construction of eukaryotic expression vector for human vascular by luckboy

VIEWS: 34 PAGES: 5

More Info
									¡⁄ 220 ¡⁄
:100929905 (2002) 0420220205 ¡¿ 78 ;Q786 Q ¡¿ A
pUMT 18 — , ؘ 2

¡¡

—„œ ˇ ·œ ˘ ˝¤ ˝ ¿˘ ‰ł „

¡¡2002 ˜Œ12 ´

5

4˘

Chin J Curr Adv Gen Surg ¡¡Dec. ¡¡ 2002¡¡Vol. 5 ¡¡No. 4

¡¡

Co nst ructio n of e uka ryotic e xp ressio n vect or f or h u m a n vasc ula r e n d ot helial gr owt h f a ct or C ge ne
L I Gui2bao ( „–ƒ
¨¸“„˜˘⁄œ‡⁄

¡ ABS TRACT¡¿O b j e c t i v e : To construct eukaryotic expression vector of human vascular endothelial growth fac2
¡ KEY WORDS ¡¿ Vascular endothelial growth factor C ; Carrier proteins ; Gene expression
¡ CLCNUMB ER¡¿ 78 ; Q786 Q

¡ DOCUM EN TCOO E¡¿ A

¡ ““ ¡¿¿˜ :VEGF2C »ø˜”¸–· ˜
‚ø¨¸
Ba mH ¢æ ˆ‚˙— ,‚¡‡—Ø ˆ‚˙—˘‹¶ˇ

¡ „…·˚

¡ —˝…•”¯

¡ ˛˜ˇ–Œ˚¶´º

Ba mH ¢æ,was found to contain the VEGF2C cDNA s equence by a garos e gel electrop horesis . R e s u l t s : The prod2 VEGF2CΠ pcDNA3. 1 ( - ) ¡£ vector for human VEGF2C ,is constructed s uccessfully.

tor C (VEGF C) gene for further study on the role VEGF2C gene play in lymp hangiogenesis . M e t h o d s :According 2 ployed to a mplify VEGF2C cDNA from human breast cancer cell MDA2MB2231. After being p urified ,the product of

DNA s equence analysis s howed that it contained full length of VEGF2C cDNA . The obtained VEGF C cDNA was in2 2 s erted into eukaryotic expression vector pcDNA3. 1 ( - ) . The pcDNA3. 1 ( - ) ΠVEGF2C , digested with EcoR ¢æ and uct of RT PCR contained the human VEGF C cDNA . The recombinant pUMT 18 contained correct nucleotide s e2 2 2 2

L IU Zhi2yu ( `ı·æ

) ,SONG Tao ( ¸˛˛

Department of Huma n Anatomy , School of Medicine , Sha ndong University ¡¡ ( J ina n 250012 , China )

RT PCR was ins erted into a clone vector pUMT 18. The recombinant plas mids pUMT 18 ,first prop a gated in Es 2 2 2 2

to human VEGF2C cDNA s equence ,we designed a p air of sp ecific primers which contained digestion site of EcoR

ƒ` herichia coli DH5 ,then extracted , p urified and digested with EcoR ¢æ and Ba mH ¢æ Agaros e gel analysis and .

ˆ RT RCR •‰•¤'¨¸¨Øˇ'ˇ‚ß 2 ˘`‹‰`¿¸´¡ ”‹—¨•˜¨¸ ¡¿ “„˜˘⁄œ‡⁄

quence of full length of human VEGF2C cDNA fra gment . The VEGF2C cDNA fra gment ha d been ins erted into the

–·˜„„‰¤

EcoR ¢æ Ba mH ¢æ ”˝ ˆ‚˙—Ł…ł¶¤

eukaryotic expression vector pcDNA3. 1 ( - ) . C o n c l u s i o n : The pcDNA3. 1 ( - ) ΠVEGF2C , eukaryotic expression

¢æ and Ba mH ¢æon the 5¡flend resp ectively. Then revert transcript p olymoras e chain reaction (RT PCR) was em2 2

VEGF2C ˜

cDNA —`— ,Ł…˘”ˇ‡»¶

(1127kb) ,¨»”

VEGF2C cDNA ¨«‡⁄—`— ,ؘ

) , GAO Jie ( ‚‰ ) ,FANG Yun2hai ( •¿˘”£ )

) ,DONG Ping ( ¶›˘‰) ,

C »ø”¸

,–ª‰ł»†‰—¿ 5¡fl¸•–”‹— ¶

EcoR ¢æ Ba mH ¢æ ”˝ ˆ‚˙—˛»ª˜—˛

,†¢‰ł——»ø†—…ł¶¤ ;˙‹˙˜‰”»˚”‹—

DNA `‹‰ˆ‚ ˆˇ´‰«˘º ”¸–·

;˚

¡£ ‰Æ„ßRT PCR †œ˛”‹— : 2

MDA2MB2231 —˜ VEGF2C cDNA (1126kb) ;»˚ pUMT 18 ·‡ƒ‚¸œ 2

pcDNA3. 1 ( - ) —”‹—¨¸

;»ø–·

VEGF2C cDNA ,»ø†—ˇ˚ؘ

VEGF C »ø`˝„œ‡—˜ˆ 2

¡£ •‰•¤ :

,¸

ƒ` DH5 ˜' ”

,›˚`£Æ¨¡

pcDNA311 ( - ) `‹‰ , Ø˚`£›

VEGF2C cDNA ¨«‡⁄—`— ¡£ ‰Æ´ :

PCR †œ˛ ( 1128kb ) ,†¢‰«

¡¢ EcoR ¢æ”˝

VEGF2C cDNA ¨«‡⁄˜

pUMT 18 — 2

INTROD UCTION

ogy. This study helped to probe into the role of VEGF2C odiseases. 1 ¡¡ MATERIALS AND METHODS 1. 1 ¡¡ Materials lecular Biology Department of our school . for clonal PCR products. Eukaryotic expression vector pcDNA3. 1 ( - ) was purchased from Invitrogen Co. Ltd. 1. 1. 4 ¡¡ Other agents ¡¡ Trizol agent kit and cDNA the first chain construction kit were purchased from Giboco cer cell line MDA2MB2231 was purchased from Basic TCCACCATGCACTTGCTGGGCTTC - 3¡fl,the sequence of downstream primer was constructed by Shanghai Sangon Biotechnology Co. Ltd. TAGCTCATTTGTGGTCTTTTCC 3 ¡fl, both of them were 2 1. 1. 3 ¡¡ Vectors ¡¡pMD182T was a kind of specific vector 1. 1. 2 ¡¡ Primers ¡¡ According to human VEGF2C cDNA

pression vector pcDNA3. 1 ( - ) Π VEGF2C containing

LaboratoriesΠ Life Technologies. PCR agent kit was pur2

pression of VEGF2C can notably promote the tumor growth in naked mouse of transplanted tumor cells and promote the development of lymphatic vessels in tumor interstitial vessels
2 ,3

tively. The sequence of upstream primer was 5¡flCCG 2 AAT2

Medical Research Department of the Chinese Academy of ƒ` Medical Sciences. Esherichia coli DH5 was gift from Mo2 sequence ,we designed a pair of specific primers ,which

VEGF2C cDNA fragment by the method of molecular biol2 1. 1. 1 ¡¡ Cell and bacterium lines ¡¡ Human breast can2 in the development of lymphatic vessels and laid a foun2 dation for the application of gene therapy on some lymph2 containing digestion site of EcoR ¢æand BamH ¢ærespec2

VEGF C may induce the proliferation of lymphatic ves2 2 sels
1

transcriptional regulation , we constructed eukaryotic ex2

lymphatic endothelial cells ,VEGF2C is believed to be the transgenic mice have shown that the high expression of . In order to study the role of VEGF2C in the

chief specific regulating factor of lymphatic endothelial

cells. However , experimental results with the VEGF2C substance and the spread of tumor cells along lymphatic

FR22 and VEGFR23 . As VEGFR23 is mainly expressed in

new member of VEGF family ,whose receptors are VEG 2

development of lymphatic vessels and the mechanism of its

¡¡LIU Zhi2yu ,et al. Construction of eukaryotic expression vector for human vascular endothelial growth factor C gene Vascular endothelial growth factor C ( VEGF2C) is a 1. 2 ¡¡ Methods . Recent studies have demonstrated that high ex2 37 ¡ ,digested by 0. 25 % trypsin.
6

¡⁄ 221 ¡⁄

chased from Dalian TaKaRa Biotechnology Co. Ltd. Gel retrieve agent kit and plasmid extraction agent kit were purchased from Qiagen of Germany. Restriction enzyme , DNA molecule mass standard DNA Marker DL2000 andƒ¸2 Ecot14 ¢æ digest were purchased from Dalian TaKaRa purchased from Shanghai Sangon Biotechnology Co. Ltd. cillin and 100UΠ streptomycin. Cells were cultured in ml incubator containing 5 % CO2 and saturation humidity at illustration of Trizol agent kit . ƒ go dT. Two microliters of 20 l total RT reaction volume rast . ¡¡Ligating DNA and vector over night at 16 ¡ ,then put ƒ ƒ` pMD182T to 200 l DH5 cells with CaCl2 ,plated at LA 1. 2. 2 ¡¡ Extract total RNA ¡¡ Collect MDA2MB2231 cells about ( 5¡« 6 ) ¡` 10 . Extract total RNA according to the electrophoresed on 1 % agarose gel . Using Utraviolet light electrophoresed on 1 % agarose gel . 1. 2. 5 ¡¡ Link up PCR products and pMD182T vector in logarithmic growth period. The amount of cells was verse transcribed according to the illustration of cDNA ƒ croliters of 50 l total PCR mix were electrophoresed on 1 % agarose gel . Humanƒ´2actin was used as internal cont2 ƒ 1. 2. 4 ¡¡ Retrieve PCR products ¡¡ 60 l PCR products ulated in 5ml LA liquid culture medium respectively ,cul2 to illustration of plasmid extraction agent kit and digested plasmid ¡¡ Select several single clone randomly ,then inoc2 1. 2. 3 ¡¡ RT2PCR ¡¡ Five microliters total RNA were re2 72 ¡ ,the final elongation time was 7min at 72 ¡ . Ten mi2

formed with specific primers for 35 cycles with cycle times of 5min at 94 ¡ ,30s at 94 ¡ ,30s at 60 ¡ and 1min at

5 ¡flCGCGG 2 ATCCT2

Life Technologies) ,10 % fetal calf serum ,100UΠ peni2 ml first chain construction agent kit with random primers Oli2 objective gene by clean scalpel . Then retrieve DNA by gel flat plate and incubated 16h at 37 ¡ . was used as the template DNA for the PCR. PCR was per2 ture at 37 ¡ 180 rpm overnight . Extract plasmid according

Biotechnology Co. Ltd. ƒ¸2DNAΠ EcoR ¢æ+ Hind ¢ was

1. 2. 1 ¡¡ The culture of cells ¡¡ The cell culture liquid is composed of L215 ( purchased from Giboco LaboratoriesΠ analysis apparatus as monitor ,cut down the gel containing according to the illustration of agent kit . Identified by 1. 2. 6 ¡¡ Screening and identify of positive recombined

¡⁄ 222 ¡⁄ by restriction enzyme EcoR ¢æand BamH ¢æ respectively. ƒ ƒ ƒ The total volume was 50 l :plasmid 20 l , EcoR ¢æ1 l , ƒ ƒ BamH ¢æƒ l ,10 ¡` K Buffer 5 l , dH2 O 23 l , digested 2. 1 5h at 37 ¡ in water bath ,then inactivated the activity in water bath for 30min at 65 ¡ . Ten microliters reaction products electrophoresed on 1 % agarose gel to screen positive recombined plasmid and retrieve objective gene fragment . Carried out sequence analysis with 1. 5ml liquid containing positive recombined plasmid by Shanghai Sangon Biotechnology Co. Ltd. 1. 2. 7 ¡¡ Digest and retrieve pcD NA3. 1 ( - ) ¡¡ Use EcoR ¢æ and BamH ¢æ digest pcDNA3. 1 ( - ) . Digest to ƒ ƒ volume was 50 l : plasmid 20 l , EcoR ¢æƒ l ,BamH ¢æ 1 1 ƒ ƒ l ,10 ¡` K Buffer 5 l ,dH2 O23 l ,digested 2. 5h at 37 ¡ ƒ in water bath ,then inactivated in water bath for 30min at 65 ¡ . Ten microliters reaction products electrophoresed on 1 % agarose gel to identify. 1. 2. 8 ¡¡ Ligation of VEGF2C D NA and pcD NA3. 1 ¡ . 1. 2. 9 ¡¡ Identification of pcD NA3. 1( - ) Π VEGF2C ¡¡ spectively by restriction enzyme EcoR ¢æand BamH ¢æ . 2 ¡¡ RESUL TS the background reference of human VEGF2C cDNA record 2. 1 ¡¡ Identification of RT2PCR products ¡¡ According to ƒ ƒ ( - ) ¡¡ Volume was 10 l :VEGF2cDNA fragment 1 l ,re2 CaCl2 ,plated at LA flat plate and incubated 16h at 37 Select several single clone randomly , then inoculated in kb. The length of RT PCR produced fragments identified 2 by electophoresed on agarose gel was accord with the

—„œˇ·œ˘˝¤˝¿˘‰ł„ ¡¡

2002 ˜Œ12 ´ ¡¡

5 ¡¡

4 ˘ ¡¡

analysis of background reference ( Fig. 1) .

ƒ trieved pcDNA3. 1 ( - ) fragment 1 l , T4 DNA ligase

ƒ ƒ` night. Put pcDNA3. 1 ( - ) to 200 l DH5 cells with

5ml LA liquid culture medium respectively , cultured at 37 ¡ 180 rpm overnight . Extracted plasmid according to

in water bath ,then put out the activity in water bath for

phoresed on 1 % agarose gel to screen positive reformed plasmid.

ers ,the whole length of RT PCR products should be 1. 28 2

30min at 65 ¡ . Ten microliters reaction products electro2

illustration of plasmid extraction agent kit and digested re2 ƒ ƒ ƒ 1 l ,10 ¡` KBuffer 5 l ,dH2 O 23 l ,reacted 2. 5h at 37 ¡

ƒ ƒ ƒ 1 l ,10 ¡` K Buffer 1 l , dH2 O 6 l ,ligated at 16 ¡ over2 by Genebank and the trait of the designed specific prim2

ƒ ƒ The volume was 50 l :plasmid 20 l ,EcoR ¢æƒ l ,BamH ¢æ 1

formed pMD182T clone by random , extract plasmid , di2 gested by EcoR ¢æand BamH ¢æ,then electrophorsesed on agarose gel . One clone presented two fragments of 2. 6kb and 1. 27kb. The fragment of 2. 6kb was accord with RT2PCR products digested by enzyme ( Fig. 2) . ( Fig. 3) .
BamH ¢æ

with human VEGF2C cDNA sequence record by Genebank

pMD182T , another fragment of 1. 27kb was accord with
1. Nagative clone ;2. Positive clone ;3. Marker DNAΠ EcoR ¢æ+ Hind ¢

1. Markerƒ¸DNAΠ EcoR ¢æ + Hind ¢ ;2. Humanƒ´2actin ;3. Human VEGF2C cDNA

2. 2 ¡¡ Screen of reformed pMD18 2T ¡¡ Choose six re2 2. 3 ¡¡ VEGF2C gene sequence a nalysis ¡¡ Proved by analysis ,the fragment inserted in pMD182T was consistent
Fig. 2 ¡¡ Results of recombinant plasmid pMD 182T digested by EcoR ¢æand

Fig. 1 ¡¡Agarose gel electrophroesis of products of RT2PCR

2. 4 ¡¡ Identification of reformed pcDNA3. 1 ( - ) Π VEGF2C ¡¡ There were two fragments of 5. 4kb and 1. 27kb when pcDNA3. 1 ( - ) Π VEGF2C was digested by EcoR ¢æand BamH ¢æand electrophoresed on agarose gel . The fragment of 5. 4kb was accord with pcDNA3. 1 ( - ) , another fragment of 1. 27kb was accord with human VEGF2C cDNA fragment produced by RT PCR. This dem2 2 onstrated there was VEGF2C cDNA been inserted to pcD2 NA3. 1 ( - ) Π VEGF2C ( Fig. 4) . 3 ¡¡ DISCUSSION The mechanism of lymphangiogenesis has been a long2standing controversy. Some researchers believe lym2 phatic vessels are sprout from veins ,others believe that
1. Markerƒ¸DNAΠ EcoT14 ¢æ;2. pcDNA3. 1 ( - ) ;3. pcDNA3. 1 ( - ) Π VEGF2 C Fig. 4 ¡¡Digestion of pcDNA3. 1 ( - ) Π VEGF2C with EcoR ¢æand BamH ¢æ

Fig. 3 ¡¡ Result of VEGF2C gene DNA sequencing(64bp¡« 1324bp)

¡¡LIU Zhi2yu ,et al. Construction of eukaryotic expression vector for human vascular endothelial growth factor C gene

¡⁄ 223 ¡⁄

lymphatic vessels have their independent origin just like blood vessels , neither of them have exact evidence. With the development of modern biology and more attention was paid to the function of lymphatic system , people further developed the study on lymphangiogenesis. The relation2 ship between lymphangiogenesis and metastasis along lym2 phatic vessels is becoming the hot point of study. Re2 searches of recent years show lymphangiogenesis is affect2 ed and influenced by many factors ,among which VEGF2C is believed to be the chief specific regulating factor on lymphatic endothelial cells. VEGF2C was separated and purified in 1996 ,it be2 long to VEGF family. Researches showed that VEGF2C can regulating the development of lymphatic system in em2 4 bryo by VEGFR23 ,VEGF2C plays a significant role in 5 ,6 the lymphangiogenesis of tumor . Furthermore ,the high expression of VEGF2C can induce the hyperplasia of lym2 phatic vessels , but its concrete mechanism was still un2 clear. As a member of VEGF family ,VEGF has been used on the study of gene therapy and obtained remarkable achievement. According to the trait of VEGF2C ,it is con2 ceivable that VEGF2C can be used on gene therapy of lymphangiogenesis defect diseases ,for instance ,lymphatic dropsy. T study the role of VEGF2C in lymphangiogenesis o and carry out corresponding study on gene therapy of lym2 phangiogenesis defect diseases , the key material founda2 tion is the construction of eukaryotic expression vector of VEGF C gene. Vectors of eukaryotic expression used in 2 the study for external gene were divided into virus vectors

¡⁄ 224 ¡⁄ and nonvirus vectors. Virus vectors have the advantage of efficient in transfection and stable in expression ,but they are poor in security. Most of the nonvirus vectors were var2 ious plasmids. They exist in target cells as additional body; they have the advantage of good in security and large in capacity. In this experiment pcDNA3. 1 ( - ) have the below traits in structure : ¢ containing SV40 ori repro2 duce component ,can reproduce with host cells ,this ensure the stable transfer of object gene in some degree ; ¢ there are T7 and pCMV in the upstream of polyclone site which can express the inserted object gene fragment efficiently ; ¢ there is neo gene ,object cells containing this plasmid can be screened by G418. In short ,we constructed pcDNA3. 1 ( - ) Π VEGF2C eukaryotic expression vector successfully by molecular clone technology. We also used this plasmid in the study on gene therapy of animal model lymphatic dropsy. We believe with the development of this study ,we can offer direct experimental evidence for the study of the mecha2 nism VEGF2C play in lymphangiogenesis and lay a foun2 ˛˜´–”¯
‚`¢¤„˝¿˘˛`˘

¡¡

—„œ ˇ ·œ ˘ ˝¤ ˝ ¿˘ ‰ł „

¡¡2002 ˜Œ12 ´

5

4˘

Chin J Curr Adv Gen Surg ¡¡Dec. ¡¡ 2002¡¡Vol. 5 ¡¡No. 4

¡¡

dation for gene therapy on related diseases. FEFERENCE
1 Jeltsch M , Kaipainen A ,Joukov V ,et al . Hyperplasia of lymphatic vessels in VEGF2C transgenic mice[ J ] . Science ,1997 ,276 (5317) :1423¡« 1425 2 Yanai Y,Furuhata T , K imura Y,et al . Vascular endothelial growth factor C promotes gastric carcinoma lymph node metastasis in mice [ J ] . J Exp Clin Cancer Res ,2001 ,20 (3) :419¡« 428. 3

40 •˛

”œ¿“–ł ¡¡ ıˇ´ ` †»”ˇ•˚˚—¶¨¸ˆæ‰”˘˝¿˘

230011)

( > 65 ¸Œ) ¡¡¡¡ ” ˛ 1998 ˜Œ10 ´¡« 2002 ˜Œ 3 ´˚˛‚` (ACST) 40 ¢¤„ ,ˇ–¤‚¨ˇ´ ¡£ 1 ¡¡ ·†˚`ˇ ` –ؘ— 11 ,¯fi 29 ,˜Œ` 65¡« 79 ¸Œ ¡£‰Æ˚fl—¤„ 31 ,•˙‰Æ˚fl—¤„ 9 ¡£…¨˝ø—¤…††¡˚• 27 ,„ (… 2 ·˛ ˚ ˚ı 8 , 3 ·˛ 2 ¡£†¢ · ˜ ¿˘ ´ — …† †¡ 26 65 %) ,˘—„—˜†¡ 8 ·˛ ,‚“„ 7 ·˛ ,´—§˘ł„ •˛ —˜†¡ 8 ·˛ ,˙˜†¡ 5 ·˛ ,˜¸¤¨ß 2 ·˛ ,‚˛†»fl†¢‚˛„ƒ˜ †»¨« 2 ·˛ ,„ƒ˜†»¨« 1 ·˛ ¡£ 7 —`‰ˇ†¢·†¡ ¡£ †¡¨¸ø—†»˝‹‡¶¨˜‚„˝· ,— —˝ Charcot ¨`“¢ ‰ 10 ( 25 %) , ‚„ †¿ — „ ˝· ¡¢· ł ˝· ”˝ …¡ ‰ ¯ • 20

:100929905 (2002) 0420224201

¡¡( †» ¡¡”ˇ•˚ ¡¡

(50 %) ,‚¨¨ 12 (30 %) ,•¢œ—¿¸ 19 (4715 %) ¡£ ˚ˇ¨˙¨—¿¸ ,†„‡“¨`¿ ,`ƒø 24¡« 48h ˜‚˜˘— ¿¸·‹ ,¡ ˚'——¤ …ı„ ¡¢ ˝¤‡'˚˚ı ¡£ 25 ——˜•˛…††¡ ,ƒˆ˘ł„†„†´‚·”ˇ´Ø , 15 ƒˆ†˜⁄˝Ł˝´Ø ¡£‚„˜˚˚ı†…Ƈ··¸—¡ ,‡“ ,˙£›˙Æ…˚–…¶¨ › ¡£¶–'´¶¤„—§˜†¡¨¸ ,¤˜„˝¤‡'˙Ø¿ˇ´¥·¿ ——¤˜¿˚ı ;¶˜–'´¶¤„¶ł¤˜„¨¥˙—‡»¤˜˜ ˛‰Æ˚fl ,——¥·¿¤„˙—¿“‰†Ø T „` ;¶¤˜·‰Æ ˚fl˜ ACST †¡¨¸˚'——¤˜˙—‡ ,¤„˙—¿“¨¡˚fl ¡£¤„˚fi ¶‚‡ƒ˛˙”ˇ 4 ,˚ı— 1 ¸˝ ,2 ˚ı” 12¡« 24h ¸˝ ¡£ 2 ¡¡ ´ ‚` ACST ˜`·† ª‡£˚˙ ˘¢· ¡¢ —˝ †» ,˝ ˚–…˝ ,¨•¢œ—¿¸ ¡£˛`˘˚–‰ˇ´ 4 ‚˛˚˚˙…ı †¢•¢¢ ¡¢ ‰˝†¡¸´˚˜“»•‰ : (1) »…«˜¿„—¿¸…§‡ ˛`˘ ¡£ (2) ˛”ˆ˚˚ı˚–»œ ¡£‚` ACST ˘˜—¿¸ ,›»…« ( 3) ˚˚ı ˛`˘ ,†¡˙Ø»¶¨”ˆ“ ,˚˙…–¢…ı„`˜˙¡–˚–˘ ¡£ `ƒ˙…¥ ¡¢ ¡¢ ¿‰ ——§¶ł‡„ ,—¿¸·‹ˇ´‰‡„£Ł ,» (4) ”ˇ˛`˘ ¡£˚ı—…˛§˚˚ı˘ ‚·¤˝¤‡'`˛“› ¡£ ˜ ,»…«˛`˘†¢·†¡ ,…˙¿“ł§‡ ¡£

4 Kukk E ,Lymboussaki , A , Taira S , et al . VEGF2C receptor binding and

pattern of expression with VEGFR23 suggests a role in lymphatic vascular development [ J ] . Development ,1996 ,122 (12) :3829¡« 37. 5 George ML ,Tutton MG,Janssen F ,et al . VEGF2A ,VEGF2C ,and VEGF2 D in colorectal cancer progression[ J ] . Neoplasia ,2001 ,3 (5) :420¡« 427. 6 Skobe M ,Hambery LM ,Hawighorst T ,et al . Concurrent induction of lym2 phangiogenesis ,angiogenesis ,and macrophage recruitment by vascular en2 dothelial growth factor2C in melanoma [ J ] . Am J Pathol ,2001 ,159 (3) : 893¡« 903.

Karpament T , Egeblad M , Karkkainen M , et al . Vascular endothelial J growth factor C promotes tumor lymphangiogenesis and intralymphatic tu2 mor growth[ J ] . Cancer Res ,2001 ,61 (5) :1786¡« 1790.

( Received date ¡¡ 2002208221) ( ˚‚¨˘ ¡¡ 2002207204)


								
To top