Docstoc

Protein synthesis .ppt - tbarshinger

Document Sample
Protein synthesis .ppt - tbarshinger Powered By Docstoc
					PROTEIN SYNTHESIS
              DNA vs. RNA
       DNA                       RNA
• Made of                 • Made of ribose
  deoxyribose               sugar
  sugar                   • A - C - G - Uracil
•   A - C - G - Thymine   • Transfers genetic
                            info
•   Located in nucleus
                          • Single Stranded
•   Stores genetic info
                          • Located in nucleus
•   Double Stranded
                            and cytoplasm
         What are proteins?
• Organic compounds made of long chains of amino
  acids (1000’s) in a certain sequence that coil
  together.
• The sequence of amino acids determine the type of
  protein
             Types of RNA
• mRNA- messenger RNA
  – Takes information from DNA to ribosomes-
    transcription
  – Long single stranded molecule
• tRNA- transfer RNA
  – Transports amino acids & takes them to the
    ribosomes to be assembled- translation
  – Cloverleaf shape
• rRNA- ribosomal RNA
  – Along with proteins it makes up the ribosomes
STEPS OF PROTEIN
   SYNTHESIS
           Transcription
• Process of converting the DNA code
  into an mRNA code
  – Location: Nucleus
  – Type of RNA involved mRNA
     Steps of Transcription
1. RNA polymerase (an enzyme) binds to
   a region of DNA called a promoter
   (start pt for a gene)
2. DNA molecule unwinds
3. Complimentary base pairs are added
   on to an RNA molecule as was done
   in replication (Uracil binds with
   Adenine)
4. When mRNA reaches a termination
   codon it stops and releases from the
   DNA molecule
             mRNA base pairings

• Nitrogen base sequence of DNA:
       AAGAATAGGGTCTCAGCACGCCCAAAA

• mRNA would be built with the following base sequence:

      U U C U U A U C C C A G A G U C G U G C G G G UU U
  U

When mRNA reaches a STOP CODON it stops and releases from
 DNA molecule.
              CODONS
• Group of 3 nucleotide bases that will
  code for a specific amino acid (correct
  this on your notes sheet).
• Refer to your chart on the last page to
  see how each codon codes for one of
  the 20 amino acids
• SPECIAL CODONS:
  – Start: AUG --> tells ribosomes to begin
    adding amino acids
  – Stop: UAA; UAG; UGA --> tells ribosomes
    to stop adding amino acids
   Example mRNA codons
• UUC/UUA/ UCC/ CAG/ AG
  U/ CGU/ GCG/ GGU/UUU
            Translation
• Process that occurs along the
  ribosomes in which the mRNA codons
  are read and the tRNA finds the
  corresponding amino acid that matches
  the mRNA codon (refer to chart)
• Location: Cytoplasm
• Type of RNA involved: mRNA and tRNA
         Steps of Translation
1.   mRNA will migrate from the nucleus to a ribosome
     (made of rRNA and protein)
2.   A tRNA will have a codon opposite that of the
     mRNA’s codons called an anticodon.


 The tRNA’s anticodon is UAC.
 This will be received in the
 ribosomes if the mRNA codon is
 AUG. This tRNA will thus pick
 up the amino acid Methionine (it
 is based on the codon not
 anticodon
         Steps of Translation
The anticodons of the tRNA’s will be
Codon Anti            Codon Anti
U U C = AAG          CGU= GCA
U U A = AAU          GCG= CGC
U C C = AGG          GGU= CCA
C A G = GUC          UUU= AAA
A G U= UCA
3. Each tRNA will hunt and find the appropriate amino
   acid based on the codon (NOT it’s ANTICODON)
          Protein Assembly
• The ribosome will line up the amino
  acids based on the order that the
  mRNA codons read and create peptide
  bonds between each amino acid. It is
  the tRNA’s job to go and get the correct
  amino acid.
        Order of amino acid bases
 • Order of amino acids based on mRNA sequence:
                    (Use the amino acids chart)
Codes
for   UUC       / UUA / UCC / CAG           / AGU
 Phenylalanine- Leucine - Serine - Glutamine- Serine
     CGU / GCG / GGU / UUU
 - Arginine- Alanine- Glycine - Phenylalanine

 Add this to your Notes:
 This would continue….most proteins are made of amino
   acid sequences that are thousands of amino acids
   long.
 Once amino acid chain is completed the chain will twist
   into its secondary and tertiary levels of organization

				
DOCUMENT INFO
Shared By:
Categories:
Tags:
Stats:
views:0
posted:11/22/2013
language:Unknown
pages:16