunan usaha perikanan (YUNIARTI, 2000). Untuk propinsi Riau produksi perikanan umum adalah sebesar 12.706,6 ton atau 7% dari seluruh produksi prikanan Riau, dimana produksi perikanan tersebut berasal dari kabupaten indragiri hulu, Kampar, Bengkalis dan Indragiri hilir (EVY, MUJIANTI dan SUJONO, 2001). Salah satu jenis ikn air tawar yang potensial untuk dikembangkan ialah ikan Palau bujap yang hampir mirip dengan ikan paweh. Ikan ini merupakan salah satu spesies yang mampu beradaptasi terhadap kondisi perairan yang marginal, seperti derajad keasaman perairan yang relatif rendah dan adanya dominasi ikan-ikan yang yang sering menimbulkan masalah di perairan umum. Disamping itu ikan Palau bujap umumnya jarang terserang penyakit atau parasit. Kalaupun ada pen7yakit yang menyerang tidaklah berbahaya (HARDJAMULIA, 1978). Ikan ini juga merupakan salah satu ikan ekonomis penting yang ada di perairan tawar (DJAJADIRREDJA, et al., 1977. Ikan merupakan organisme tingkat tinggi yang memiliki nilai ekonomis dan ekologi penting. Mengingat pentingnya keberadaan ikan dalam suatu ekosistem, maka diperlukan pengetahuan tentang beberapa aspek biologi, antara lain tingkat kematangan gonad, fekunditas, hubungan panjang berat, seksualitas ikan, ruaya, pemijahan, awal daur hidup, kebiasaan makanan dan cara memakan, persaingan dan pemangsaan, pertumbuhan ikan, umur ikan, analisis populasi dan analisa saluran pencernaan yang merupakan kunci penting dan harus diperhatikan untuk menjamin kelestarian sumberdaya dan usaha budidaya ikan tersebut. 1.2. Tujuan dan Manfaat Adapun tujuan dari pelaksanaan pratikum ini adalah untuk mengenal jenis ikan baik yang berasal dari habitat air tawar maupun dari habitat air laut, dengan cara melihat seksual primer dan seksual sekunder yang dimiliki ikan tersebut. Manfaat dari pratikum ini adalah untuk mengenal lebih jauh lagi tentang identifikasi yang dimilik ikan yang kita amati dengan menggunakan data mertistik dan morphometrik serta suatu informasi tentang keberadaan habitat ikan tersebut.

II. TINJAUAN PUSTAKA

Ikan adalah hewan bertulang belakang yang berdarah dingin, hidup di air, pergerakan dan keseimbangan tubuhnya menggunakan sirip dan bernafas dengan insang ( RAHARJO, 1980) Menurut MUDJIMAN (2001) setiap ikan mempunyai makanan yang berbeda. Jika dilihat dari jenis makanannya maka ikan dapat dibagi menjadi tiga golongan yaitu herbivor, karnivora dan omnivora. Berdasarkan cara makannya ikan dibedakan menjadi lima golongan yaitu pemangsa (predator), penggerogot (grazer), penyaring (strainer), penghisap (sucker) dan parasit. Berdasarkan macam makanannya, ikan dapat kita bedakan menjadi lima macam golongan yaitu pemakan tumbuh-tumbuhan (herbivor atau vegetaris, pemakan hewan (karnivor), pemakan tumbuhan dan hewan (omnivor), pemakan plankton dan detritus (hancuran bahan organic) dan pemakan dasar (EFFENDI 1997 dan PULUNGAN, PUTRA, EFRIYELDI dan EFIZON, 2001). Menurut SUSANTO (1987) ciri-ciri dari ikan Palau bujap panjang tubuh 15 cm. Sirip punggungnya mempunyai 3 jari-jari keras dan 10-11 jari-jari lunak. Sirip dubur mempunyai 3 jari-jari keras dan 5 jari-jari lunak. Warna tubuh hitam kecoklat-coklatan, pada punggung dan pangkal sirip punggungnya ada serangkaian binti-bintik hitam. Menurut (KOTTELAT et. al. 1993, SAANIN, 1984 dan DJUHANDA ,1981). Ciri-ciri ikan Palau bujap adalah tidak ada tubus keras pada moncong, 6-9 baris bintik-bintik berwarna pada sepanjang barisan (walaupun tidak terlalu jelas), terdapat bintik bulat besar pada batang ekor, batang ekor dikelilingi 16 sisik dan bagian depan sirip punggung dikelilingi 26 sisik, letak mata lebih tinggi, jari keras sirip dubur tidak bergigi sebelah ke belakang, permukaan sirip punggung dimuka, diatas atau sedikit dibelakang sirip perut, sirip ekor bercagak dua, bentuknya simetris, dekat sudut rahang atas ada dua sungut peraba DJUHANDA (1981) mengklasifikasikan ikan Palau bujap ke dalam, ordo Cypriniformes, famili Cyprinidae, genus Osteochillus , dan spesies Osteochillus kahajanensis. Ikan jantan mempunyai kelenjar yang berwarna putih yang permukaan licin, berisi sel-sel kelamin jantan (sperma) dan saluran pelepasan disebut vasdeferens. Saluran ini bertemu dan bersatu dengan saluran kencing. Sedangkan pada ikan betina kelenjar kelaminnya mempunyai permukaan kasar, berbintik bintik, berisi sel telur dan saluran pelepasan disebut dengan oviduct. (SURIPTO 1982) Ukuran warna gonad bervariasi tergantung kematangan sel telur tersebut. Beratnya bisa mencapai 12% dari berat tubuhnya. Kebanyakan testes transparan dan putih. Sedangkan ovari kuning. (RIDWAN, 1980) Berdasarkan tempat pemijahan. Ikan dapat dimasukkan kedalam beberapa golongan, yaitu golongan ikan phytopil yang memijah pada tanaman. Golongan psamopil memijah dipasir. Golongan ikan pelagopil memijah pada kolam air diperairan dan golongan ikan ostracopil pada cakang yang telah mati (RAHARJO, 1980). EFFENDIE (1979) menyatakan bahwa sifat seksualitas primer pada ikan ditandai dengan adanya yang secara langsung berhubungan dengan proses reproduksi, yaitu ovarium dan pembuluhnya. Sifat seksual sekunder adalah tanda-tanda luar yang dipakai untuk membedakan jantan dan betina. Apabila suatu spesies ikan mempunyai sifat morfologi yang dapat dipakai untuk

membedakan jantan dan betina, maka spesies itu mempunyai seksual dimorphisme. Dan apabila yang menjadi tanda itu adalah warna, maka ikan tersebut mempunyai sifat dicromatisme. Pada ikan jantan mempunyai warna yang lebih cerah dan mebarik dari pada ikan betina. LAGLER et al., (1977) menyatkan bahwa perbedaan antara ikan jantan dan ikan betina pada jenis ikan yang sama dapat dilihat pada ukuran kepala, bentuk kepala, permukaan tengkorak kepala, bentuk sirip ekor, bentuk badan, bentuk perut, bentuk sirip anus, dasar sirip dada, bentuk sirip perut dan sirip aus, bentuk serta ukuran lubang pelepasan alat kelamin.

III. BAHAN DAN METODE

3.1. Waktu dan tempat Pratikum Biologi perikanan tentang seksualitas ikan ini dilaksanakan pada tanggal 7 Maret 2005 setiap hari Senin pada pukul 14.00 – 17.00 WIB. Yang bertempat di Laboratorium Biologi Perikanan Fakultas Perikanan dan Ilmu Kelautan Universitas Riau. 3.2. Bahan dan Alat Adapun bahan yang digunakan dalam pratikum ini adalah ikan Palau bujap yang satu genus dengan ikan paweh. Sebagai objek yang diamati selama pratikum. Sedangkan alat yang digunakan dalam pratikum adalah baki atau nampan, kain lap, laporan sementara, buku pratikum, alat untuk menghitung sisik, timbangan, gunting, pisau dan alat tulis. Sebagaimana terlampir pada (lampiran 1). 3.3. Metode Penelitian Metode yang digunakan dalam pratikum Biologi perikanan dengan judul seksualitas ikan ini adalah metode dengan pengamatan langsung terhadap objek pratikum yang diteliti atau yang diamati, yang tetap berpegang pada buku panduan pratikum dan didukung beberapa literature tertentu. Objek pratikum yang diteliti dan diamati adalah ciri seksual primer terdiri atas membedah tubuh ikan, mengeluarkan gamet melalui stripping (pengurutan) dan mengambil gamet dengan bantuan alat yang disebut cateter canula (selang halus) dan ciri seksual sekunder ikan yang terdiri atas seksual dirmophisme dan seksual dicromatisme.

3.4. Prosedur Pratikum Di dalam prosedur pratikum ini, yang pertama dilakukan adalah identifikasi ikan yang menjadi objek praktikum, kemudian ukur panjang total (TL), panjang baku (SL), tinggi badan (Bd h), panjang kepala (Hd L), panjang fork (FL). Setelah dilakukan pengukuran secara morphometrik selanjutnya ditimbang. Amati perbedaan antara ikan ikan jantan dan betina dengan seksualitas

sekunder dan untuk memastikan jenis kelamin ikan tersebut dengan seksualitas primer. IV. HASIL DAN PEMBAHASAN 4.1. Hasil Berdasarkan hasil pengamatan selama praktikum diperoleh data sebagai berikut: NO TL (mm) SL (mm) FL (mm) Bd H (mm) Hd L (mm) BERAT (gram) JENIS KELAMIN 1. 200 150 145 60 35 120 Betina 2. 175 130 154 55 30 80 Jantan 3. 205 155 180 60 33 120 Betina 4. 170 128 145 48 28 60 Betina 5. 180 135 150 55 30 190 Betina 6. 160 119 160 46 27 60 Jantan 7. 165 123 135 45 21 70 Jantan 8. 145 104 120 43 26 40 Jantan 9. 160 124 133 45 27 50 Jantan 10. 135 96 113 38 29 10 Jantan 11. 150 110 130 42 27 50 Jantan 12. 130 93 110 38 23 30 Jantan 13. 140 104 120 42 24 30 Jantan 14. 160 120 135 47 26 50 Jantan 15. 180 131 155 55 28 80 Betina 16. 165 121 140 51 30 70 Jantan 17. 145 104 123 40 25 40 Jantan 18. 155 115 130 44 25 50 Jantan 19. 155 122 135 46 25 50 Jantan 20. 160 118 130 43 26 60 Jantan 21. 130 97 405 32 23 30 Jantan 22. 135 97 110 38 22 40 Jantan 23. 120 94 110 38 23 30 Jantan 24. 175 130 150 50 28 70 Betina 25. 175 132 145 50 29 80 Betina Catatan : Jumlah ikan jantan 18 ekor Jumlah ikan Betina 7 ekor 4.1.1. Klasifikasi dan Morfologi ikan Palau bujap (Osteochilus kahajanensis) Adapun klasifikasi dari pada ikan Palau bujap menurut SAANIN (1981) adalah : Ordo : Ostariophysi Famili : Cyprinidae

Genus : Osteochilus Spesies : Osteochilus kahajanensis Untuk menentukan ciri seksual primer pada ikan dengan penentuan berdasarkan gonadnya, pada ikan jantan testes bewarna putih dan pada ikan betina ovarynya bewarna kuning. Pada seksual sekunder dibagi atas seksual dirmophisme dan dicromatisme. Ciri seksual dirmophisme yang diamati adalah bentuk tengkuk kepala ikan jantan tumpul dan ikan betina lancip, warna ujung sirip punggung pada ikan jantan terang dan pada ikan betina pudar, bentuk abdominal pada ikan jantan berbentuk datar dan untuk ikan betina bulat, bentuk papilla genital pada ikan jantan berbentuk lonjong dan ikan betina berbentuk bulat, jumlah lubang papilla genital pada ikan jantan berjumlah satu dan pada ikan betina juga satu, bentuk salah satu sirip anal untuk ikan jantan keras dan begitu juga pada ikan betina. Bentuk sirip perut sebelah kiribaik pada ikan jantan dan ikan betrina berbentuk bulat. Ciri-ciri dari pada seksual dicromatisme yang diamati adalah warna tubuh pada ikan jantan bewarna putih keperakan, terang sedangkan pada ikan betina putih keperakan, pudar. Warna pada sirip punggung dan ekor pada ikan jantan kemerahan dan hitam merah (terang), untuk ikan betina bewarna keabu-abuandan hitam merah (pudar), garis warna pada sirip ekor dan tubuh untuk ikan jantan merah terang dan kehitaman sedangkan pada ikan betina merah pudar dan keperakan, warna noktah pada batang ekor untuk ikan jantan hitam pudar dan ikan betina hitam terang dan warna pada dasa4r sirip dada pada ikan jantan bewarna putih dan ikan betina bewarna hitam.

4.1.2. Gambar bentuk ovary dan testes 4.2. Pembahasan Berdasarkan hasil pengamatan selama praktikum bahwa dalam seksualitas ikan pada beberapa spesies ikan tertentu dapat terlihat apabila ikan sudah mengalami matang gonad (kelamin), akan tetapi pada beberapa spesies ikan linnya ciri-ciri seksual itu dapat terlihat dengan jelas walaupun individu ikan tersebuty belum matang gonad ataupun sudah selesai mijah. Penampakan ciri seksual yang dimiliki pada setiap individu spesies ikan terdiri dari seksual primer dan seksual sekunder. Pada pengamatan ciri seksual primer pada individu ikan dilakukan melalui beberapa cara yaitu membedah tubuh ikan bagian abdominal individu ikan tersebut, amati gonad yang dimiliki apakah berbentuk testes atau ovary, mengeluarkan ganet yang dilkukan dengan cara menstriping induk yang sudah matang gonad dilakukan dengan cara memberi tekanan lembut dan halus pada bagian abdominal dan diurut dari arah dada kelubang genital dan mengambil gamet dari dalam gonad melalui cara pengisapan dengan bantuan cateter canula. Dan yang digunakan pada praktikum ini adalah dengan membedah tubuh ikan tersebut karena ikan itu sudah mati dan untuk mengunakan alat dari cateter canula tidak ada. Yang diamati seperti bentuk testes atau ovary dan warna testes atau ovary (EFFENDIE , 1979). Pada penampakan sekunder dilakukan dengan memperhatikan penampakan ciri yang terlihat pada permukaan tubuh. Seksual sekunder dibagi atas seksual dimorphisme dan seksual dicromatisme. Pada seksual dirmophisme yaitru dengan melihat bentuk atau ukuran tubuh serta bagian-bagian tertentu dan organ-organ pelengkapnya seperti ukuran tubuh, bnetuk tengkuk kepala, bentuk abdominal. Dan pada seksual dicromatisme yaitu pengamtan berdasarkan warna pada permukaan tubuh dan organ-organ pelengkapnya seperti warna pada badan, warna pada

sirip punggung dan ekor, warna noktah pada batang ekor, garis-garis warna pada sirip ekor dan tubuh dan warna pada dasar sirip dada dan perut. Ikan yanng diamati atau menjadi objek praktikum sebanyak 25 ekor yang mana data morphometriknya dari setiap ekor ikan tersebut berbeda seperti panjang total (TL), panjang baku (SL), panjang fork (FL), tinggi badan (Bd H), panjang kepala (Hd L). hal ini disebabkan karena beberapa faktor antara lain umur, induk ikannya berbeda, makanan, kualitas perairan dan pertumbuhan dari ikan tersebu V. KESIMPULAN DAN SARAN 5.1. Kesimpulan Dari hasil pratikum yang dilakukan maka dapat disimpulkan bahwa dalam seksualitas ikan dilakukan melalui dua data yaitu dengan seksual primer denga memperhatikan gonad yang dimilikinya dan seksual sekunder yang dibagi atas seksual dimorphisme (secara morfologi) dan seksual dicromatisme (warna) yang dilakukan dengan metode survey atau pengamatan langsung terhadap objek praktikum. Pada ciri seksual primer pada setiap individu ikan dilakukan melalui beberapa cara membedah tubuh bagian abdominal individu ikan, kemudian amati gonad yang dimiliki apakah berbentuk testes atau ovary. Yang menjadi pengamatan pada seksual primer adalah bentuk testes atau ovary, warna testes atau warna ovary. Sedangkan pada ciri seksual sekunder, penentuan jenis kelamin ikan dengan cara memperhatikan ciri dari pada permukaan tubuh ikan. Pengamatan pada ciri seksual sekunder dibagi atas seksual dimorphisme (morfologi) seperti ukuran tubuh, bentuk tengkuk pada kepala, bentuk abdominal, bentuk papila genital dan seksual dicromatirme (warna) seperti warna pada badan, pada sirip punggung dan ekor, warna noktah pada batang ekor dan warna pada dasar sirip dada dan perut. .2. Saran Agar pratikum Biologi perikanan ini dapat berjalan dengan lancar dan baik dimasa yang akan datang diharapkan ikan yang menjadi sampel adalah ikan yang masih segar dan kalau bisa ikan yang sudah matang gonad.

DAFTAR PUSTAKA DINAS PERIKANAN KABUPATEN BENGKALIS. 1996/1997. Kebijaksanaan umum tentang perikanan dan kelautan. Bengkalis. 27 hal DINAS PERIKANAN dan KELAUTAN PROPINSI RIAU, 2001. Potensi dan tingkat pemanfaatan sumber daya perikanan dan kelautan propinsi Riau. 45 hal (tidak diterbitkan). DJUHANDA, T. 1981.Dunia ikan. Bagian I. Kehidupan ikan dalam ekosistem perairan di

Indonesia. 20 hal. DJAJADIREJA, R., S. HATIMAH dan Z. ARIFIN. 1977. Buku pedoman pengenalan sumberdaya perikanan darat bagian I. Dtjen perikanan. Jakarta. 96 hal. EVY,R., ENDANG MUJIANI dan K. SUJONO.2001. Usaha Perikanan di Indonesia. Mutiara Sumber Widya. Jakarta. 96 hal. EFFENDIE, M. I., 1979. Metode biologi perikanan. Yayasan Dwi Sri, Bogor. 122 hal. EFEENDIE., M. I., D. J. SJAFEI.; M. RAHARJO; R. AFFANDI dan SULISTIONO., 1979. Ichthyology Fakultas Perikanan Institut Pertanian Bogor, Bogor. 183 hal (tidak diterbitkan). HARDJAMULIA, A., 1978. Budidaya perikanan. Departemen Pertanian. BPLPP. Sekolah usaha perikanan, Bogor. 58 hal. KOTTELAT, M., A. J. WHITTEN., S. N Kartika sari., dan R.WIJOATMOJO. 1993. Freshwater Fishes of Western Indonesia and Sulawesi. Gajah Mada Press. 293 hal. LAGLER, K. F; J. E. BAARDACH; R. R. MILLER and D. R. M PASSINO., 1977. Ichthyology. Jhon Willey and Sons. Inc. Toronto, 506 pp. RAHARJO. 1980. Sistem morfologi dan anatomi ikan. Bandung. 21 hal.

SUSANTO. 1987. Budidaya ikan dipekarangan. Penerbit Penebar Swadaya. Jakarta. 152 hal. YUNIARTI. 2000. inventarisasi dan identifikasi ikan Channidae yang terdapat di Sungai Kampar Propinsi Riau. Laporan Praktek lapang. Fakultas perikanan dan ilmu kelautan, Universitas Riau, Pekanbaru. 32 hal (tidak diterbitkan)


				
DOCUMENT INFO