Docstoc

Pichia-Pastoris-Expression-Constructs---Biosciences-Division-at-

Document Sample
Pichia-Pastoris-Expression-Constructs---Biosciences-Division-at- Powered By Docstoc
					ANL ID Anig002(21-771)

JGI GH Protein Family ID 56619 GH67 GH3

Literature name aguA hypothetical protein hypothetical protein cbhA hypothetical protein hypothetical protein hypothetical protein hypothetical protein eglB suc1 xynB eglA hypothetical protein msdS hypothetical protein hypothetical protein hypothetical protein xynG aglB hypothetical protein aglU hypothetical protein

Cloned Sequence

Description

Expressed Protein Sequence

Protein Length

GAGGATGGGTACGATGGCTGGCTCCGATATGCTCCCGTGTCCTGCG mature peptide EDGYDGWLRYAPVSCDLRCRQALPS 751

Anig003(20-765) 179265

GCTCCGACACAGAACATCACTAGTGATGCTTACTTCTATGGACAGTC mature peptide APTQNITSDAYFYGQSPAVYPSPEGTG 746

Anig009(20-400) 205580

GH5

mature peptide, AGCCCGAGGGCTAAGCGGTCGTCTGGCTTCCAATGGTTCGGCAGC c-term SPRAKRSSGFQWFGSNESGAEFGSG 381 truncation

Anig012(18-452) Anig017(19-459) Anig021(21-424)

53159 54490 56172

GH7 GH6 GH16

CAGCAAGCCGGAACGCTCACGGAGGAAGTCCATCCTTCCTTGACCT mature peptide QQAGTLTEEVHPSLTWQKCTSEGSCT 435

CAGCAAACCCTTTGGGGACAATGTGGTGGTCAGGGATATTCAGGAG mature peptide QQTLWGQCGGQGYSGATSCVAGATC 441

ACCTCGTCCCCTCCTTCATGCAGTACCAGCTCTCAGTGCCCCGAAG mature peptide TSSPPSCSTSSQCPEEYPCCSQYGQC 404

Anig025(16-318) 197735 GH43 Anig026(23-417) 202490 Anig027(19-331) 209376 GH5 GH5

TACTCAGACCCGGGTGCATGCTCGGGAACCTGCTGGGCACACGACC mature peptide YSDPGACSGTCWAHDPNVIRRVSDG 303

GTGCCACGATATAGCCGCCGGCAAGGCGCCTCGAGCTCCTTTGATT mature peptide VPRYSRRQGASSSFDYKSQIVRGVNL 395

GTGCCTCATGGCTCCGGACATAAGAAGAGGGCGTCTGTGTTTGAAT mature peptide VPHGSGHKKRASVFEWFGSNESGAE 313

Anig028(16-589) 198063 GH32 Anig031(19-225) 52071 GH11

GCCTCGCCTTCCATGCAGACGCGGGCCTCCGTTGTCATCGACTACA mature peptide ASPSMQTRASVVIDYNVAPPNLSTLPN 574

GTTCCCCACGACTCTGTGGCCCAGCGTTCGGATGCCTTGCACATGC mature peptide VPHDSVAQRSDALHMLSERSTPSSTG 207

Anig038(17-239) 211053 GH12 Anig039(23-278) 211595 GH55 Anig044(22-513) 205517 GH47 Anig048(1-692) 211162 GH13

CAGACGATGTGCTCTCAATATGACAGTGCCTCGAGCCCCCCGTATT mature peptide QTMCSQYDSASSPPYSVNQNLWGEY 223

CACGGCCATGTGAGCAATATTGTCATCAATGGTGTCTCCTACCGTGG mature peptide HGHVSNIVINGVSYRGWDINSDPYNSD 256

TATCCTCACTTGGGTTCTTCCCAGCCTGTGCTTCACACTAATTCCGA mature peptide YPHLGSSQPVLHTNSDTTQSRADAIKA 492

ATGGCTTCTACCGAAACTCAAACTGCCCTTCAATCGGCGCCTCCAGA full length MASTETQTALQSAPPDGTGVIQLDPW 692

Anig050(23-457) 133870 GH76 Anig059(22-349) 199085 GH16 Anig060(20-231) 171269 GH11 Anig061(18-440) 207264 GH27 Anig062(20-314) 191172 GH17 Anig063(21-985) 214233 GH105 Anig066(24-412) 194447 GH5

ATCGATCTCGACATCACCAACGAAGAATCTATCAAAAATGCCGCCGC mature peptide IDLDITNEESIKNAAATAAFNAMSYYTG 435

CAGACATACACCAATTGTAACCCATTGAAAAAATCATGCCCCGCGGA mature peptide QTYTNCNPLKKSCPADPALGKSASYD 328

CTCCCCAATGGCAAGGCCCTGCTGGACATGGCCAAGCGCAGTCTTA mature peptide LPNGKALLDMAKRSLTSSAEGESNGY 212

GTTCGACCCGATGGCGTGGGCCTCACTCCTGCCCTTGGCTGGAACT full length VRPDGVGLTPALGWNSWNAYSCDID 423

TACCAGGGTTTCAACTACGGCAACAAGTTCTCCGATGAGAGCTCCAA mature peptide YQGFNYGNKFSDESSKFQADFEAEFK 295

AGCCAGTCACTCTTATCCACCACTGCCCCTTCGCAGCCGCAGTTTAC mature peptide SQSLLSTTAPSQPQFTIPASADVGAQL 965

TCTCCTCTATCCACCTCGGGCCGATGGATCGTCGACACCGACGGAA mature peptide SPLSTSGRWIVDTDGNNVTYAGVNWP 389

Anig068(21-321) 203143 GH43 Anig069(24-430) Anig070(21-327) 41877 57436 GH88 GH10

abnA hypothetical protein xynA hypothetical protein xlnD rhgB hypothetical protein sucB pgaA agtA hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein inuA abfB hypothetical protein hypothetical protein hypothetical protein

GCTGACCCCGGAGCATGCTCGGGTGTTTGTACCACCCATGACCCCG mature peptide ADPGACSGVCTTHDPGLIRRESDGTY 301

GCGGCGGTGGGAATCAGCTGCGATCCAAACACCCGTCCATACTCGG mature peptide AAVGISCDPNTRPYSAWMTDSVIARR 397

CCCATTGAACCCCGTCAGGCTTCAGTGAGTATTGATACCAAATTCAA mature peptide PIEPRQASVSIDTKFKAHGKKYLGNIGD 307

Anig072(21-660) 185285 GH27 Anig080(27-804) 205670 GH3

CAGCCACGTCTGCAAGATGGCTTAGCATTGACACCACAAATGGGAT mature peptide QPRLQDGLALTPQMGWNTYNHYSCS 640

CAGGCCAACACCAGCTACGTCGACTACAACATCGAAGCCAACCCGG mature peptide QANTSYVDYNIEANPDLYPLCIETIPLS 778

Anig083(22-558) 211163 GH28 Anig084(28-256) 183088 GH11 Anig092(1-553) Anig096(20-370) 138876 GH32 57002 GH28

CAGCTCTCCGGTTCCGTGGGACCGCTGACATCCGCGTCCACCAAGG mature peptide QLSGSVGPLTSASTKAATKTCNVLDYG 537

ATCCCCCCACCACCGCGTGGAGCTCTTTCACCCGAACGTCTGCAAT mature peptide IPPPPRGALSPERLQWIREVIGNQTEN 229

ATGATCCTGCAACCGGTGTCTAATGATCTGCTCCATTGGGAGGTTTA full length MILQPVSNDLLHWEVYPEPCLQPTTEY 553

GCTCCTGCGCCTTCCCGCGTCTCCGACTTCACCAAGCGGTCCACCT mature peptide APAPSRVSDFTKRSTCTFTDAATASES 351

Anig100(26-555) 188489 GH13 Anig101(1-510) 190616 GH18

GCCAGCACCGAGCAATGGAAGTCCCGGTCAATCTATCAGACCATGA mature peptide ASTEQWKSRSIYQTMTDRFARTDGST 530

ATGTCCACCTACACCATCGTCAGCGGCGACTCATTATGGAAAATCTC full length MSTYTIVSGDSLWKISQDHGVTLDALR 510

Anig104(20-403) 181252 GH16 Anig108(1-655) 55419 GH31

TCTGCCCCGACTTGCAGCACCGACAGCAAGTGTCCGGAAGAGTATC mature peptide SAPTCSTDSKCPEEYPCCYSGQCGVG 384

ATGCTGTACGCCGAAGACAACAAACTCATCTTCCGGTTCGACGACCA full length MLYAEDNKLIFRFDDHLLWIQPWGEN 521

Anig110(20-301) 208214 GH17 Anig111(23-619) 209490 GH76 Anig116(1-594) Anig118(20-386) Anig120(24-418) Anig121(1-289) Anig122(20-441) Anig124(26-516) Anig125(19-499) Anig127(21-407) Anig128(26-440) Anig130(20-464) 46827 52811 GH2 GH5

AGTGGCACTCTGGGACTCTCCATAGGTGATAAAAATGGTGACTCCAG mature peptide SGTLGLSIGDKNGDSSCKSTSDYEAD 282

CTGGCGTTGCGGTCGCAGGACGTCCTTGCGCCATTGTCTCCAAATG mature peptide LALRSQDVLAPLSPNAQIPLEDSTDPP 597

full length 594 ATGCTGAAGCCCCAACAAACACCTTTTAGAGATATAGTCT MLKPQQTPFRDIVSLDGIWKFAL

mature peptide APLASPPNSSYIDWRTFKGNGVN 367 GCCCCCCTAGCCAGCCCCCCAAACTCTTCCTACATCGACT

134363 GH16 212379 GH18 172944 GH28 52928 GH32

mature peptide ISIPSPQETHPDANCDCYITSSFTS 395 ATATCCATACCATCACCCCAAGAAACCCACCCCGACGCCA

mature peptide MLPLLDNNTGVTHIILAAFHLNA 289 ATGCTGCCGCTGCTGGACAACAACACCGGCGTCACGCAC

mature peptide VPHSSRASRSQQCVVPSKYQASN 421 GTTCCACACTCCAGCAGAGCATCTCGGAGCCAACAATGC

mature peptide MPQKEFVPKTYQESSTGAQSSSS 847 AATGATTACCGTCCTTCATACCACTTCACACCGGACCAGT

200605 GH54 182430 GH61 194765 GH61 52590 GH71

mature peptide GPCDIYEAGDTPCVAAHSTTRALYSSF 481 GGCCCCTGTGACATCTACGAAGCCGGCGACACGCCCTGC

mature peptide HTTVQAVWINGEDQGLGNSADG 387 CACACCACCGTCCAGGCCGTCTGGATCAACGGCGAGGAC

mature peptide IEVDGTTYGGYLVDTYYYESDP 414 ATCGAGGTCGACGGCACTACTTACGGTGGCTACCTCGTTG

mature peptide AAVFAHFIVGNAWNYTLADWE 445 GCCGCCGTGTTCGCCCACTTCATCGTCGGCAACGCATGGA

Anig134(1-915) Anig135(1-365) Anig136(19-335) Anig139(19-380) Anig140(18-823) Anig144(16-241) Anig145(24-248) Anig147(1-318) Anig149(19-225) Anig150(22-362)

40264

GH78

41703 GH105 40875 GH26

134687 GH76 210981 52011 GH3 GH12

191511 GH12 38924 52071 GH43 GH11

hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein xynB epgII

full length 915 ATGCAAGTTCTGCGATGTGGAATCCACGGCTTTCATGAAG MQVLRCGIHGFHEVLGIDVDEIR

full length 365 ATGGCTTCTACATCTCCTCCCGCTGTCCGATCCAAAATTG MASTSPPAVRSKIDLLITNLVNIQ

mature peptide ASNQTLSYGNIDKSATPEARALL 317 GCTTCCAACCAGACTCTGTCCTATGGCAACATTGACAAGT

mature peptide SPTQLTLSSTTPYLDNAKSAVNT 362 TCTCCCACTCAACTAACCCTCAGCTCAACCACACCATACC

mature peptide AVVQKRTVDVAELEHFWSYGR 806 GCTGTAGTACAAAAGCGAACAGTCGATGTTGCTGAGCTA

mature peptide ASISRRSDFCGQWDTATAGDFIL 226 GCCTCTATCAGCCGCCGTAGCGACTTCTGCGGCCAATGGG

mature peptide RDPIGTICTKNNIITTDDFILYNNL 225 CGCGACCCCATCGGTACCATCTGCACCAAGAACAACATC

full length 318 ATGTCGCACCCCCAACAGAATCTCCTCGCCACCACAACCT MSHPQQNLLATTTSNTKAGNPV

mature peptide VPHDSVAQRSDALHMLSERSTP 207 GTTCCCCACGACTCTGTGGCCCAGCGTTCGGATGCCTTGC

182156 GH28

mature peptide SPIEARDSCTFTTAAAAKAGKAK 341 TCTCCTATCGAAGCTCGAGACAGCTGCACGTTCACCACCG

Expression Comments Level did not express low

high

low high low low high high did not express high high low low did not express did not express high high did not express high low high

did not express high high did not express low low high low high low did not express low did not express did not express did not express did not express high did not express did not express did not express did not express did not express high did not express low Revised gene model Revised gene model Revised gene model

did not express did not express low low low low high low high high


				
DOCUMENT INFO
Shared By:
Tags: Pichi, a-Pas
Stats:
views:7
posted:11/28/2009
language:English
pages:6
Description: Pichia-Pastoris-Expression-Constructs---Biosciences-Division-at-