expression and function analysis of cholinergic components nachrα7
Description
expression and function analysis of cholinergic components nachrα7
Document Sample


ISSN ¡¡ 100727626 CN ¡¡ 1123870Π Q — „œœ ˛ »fl § º • œ ˛ § –¤ Chinese Journal of Biochemistry and Molecular Biology 2008 ˜Œ9 ´ 24 (9) :803¡« 809 Expression and Function Analysis of Cholinergic Components ƒ` nAChR 7 in Preadipocytes WU Jing , LU Hui2Ling 1) 2) ( 1) Department of Pediatrics , Tongji Hospital , Tongji Medical College , Huazhong University of Science and Technology , Wuhan ¡¡430030 , China ; Clinical College , Wuhan University of Science and Technology , Wuhan ¡¡430064 , China) Received : March 14 , 2008 ; Accepted : May 29 ,2008 3 3 Supported by National Natural Science Foundation of China (No. 30600213) ˚ ‚ ¨ ˘ :2008203214 ;‰˚ ¨ ˘ :2008205229 „œ… ¨» ¿˘ § »ø‰˚ œ ˇ ˜¿ (No. 30600213) Corresponding author ¡¡ Tel : 027283663315 ; E2mail : huilinglu @yahoo. cn Tel : 027283663315 ; E2mail : huilinglu @yahoo. cn ƒ`7 ( nicotinic acetylcholine receptor ƒ`7 , nAChR 7 ) ˚˙ ƒ` … ø ¤ … ˜ ¿„ ˝¤ ´• ( nicotinic anti2inflammatory pathway) — “ ˜ • ”¸ —˜ œ˘ ,˝‹ ˚– † ˚˙ »œ ˇ ˘ ¸ » • ø •· ƒ ' · ˜ ˜ · —¿„ »œ˘ fi » . – ƒ`7 ¶ ˛˜ … ‰ ( ˙ ) ‹ • ˇ‚ ß ˇ •˙ æ › “ —˝ …˜ ˇ ˝‡ ˚˙ •æ· ¤ …‡ı †‰ ‰˚ …ø ¤ …˜ ˚ ˙ ‹ • ˇ‚ ß „ƒ ˜ ˜ ¤ …˚ ƒ`7 ˜ 3 ˇ . ¡ …£ … ,• – …† ˙ ‹ • ˇ‚ ß ”˝ ‡ ˚ ‹ • ˇ‚ ß — … ˚ı ¤ …˜ ˇ ˝‡ “ Ø• ˜ ˝ ¯ ł ˜ 3T32L1 ˙ ‹ • ˇ‚ ß ˛“ —¿ ¶ ˇ ,† ˆ ˆ ı£ ¤ …ı¥ ˆ‚ ¡¢ … ¤ Ø »fl”˝ ˚ ˆ ı£ “ ˘ ˆ‚ ”˝ …ø ı£ – · . ` ‰« ‹ • ˇ‚ ß • ˛“ ‚ł Ł „ª ˘ ˙ …ø ı£ Abstract ¡¡ The non2neuronal cholinergic system , widely exists in prokaryotic , eukarytic , and even plant cells , however , it has not been investigated in preadipocytes and adipocytes. T search for evidence its o existence in preadipocytes and adipocytes , the nicotinic acetylcholine receptor ( nAChR ) ƒ`7 subunit , acetylcholinesterase ( AChE) and choline acetyltransferase ( ChAT) in 3T32L1 cells were examined using immunohistochemical staining and Western blotting. The choline2regulated visfatin expression in 3T32L1 - 6 - 4 preadipocytes was also tested by reverse transcriptase2PCR. Incubation with methyllycaconitine ( 10 to 10 molΠ ) for 12 , 24 and 36 hours dose2dependently increased visfatin expression from 1132 to 11552folds ( P < L - 4 - 6 0101) with maximal induction at 24 hours with 10 molΠ methyllycaconitine. Nicotine treatments ( 10 to L - 4 - 4 10 molΠ ) for 12 , 24 and 36 hours decreased visfatin expression ; choline chloride ( 10 molΠ ) ) L L suppressed visfatin expression in 3T32L1 preadipocytes at 36 hours by 1164 to 2103 fold ( P < 0105 ) which was more effective as compared with nicotine. It was concluded that ƒ`7 nAChR was expressed in 3T32L1 preadipocytes and involved in visfatin expression. Key words ¡¡ non2neuronal cholinergic system ; cholinergic anti2inflammatory pathway ; visfatin ; inflammation ; obesity ( ˙ ) ‹ • ˇ‚ ß ˜ – · … ƒ` nAChR 7 „ƒ˜ · ‹ ¶ ˙ ‹ • ˇ‚ ß Visfatin »ø – · ˜ •˙ æ › “ —˝ ¤ … ˜ ˇ ˝‡ ˛ ¡¡† 1) ¡¡ › , ¡¡ ´‹ » `Æ — ¿˘ …… · § ( 1) »“ “ “ ”¸ œ ˛ ¡¢ ”¸ œ ˛ ı£ ¤ …ı¥ ˆ‚ ( acetylcholinesterase ,AChE) ¡¢ … ¤ ( acetylcholine receptor , AChR) ‚ ˙ —˝ ˜ ˜ ¤ …˜ ˇ ˝‡ Ø • ˜ · ˚ 1) 3 , ¡¡ ”œ—ª • ” ˝‹ …ˆ ‰ § ¡¢ ˛ † WANG Hong2Wei 1) ‚‰ ˚ 1) 3 , ¡¡ `” ˇ ˝‹ …ˆ ‰ ” ˜ , HU Xiu2Fen , LIANG Xiao2Yan , LIN Han2Hua , 1) 1) 1) 1) , Y ANG Yang , XIA Zhi 2) 1) ˇ 1) , ¡¡ ` ”” »“ 1) 1) , ¡¡ ˝ı ”Œ ˛ ”” ¿˘ …… · § , ¡¡ ¡¡ 2) , ¡¡ ˇ˜ ¡¡ ˛ 1) ¶ø ¿˘ , ˛ ”” ¡¡430030 ; 2) ˛ ` ·† § ” ,˛ ”” ¡¡430064) •˙ æ › ˇ‚ ß ”˝ Ø fl — » —ˇ‚ ß — ,ø ⁄ ˚ ı£ “ ˘ ˆ‚ ( choline acetyltransferase ,ChAT) ”˝ ı£ ¤ … ,˘ — …ø ı£ ¤ …˚ ,¨ ˘ ˚˙ ¶ ˆ 804 Chinese Journal of Biochemistry and Molecular Biology Vol. 24 7 …⁄¶fl…` ¨ »fl¤ …… ´ ˚ ƒ`7 ¿„ …` »ø¯£ – ˝⁄ …‚ ⁄ … 12 h ¡¢ 4 h ¡¢ 6 h ,†¢Ł `¢ ˇ ƒ ·ƒ 2 3 ˚– …˜ ¿ ¶ — …ø ı£ ¤ … Ø ,˜ “ ´… ”ˇ ˆ‚ `· •· ƒ …† ˙ ‹ • ˇ‚ ß visfatin mRNA – · ˙Ø¿ . ˆ Ø »fl¨ « ¿ …ß ‹ • ˇ‚ ß — AChE¡¢ ˙ ChAT ƒ` … AChR 7 ø — —– · ; ˆ ¡ …£ † ‰ł» †‰ ¶¤ `¿ ⁄ ˚ `¸ ˙ ‹ • ˇ‚ ß ”˝ ‡ ˚ ‹ • ˇ‚ ß — … º ƒ` AChE¡¢ hAT … AChR 7 ˜ C …˘ † § ¶ – · ; ¿„ …` »ø¯£ – ˝⁄ … ( 10 ¡« 10 … ˙ ‹ • ˇ‚ ß visfatin mRNA – · ( 113¡« 11552fold , P < 0101 ) ,º ¶ ƒ ¿ ; …¨º †»˝‹ …` ¿ ˜ ˜Æ„¯ ¶¡ ”˝ ´¨ »fl¤ … , ` ˇ´ ‰ ,˘ — —¶ `¢ ˜ ¤ …˜ “ Ø ˇ –¨ ,ø †»˝‹ ‡ ¶¨ „ ‡ —•¢ » ˇ‚ ß —ø · †¡ œ ˆ . „ …·˚ ¡¡ •˙ æ › “ —˝ …˜ ˇ ˝‡ ;¤ …˜ ¿„ ¤ —˝… • ”¯ ¡¡ R329 ;R335 ;R36312 2 + - 6 - 4 ˙ ‹ • ˇ‚ ß — visfatin mRNA – · ¸fi ˘‰ ¶ ƒ ¿ º ´¨ »fl¤ …˜ ˘ —§ ‚ ˛“ ˇ ł . ˙ ‹ • ˇ‚ ß º ‡ ˚ ‹ • ƒ ƒ` ˇ ,˘ — AChR 7 ” ¿ ˜ ‰‹ • ˇ‚ ß • ˆ …•˚ ¯ ˇ „ ˜ ˝¤ ´• ;˜ ‹ ¸ ; ¢ ;•˚ ¯ ¡¡ ¡¡ White adipose tissue ( WAT) is now recognized as not only the major energy reserve in the form of triglyceride , but also as an active endocrine source which provide a large number of factors involved in regulating inflammation and metabolism , which collectively termed as adipokines or adipocytokines. It has become fairly clear that excess fat storage with an altered expression profile of adipokines contributes to chronic , sub2acute , [1 ] non2infected inflammation states . In the course of evolutionary history , acetylcholine ( ACh ) has been a highly conserved fundamental neurotransmitter in body fluid since ancient ages , and is widely distributed over diverse living organisms from [2 ] prokaryotes to vertebrates , even in plants . Proposed by Wessler et al in the 1990s , the novel concept of a non2 [3 ] neuronal acetylcholine system , scilicet , referred as a [3 ] hard2wired cholinergic system . Hitherto , most of the cholinergic components , known to exist in the nervous system , were also found widely expressed in immuno2 competent cells , including mononuclear leukocytes , bone marrow2derived dendritic cells , peritoneal [4 ] macrophages , keratinocytes , endothelial , glial , and bronchial epithelial cells and urinary bladder [5 ,6 ] urothelium . ACh controls the production of pro2 inflammatory cytokines and anti2inflammatory cytokines either through muscarinic ( G protein2coupled receptors , 2 mAChR ) or nicotinic receptors ( ligand2gated ion channels , nAChR ) in either an autocrine or paracrine [7 ] manner . Various functions of the non2neuronal cholinergic systems have been considered , including regulation of cell2cell contact and signaling , differentiation , carcinogenesis , hematopoiesis , and anti2 [4¡« 7 ] inflammation . Most evidence points towards a crucial role for theƒ`7 homo2pentamer nAChR in the cholinergic regulation of various cytokines and anti2inflammatory effect on [7 ] inflammation2related cells . Visfatin , a 522kD secreted molecule , initially termed as pre2B cell2enhancing factor ( PBEF ) , has been re2discovered recently as a novel adipocytokine abundantly expressed in 3T32L1 preadipocytes and adipocytes. Notably , the visfatin [8 ] insulin2mimicking property reported by Fukuhara et al , [9 ] has been questioned and the paper has been retracted , however , its important pathophysiologic role involved in the inflammatory process has been extensively [10 ] elucidated . Several reports pointed out that visfatin might serve as a novel mediator of innate immunity. Visfatin can dose2dependently up2regulated the pro2 ƒ´ ƒ inflammatory cytokines IL21 , IL26 and TNF2 , and itselevated expression was observed in many acute and [11 , 12 ] chronic inflammatory diseases . Notheless , the mechanisms responsible for visfatin regulation remained to be fully elucidated. Although nearly all nAChR subtypes were detected [13 ] in rat adipocytes , their existence regarding parasympathetic innervation in WAT appeared to be [14 ] controversial . In this study , we investigated the expression of major components of the non2neuronal acetylcholine system , ƒ`7 nAChR , acetylcholinesterase ( AChE ) and choline acetyltransferase ( ChAT ) , in cultured mouse 3T32L1 preadipocytes and adipocytes. Following exposure of 3T32L1 preadipocytes to different dose of the non2selective nAChR agonist nicotine , selective ƒ`7 nAChR antagonist methyllycaconitine and selectiveƒ`7 nAChR agonist choline chloride for 12 , 24 , 36 hours respectively , the modulation of visfatin gene expression was evaluated using reverse transcriptase2PCR. The classical experiments to investigate the properties of a non2neuronal cholinergic system were carried out , in particular the determination ofƒ`7 nAChR in cultured 3T32 L1 preadipocytes. Understanding this rapidly expanding knowlege of non2neuronal acetylcholine pathway could be of importance in developing novel therapies for obesity2 associated diseases. 1 ¡¡ Materials and Methods 111 ¡¡ Materials 3T32 preadipocytes were purchased from ATCC L1 molΠ ) ˚– … ¡¢ ` ¿ L … ¶ Ø ˇ –¨ ,· —ˇ ˇ ł —˝‡ No. 9 ƒ` WU Jing ,et al : Expression and Function Analysis of Cholinergic Components nAChR 7 in Preadipocytes 805¡¡ (Manassas ,VA ,USA) . Isobutylmethylxanthine ( IBMX) , dexamethasone ( DEX) , insulin ( INS) and bovine serum albumin ( BSA ) were purchased from Sigma2Aldrich ( St . Louis , MO) . Mini2Protein ¢ electrophoresis system and Mini trans2blot system were obtained commercially from Bio2Rad Laboratories , Inc. ( Bio2Rad , USA ) . Rabbit ƒ` polyclonal antibodies against nAChR 7 and goat polyclonal antibodies against AChE were purchased from Abcam , goat polyclonal antibodies against ChAT was purchased from Chemicon and rabbit polyclonal antibodies against ƒ´2actin were from Cell Signaling. Horseradish peroxidase2conjugated secondary antibody , BCA Protein Assay K and super2signal reagents were purchased from it TM Pierce ( Rockford , IL ) . PageRular Prestained Protein Ladder was ordered from Fermentas. Nicotine , methyllycaconitine and choline chloride were supplied by Sigma2Aldrich ( St . Louis , MO) . 112 ¡¡ Cell culture 3T32L1 preadipocytes were grown at 37 ¡ with 5 % CO2 in DMEMΠ F12 media supplemented with 10 % fetal bovine serum ( FBS) and Pen2Strep ( 100 UΠ penicillin ml 2 and 100 ƒ molΠ streptomycin ) in 75 cm flasks to L complete confluence. Post2confluent cells , cultured in the presence of DMEMΠ media with FBS , were hormonally F12 stimulated to differentiate with 1 mgΠ INS , 015 mmolΠ L L ƒ molΠ DEX for 2 days , subsequently with IBMX and 1 L insulin only. By continuous treatment and every 2 days¡fl replenishment , at least 80 % cells exhibited adipocytes morphology on day 8¡« 9. 113 ¡¡ Immunocytochemistry Cells fixed with ice2cold acetone were washed with PBS , then blocked with serum from the species that the secondary antibody was raised in for 30 min at 37 ¡ , and then incubated with diluted primary antibody in a humidified chamber overnight at 4 ¡ , followed by a further wash in PBS. After this , fixed cells were incubated with the secondary antibody in 1 % BSA for 1 hour at room temperature in the dark. After a final wash in PBS , color was developed with DAB kit for 2¡« 3 min and cell nuclei were counterstained with haematoxylin. 114 ¡¡ Protein sample preparation and concentration assay Gene Mouse Visf atin 117 ¡¡ Statistical analysis Results are presented as the percentage of control values ( mean ¡ SD) and represent data were collected from at least three experiments. Data were compared using the Students t2test . Table 1 ¡¡ Primers used for semi2quantitative reverse transcription RT PCR 2 Forward Reverse Reverse Forward ƒ´2Actin 5¡2AAACAATACCCACCCAACAC23¡ 5¡2TCCTCCCTGG AAG AG AGCTA23¡ 5¡2TGG ATACCAGG ACTG AACAA23¡ 5¡2TCAGG AGG AGCAATG ATCTTG 3¡ 2 Whole2cell extracts of 3T32L1 preadipocytes and adipocytes were prepared by lysing cells in RIPA lysis buffer ( 50 mmolΠ Tris2HCl ,pH 810 , 150 mmolΠ NaCl , L L 012 gΠ NaN3 , 1 gΠ SDS , 10 gΠ NP240 , 100 ƒ gΠ L L L ml PMSF , 5 gΠ sodium deoxycholate , 1 ƒ gΠ Aprotinin) , L ml collecting and centrifuging at 4 ¡ 12 000 ¡` g for 15 min to pellet insoluble material . Then the protein content was determined by using BCA Protein Assay K and with BSA it as a standard. The proteins were denatured by adding 5 ¡` concentrated SDS sample buffer containing a reducing agent and boiling for 5 min. 115 ¡¡ SDS2PAGE and immunoblot analysis Each lane of the gels was loaded with 40 ƒ g protein with 5 ƒ l pre2stained molecular weight markers used as standards in the first lane. Then lysate was separated by SDS2PAGE using a 1215 % polyacrylamide gel . Following transfer to nitrocellulose at 100 V for 120 min , the membranes were blocked and probed with specified primary antibodies at a dilution appropriate for each protein while shaking overnight at 4 ¡ , followed by washing three times in TBS2T. The blots were then incubated with horseradish peroxidase ( HRP) 2conjugated secondary antibody at 1¡ˆ5 000 dilution for 90 min while shaking at 37 ¡ , followed by enhanced chemiluminescence ( ECL ) system detection. 116 ¡¡ Reverse transcriptase2PCR Cells were collected 12 , 24 or 36 hours after nicotine , choline chloride or methyllycaconitine treatment . T otal RNA was extracted from pre2treated 3T32 L1 preadipocytes using TRIzol reagent ( Invitrogen Life Technologies ) . RNA concentration and quality were assessed based on 260 nmΠ nm absorbance ratios. The 280 single strand cDNA synthesis was performed by using TaKaRa RNA PCR kit ( Takara , Japan) according to the manufacturer¡fls directions. PCR primers are listed in Table 1. The gene expression levels were normalized to the murine housekeeping geneƒ´2 actin . The PCR products present in 25 ƒ l reaction mixture were then separated according to size on 215 % agarose gels and visualized by ethidium bromide staining. The resultant fluorescent bands were digitized and quantified using Bio2Rad Gel Doc XR System (Bio2Rad , USA) . 2 ¡¡ Results 211 ¡¡ Morphological observation The cultured 3T32L1 preadipocytes showed elongated fibroblast phenotype. After hormonal induction , they lost LengthΠ bp 405 302 Cycle 35 35 TmΠ 54 55 806 Chinese Journal of Biochemistry and Molecular Biology Vol. 24 their spindle shape and became spherical , gradually differentiating. On the ninth day , the fully differentiated adipocytes were almost filled with numerous lipid droplets 212 ¡¡ Spatial expression in 3T32L1 preadipocytes Our study revealed that undifferentiated 3T32L1 ƒ` preadipocytes contained nAChR 7 both on the cell membrane and the nuclear membrane. The staining 213 ¡¡ Protein expression of ƒ`7 nAChR, AChE and ChAT in 3T32L1 preadipocytes and adipocytes As compared to the high level of AChE and ƒ`7 nAChR expression in preadipocytes ( day 0 ) , AChE was Fig. 1 ¡¡ Morphology of 3T32L1 preadipocytes and mature adipocytes ¡¡ ¡¡ ( A ) Preadipocyte ; ( B ) Adipocytes ; ( C) Unstained adipocytes ; (D) Adipocytes with oil2red O staining. 3T32L1 adipocytes (on day 9 of differentiation) were washed three times with PBS , then fixed for 5 min with 317 % formaldehyde in PBS , and washed three times with H2 O , followed by staining in Oil red O solution (013 % Oil red O in 60 % isopropanol ) for 1 hour. Cells were then washed three times with H2 O and the phenotypic changes of the cells were visualized under a microscope and photographed ƒ` Fig. 2 ¡¡ Intracellular distribution and abundance of nAChR 7 , ChAT and AChE proteins in undifferentiated 3T32L1 cells ¡¡ ¡¡ The ƒ` cellular localization of nAChR 7 , ChAT and AChE protein ( yellow , as indicated by the red arrow directed ) was determined by immunocytochemical staining using respective specific antibodies. Nuclei were counterstained by hematoxylin staining (pale blue) of various sizes , which distributed around the nucleus forming the classical ¡ finger ring2 loop ¡– structure ( See Fig11) . decreased 39109 % at 9 days differentiation ( P < 0101 ) andƒ`7 nAChR by 28185 % ( P < 0105) respectively. We found no significant statistical difference in ChAT expression between day 0 ( undifferentiated cells) and day pattern for immunoreactive antibodies indicated that ChAT and AChE protein appeared to be diffusely scattered throughout the cytosol of the undifferentiated 3T32L1 cells ( See Fig12) . No. 9 ƒ` WU Jing ,et al : Expression and Function Analysis of Cholinergic Components nAChR 7 in Preadipocytes 807¡¡ 214 ¡¡ƒ`7 homo2pentamer nAChR in the cholinergic regulation of visfatin expression in 3T32L1 preadipocytes 3T32L1 preadipocytes were incubated for 12 , 24 , 36 hours in the presence or absence of nicotine , choline - 8 - 4 chloride or methyllycaconitine ( 10 ¡« 10 molΠ ) . L Incubation with choline chloride for 12 hours obtained to a 48138 % ( P < 0105) decrease in visfatin expression , but only after treatment with relatively high concentrations ( 10 - 6 molΠ ) . By contrast , cells responded to incubation L with respectively low to high concentrations of nicotine for - 8 12 hours with 16162 % ( 10 molΠ , P < 0105 ) , L - 6 - 4 4311 % ( 10 molΠ , P < 0105 ) and 55169 % ( 10 L molΠ , P < 0105 ) decrease of visfatin compared to L - 6 controls , at 24 hours this was 32185 % ( 10 molΠ , P L - 4 < 0101 ) and 4615 % ( 10 molΠ , P < 0105 ) down2 L - 6 regulation , and at 36 hours , 37118 % ( 10 molΠ , P < L - 4 0105) and 4816 % ( 10 molΠ , P < 0105 ) for 36 L hours. The results also demonstrated a time2dependent reduction in intracellular expression of visfatin as 9 (fully2differentiated cells) ( Fig13) . ƒ` Fig. 3 ¡¡ Protein expression of nAChR 7 , AChE and ChAT in 3T32L1 preadipocytes and adipocytes ¡¡ ¡¡ The percentage relative intensity was calculated as the ratio of target protein vsƒ´2 actin gray value from the corresponding preadipocytes group , and shown in black bar ( A , AChE ) , thick hatched bar ( B , ƒ` nAChR 7) and thin hatched bar ( C , ChAT) , respectively ; ( D) Western blots probed with specific antibodies show the existence ƒ` of AchE , nAChR 7 and ChAT protein utilizing total cellular protein extracts from undifferentiated ( lane 1 ) and fully differentiated ( lane 2 ) 3T32L1 cells. ƒ´2actin was used as an internal control for loading between lanes and between blots evidenced starting from 12 up to 36 hours post exposure to - 8 - 4 nicotine ( 10 molΠ 12 vs 36 hours , P < 0105 ; 10 L molΠ 12 vs 36 hours , P < 0105 ) , however , prolonged L incubation with choline chloride had no further effect on decreased visfatin level . In the same experimental conditions , we found that choline chloride , at all tested doses for 24 and 36 hours , were more capable of inhibiting visfatin expression than nicotine. In addition , treatment of preadipocytes with - 4 - 6 methyllycaconitine at 10 molΠ or 10 molΠ for 12 , L L 24 and 36 hours , robustly elevated visfatin content in a - 4 time2dependent manner ( 11532fold at 10 molΠ for 12 L - 6 hours vs control , P < 0105 ; 1132fold at 10 molΠ for L - 4 24 hours vs control , P < 0101 ; 11552fold at 10 molΠ L - 6 for 24 hours vs control , P < 0101 ; 1132fold at 10 molΠ - 4 L for 36 hours vs control , P < 0101 ; 11382fold at 10 - 8 molΠ for 36 hours vs control , P < 0105 ) , 10 molΠ L L treatment even up to 36 hours did not affect visfatin expression. The results also revealed a dose2dependent - 8 elevation by methyllycaconitine ( 10 molΠ for 12 hours L - 4 - 8 vs 10 molΠ for 12 hours , P < 01001 ; 10 molΠ for L L - 4 - 8 24 hours vs 10 molΠ for 24 hours , P < 01001 ; 10 L - 4 molΠ for 36 hours vs 10 molΠ for 36 hours , P < L L 0105) . The resutls could be seen in Fig14. 3 ¡¡ Discussion A role of adipose tissue in inflammation and immunity illustrated from the production of adipokines has [15 ] recently emerged. . The most relevant adipokines are leptin , adiponectin and visfatin , all of which have significant effects on inflammatory and immune functions. This has led to a novel developed concept that the pathogenesis of obesity2related diseases can be associated with slow ( auto ) immune attack of target organs andΠ or [16 ,17 ] sustained by low2degree chronic inflammation . Recent evidence suggested potent anti2inflammatory functions for non2neuronal cholinergic system in various [4¡« 7 ] inflammation2related cells . Despite of the lack of systermaticl studies of the non2neuronal cholinergic system and its functions in adipocytes , reported data supported that rat adipocytes could express nearly all subtypes of nAChR , including alpha 1 ¡“7 , 9 , 10 , beta 1 ¡“4 , [13 ] delta , and epsilon subunits . This study revealed that both 3T32L12derived mouse preadipocytes and adipocytes expressed ChAT , AChE as well asƒ`7 nAChR , which was in agree with recent studies suggesting ACh synthesis by both ChAT and carnitine acetyltransferase ( CarAT) at [6 ] mammalian periphery . Notably , Kawashima et al reported very recently that neither resting nor activated macrophages had the ability to synthesize ACh using [4 ,18 ] ChAT , which or other transporters might be involved , the synthesis of acetylcholine yet not detected in this study. In addition , a large number of studies have shown the AChE existence in immune2related cells , suggesting a putative function of preventing unnecessary 808 Chinese Journal of Biochemistry and Molecular Biology Vol. 24 signal propagation by Ach . According to our results , protein levels of those enzymes were decreased in 3T32 L1 differentiated adipocytes compared to preadipocytes statistically. The functions of the non2 neuronal cholinergic system in mouse preadipocytes and mature adipocytes need to be further studied. We also studied the correlation between functional ƒ`7 nAChR and cellular visfatin expression in 3T32L1 preadipocytes , and demonstrated a significant dose2dependent andΠ time2 or dependent profile , which was induced following the incubation with the selective ƒ`7 nAChR antagonist methyllycaconitine as opposed to the results of choline chloride treatments. Some studies have indicated that preadipocytes could transform into a macrophage phenotype and acquire the accorded properties traditionally , thus became a main target of inflammatory [20 , 21 ] stimuli in adipose tissue . In macrophages , the expression of ƒ`7 nAChR is crucial for the anti2 inflammatory functionality in vagal nerve signaling , that could be counteracted by selective ƒ`7 nAChR antagonists Fig. 4 ¡¡ Effect of choline chloride , nicotine and methllycaconitine on visfatin gene expression ¡¡ ¡¡ T otal RNA was isolated from 3T32L1 cells at the indicated times following treatment with choline chloride , nicotine or methllycaconitine. cDNA was synthesized from total RNA (1 ƒ g) and RT PCR was performed to measure the relative amounts of visfatin. Data were expressed as relative intensity ( %) of visfatin 2 relative toƒ´2actin compared to untreated cells ( = 110) at the indicated times. White bars represent nicotine treatment groups , hatched bars represent choline chloride treatment groups and black bars represent methllycaconitine treatment groups. ( A) 12 hours2treatment groups ; (B) 24 hours2treatment groups ; ( C) 36 hours2treatment groups. (D) A sample of 5ƒ l of each reaction was separated by electrophoresis in -8 -4 ethidium bromide stained 2 % agarose gel. Lane 1 : control cells at 12 hours ; Lanes 2¡« 4 : choline chloride from 10 ¡« 10 at 12 hours ; -8 -4 -8 -4 Lanes 5¡« 7 : nicotine from 10 ¡« 10 at 12 hours ; Lanes 8¡« 10 : methllycaconitine from 10 ¡« 10 at 12 hours ; M :DNA marker. The 3 33 333 data in panels (A) , (B) and ( C) represent the average of triplicate experiments. P < 0105 ; P < 0101 , P < 01001 [4¡« 7 , 19 ] with the presence of nicotine. The agonists effectively depressed macrophage cytokine levels and ameliorated the [4 , 7 , 22 ] inflammatory state in animal models . Several plausible theories have been advanced to explain the ability of the cholinergic anti2inflammatory pathway to act at both the transcriptional and posttranslational [23 ,24 ] levels : ¢ rapid suppression of the release of pre2 formed pro2inflammatory cytokine through activation of ƒ`7 nAChR ; ¢ prevention of the up2regulation of pro2 inflammatory gene activity through inactivation of the NF2 ƒ B pathway ; ¢ recruitment of the tyrosine kinase Jak2 to the ƒ`7 nACh receptor , subsequent phosphorylation of the transcription factor STAT3 , and activation of STAT3 and SOC3 signaling cascade. In conclusion , the ƒ`7nAChR functions reported in our study suggested a potential role of this protein in the pathogenesis of inflammatory disorders and provided additional evidence for understanding the linkage between obesity and chronic inflammation. No. 9 ƒ` WU Jing ,et al : Expression and Function Analysis of Cholinergic Components nAChR 7 in Preadipocytes 809¡¡ References [ 1 ] ¡¡ Pradhan A. Obesity , metabolic syndrome , and type 2 diabetes : inflammatory basis of glucose metabolic disorders [ J ] . Nutr Rev , 2007 ,65 (12 Pt 2) :S1522S156 [ 2 ] ¡¡ Rand JB. Acetylcholine[J ] . WormBook , 2007 :1221 [ 3 ] ¡¡ Grando SA , Kawashima K, K irkpatrick CJ , et al . Recent progress in understanding the non2neuronal cholinergic system in humans[J ] . Life Sci , 2007 ,80 (24225) :218122185 [ 4 ] ¡¡ Kawashima K, Y oshikawa K, Fujii YX , et al . Expression and function of genes encoding cholinergic components in murine immune cells [J ] . Life Sci , 2007 , 80 (24225) :231422319 [ 5 ] ¡¡ Hana A , Booken D , Henrich C , et al . Functional significance of non2neuronal acetylcholine in skin epithelia [J ] . Life Sci , 2007 , 80 (24225) :221422220 [ 6 ] ¡¡ Hanna2Mitchell AT , Beckel JM , Barbadora S , et al . Non2neuronal acetylcholine and urinary bladder urothelium[J ] . Life Sci , 2007 , 80 (24225) :229822302 [ 7 ] ¡¡ de Jonge W , Ulloa L. The alpha7 nicotinic acetylcholine receptor as J a pharmacological target for inflammation [ J ] . Br J Pharmacol , 2007 , 151 (7) :9152929 [ 8 ] ¡¡ Fukuhara A , Matsuda M , Nishizawa M , et al . Visfatin : a protein secreted by visceral fat that mimics the effects of insulin [ J ] . Science , 2005 , 307 :4262430 [ 9 ] ¡¡ Fukuhara A , Matsuda M , Nishizawa M , et al . Retraction [ J ] . Science , 2007 , 318 (5850) :565 [ 10 ] ¡¡Moschen A R , Kaser A , Enrich B , et al . Visfatin , an adipocytokine with proinflammatory and immunomodulating properties [ J ] . J Immunol , 2007 , 178 (3) :174821758 [ 11 ] ¡¡ Tilg H , Moschen AR. Role of adiponectin and PBEFΠ visfatin as regulators of inflammation : involvement in obesity2associated diseases [J ] . Clin Sci (Lond ,UK) , 2008 , 114 (4) :2752288 [12 ] ¡¡Luk T , Malam Z , Marshall JC. Pre2B cell colony2enhancing factor ( PBEF) Π visfatin : a novel mediator of innate immunity [ J ] . J Leukocyte Biol , 2008 , 83 (4) :8042816 [ 13 ] ¡¡Liu R H , Mizuta M , Matsukura S. The expression and functional role of nicotinic acetylcholine receptors in rat adipocytes [J ] . J Pharmacol Exp Ther , 2004 , 310 (1) :52258 [14 ] ¡¡ G iordano A , Song C K, Bowers R R , et al . White adipose tissue lacks significant vagal innervation and immunohistochemical evidence of parasympathetic innervation[J ] . Am J Physiol Regul Integr Comp Physiol , 2006 , 291 (5) :R12432R1255 [ 15 ] ¡¡ Tilg H , Moschen A R. Inflammatory mechanisms in the regulation of insulin resistance [J ] . Mol Med , 2008 ,14 (324) :2222231 [ 16 ] ¡¡ Guzik T J , Marvar P J , Czesnikiewicz2Guzik M , et al . Perivascular adipose tissue as a messenger of the brain2vessel axis : role in vascular inflammation and dysfunction [J ] . J Physiol Pharmacol , 2007 , 58 (4) :5912610 [ 17 ] ¡¡Nishimura S , Manabe I , Nagasaki M , et al . In vivo imaging in mice reveals local cell dynamics and inflammation in obese adipose tissue [J ] . J Clin Invest , 2008 ,118 (2) :7102721 [ 18 ] ¡¡ Kawashima K, Misawa H , Moriwaki Y, et al . Ubiquitous expression of acetylcholine and its biological functions in life forms without nervous systems [J ] . Life Sci , 2007 , 80 (24225) :220622209 [19 ] ¡¡ Santos S C , Vala I , Miguel C , et al . Expression and subcellular localization of a novel nuclear acetylcholinesterase protein [J ] . J Biol Chem , 2007 , 282 (35) :25597225603 [ 20 ] ¡¡ Poulain2G odefroy O , Froguel P. Preadipocyte response and impairment of differentiation in an inflammatory environment [ J ] . Biochem Biophys Res Commun , 2007 , 356 (3) :6622667 [21 ] ¡¡ Lacasa D , Taleb S , Keophiphath M , et al . Macrophage2secreted factors impair human adipogenesis : involvement of proinflammatory state in preadipocytes[J ] . Endocrinology , 2007 , 148 (2) :8682877 [22 ] ¡¡ Y oshikawa H , Kurokawa M , Ozaki N , et al . Nicotine inhibits the production of proinflammatory mediators in human monocytes by suppression of I2kB phosphorylation and nuclear factor2kB transcriptional activity through nicotinic acetylcholine receptor [ J ] . Clin Exp Immunol , 2006 , 146 (1) :1162123 [ 23 ] ¡¡ Chung S , Lapoint K, Martinez K, et al . Preadipocytes mediate lipopolysaccharide2induced inflammation and insulin resistance in primary cultures of newly differentiated human adipocytes [ J ] . Endocrinology , 2006 ,147 (11) : 534025351 [ 24 ] ¡¡Lau PP , Li L , Merched AJ , et al . Nicotine induces proinflammatory responses in macrophages and the aorta leading to acceleration of atherosclerosis in low2density lipoprotein receptor (2Π) mice [ J ] . 2 Arterioscler Thromb Vasc Biol , 2006 , 26 (1) :1432149
Get documents about "