USMLE 2000 QUESTIONS

Document Sample
USMLE 2000 QUESTIONS Powered By Docstoc
					1>Most fascia of the body that attach to bones attach by which of the following mechanisms? A. Blending with the covering periosteum B. Inserting deeply into the cancellous bone C. Inserting deeply into the cartilage D. Inserting deeply into the diaphysis E. Inserting deeply into the marrow 1>The correct answer is A. Fascial straps (retinacula) and fascial coverings of muscles or muscle groups characteristically attach to nearby bones by blending with the covering periosteum. No deep attachments are usually made by fascia. Cancellous bone (choice B) is spongy bone, which is usually found in marrow, and is not the site for fascial attachment. Fascia do not usually attach to cartilage (choice C). Fascia attaches to bony shafts, or diaphyses (choice D), superficially via the periosteum. Fascia do not penetrate the bone to reach the marrow (choice E). 2>A 35-year-old woman notices a change in the appearance of a mole on her neck. Physical examination reveals that the lesion is an irregular, nodular, superficial mass with a variegated appearance. Biopsy demonstrates a primary malignant tumor. Which of the following factors is most predictive of the patient's long term prognosis? A. Circumference of lesion B. Darkness of lesion C. Degree of color variation D. Depth of lesion E. Sharpness of border between lesion and adjacent skin 3>A 43-year-old, insulin-dependent diabetic patient is diagnosed with hypertension and begins therapy with an antihypertensive agent. Three days later, he measures his blood glucose at home and finds that it is 53 mg/dL. He recalibrates his glucose testing apparatus and repeats the test, only to find that the first reading was accurate. He is concerned that his hypoglycemia did not produce the normal premonitory signs and symptoms. Which of the following medications was most likely prescribed to treat his hypertension? A. Captopril B. Diltiazem C. Methyldopa D. Prazosin E. Propranolol 4>A 33-year-old woman presents with fever, vomiting, severe irritative voiding symptoms, and pronounced costovertebral angle tenderness. Laboratory evaluation reveals leukocytosis with a left shift; blood cultures indicate bacteremia. Urinalysis shows pyuria, mild hematuria, and gram-negative bacteria. Which of the following drugs would best treat this patient's infection? A. Ampicillin and gentamicin B. Erythromycin C. Gentamicin and vancomycin D. Phenazopyridine and nitrofurantoin E. Tetracycline 5>A 32-year-old, blood type A positive male receives a kidney transplant from a blood type B positive female donor with whom he had a 6-antigen HLA match. Once the kidney is anastomosed to the man's vasculature, the transplant team immediately begins to observe swelling and interstitial hemorrhage. After the surgery, the patient

developed fever and leukocytosis and produced no urine. Which of the following is the most likely explanation? A. Acute rejection due to antibody-mediated immunity B. Acute rejection due to cell-mediated immunity C. Chronic rejection due to cell-mediated immunity to minor HLA antigens D. Hyperacute rejection due to lymphocyte and macrophage infiltration E. Hyperacute rejection due to preformed ABO blood group antibodies 6>A cardiovascular physiologist is performing experiments using a new alpha1 adrenergic agonist to determine the amount of vasoconstriction the new drug can produce compared with a phenylephrine control. Which of the labeled structures is the cellular target of both of these drugs? A. A B. B C. C D. D E. E

7>A patient with familial hypercholesterolemia undergoes a detailed serum lipid and lipoprotein analysis. Studies demonstrate elevated cholesterol in the form of increased LDL without elevation of other lipids. This patient's hyperlipidemia is best classified as which of the following types? A. Type 1 B. Type 2a C. Type 2b D. Type 3 E. Type 5 8>A chronic alcoholic develops severe memory loss with marked confabulation. Deficiency of which of the following vitamins would be most likely to contribute to the neurologic damage underlying these symptoms? A. Folic acid B. Niacin C. Riboflavin D. Thiamine E. Vitamin B12

9>In the clotting process, as the hemostatic plug develops, fibrin polymerizes into monomeric threads which are held together by noncovalent bonds. Which clotting protein increases the strength of the clot by crosslinking the newly formed fibrin threads? A. Factor XIII B. High molecular weight kininogen (HMWK) C. Plasminogen D. Thrombin E. von Willebrand Factor (vWF) 10>A 72-year-old male is noted as having a 9-pound weight loss over the past few weeks. His past medical history is significant for oat cell carcinoma of the lung, without known metastases, for which he is currently undergoing treatment. The patient states that even though his wife is preparing his favorite meals, he is not hungry. Which of the following would be the best treatment option to improve his eating habits? A. Amitriptyline B. Megestrol acetate C. Methotrexate D. Neostigmine E. Prochlorperazine 11>An archaeologist who has been excavating a very old Middle Eastern site develops a pustule on his hand. The pustule then ruptures to form a black eschar surrounded by expanding brawny edema. Which of the following organisms is the most likely cause of this condition? A. Bacillus anthracis B. Borrelia burgdorferi C. Francisella tularensis D. Spirillium minus E. Yersinia pestis 12>A 48-year-old white female secretary presents with progressive difficulty typing over the past month. She also notes that her hands begin to feel numb and weak after typing for long periods of time. Upon testing, which of the following deficits would be predicted? A. Difficulty in abducting the fifth finger B. Difficulty in adducting the thumb C. Difficulty in flexing digits two and three at the metacarpophalangeal joints D. Loss of sensation over the lateral half of the dorsum of the hand E. Loss of sensation over the lateral half of the palm F. Loss of sensation over the medial half of the dorsum of the hand G. Loss of sensation over the medial half of the palm 13>A boy with Duchenne muscular dystrophy (DMD) was born to parents with no family history of the disease. The most likely explanation for this occurrence is A. a CGG expansion that resulted in the disruption of the promoter of the dystrophin gene B. infidelity C. a point mutation in the dystrophin gene D. a recombination event in the dystrophin gene that gave rise to a frameshift mutation leading to an untranslatable mRNA E. a translocation that resulted in the disruption of the dystrophin gene

14>An obese patient is brought into the emergency room in shock and in need of intravenous fluids. No superficial veins can be seen or palpated. The emergency room physician decides to make an incision to locate the great saphenous vein for the insertion of a cannula ("saphenous cutdown"). In which of the following locations should the incision be made? A. Anterior to the lateral malleolus B. Anterior to the medial malleolus C. On the dorsum of the foot, lateral to the extensor hallucis longus tendon D. Posterior to the lateral malleolus E. Posterior to the medial malleolus 15>A 2-year-old child with leukemia develops nephrotic syndrome. Light microscopic studies are normal. Electron microscopic studies demonstrate fusion of epithelial foot processes. The current hypothesis for the pathogenesis of this change is that it is secondary to which of the following? A. Consumption of complement factors B. IgG directed against basement membrane C. Immune complex deposition D. Lymphokine production by T cells E. Mesangial IgA deposition 16>A 4-year-old boy is seen by his pediatrician for epistaxis. The patient has a history of multiple bacterial and viral respiratory tract infections and eczema. An uncle had similar problems. Physical examination is remarkable for multiple petechial lesions on the skin and mucous membranes. Serum IgE is increased, and platelets are decreased. Which of the following is the most likely diagnosis? A. Acquired hypogammaglobulinemia B. Ataxia telangiectasia C. DiGeorge syndrome D. Selective IgA deficiency E. Wiskott-Aldrich syndrome 17>A healthy, 37-year-old, recently divorced woman loses her job at the auto factory. She picks up her three young children from the factory day care center and gets into an automobile accident on the way home. Her 5-year-old son, who was not wearing a seat belt, sustains a severe head injury. The woman was not hurt in the accident, but is hyperventilating as she sits in the waiting room at the hospital. She complains of feeling faint and has blurred vision. Which of the following is decreased in this woman? A. Arterial oxygen content B. Arterial oxygen tension (PO2) C. Arterial pH D. Cerebral blood flow E. Cerebrovascular resistance 18>A 32-year old women complains of amenorrhea since delivery of a baby 15 months previously, despite the fact that she did not breast feed her baby. The delivery was complicated by excessive hemorrhage that required transfusion of 2.5 liters of blood. She has also been fatigued and has gained an additional 10 pounds since the baby was born. Laboratory data show the following: Serum LH < 1 IU/L (normal, 4-24 IU/L) Serum estradiol 5 pg/mL (normal, 20 - 100 pg/mL) Serum TSH 0.1 mU/L (normal, 0.5 - 5 mU/L) Serum GH 3 ng/mL (normal, < 5 ng/mL) Serum ACTH 28 pg/mL (normal, 10 - 50 pg/mL) Serum prolactin 2 ng/mL (normal, <20 ng/mL) Injection of 500 mg of TRH failed to produce

the expected rise in both serum TSH and prolactin. Which of the following diagnoses most likely explains the findings in this patient? A. Hashimoto's thyroiditis B. Isolated gonadotropin deficiency C. Primary amenorrhea D. Prolactinoma E. Sheehan's syndrome 19>A 7- year-old girl develops behavioral changes, and her performance in school begins to deteriorate. Several months later she develops a seizure disorder, ataxia, and focal neurologic symptoms. She is eventually quadriparetic, spastic, and unresponsive. Death occurs within a year. This patient may have had which of the following viral diseases at 1 year of age? A. Chickenpox B. German measles C. Measles D. Mumps E. Parvovirus B19 20>A 40-year-old, moderately obese man presents with a persistent productive cough. The cough has been present for several weeks, but recently the man noted that his sputum has assumed a greenish color. Further questioning elicits a history of productive cough, usually in the winter months, over the past several years. He has smoked two packs of cigarettes per day since he was 16 years old. On examination, the man is febrile (100° F), and coarse rhonchi and wheezes can be appreciated bilaterally. Which of the following is the most likely diagnosis? A. Bronchogenic carcinoma B. Chronic bronchitis with superimposed infection C. Cystic fibrosis D. Emphysema E. Pulmonary tuberculosis 21>A 7-year-old patient presents with a mass in the anterior midline of the neck, slightly above the larynx. The mass is mobile and elevates upon protrusion of the tongue. This mass is most likely a cyst that developed from which of the following embryonic structures? A. First pharyngeal cleft B. First pharyngeal pouch C. Second pharyngeal cleft D. Second pharyngeal pouch E. Thyroglossal duct 22>An elderly man comes to medical attention because of anemia and multiple infections. Physical examination is remarkable for hepatosplenomegaly. An automated blood count demonstrates pancytopenia. Review of the peripheral smear by a hematologist demonstrates rare, distinctive, neoplastic white cells covered by fine, hairlike projections. Which of the following characteristics would likely be associated with these cells? A. Birbeck granules B. Elevated leukocyte alkaline phosphatase C. Philadelphia chromosome D. Positive tartrate-resistant acid phosphatase E. Production of Bence-Jones proteins

23>A patient develops a swollen and tender lymph node in his popliteal fossa. An infected skin lesion in which of the following sites would most likely induce lymphadenopathy in this region? A. Lateral side of the dorsum of the foot B. Lateral side of the thigh C. Medial side of the leg below the knee D. Medial side of the sole of the foot E. Medial side of the thigh 24>1. Internal oblique 2. External oblique 3. Peritoneum 4. Transversus abdominis A surgeon performing an appendectomy makes an incision through the ventrolateral wall. Which of the following corresponds to the order of penetration of the layers of the abdominal wall? A. 1-3-4-2 B. 2-1-3-4 C. 2-1-4-3 D. 4-1-2-3 E. 4-2-1-3 25>A 50-year-old physician is recovering from aseptic meningitis that began two weeks ago. He appears to have lost considerable cognitive function, and he says he will not go on living if his cognitive ability remains compromised. To demonstrate to him that recovery is occurring, serial evaluations with which of the following psychological assessments is indicated? A. Halstead-Reitan Battery B. Stanford Binet Intelligence Test C. Vineland Adaptive Behavior Scale D. Wechsler Adult Intelligence Scale E. Wide Range Achievement Test 26>A 37-year-old woman is abducted, beaten, and repeatedly raped. For five months after the attack she is nervous, tearful, easily fatigued, and has difficulty concentrating. She also notes difficulty sleeping and lack of appetite, and is hyperreactive to unexpected or loud stimuli. By six months she has returned to her characteristic pre-attack behavioral patterns. Which of the following is the most likely diagnosis? A. Acute stress disorder B. Adjustment disorder with mixed anxiety and depressed mood C. Major depressive disorder D. Panic disorder without agoraphobia E. Post-traumatic stress disorder 27>A 67-year-old black man with a history of glucose-6-phosphate dehydrogenase (G-6-PD) deficiency presents with fever, irritative voiding symptoms, and perineal pain. Rectal examination is remarkable for a boggy, exquisitely tender prostate. A urine Gram's stain is positive for gram-negative rods. The risk for development of hemolytic anemia is highest if he receives high-dose, 21-day therapy with A. ampicillin B. cefaclor C. ciprofloxacin

D. E.

sulfamethoxazole/trimethoprim tetracycline

28>A patient, who appears to be female, is found to be 46,XY. The patient's vagina is very shallow, ending in a blind pouch, and there are palpable masses in the labia. The diagnosis of testicular feminization syndrome is made. Which of the following was most likely present during the early fetal life of this individual? A. A streak ovary B. A uterus C. An oviduct D. Depressed levels of testosterone E. MIF (Mullerian inhibitory factor) 29>A patient develops a form of lung cancer that spreads to occlude the thoracic duct. Edema involving which of the following sites might be expected as a potential complication? A. Entire left side and right leg B. Entire right side and left leg C. Left arm only D. Right arm and right half of head only E. Right arm only 30>A patient develops an acute febrile illness with shivers, nonproductive cough, and pleuritic chest pain. Five days later, he presents to the emergency room after abruptly having "coughed up" nearly a cup of blood-stained sputum. Which of the following is most likely to be seen on chest x-ray? A. A cavity with a fluid level B. Blunting of diaphragmatic costal angles C. Complete opacification of one lobe with no additional findings D. Patchy consolidation centered on bronchi E. Prominent bronchi that can be followed far out into the lung fields 31>Maintenance of the corpus luteum during the first trimester of pregnancy is accomplished principally by the secretion of A. antidiuretic hormone (ADH) B. follicle stimulating hormone (FSH) C. human chorionic gonadotropin (hCG) D. luteinizing hormone (LH) E. progesterone 32>A 15-year-old boy is evaluated by a clinician for failure to develop normal male secondary sexual characteristics. Physical examination reveals small testes, a small penis, and gynecomastia. The boy has had some difficulties in school, and the parents say that the school psychometrist said he had an IQ of 90. This patient's condition is most likely to be related to which of the following? A. Deletion B. Nondisjunction of an autosomal chromosome C. Nondisjunction of a sex chromosome D. Non-Robertsonian translocation E. Robertsonian translocation

33>A 52-year-old female presents with groin pain . Physical examination reveals a bulge in the groin area immediately inferior to the inguinal canal. The physician suspects that the patient has a femoral hernia containing a loop of small intestine. Which of the following structures is located immediately medial to the hernia sac? A. Femoral artery B. Femoral nerve C. Femoral vein D. Inferior epigastric artery E. Lacunar ligament 34> The modified structures at the border of the epithelium shown above are immotile in a 23-year-old patient. Which of the following would be a consequence of this lack of motility? A. Implantation failure B. Kartagener's syndrome C. Malabsorption syndrome D. Reduction in number of disaccharidases E. Uptake and digestion of spermatid residual bodies

35>A patient with tuberculosis develops bright orange-red urine and calls his physician in a panic because he is afraid he is bleeding into the urine. The patient has no other urinary tract symptoms. Which of the following medications is most likely to produce this side effect? A. Ethambutol B. Isoniazid C. Pyridoxine D. Rifampin E. Streptomycin 36>Which of the following Starling force changes is the primary cause of the edema seen in patients with nephrotic syndrome? A. Decreased capillary hydrostatic pressure (Pc) B. Decreased capillary oncotic pressure (pc) C. Decreased interstitial hydrostatic pressure (Pi) D. Decreased interstitial oncotic pressure (pi) E. Increased capillary hydrostatic pressure (Pc) F. Increased capillary oncotic pressure (pc) G. Increased interstitial hydrostatic pressure (Pi) H. Increased interstitial oncotic pressure (pi)

37>HbNl: AAGUAUCACUAAGCUCGC HbCr: AAGAGUAUCACUAAGCUCGCUUUC ... UAU UAA Hemoglobin is isolated from the erythrocytes of a young child with anemia. Hemoglobin electrophoresis reveals the presence of an unstable hemoglobin, known as hemoglobin Cranston (HbCr), containing an abnormal b-globin chain. The normal sequence of the bglobin gene (HbNl) and the sequence of the HbCr b-chain are presented above. Which of the following would account for the development of HbCr? A. A frameshift mutation resulted in the deletion of several amino acid residues in the b-chain B. A mutation in the stop codon resulted in elongation of the b-chain C. A point mutation resulted in the insertion of a stop codon in the b-chain D. A two base pair addition resulted in the elimination of a stop codon in the bchain E. A two base pair deletion resulted in truncation of the b-chain

38> What is the primary function of the cell pointed to in the figure above? A. It produces low-molecular weight polypeptides B. It secretes bactericidal enzymes C. It secretes lipases D. It secretes mucins E. It secretes pepsinogen

39>A 37-year-old woman who was diagnosed with AIDS 3 years earlier is unable to work, is physically debilitated, and requests her physician to provide her with medications with which to take her own life. The most common emotional disorder that results in such requests by patients is A. bipolar I disorder, manic type B. borderline personality disorder C. factitious disorder D. major depressive disorder E. schizophrenic disorder 40>IV administration of drug X to an anesthetized animal produces an increase in blood pressure. After administration of drug Y, readministration of drug X produces a decrease in blood pressure. Which of the following pairs of drugs could produce this sequence of events? Drug X Drug Y A. Acetylcholine Neostigmine B. Epinephrine Phentolamine C. Isoproterenol Atropine D. Norepinephrine Propranolol E. Phenylephrine Hexamethonium

41>A 25-year-old woman with sickle cell anemia complains of steady pain in her right upper quadrant with radiation to the right shoulder, especially after large or fatty meals. Her physician diagnoses gallstones. Of which of the following compounds are these stones most likely composed? A. Calcium bilirubinate B. Calcium oxalate C. Cholesterol D. Cholesterol and calcium bilirubinate E. Cystine 42>A patient with prolonged diarrhea undergoes esophagogastroduodenoscopy. Biopsy of the small intestine demonstrates numerous crescent-shaped protozoa adjacent to the epithelial brush border. Which of the following organisms is the most likely pathogen? A. Entamoeba histolytica B. Escherichia coli C. Giardia lamblia D. Naegleria fowleri E. Trichomonas vaginalis 43>A neuroscientist is investigating the development of the nervous system. In his experiments, he microinjects a dye into the embryo of an animal subject in vivo. After birth, he performs histological studies to determine the destination of the dye. In one animal subject, he locates the dye in the dorsal horn of the spinal cord. Which of the following locations in the embryo was the most likely site of the injection? A. Alar plate B. Basal plate C. Neural crest D. Rostral end of neural tube E. Sulcus limitans 44>The heart of an embryo first begins beating at which of the following ages? A. 2 weeks B. 3 weeks C. 4 weeks D. 6 weeks E. 8 weeks 45>Which of the following respiratory system components is derived from neural crest? A. Endothelial cells B. Epithelium of primary bronchi C. Laryngeal cartilage D. Tracheal glands E. Type I pneumocytes 46>A 36-year-old Asian male complains of difficulty swallowing. Esophagoscopy reveals a polypoid mass that is subsequently biopsied. In addition to tumor cells, the esophageal biopsy show normal smooth muscle and striated muscle in the same section. Which portion of the esophagus was the source of this biopsy? A. Lower esophageal sphincter B. Lower third of the esophagus C. Middle third of the esophagus D. Upper esophageal sphincter

E.

Upper third of the esophagus

47>Which of the following hormones is secreted by anterior pituitary cells that stain with acidic dyes? A. ACTH B. FSH C. LH D. Prolactin E. TSH 48>A 20-year-old develops weakness accompanied by difficulty in relaxation that is most pronounced in the hands and feet. Muscle biopsy demonstrates prominent ring fibers, centrally located nuclei, chains of nuclei, and disorganized sarcoplasmic masses. This condition been associated with a mutation on which of the following chromosomes? A. X B. Y C. 4 D. 5 E. 19 49>A 24-year-old woman in her third trimester of pregnancy presents with urinary frequency and burning for the past few days. She denies fever, nausea, vomiting, or chills. She takes no medications besides prenatal vitamins and is generally in good health. Physical examination is remarkable for mild suprapubic tenderness, and a urine dipstick is positive for white blood cells, protein, and a small amount of blood. Culture produces greater than 100,000 colonies of gram-negative bacilli. which of the following attributes of this uropathogenic organism is most strongly associated with its virulence? A. Bundle-forming pili B. GVVPQ fimbriae C. Heat labile toxins D. Heat stable toxins E. P pili F. Type 1 pili 50> A baby who was apparently normal at birth, develops persistent regurgitation and vomiting in the second and third weeks of life. No fever is present and hematologic studies and blood chemistries are normal. Which of the following therapies is most likely to be effective in this case? A. Antacids B. Barium enema C. Gastric resection D. Oral antibiotics E. Pyloromyotomy Answers

2>The correct answer is D. The lesion is a malignant melanoma. Melanomas can develop either de novo or in an existing mole. Sunlight exposure is a significant risk factor and fairskinned persons are at increased risk of developing melanoma. The most significant factor for long term prognosis is the depth of the lesion, since the superficial dermis lies about 1

mm under the skin surface, and penetration to this depth is associated with a much higher incidence of metastasis than is seen with a more superficial location. The circumference of the lesion (choice A) is much less important than depth , since one form of melanoma (superficial spreading) can still have good prognosis despite large size, if it has not extended to the depth of the superficial dermal lymphatic bed. The darkness (choice B) or degree of variation in color (choice C) do not have prognostic significance once melanoma is diagnosed. Irregularity, or fuzziness at the border (choice E) of a mole-like lesion is a good clue to potential malignancy, but does not affect prognosis once a melanoma is diagnosed.

3>The correct answer is E. Beta-adrenergic blockade may blunt or prevent the premonitory signs and symptoms (e.g., tachycardia, blood pressure changes) of acute episodes of hypoglycemia. Non-selective beta-blockers, such as propranolol, may even potentiate insulin-induced hypoglycemia. Even though this effect is less likely with cardioselective agents, the use of either cardioselective or non-selective beta-blockers in diabetics is not recommended due to their "masking" effect of the normal warning signs and symptoms of hypoglycemia. None of the drugs listed in the othe r choices will blunt the premonitory signs and symptoms of hypoglycemia. Captopril (choice A) is an angiotensin-converting enzyme (ACE) inhibito r that can be safely used for the treatment of hypertension in diabetic patients. Diltiazem (choice B) is a calcium channel blocker that is also considered to be safe and effective for the treatment of hypertension in diabetic patients. Both methyldopa (choice C), a centrally acting alpha-adrenergic agonist , and prazosin (choice D), an alpha1-adrenergic antagonist, can be safely used to treat hypertension in diabetic patients. However, due to the side effect profile of these medications, they are generally used only in diabetic patients who are unresponsive to ACE inhibitors and calcium channel blockers.

4>The correct answer is A. Acute pyelonephritis is an infectious disease involving the kidney parenchyma and the renal pelvis. Gram-negative bacteria, such as Escherichia coli, Proteus, Klebsiella, and Enterobacter, are the most common causative organisms in acute pyelonephritis. Laboratory evaluation will often reveal leukocytosis with a left shift, and urinalysis typically shows pyuria, varying degrees of hematuria , and white cell casts. Since bacteremia is present, the patient should be hospitalized and empirically started on IV ampicillin and gentamicin . This regimen may be need to be changed, however, once the sensitivity results are available. Erythromycin (choice B) and tetracycline (choice E) are both bacteriostatic antibiotics and would not be recommended in a patient with a severe infection, such as acute pyelonephritis with bacteremia. Vancomycin (choice C) is primarily used in the treatment of severe gram-positive infections. Phenazopyridine (choice D) is a urinary analgesic, and nitrofurantoin (choice D) is a urinary tract anti-infective. Although nitrofurantoin is indicated for the treatment of "mild" cases of pyelonephritis, as well

as cystitis, this patient's condition is severe and should be treated with appropriate antibiotics.

5>The correct answer is E. The patient is suffering from hyperacute rejection due to the preformed anti-B ABO blood group antibody found in all type A positive individuals. Hyperacute rejection occurs within minutes to a few hours of the time of transplantation, and is due to the destruction of the transplanted tissue by preformed antibodies reacting with antigens found on the transplanted tissue that activate complement and destroy the target tissue. Preformed antibodies can also be due to presensitization to a previous graft, blood transfusion, or pregnancy. Acute rejection due to antibody-mediated immunity (choice A) is incorrect because this patient suffered from hyperacute rejection (immediate) occurring within minutes to hours, rather than days. Acute rejection due to cell-mediated immunity (choice B) will not occur until several days or a week following transplantation. Acute rejection is due to type II and type IV reactions. Chronic rejection, due to the presence of cell-mediated immunity to minor HLA antigens (choice C), occurs in allograft transplantation months to even years after the transplant. Chronic rejection is generally caused by both humoral and cell-mediated immunity. An accelerated acute rejection, occurring in 3-5 days, can be caused by tissue infiltration and destruction by presensitized T lymphocytes and macrophages (choice D) and/or antibody-dependent, cell-mediated cytotoxicity (ADCC). Note that this is not a hyperacute reaction.

6>The correct answer is E. Arrow E points to a smooth muscle cell in the media of the arteriole. Alpha1 agonists stimulate alpha1 receptors present on the smooth muscle, which leads to an increase in intracellular calcium via phosphatidylinositol hydrolysis. This increase in calcium is necessary for smooth muscle contraction. Arrow A indicates an endothelial cell located in the intima of the arteriole. Nitric oxide, also known as endothelial cell relaxing factor (EDRF), is produced from arginine by endothelial cells. A muscarinic agonist can lead to the evolution of NO, producing vasodilatation. Arrow B indicates a polymorphonuclear leukocyte in the bloodstream. Arrow C indicates the basal lamina underlying the endothelium. Arrow D indicates the arteriolar adventitia.

7>The correct answer is B. Hyperlipidemia has been subclassified based on the lipid and lipoprotein profiles. Type 2a, which this patient has, can be seen in a hereditary form, known as familial hypercholesterolemia, and also in secondary, acquired forms related to nephritic syndrome and hyperthyroidism. The root problem appears to be a deficiency of LDL receptors, which leads to a specific elevation of cholesterol in the form of increased LDL. Heterozygotes for the hereditary form generally develop cardiovascular disease from 30 to 50 years of age. Homozygotes may have cardiovascular disease in childhood.

Type 1 (choice A) is characterized by isolated elevation of chylomicrons. Type 2b (choice C) is characterized by elevations of both cholesterol and triglycerides in the form of LDL and VLDL. Type 3 (choice D) is characterized by elevations of triglycerides and cholesterol in the form of chylomicron remnants and IDL. Type 5 (choice E) is characterized by elevations of triglycerides and cholesterol in the form of VLDL and chylomicrons.

8>The correct answer is D. Wernicke-Korsakoff syndrome refers to the constellation of neurologic symptoms caused by thiamine deficiency. Among these, a severe memory deficit, which the patient may attempt to cover by making up bizarre explanations (confabulation), is prominent. Anatomical damage to the mamillary bodies and periventricular structures has been postulated as the cause. In the U.S., severe thiamine deficiency is seen most commonly in chronic alcoholics. Thiamine deficiency can also damage peripheral nerves ("dry" beriberi) and the heart ("wet" beriberi). Folic acid deficiency (choice A) produces megaloblastic anemia without neurologic symptoms. Niacin deficiency (choice B) produces pellagra, characterized by depigmenting dermatitis, chronic diarrhea, and anemia. Riboflavin deficiency (choice C) produces ariboflavinosis, characterized by glossitis, corneal opacities, dermatitis, and erythroid hyperplasia. Vitamin B12 deficiency (choice E) produces megaloblastic anemia accompanied by degeneration of the posterolateral spinal cord.

9>The correct answer is A. Fibrinogen is cleaved by thrombin twice as it is activated to form fibrin. The initial cleavage causes it to polymerize and the second causes it to branch. Thrombin also activates Factor XIII to XIIIa, which crosslinks the fibrin strands and strengthens the clot. HMWK (choice B) is a cofactor in the intrinsic pathway that converts Factor XI to XIa. Plasminogen (choice C) is a central proenzyme in clot lysis. When plasminogen is converted to plasmin, it digests fibrin threads, as well as a number of protein factors including Factors V, VIII, XII, and prothrombin. Thrombin (choice D) is an enzyme derived from prothrombin. It converts fibrinogen to fibrin, and activates factor XIII. vWF (choice E) is a tissue-bound protein which is exposed with vascular trauma and helps in the process of platelet adhesion.

10>The correct answer is B. One of the most common side effects of any antineoplastic therapy is weight loss secondary to decreased appetite and/or nausea and vomiting. Furthermore, weight loss due to decreased food intake tends to occur more frequently in elderly patients receiving antineoplastic therapy. One medication that has consistently helped to increase appetite in such patients is megestrol acetate. This agent is a progestational hormone with antineoplastic properties used in the treatment of advanced carcinoma of the breast and endometrium. Megestrol, when given in relatively high doses, can substantially increase the appetite in most individuals, even those with advanced cancer.

Amitriptyline (choice A) is a tricyclic antidepressant used in the treatment of depression. There is nothing mentioned in the case study to suggest that the patient is clinically depressed; hence, this agent would provide no benefit. Methotrexate (choice C) is an antimetabolite and folic acid antagonist commonly used in various neoplastic disorders and in the treatment of rheumatoid arthritis. Since nausea, vomiting, and ulcerative stomatitis are common side effects of this medication, its usage in this patient would not be recommended. Neostigmine (choice D) is a carbamylating acetylcholinesterase inhibitor that would not increase appetite. Prochlorperazine (choice E) is a phenothiazine derivative used primarily to control severe nausea and vomiting. This patient is not experiencing nausea. Furthermore, this agent does not possess appetite-stimulating properties.

11>The correct answer is A. Anthrax forms extremely stable spores and has, in fact, been encountered in very old (i.e., deep) dirt in Israeli and Arabian excavation sites. The causative organism, Bacillus anthracis, is found in many animal species, and humans can acquire the organism either through contact with the animals or from locally contaminated soil. The pustule described in the question stem is called a "malignant pustule" and may be accompanied by lymphadenopathy. Most cases remain localized, but death can occur as the result of complications such as bacteremia, meningitis, and pneumonia. Borrelia burgdorferi (choice B) causes Lyme disease. In the first stage of this disease, there is a localized expanding erythematous rash rather than an eschar. Furthermore, Lyme disease occurs in the U.S., Europe, and Asia, corresponding to the distribution of Ixodid ticks, which spread the infection. Francisella tularensis (choice C) causes tularemia. The organism can persist for weeks to months but does not form spores that could survive for hundreds or thousands of years. Also, most human cases occur in the endemic areas of the U.S. Spirillium minus (choice D) is one of the causes of rat-bite fever. There is no indication the man was bitten by a rat. Yersinia pestis (choice E) causes bubonic plague. This organism does not form stable spores that could survive for extended periods of time. 12>The correct answer is C. This is a classic presentation of a patient with carpal tunnel syndrome, which typically affects females between the ages of 40 and 60 who chronically perform repetitive tasks that involve movement of the structures that pass through the carpal tunnel. One important structure that passes through the carpal tunnel is the median nerve. Patients often note a tingling, a loss of sensation, or diminished sensation in the digits. There is also often a loss of coordination and strength in the thumb, because the median nerve also sends fibers to the abductor pollicis brevis, flexor pollicis brevis, and the opponens pollicis. A final function of the median nerve distal to the carpal tunnel is control of the first and second lumbricals which function to flex digits two and three at the metacarpophalangeal joints and extend interphalangeal joints of the same digits. Abduction of the fifth digit (choice A) is a function controlled by the ulnar nerve, which does not pass through the carpal tunnel. Adduction of the thumb (choice B) is a function of the adductor pollicis, which is the only short thumb muscle that is not innervated by the median nerve, but rather by the deep branch of the ulnar nerve. Sensation of the lateral half of the dorsum of the hand (choice D) is mediated by the radial nerve, which also does not pass through the carpal tunnel.

Sensation over the lateral aspect of the palm (choice E) is mediated by the median nerve, however the branch innervating the palm (palmar cutaneous branch of the median nerve) passes superficial to the carpal tunnel. Sensation over the medial aspect of the dorsum of the hand (choice F) is mediated by the ulnar nerve. Sensation over the medial aspect of the palm (choice G) is mediated by the ulnar nerve. 13>The correct answer is D. Duchenne muscular dystrophy (DMD) is a lethal, X-linked recessive disease affecting approximately 1 in 3300 live male births. The disease becomes symptomatic in early childhood. Inability to walk occurs by the end of the first decade, and death usually occurs by the second decade. Nearly all patients show the complete absence of the protein dystrophin, which is abundant in skeletal and cardiac muscle. The dystrophin gene (or DMD gene), located at Xp21, is approximately 2300 Kb in size, making it one of the largest known genes of any species. It contains 24 regions of 109 amino acids that are similar but not identical repeats of each other. In women, the similarity of these sequences can lead to the misalignment of homologous material at meiotic synapsis. In association with a recombination event, this misalignment gives rise to frameshift mutations, leading to an untranslatable mRNA. This series of events occurs at an extremely high rate of about 1 in 10,000. In fact, one third of DMD cases in each generation arise from this mechanism. Diseases such as fragile X syndrome and Huntington disease are caused by the expansion of a trinucleotide repeat (choice A). Infidelity (choice B) is not a plausible explanation for the child because the trait is an Xlinked recessive condition. A male child must receive the DMD trait on the maternal X chromosome. The father of the child contributes only a Y chromosome, and the history stated that the mother had no family history of the disorder. DMD in a patient with no family history is not generally due to a point mutation in the dystrophin gene (choice C). Rare cases of DMD in females have been caused by an X chromosome-autosome translocation (choice E) with the breakpoint on the X chromosome within the DMD gene. Because of the translocation, only the cells in which the normal X chromosome is inactivated survive in the female zygote. This gives rise to a female who is heterozygous for the DMD gene but phenotypically expresses the disease. 14>The correct answer is B. The great saphenous vein is one of the two major superficial veins of the lower limb. It is found in the superficial fascia, where it is accessible for procedures such as saphenous cutdown and saphenous venous graft. As the vein ascends along the lower limb, it passes anterior to the medial malleolus at the ankle and posterior to the medial side of the knee. The vein then passes through the saphenous hiatus of the fascia lata to empty into the femoral vein slightly below the inguinal ligament. No major vein is found anterior to the lateral malleolus (choice A). Veins on the dorsum of the foot (choice C) are small tributaries of the great and small saphenous veins. The small saphenous vein passes posterior to the lateral malleolus (choice D). There are no major superficial veins that pass posterior to the medial malleolus (choice E). In this region, under the deep fascia, will be found the posterior tibial artery and vein, along with the tibial nerve. 15>The correct answer is D. The child is suffering from minimal change or nil disease (lipoid nephrosis), which has a peak incidence at 2-3 years of age. Minimal change disease can be associated with food allergies, medications, or hematologic malignancies, or it can occur idiopathically. The pathology does not appear to involve complement, immunoglobulins, or immune complex deposition. Rather, an altered cell-mediated immunologic response with

abnormal secretion of lymphokines by T cells is thought to reduce the production of anions in the glomerular basement membrane, thereby increasing the glomerular permeability to plasma albumin through a reduction of electrostatic repulsion. The loss of anionic charges is also thought to favor foot process fusion. Some authors have noted that other conditions associated with T-cell abnormalities, such as Hodgkin's disease and T-cell lymphoma, are sometimes associated with minimal change disease. Consumption of complement factors (choice A) is observed in many conditions in which complement activation occurs, for example, membranoproliferative glomerulonephritis. IgG directed against renal and pulmonary basement membranes (choice B) is found in Goodpasture's syndrome, a cause of rapidly progressive glomerulonephritis and hemoptysis. Immune complex deposition (choice C) is associated with type III hypersensitivity reactions, including postinfectious glomerulonephritis, lupus nephritis, Henoch-Schönlein purpura, cryoglobulinemia, and bacterial endocarditis. Mesangial IgA deposition (choice E) is associated with Berger's disease, or IgA nephropathy, a cause of glomerulonephritis.

16>The correct answer is E. Wiskott-Aldrich syndrome is an X-linked condition characterized by eczema, thrombocytopenia, and repeated infections. Affected children may present with bleeding and often succumb to complications of bleeding, infection, or lymphoreticular malignancy. The platelets are small, have a shortened half-life, and appear to be deficient in surface sialophorin (CD43). Splenectomy can correct the thrombocytopenia, but not the immune defect. Serum IgM is usually decreased, while IgE is frequently increased. Mutations in the Wiskott-Aldrich serum protein (WASP) gene on the short arm of the X chromosome are responsible for this disease. Acquired hypogammaglobulinemia (choice A) is a disease of adults characterized by normal numbers of B cells but low immunoglobulin production. Ataxia telangiectasia (choice B) is an autosomal recessive disease characterized by progressive cerebellar dysfunction, telangiectasias, and a variable immunodeficiency. DiGeorge syndrome (choice C) is a developmental malformation leading to thymic aplasia and, sometimes, hypoparathyroidism. Selective IgA deficiency (choice D) is a relatively common condition characterized by low levels of IgA.

17>The correct answer is D. The key symptom is hyperventilation. Hyperventilation results in hypocapnia, alkalosis, increased cerebrovascular resistance, and decreased cerebral blood flow. Carbon dioxide plays an important role in the control of cerebral blood flow. An increase in arterial PCO2 dilates blood vessels in the brain and a decrease in PCO2 causes vasoconstriction. The anxious, hyperventilating woman is "blowing off" carbon dioxide, which lowers her arterial PCO2. This decrease in PCO2 has caused the cerebrovascular resistance (choice E) to increase, thereby decreasing cerebral blood flow. The decrease in cerebral blood flow has caused the woman to feel faint and to have blurred vision. Other symptoms commonly associated with the hyperventilation of anxiety states are feelings of tightness in the chest and a sense of suffocation. Hyperventilation increases the arterial oxygen content (choice A) and PO2 (choice B) in a normal person. A decrease in arterial PCO2 causes the arterial pH (choice C) to increase, i.e., the patient becomes alkalotic.

18>The correct answer is E. Sheehan's syndrome is hypopituitarism due to ischemic damage to the pituitary resulting from excessive hemorrhage during parturition. The pituitary is enlarged during pregnancy; it is more metabolically active, and more susceptible to hypoxemia. Furthermore, the blood vessels in the pituitary may be more susceptible to vasospasm because of the high estrogen. In about 30% of women who hemorrhage excessively during parturition, some degree of hypopituitarism eventually becomes manifest. The symptoms depend on how much of the pituitary is damaged and what cell types are destroyed. The patient described above exhibited persistent amenorrhea after delivery of her infant. This is due to destruction of pituitary gonadotrophs and diminished secretion of gonadotropins (LH). There also appears to have been significant destruction of lactotrophs since TRH injection failed to induce an increase in prolactin. Had the women attempted to breast-feed her infant, a failure to lactate mostly likely would have occurred. This case is also characterized by secondary hypothyroidism. The low TSH and failure to respond to TRH injection is confirmatory. Corticotrophs appear to have been spared since plasma ACTH is normal. It is not clear whether somatotrophs were damaged. Further testing would be needed to see if GH reserve is diminished. Hashimoto's thyroiditis (choice A) is an autoimmune disorder that produces primary hypothyroidism. Because of diminished negative feedback effects of T4, serum TSH is usually increased (not decreased). Isolated gonadotropin deficiency (choice B) produces amenorrhea and is associated with low serum LH and estradiol. Hypogonadotropic hypogonadism can occur in female athletes that over-train, in anorexia nervosa, in obesity, or with other emotional or physical stresses. However, other pituitary hormones are unaffected (by definition isolated gonadotropin deficiency only involves a decrease in gonadotropins). Primary amenorrhea (choice C), by definition, means failure of menstrual cycles to ever begin. Since this woman has delivered a baby, primary amenorrhea is highly unlikely. A prolactinoma (choice D) is a functional pituitary tumor that secretes excessive prolactin. This can cause amenorrhea by suppressing the GnRH-pituitary-gonad axis. The patient described above has decreased prolactin secretion.

19>The correct answer is C. The child has subacute sclerosing panencephalitis (SSPE), which is fortunately a very rare, late complication of measles infection at an early age. The existence of this complication is part of the rationale to immunize children to measles at an early age. It is thought that very young children's immune and neurologic systems may permit the virus to become established in the brain. The exact mechanism of injury is poorly understood, but the brain shows encephalitis involving both gray and white matter. 40% of cases die within 1 year, and it is thought that the disease is probably always eventually fatal. None of the other diseases progresses to SSPE.

20>The correct answer is B. The diagnosis of chronic bronchitis requires the presence of chronic productive cough over at least 3 months of the year for 2 successive years. The symptoms in this patient (green productive sputum, fever) suggest that he has an acute infection superimposed on chronic bronchitis (history of cigarette smoking, history of excessive mucus production over many years). Histologically, the mucus-producing glands in the bronchi would show hyperplasia and hypertrophy and extend to a greater depth in the

bronchial wall, resulting in a higher Reid index (ratio of thickness of mucus gland to thickness of bronchial wall). Although the patient is a smoker and is at increased risk for bronchogenic carcinoma (choice A), this is unlikely to be the cause of his symptoms. Hemoptysis and weight loss might also be present if he had cancer. Cystic fibrosis (choice C) presents earlier in life and may be associated with severe production of mucus, especially if bronchiectasis supervenes. The age of the patient and the relative late onset of disease preclude this diagnosis. This patient may also have emphysema (choice D), as chronic bronchitis and emphysema are often coexistent. However, although pure emphysema might cause dyspnea, it would not be associated with a fever or a productive cough. Pulmonary tuberculosis (choice E) would typically present with a history of hemoptysis rather than abundant green sputum. Weight loss, night anorexia, malaise, and weakness may also be present.

21>The correct answer is E. The thyroglossal duct develops as an evagination of the floor of the pharynx in the region where the tongue develops. The adult foramen cecum of the tongue marks the site of this evagination. The distal end of this duct normally forms the thyroid gland; the proximal part of the duct normally degenerates. Failure of a part of the duct to degenerate may lead to a thyroglossal duct cyst or median cervical cyst, as seen in this patient. The first pharyngeal cleft (choice A) forms the external ear canal. This cleft normally remains patent. The first pharyngeal pouch (choice B) forms the middle ear cavity and the auditory tube. This pouch normally remains patent. The second pharyngeal cleft (choice C) normally does not remain patent. It is typically covered over by the overgrowth of the second pharyngeal arch. If part of this pouch does remain patent, it may form a lateral cervical cyst, which is seen on the lateral side of the neck along the posterior border of the sternocleidomastoid muscle. The second pharyngeal pouch (choice D) forms the tonsillar fossa of the pharynx. The pharyngeal mucosa in this area arises from the endoderm of the pouch. Ingrowth of mesoderm cells results in the formation of the palatine tonsil.

22>The correct answer is D. The disease is hairy cell leukemia, which, unlike most forms of leukemia, is characterized by pancytopenia rather than increased numbers of circulating cells. This disease tends to affect older men and the characteristic cells (which are not always obviously "hairy") are positive for tartrate-resistant acid phosphatase (TRAP). Associate Birbeck granules (choice A) with Langerhans cell histiocytosis (histiocytosis X). Associate elevated leukocyte alkaline phosphatase (choice B) with myeloid metaplasia. Associate Philadelphia chromosome (choice C) with chronic myeloid leukemia (and occasionally with acute lymphocytic leukemia). Associate production of Bence-Jones proteins (choice E) with multiple myeloma.

23>The correct answer is A. Most of the venous drainage of the skin of the lower extremity is to the long saphenous vein, the accompanying lymphatics of which drain into the superficial group of the inguinal lymph nodes. However, the skin drained by the short saphenous vein, including that of the lateral aspect of the dorsum of the foot, is an exception to this rule.

Lymphatic fluid from this area drains into lymphatics accompanying the short saphenous vein, then drains into lymph nodes behind the knee in the popliteal fossa. The lateral side of the thigh (choice B), the medial side of the leg below the knee (choice C), the medial side of the sole of the foot (choice D), and the medial side of the thigh (choice E) all drain to the superficial inguinal nodes.

24>The correct answer is C. Questions like these are particularly amenable to the use of testtaking strategies because even if you don't know 100% of the answer, you will be able to eliminate some answer choices based on the knowledge you do have. For example, you probably were aware that the peritoneum does not lie above the transversus abdominis muscle, enabling you to eliminate choice A and to increase your chances of answering correctly by 20%. Note that this is a question surgeons love to ask students, so keep this information in mind in the OR!

25>The correct answer is A. The Halstead-Reitan Battery is a group of tests that reflects the basic and higher level cognitive and neuro-sensory functioning of the entire brain, and can be used in a serial fashion with little learning effect being present. Since there is recovery of function for up to 2 years post CNS-trauma, test results can demonstrate that the present loss the patient is experiencing is not permanent. The Stanford Binet Intelligence Test (choice B), used in the adult, mainly reflects verbal skills and consequently would miss large portions of this man's situation. The Vineland Adaptive Behavior Scale (choice C) assesses developmental and social functioning, not cognitive and neuro-sensory abilities. The Wechsler Adult Intelligence Scale (choice D) confines its results to intelligence assessment and does not assess more basic issues like aphasia and neuro-sensory skills. The Wide Range Achievement Test (choice E) assesses academic achievement only.

26>The correct answer is B. The reaction was precipitated by a stressful event that would cause anyone to experience a severe and intense emotional response. The symptoms occurred within 3 months of the event and lasted for less than 6 months after the trauma, all corresponding to the diagnosis of adjustment disorder with mixed anxiety and depressed mood. Acute stress disorder (choice A) and post-traumatic stress disorder (choice E) both require that the person reexperience the traumatic event in wakeful or dream states and the presence of dissociative symptoms. This is not a major depressive disorder (choice C) because her symptoms are not of psychotic proportion and there is a clear precipitating stimulus. Panic disorder without agoraphobia (choice D) is incorrect because the panic episodes are uncued and not the response to an environmental stressor.

27>The correct answer is D. The patient has acute prostatitis, which is characterized by fever, chills, and dysuria, with a swollen, extremely tender prostate on rectal exam. The urine Gram's stain and culture will generally be positive. The treatment regimen for this bacterial infection is typically a 21-day course of ampicillin, a fluoroquinolone, or

sulfamethoxazole/trimethoprim (SMX-TMP). G-6-PD deficiency is an X-linked recessive disorder affecting 10% to 15% of American black males. The medications most commonly associated with the induction of hemolytic anemia in deficient patients are sulfonamides, nitrofurantoin, dapsone, primaquine, and quinine. The sulfamethoxazole in the SMX-TMP combination is a sulfonamide, and can produce hemolytic anemia in patients with G-6-PD deficiency. Ampicillin (choice A) is a broad-spectrum penicillin antibiotic commonly used in the treatment of infections in the genitourinary, respiratory, or GI tracts, as well as in the skin and soft tissues. Cefaclor (choice B) is a second-generation cephalosporin indicated for a variety of bacterial infections, including those of the respiratory and GI tracts. Ciprofloxacin (choice C) is a fluoroquinolone commonly used in the treatment of serious infections caused by gram-negative organisms. Tetracycline (choice E) is most commonly used in the treatment of acne vulgaris and gonococcal infections.

28>The correct answer is E. Testicular feminization is a disorder of the androgen receptor. Phenotypically, the patient appears female, but has a blindly ending vagina and lacks a uterus or other female internal reproductive organs. The patient has an XY genotype. Since the gene for testes determining factor (TDF) is on the Y chromosome, TDF will cause the indifferent gonad to develop into a testis containing Sertoli cells. Sertoli cells at this stage will secrete MIF, a substance that suppresses the paramesonephric ducts, preventing the formation of female internal reproductive organs. This patient would not have a streak ovary (choice A), a finding in Turner's syndrome that is associated with a 45,XO genotype. In fact, the patient would have testes, since the genetic complement contained a Y chromosome. The testes in individuals with testicular feminization syndrome are often undescended and are usually removed surgically. This patient would not possess a uterus (choice B) or an oviduct (choice C). Both of these structures are derived from the paramesonephric duct, which is suppressed by MIF. Depressed levels of testosterone (choice D) would not occur in this patient. In fact, individuals with testicular feminization syndrome have normal or even slightly elevated levels of testosterone. The development of female external genitalia is the result of defective androgen receptors, not depressed levels of testosterone.

29>The correct answer is A. The right lymphatic duct drains the right arm, the right side of the chest, and the right side of the head. The thoracic duct drains the rest of the body. Both the right lymphatic duct and the thoracic duct dump into the large venous channels at the base of the neck. Occlusion of this drainage can produce intractable edema in sites feeding these ducts. The left side and right leg would be affected, rather than the right side and left leg (choice B). The entire left side (rather than just the left arm, choice C) and right leg drain into the thoracic duct. The right arm and the right half of the head (choices D and E) drain to the right lymphatic duct.

30>The correct answer is A. This is a classic presentation of a pulmonary abscess. Chronic courses with less severe symptoms (with intermittent improvement following short courses of antibiotics) are also sometimes seen, particularly if the diagnosis was not suspected. Chest xray typically shows pneumonic opacification in which a cavity, often with a fluid level, is visible. Pulmonic abscesses can be caused by anaerobes (most common, particularly if aspiration initiated the abscess), gram-negative aerobic bacilli, and Staphylococci. Therapy is based on the organisms isolated, and should be continued for at least 4 to 6 weeks. In cases that fail to resolve, the possibility of coexisting carcinoma should be considered. Choice B is the x-ray appearance of pleural effusion. Choice C is the x-ray appearance of lobar pneumonia. Choice D is the x-ray appearance of bronchopneumonia. Choice E is the x-ray appearance of bronchiectasis.

31>The correct answer is C. The corpus luteum secretes estrogens, progesterone, and relaxin. hCG, secreted by the syncytiotrophoblast lining the placental villi, maintains the corpus luteum during the first trimester of pregnancy. Antidiuretic hormone (vasopressin; choice A) does not play a significant role during pregnancy. FSH (choice B) acts on granulosa cells to promote the conversion of androstenedione to estradiol. LH (choice D) acts on theca cells to promote androstenedione secretion. Progesterone (choice E) is important for maintaining the pregnancy, however, it does not act to maintain the corpus luteum.

32>The correct answer is C. The boy probably has Klinefelter's syndrome (47, XXY), which has the typical presentation described in the question. The condition arises as a result of failure of separation (nondisjunction) of the sex chromosomes, and can be related to either paternal nondisjunction (slightly more common) or maternal nondisjunction. Deletions (choice A) are a common form of genetic disease and contribute to many genetic recessive diseases. Examples of nondisjunction of autosomes (choice B) include trisomies such as most cases of Down's syndrome (trisomy 21), Edwards' syndrome (trisomy 18), and Patau syndrome (trisomy 13). There are two types of translocations: non-Robertsonian (choice D) and Robertsonian (choice E). Non-Robertsonian (reciprocal) translocations result when two non-homologous chromosomes exchange genetic material. Robertsonian translocations are a special type of translocation that involve exchange of genetic material from the long arms of one acrocentric chromosome to the long arms of another acrocentric chromosome, with fusion of the centromeres. Four percent of cases of Down's syndrome are caused by this mechanism.

33>The correct answer is E. A femoral hernia exits the abdominal cavity through the femoral ring to enter the femoral canal. The femoral ring is bounded medially by the lacunar ligament. Compression of the herniated intestine against the sharp edge of the lacunar ligament may cause strangulation of the intestine. The other borders of the inguinal ring are the inguinal ligament anteriorly, the pubis posteriorly, and the femoral vein laterally.

The femoral artery (choice A) is within the femoral sheath along with the femoral hernia, but is lateral to the femoral vein, which separates the artery from the hernia. The femoral nerve (choice B) is not inside of the femoral sheath, but is lateral to the sheath. The femoral vein (choice C) is lateral to the femoral canal within the femoral sheath. The inferior epigastric artery (choice D) is not related to a femoral hernia. This artery is on the anterior abdominal wall and passes immediately medial to the deep inguinal ring. Indirect inguinal hernias pass lateral to this artery and direct inguinal hernias pass medial to this artery.

34>The correct answer is B. The border modification consists of cilia on the surface of pseudostratified columnar epithelium. Cilia are shorter than stereocilia and usually appear bent or wavy in sections. Kartagener's syndrome is one type of immotile cilia syndrome in which the dynein arms of microtubules are missing or defective. Thus, cilia cannot move properly and all functions associated with them are affected (mucous sweeping or ciliary elevator functioning, sperm motility, embryonic cell movement, etc.). The result is infertility, situs inversus, bronchiectasis and/or sinusitis. Implantation (choice A) is not affected in patients with Kartagener's syndrome. The fertilized ovum can still reach the endometrium and implantation can occur. Also, this is not a section of the uterine tube; the uterine tube has a simple columnar epithelium with peg cells (secretory) and ciliated cells. The border modification consists of cilia, not microvilli and the specimen is not a section of the intestine, therefore malabsorption (choice C) is incorrect. Both the small and large intestine have a simple columnar epithelium with microvilli. Microvilli are upright and irregular and resemble a "flat top" haircut across the top of cells. Disaccharidases (choice D) are present in the cell membrane of microvilli. Deficiencies in digestion occur with the loss of microvilli.

35>The correct answer is D. While not of major medical concern, urine color changes as a result of medications can be very distressing to patients. These changes are consequently worth learning so that you can warn patients when you prescribe the medicine. Rifampin is a safe drug that is used both for prophylaxis and for active tuberculosis therapy. In addition to discoloring urine, rifampin and its metabolites can discolor feces, saliva, sweat, and tears (and apparently can stain soft contact lenses). Ethambutol (choice A) is an antituberculosis agent that is added if isoniazid-resistance is suspected and does not alter urine color. Isoniazid (choice B) remains the principle antituberculosis agent and does not alter urine color. Pyridoxine (choice C) is used principally in prophylaxis against tuberculosis and does not alter urine color. Streptomycin (choice E), which must be given intramuscularly, is sometimes used as an adjunctive agent very early in antituberculosis therapy and has sometimes been lifesaving in critically ill patients. It does not cause a urine color change.

36>The correct answer is B. This question illustrates an important strategy: knowing what you're looking for before you consider the answer choices. If you thought about the answer before considering the choices, this question was very straightforward and simple. If, on the

other hand, you considered each answer choice in turn, you no doubt got pretty confused and wasted a lot of precious test time. The first thing to remember is that nephrotic syndrome is defined as proteinuria (over 3.5 gm/day) with concurrent hypoalbuminemia and hyperlipidemia. The loss of protein in the urine results in a decreased oncotic pressure in the vascular space (decreased pc). This decrease in capillary oncotic pressure promotes movement of fluid into the interstitium and the development of edema. This is also the cause of edema in patients with liver disease. Decreased interstitial oncotic pressure (pi; choice D) would actually promote the movement of fluid into the vasculature; it would not lead to edema. The same thing would occur with decreased capillary hydrostatic forces (Pc; choice A). While decreased interstitial hydrostatic pressure (Pi; choice C) would lead to edema, it is not the mechanism of action in nephrotic syndrome. While increased capillary hydrostatic pressure (choice E) does lead to edema, it is not the mechanism at work in nephrotic syndrome. It is, however, the mechanism of edema in the setting of congestive heart failure (increased capillary hydrostatic pressure due to inefficient pumping of the heart, leading to pooling) and in glomerulonephritis (increased intravascular volume due to inefficient excretion by the kidney). Increased capillary oncotic pressure (choice F) would not lead to edema. Increased interstitial hydrostatic pressure (choice G) would not lead to edema. Increased interstitial oncotic pressure (choice H) would cause edema, but not in the setting of nephrotic syndrome. Instead, this is the mechanism of edema (typically localized) in the setting of burns and inflammation (increased capillary permeability allows protein to leak into interstitium and increase oncotic pressure).

37>The correct answer is D. Looking at the coding segment of the normal b-gene of hemoglobin, one should read the information codon by codon, as follows: AAG UAU CAC UAA GCU CGC 1 2 3 4 5 6 The normal b-globin gene has a stop codon (UAA) at the 4th position, therefore the last 2 codons (GCU and CGC) are not translated and do not code for amino acid residues found in the protein. Comparing this information to the coding segment of the mutated b-gene of hemoglobin Cranston, one would notice the following: AAG AGU AUC ACU AAG CUC GCU UUC ...UAU UAA 1 2 3 4 5 6 7 8 ...etc The insertion of two base pairs (AG) results in a frameshift mutation that eliminates the stop codon at position 4, thereby causing the addition of amino acids normally not translated in the hemoglobin b-chain of the child. Since the chain is now too long, this destabilizes the tetrameric conformation of hemoglobin. A frameshift mutation resulting in deletion of several amino acids (choice A) is wrong, since such a mutation would have inserted a stop codon (UAA, UGA or UAG) before position 4. A mutation in the stop codon (choice B) would have resulted in a longer-than-normal bglobin gene, but the information given does not indicate any changes in the stop codon at position 4. Interestingly, a chain elongation by mutation in the stop codon exists and is known as hemoglobin Constant Spring, affecting the a-chain of hemoglobin. A point mutation (choice C) is the result of a single base pair change, which is not the case here. A point mutation resulting in the insertion of a new stop codon is called a nonsense mutation, and it would result in a shorter-than-normal protein. A two base pair deletion (choice E) is not evidenced by the coding sequence given in the stem. It would also cause a frameshift in the reading frame with the possible result of a longer or shorter protein, most likely with abnormal function due to the change in primary structure (amino acid sequence).

Strategy note: Since the hemoglobin Cranston b-chain is clearly longer than the normal bchain, choices A, C, and E, which would produce a shorter chain, can be eliminated immediately.

38>The correct answer is B. The drawing depicts the histology of the small intestinal villus and crypts. The arrow points to a Paneth cell. Paneth cells are unique to the small intestine. They are found at the base of the crypts of Lieberkühn in the small intestinal villi, and have many secretory granules that contain enzymes with bactericidal activity. The enteroendocrine cells of the stomach produce low-molecular weight polypeptides (choice A). There are no lipase-secreting cells in the small intestine (choice C). Lipases are secreted by cells in the salivary glands, stomach, and exocrine pancreas. So, even if you did not know that the arrow pointed to Paneth cells, you should have eliminated this choice based on the fact that the small intestine does not secrete lipase. The goblet cells of the small intestinal villi are responsible for producing protective glycoproteins called mucins (choice D). After secretion, they are hydrated and become a mucous layer that protects the intestinal epithelium. There are many goblet cells depicted in this figure, but they are not located at the bases of the crypts. Pepsinogen (choice E) is secreted by the chief cells of the stomach.

39>The correct answer is D. Many people who request physician-assisted suicide have one of two conditions present: either a poorly controlled painful condition or severe depression. If the painful condition is adequately treated or the depression is brought under good medical control, the request for physician assistance in terminating the situation is typically withdrawn. It is important to note that bringing these conditions under control requires the intervention of caregivers who are specifically trained in the management of these two conditions; primary care physicians usually are not adequately trained to address these difficult presentations. While patients who are diagnosed as bipolar disorder (choice A), borderline personality disorder (choice B), and schizophrenic disorder (choice E) often make suicide attempts (and frequently complete those attempts), they do not generally ask their physician for assistance in the suicide. Persons with factitious disorder (choice C) are seeking primary gain, often for dependency needs, and are seeking to enter the "sick role" not the "dead role.

40>The correct answer is B. First, eliminate all answers in which Drug X does not produce an increase in blood pressure (BP). Choice A should be eliminated because acetylcholine stimulates the noninnervated muscarinic (M3) receptors that are located on endothelial cells of the vasculature. Stimulation of these receptors releases endothelial-derived relaxing factor (EDRF; nitric oxide), which produces a relaxation of the neighboring smooth muscle cells, leading to a decrease in BP. Choice C should be eliminated because isoproterenol (a nonspecific beta agonist) decreases BP by stimulating beta-2 receptors in the vasculature. Epinephrine, norepinephrine, and phenylephrine all increase BP, so the remaining answers must be eliminated by examining the effects of Drug Y on Drug X. Start with choice B: Epinephrine is an agonist at alpha-1, alpha-2, beta-1, and beta-2 receptors; phentolamine is an antagonist at alpha-1 and alpha-2 receptors. Therefore, after the administration of phentolamine, epinephrine can stimulate only beta receptors, which would produce a decrease in BP. Epinephrine is now acting like isoproterenol. This is called epinephrine reversal (the name stems from the fact that epinephrine originally increases BP and then

produces the opposite effect after phentolamine administration). Therefore, choice B is correct. Choice D: Norepinephrine is an agonist at alpha-1, alpha-2, and beta-1 receptors; propranolol is a nonselective beta antagonist. After administration of propranolol, norepinephrine can stimulate only alpha receptors, which will still cause vasoconstriction (primarily via alpha-1 stimulation in the vasculature) and therefore increase BP. Choice E: Phenylephrine is an alpha-1 agonist; hexamethonium is a nicotinic ganglionic blocker. Hexamethonium administration would be predicted to eliminate the baroreceptor response after the second phenylephrine administration by blocking the peripheral ganglia. However, phenylephrine will still reach the alpha-1 receptors on the vasculature to produce an increase in blood pressure.

41>The correct answer is A. Bilirubin is a degradative product of hemoglobin metabolism. Bilirubin (pigment) stones are specifically associated with excessive bilirubin production in hemolytic anemias, including sickle cell anemia. Bilirubin stones can also be seen in hepatic cirrhosis and liver fluke infestation. Calcium oxalate stones (choice B) and cystine stones (choice E) are found in the kidney, rather than the gallbladder. Pure cholesterol stones (choice C) are less common than mixed gallstones, but have the same risk factors, including obesity and multiple pregnancies. Mixed stones (choice D) are the common "garden variety" gallstones, found especially in obese, middle aged patients, with a female predominance.

42The correct answer is C. The probable organism is Giardia lamblia, which characteristically infects the small intestine. When seen in smears from duodenal aspirates, this flagellated organism has a characteristic "face-like" appearance. However, in biopsy specimens, the organism is often caught at an angle, and the characteristic appearance and location is as described in the question stem. Giardia is a common contaminant of water supplies (even in the United States), and patients who ingest the cysts may be asymptomatic or may occasionally develop prolonged diarrhea or intestinal malabsorption. Some patients with severe disease have low serum IgA or low overall immunoglobulin levels. Entamoeba histolytica (choice A) usually infects the large intestine and/or liver. Escherichia coli (choice B) is a bacterial cause of diarrhea. Naegleria fowleri (choice D) causes meningoencephalitis. Trichomonas vaginalis (choice E) causes vaginitis.

43The correct answer is A. The spinal cord arises from the caudal end of the neural tube. During development, an alar and a basal plate is formed, separated by a longitudinal groove called the sulcus limitans (choice E). The alar plate forms the dorsal (posterior) part of the spinal cord and becomes the sensory or afferent portion of the cord. The basal plate (choice B) is the ventral (anterior) part of the cord, and becomes the motor, or efferent, portion of the spinal cord, and therefore would contain anterior horn cells. The neural crest (choice C) develops into multipolar ganglion cells of autonomic ganglia, pseudounipolar cells of spinal and cranial nerve ganglia, leptomeningeal cells, Schwann cells, melanocytes, chromaffin cells of the adrenal medulla, and odontoblasts. The brain forms from the rostral end of the neural tube (choice D).

44>The correct answer is C. While the third-week embryo is a primitive trilaminar plate, in the fourth week, the heart begins to form and begins beating almost immediately. Hematopoiesis occurs in the yolk sac, and a primitive circulatory system connects the capillary plexuses of the yolk sac and chorion to the embryo. Partitioning of the atrium also begins in the fourth week. During the fifth week, cardiac septa form and the atrioventricular (AV) cushions fuse. By the sixth week, the heart is close to fully formed. This early sequence for the heart explains why it is so difficult to try to prevent congenital malformations of the cardiovascular system from occurring, since the mother of a 6-week-old fetus is only about 8 weeks from her last menstrual period, and may have assumed that she just "missed a period" (a very common phenomenon) for reasons other than pregnancy.

45>The correct answer is C. Laryngeal cartilages (e.g., the thyroid, cricoid, arytenoid cartilages) are derived from neural crest. The endothelial cells (choice A) in the simple squamous epithelium that lines the pulmonary capillaries are derived from visceral mesoderm. The epithelial lining of primary bronchi (choice B) is derived from endoderm. Tracheal glands (choice D) and epithelium both derive from endoderm. Type I pneumocytes (choice E) are derived from endoderm.

46The correct answer is C. The muscularis of the upper third of the esophagus (choice E) is composed entirely of striated muscle. The middle third (choice C) contains both striated and smooth muscle. The lower third (choice B) and lower esophageal sphincter (choice A) contain only smooth muscle. There is no such thing as the upper esophageal sphincter (choice D).

47>The correct answer is D. The cells of the anterior pituitary can be classified as chromophils (love dyes) or chromophobes (do not stain with dyes). The chromophils can be further divided into acidophils (stain with acidic dyes) and basophils (stain with basic dyes). The acidophils include the somatotropes, which secrete growth hormone, and the mammotropes, which secrete prolactin. The basophils include the corticotropes, which secrete ACTH (choice A), the gonadotropes, which secrete FSH and LH (choices B and C), and the thyrotropes, which secrete TSH (choice E).

48>The correct answer is E. The disease is myotonic dystrophy, which is an autosomal dominant disease; the affected gene has been localized to chromosome 19. Myotonic dystrophy is relatively common and is best thought of as a systemic disease, since it causes cataracts, testicular atrophy, heart disease, dementia, and baldness in addition to muscular weakness. A mutation on the X chromosome (choice A) causes Duchenne muscular dystrophy. None of the muscle diseases are known to be related to defects on the Y chromosome (choice B). Facioscapulohumeral dystrophy is associated with a defective gene on chromosome 4 (choice C). Infantile hypotonia has been related to defective genes on chromosome 5 (choice D).

49>The correct answer is E. Urinary tract infections are the most common bacterial infections encountered during pregnancy, and Escherichia coli is the most commonly isolated organism. 70% of cases in the U.S. are caused by P pili-positive strains. Bundle-forming pili (choice A) are found in enteroaggregative E. coli (EAEC). GVVPQ fimbriae (choice B) are found in EAEC. Heat labile toxins (choice C) are pathogenic factors in enterotoxic strains (ETEC). Heat stable toxins (choice D) are pathogenic factors in ETEC or EAEC. Type 1 pili (choice F) are a major pathogenic factor in ETEC.

50>The correct answer is E. The baby probably has congenital hypertrophic pyloric stenosis, which usually presents at several weeks of age. Partial surgical incision through the pylorus (pyloromyotomy) is usually curative. Antacids (choice A) are beneficial in esophageal reflux and peptic ulcer disease. Barium enema (choice B) can reverse intussusception in a child, but would not be therapeutic in this case. Gastric resection (choice C) is not indicated, since the much less invasive procedure of pyloromyotomy is actually more effective. Oral antibiotics (choice D) are not indicated, since this is not an infectious process. <1>A 37-year-old female presents to the emergency room with a fever. Chest x-ray shows multiple patchy infiltrates in both lungs. Echocardiography and blood cultures suggest a diagnosis of acute bacterial endocarditis limited to the tricuspid valve. Which of the following is the most probable etiology? A. Congenital heart disease B. Illicit drug use C. Rheumatic fever D. Rheumatoid arthritis E. Systemic lupus erythematosus Answer

<2>Which of the following is the primary opsonin in the complement system? A. B. C. D. E. Answer C1q C3b C5 C5a Factor B

<3>A patient is referred to a neurologist because of ataxia. Neurological examination reveals a loss of proprioception and a wide-based, slapping gate Magnetic resonance imaging reveals degeneration of the dorsal columns and dorsal roots of the spinal cord. Which of the following organisms is most

likely to have caused this pattern of damage? A. B. C. D. E. Haemophilus influenzae Herpes simplex I Neisseria gonorrhoeae Neisseria meningitidis Treponema pallidum

Answer

<4>A 24-year-old woman in her third trimester of pregnancy presents with urinary frequency and burning for the past few days. She denies fever, nausea, vomiting, or chills. She takes no medications besides prenatal vitamins and is generally in good health. Physical examination is remarkable for mild suprapubic tenderness, and a urine dipstick is positive for white blood cells, protein, and a small amount of blood. Culture produces greater than 100,000 colonies of gram-negative bacilli. Which of the following attributes of this uropathogenic organism is most strongly associated with its virulence?

A. B. C. D. E. F.

Bundle-forming pili GVVPQ fimbriae Heat labile toxins Heat stable toxins P pili Type 1 pili

Answer

<5>A previously healthy 11-year-old girl develops a gastrointestinal infection with cramping and watery stools. After several days, she begins to pass blood per rectum, and is hospitalized for dehydration. In the hospital, she is noted to have decreasing urine output with rising blood urea nitrogen (BUN). Total blood count reveals anemia and thrombocytopenia, and the peripheral smear is remarkable for fragmented red cells (schistocytes). Infection with which of the following bacterial genera is most likely responsible fo r this syndrome?

A. B. C. D. E.

Campylobacter Clostridium Salmonella Shigella Vibrio

Answer

<6>Five days after returning to his military base in South Carolina after survival training in the nearby countryside, an 18-year-old recruit reports to the infirmary complaining of a headache. Physical examination reveals a fever, but no other abnormalities are noted. A few days later he returns to the infirmary with a maculopapular rash involving the hands and feet. The rash then spreads centripetally to involve the trunk. Which of the following diseases should be suspected?

A. B. C. D. E.

Chickenpox German measles Measles Mumps Rocky Mountain spotted fever

Answer

<7>A 32-year-old, blood type A positive male receives a kidney transplant from a blood type B positive female donor with whom he had a 6-antigen HL A match. Once the kidney is anastomosed to the man's vasculature, the transplant team immediately begins to observe swelling and interstitial hemorrhage. After the surgery, the patient developed fever and leukocytosis and produced no urine. Which of the following is the most likely explanation? A. Acute rejection due to antibody-mediated immunity B. Acute rejection due to cell-mediated immunity C. Chronic rejection due to cell-mediated immunity to minor HLA antigens D. Hyperacute rejection due to lymphocyte and macrophage infiltration E. Hyperacute rejection due to preformed ABO blood group antibodies

Answer

<8>A sexually active 18-year-old woman presents with a fever of 102 F for the past 24 hours and lower abdominal pain and anorexia for the past 5 days. On physical examination, there is generalized tenderness of the abdomen, and the cervix is erythematous with motion tenderness. There is no rash nor any lesions on the external genitalia. A smear of the odorless cervical discharge contains sloughed epithelial cells and scant

neutrophils. Which of the following would likely be found in the exudate?

A. B. C. D. E. F. G. H.

A naked, icosahedral double-stranded circular DNA virus Iodine-staining intraepithelial inclusion bodies Intraneutrophilic gram-negative diplococci Intranuclear "owl's eye" inclusion bodies Lactose-fermenting gram-negative bacilli Pear-shaped flagellated protozoa Pleomorphic, gram-negative rods Spirochetes on dark-field microscopy

Answer

<9>A 45-year-old homeless man has a chronic cough, a cavitary lesion of the lung, and is sputum positive for acid-fast bacilli. Which of the following is the principle form of defense by which the patient's body fights this infection?

A. B. C. D. E.

Antibody-mediated phagocytosis Cell-mediated immunity IgA-mediated hypersensitivity IgE-mediated hypersensitivity Neutrophil ingestion of bacteria

Answer

<10>A 15-year-old girl in a rural community has swollen, painful lymph nodes in her right axilla. Physical examination reveals multiple scratches on her right arm with a papule associated with one of the scratch marks. She states that the scratches occurred about 5 days ago. What type of animal is the most likely source of the infection?

A. B. C. D. E.

Cat or kitten Chicken Dog or puppy Horse Parrot

Answer

<11>A 38-year-old AIDS patient presents to the clinic complaining of nausea, occasional vomiting and "bumps" on his groin. On physical examination, multiple, nontender, pedunculated reddish purple nodules in the inguinal and perirectal areas are observed. The patient's liver is palpable 8 cm below the right costal margin. Routine laboratory tests are unremarkable except for an alanine aminotransferase level of 58 and alkaline phosphatase of 90. He denies any foreign travel, but has two pet cats . Which of the following is the most likely cause of this patient's infection?

A. B. C. D. E. Answer

Bartonella henselae Human papillomavirus Molluscum contagiosum virus Rickettsia prowazekii Treponema pallidum

<12>A 49-year-old Vietnamese man is diagnosed with tuberculosis. On physical examination, large flocculent masses are noted over the lateral lumbar back , and a similar mass is located in the ipsilateral groin. This pattern of involvement strongly suggests an abscess tracking along the A. adductor longus B. gluteus maximus C. gluteus minimus D. piriformis E. psoas major

Answer <13>A 25-year-old man presents with a high fever and generalized malaise. His condition deteriorates so rapidly that his friends decide to take him to the emergency department 24 hours after the onset of symptoms. He has a history of intravenous drug abuse. A test for anti-HIV antibodies is negative. Physical examination reveals a systolic murmur, and echocardiography shows bulky vegetations attached to the tricuspid valve leaflets. Which of the following microorganisms will be most likely be isolated from this patient's blood cultures? A. Candida albicans B. Hemophilus influenzae C. Staphylococcus aureus D. Staphylococcus epidermidis E. Viridans (a-hemolytic) streptococci Answer

<14>A 23-year-old man develops explosive watery diarrhea with blood, fecal leukocytes, and mucus approximately 3 days after eating chicken that was improperly cooked. Comma-shaped organisms were found in the fecal smea r along with red blood cells and leukocytes. Which of the following pathogens is the most likely cause of these symptoms? A. Campylobacter jejuni B. Enterotoxigenic E. coli C. Shigella sonnei D. Staphylococcus aureus E. Vibrio cholera Answer

<15>An otherwise healthy 3-year-old child is brought to the pediatrician with umbilicated, flesh-colored papules on his trunk. This condition is related to infection with which of the following viruses? A. Cytomegalovirus B. Herpesvirus 6 C. Parvovirus D. Poxvirus E. Variola Answer

<16>A 47-year-old male presents with declining renal function characterized by oliguria, elevated blood urea nitrogen and creatinine, and hematuria . He also complains of nasal congestion and epistaxis. Review of systems is notable for occasional cough and hemoptysis. Examination shows mucosal ulceration and nasal septal perforation, but no polyps. Which of the following serum markers would likely be present in this case? A. Anti-centromere antibody B. Anti-Ro C. Anti-SS-B D. c-ANCA (cytoplasmic antinuclear cytoplasmic antibody) E. Decreased erythrocyte sedimentation rate (ESR) Answer

<17>A child with sickle cell anemia is seen in a hematology clinic. Her mother states that she has been feeling very tired lately, and may have "come down with a virus." On physical examination, the girl is very pale, and a complete blood count shows severe anemia. A bone marrow aspirate contains no erythroid precursor cells. The girl was probably infected with which of the following viruses? A. Coxsackie virus B. Echovirus C. Hepadnavirus D. Herpes virus E. Parvovirus Answer

<18>Zygomycosis, a destructive fungal infection of the sinuses, is likely to reach the brain by which of the following routes? A. Cavernous sinus B. External carotid artery C. Internal carotid artery D. Superior sagittal sinus E. Superior vena cava Answer

<19>A newborn in the neonatal intensive care unit becomes tachypneic and irritable. Blood cultures grow a gram-positive coccus in chains that is presumed to be a streptococcus. Which of the following characteristics would help to differentiate Streptococcus agalactiae from Streptococcus pneumoniae? A. Alpha-hemolysis B. Carbohydrate capsule C. Cytochrome enzyme system D. Growth in bile E. Oxacillin sensitivity Answer

<20>A 16-year-old girl presents with a painlessly enlarged lymph node in her right axilla. Peripheral blood counts are within normal limits. The lymph node is biopsied, and numerous granulomas filled with neutrophils and necrotic debris are observed. Which of the following organisms could produce this disease? A. Bartonella henselae B. Borrelia burgdorferi C. Chlamydia psittaci D. Coxiella burnetii E. Rickettsia prowazekii Answer

<21>A 36-year-old mother of two children presents with a 4-day history of swollen, painful hands. Her wrists and metacarpophalangeal joints are boggy and inflamed bilaterally. Her 5-year-old son had been sent home from school approximately 3 weeks previously with red cheeks and a blotchy rash on his torso. What is the most likely diagnosis? A. Listeriosis B. Lyme disease C. Mumps D. Parvovirus E. Reiter's syndrome Answer

<22>A 37-year-old, intravenous drug-abusing male presents with fever and chills. Blood cultures are positive for Staphylococcus aureus. He develops central nervous system symptoms, and a cerebral abscess is suspected. Which part of the brain is most often affected by septic emboli in patients with infective endocarditis? A. Brainstem B. Cerebellum C. Frontal lobe D. Occipital lobe E. Parietal lobe Answer

<23>Which of the following organisms is the most common cause of community-acquired pneumonia? A. Chlamydia pneumoniae B. Haemophilus influenzae C. Mycoplasma pneumoniae D. Staphylococcus aureus E. Streptococcus pneumoniae Answer

<24>One week following a visit to the woods along an Eastern seaboard beach, a 50-year-old woman develops fever, headache, chills, and fatigue. A blood smear demonstrates protozoa within erythrocytes. Which of the following is the most likely pathogen? A. Babesia microti B. Leishmania donovania C. Plasmodium falciparum D. Plasmodium vivax E. Trypanosoma cruzi Answer

<25>A 20-year-old female presents with a two day history of dysuria and increased urinary frequency. She states that she was recently married and was not sexually active prior to the marriage. Physical exam reveals a temperature of 100.7 °F with normal vital signs. Gynecological exam reveals no evidence of discharge, vaginitis, or cervicitis. Urinalysis reveals 14 white blood cells per high-powered field with many gram-negative rods. The most appropriate therapy would be A. ampicillin B. ceftriaxone C. fluconazole D. gentamicin E. metronidazole Answer

<26>An active intravenous drug abuser presents to the emergency department

with fever of 5 days' duration, a cough occasionally productive of blood, and pleuritic chest pain. Petechiae are present in his mouth and conjunctivae, and splinter hemorrhages are visible under the fingernails. Which of the following test results would most likely confirm the identity of the causative agent? A. Antibodies to p24 capsid antigen B. Antibodies to Trichinella spiralis antigen C. Blood culture of a catalase-positive, novobiocin-sensitive, gram-positive coccus D. Blood culture of a coagulase-positive, catalase positive, gram-positive coccus E. agar F. G. Answer Blood culture of an alpha-hemolytic, optochin-resistant, gram-positive coccus Blood culture of an alpha-hemolytic, optochin-sensitive, gram-positive coccus Blood culture of a gamma-hemolytic, gram-positive coccus on bile-esculin

<27>A 43-year-old executive presents to a physician with chronic, symmetric polyarthritis involving the knees. The man gives a history of having developed an extensive rash after a deer hunting trip in Connecticut several years earlier. He recalls that he felt "sick" at the time, and developed knee pain that prevented him from climbing stairs for several months, but then partially resolved. Which of the following organisms is most likely etiologically related to the patient's arthritis? A. Fungus B. Gram-negative cocci C. Gram-negative rod D. Gram-positive cocci E. Spirochete Answer

<28>A 34-year-old woman presents with fatigue, malaise, and swollen, tender joints. Physical examination is significant for a maculopapular eruption over sun-exposed areas, including the face. Examination of a peripheral blood smear reveals mild thrombocytopenia. Which of the following autoantibodies, if present, would be most specific for the diagnosis of the patient's disorder? A. Anti-centromere antibody B. Anti-IgG antibody C. Antinuclear antibody D. Anti-Sm (Smith antigen) antibody E. Anti-SS-A (Ro) antibody Answer

<29>A 33-year-old single mother of two young children visits her physician

because of an oral ulcer. A review of systems is significant for fatigue, myalgia, and joint pain. Laboratory results demonstrate leukopenia, and a high-titered antinuclear antibody. A speckled staining pattern due to anti-Sm is seen with immunofluorescence; urinary protein is elevated. Which of the following is the most likely diagnosis? A. Generalized fatigue B. Goodpasture's syndrome C Mixed connective tissue disease D. Scleroderma E. Systemic lupus erythematosus Answer

<30>A 67-year-old black man with a history of glucose-6-phosphate dehydrogenase (G-6-PD) deficiency presents with fever, irritative voiding symptoms, and perineal pain. Rectal examination is remarkable for a boggy, exquisitely tender prostate. A urine Gram's stain is positive for gram-negative rods. The risk for development of hemolytic anemia is highest if he receives high-dose, 21-day therapy with A. ampicillin B. cefaclor C. ciprofloxacin D. sulfamethoxazole/trimethoprim E. tetracycline Answer

<31>A patient with colorectal cancer develops septicemia complicated by endocarditis. You would expect the blood cultures to grow A. Streptococcus agalactiae B. Streptococcus bovis C. Streptococcus pneumoniae D. Streptococcus pyogenes E. Streptococcus viridans Answer

<32>A patient with a cavitary lung lesion coughs up sputum that contains thin, acid-fast positive rods. Which of the following features would most likely be associated with these bacteria? A. Nutritional requirement for factors V and X B. Streptokinase C. Toxic shock syndrome toxin D. Visible under dark field illumination E. Waxy envelope Answer

<33>A 27-year-old woman presents to the emergency department complaining of 10-12 episodes of nonbloody diarrhea per day for the past 2 days, along with severe abdominal cramps, nausea, vomiting, and a low-grade fever. She states that she just returned from a vacation to Mexico. While in Mexico, she did not drink any of the local water and ate only cooked foods and a few fresh salads. If fecal leukocytes are present, the patient should most likely be empirically treated with A. acyclovir B. ciprofloxacin C. mebendazole D. quinine E. tetracycline Answer

<34>A 54-year-old woman suffering from influenza deteriorates and develops shaking chills and a high fever. Physical examination is remarkable for dullness to percussion at the left base and decreased breath sounds on the left. Chest x-ray confirms the diagnosis of lobar pneumonia, presumed to be caused by Streptococcus pneumoniae. The patient has no known drug allergies. Which of the following antibiotics would be most appropriate to treat the patient's condition? A. Cefotaxime B. Chloramphenicol C. Erythromycin D. Penicillin E. Vancomycin Answer

<35>A 4-year-old boy is seen by his pediatrician for epistaxis. The patient has a history of multiple bacterial and viral respiratory tract infections and eczema. An uncle had similar problems. Physical examination is remarkable for multiple petechial lesions on the skin and mucous membranes. Serum IgE is increased, and platelets are decreased. Which of the following is the most likely diagnosis? A. Acquired hypogammaglobulinemia B. Ataxia telangiectasia C. DiGeorge syndrome D. Selective IgA deficiency E. Wiskott-Aldrich syndrome Answer

<36>Which of the following organisms is most likely to be implicated as a cause of urethritis that persists after antibiotic therapy for gonorrhea? A. Actinomyces

B. C. D. E. Answer

Chlamydia Mycobacteria Nocardia Rickettsia

<37>A 73-year-old woman with a history of diabetes presents with left ear pain and drainage of pus from the ear canal. She has swelling and tenderness over the left mastoid bone. Which of the following microorganisms is the most likely causative agent? A. Hemophilus influenzae B. Klebsiella pneumoniae C. Mucor sp. D. Pseudomonas aeruginosa E. Streptococcus pyogenes Answer

<38>: A 25-year-old female presents with a confluent maculopapular rash that began on her face, then spread downward over her trunk. She states that 3 days ago she started having a fever and headache, with bilateral pain associated with the front and back of her neck. She also complains of joint pain. Which of the following diseases does she most likely have? A. Infectious mononucleosis B. Lyme disease C. Roseola D. Rubella E. Rubeola Answer

<39>A 24-year-old woman presents with a 3-day history of fever, chills, chest pain, and cough productive of rust-colored sputum. Past medical history includes a splenectomy 1 year ago. A chest x-ray film indicates consolidation of the right lower lobe. Blood cultures are positive for a-hemolytic gram-positive diplococci. Immunity to the causative organism is based on A. alternative complement pathway activation B. antibody to an a-helical coiled fimbria C. IgA antibodies to C carbohydrate D. IgG antibodies to C carbohydrate E. IgG antibodies to a surface acidic polysaccharide Answer

<40>A 3-year-old male presents with a skin rash and epistaxis. He has had several, severe sinopulmonary infections. A careful history reveals that his maternal grandfather died of bleeding complications following an

emergency cholecystectomy. What additional findings are likely in this case? A. A CD4/CD8 ratio of < 1.5:1 B. Cerebellar ataxia C. Elevated platelet count and high serum IgG, IgA, and IgE levels D. Low platelet count and low serum IgG levels E. Low platelet count and low serum IgM levels Answer

<41> Which of the following characteristics most strongly suggests that the cell depicted above is a phagocytically active macrophage? A. Immunocytochemical detection of collagenase B. Microvilli-covered surface C. Presence of receptors for IgG and complement D. Presence of secondary lysosomes throughout cytoplasm E. Shape of the nucleus Answer

<42>A 27-year-old white male presents with a 3-week history of several swollen and painful toes and knees. He has a past history of conjunctivitis. He also describes some low back stiffness that is more severe in the morning. Which of the following is the most likely diagnosis? A. Gout B. Lyme disease C. Reiter's syndrome D. Rheumatoid arthritis E. Septic arthritis Answer

<43>A 1-year-old girl presents with a 2-day history of fever, vomiting, and watery, nonbloody diarrhea. On physical exam, she appears dehydrated. Which of the following best describes the most likely infecting organism? A. It has a complex double-stranded DNA genome B. It has a partially double-stranded circular DNA genome C. It has a segmented, double-stranded RNA genome D. It has a single-stranded circular RNA genome E. It has a single-stranded RNA genome Answer

<44>A 46-year-old woman visits her podiatrist to have several bunions removed from her right foot. She chooses conscious sedation rather than general anesthesia for this procedure. She is given intravenous midazolam to supplement the local anesthetics that are injected into her foot. Midway through the surgery, she suddenly becomes agitated,

combative, and exhibits involuntary movements. The anesthesiologist determines that she is having a paradoxical reaction to the midazolam and immediately administers A. flumazenil B. glucagon C. naloxone D. nitrite E. protamine Answer

<45>A 24-year-old woman attempts suicide by taking an overdose of diazepam. She is rushed to the emergency department, where the attending physician will most likely order which of the following treatments? A. Acetylcysteine B. Atropine C. Bicarbonate D. CaNa2EDTA chelation E. Deferoxamine F. Ethanol G. Flumazenil H. Physostigmine I. Pralidoxime J. Protamine Answer

<46>Which of the following enzymes is stimulated by glucagon? A. Acetyl-CoA carboxylase B. Glycogen phosphorylase C. Glycogen synthase D. HMG-CoA reductase E. Pyruvate kinase Answer

<47>A 29-year-old epileptic sanitation engineer is maintained on primidone. Ultrastructural examination of a liver biopsy reveals increased amounts of smooth endoplasmic reticulum. This change is most closely related to increases in the activity of which of the following? A. P-450 system B. Purine degradation C. Pyrimidine synthesis D. Tricarboxylic acid (Krebs) cycle E. Urea cycle Answer

<48> A pregnant southeast Asian immigrant presents for prenatal care. Her past medical history is significant for a severe illness 3 years ago characterized by fatigue, nausea, anorexia, vomiting, jaundice, joint pains, and generalized skin lesions that slowly disappeared. She has felt well recently. Which of the following laboratory tests should be ordered to investigate the patient's past illness? A. Hepatitis B surface antigen (HBsAg) B. IgG cytomegalovirus (CMV) antibody levels C. IgM antibody to HBsAg D. IgM antibody to hepatitis B core antigen E. Quantitation of hepatitis A virus (HAV) IgM antibody Answer

<49>A research scientist is studying calcium fluxes in cultured cells using confocal laser scanning microscopy. The magnitude of the signal (brightness) is proportional to the strength of the calcium flux. Stimulation of which of the following receptor types would be expected to produce the strongest signal? A. Alpha-1 adrenergic receptor B. Beta-1 adrenergic receptor C. Dopamine-1 receptor D. Muscarinic acetylcholine receptor E. Nicotinic acetylcholine receptor <50>A 10-year-old child is suspected of having pellagra because of chronic symptoms including diarrhea, a red scaly rash, and mild cerebellar ataxia. However, his diet is not deficient in protein and he appears to be ingesting adequate amounts of niacin. A sister has a similar problem. Chemical analysis of his urine demonstrates large amounts of free amino acids. Which of the following is the most likely diagnosis? A. Alkaptonuria B. Carcinoid syndrome C. Ehlers-Danlos syndrome D. Hartnup's disease E. Scurvy Answer

Answers

1>The correct answer is B. The most probable etiology of bacterial endocarditis involving the tricuspid valve is illicit intravenous drug use, which can introduce skin organisms into the venous system that then attack the tricuspid valve. Staphylococcus aureus accounts for between 60% and 90% of cases of endocarditis in intravenous drug users. The endocarditis associated with congenital heart disease (choice A) typically involves either damaged valves or atrial or ventricular septal defects. The tricuspid valve is not particularly vulnerable. Rheumatic fever (choice C) most commonly damages the mitral and aortic valves, and tricuspid damage is usually less severe and seen only when the mitral and aortic valves are heavily involved. Consequently, secondary bacterial endocarditis involving only the tricuspid valve in a patient with a history of rheumatic fever would be unusual. Rheumatoid arthritis (choice D) is not associated with bacterial endocarditis. Systemic lupus erythematosus (choice E) can produce small, aseptic vegetations on valves, but is not associated with bacterial endocarditis.

2>The correct answer is B. C3b is the most critical molecule in both the classical and alternative complement pathways. C3, the most abundant protein of all the complement proteins, is cleaved into C3a and C3b. C3b attaches to bacterial surfaces for opsonization by phagocytes. C3a binds to mast cells and basophils, activating them and producing histamine release. C1q (choice A) is a complement component in the classical pathway. It binds to the constant heavy domain of an IgG molecule that has reacted with the bacterial surface epitope. C1q is not involved in opsonization as it simply functions as an enzyme in the early complement cascade. C5 (choice C) is a protein, that once split into C5b, initiates the assembly of the membrane attack complex. This complex consists of C5b, C6, C7, C8, and polymerization of C9, and is responsible for lysis of the bacteria. C5a is a strong chemotactic molecule. This fragment is the result of C5 being split by the C5 convertases of both pathways. This C5a (choice D) is a strong chemotactic factor for neutrophils and results in stimulating the inflammatory response. Factor B (choice E) is an activator protein of the alternative pathway. It combines with C3b to form C3bBb. This C3bBb is the C3 convertase of the alternative pathway.

3>The correct answer is E. The findings described are those of tabes dorsalis, a form of tertiary syphilis caused by Treponema pallidum. Tabes dorsalis, and other forms of tertiary syphilis, are now uncommon in this country, possibly because the common use of antibiotics may "treat" many unsuspected cases of syphilis. Haemophilus influenzae (choice A) and Neisseria meningitidis (choice D) can cause meningitis. Neisseria gonorrhoeae (choice C) causes gonorrhea, which usually does not involve the CNS. Herpes simplex I (choice B) can cause an encephalitis that typically involves the frontal and temporal lobes.

4>The correct answer is E. Urinary tract infections are the most common bacterial infections encountered during pregnancy, and Escherichia coli is the most commonly isolated organism. 70% of cases in the U.S. are caused by P pili-positive strains. Bundle-forming pili (choice A) are found in enteroaggregative E. coli (EAEC). GVVPQ fimbriae (choice B) are found in EAEC. Heat labile toxins (choice C) are pathogenic factors in enterotoxic strains (ETEC). Heat stable toxins (choice D) are pathogenic factors in ETEC or EAEC. Type 1 pili (choice F) are a major pathogenic factor in ETEC.

5>The correct answer is D. This patient has developed hemolytic-uremic syndrome (HUS), a complication of the Shiga toxin or Shiga-like toxin: exotoxins released by Shigella species and the enterohemorrhagic E.coli. HUS in children usually develops after a gastrointestinal or flu-like illness, and is characterized by bleeding, oliguria, hematuria and microangiopathic hemolytic anemia. Presumably the Shiga toxin is toxic to the microvasculature, producing microthrombi that consume platelets and RBCs, and may fragment the red cell membrane. The incorrect choices are all bacteria which may produce an enterocolitis, but do not elicit HUS. A long-term consequence of Campylobacter (choice A) infection is a reactive arthritis or fullblown Reiter's syndrome. Clostridial enterocolitis is produced by Clostridium difficile (choice B), a normal inhabitant of the gut that produces pseudomembranous colitis when other gut flora are suppressed by treatment with antibiotics. In the United States, Salmonella infections (choice C) are almost all non-typhoid inflammatory diarrhea, producing a simple enterocolitis that may proceed to sepsis in some cases. Typhoid fever (produced by Salmonella typhi and S. paratyphi) produces a protracted illness that progresses over several weeks and includes rash and very high fevers, but not HUS. Vibrio (choice E) infections produce copious amounts of watery diarrhea, and the major risk of cholera and other Vibrio enteritides is shock due to hypovolemia or electrolyte loss.

6>The correct answer is E. Take rashes involving the palms and soles (otherwise unusual sites) very seriously: only a small number of infections can cause this pattern, including Rocky Mountain spotted fever, meningococcemia, and secondary syphilis. Rocky Mountain spotted fever is caused by the rickettsia R. rickettsii, and is found throughout the United States, particularly in south central and eastern portions (not the Rocky Mountains). 3-12 days after a tick bite, patients develop malaise, frontal headache, and fever. Several days later, the rash described in the question stem develops. Other manifestations can include hepatosplenomegaly, thrombocytopenia, and (potentially fatal) disseminated intravascular coagulation. Chickenpox (choice A), or varicella, is characterized by maculopapules that evolve into vesicles over hours to days, then eventually form crusts. Typical lesions first appear on the trunk and face and rapidly spread to involve other areas. The maculopapular rash of German measles (choice B), or rubella, usually begins on the face, then spreads down the body. Although the maculopapular rash of measles (choice C), or rubeola, can include the palms and soles, it typically begins along the hairline in frontal and temporal regions, then spreads down the trunk to the limbs. Mumps (choice D) is characterized by fever, malaise, parotitis, and orchitis, but not a rash.

7>The correct answer is E. The patient is suffering from hyperacute rejection due to the preformed anti-B ABO blood group antibody found in all type A positive individuals. Hyperacute rejection occurs within minutes to a few hours of the time of transplantation, and is due to the destruction of the transplanted tissue by preformed antibodies reacting with antigens found on the transplanted tissue that activate complement and destroy the target tissue. Preformed antibodies can also be due to presensitization to a previous graft, blood transfusion, or pregnancy. Acute rejection due to antibody-mediated immunity (choice A) is incorrect because this patient suffered from hyperacute rejection (immediate) occurring within minutes to hours, rather than days. Acute rejection due to cell-mediated immunity (choice B) will not occur until several days or a week following transplantation. Acute rejection is due to type II and type IV reactions. Chronic rejection, due to the presence of cell-mediated immunity to minor HLA antigens (choice C), occurs in allograft transplantation months to even years after the transplant. Chronic rejection is generally caused by both humoral and cell-mediated immunity. An accelerated acute rejection, occurring in 3-5 days, can be caused by tissue infiltration and destruction by presensitized T lymphocytes and macrophages (choice D) and/or antibodydependent, cell-mediated cytotoxicity (ADCC). Note that this is not a hyperacute reaction.

8>The correct answer is B. The presentation is typical for pelvic inflammatory disease (PID). Chlamydia trachomata (serotypes D-K) is the most common bacterial cause of sexually transmitted disease (STD) in this country and is the most likely agent on the list to produce the symptoms described. It is an ATP-defective organism that must therefore live intracellularly in the human host and can be visualized inside epithelial cells with iodine, Giemsa, or fluorescent-antibody stains. The remainder of the answer choices refer to other agents that could be found in the female genital tract, either by sexual transmission or by contamination with fecal flora, but they are not the best choices. A naked, icosahedral double-stranded circular DNA virus (choice A) refers to human papilloma virus, which is the most common cause of STDs in the U.S., but presents with anogenital warts. Intraneutrophilic gram-negative diplococci (choice C) refers to Neisseria gonorrhoeae, which would be expected to present with dysuria and neutrophilic exudate. Intranuclear "owl's eye" inclusion bodies (choice D) refers to cytomegalovirus, a common STD in the United States, but not a common agent of PID. Most cases in average adults are manifested by mononucleosis-like symptoms. Lactose-fermenting gram-negative bacilli (choice E) would be consistent with Escherichia coli. Although this organism is the most common cause of urinary tract infections in women in the United States, it would not be expected to cause PID. Pear-shaped flagellated protozoa (choice F) refers to the protozoan parasite Trichomonas vaginalis, the only protozoan STD in the world. Infection would be characterized by a malodorous, cheesy exudate, and there would be more erythema of the external genitalia than of the cervix. Pleomorphic, gram-negative rods (choice G) are consistent with Hemophilus ducreyi, which causes chancroid, and presents in a different manner. Spirochetes on dark-field microscopy (choice H) refers to Treponema pallidum, the causative agent of syphilis, which would produce rash and/or chancre, depending on the stage of the infection.

9>The correct answer is B. The principle host defense in mycobacterial infections (such as this patient's tuberculosis) is cell-mediated immunity, which causes formation of granulomas. Unfortunately, in tuberculosis and in many other infectious diseases characterized by granuloma formation, the organisms may persist intracellularly for years in the granulomas, only to be a source of activation of the infection up to decades later. While antibody-mediated phagocytosis (choice A) is a major host defense against many bacteria, it is not the principle defense against Mycobacteria. IgA-mediated hypersensitivity (choice C) is not involved in the body's defense against Mycobacteria. IgE-mediated hypersensitivity (choice D) is not involved in the body's defense against Mycobacteria. It is important in allergic reactions. Neutrophil ingestion of bacteria (choice E) is a major host defense against bacteria, but is not the principle defense against Mycobacteria.

10>The correct answer is A. This patient has the classic symptoms of cat scratch disease caused by the bacillus Bartonella henselae. The disease is self-limited with the onset of symptoms occurring 3-10 days following an inoculating scratch. The organism can be isolated from kittens, typically less than 1 year of age, or from fleas. A history of a new kitten in the house and the papule at the site of a scratch with regional painful adenopathy defines the classic scenario. Chickens (choice B) can harbor Salmonella spp. producing a gastroenteritis or enterocolitis. Chicken guano is also a favorable environment for the fungus Histoplasma capsulatum. The mycelial phase thrives in the rich soil. The human disease is a granulomatous infection involving the lungs and mimicking tuberculosis. Dogs or puppies (choice C) carry Capnocytophaga canimorsus as part of the normal flora of the oral cavity. Infections from licking or biting range from a self-limited cellulitis to fatal septicemia. Patients at risk for more severe infections are those with asplenia, alcoholism, or hematologic malignancies. This organism is also associated with cat bites, but the patient develops cellulitis and fulminant septicemia, especially in asplenic patients. Pasteurella multocida is another pathogen that colonizes the nasopharynx and gastrointestinal tract of cats and dogs. Cats have the highest rate of colonization (50-90%), followed by dogs (50%), swine (50%), and rats (14%). P. multocida most commonly causes a localized soft tissue infection or cellulitis after an animal bite, but systemic symptoms may be present in about 40% of the cases. These symptoms include osteomyelitis, septic arthritis, or tenosynovitis. Horses (choice D) and horse manure have been associated with a pulmonary opportunistic infection with cavitation caused by Rhodococcus equi that resembles tuberculosis in immunocompromised patients. Burkholderia mallei (the cause of glanders) is characterized by non-caseating granulomatous abscesses of skin, lymphadenopathy, and pronounced involvement of the lungs. Parrots (choice E) are associated with psittacosis caused by Chlamydia psittaci. Psittacosis is associated with a dry, hacking cough productive of scant sputum, an interstitial infiltrate in the lungs, severe headache, and myalgias. A pale macular rash is also seen.

11>The correct answer is A. Bacillary angiomatosis is a disease that occurs primarily in AIDS patients, and is indicative of a defect in cell-mediated immunity. It is caused by either

Bartonella henselae or Bartonella quintana. The domestic cat is the reservoir for these organisms and they are usually transmitted to humans via a cat scratch or cat bite. Patients with this illness usually have multiple skin lesions and extracutaneous manifestations involving liver and bone. Diagnosis is usually based on characteristic histopathologic findings including plump "epithelioid" endothelial cells and mitotic figures. A macrolide, such as erythromycin or azithromycin, is the drug of choice for the infection. Human papillomavirus (choice B) causes warts. Infection can present as a sessile wart or as condyloma acuminatum, which are fleshy soft growths that coalesce into large masses. When cellular immunity is depressed, as in AIDS, the condylomata acuminatum proliferate. Molluscum contagiosum virus (choice C) is a pox virus that is spread by close person-toperson contact. Infection produces a firm nodule that often becomes umbilicated, and may resolve by discharging its contents. In AIDS, the lesions do not resolve, but enlarge and spread. Rickettsia prowazekii (choice D) is the cause of epidemic typhus. It is spread by the human body louse, Pediculus humanis. Its reservoirs are humans and flying squirrels. Treponema pallidum (choice E) is the spirochete that causes syphilis. The characteristic primary lesion is a chancre (a painless, indurated ulcer) at the site of inoculation.

12>The correct answer is E. This is the classic presentation of a psoas abscess. This clinical entity was formerly a fairly common complication of vertebral tuberculosis, but is now rare in clinical practice in this country. The psoas muscle is covered by a fibrous sheath known as the psoas fascia. This sheath is open superiorly, permitting an infection involving the soft tissues around the spine to enter the sheath, then track down to the groin. The adductor longus (choice A) is a muscle of the anterior thigh, and is not related to the lumbar portion of the back. The gluteus maximus (choice B) gluteus minimus (choice C) and piriformis (choice D) are muscles of the buttock with no relationship to the groin.

13>The correct answer is C. The patient has a fever and is extremely ill. The most important clue to the diagnosis is the presence of bulky vegetations on the tricuspid valve, indicating that he has infective endocarditis. On the basis of the rapid clinical course, this is likely a case of acute infective endocarditis. The diagnosis of this condition must be confirmed by blood cultures, which are also necessary to determine bacterial antibiotic sensitivity. S. aureus (commonly present on the skin) is the most frequent etiologic agent of infective endocarditis in intravenous drug abusers. It commonly affects the tricuspid valve. Because of its high virulence, S. aureus-related endocarditis follows an acute course and may lead to death within a few days. The causative agents of infective endocarditis differ depending on host factors. Fungal organisms, such as Candida albicans (choice A), may cause infective endocarditis in severely immunosuppressed patients, such as those with AIDS. A minority of cases of infective endocarditis are caused by a number of normal commensals in the oral cavity, i.e., the "HACEK" group: Hemophilus (choice B), Actinobacillus, Cardiobacterium, Eikenella, and Kingella. S. epidermidis (choice D) and other coagulase-negative staphylococci tend to produce endocarditis in recipients of prosthetic valves. Viridans streptococci (choice E) are the most frequent agents causing endocarditis in previously abnormal valves, such as those damaged by rheumatic disease, or congenitally abnormal valves. Coagulase-negative staphylococci and viridans (a-hemolytic) streptococci

are less virulent than S. aureus and are thus associated with a subacute (more prolonged) clinical course and a better prognosis

14>The correct answer is A. Campylobacter jejuni is a pathogen causing an invasive enteric infection associated with ingestion of raw or undercooked food products, or through direct contact with infected animals. In the U.S., ingestion of contaminated poultry that has not been sufficiently cooked is the most common means of acquiring the infection. The patients typically have bloody diarrhea, abdominal pain, and fever. The presence of fecal leukocytes indicates an invasive infection. The organism is a gram negative rod with a "comma-shape." Enterotoxigenic E. coli (choice B) causes the classic traveler's diarrhea. The infection is noninvasive and is acquired via the fecal-oral route through consumption of unbottled water or uncooked vegetables. The major manifestation is a copious outpouring of fluid from the GI tract presenting as explosive diarrhea. This is due to the action of one of two types of enterotoxins on the GI tract mucosa. Shigella sonnei (choice C) produces a syndrome very similar to C. jejuni. However, the organism appears as a gram-negative rod on Gram's stain. It does not have a comma shape. Transmission is from person to person via the fecal-oral route. Infection requires a low infective dose since the organism is fairly resistant to gastric acidity. Staphylococcus aureus (choice D) produces food poisoning due to the ingestion of a preformed enterotoxin. The organism is present in food that is high in salt content such as potato salad, custard, milk shakes, and mayonnaise. The patient presents with nausea, vomiting, and abdominal pain, followed by diarrhea beginning 1-6 hours after ingestion of the enterotoxin. Vibrio cholerae (choice E) produces a secretory diarrhea due to increases in cAMP in the intestinal cells. The organism is not invasive. The patient presents with the sudden onset of painless, watery diarrhea that becomes voluminous, followed by vomiting. The stool appears nonbilious, gray, and slightly cloudy with flecks of mucus, no blood, and a sweet odor.

15>The correct answer is D. The lesions are characteristic of molluscum contagiosum, which is a typically benign and self-limited condition caused by a poxvirus. The disease can be transmitted either venereally or through non-venereal contact. The other viruses listed do not cause similar skin lesions. Patients with advanced HIV infection may develop a severe, generalized, and persistent eruption, often involving the face and upper body. Cytomegalovirus (choice A) causes congenital infections and disseminated infections in immunosuppressed patients. Herpesvirus 6 (choice B)causes roseola (exanthem subitum). Parvovirus (choice C) causes aplastic crises in patients with hemolytic anemia. Variola (choice E) is the smallpox virus.

16>The correct answer is D. This patient has Wegener's granulomatosis, which is characterized by renal involvement, severe upper respiratory tract symptoms, and pulmonary involvement. Other organ systems may also be involved. The renal syndrome is a crescentic rapidly progressive glomerulonephritis leading to renal failure. The upper respiratory tract findings include sinus pain and drainage, and purulent or bloody nasal discharge with or without nasal ulcerations. Nasal septal perforation may follow. Pulmonary involvement may be clinically silent with only infiltrates present on x-ray, or it may present as cough and

hemoptysis. c-ANCA is a marker for Wegener's granulomatosis, present in a high percentage of patients. Anti-centromere antibody (choice A) is associated with approximately 90% of cases with CREST syndrome (calcinosis, Raynaud's phenomenon, esophageal motility syndrome, sclerodactyly, and telangiectasia) which is also called limited scleroderma. Anti-Ro (choice B) is also called anti-SS-A and is associated with Sjögren's syndrome (7095%). Anti-SS-B (choice C) is associated with Sjögren's syndrome (60-90%). Decreased ESR (choice E) is not a marker of Wegener's. Instead, a markedly elevated ESR is seen. Additionally, mild anemia, thrombocytosis, leukocytosis, mild hypergammaglobulinemia (IgA), and mildly elevated rheumatoid factor are seen in this disorder.

17>The correct answer is E. Parvoviruses are small single-stranded DNA viruses, of which only serotype B19 is pathogenic for humans. This virus causes three distinct syndromes: a childhood febrile rash known as erythema infectiosum ("Fifth disease"); aplastic crisis in individuals with chronic hemolytic diseases (sickle cell anemia, thalassemia, etc); and congenital infections that can present as stillbirth, hydrops fetalis (analogous to severe Rh incompatibility), or severe anemia. Coxsackie viruses (choice A) usually cause cold-like illness, but can cause herpangina, myocarditis, and meningitis. Echoviruses (choice B) can infect a variety of organ systems (GI, CNS, eyes, heart, respiratory, skin), but are not a cause of aplastic crises. Hepadnavirus (choice C) is the causative agent of hepatitis B. Herpes viruses (choice D) cause a variety of acute to chronic infections including herpes simplex types I and II, chicken pox, chronic herpes zoster, CMV infection, and Epstein Barr virus infections.

18>The correct answer is A. The cavernous sinuses are located on either side of the body of the sphenoid bone, and become a potential route of infection because they receive blood both from the face (via the ophthalmic veins and sphenoparietal sinus) and some of the cerebral veins. The spread of infection, especially by Mucor sp., into the cavernous sinus, can produce either CNS infection or cavernous sinus thrombosis, both of which are potentially fatal. The route from the face to the brain is not arterial (choices B and C). The superior sagittal sinus (choice D) is located in the falx cerebri, and drains venous blood from the brain to other dural sinuses, from which it eventually drains into the jugular vein. Zygomycosis does not reach the brain by way of the superior sagittal sinus. The superior vena cava (choice E) drains blood from the upper part of the body into the heart.

19>The correct answer is A. Streptococci are usually initially speciated by their hemolytic capacity on sheep blood agar. Beta-hemolytic streptococci include groups A, B, and D. S. agalactiae is the classic group B streptococcus. The non beta-hemolytic streptococci consist principally of the pneumococci and the viridans group. Both S. agalactiae and pneumococcus have a carbohydrate capsule (choice B), an important virulence factor and means of subtyping streptococcal species.

None of the streptococci utilize cytochrome enzymes (choice C). They derive all of their energy from the fermentation of sugars to lactic acid. Neither pneumococcus nor S. agalactiae can grow in bile (choice D). This ability is specific for the enterococcus group (group D) of streptococci. Both pneumococci and S. agalactiae are usually treated with penicillin-type antibiotics, although group B streptococci require a penicillinase-resistant type such as oxacillin (choice E).

20>The correct answer is A. Bartonella henselae is the infective agent of cat scratch disease, which generally presents as regional lymphadenopathy with or without low fevers and headaches. Bartonella is a gram-variable pleomorphic rickettsial organism that is introduced to the skin in a cat bite or scratch. It produces a self-limited granulomatous response in the draining lymph nodes. Borrelia burgdorferi (choice B) is a spirochetal organism that is transmitted by a tick bite (Ixodes spp.), producing Lyme disease. Lyme disease progresses from a skin rash to fevers, headache and pain over about one month. It may produce lymphadenopathy, but is not associated with granuloma formation. Chlamydia psittaci (choice C) infection occurs after contact with infected bird droppings and produces an atypical pneumonia. The central nervous system may also be involved, but lymph nodes are spared. Chlamydia trachomatis is the chlamydial species that typically produces suppurative nodal granulomas (lymphogranuloma venereum). Coxiella burnetii (choice D) infection is transmitted by inhaling dusts or drinking milk from infected mammals, especially sheep and cows. The disease in humans, Q fever, is marked by mild nonspecific symptoms or pneumonia, and may progress to myocarditis or hepatitis. Rickettsia prowazekii (choice E) produces epidemic (louse-borne) typhus, which is transmitted by body lice and produces a rash akin to Rocky Mountain spotted fever. Although the organism may reside in the lymph nodes in dormancy, it does not elicit granuloma formation.

21>The correct answer is D. Parvovirus B19 causes erythema infectiosum, or Fifth disease. The 5-year-old boy has the classic "slapped cheek" appearance. Adults typically do not get the facial rash, but have arthralgias and arthritis. The symmetrical distribution of involved joints is similar to that in rheumatoid arthritis. The onset in adults is typically 3 to 4 weeks after exposure. Parvovirus infections may persist in immunosuppressed patients, resulting in red blood cell aplasia. Listeriosis (choice A) is caused by the gram-positive rod Listeria monocytogenes. Meningitis and bacteremia are common clinical manifestations. Elderly, neonates, pregnant women, and those taking steroids have the highest risk for infection. Lyme disease (choice B) is caused by Borrelia burgdorferi. It is the most common vectorborne disease (Ixodes ticks) in the U.S. The incidence is highest in the summer and fall. The white-footed mouse and the white-tailed deer are zoonotic reservoirs. From 3 to 32 days following a tick bite, the patient develops fever, lymphadenopathy, meningismus, and the characteristic rash (erythema migrans). The rash enlarges and resolves over 3 to 4 weeks. Sequelae include arthritis, carditis, and neurologic abnormalities. Mumps (choice C) is caused by a Paramyxovirus. The virus most commonly affects glandular tissue. Parotitis, pancreatitis, and orchitis are characteristic. Mumps meningoencephalitis is one of the most common viral meningitides. Mumps polyarthritis is most common in men

between the ages of 20 and 30 years. Joint symptoms begin 1 to 2 weeks after the parotitis subsides and large joints are involved. Reiter's syndrome (choice E) is a seronegative, asymmetric arthropathy predominantly affecting the lower extremities. It may be triggered by a C. trachomatis infection. In addition to the arthritis, patients may have urethritis (which is usually due to chlamydia), conjunctivitis, mucocutaneous disease such as balanitis, oral ulcerations, or keratoderma. Approximately 80% of patients are HLA-B27 po

22>The correct answer is E. Embolization from infective endocarditis typically causes multiple, small parietal lobe abscesses. This "factoid" is worth knowing because some patients with infective endocarditis present with what clinically looks like multiple small "strokes", and their treatable cardiac disease may be completely unsuspected.

23>The correct answer is E. The most common bacteria implicated in community-acquired pneumonia is the pneumococcus, Streptococcus pneumoniae. Other organisms frequently implicated in patients less than age 60 without comorbidity include Mycoplasma pneumoniae, respiratory viruses, Chlamydia pneumoniae, and Haemophilus influenzae. When community-acquired pneumonia occurs in elderly patients or patients with comorbidity, aerobic gram-negative bacilli and Staphylococcus aureus are added to the list. The organisms listed in choices A, B, and C are important causes of community-acquired pneumonia, but are not the most frequent causes. Staphylococcus aureus (choice D) is an important cause of community-acquired pneumonia (particularly in the elderly and in patients with comorbidity), but is not the most frequent cause.

24>The correct answer is A. The combination of a one week incubation period, the Eastern seaboard clue, and the intra-erythrocyte parasites strongly suggest Babesia microti as the infecting organism. The clinical disease is called babesiosis. The infecting protozoan is related to Plasmodium and is transmitted by the bite of the Ixodes dammini tick. Occasional cases have been transmitted by blood transfusions. Most patients are asymptomatic; symptomatic cases in reasonably healthy individuals have the features listed in the question stem. Rare severe cases, which may be fatal, may develop in severely debilitated or asplenic individuals and can be accompanied by severe hemolysis (up to 30% of RBCs may have the parasites) with subsequent hemoglobinuria, hemolysis, and renal failure. Leishmania donovania (choice B) is an intracellular tissue protozoan, not a blood protozoan. Plasmodium falciparum (choice C) and Plasmodium vivax (choice D) are malarial parasites not encountered on the Eastern seaboard. Trypanosoma cruzi (choice E) is an intracellular tissue protozoan, and does not infect blood cells.

25>The correct answer is A. The patient's presentation is consistent with a simple urinary tract infection; there is a short history of dysuria, increased urinary frequency and the appearance of white blood cells and gram-negative rods in the urine. Urinary tract infections are common in women after they become sexually active. The infection is likely caused by

urethral trauma during intercourse, which leads to bacterial contamination of the bladder. Since the majority of these infections are caused by Escherichia coli (a gram-negative rod), the most appropriate therapy would be ampicillin for around 10 days. Ceftriaxone (choice B) is the treatment of choice for uncomplicated infections with N. gonorrhoeae, now that most strains are resistant to penicillin. Intravenous ceftriaxone is a regimen reserved for the treatment of life-threatening infections. Fluconazole (choice C) is indicated for the treatment of vaginal candidiasis. Since there is no vaginal discharge and the patient has gram-negative rods in the urine, a diagnosis of vaginal candidiasis can be excluded. Gentamicin (choice D) would be an inappropriate choice since the majority of urinary tract infections caused by gram negative rods are sensitive to ampicillin and the potential for toxicity secondary to gentamicin is great. Metronidazole (choice E) is an antibiotic typically used in the treatment of Trichomoniasis, Giardiasis, and Gardnerella, as well as serious infections believed to be caused by anaerobic bacteria. Since there is no vaginal discharge and the patient has gram negative rods in the urine, one can conclude that these infections are not present and the patient instead has a urinary tract infection.

26>The correct answer is D. The patient is exhibiting the classic signs of acute bacterial endocarditis. In intravenous drug abusers, Staphylococcus aureus is the most common causative agent, because it is the most common normal flora organism on the skin of these patients, and choice D is the classic description of this species. Catalase positivity distinguishes the genus Staphylococcus from Streptococcus, and Staphylococcus aureus is the only coagulase positive member of its genus. Antibodies to p24 capsid antigen (choice A) would be likely in an HIV-positive drug abuser, rather than a patient with endocarditis. Trichinella spiralis (choice B) can cause splinter hemorrhages during the larval migration period, but would not be the most likely agent given the other symptoms. Staphylococcus epidermidis is a catalase-positive, novobiocin-sensitive, gram-positive coccus (choice C). It is sometimes implicated in subacute bacterial endocarditis, but is less common as a causative agent in drug abusers than in normal individuals. Enterococci are gamma-hemolytic, gram-positive cocci that grow on bile-esculin agar (choice E). Enterococci can cause subacute bacterial endocarditis, chiefly after urologic instrumentation in men, rather than in association with intravenous drug abuse. Streptococcus viridans is an alpha-hemolytic, optochin-resistant, gram-positive coccus (choice F). It is implicated in subacute bacterial endocarditis after oral or dental treatments but would not be the most likely agent, given the acute nature of this patient's presentation. Streptococcus pneumoniae is an alpha-hemolytic, optochin-sensitive, gram-positive coccus (choice G) that produces cough and chest pain, but would be an unlikely cause of bacterial endocarditis.

27>The correct answer is E. The history is characteristic for Lyme disease, caused by the spirochete Borrelia burgdorferi. The clues are deer, Connecticut, rash, knees, and acute arthritis followed by chronic arthritis. Fungal arthritis (choice A) can be caused by coccidioidomycosis, blastomycosis, sporotrichosis, and candidiasis. N. gonorrhoeae are gram-negative cocci (choice B) that can cause septic arthritis.

Haemophilus (young children) and Salmonella (sickle cell patients) are gram-negative rods (choice C) that can cause septic arthritis. Staphylococcus are gram-positive cocci (choice E) that can cause septic arthritis

28>The correct answer is D. The patient described probably has systemic lupus erythematosus (SLE). This is a systemic disorder that often presents with fatigue, malaise, fever, gastrointestinal symptoms, arthralgias, and myalgias. Hematologic abnormalities include anemia of chronic disease, hemolytic anemia, leukopenia, lymphocytopenia, and thrombocytopenia. A circulating anticoagulant may prolong the APTT (activated partial thromboplastin time). Cutaneous manifestations include a malar rash and a generalized maculopapular eruption, both of which are photosensitive. Antibodies to the Smith antigen (core proteins of small ribonucleoproteins found in the nucleus) are present in only 20-30% of patients with SLE, but are quite specific for the disease, occurring only rarely in other autoimmune diseases. Anti-centromere antibody (choice A) is specific for the CREST (Calcinosis, Raynaud's syndrome, Esophageal dysfunction, Sclerodactyly, and Telangiectasia) variant of progressive systemic sclerosis (scleroderma). Rheumatoid factor is actually an autoantibody directed against the Fc portion of the IgG molecule (choice B). It is found in more than two-thirds of patients with rheumatoid arthritis. The majority of patients with SLE (around 95%) develop antinuclear antibodies (ANA; choice C), so this test is quite sensitive, but not very specific for SLE. ANA occur in other inflammatory disorders, autoimmune diseases, viral diseases, and in a number of normal individuals. Antibodies to double-stranded DNA are more specific for SLE, but are not included as an answer choice. Anti-SS-A antigen (choice E) refers to antibodies to certain ribonucleoproteins, which are fairly specific for Sjögren's syndrome.

29>The correct answer is E. Systemic lupus erythematosus (SLE) is a prototype connective tissue disease. The diagnosis requires four criteria to be met from a list of eleven possible criteria: malar rash, discoid rash, photosensitivity, oral ulcers, arthritis, serositis, renal disorder, neurologic disorder, hematologic disorder, immunologic disorder, and antinuclear antibody. This patient also has anti-Sm, which is pathognomonic for SLE, but is only found in 30% of the affected patients. Antinuclear antibodies (ANA) are present in 95-100% of cases of SLE; anti-double-stranded DNA is found in 70% of the cases. Generalized fatigue (choice A) due to being a single working mother of two children could well be a possibility, but the presence of the other criteria make SLE more likely. Goodpasture's syndrome (choice B) is characterized by linear disposition of immunoglobulin, and often C3, along the glomerular basement membrane (GBM). Glomerulonephritis, pulmonary hemorrhage, and occasionally idiopathic pulmonary hemosiderosis occur. Mixed connective tissue disease (choice C) is an overlap syndrome characterized by a combination of clinical features similar to those of SLE, scleroderma, polymyositis, and rheumatoid arthritis. These patients generally have a positive ANA in virtually 100% of the cases. High titer anti-ribonucleoprotein (RNP) antibodies may be present, generating a speckled ANA pattern. Anti-RNP is not pathognomonic for mixed connective tissue disease, since it can be found in low titers in 30% of the patients with SLE. Scleroderma (choice D) is characterized by thickening of the skin caused by swelling and thickening of fibrous tissue, with eventual atrophy of the epidermis. ANA are often associated with the disease, but the staining pattern is generally nucleolar

30>The correct answer is D. The patient has acute prostatitis, which is characterized by fever, chills, and dysuria, with a swollen, extremely tender prostate on rectal exam. The urine Gram's stain and culture will generally be positive. The treatment regimen for this bacterial infection is typically a 21-day course of ampicillin, a fluoroquinolone, or sulfamethoxazole/trimethoprim (SMX-TMP). G-6-PD deficiency is an X-linked recessive disorder affecting 10% to 15% of American black males. The medications most commonly associated with the induction of hemolytic anemia in deficient patients are sulfonamides, nitrofurantoin, dapsone, primaquine, and quinine. The sulfamethoxazole in the SMX-TMP combination is a sulfonamide, and can produce hemolytic anemia in patients with G-6-PD deficiency. Ampicillin (choice A) is a broad-spectrum penicillin antibiotic commonly used in the treatment of infections in the genitourinary, respiratory, or GI tracts, as well as in the skin and soft tissues. Cefaclor (choice B) is a second-generation cephalosporin indicated for a variety of bacterial infections, including those of the respiratory and GI tracts. Ciprofloxacin (choice C) is a fluoroquinolone commonly used in the treatment of serious infections caused by gram-negative organisms. Tetracycline (choice E) is most commonly used in the treatment of acne vulgaris and gonococcal infections.

31>The correct answer is B. Streptococcus bovis is a Group D streptococcus. There is a significant association between S. bovis bacteremia and endocarditis with carcinoma of the colon and other colonic diseases. Every patient with S. bovis bacteremia should undergo gastrointestinal and cardiac evaluation. Up to 50% of patients with S. bovis bacteremia are reported to have underlying colonic malignancies. In another study, 25-50% of cases of S. bovis bacteremia were associated with endocarditis, especially in patients with preexisting valvular lesions. Streptococcus agalactiae (choice A) is an important cause of maternal and neonatal bacteremia and neonatal meningitis. It is part of the normal flora of the gastrointestinal tract and the female genital tract. Streptococcus pneumoniae (choice C) is a leading cause of community-acquired pneumonia, meningitis in adults, otitis media (especially in children), and sinusitis. Spontaneous peritonitis due to S. pneumoniae is reported in children with ascites from nephrotic syndrome. Asplenia predisposes patients to severe infections with S. pneumoniae and other encapsulated organisms. S. pneumoniae infections are also more frequent and unusually severe in patients with sickle cell anemia, multiple myeloma, alcoholism, and hypogammaglobulinemia. S. pneumoniae is now the leading cause of invasive bacterial respiratory disease in patients with AIDS. Streptococcus pyogenes (choice D) is the most common cause of bacterial pharyngitis. Complications include paratonsillar abscesses, otitis media, and sinusitis. Long-term sequelae include rheumatic fever and poststreptococcal glomerulonephritis. S. pyogenes is also responsible for many skin and soft tissue infections. The organism also produces many toxins that produce a variety of diseases. Streptococcus viridans (choice E), or the viridans Streptococci, are the most common cause of subacute bacterial endocarditis, which should be suspected in cases of viridans streptococcal bacteremia. One species of viridans Streptococci, Streptococcus milleri, is frequently associated with pyogenic abscesses, especially of the liver.

32>The correct answer is E. Mycobacteria, such as the causative organism of this patient's tuberculosis, are "acid fast" because they have an envelope that contains large amounts of lipids and even true waxes (unlike envelopes of other types of bacteria) that prevents the acid-fast stain (carbolfuchsin) from leaking out. The other characteristics listed in the answers are commonly tested features of specific bacteria: Nutritional requirement for factors V and X (choice A) is a feature of Haemophilus influenzae. Streptokinase (choice B) is a feature of Streptococci. Toxic shock syndrome toxin (choice C) is a feature of Staphylococcus aureus. Visibility under dark field illumination (choice D) is a feature of the syphilis organism Treponema pallidum.

33>The correct answer is B. When individuals travel from one country to another with marked differences in climate and sanitation standards, the risk for development of traveler's diarrhea is dramatically increased. This type of diarrhea is most likely to develop within 2-10 days after ingesting local water and/or eating fresh fruits and vegetables (such as a fresh salad) that could have been "washed off" with the local water. Traveler's diarrhea is often accompanied by the appearance of approximately 10 or more episodes of diarrhea per day, as well as severe abdominal cramps, nausea, vomiting, and a mild fever. Depending on the causative bacteria, blood and/or fecal leukocytes may be present. Most cases of traveler's diarrhea are caused by enterotoxigenic Escherichia coli, Shigella species, and Campylobacter jejuni. The most commonly used agents to treat traveler's diarrhea are the fluoroquinolones, such as ciprofloxacin, ofloxacin, and norfloxacin. Trimethoprim/sulfamethoxazole is most commonly used in treatment of children. None of the other agents are indicated for the treatment of traveler's diarrhea. Acyclovir (choice A) is an antiviral agent indicated for the treatment of herpes virus infections. Mebendazole (choice C) is a broad-spectrum anthelminthic indicated for the treatment of "worm" infections, such as Enterobius vermicularis, Trichuris trichiura, and Ascaris lumbricoides. Quinine (choice D) is an antimalarial agent indicated for the treatment of malaria and severe leg cramps. Tetracycline (choice E) is an antibacterial agent with a limited antibacterial spectrum; it is primarily used in the treatment of acne vulgaris and gonorrhea infections.

34>The correct answer is D. Penicillin remains the first-line drug of choice for pneumococcal pneumonia, except in patients with penicillin allergy and in the relatively few areas in which pneumococcal strains with high-level penicillin resistance exist. Alternative therapies include erythromycin and vancomycin. The third-generation cephalosporin cefotaxime (choice A) is not usually used for pneumococcal pneumonia. Chloramphenicol (choice B) is not usually used for pneumococcal pneumonia. Erythromycin (choice C) is a good alternative therapy for pneumococcal pneumonia, but is usually used only when a penicillin allergy is present.

Vancomycin (choice E) is not the first-line therapy, but it is a good alternative in patients allergic to penicillin or when high-level penicillin resistance (relatively uncommon) is present.

35>The correct answer is E. Wiskott-Aldrich syndrome is an X-linked condition characterized by eczema, thrombocytopenia, and repeated infections. Affected children may present with bleeding and often succumb to complications of bleeding, infection, or lymphoreticular malignancy. The platelets are small, have a shortened half-life, and appear to be deficient in surface sialophorin (CD43). Splenectomy can correct the thrombocytopenia, but not the immune defect. Serum IgM is usually decreased, while IgE is frequently increased. Mutations in the Wiskott-Aldrich serum protein (WASP) gene on the short arm of the X chromosome are responsible for this disease. Acquired hypogammaglobulinemia (choice A) is a disease of adults characterized by normal numbers of B cells but low immunoglobulin production. Ataxia telangiectasia (choice B) is an autosomal recessive disease characterized by progressive cerebellar dysfunction, telangiectasias, and a variable immunodeficiency. DiGeorge syndrome (choice C) is a developmental malformation leading to thymic aplasia and, sometimes, hypoparathyroidism. Selective IgA deficiency (choice D) is a relatively common condition characterized by low levels of IgA.

36>The correct answer is B. Chlamydia, Mycoplasma, and Ureaplasma are not effectively treated by penicillins and cephalosporins, and are important causes of post-gonococcal urethritis. Chlamydial urethritis can be diagnosed by using fluorescent antibodies to identify inclusions in epithelial cells. Actinomyces (choice A) is a mouth commensal that rarely causes a deeper oral infection. Mycobacteria (choice C) cause chronic granulomatous diseases such as tuberculosis and leprosy. Nocardia (choice D) can cause necrotizing pneumonia and disseminated disease. Rickettsia (choice E) cause typhus and Rocky Mountain spotted fever.

37>The correct answer is D. Pseudomonas aeruginosa causes malignant otitis externa, which is a severe necrotizing infection of the external ear canal. Infection tends to spread to the mastoid bone, temporal bone, sigmoid sinus, base of the skull, meninges, and brain. Patients at increased risk include the elderly, those with diabetes, and the immunocompromised. Pseudomonas is also associated with many other clinical syndromes, including infection following traumatic wounds to the feet in persons wearing sneakers or rubber-soled shoes, since the organism can be cultured from the shoes. Hemophilus influenzae (choice A) produces a variety of clinical syndromes. H.Influenzae is the third-most common cause of meningitis in children aged 1 month to 18 years. It is the most common cause of acute epiglottitis, the most common cause of purulent bacterial conjunctivitis, and the second-most common cause of otitis media. Patients at risk include those with COPD and cystic fibrosis, alcoholics, splenectomized patients, and young patients.

Klebsiella pneumoniae (choice B) is a gram-negative organism that produces a necrotizing pneumonia in diabetics and alcoholics. Patients typically present with an abrupt onset of fever, shaking chills, and purulent, foul-smelling sputum. Mucor (choice C) is a fungal infection that is particularly severe in the diabetic or the immunocompromised patient. In the acidotic diabetic, the fungus produces a life-threatening, invasive rhinocerebral infection. The infection begins in the nasal passages, extends into the paranasal sinuses, and spreads through the cribiform plate to the frontal lobes of the brain. Patients typically complain of headache, facial pain, and orbital swelling. Streptococcus pyogenes (choice E) causes bacterial pharyngitis, otitis media, and sinusitis. It is also associated with toxin-related diseases and skin infections.

38>The correct answer is D. Rubella, also called German measles or 3-day measles, is a disease caused by a Togavirus, which are small, enveloped, single-stranded, (+) linear RNA viruses. Approximately 40% of patients are asymptomatic or have mild symptoms. In symptomatic patients, the clinical presentation typically consists of an erythematous rash beginning on the head, which spreads downward to involve the trunk, lasting for approximately 3 days. In addition to a transient rash, symptoms include fever, posterior cervical lymphadenopathy, and arthralgias. The greatest danger from rubella is to the fetus. If clinical rubella develops or seroconversion is demonstrated, there is a high risk of congenital abnormalities or spontaneous abortion. The risk varies from 40%-60% if infection occurs during the first 2 months of gestation to 10% by the 4th month. Females of childbearing age should be warned not to become pregnant within 2-3 months from the time of immunization. Mild arthralgias and other symptoms may develop in 25% of immunized women. Enteroviral rashes may mimic rubella and rubeola. Infectious mononucleosis (choice A) is caused by the Epstein-Barr virus, a herpesvirus. Classic findings include fever, exudative pharyngitis, generalized lymphadenopathy, severe malaise (most common complaint), and hepatosplenomegaly. A rash is not a characteristic feature unless the patient has been treated with ampicillin. Lyme disease (choice B) is caused by the spirochete Borrelia burgdorferi. The disease is transmitted by the bite of the tick, Ixodes dammini. Reservoirs in nature include the whitetailed deer and the white-footed mouse. The initial lesion is an annular rash with central clearing and a raised red border (erythema chronicum migrans) at the bite site. The rash is warm, but not painful or itchy. Patients also have fever, malaise, myalgias, arthralgias, headache, generalized lymphadenopathy, and, occasionally, neurologic findings. Roseola (choice C) is caused by human herpesvirus 6. Other names include exanthem subitum or sixth disease. Children have a febrile period of 3-5 days with rapid defervescence followed by an erythematous maculopapular rash lasting 1-3 days. Rubeola (choice E), or regular measles, is a disease caused by a paramyxovirus. Patients present with an upper respiratory prodrome and characteristic oral lesions (Koplik's spots) that precede the rash. The non-pruritic maculopapular rash begins on the face and spreads to the trunk and extremities, including palms and soles. The incubation period is 10-14 days. Patients also have a posterior cervical lymphadenopathy. The virus is not associated with risk to a fetus.

39>The correct answer is E. The patient in this question has pneumococcal pneumonia, which must be considered in any patient with chills, fever, chest pain, and cough productive of purulent, rust-colored sputum. Streptococcus pneumoniae is an a-hemolytic, gram-positive coccus that grows in chains. It can be easily distinguished from other a-hemolytic

streptococci because it is exquisitely sensitive to bile and bilelike compounds, such as optochin. It is the most common cause of community-acquired pneumonia and the most common cause of community-acquired meningitis in adults older than 30. The only recognized virulence factor of S. pneumoniae is its carbohydrate capsule (which contains acidic polysaccharides). Antibody to a specific capsule type is necessary to overcome infection. More than 80 capsule types have been recognized. The 23 types that most commonly cause disease are contained in a vaccine that is recommended for high-risk groups, including the elderly and those undergoing splenectomy. Increased susceptibility is also found in patients with Hodgkin disease, chronic lymphocytic leukemia, and myeloma. The vaccine should still be given to patients with these conditions, but it is less successful. The alternative complement pathway (choice A) is important in clearing Neisseria infections. Individuals with deficiencies in C5 through C8 are at increased risk of disease from Neisseria. The fimbria of Streptococcus pyogenes (Group A a-hemolytic streptococcus) is composed of an a-helically coiled M protein. Antibody against a specific M type (choice B) will prevent infection. However, raising antibodies to M proteins can lead to rheumatic fever, so Strep throat infections are routinely treated with penicillin to prevent an antibody response. The C carbohydrate is an antigen of a-hemolytic streptococci used to divide them into different groups. Antibody against C carbohydrate (choices C and D) is not protective.

40>The correct answer is E. This clinical scenario is typical for Wiskott-Aldrich syndrome. This is a sex-linked recessive disorder presenting with the triad of thrombocytopenia, eczema, and recurrent sinopulmonary infections. Serum IgM levels are low but IgG, IgA, and IgE levels are increased. Patients have a defective response to polysaccharide antigens, which is due to a cytoskeletal defect in T cells that inhibits their binding to B cells. A CD4/CD8 ratio of < 1.5:1 (choice A) is the pattern seen in AIDS due to selective tropism of the CD4+ T-helper cell population. Cerebellar ataxia (choice B) is part of the ataxia-telangiectasia syndrome. The ataxia develops between age 2 and 5. The defect is associated with a DNA repair enzyme deficiency. Elevated platelet count and increased serum levels of IgG, IgA, and IgE (choice C) is not associated with a particular syndrome. Polyclonal gammopathies result in an increase in immunoglobulin of more than one class. This benign alteration is frequently seen in viral or bacterial infections. Thrombocythemia may be associated with a myeloproliferative syndrome or with a secondary reactive process. Low platelet count and low serum IgG (choice D) are not associated with any particular disorder.

41>The correct answer is C. Macrophages interact with a segment of the heavy chains of the IgG molecule, the Fc domain. Thus, the macrophage receptors for IgG are called Fc receptors. Complement receptors are also found on the macrophage surface. Phagocytosis occurs more readily when both of these components are present. Neutrophils and eosinophils have similar receptors: neutrophils assist macrophages in destruction of bacteria, while eosinophils respond to parasitic infections. Collagenase can be demonstrated immunologically (choice A) in a number of cells including eosinophils, mast cells, osteoclasts, and fibroblasts.

Microvilli (choice B) or pseudopodial extensions are common in macrophages, but also may be found on other cells such as fibroblasts and epithelial cells that phagocytize material. Secondary lysosomes (choice D) are a feature of macrophages, but may also be found in fibroblasts and epithelial cells. The shape of the nucleus (choice E) has little to do with phagocytic activity.

42>The correct answer is C. This is a case of Reiter's syndrome. Patients typically present with the acute onset of arthritis (usually asymmetric and additive), with involvement of new joints occurring over a period of a few days to 2 weeks. Joints of the lower extremities are the most commonly involved, but wrists and fingers can also be affected. Dactylitis (sausage digit), a diffuse swelling of a solitary finger or toe, is a distinctive feature of Reiter's arthritis and psoriatic arthritis. Tendonitis and fasciitis are common. Spinal pain and low back pain are common. Conjunctivitis, urethritis, diarrhea, and skin lesions are also associated with Reiter's syndrome. Up to 75% of patients are HLA-B27 positive. Microorganisms which can trigger Reiter's syndrome include Shigella spp., Salmonella spp., Yersinia spp., Campylobacter jejuni, and Chlamydia trachomatis. Most patients are younger males. Gout (choice A) usually presents as an explosive attack of acute, very painful, monarticular inflammatory arthritis. Hyperuricemia is the cardinal feature and prerequisite for gout. The first metatarsophalangeal joint is involved in over 50% of first attacks. Lyme disease (choice B), caused by Borrelia burgdorferi, presents with a red macule or papule at the site of the tick bite. This lesion, called erythema chronicum migrans, slowly expands to form a large annular lesion with a red border and central clearing. The lesion is warm, but usually not painful. The patient also has severe headache, stiff neck, chills, arthralgias, and profound malaise and fatigue. Untreated infection is associated with development of arthritis. The large joints (e.g., knees) are usually involved with the arthritis lasting for weeks to months. Rheumatoid arthritis (choice D) begins insidiously with fatigue, anorexia, generalized weakness, and vague musculoskeletal symptoms leading up to the appearance of synovitis. Pain in the affected joints, aggravated by movement, is the most common manifestation of established rheumatoid arthritis. Generalized stiffness is frequent and is usually greatest after periods of inactivity. Morning stiffness of greater than 1 hour in duration is very characteristic. Rheumatoid arthritis is more common in females. The metacarpophalangeal and proximal interphalangeal joints of the hands are characteristically involved. Septic arthritis (choice E) is caused by a variety of microorganisms, including Neisseria gonorrhoeae and Staphylococcus aureus. Hematogenous spread is the most common route in all age groups. 90% of patients present with involvement of a single joint, usually the knee. The usual presentation is moderate-to-severe pain, effusion, muscle spasm, and decreased range of motion. Peripheral leukocytosis and a left shift are common. Disseminated gonococcal infections present as fever, chills, rash, and articular symptoms. Papules progressing to hemorrhagic pustules develop on the trunk and extensor surfaces of the distal extremities. Migratory arthritis and tenosynovitis of multipl 43>The correct answer is C. Rotavirus is the most common cause of gastroenteritis in children between 3 months and 2 years of age. It is most prevalent in the winter. Rotavirus, one of the reoviruses, looks like a wheel (which ROTAtes) and possesses a double-shelled icosahedral capsid with no envelope. Its genome consists of 11 segments of double-stranded RNA. A complex double-stranded DNA genome (choice A) is found in enteric adenoviruses, the third most common cause of gastroenteritis in infants and children. This organism possesses an icosahedral nucleocapsid.

A partially double-stranded circular DNA genome (choice B) is characteristic of hepatitis B. Its envelope contains surface antigen (HBsAg). Its capsid is icosahedral and contains the genome along with DNA-dependent DNA polymerase, which also has reverse transcriptase activity. A single-stranded circular RNA genome (choice D) is characteristic of hepatitis D virus. Its envelope consists of HBsAg. The virus is defective and is able to replicate only in cells infected with hepatitis B. A single-stranded RNA genome (choice E) is characteristic of several viruses that cause gastroenteritis in children, including astrovirus and Norwalk virus. Astrovirus is the second most common cause of viral gastroenteritis in young children. Three structural proteins form its capsid. Norwalk virus is the most common cause of gastroenteritis outbreaks in older children and adults. Its capsid consists of one structural protein.

44>The correct answer is A. Flumazenil is a benzodiazepine antagonist and has been approved to hasten the recovery from benzodiazepines used in anesthetic and diagnostic settings and to reverse the CNS depressant effects following an overdose with benzodiazepines. Flumazenil can only be used for benzodiazepines and is not useful to reverse the effects of other CNS depressants such as barbiturates and ethanol. Glucagon (choice B) is an antidote for beta-blocker overdose. Naloxone (choice C), an opioid receptor antagonist, is an antidote for opioid overdose. Nitrite (choice D), or sodium nitrite, is an antidote for cyanide poisoning. Protamine (choice E) is an antidote for heparin overdose.

45>The correct answer is G. Flumazenil is an antagonist at the benzodiazepine receptor. It has no effect on other CNS depressants, such as barbiturates or alcohol. Acetylcysteine (choice A) is the drug of choice for treatment of overdose of acetaminophen, the active ingredient in Tylenol. Atropine (choice B) is a muscarinic antagonist used in cases of acetylcholinesterase inhibitor overdose. Bicarbonate (choice C) infusions may be given to alkalinize the urine and enhance the excretion of acidic drugs (e.g., aspirin). CaNa2EDTA (choice D) is used as a chelator in lead poisoning. Deferoxamine (choice E) is an effective chelator for poisoning with iron salts. Ethanol (choice F) is used in cases of methanol and ethylene glycol poisoning. Administration of EtOH in cases of diazepam overdose would be completely inappropriate because CNS depressants are additive. Physostigmine (choice H) is used in cases of anticholinergic agent overdose. Pralidoxime (choice I) is an acetylcholinesterase reactivating agent used in cases of organophosphorus acetylcholinesterase inhibitor overdose. Protamine (choice J) is administered to reverse the anticoagulant effects of heparin overdose.

46>The correct answer is B. Before you started analyzing all of the answer choices you should have reminded yourself that glucagon increases serum glucose. So an enzyme stimulated by glucagon might be involved in either the breakdown of glycogen to glucose (glycogenolysis) or in the creation of glucose from noncarbohydrate precursors

(gluconeogenesis). Glycogen phosphorylase catalyzes the first step in glycogenolysis; it makes sense that it would be stimulated by glucagon. Acetyl-CoA carboxylase (choice A) catalyzes the first step in fatty acid synthesis, an anabolic process that would be stimulated by insulin, not glucagon. As its name implies, glycogen synthase (choice C) is involved in the synthesis of glycogen. Glucagon (and epinephrine) stimulate the phosphorylation and inactivation of glycogen synthase. HMG-CoA reductase (choice D) is the key enzyme involved in the synthesis of cholesterol. Since this is an anabolic process that occurs in the well-fed state, you would expect it to be stimulated by insulin and inhibited by glucagon (which it is). Pyruvate kinase (choice E) catalyzes the last reaction of glycolysis. You would expect it to be inhibited by glucagon (thus decreasing the amount of glucose consumption). Glucagon promotes the phosphorylation of pyruvate kinase, which renders it inactive.

47>The correct answer is A. The cytochrome P-450 mixed-function oxidase system is located on smooth endoplasmic reticulum in liver cells. This system is involved in the detoxification of some drugs and other exogenous compounds (barbiturates, carcinogenic hydrocarbons, steroids, carbon tetrachloride, alcohol, insecticides), and its growth can be stimulated by exposure (particularly chronic exposure) to these agents. As a consequence, cells adapted to one drug can more rapidly metabolize the other drugs and compounds handled by the P-450 system.

48>The correct answer is A. The clinical signs suggest that this woman had hepatitis B three years ago and the fact that she is now feeling better also suggests that she recovered from this infection. Since she is pregnant, it is necessary to find out if she still has the organism in her liver (chronic hepatitis B infection) by performing a test for HBsAg. This test will be negative if she has completely recovered from the disease, but it would be positive if she is a chronic carrier. The clinical signs of the disease she had 3 years ago do not match those of CMV (choice B), and CMV does not produce chronic infections. Measurement of IgM antibody to hepatitis B core antigen (choice D) would be of no value at this time. This antibody is positive in acute cases of hepatitis B, but would no longer be positive in this case. Measurement of IgM anti-hepatitis B core antigen is one of the most important tests in the hepatitis profile because the appearance of the antibody correlates with the disappearance of HBsAg. Examination of IgM antibody to HBsAg (choice C) would be of no value at this time. This IgM antibody would be formed early during the recovery from acute hepatitis B, and would class switch to IgG later on in the disease. Quantitation of hepatitis A virus (HAV) IgM antibody (choice E) would be useless, since hepatitis A virus (HAV) only causes acute infection.

49>The correct answer is A. Alpha-1 receptors activate phospholipase C via the G protein Gq. Phospholipase C cleaves the membrane phospholipid phosphatidylinositol 4,5-

bisphosphate to produce the products, inositol triphosphate (IP3) and diacylglycerol (DAG). IP3 releases intracellular calcium from the endoplasmic reticulum, and would therefore generate a robust signal. DAG activates protein kinase C. Beta-1 adrenergic receptors (choice B) stimulate adenylate cyclase via the G protein Gs, leading to an increase in intracellular cAMP. All beta adrenergic receptors share a common mechanism of action. Dopamine-1 receptors (choice C) stimulate adenylate cyclase via the G protein Gs. This leads to an increase in intracellular cAMP. Muscarinic acetylcholine receptors (choice D) inhibit adenylate cyclase via the G protein Gi. This leads to an decrease in intracellular cAMP. Muscarinic receptors also stimulate the opening of potassium channels in the heart, via the beta and gamma subunits of Gi. Nicotinic acetylcholine receptors (choice E) are ligand-gated ion channels. When stimulated, they allow sodium ions to enter the cell.

50>The correct answer is D. The child has Hartnup's disease. This condition clinically resembles pellagra ("diarrhea, dementia, and dermatitis"), and may be misdiagnosed as this nutritional (niacin) deficiency. In fact, niacin therapy may actually be helpful in controlling the symptoms. The underlying problem is a defect in the epithelial transport of neutral amino acids, including tryptophan, which can act as a precursor of niacin. The defective amino acid transport leads to poor absorption of dietary amino acids as well as excess amino acid secretion in the urine. Alkaptonuria (choice A) is characterized by urine that turns black upon standing and a debilitating arthritis. Carcinoid syndrome (choice B) is seen in patients with carcinoid tumor. It is characterized by episodes of flushing, diarrhea, hypertension, and bronchoconstriction. Ehlers-Danlos syndrome (choice C) is a disease characterized by abnormal collagen formation leading to very elastic skin, joint problems, and fragility of some blood vessels and the intestines. Scurvy (choice E) is due to vitamin C deficiency. It is characterized by easy bruising and gum problems.

<1>A 72-year-old male is noted as having a 9-pound weight loss over the past few weeks. His past medical history is significant for oat cell carcinoma of the lung, without known metastases, for which he is currently undergoing treatment. The patient states that even though his wife is preparing his favorite meals, he is not hungry. Which of the following would be the best treatment option to improve his eating habits? A. Amitriptyline B. Megestrol acetate C. Methotrexate D. Neostigmine E. Prochlorperazine Answer

<2>A 45-year-old homeless man has a chronic cough, a cavitary lesion of the lung, and is sputum positive for acid-fast bacilli. Which of the following is the principle form of defense by which the patient's body fights this infection? A. Antibody-mediated phagocytosis B. Cell-mediated immunity C. IgA-mediated hypersensitivity D. IgE-mediated hypersensitivity E. Neutrophil ingestion of bacteria

Answer

<3>A researcher is examining the distribution of an ion channel protein in the kidney. She incubates slices of kidney tissue in a dilute solution of a specific antibody directed against the protein, then uses the immunoperoxidase method to localize the ion channel proteins. She notes the presence of brown pigment in a population of epithelial cells, which on closer examination, have a brush border. The researcher concludes that the protein is probably present in cells of the A. collecting duct B. deep portion of loop of Henle C. distal convoluted tubule D. glomerulus E. proximal convoluted tubule

Answer

<4>A 38-year-old pregnant woman with a past medical history significant for chronic hypertension presents with a blood pressure of 158/105 mm Hg. Which of the following antihypertensive agents would be most suitable for initial therapy in this patient? A. Bumetanide B. Fosinopril C. Hydrochlorothiazide D. Methyldopa E. Valsartan

Answer

<5>A 3 year-old boy is brought to a physician because the mother notices tha t the child is engaging in less active play and tires easily. During physical

examination, the pediatrician notices that the child's thighs are larger than normal for age and that the child cannot stand up without using his arms to help. Further studies demonstrate a defective dystrophin gene in the boy. Which of the following people in the child's family is most likely to also have this disease? A. Father B. Father's brother C. Mother D. Mother's brother E. Sister

Answer

<6> The leukocyte pictured above stains intensely with acidic dyes such as eosin. Which of the following substances is contained in the crystalline core of the granule at the arrow? A. Lactoferrin B. Major basic protein C. Myeloperoxidase D. Histamine E. Tartrate-resistant acid phosphatase

Answer

<7>A 7-year-old boy is brought to a physician because of a nearly confluent, fine, erythematous, macular rash that is most pronounced on his trunk. He has had a mild fever for 36 hours, but does not appear very sick, and is happily playing when the pediatrician enters the examining room. Physical examination demonstrates a reddened throat with tonsillar exudates, enlarged cervical nodes including the occipital node, and questionable splenomegaly. The mother says that the boy has not been coughing, and no Koplik spots are noted. Which of the following is the most likely diagnosis? A. Bullous pemphigoid B. Dermatitis herpetiformis C. Herpes simplex D. Measles E. Rubella

Answer

<8>A child who has had abnormal development of the membranous bones has a

broad skull with associated facial and dental anomalies. Which other bones are most likely to also be affected? A. B. C. D. E. Answer clavicles Femurs Metatarsals Phalanges Tibias

<9>A 33-year-old woman presents with fever, vomiting, severe irritative voiding symptoms, and pronounced costovertebral angle tenderness. Laboratory evaluation reveals leukocytosis with a left shift; blood cultures indicate bacteremia. Urinalysis shows pyuria, mild hematuria, and gram-negative bacteria. Which of the following drugs would best treat this patient's infection? A. Ampicillin and gentamicin B. Erythromycin C. Gentamicin and vancomycin D. Phenazopyridine and nitrofurantoin E. Tetracycline Answer

<10>A surgical pathology specimen from a 24-year-old woman seen at a reproductive medicine clinic demonstrates a ciliated columnar epithelium. From which of the following locations in the female genital tract was the biopsy obtained? A. Cervix B. Endometrium C. Fallopian tube D. Ovary E. Vagina Answer

<11>In a genotypic male, the testes fail to develop, and do not secrete testosterone or Müllerian regression factor. Which of the following best describes the in utero reproductive system development of this individual ? A. Both male- and female-type internal reproductive tracts and male-type external genitalia B. Female-type internal reproductive tract and female-type external genitalia C. Female-type internal reproductive tract and male-type external genitalia D. Male-type internal reproductive tract and female-type external genitalia E. Male-type internal reproductive tract and male-type external genitalia

Answer

<12>A pulmonologist is testing a patient's lung volumes and capacities using simple spirometry. Which of the following lung volumes or capacities cannot be measured directly using this technique? A. Expiratory reserve volume B. Functional residual capacity C. Inspiratory reserve volume D. Tidal volume E. Vital capacity Answer

<13>Contraction of which of the following muscles contributes most to the backward movement of the lower jaw during the process of mastication? A. Digastric B. Lateral pterygoid C. Medial pterygoid D. Mylohyoid E. Temporalis Answer

<14>A 28-year-old female presents to the doctor complaining of syncopal episodes that last a few minutes. She is not taking any medications and has no previous medical history. EEG and EKG studies are performed and are unremarkable. An echocardiogram shows a single ball-shaped mass dangling in the left atrium near the mitral valve. The most likely diagnosis is A. angiosarcoma B. mesothelioma C. myxoma D. rhabdomyoma E. rhabdomyosarcoma Answer

<15>A patient who has been exhibiting various endocrine abnormalities has an MRI scan of the head. This scan reveals a small tumor of the pituitary gland. If this tumor expands laterally, which of the following nerves will most likely be affected first? A. Abducens nerve B. Oculomotor nerve

C. D. E. Answer

Optic nerve Trigeminal nerve Trochlear nerve

<16>A liver biopsy from a 54-year-old man shows many Mallory bodies. This finding is most suggestive of which of the following diseases? A. Alcohol abuse B. Alpha1-antitrypsin deficiency C. Hepatitis A D. Hepatitis B E. Wilson's disease Answer

<17>A 27-year-old man has been arrested by the police for hitting, cursing at, and verbally berating his wife of 8 years. The wife tells the police he also regularly physically whips his 7-year-old son with a leather belt and often strikes the boy with his hand. When asked why he does this, he responds that this is "how my father treated me, it's how men should act." This represents which of the following types of learning? A. Classical conditioning B. Cognitive learning C. Imprinting D. Operant conditioning E. Social learning Answer

<18>A 64-year-old man presents to his doctor with aching, burning pain afte r meals. He had been self-medicating for several months with antacids, but he found this to be increasingly ineffective. His physician decides to take him off the antacids and instead places him on a combination of ranitidine and sucralfate. Why is this combination a bad idea? A. Ranitidine increases the toxicity of sucralfate B. Ranitidine inhibits the action of sucralfate C. Sucralfate and ranitidine coprecipitate D. Sucralfate increases the toxicity of ranitidine E. Sucralfate inhibits the action of ranitidine Answer

<19>A 42-year-old female presents with a recent onset of fatigue, malaise,

constipation, and a 12-pound weight gain. On examination, her thyroid is firm and enlarged. What laboratory test is most likely to confirm the expected diagnosis? A. Antithyroid antibodies B. Serum thyroid-stimulating hormone (TSH) measurement C. Serum thyroxine (T4) measurement D. Serum triiodothyronine (T3) measurement E. T3 resin uptake Answer

<20>A 70-year-old man with a history of atrial fibrillation is started on an oral anticoagulant. His prothrombin time is monitored on a regular basis. A few months into his therapy, he begins treatment for a duodenal ulcer and he develops symptoms of a bleeding diathesis. Which of the following ulcer medications is most likely responsible for this change in his hemostatic status? A. Cimetidine B. Famotidine C. Misoprostol D. Omeprazole E. Ranitidine Answer

<21>An elderly woman with a history of multiple oral ulcers presents with flaccid bullae on her scalp, face, and trunk. Manual pressure on the skin produces separation of the upper layer of the epidermis, followed by eventual sloughing of the skin. The patient has been in relatively good health until recently, and denies taking any medications. A biopsy of one of the skin lesions reveals separation of epithelial cells above the basal layer. Autoantibodies to which of the following components would most likely be found in this patient? A. Epidermal basement membrane proteins B. Glycoprotein IIb/IIIa C. Intercellular junctions of epidermal cells D. Intrinsic factor E. Type IV collagen Answer

<22>A 35-year-old woman notices a change in the appearance of a mole on her neck. Physical examination reveals that the lesion is an irregular, nodular, superficial mass with a variegated appearance. Biopsy demonstrates a primary malignant tumor. Which of the following factors is most predictive of the patient's long term prognosis? A. Circumference of lesion

B. C. D. E. Answer

Darkness of lesion Degree of color variation Depth of lesion Sharpness of border between lesion and adjacent skin

<23>During embryological development, hematopoiesis occurs in different organs at different times. Which of the following are the correct organs, in the correct sequence, at which hematopoiesis occurs embryologically? A. Amnion, yolk sac, placenta, bone marrow B. Placenta, liver and spleen, yolk sac, bone marrow C. Placenta, spleen and lymphatic organs, bone marrow D. Yolk sac, bone marrow, liver and spleen E. Yolk sac, liver, spleen and lymphatic organs, bone marrow Answer

<24>A 6-month-old boy is brought to the pediatrician by his parents, who are first cousins. This is their first child. Physical examination reveals a small, thin, lethargic infant with slightly misshapen long bones. His features are somewhat coarse. Joint movements are restricted, his corneas are clouded, and his gums are underdeveloped. His liver is not enlarged. Serum levels of acid hydrolases are found to be elevated. The child most likely has a defect in which of the following metabolic activities? A. Degradation of dermatan sulfate and heparan sulfate B. Degradation of gangliosides C. Degradation of glycogen D. Degradation of sphingomyelin E. Phosphorylation of mannose moieties F. Phosphorylation of tyrosine moieties Answer

<25>A particular association determines membership on the basis of members' IQ scores. Only those persons who have documented IQ scores at least 2 standard deviations above the mean on the Wechsler Adult Intelligence Scale (WAIS) are eligible for admission. Of a group of 200 people randomly selected from the population at large, how many would be eligible for membership to this society? A. 1 B. 2 C. 3 D. 4 E. 5

Answer

<26>5 mL of synovial fluid is aspirated from an inflamed knee joint. The fluid is yellow-white and cloudy and contains 200,000 WBC/mm3 (85% neutrophils). Needle-shaped, strongly negatively birefringent crystals are seen both within and outside neutrophils. These crystals most likely have which of the following compositions? A. Basic calcium phosphate B. Calcium oxalate C. Calcium pyrophosphate dihydrate D. Cholesterol E. Monosodium urate Answer

<27>A patient has a painful ulcer on the tip of his tongue. Which of the following cranial nerves carries the pain sensation he experiences? A. V2 B. V3 C. VII D. IX E. X Answer

<28>A 30-year-old veterinarian on a cattle ranch presents with a 1-to-2-month history of malaise, chills, drenching malodorous sweats, fatigue, and weakness. He has anorexia and has lost 15 pounds. He has intermittent fevers that range up to 103 F (39.4 C). He complains of visual blurring. A physical examination reveals mild lymphadenopathy, petechiae, and a cardiac murmur consistent with aortic insufficiency. What is the most likely etiologic agent? A. Bacillus anthracis B. Brucella abortus C. Coccidioides immitis D. Erysipelothrix rhusiopathiae E. Trichinella spiralis Answer

<29>The parents of a 6-month-old child who was normal at birth bring her into the clinic. Since their emigration to the U.S. from Eastern Europe soon after her birth, the child has developed diminished responsiveness

, progressive blindness and deafness, and recently, seizures. Serum levels of which of the following compounds would be expected to be decreased in both of the parents? A. Dystrophin B. Hexosaminidase A C. Hypoxanthine-guanine phosphoribosyltransferase (HGPRT) D. Phenylalanine hydroxylase E. Vitamin D3 Answer

<30>A 60-year-old male with angina comes to the emergency room with severe chest pain unresponsive to sublingual nitroglycerin. An EKG shows ST segment elevation in the anterolateral leads, and thrombolytic therapy is initiated. If streptokinase is given to this patient, it may produce thrombolysis after binding to which of the following proteins? A. Antithrombin III B. Fibrin C. Plasminogen D. Protein C E. Thrombomodulin Answer

<31>The left adrenal vein drains directly into which of the following veins? A. Hemiazygos vein B. Inferior vena cava C. Left renal vein D. Splenic vein E. Superior mesenteric vein Answer

<32>A premature infant develops progressive difficulty breathing over the first few days of life. Deficient surfactant synthesis by which of the following cell types may have contributed to the baby's respiratory problems? A. Alveolar capillary endothelial cells B. Bronchial mucous cells C. Bronchial respiratory epithelium D. Type I pneumocytes E. Type II pneumocytes Answer

<33>A surgeon performs an exploratory laparotomy, producing a large incision in the patient's abdomen. Poor blood supply to which of the following is most likely to cause problems during the healing process? A. Adipose tissue B. Aponeuroses C. Loose connective tissue D. Muscle E. Skin Answer

<34>A 1-year-old child develops voluminous watery diarrhea and vomiting. She is brought to the pediatrician by her parents and evaluated, then sent home with instructions for the parents to give the child an electrolyte replacement solution. Which of the following viruses is the most likely cause of the child's diarrhea? A. Coronavirus B. Lymphocytic choriomeningitis virus C. Norwalk agent D. Orbivirus E. Rotavirus <35>A 2-year-old child presents to the pediatrician with hematuria. Examination reveals hypertension and an abdominal mass. A tumor is localized to the right kidney and biopsy reveals a stroma containing smooth and striated muscle, bone, cartilage, and fat, with areas of necrosis. The gene for this disorder has been localized to which of the following chromosomes? A. 5 B. 11 C. 13 D. 17 E. 22 Answer

<36>A newborn baby has a prominent defect at the base of his spine through which his meninges and spinal cord protrude. A failure of which of the following processes is the most common cause of this type of defect? A. Development of primary vertebral ossification centers B. Development of the body C. Development of the pedicle D. Development of the superior articular process E. Fusion of the vertebral arches Answer

<37>A 45-year-old male presents to the physician with muscle cramps, perioral numbness, and irritability over the past 3 to 4 months. Lab results reveal hypocalcemia, normal albumin level, and hyperphosphatemia . Parathyroid hormone level is decreased. Alkaline phosphatase level is normal. Which of the following is most likely causing this clinical scenario? A. Bone metastases B. Hashimoto's thyroiditis C. Hypervitaminosis D D. Hypomagnesemia E. Previous subtotal thyroidectomy Answer

<38>In which of the following organs are fenestrated endothelial cells common? A. Heart B. Liver C. Lungs D. Pancreas E. Stomach Answer

<39>A macroscopic hepatic change known as nutmeg liver is indicative of A. acute left-sided heart failure B. acute right-sided heart failure C. alcohol toxicity D. chronic congestive heart failure E. liver cirrhosis Answer

<40>A 26-year-old man is admitted through the emergency department to the hospital for a heroin overdose. His heart rate is 45 beats/min, and his blood pressure is 75/40 mm Hg. Which of the following best depicts the results from an arterial blood sample ? pH PaCO2 (mm Hg) HCO3- (mEq/L) A. 7.22 66 26 B. 7.34 29 15 C. 7.40 40 24 D. 7.47 20 14 E. 7.49 48 35

Answer

<41> The maximum expiratory flow-volume curve shown above is created when the patient inhales as much air as possible and then expires with maximum effort until no more air can be expired. What is the forced vital capacity of this patient? A. 1.5 Liters B. 2.5 Liters C. 3.5 Liters D. 4.5 Liters E. 6.0 Liters Answer

<42>A 25-year-old male gets into a brawl outside a bar. During the altercation, someone pulls out a gun and shoots him in the head. The bullet enters the man's temple and severs his right optic nerve completely. He is quickly transported to a nearby emergency room and an emergency physician tests his pupillary response by shining a light in the right eye. What will the physician most likely find? A. No pupillary constriction in the right eye, and no pupillary constriction in the left eye B. No pupillary constriction in the right eye, but pupillary constriction in the left eye C. Pupillary constriction followed by pupillary dilatation in both eyes D. Pupillary constriction in the right eye, and no pupillary constriction in the left eye E. Pupillary constriction in both eyes F. Pupillary dilatation in both eyes Answer

<43>A patient complaining of chest pain with exercise is evaluated by cardiac catheterization. The left anterior descending (LAD) branch of the coronary artery is visualized but the contrast angiography is poor . A Doppler-tipped catheter is inserted and the blood velocity is observed to increase transiently from 10 cm/sec to 70 cm/sec and then decrease bac k to 10 cm/sec as the probe passes a particular location in the artery . What was the cause of these changes in velocity measurements? A. A coronary artery aneurysm with a cross-sectional area 1/7th the size of the native artery B. A coronary artery aneurysm with a cross-sectional area 7 times greater than the native artery C. A coronary artery obstruction with a cross-sectional area 1/7th of the size of the native artery D. A coronary artery obstruction with a cross-sectional area 7 times greater than the native artery

Answer

<44>Type of blood vessel resistance) Aorta and large arteries Small arteries 10-20 Arterioles 50 Capillaries 25 Venules and small veins Vena cave <1

Fall in blood pressure (mm Hg) (% of total peripheral <1

9

The table above shows the fall in blood pressure that occurs for the various types of blood vessels as blood flows from the aorta (100 mm Hg) to the right atrium (0 mm Hg). Which of the following types of blood vessel is likely to have the highest ratio of wall cross-sectional area to lumen cross-sectional area? A. Aorta and large arteries B. Small arteries C. Arterioles D. Capillaries E. Venules and small veins F. Vena cavae Answer

<45>Evaluation of an infant with a variety of congenital abnormalities reveals hypocalcemia due to a lack of parathyroid hormone. On x-ray, the thymic shadow is absent. A failure of development and differentiation of which of the following embryonic structures would most likely be responsible for the observed presentation? A. Second pharyngeal arch B. Second pharyngeal cleft C. Second pharyngeal pouch D. Third pharyngeal arch E. Third pharyngeal pouch Answer

<46>A person lifts one foot prior to taking a step. Which of the following nerves innervates the muscle group that allows the person to maintain balance by holding the weight of his body over the foot remaining on the ground? A. Femoral nerve

B. C. D. E. Answer

First and second sacral nerves Obturator nerve Superior gluteal nerve Tibial nerve

<47>A 21-year-old college student from Connecticut with a past history of Lyme disease presents with chronic pain and swelling in his right knee. He states that he has had problems with the knee for the past two years. Which of the following HLA alleles would you expect to be present in this individual? A. HLA-B9 B. HLA-B17 C. HLA-B27 D. HLA-DR3 E. HLA-DR4 Answer

<48>Which of the following metabolic processes occurs exclusively in the mitochondria? A. Cholesterol synthesis B. Fatty acid synthesis C. Gluconeogenesis D. Glycolysis E. Hexose monophosphate shunt F. Ketone body synthesis G. Urea cycle

Answer

49>An alert pediatric intern notices that a neonate with dysmorphic facies is twitching abnormally. As he watches, the baby experiences a seizure. Stat laboratories indicate a glucose of 90, serum sodium of 140, serum potassium of 4.2 and serum calcium of 3.9. Over the next several months, the child is admitted to the hospital twice for Candida infections, and once for a viral exanthem. Which of the following is the most likely diagnosis? A. Ataxia telangiectasia B. Bruton's hypogammaglobulinemia C. DiGeorge syndrome D. Severe combined immunodeficiency E. Wiskott-Aldrich syndrome Answer

50>A 2-month-old boy is evaluated for failure to thrive. As the pediatrician is examining the patient, she witnesses a seizure. Physical examination is remarkable for hepatomegaly, a finding later confirmed by CT scan, which also reveals renomegaly. Serum chemistries demonstrate severe hypoglycemia, hyperlipidemia, lactic acidosis, and ketosis. Which of the following diseases best accounts for this presentation? A. Gaucher's disease B. McArdle's disease C. Niemann-Pick disease D. Pompe's disease E. von Gierke's disease Answer

Answer

Answers

1>The correct answer is B. One of the most common side effects of any antineoplastic therapy is weight loss secondary to decreased appetite and/or nausea and vomiting. Furthermore, weight loss due to decreased food intake tends to occur more frequently in elderly patients receiving antineoplastic therapy. One medication that has consistently helped to increase appetite in such patients is megestrol acetate. This agent is a progestational hormone with antineoplastic properties used in the treatment of advanced carcinoma of the breast and endometrium. Megestrol, when given in relatively high doses, can substantially increase the appetite in most individuals, even those with advanced cancer. Amitriptyline (choice A) is a tricyclic antidepressant used in the treatment of depression. There is nothing mentioned in the case study to suggest that the patient is clinically depressed; hence, this agent would provide no benefit. Methotrexate (choice C) is an antimetabolite and folic acid antagonist commonly used in various neoplastic disorders and in the treatment of rheumatoid arthritis. Since nausea, vomiting, and ulcerative stomatitis are common side effects of this medication, its usage in this patient would not be recommended. Neostigmine (choice D) is a carbamylating acetylcholinesterase inhibitor that would not increase appetite. Prochlorperazine (choice E) is a phenothiazine derivative used primarily to control severe nausea and vomiting. This patient is not experiencing nausea. Furthermore, this agent does not possess appetite-stimulating properties.

2>The correct answer is B. The principle host defense in mycobacterial infections (such as this patient's tuberculosis) is cell-mediated immunity, which causes formation of granulomas. Unfortunately, in tuberculosis and in many other infectious diseases characterized by granuloma formation, the organisms may persist intracellularly for years in the granulomas, only to be a source of activation of the infection up to decades later. While antibody-mediated phagocytosis (choice A) is a major host defense against many bacteria, it is not the principle defense against Mycobacteria. IgA-mediated hypersensitivity (choice C) is not involved in the body's defense against Mycobacteria. IgE-mediated hypersensitivity (choice D) is not involved in the body's defense against Mycobacteria. It is important in allergic reactions. Neutrophil ingestion of bacteria (choice E) is a major host defense against bacteria, but is not the principle defense against Mycobacteria.

3>The correct answer is E. The immunoperoxidase method uses horseradish peroxidase to produce a visible pigment when a specific antibody binds to antigenic sites in the tissue. Binding of the antibody to the epithelial cells indicates that the protein in question is being expressed by those cells. The positive immunoperoxidase results obtained here suggests that the channel protein is expressed in proximal convoluted tubular epithelium, since this is the only site in the kidney at which the epithelial cells have a "brush border." The brush border is made of microvilli, which enhance the proximal tubules' ability to reabsorb plasma constituents filtered at the glomeruli.

4>The correct answer is D. Pregnant women with chronic hypertension "require" antihypertensive therapy when the diastolic pressure is greater than 100 mm Hg; however, some clinicians may decide to treat patients with diastolic blood pressures less than 100 mm Hg. For the initiation of therapy, methyldopa is still considered to be the agent of choice. Methyldopa is converted intraneuronally to a-methylnorepinephrine, an alpha-2 adrenergic agonist, which is subsequently released. Release of a-methylnorepinephrine in the medulla leads to a decrease in sympathetic outflow, thus lowering blood pressure. Methyldopa has been safely used in the treatment of hypertension during pregnancy; this agent is not associated with the development of teratogenic or other fetal abnormalities. Diuretics, such as bumetanide (choice A) and hydrochlorothiazide (choice C), are often avoided since these agents can produce hypovolemia, leading to reduced uterine blood flow. Although these agents can be used during pregnancy, methyldopa and hydralazine are the drugs of choice for hypertension during pregnancy. Fosinopril (choice B) is an angiotensin-converting enzyme (ACE) inhibitor that should not be administered to pregnant women, especially in the second or third trimesters. These agents have been associated with severe fetal and neonatal injury, such as hypotension, neonatal skull hypoplasia, anuria, renal failure, and death. Along the same lines, the use of the angiotensin II receptor antagonists, such as valsartan (choice E), is not recommended since these agents cause fetal complications similar to the ACE inhibitors.

5>The correct answer is D. The disease is Duchenne muscular dystrophy, an X-linked recessive muscular disease usually caused by a deletion involving the dystrophin gene. This

defect produces accelerated muscle breakdown leading initially to proximal muscle weakness, then later to generalized weakness that typically begins before age 5. A feature of X-linked recessive diseases is that carrier mothers pass the disease to half their sons; affected fathers can have carrier daughters but not affected sons. Since the mother is presumably normal (because the disease is X-linked), she must be a carrier to have an affected son, and the grandmother must also be a carrier, therefore the mother's brother (maternal uncle) may also have the disease. The father's (choice A) side of the family, including the father's brother (choice B), most likely does not carry the defective gene (since they themselves would be affected, and furthermore since the father cannot pass the gene on to a son). It would be extremely unlikely for a carrier female to marry an affected male (and the question does not mention any similar symptoms in the father). The mother (choice C) and possibly the sister (choice E) are carriers of, but not affected by, the defective gene.

6>The correct answer is B. The cell pictured is an eosinophil, a member of the granulocytic lineage of white blood cells. The crystalline core of the granule contains a protein called the major basic protein, which appears to function in the destruction of parasites. Major basic protein also has deleterious effects on epithelial cells in patients with asthmatic reactions. The light component around the dense crystalline core contains products such as histaminase, arylsulfatase, and other enzymes. Lactoferrin (choice A) is found in the specific granules of the neutrophil. It inhibits the growth of bacteria by interfering with iron metabolism. Myeloperoxidase (choice C) is found in the azurophilic (large) granule of the neutrophil. This enzyme is also destructive to bacteria, destroying their cell walls. Histamine (choice D) is produced by the basophil and the mast cell. The histaminase of the eosinophil regulates the inflammatory reaction of these two cell types. Tartrate-resistant acid phosphatase (choice E) is a marker for hairy cell leukemia, a neoplasm of the B lymphocyte line.

7>The correct answer is E. This presentation (fine, nonblotchy, truncal rash in a not-very-ill child) is characteristic of rubella, or German measles. IgM specific for rubella can often be detected in serum within 1-2 days of developing the rash. The principal significance of this disease is that it can cause a devastating congenital infection characterized by ocular problems (cataracts, retinopathy, microphthalmos, glaucoma), cardiovascular problems (patent ductus arteriosus, ventricular septal defect, pulmonary stenosis), deafness, thrombocytopenic purpura, hepatosplenomegaly, CNS problems, and bony lesions. Bullous pemphigoid (choice A) produces large, tense blisters. Dermatitis herpetiformis (choice B) causes recurrent crops of small vesicles or papules. Herpes simplex (choice C) is characterized by crops of vesicles on oral or genital sites. Measles (choice D) causes a blotchy, maculopapular erythematous rash that begins on the face and spreads downward. Patients with measles are usually much sicker than those with German measles, and Koplik spots maybe seen on the buccal mucosa.

8>The correct answer is A. In a syndrome called cleidocranial dysostosis, absence of part of the clavicles accompanies a broad skull, and facial and dental anomalies. Note that you could

also have answered this question by noting that of the bones listed, only the clavicles form by intramembranous ossification. The femurs (choice B), metatarsals (choice C), phalanges (choice D), and tibias (choice E) are cartilaginous (formed by endochondral ossification) rather than membranous bones.

9>The correct answer is A. Acute pyelonephritis is an infectious disease involving the kidney parenchyma and the renal pelvis. Gram-negative bacteria, such as Escherichia coli, Proteus, Klebsiella, and Enterobacter, are the most common causative organisms in acute pyelonephritis. Laboratory evaluation will often reveal leukocytosis with a left shift, and urinalysis typically shows pyuria, varying degrees of hematuria, and white cell casts. Since bacteremia is present, the patient should be hospitalized and empirically started on IV ampicillin and gentamicin. This regimen may be need to be changed, however, once the sensitivity results are available. Erythromycin (choice B) and tetracycline (choice E) are both bacteriostatic antibiotics and would not be recommended in a patient with a severe infection, such as acute pyelonephritis with bacteremia. Vancomycin (choice C) is primarily used in the treatment of severe gram-positive infections. Phenazopyridine (choice D) is a urinary analgesic, and nitrofurantoin (choice D) is a urinary tract anti-infective. Although nitrofurantoin is indicated for the treatment of "mild" cases of pyelonephritis, as well as cystitis, this patient's condition is severe and should be treated with appropriate antibiotics.

10>The correct answer is C. The fallopian tube is the only structure in the female genital tract with a ciliated columnar epithelium; the beating of the cilia helps move the egg into the uterus. This fact is also sometimes clinically helpful since dilated and deformed fallopian tubes can be microscopically distinguished from cystic ovarian tumors by the presence of the cilia. The cervix (choice A) and vagina (choice E) are lined by squamous epithelium. The endometrium (choice B) is lined by columnar epithelium (although a few ciliated cells may be present). The covering of the ovary (choice D) is cuboidal epithelium, and cysts within the ovary can be lined by cuboidal or non-ciliated columnar epithelium.

11>The correct answer is B. The description is that of gonadal dysgenesis. In the absence of testosterone, the Wolffian ducts will regress and fail to differentiate into normal male internal reproductive tracts. In the absence of Müllerian regression factor, the Müllerian ducts will automatically differentiate into oviducts and a uterus. Differentiation of the male external genitals is dependent on adequate dihydrotestosterone (via an action of 5 a-reductase on testosterone). In the absence of testosterone, female-type external genitalia will develop. Selective dysgenesis of the Sertoli cells could produce the situation described in choice A. Normal Leydig cells would secrete testosterone and produce normal male-type internal and external tracts. However, the absence of Müllerian regression factor, which is secreted by the Sertoli cells, would allow formation of female-type internal structures as well. Female-type internal reproductive tract and male-type external genitalia (choice C) would not be likely to occur under any circumstances.

The situation described in choice D could occur with 5 a-reductase deficiency. Normal maletype internal tracts can form because there is no requirement for dihydrotestosterone. Müllerian regression factor will prevent differentiation of female-type internal tracts. Since differentiation of the normal male external genitals requires dihydrotestosterone, 5 areductase deficiency will lead to feminization. The situation described in choice E is normal, and would not occur in the individual described who has testicular dysgenesis.

12>The correct answer is B. The functional residual capacity is the amount of air left in the lungs after a normal expiration. Because this volume cannot be expired in its entirety, it cannot be measured by spirometry. Essentially, lung volume that contains the residual volume, which is the amount of air remaining after maximal expiration (e.g., functional residual capacity and total lung capacity), cannot be measured by spirometry. These volumes can be determined using helium dilution techniques coupled with spirometry or body plethysmography. The expiratory reserve volume (choice A) is the volume of air that can be expired after expiration of a tidal volume. The inspiratory reserve volume (choice C) is the volume of air that can be inspired after inspiration of a tidal volume. Tidal volume (choice D) is the amount of air inspired or expired with each normal breath. Vital capacity (choice E) is the volume of air expired after a maximal inspiration

13>The correct answer is E. Mastication is a complex process involving alternating elevation, depression, forward movement, and backward movement of the lower jaw. The backward movement step is accomplished by the posterior fibers of the temporalis muscle. The digastric (choice A) helps to depress the lower jaw during chewing. The lateral pterygoid (choice B) helps to move the lower jaw forward during chewing. The medial pterygoid (choice C) helps to elevate the lower jaw during chewing. The mylohyoid (choice D) helps to depress the lower jaw during chewing.

14>The correct answer is C. The vignette illustrates a typical presentation for a tumor of the heart. Primary cardiac tumors are rare and usually require an intensive work-up to pinpoint the diagnosis. 75% of primary cardiac tumors are benign and among these, myxoma is the most common. The tumors are usually single; the most common location is the left atrium. They may cause syncopal episodes or even shock and death due to obstruction by a "ball valve" mechanism. Angiosarcoma (choice A) is a malignant tumor of vascular origin that can occur as a primary cardiac tumor. It is the most common malignant primary cardiac tumor, but it is still very rare. Angiosarcoma usually affects the right side of the heart. Mesothelioma (choice B) is a benign tumor of mesothelial origin that can rarely present as a primary cardiac tumor. It is usually a small intramyocardial tumor that presents with disturbances of the conduction system of the heart. Rhabdomyoma (choice D) is a benign tumor of muscle origin. It can occur as a primary cardiac tumor, typically in infants and children, in whom it may be associated with tuberous sclerosis. It usually occurs in the ventricles.

Rhabdomyosarcoma (choice E) is a malignant neoplasm that can also occur as a rare primary cardiac tumor. It is of muscle origin and usually affects the right heart.

15>The correct answer is A. The pituitary gland is located in the pituitary fossa within the skull. The floor of this fossa is formed by the sella turcica. The lateral walls of the fossa are formed by the cavernous sinuses. The abducens nerve passes through the cavernous sinus along with the internal carotid artery. As the tumor expands laterally, the first nerve that will be encountered is the abducens nerve, producing a lateral rectus palsy. The oculomotor nerve (choice B) lies in the lateral wall of the cavernous sinus. It is further from the pituitary gland than is the abducens nerve. The optic nerve (choice C) is anterosuperior to the pituitary gland. Upward expansion of the tumor may compress the optic chiasm. The trigeminal nerve (choice D) is found posterior to the cavernous sinus. Two of its three divisions (ophthalmic and maxillary divisions) pass through the lateral wall of the cavernous sinus and are further from the pituitary gland than is the abducens nerve. The trochlear nerve (choice E) is also in the lateral wall of the cavernous sinus, and would be affected later if the tumor continued to expand.

16>The correct answer is A. Mallory bodies are eosinophilic cytoplasmic inclusions ("alcoholic hyaline") that are found in the largest numbers in alcoholic hepatitis. They were originally considered to be pathognomic of alcohol abuse, but have since been found (in much smaller numbers) in many other liver conditions. Alpha1-antitrypsin deficiency (choice B) involvement of the liver is characterized by periodic acid Schiff (PAS)-positive cytoplasmic granules in hepatocytes. Hepatitis A (choice C) and hepatitis B (choice D) infections are definitively established with serologic markers. In Wilson's disease (choice E), there is excess copper deposition in the liver

17>The correct answer is E. In social learning, also known as modeling, behavior is acquired by watching other persons and assimilating their actions into the behavioral repertoire. There is no verbal or cognitive process (choice B) that is involved, no reinforcement (as in operant conditioning; choice D), no pairing of stimuli to get stimulus substitution (as in classical conditioning; choice A), nor any early-life bonding or imprinting (choice C) involved in this type of process. Because behaviors such as spousal abuse, child abuse, and elder abuse are all based on observing and incorporating behaviors from significant others, the person displaying the behaviors does not realize the behaviors are inappropriate and is typically very resistant to change. The fact that the learning is nonverbal and not dependent upon reinforcement contributes to the resistance to change.

18>The correct answer is B. Sucralfate is a promising drug that is not presently in widespread use because it is incompatible with H2 antagonists such as cimetidine, ranitidine, famotidine and nizatidine. Sucralfate is aluminum sucrose sulfate, a sulfated disaccharide, which polymerizes and binds to ulcerated tissue. It forms a protective coating against acid, pepsin and bile, giving the tissue a chance to heal. Unfortunately, a low gastric pH is required for polymerization, meaning that sucralfate is incompatible with drugs that reduce gastric acidity,

such as H2 blockers and antacids. The moral of the story is that you cannot assume that two medications that are individually helpful in a medical condition will be synergistic. Learning the mechanisms by which the drugs work will help you spot potential interactions and earn you points on the USMLE.

19>The correct answer is B. The patient's presentation is consistent with hypothyroidism. Serum thyroid-stimulating hormone (TSH) measurement (choice B) is most likely to confirm the empiric diagnosis. TSH levels usually rise above normal before serum thyroxine (T4; choice C) and serum triiodothyronine (T3; choice D) levels do, even in mild cases of hypothyroidism. Therefore, TSH measurement would be the most accurate test to determine the presence of hypothyroidism regardless of the severity. A high titer of antithyroid antibodies (choice A) is characteristic of chronic thyroiditis, which is the most common cause of hypothyroidism. However, detection of these antibodies would not indicate if hypothyroidism was present. T3 resin uptake (choice E) measurement is not an accurate test of thyroid function; it is primarily used to exclude various abnormalities in the thyroid-hormone binding proteins.

20>The correct answer is A. Warfarin is the oral anticoagulant the patient was most likely taking. This drug is commonly prescribed to patients with atrial fibrillation to prevent the formation of atrial thrombi. Warfarin increases prothrombin time (PT) because it interferes with the synthesis of the vitamin K clotting factors of the liver (II, VII, IX, and X) and therefore necessitates regular monitoring of the PT. Cimetidine is an H2-blocker that inhibits hepatic enzymes, including those that metabolize warfarin. Consequently, coadministration of warfarin and cimetidine results in enhanced warfarin activity, producing pronounced anticoagulation and the bleeding diathesis in the patient in question. Cimetidine has one of the worst side effect profiles of all the H2-blockers and may also result in gynecomastia in men. Famotidine (choice B) is an H2-blocker that does not affect liver metabolism. Misoprostol (choice C) is a prostaglandin E1 analog used in peptic ulcer disease. It does not affect hepatic metabolism. Omeprazole (choice D) is a proton-pump inhibitor used to decrease acid production in patients with peptic ulcer disease or reflux. It does not affect drug metabolism by the liver. Ranitidine (choice E) is another H2-blocker. It does not inhibit liver enzymes as strongly as cimetidine does.

21>The correct answer is C. Bullae with the cleavage plane above the basal layer of the epidermis suggests pemphigus vulgaris, which is caused by autoantibodies to intercellular junctions of epidermal cells. The autoantibodies decrease the ability of the keratinocytes to adhere to one another, permitting formation of vesicles and bullae. Oral involvement is common, and often precedes the characteristic skin lesions. Separation of the epidermis upon manual stroking of the skin is known as Nikolsky's sign. This sign is present in other disorders such as Stevens-Johnson syndrome, but we are told the woman is not taking any medications, a typical cause of Stevens-Johnson syndrome in the adult population. Antibodies to epidermal basement membrane proteins (choice A) are seen in bullous pemphigoid, which is a bullous disease characterized by blisters with a cleavage line between the epidermis and dermis.

Antibodies to glycoprotein IIb/IIIa (choice B) are seen in autoimmune thrombocytopenic purpura. Antibodies to intrinsic factor (choice D) are seen in pernicious anemia. Antibodies to Type IV collagen (choice E) are seen in Goodpasture's syndrome.

22>The correct answer is D. The lesion is a malignant melanoma. Melanomas can develop either de novo or in an existing mole. Sunlight exposure is a significant risk factor and fairskinned persons are at increased risk of developing melanoma. The most significant factor for long term prognosis is the depth of the lesion, since the superficial dermis lies about 1 mm under the skin surface, and penetration to this depth is associated with a much higher incidence of metastasis than is seen with a more superficial location. The circumference of the lesion (choice A) is much less important than depth, since one form of melanoma (superficial spreading) can still have good prognosis despite large size, if it has not extended to the depth of the superficial dermal lymphatic bed. The darkness (choice B) or degree of variation in color (choice C) do not have prognostic significance once melanoma is diagnosed. Irregularity, or fuzziness at the border (choice E) of a mole-like lesion is a good clue to potential malignancy, but does not affect prognosis once a melanoma is diagnosed.

23>The correct answer is E. By the third week of development, hematopoiesis begins in the blood islands of the yolk sac. Beginning at 1 month of age and continuing until 7 months of age, blood elements are also formed in the liver. Hematopoiesis occurs in the spleen and lymphatic organs between 2 and 4 months, and in the bone marrow after 4 months.

24>The correct answer is E. The patient has I-cell disease, also known as mucolipidosis II, which is due to a defective UDP-N-acetylglucosamine-1-phosphotransferase, the enzyme that phosphorylates mannose on enzymes destined for lysosomes. Proteins coded by nuclear DNA are synthesized on cytoplasmic ribosomes, which may be either "free" or associated with the endoplasmic reticulum to form the rough endoplastic reticulum (RER). Proteins synthesized on the RER are transferred into the Golgi apparatus, where they undergo further modifications that determine whether they remain part of the Golgi apparatus, become part of the plasma membrane, or are shipped to lysosomes or mitochondria. Proteins not marked for transport to a specific intracellular site follow the default pathway and are exported into the extracellular compartment. The signal for transport of the acid hydrolases (and probably other enzymes) to the lysosomes is phosphorylation of a terminal mannose moiety on an N-linked oligosaccharide to form mannose 6-phosphate. In I-cell disease, this terminal mannose moiety is not phosphorylated, and the acid hydrolases follow the default pathway and are secreted. Deficiency of alpha-L-iduronidase results in lysosomal accumulation of dermatan sulfate and heparan sulfate (choice A) in several conditions such as mucopolysaccharidosis I, Hurler's disease, or Hurler's/Scheie disease. Hexosaminidase A deficiency (Tay-Sachs disease) is one example of a condition in which ganglioside accumulation occurs (choice B). There are a number of diseases in which glycogen degradation (choice C) is defective. These are collectively termed glycogen storage diseases since they result in abnormal cellular

accumulation of glycogen. In Pompe's disease, or type II glycogen storage disease, a lysosomal glucosidase is deficient, resulting in lysosomal glycogen accumulation. Deficiency of sphingomyelinase (choice D), an enzyme involved in degradation of sphingomyelin, results in Niemann-Pick disease. Phosphorylation of tyrosine moieties (choice F) is unrelated to lysosomes or lysosomal enzymes; however, decreased ability to phosphorylate tyrosine moieties might be associated with diabetes or dwarfism.

25>The correct answer is E. 95% of a normally distributed population will fall between plus or minus 1.96 standard deviations from the mean. Since the population is normally distributed with regard to IQ, this means that approximately 2.5% of the population will have IQ scores 2 standard deviations or more above the mean, and 2.5% of the population will have IQ scores 2 standard deviations or more below the mean. 2.5% of 200 people is 5 people.

26>The correct answer is E. All the compounds listed can produce crystals in joint fluid, but only monosodium urate (associated with gout) and calcium pyrophosphate dihydrate (associated with CPPD crystal deposition disease, also called pseudogout), and to lesser degree basic calcium phosphate (apatite-associated arthropathy), have a high likelihood of being encountered on a step 1 USMLE exam. The crystals described are those of monosodium urate. Be careful not to answer "uric acid" if that is listed as an alternative choice on an exam, since the sodium salt is the predominant species in vivo. Basic calcium phosphate (choice A) is seen in apatite-associated arthropathy and produces spherical clumps of nonbirefringent submicroscopic crystals. Calcium oxalate crystals (choice B) are seen in primary oxalosis and are bipyramidal, positively birefringent crystals. Calcium pyrophosphate dihydrate crystals (choice C) are a feature of pseudogout and are rodto-rhomboidal-shaped, weakly positively birefringent crystals. Cholesterol crystals (choice D) are seen in chronic and chylous effusions in inflammatory and degenerative arthritis, where they form large, flat, rhomboidal plates with notched corners.

27>The correct answer is B. The innervation of the tongue is complex. The mandibular division of the trigeminal nerve (V3) carries general somatic sensation from the anterior twothirds of the tongue. The maxillary division (V2, choice A) carries somatic sensation from the palate, upper gums, and upper lip. The facial nerve (VII, choice C) carries taste from the anterior two-thirds of the tongue. The glossopharyngeal nerve (IX, choice D) carries sensation and taste from the posterior onethird of the tongue. The vagus nerve (X, choice E) carries sensation from the lower pharynx.

28>The correct answer is B. Brucella abortus produces a chronic, granulomatous disease with caseating granulomas. Most cases occur in four states (Texas, California, Virginia, and Florida), and are associated with cattle, in which it produces spontaneous septic abortions.

Most cases of brucellosis produce mild disease or fevers of unknown origin. However, Brucella spp. can infect the cardiovascular system and cause a localized infection. B. abortus is the most common species to cause endocarditis. The aortic valve is most commonly involved, followed by the mitral valve, and then both valves. Most cases of brucellosis are associated with occupational exposure, in persons such as veterinarians, ranchers, and those who handle carcasses. Bacillus anthracis (choice A) is the causative agent for anthrax. It usually produces cutaneous disease (malignant pustule or eschar) at the site of inoculation in handlers of animal skins. It can also produce a severe hemorrhagic pneumonia (Woolsorter's disease) and septicemia. Atrisk groups include those who handle animal carcasses or skins. Coccidioides immitis (choice C) is a dimorphic fungal disease producing a granulomatous pulmonary syndrome that is more severe in dark-skinned individuals. Disseminated disease occurs most often in Filipinos, Mexicans, and Africans. The infective form is the arthrospore; the diagnostic form in tissue is the spherule containing endospores. The disease is endemic in the San Joaquin River Valley. At-risk groups include military personnel, agricultural workers, construction workers, oil field workers, archaeology students, participants in outdoor sports, and sightseers. Remote infections from fomites (cotton harvested in the Southwestern U.S.) have been reported. Erysipelothrix rhusiopathiae (choice D) is a pleomorphic, gram-negative rod that causes a localized skin infection. It is an occupational disease of fishermen, fish handlers, butchers, meat-processing workers, poultry workers, farmers, veterinarians, abattoir workers, and housewives. Trichinella spiralis (choice E) is a nematode infection caused by the ingestion of larvae found in undercooked meat. Pork is the most common contaminated meat. However, outbreaks in the northern parts of the U.S. have been associated with eating undercooked infected bear meat. Symptoms include diarrhea, periorbital edema, myositis, fever, and eosinophilia.

29>The correct answer is B. This patient has Tay-Sachs disease, an autosomal recessive disorder caused by the deficiency of hexosaminidase A, which leads to the accumulation of ganglioside GM2 in neurons, producing a degenerative neurologic disease. Children appear normal at birth, but then begin to suffer from diminished responsiveness, deafness, blindness, loss of neurologic function, and seizures. A cherry-red spot on the macula may be seen by ophthalmoscopic examination. Death usually occurs by 4 to 5 years of age. There is no therapy. The incidence is higher among Jews of Eastern European descent. Since the parents must be heterozygotes for the mutant hexosaminidase A allele, they would be expected to have diminished levels of the enzyme. A defect in the dystrophin (choice A) gene produces Duchenne muscular dystrophy, characterized by onset of weakness in early childhood. A severe deficiency in HGPRT (choice C) will lead to Lesch-Nyhan syndrome, characterized by excessive uric acid production, mental retardation, spasticity, self-mutilation, and aggressive, destructive behavior. Deficiency of phenylalanine hydroxylase (choice D) results in classic phenylketonuria, a disease in which phenylalanine, phenylpyruvate, phenylacetate, and phenyllactate accumulate in plasma and urine. Clinically, there is a musty body odor and mental retardation. Hypophosphatemic rickets is an X-linked dominant condition causing abnormal regulation of vitamin D3 (choice E) metabolism and defects in renal tubular phosphate transport. Symptoms include growth retardation, osteomalacia, and rickets.

30>The correct answer is C. The fibrinolytic activity of streptokinase is due to its ability to bind and cleave plasminogen, producing plasmin. Plasmin directly cleaves fibrin, both between and within the fibrin polymers, thus breaking up thrombi and potentially restoring blood flow to ischemic cardiac muscle. This same mechanism of fibrinolysis is shared by urokinase and tissue-plasminogen activator (tPA). Antithrombin III (choice A) is a coagulation inhibitor that binds to and inactivates thrombin. Antithrombin III is anticoagulant, not fibrinolytic. Fibrin (choice B) is not directly acted upon by streptokinase. It is indirectly cleaved through the action of plasmin. Protein C (choice D) is a glycoprotein that modulates coagulation by inhibiting the procoagulant activities of factors V/Va and VIII/VIIIa. Protein C has no inherent fibrinolytic activity. Thrombomodulin (choice E) is an anticoagulant protein that binds to thrombin and diminishes its capacity to activate fibrinogen, Factor V, and platelets. Thrombomodulin has no fibrinolytic activity.

31>The correct answer is C. The left adrenal vein and the left gonadal vein (either testicular or ovarian) drain into the left renal vein. The left renal vein then drains into the inferior vena cava. In contrast, the right adrenal vein and right gonadal vein drain directly into the inferior vena cava. The hemiazygos vein (choice A) receives the venous drainage from the body wall on the left side of the thorax and abdomen. No visceral organs drain directly to the azygos or hemiazygos veins. The inferior vena cava (choice B) receives the direct venous drainage from the right adrenal vein, but not the left adrenal vein. Remember, the inferior vena cava is on the right side of the abdomen. The splenic vein (choice D) receives the venous drainage from the spleen and part of the pancreas and stomach. The splenic vein is part of the portal venous system. The superior mesenteric vein (choice E) receives venous drainage from much of the intestinal tract. It is part of the portal venous system and joins with the splenic vein to form the portal vein.

32>The correct answer is E. The child has neonatal respiratory distress syndrome (hyaline membrane disease). This condition is caused by the inability of the immature lungs to synthesize adequate amounts of surfactant. Surfactant, which reduces surface tension, helps keep alveoli dry and aids in expansion of the lungs, is synthesized by type II pneumocytes. Alveolar capillary endothelial cells (choice A) are important in maintaining the capillary structure and permitting flow of gases into and out of the blood stream. Bronchial mucous cells (choice B) produce the usually thin (in healthy individuals) coat of mucus that lines the bronchi. The ciliated bronchial respiratory epithelium (choice C) is responsible for moving the dust coated mucus layer out of the bronchi. Type I pneumocytes (choice D) are the squamous cells that line alveoli and permit easy gas exchange. These cells tend to be immature (and thick) in premature infants, but do not produce surfactant.

33>The correct answer is A. Surgeons worry about their obese patients more than their skinny ones, because a thick layer of relatively poorly vascularized subcutaneous fatty tissue is both mechanically unstable (it holds stitches poorly) and heals very slowly. These patients

have a frequent rate of dehiscence (tearing open of the incisional site) with subsequent, difficult-to-control infection (access by antibiotics, leukocytes, and serum antibodies are all hampered by the poor blood supply). Aponeuroses (choice B) are strong thickenings of muscle sheath that usually suture and heal well after surgery. Loose connective tissue (choice C) is well vascularized and surgeons do not usually worry much about it during the healing process. Muscle (choice D) usually heals well after surgery. Skin (choice E) usually heals well, unless it becomes infected.

34The correct answer is E. Rotavirus is the major cause of diarrhea in infants and children under the age of 2. The replicates in the intestinal mucosa, producing a profuse, watery, nonbloody diarrhea, often coupled with nausea and vomiting. Transmission is by the fecal-oral route. Coronaviruses (choice A) usually cause cold-like illnesses. Lymphocytic choriomeningitis virus (choice B) can cause headache, malaise, myalgia, conjunctivitis, and, occasionally, meningitis. Norwalk agent (choice C) can also cause diarrhea, but usually affects patients older than 2 years. Orbivirus (choice D) is the cause of Colorado tick fever, which is the only tick-borne viral disease in the United States.

35>The correct answer is B. This is a tough two-step style question. You first needed to make the diagnosis, and then you needed to recall the localization of this particular disease to a specific chromosome. In this case, everything in the vignette leads you to a diagnosis of Wilms' tumor. Wilms' tumor occurs in children and typically presents with an abdominal mass as well as with hypertension, hematuria, nausea, and intestinal obstruction. Because the tumor is derived from mesonephric mesoderm, it can include mesodermal derivatives such as bone, cartilage, and muscle. The Wilms' tumor suppressor gene (WT-1) has been localized to chromosome 11 (11p). The remaining answer choices provide us the opportunity to discuss some other known relationships between genes and disease. This is a topic of intense research that is likely to become more and more emphasized on the USMLE examinations. Chromosome 5 (choice A) is the site of the tumor suppressor gene APC, which is involved in the pathogenesis of colon cancer and familial adenomatous polyposis. Chromosome 13 (choice C) is the site of the tumor suppressor gene for retinoblastoma and osteosarcoma (Rb) as well as the BRCA-2 gene for breast cancer. Chromosome 17 (choice D) is the site of p53 (involved in most human cancers), NF-1 (neurofibromatosis type I), and BRCA-1 (breast and ovarian cancer). Chromosome 22 (choice E) is home to the NF-2 gene, which is involved in neurofibromatosis type II.

36>The correct answer is E. The condition described is spinal bifida with myelomeningocele. A failure of the posteriorly located vertebral arches to fuse posteriorly causes spina bifida, which can vary in severity from a completely asymptomatic minor abnormality to protrusion of the spinal cord and roots through an open skin defect, with a very real risk of minor trauma or infection causing paralysis. Failure of development of one of the paired primary ossification centers (choice A) of the body can produce very severe scoliosis.

The bodies of the vertebrae (choice B) are the stacking ovoid structures on the anterior aspect of the spinal canal. The pedicles (choice C) attach the body ring that surrounds the spinal canal to the body of the vertebrae. The superior articular process (choice D) articulates with the inferior articular facet of the vertebra above it.

37The correct answer is E. This patient is experiencing symptoms of hypocalcemia secondary to diminished parathyroid hormone (PTH) secretion. This must always be considered in a patient who undergoes total or subtotal thyroidectomy because the parathyroids are nestled in the tissue surrounding the thyroid gland. Surgical attempts to leave portions of the parathyroids intact are sometimes unsuccessful. Other causes of decreased PTH include neck irradiation, autoimmune phenomena (polyglandular autoimmune syndromes), dysembryogenesis (as in DiGeorge's syndrome), or as a result of heavy metal damage (Wilson's disease, hemosiderosis, hemochromatosis). Bone metastases (choice A) would cause hypercalcemia, as a result of osteolysis. Hashimoto's thyroiditis (choice B) is the most common cause of hypothyroidism and results in decreased thyroid hormone and elevated TSH levels. Serum calcium and PTH should be normal. Hypervitaminosis D (choice C) would cause hypercalcemia. Hypomagnesemia (choice D) may cause a functional hypoparathyroidism because magnesium is needed for PTH activity in tissue. However, in such a case, actual PTH levels would not be decreased.

38>The correct answer is B. Fenestrated ("windowed") endothelial cells, which permit free flow of serum across the endothelium, are an unusual feature of the hepatic sinusoids. They are not seen in the other organs listed. 39>The correct answer is D. Chronic heart failure results in blood stasis in the central veins and central sinusoids of hepatic lobules, with subsequent central hemorrhagic necrosis. Thus, the red central regions compared with the surrounding tan-brown viable parenchyma impart the mottled appearance of a nutmeg to the liver cut surface. Acute left-sided heart failure (choice A) gives rise to acute pulmonary edema, with extravasation of plasma and red blood cells into alveolar spaces. Acute right-sided heart failure (choice B) leads to acute congestion of the liver, which does not acquire the typical nutmeg appearance as in chronic congestion. Alcohol toxicity (choice C) leads to a number of hepatic alterations. Fatty change results from alteration in lipoprotein metabolism, leading to accumulation of fats as a large single droplet within the cytoplasm of hepatocytes (microvesicular steatosis). Alcoholic hepatitis is an acute response to alcohol abuse and is associated with hepatocyte necrosis and formation of Mallory bodies. Long-standing alcohol toxicity may cause a perturbation of the liver architecture leading to liver cirrhosis. Liver cirrhosis (choice E) is an end-stage condition that may be caused by a number of chronic insults, such as alcohol toxicity, viral hepatitis B or C, and hemochromatosis. It results from simultaneous degeneration and regeneration of the liver parenchyma with formation of broad scars connecting portal spaces. The normal liver architecture is entirely lost and replaced by regenerating nodules. The nodular pattern is the distinguishing macroscopic feature that allows easy diagnosis, even on gross examination.

40>The correct answer is A. This man has a respiratory acidosis. Overdose with drugs that suppress ventilation (e.g., heroin, morphine, barbiturates, methaqualone, and "sleeping pills") often causes hypercapnia. In patients with an intact renal response, the respiratory acidosis causes a compensatory rise in plasma HCO3-, which lessens the fall in pH. However, the renal response requires several days to develop fully. The plasma HCO3- of 26 mEq/L (normal: 22-28 mEq/L) for this man is typical of acute respiratory acidosis with little or no renal compensation. Choice B reflects metabolic acidosis. Choice C is normal. Choice D reflects respiratory alkalosis. Choice E reflects metabolic alkalosis.

41>The correct answer is D. The forced vital capacity (FVC) is the difference in volume between the total lung capacity (TLC) and the residual volume (RV). The TLC and RV are represented on the diagram as the points of intersection between the abscissa and flowvolume curve: TLC = 6 L and RV = 1.5 L. Therefore, FVC = 6 - 1.5 = 4.5 Liters. Although the diagram shows absolute lung volumes, these cannot be obtained from a forced expiration without first determining the residual volume using other methods (for the same reason that TLC and RV cannot be determined using a spirometer). However, it is still possible to determine FVC because this is the difference between TLC and RV, and differences in volume can be determined from a forced expiration diagram.

42>The correct answer is A. This person is blind in the right eye. The afferent limb of the pupillary light reflex is carried by the optic nerve (CN II), and the efferent limb is via the oculomotor nerve (CN III), which carries parasympathetic fibers from the Edinger-Westphal nucleus. Thus, shining a light in the affected eye will not elicit any pupillary response. On the other hand, shining the light in the left eye will result in simultaneous constriction of both pupils (assuming an intact right CN III), since the left optic nerve is intact.

43>The correct answer is C. Flow has increased 7-fold, indicating a decrease in crosssectional area by a factor of 7. This would be caused by an obstruction, not an aneurysm. Choice A is incorrect, because a coronary artery aneurysm would produce an increase in cross-sectional area rather than a decrease. Flow has increased 7-fold, indicating a decrease in vessel diameter, thus choices B and D are incorrect.

44>The correct answer is C. The table shows that the greatest fall in blood pressure (50 mm Hg) occurs in the arterioles, which indicates that the arterioles account for about 50% of the total peripheral resistance. The structural characteristics of arterioles are consistent with their function as control valves that regulate blood flow to the capillary networks of the body. Thus, arterioles are thick-walled vessels with the highest ratio of wall cross-sectional area to lumen cross-sectional area. This does not mean that arterioles have thicker walls compared to arteries. It simply means that the walls of arterioles are relatively thick compared to their

overall size (diameter). The wall-to-lumen ratio of arteries, which includes the aorta (choice A) as well as large (choice A) and small arteries (choice B), is less than that of arterioles but greater than that of venules and veins (choices E and F). The capillaries (choice D) lack smooth muscle cells in their walls, which makes wall-to-lumen ratio measurements much less meaningful.

45>The correct answer is E. The third pharyngeal pouch normally gives rise to the inferior parathyroid glands and the thymus. Cells from these pouches migrate caudally in the embryo to the eventual location of these organs. The superior parathyroid glands are derived from the fourth pharyngeal pouch. The absence of these organs is found in DiGeorge syndrome, which typically presents with immunodeficiency and hypoparathyroidism. The second pharyngeal arch (choice A) gives rise to several skeletal and muscular structures. These include the stapes, styloid process, stylohyoid ligament, a portion of the hyoid bone, the stapedius muscle, stylohyoid muscle, posterior digastric muscle, and all of the muscles of facial expression. The second pharyngeal cleft (choice B) is normally obliterated. A persistence of this cleft may result in a lateral cervical cyst, sinus, or fistula. The second pharyngeal pouch (choice C) gives rise to the tonsillar fossa and the palatine tonsils. The third pharyngeal arch (choice D) gives rise to most of the hyoid bone and the stylopharyngeus muscle. The third aortic arch, which passes through the third pharyngeal arch, gives rise to the common carotid artery and the internal carotid artery.

46>The correct answer is D. The muscles in question are the gluteus medius and gluteus minimus, which are the innervated by the superior gluteal nerve. Textbooks often describe these muscles as abductors of the hip, but in real life, they usually function as described in the question. The femoral nerve (choice A) innervates muscles of the anterior thigh, allowing extension of the leg at the knee. The first and second sacral nerves (choice B) innervate the piriformis muscle, which is a lateral rotator of the thigh at the hip. The obturator nerve (choice C) innervates muscles of the medial thigh. The tibial nerve (choice E) innervates muscles of the posterior lower leg. 47>The correct answer is E. Approximately 60% of patients in the United States who contract Lyme disease, but are not treated with antibiotics, will develop frank arthritis. The pattern typically consists of intermittent attacks of oligoarticular arthritis in large joints (especially knees) lasting for weeks to months in a given joint. Patients with persistent arthritis have a higher frequently of HLA-DR4 class II MHC complex than patients with brief Lyme arthritis or normal controls. HLA-B9 (choice A), and HLA-B17 (choice B) are not thought to be associated with Lyme disease arthritis. HLA-DR3 (choice D) is associated with a variety of disorders, but not Lyme disease arthritis. HLA-B27 (choice C), although associated with reactive arthritis, is not associated with Lyme disease arthritis.

48>The correct answer is F. Of the processes listed, only ketone body synthesis occurs exclusively in the mitochondria. Other mitochondrial processes include the production of acetyl-CoA, the TCA cycle, the electron transport chain, and fatty acid oxidation. Processes that occur exclusively in the cytoplasm include cholesterol synthesis (choice A; in cytosol or in ER), fatty acid synthesis (choice B), glycolysis (choice D), and the hexose monophosphate shunt (choice E). Note that gluconeogenesis (choice C) and the urea cycle (choice G) occur in both the mitochondria and the cytoplasm.

49>The correct answer is C. DiGeorge syndrome is due to fetal malformation of epithelial elements of the third and fourth pharyngeal pouches, leading to thymic aplasia or severe hypoplasia and sometimes, absence of the parathyroids. Clinically, the condition is classified as a selective T-cell deficiency, but varying degrees of deficiency of antibody production may also be seen. Affected infants are susceptible to fungal and viral infections, and may exhibit tetany due to severe hypocalcemia. In autosomal recessive ataxia telangiectasia (choice A), progressive cerebellar ataxia is accompanied by multiple telangiectasias on exposed skin and a variable, usually moderate, immunodeficiency that may involve both antibody production and cell-mediated immunity. Chronic or recurrent sinus and pulmonary infections result in bronchiectasis. In Bruton's (X-linked) agammaglobulinemia (choice B), children have normal numbers of circulating T cells with very few circulating B cells and only tiny amounts of circulating antibody. Affected individuals have recurrent bacterial infections beginning late in the first year of life. Severe combined immunodeficiency (choice D) is actually a cluster of several diseases with variable genetics characterized by severely deficient T cell functions and variable (often depressed) antibody production. Multiple, sometimes simultaneous, infections with viruses, bacteria, and fungi occur. Wiskott-Aldrich syndrome (choice E) is an X-linked disease with thrombocytopenia, lymphopenia, and decreased T cell function. Lymphoid malignancy (e.g., acute lymphocytic leukemia) may occur.

50>The correct answer is E. von Gierke's disease is a glycogen storage disease caused by a deficiency of glucose-6-phosphatase. It typically presents with neonatal hypoglycemia, hyperlipidemia, lactic acidosis, and ketosis. Failure to thrive is common in early life; convulsions may occur due to profound hypoglycemia. The glycogen accumulation in von Gierke's disease occurs primarily in the liver and kidneys, accounting for the enlargement of these organs. Gout may develop later because of the derangement of glucose metabolism. Even if you do not remember all of the details of the presentation of these genetic diseases, you should be able to narrow the choices: Gaucher's disease (choice A) and Niemann-Pick disease (choice C) are lipid storage diseases, and would not be expected to produce hypoglycemia. The other diseases are glycogen storage diseases, but McArdle's (choice B) and Pompe's (choice D) disease affect muscle rather than liver and would not be expected to produce profound hypoglycemia, since the liver is the major source for blood glucose.

1>What percentage of patients with ischemic heart disease present with sudden death? A. 1% B. 5% C. 25% D. 50% E. 80% Answer

2>Which of the following respiratory system components is derived from neural crest? A. Endothelial cells B. Epithelium of primary bronchi C. Laryngeal cartilage D. Tracheal glands E. Type I pneumocytes Answer

3>Axons found around the area indicated by the arrow in the figure above are myelinated by A. astrocytes B. dorsal root ganglion cells C. microglia D. oligodendrocytes E. Schwann cells Answer

4>A 35-year-old woman notices a change in the appearance of a mole on her neck. Physical examination reveals that the lesion is an irregular, nodular, superficial mass with a variegated appearance. Biopsy demonstrates a primary malignant tumor. Which of the following factors is most predictive of the patient's long term prognosis? A. Circumference of lesion B. Darkness of lesion C. Degree of color variation D. Depth of lesion E. Sharpness of border between lesion and adjacent skin Answer

5>A 27-year-old white male presents with a 3-week history of several swollen and painful toes and knees. He has a past history of conjunctivitis. He also describes some low back stiffness that is more severe in the morning. Which of the following is the most likely diagnosis? A. Gout

B. C. D. E. Answer

Lyme disease Reiter's syndrome Rheumatoid arthritis Septic arthritis

6>Histologic examination of normal skin demonstrates small numbers of perivascular cells, with darkly stained ovoid nuclei and granular cytoplasm on hematoxylin and eosin staining. The cells demonstrate metachromasia of the cytoplasm when stained with Giemsa stain. Which of the following products would these cells be most likely to secrete? A. Bradykinin B. Complement factor 3a C. Histamine D. Interleukin 2 E. Nitric oxide Answer

7>A 34-year-old woman presents with fatigue, malaise, and swollen, tender joints. Physical examination is significant for a maculopapular eruption over sun-exposed areas, including the face. Examination of a peripheral blood smear reveals mild thrombocytopenia. Which of the following autoantibodies, if present, would be most specific for the diagnosis of the patient's disorder? A. Anti-centromere antibody B. Anti-IgG antibody C. Antinuclear antibody D. Anti-Sm (Smith antigen) antibody E. Anti-SS-A (Ro) antibody Answer

8>A woodworker operating a bandsaw accidently injures his wrist, severing his radial artery and producing severe hemorrhage. As he loses blood, his body tries to compensate for the developing hypotension by increasing sympathetic outflow. The postganglionic signals carrying the impulses to constrict his arterioles are transmitted along which of the following fiber types? A. A-d fibers B. B fibers C. C fibers D. Ia fibers E. Ib fibers Answer

9>A child who has had abnormal development of the membranous bones has a broad skull with associated facial and dental anomalies. Which other bones are most likely to also be affected? A. Clavicles B. Femurs C. Metatarsals D. Phalanges E. Tibias Answer

10>A 54-year-old man with emphysema presents to his physician with a blood pressure of 157/101 mm Hg. Over the next several months the physician prescribes angiotensin converting enzyme inhibitors, diuretics, and calcium channel blockers, but the patient has to discontinue each agent because of undesirable side effects. The physician then decides to prescribe a beta antagonist. Which of the following beta antagonists would be most appropriate for this particular patient? A. Metoprolol B. Nadolol C. Propranolol D. Sotalol E. Timolol Answer

11>Glomerular hydrostatic pressure = 44 mm Hg, Bowman's capsule hydrostatic pressure = 9 mm Hg, Osmotic pressure of plasma = 28 mm Hg, Osmotic pressure of tubular fluid = 0. Given this data, what is the net filtration pressure at the glomerulus? A. - 5 mm Hg B. 7 mm Hg C. 25 mm Hg D. 63 mm Hg E. 81 mm Hg Answer

12>Two normal, healthy subjects volunteer for a study on insulin secretion . In Patient 1, blood glucose is increased to 150 mg/dL by direct intravenous

infusion. In Patient 2, blood glucose is increased to 150 mg/dL by ingestio n of oral glucose. The peak plasma insulin concentration produced in Patient 1 is 70 mU/mL while in Patient 2, it is 95 mU/mL. Which of the following best explains the higher insulin concentration in Patient 2? A. Ingested glucose activates a sympathetic reflex that increases b cell release of insulin B. Ingested glucose increases duodenal secretion of gastric inhibitory peptide (GIP), increasing b cell release of insulin C. Intravenous glucose increases islet cell secretion of somatostatin, inhibiting b cell release of insulin D. Intravenous glucose increases islet cell secretion of glucagon, inhibiting b cell release of insulin Answer

13>A researcher employs site-directed mutagenesis to produce mutations in a gene that is important for development of the ureteric bud in a rat embryo . The embryo develops abnormally, and is delivered stillborn twenty days later. Examination of the stillborn fetus would likely reveal absence of which of the following renal structures? A. Ascending loop of Henle B. Bowman's capsule C. Collecting duct D. Descending loop of Henle E. Glomerular tuft Answer

14>5 mL of synovial fluid is aspirated from an inflamed knee joint. The fluid is yellow-white and cloudy and contains 200,000 WBC/mm3 (85% neutrophils). Needle-shaped, strongly negatively birefringent crystals are seen both within and outside neutrophils. These crystals most likely have which of the following compositions? A. Basic calcium phosphate B. Calcium oxalate C. Calcium pyrophosphate dihydrate D. Cholesterol E. Monosodium urate Answer

15>A knife wound to the neck damages the posterior cord of the brachial plexus. Which of the following muscles would be most likely to be paralyzed? A. Deltoid B. Flexor carpi ulnaris C. Flexor digitorum superficialis

D. E. Answer

Flexor pollicis brevis Palmaris longus

16>A 41-year-old man presents to his physician complaining of swollen ankles. He states that he has never had this problem before. Physical examination demonstrates marked lower extremity edema and periorbita l swelling. His pulse is strong, and regular. Urine dipstick is 4+ positive for protein, but negative for blood and glucose. 24-hour urine collection demonstrates proteinuria of 6 grams per day. Which of the following is the most likely cause of this patient's disorder? A. Berger's disease B. Diabetic nephropathy C. Membranoproliferative glomerulonephritis D. Membranous glomerulonephritis E. Minimal change disease Answer

17>A surgical pathology specimen from a 24-year-old woman seen at a reproductive medicine clinic demonstrates a ciliated columnar epithelium . From which of the following locations in the female genital tract was the biopsy obtained? A. Cervix B. Endometrium C. Fallopian tube D. Ovary E. Vagina Answer

18>The leukocyte pictured above stains intensely with acidic dyes such as eosin. Which of the following substances is contained in the crystalline core of the granule at the arrow? A. Lactoferrin B. Major basic protein C. Myeloperoxidase D. Histamine E. Tartrate-resistant acid phosphatase Answer

19>Five days after returning to his military base in South Carolina after survival training in the nearby countryside, an 18-year-old recruit reports to the infirmary complaining of a headache. Physical examination reveals a fever, but no other abnormalities are noted. A few days later he returns to the infirmary with a maculopapular rash involving the hands and feet. The rash then spreads centripetally to involve the trunk. Which of the following diseases should be suspected? A. Chickenpox B. German measles C. Measles D. Mumps E. Rocky Mountain spotted fever Answer

20>A patient with severe atherosclerosis of the external iliac artery and adjacent femoral artery is scheduled for coronary artery bypass surgery. The surgeon decides to use a long, mostly unbranched muscular vein found on the medial aspect of the leg both above and below the knee. Through which of the following structures does this vein pass to eventually join

the femoral vein? A. Anatomic snuff box B. Antecubital fossa C. Fossa ovalis D. Inguinal canal E. Popliteal fossa Answer

21>A 46-year-old male with non-insulin dependent diabetes presents with a recent onset of nausea, vomiting, abdominal pain, anorexia, and dark-colored urine. Laboratory examination reveals an AST = 136 U/L and an ALT = 142 U/L. Based on these findings, which of the following oral hypoglycemic agents is the patient most likely taking? A. Acarbose B. Glipizide C. Metformin D. Repaglinide E. Troglitazone Answer

22>White coat hypertension is defined as an elevation of blood pressure resulting from the apprehension associated with visiting the doctor. It is thought that the patient associates the physician's white coat with distressing experiences (e.g., being vaccinated as a child), resulting in transient hypertension. This may be viewed as a physiological manifestation of which of the following phenomena? A. Classical conditioning B. Extinction C. Habit hierarchies D. Negative reinforcement E. Operant conditioning

Answer

23>A thyroid mass usually moves with swallowing because the thyroid gland is enclosed by which of the following fascia? A. Carotid sheath B. Investing layer of the deep cervical fascia C. Pretracheal fascia D. Prevertebral fascia E. Superficial fascia

Answer

25>A patient with colorectal cancer develops septicemia complicated by endocarditis. You would expect the blood cultures to grow A. Streptococcus agalactiae B. Streptococcus bovis C. Streptococcus pneumoniae D. Streptococcus pyogenes E. Streptococcus viridans Answer

26>A 1-year-old child develops voluminous watery diarrhea and vomiting . She is brought to the pediatrician by her parents and evaluated, then sent home with instructions for the parents to give the child an electrolyte replacement solution. Which of the following viruses is the most likely cause of the child's diarrhea? A. Coronavirus B. Lymphocytic choriomeningitis virus C. Norwalk agent D. Orbivirus E. Rotavirus Answer

27>During an intra-abdominal operation, a surgeon asks a medical student to pass his hand toward the head, along the inner aspect of the anterior abdominal wall, slightly to the right of the midline. The reflection of which of the following will eventually stop the movement of the student's hand? A. Anterior layer of the coronary ligament B. Fissure for the ligamentum venosum C. Left triangular ligament D. Posterior layer of the coronary ligament E. Right triangular ligament Answer

28>A 37-year-old female presents to the emergency room with a fever. Chest x-ray shows multiple patchy infiltrates in both lungs. Echocardiography and blood cultures suggest a diagnosis of acute bacterial endocarditis limited to the tricuspid valve. Which of the following is the most probable etiology? A. Congenital heart disease

B. C. D. E.

Illicit drug use Rheumatic fever Rheumatoid arthritis Systemic lupus erythematosus

Answer

29>A patient develops a swollen and tender lymph node in his popliteal fossa. An infected skin lesion in which of the following sites would most likely induce lymphadenopathy in this region? A. Lateral side of the dorsum of the foot B. Lateral side of the thigh C. Medial side of the leg below the knee D. Medial side of the sole of the foot E. Medial side of the thigh Answer

30>A patient, who appears to be female, is found to be 46,XY. The patient's vagina is very shallow, ending in a blind pouch, and there are palpable masses in the labia. The diagnosis of testicular feminization syndrome is made. Which of the following was most likely present during the early fetal life of this individual? A. A streak ovary B. A uterus C. An oviduct D. Depressed levels of testosterone E. MIF (Mullerian inhibitory factor) Answer

31>Which of the following is thought to be a major contributor to the cachexia often experienced by patients with advanced cancer? A. Clathrin B. Histamine C. Interferon D. Interleukin 2 E. Tumor necrosis factor Answer

32>A newborn baby has a prominent defect at the base of his spine through which his meninges and spinal cord protrude. A failure of which of the

following processes is the most common cause of this type of defect? A. Development of primary vertebral ossification centers B. Development of the body C. Development of the pedicle D. Development of the superior articular process E. Fusion of the vertebral arches Answer

33>A 22-year-old male military recruit complains of a headache and stiff neck. He is examined, blood is drawn, and a lumbar puncture performed. The glucose in the CSF is 100 mg/dL and the serum glucose is 120 mg/dL. The CSF shows 3 lymphocytes and 0 neutrophils/microliter. Which of the following conclusions concerning the interpretation of these findings is most accurate? A. The CSF glucose level suggests bacterial meningitis B. The CSF glucose level suggests viral meningitis C. The lymphocytes suggest bacterial meningitis D. The lymphocytes suggest viral meningitis E. There is no evidence for meningitis Answer

34>A 68-year-old man presents to his physician with complaints of fatigue and a dragging sensation in his abdomen. Physical examination is remarkable for massive splenomegaly without lymphadenopathy. The patient's hematocrit is 30%, his platelet count is 80,000/mm3, and his leukocyte count is 2500/mm3. Bone marrow biopsy shows "fried egg" cells expressing the pan B-cell markers CD19 and CD20, and the monocyte marker CD11c. Positive staining for which of the following substances would most likely verify the likely diagnosis? A. CD4 B. GpIIb/IIIa C. Myeloperoxidase D. Nonspecific esterase E. Tartrate-resistant acid phosphatase Answer

35>A 1-week-old, bottle-fed, low-birth-weight neonate develops severe abdominal pain with bloody diarrhea. Several hours later, the neonate undergoes emergency surgery. A portion of small intestine is resected , and pathologic examination demonstrates a perforation. Which of the following would most likely be seen on microscopic examination of the involved bowel? A. Inflammatory polyps

B. C. D. E. Answer

Multiple diverticula Neoplastic polyps Thickened collagenous band Transmural necrosis

36>A Guatemalan child with a history of meconium ileus is brought to a clinic because of a chronic cough. The mother notes a history of respiratory tract infections and bulky, foul-smelling stools. After assessment of the respiratory tract illness, the physician should also look for signs of A. cystinuria B. hypoglycemia C. iron deficiency anemia D. sphingomyelin accumulation E. vitamin A deficiency Answer

37>A 4-year-old girl is discovered pulling the tail of the family dog. Her mother, who had warned her previously that this behavior was unacceptable, now assigns the girl to a 5 minute time out period . A timer is set up so that the girl can keep track of the time period. After two minutes of the period, the girl begins to scream and cry. At this point, the mother's best response would be to A. do nothing until the time out period has ended B. explain to the child why this type of punishment is necessary C. offer the child a choice between becoming quiet or "being paddled" D. reset the timer to add an additional 5 minutes to the time out period E. tell the child that if she quiets down she will be rewarded by a treat at the end of the time out period Answer

38>A pregnant woman presents at 22 weeks gestation for a routine prenatal visit. Physical examination demonstrates ankle edema and new onset hypertension. Urinalysis reveals marked proteinuria. Development of which of the following would justify a diagnosis of eclampsia? A. Diabetes mellitus B. Hyperuricemia C. Seizures D. Systemic lupus erythematosus E. Thrombocytopenia Answer

39>A 57-year-old man presents with a steady, severe pain in the right hypochondrium, nausea, vomiting, and a temperature of 102 F. He states that his signs and symptoms began shortly after eating his favorite pizza with extra cheese, pepperoni, and sausage. Laboratory examination reveals a white blood cell count of 13,400/mL and a serum bilirubin value of 2.8 mg/dL. If hepatobiliary imaging reveals an obstructed cystic duct, which of the following agents would be the drug of choice for the treatment of this patient's pain? A. Meperidine B. Morphine C. Naproxen D. Oxycodone E. Propoxyphene Answer

40>A 37-year-old woman who was diagnosed with AIDS 3 years earlier is unable to work, is physically debilitated, and requests her physician to provide her with medications with which to take her own life. The most common emotional disorder that results in such requests by patients is A. bipolar I disorder, manic type B. borderline personality disorder C. factitious disorder D. major depressive disorder E. schizophrenic disorder Answer

41>A 20-year-old develops weakness accompanied by difficulty in relaxation that is most pronounced in the hands and feet. Muscle biopsy demonstrates prominent ring fibers, centrally located nuclei, chains of nuclei, and disorganized sarcoplasmic masses. This condition been associated with a mutation on which of the following chromosomes? A. X B. Y C. 4 D. 5 E. 19 Answer

42>A 34-year-old asthmatic male presents for a check-up. He has been taking low dose oral prednisone for over 10 years and although his asthma is well controlled, he is concerned about steroid-induced osteoporosis, because his grandfather, a type 1 diabetic, recently fell and broke his hip. A comprehensive metabolic profile as well as a dual energy x-ray absorptiometry test (DEXA) of the spine and hip are ordered. Which of the following additional tests would be recommended? A. 1,25-dihydroxy vitamin D B. C-terminal PTH C. Intact PTH D. Serum glucose E. Serum protein electrophoresis Answer

43>A 2-month-old child is evaluated for failure to thrive. As the pediatrician is examining the child, a convulsion occurs. Stat serum chemistries demonstrate severe hypoglycemia, hyperlipidemia, lactic acidosis, and ketosis. Physical examination is remarkable for hepatomegaly, a finding confirmed by CT scan, which also reveals renomegaly. Which of the following diseases best accounts for this presentation? A. Gaucher's disease B. McArdle's disease C. Niemann-Pick disease D. Pompe's disease E. Von Gierke's disease Answer

44>In an experiment, norepinephrine was injected intravenously and smooth muscle contraction was measured (control curve). Curves X, Y and Z are the result of three separate experiments, in which norepinephrine was administered shortly after an unknown pharmacological agent. What are the three most likely drugs (X,Y,Z) used in the three consecutive experiments? A. Cocaine, prazosin, phenoxybenzamine B. Fluoxetine, propranolol, phenoxybenzamine C. Phenoxybenzamine, cocaine, fluoxetine, D. Prazosin, phentolamine, phenoxybenzamine E. Propranolol, cocaine, prazosin Answer

45>A normal, healthy, 24-year-old woman has regular menstrual cycles, each lasting about 28 days. Daily serum samples from the woman reveal decreasing progesterone and 17-b-estradiol levels. Serum LH and FSH levels are low, and begin rising. Basal body temperature begins falling . Within three days, which of the following events would be expected to occur? A. Markedly increased inhibin levels B. Menstruation C. Ovulation D. Rapidly decreased LH levels E. Significantly increased basal body temperature Answer

46>A 30-year-old woman is involved in an automobile accident. The woman, who was not wearing a seat belt, hits her chest against the steering wheel . When she is brought by ambulance to the emergency room, she is noted to be cyanotic. Her blood pressure is within normal limits and her heart rate is fast but regular. Her respirations are rapid and very shallow. She

receives no medications in the ambulance. Chest x-ray demonstrates multiple broken ribs, but no pleural effusion or obvious lung disease. Which of the following mechanisms would most likely account for this patient's hypoxemia? A. Decreased capacity for pulmonary diffusion B. Decreased surface area of alveolar capillary membranes C. Hypoventilation of central origin D. Hypoventilation of peripheral origin E. Inequalities of ventilation and perfusion Answer

47>Release of which of the following peptides leads to an increase in the secretion of pancreatic enzymes into the small intestine? A. Cholecystokinin B. Gastrin C. Motilin D. Secretin E. Somatostatin Answer

48>Most of the testosterone secreted by the testes exists in the plasma in the form of A. dihydrotestosterone bound to gonadal steroid-binding hormone B. free dihydrotestosterone C. free testosterone D. testosterone bound to albumin E. testosterone bound to sex-steroid-binding globulin Answer

49>A 7-year-old patient presents with a mass in the anterior midline of the neck, slightly above the larynx. The mass is mobile and elevates upon protrusion of the tongue. This mass is most likely a cyst that developed from which of the following embryonic structures? A. First pharyngeal cleft B. First pharyngeal pouch C. Second pharyngeal cleft D. Second pharyngeal pouch E. Thyroglossal duct Answer

50>Most fascia of the body that attach to bones attach by which of the following mechanisms? A. Blending with the covering periosteum B. Inserting deeply into the cancellous bone C. Inserting deeply into the cartilage D. Inserting deeply into the diaphysis E. Inserting deeply into the marrow Answer

Answers

131>The correct answer is C. This fact is obviously clinically relevant: in one quarter of patients with ischemic heart disease, the "presenting" symptom is death! This makes a very good case for aggressive screening of any patient groups at relatively high risk for atherosclerosis.

2>The correct answer is C. Laryngeal cartilages (e.g., the thyroid, cricoid, arytenoid cartilages) are derived from neural crest. The endothelial cells (choice A) in the simple squamous epithelium that lines the pulmonary capillaries are derived from visceral mesoderm. The epithelial lining of primary bronchi (choice B) is derived from endoderm. Tracheal glands (choice D) and epithelium both derive from endoderm. Type I pneumocytes (choice E) are derived from endoderm.

3>The correct answer is D. The arrow is in the fasciculus cuneatus, a tract in the white matter of the spinal cord. Therefore, it is within the central nervous system (CNS). Myelin in the central nervous system is formed by oligodendrocytes. Each oligodendrocyte myelinates several axons. Astrocytes (choice A) are stellate appearing cells possessing branching processes that associate with pia mater, neurons, and endothelial cells within the CNS. While they may provide a secondary component of the blood-brain barrier (tight junctions account for the primary barrier), one of their main functions is to modulate the molecular composition of extracellular fluid in the CNS. They do not produce myelin. Dorsal root ganglion cells (choice B) are pseudounipolar neurons that provide sensory input to the spinal cord. Their axons may be myelinated, but they do not form the myelin. Microglia (choice C) are part of the mononuclear phagocyte system, being derived from monocytes. They are phagocytic and do not produce myelin. Schwann cells (choice E) form myelin in the peripheral nervous system. A

4>The correct answer is D. The lesion is a malignant melanoma. Melanomas can develop either de novo or in an existing mole. Sunlight exposure is a significant risk factor and fairskinned persons are at increased risk of developing melanoma. The most significant factor for long term prognosis is the depth of the lesion, since the superficial dermis lies about 1 mm under the skin surface, and penetration to this depth is associated with a much higher incidence of metastasis than is seen with a more superficial location. The circumference of the lesion (choice A) is much less important than depth, since one form of melanoma (superficial spreading) can still have good prognosis despite large size, if it has not extended to the depth of the superficial dermal lymphatic bed. The darkness (choice B) or degree of variation in color (choice C) do not have prognostic significance once melanoma is diagnosed. Irregularity, or fuzziness at the border (choice E) of a mole-like lesion is a good clue to potential malignancy, but does not affect prognosis once a melanoma is diagnosed.

5>The correct answer is C. This is a case of Reiter's syndrome. Patients typically present with the acute onset of arthritis (usually asymmetric and additive), with involvement of new joints occurring over a period of a few days to 2 weeks. Joints of the lower extremities are the most commonly involved, but wrists and fingers can also be affected. Dactylitis (sausage digit), a diffuse swelling of a solitary finger or toe, is a distinctive feature of Reiter's arthritis and psoriatic arthritis. Tendonitis and fasciitis are common. Spinal pain and low back pain are common. Conjunctivitis, urethritis, diarrhea, and skin lesions are also associated with Reiter's syndrome. Up to 75% of patients are HLA-B27 positive. Microorganisms which can trigger Reiter's syndrome include Shigella spp., Salmonella spp., Yersinia spp., Campylobacter jejuni, and Chlamydia trachomatis. Most patients are younger males. Gout (choice A) usually presents as an explosive attack of acute, very painful, monarticular inflammatory arthritis. Hyperuricemia is the cardinal feature and prerequisite for gout. The first metatarsophalangeal joint is involved in over 50% of first attacks. Lyme disease (choice B), caused by Borrelia burgdorferi, presents with a red macule or papule at the site of the tick bite. This lesion, called erythema chronicum migrans, slowly expands to form a large annular lesion with a red border and central clearing. The lesion is warm, but usually not painful. The patient also has severe headache, stiff neck, chills, arthralgias, and profound malaise and fatigue. Untreated infection is associated with development of arthritis. The large joints (e.g., knees) are usually involved with the arthritis lasting for weeks to months. Rheumatoid arthritis (choice D) begins insidiously with fatigue, anorexia, generalized weakness, and vague musculoskeletal symptoms leading up to the appearance of synovitis. Pain in the affected joints, aggravated by movement, is the most common manifestation of established rheumatoid arthritis. Generalized stiffness is frequent and is usually greatest after periods of inactivity. Morning stiffness of greater than 1 hour in duration is very characteristic. Rheumatoid arthritis is more common in females. The metacarpophalangeal and proximal interphalangeal joints of the hands are characteristically involved. Septic arthritis (choice E) is caused by a variety of microorganisms, including Neisseria gonorrhoeae and Staphylococcus aureus. Hematogenous spread is the most common route in all age groups. 90% of patients present with involvement of a single joint, usually the knee. The usual presentation is moderate-to-severe pain, effusion, muscle spasm, and decreased range of motion. Peripheral leukocytosis and a left shift are common. Disseminated gonococcal infections present as fever, chills, rash, and articular symptoms. Papules progressing to hemorrhagic pustules develop on the trunk and extensor surfaces of the distal extremities. Migratory arthritis and tenosynovitis of multiple joints is common.

6>The correct answer is C. The cells in question are mast cells, which play an important role in IgE-mediated allergic responses. They are a normal (minor) constituent of dermal skin and are most definitely identified with stains, such as the Giemsa stain, that highlight the granularity of their cytoplasm (mast cells are closely related to blood basophils). Mast cells secrete histamine, serotonin, many leukotrienes, and platelet aggregating factor (PAF). Their histamine secretion after IgE stimulation helps to trigger the acute inflammatory part of the allergic response. Bradykinin (choice A) is a nonapeptide found in the plasma. It is a potent vasodilator and stimulates pain receptors. Complement factor 3a (choice B) is a plasma protein that induces vascular leakage as part of the acute inflammatory response. Interleukin 2 (choice D) is secreted by lymphocytes and augments the immune response. Nitric oxide (choice E) is released by macrophages and endothelium. It causes vasodilation and cytotoxicity.

7>The correct answer is D. The patient described probably has systemic lupus erythematosus (SLE). This is a systemic disorder that often presents with fatigue, malaise, fever, gastrointestinal symptoms, arthralgias, and myalgias. Hematologic abnormalities include anemia of chronic disease, hemolytic anemia, leukopenia, lymphocytopenia, and thrombocytopenia. A circulating anticoagulant may prolong the APTT (activated partial thromboplastin time). Cutaneous manifestations include a malar rash and a generalized maculopapular eruption, both of which are photosensitive. Antibodies to the Smith antigen (core proteins of small ribonucleoproteins found in the nucleus) are present in only 20-30% of patients with SLE, but are quite specific for the disease, occurring only rarely in other autoimmune diseases. Anti-centromere antibody (choice A) is specific for the CREST (Calcinosis, Raynaud's syndrome, Esophageal dysfunction, Sclerodactyly, and Telangiectasia) variant of progressive systemic sclerosis (scleroderma). Rheumatoid factor is actually an autoantibody directed against the Fc portion of the IgG molecule (choice B). It is found in more than two-thirds of patients with rheumatoid arthritis. The majority of patients with SLE (around 95%) develop antinuclear antibodies (ANA; choice C), so this test is quite sensitive, but not very specific for SLE. ANA occur in other inflammatory disorders, autoimmune diseases, viral diseases, and in a number of normal individuals. Antibodies to double-stranded DNA are more specific for SLE, but are not included as an answer choice. Anti-SS-A antigen (choice E) refers to antibodies to certain ribonucleoproteins, which are fairly specific for Sjögren's syndrome.

8>The correct answer is C. There are two systems currently used for classifying nerve fibers. The first system groups both sensory and motor fibers together, describing A-a, A-b, A-g, Ad, B, and C fibers. Another system relates only to sensory fibers, describing Ia, Ib, II, III, IV categories. Both classification schemes begin with large, myelinated fibers, progressing to finer, unmyelinated fibers. The C fiber (or IV fibers) is the only type of fiber that is unmyelinated. Remember that preganglionic neurons are myelinated, but postganglionic neurons are unmyelinated. Neurons

that carry slow pain and temperature information are also classified as C fibers. See the table below for more information. Sensory and Motor Fibers Sensory Fibers Function A-a Ia (choice D) Alpha motor neurons, primary afferents of muscle spindles A-a Ib (choice E) Golgi tendon organ afferents, touch and pressure A-b II Secondary afferents of muscle spindles, touch and pressure A-g Gamma motor neurons A-d (choice A) III Touch, pressure, pain and temperature (fast) B (choice B) Preganglionic autonomic, visceral afferents C (choice C) IV Postganglionic autonomic, pain and temperature (slow)

9>The correct answer is A. In a syndrome called cleidocranial dysostosis, absence of part of the clavicles accompanies a broad skull, and facial and dental anomalies. Note that you could also have answered this question by noting that of the bones listed, only the clavicles form by intramembranous ossification. The femurs (choice B), metatarsals (choice C), phalanges (choice D), and tibias (choice E) are cartilaginous (formed by endochondral ossification) rather than membranous bones.

10>The correct answer is A. Patients with nonallergic bronchospastic conditions, such as emphysema and chronic bronchitis, are generally not prescribed beta-receptor blocking agents since these agents can cause bronchoconstriction by blocking beta-2 receptors. However, relatively low doses of selective beta-1 receptor antagonists, such as metoprolol and atenolol, are relatively well tolerated in patients with emphysema. As a precautionary measure, emphysema patients receiving beta-1-selective blocking agents should use a bronchodilator with beta-2-stimulating activity. All the other answer choices are nonselective beta receptor blocking agents and should not be used in the treatment of hypertension in patients with nonallergic bronchospasm since they are likely to exacerbate the signs and symptoms of the condition.

11>The correct answer is B. There is more than one way to think about this question. One way is to determine which of each of the descriptions corresponds to Pc, Pi, pc, and pi and then to use the Starling equation for net filtration pressure: (Pc - Pi) - (pc - pi). Perhaps faster and more intuitive is to just envision that the filtration pressure will be the difference between the forces pushing fluid out and the forces pulling fluid back into the glomerulus. The pushing forces are the hydrostatic pressure of the glomerulus (44 mm Hg) and the osmotic pressure of the tubular fluid (0). So the total pressure forcing fluid from the glomerulus into the tubular fluid is 44 mm Hg. The forces pulling the fluid back are the hydrostatic pressure of the Bowman's capsule (9 mm Hg) and the osmotic pressure of the plasma (28 mm Hg). So the total pressure pushing the fluid back into the glomerulus is 9 + 28 = 37 mm Hg. The difference between the forces favoring filtration and those opposing it are therefore 44-37 = 7 mm Hg.

12>The correct answer is B. Ingestion of glucose results in secretion of a "gut factor" into the blood that subsequently increases insulin secretion by b cells. The most likely candidate for this action is the intestinal peptide known as gastric inhibitory peptide (GIP), which obviously was named for its effects on the stomach. GIP secretion is increased during ingestion of glucose and the blood level produced is sufficient to stimulate insulin secretion. Because of this effect on insulin secretion, GIP is sometimes referred to as glucose-dependent insulinotropic peptide. Activation of the sympathetic innervation to the pancreas inhibits insulin secretion via an a2adrenergic mechanism. Hence, any sympathetic reflexes activated during ingestion of glucose would decrease (not increase, choice A) insulin secretion. While paracrine release of somatostatin (choice C) by D cells in the islets does inhibit insulin secretion by b cells, there is no reason to suspect that intravenous versus ingested glucose would have a differential effect on somatostatin release. The same holds true for glucagon secretion by a cells. Furthermore, glucagon has a paracrine effect to increase (not decrease, choice D) insulin secretion.

13>The correct answer is C. The collecting system, including the collecting ducts, minor and major calyces, and the renal pelvis are all derived from the ureteric bud. All of the other structures listed are derived from metanephric mesoderm.

14>The correct answer is E. All the compounds listed can produce crystals in joint fluid, but only monosodium urate (associated with gout) and calcium pyrophosphate dihydrate (associated with CPPD crystal deposition disease, also called pseudogout), and to lesser degree basic calcium phosphate (apatite-associated arthropathy), have a high likelihood of being encountered on a step 1 USMLE exam. The crystals described are those of monosodium urate. Be careful not to answer "uric acid" if that is listed as an alternative choice on an exam, since the sodium salt is the predominant species in vivo. Basic calcium phosphate (choice A) is seen in apatite-associated arthropathy and produces spherical clumps of nonbirefringent submicroscopic crystals. Calcium oxalate crystals (choice B) are seen in primary oxalosis and are bipyramidal, positively birefringent crystals. Calcium pyrophosphate dihydrate crystals (choice C) are a feature of pseudogout and are rodto-rhomboidal-shaped, weakly positively birefringent crystals. Cholesterol crystals (choice D) are seen in chronic and chylous effusions in inflammatory and degenerative arthritis, where they form large, flat, rhomboidal plates with notched corners.

15>The correct answer is A. The posterior cord supplies the axillary and radial nerves. Of the muscles listed, only the deltoid is supplied by one of these two nerves, specifically the axillary nerve. The flexor carpi ulnaris (choice B) is supplied by the ulnar nerve. The flexor digitorum superficialis (choice C), the flexor pollicis brevis (choice D), and the palmaris longus (choice E) are supplied by the median nerve.

16>The correct answer is D. The patient has nephrotic syndrome, as evidenced by the presence of edema and massive proteinuria. The most common cause of nephrotic syndrome in adults is membranous glomerulonephritis, which is characterized by diffuse capillary thickening with a granular pattern on immunofluorescence. Berger's disease (choice A) is characterized by IgA deposition in the glomerular mesangium. It does not usually cause nephrotic syndrome. Diabetic nephropathy (choice B) can cause nephrotic syndrome, but there would likely be glucose in the urine. Membranoproliferative glomerulonephritis (choice C) is an uncommon cause of nephrotic syndrome. Minimal change disease (choice E) is the most important cause of nephrotic syndrome in children.

17>The correct answer is C. The fallopian tube is the only structure in the female genital tract with a ciliated columnar epithelium; the beating of the cilia helps move the egg into the uterus. This fact is also sometimes clinically helpful since dilated and deformed fallopian tubes can be microscopically distinguished from cystic ovarian tumors by the presence of the cilia. The cervix (choice A) and vagina (choice E) are lined by squamous epithelium. The endometrium (choice B) is lined by columnar epithelium (although a few ciliated cells may be present). The covering of the ovary (choice D) is cuboidal epithelium, and cysts within the ovary can be lined by cuboidal or non-ciliated columnar epithelium.

18>The correct answer is B. The cell pictured is an eosinophil, a member of the granulocytic lineage of white blood cells. The crystalline core of the granule contains a protein called the major basic protein, which appears to function in the destruction of parasites. Major basic protein also has deleterious effects on epithelial cells in patients with asthmatic reactions. The light component around the dense crystalline core contains products such as histaminase, arylsulfatase, and other enzymes. Lactoferrin (choice A) is found in the specific granules of the neutrophil. It inhibits the growth of bacteria by interfering with iron metabolism. Myeloperoxidase (choice C) is found in the azurophilic (large) granule of the neutrophil. This enzyme is also destructive to bacteria, destroying their cell walls. Histamine (choice D) is produced by the basophil and the mast cell. The histaminase of the eosinophil regulates the inflammatory reaction of these two cell types. Tartrate-resistant acid phosphatase (choice E) is a marker for hairy cell leukemia, a neoplasm of the B lymphocyte line.

19>The correct answer is E. Take rashes involving the palms and soles (otherwise unusual sites) very seriously: only a small number of infections can cause this pattern, including Rocky Mountain spotted fever, meningococcemia, and secondary syphilis. Rocky Mountain spotted fever is caused by the rickettsia R. rickettsii, and is found throughout the United States, particularly in south central and eastern portions (not the Rocky Mountains). 3-12 days after a tick bite, patients develop malaise, frontal headache, and fever. Several days later, the rash described in the question stem develops. Other manifestations can include

hepatosplenomegaly, thrombocytopenia, and (potentially fatal) disseminated intravascular coagulation. Chickenpox (choice A), or varicella, is characterized by maculopapules that evolve into vesicles over hours to days, then eventually form crusts. Typical lesions first appear on the trunk and face and rapidly spread to involve other areas. The maculopapular rash of German measles (choice B), or rubella, usually begins on the face, then spreads down the body. Although the maculopapular rash of measles (choice C), or rubeola, can include the palms and soles, it typically begins along the hairline in frontal and temporal regions, then spreads down the trunk to the limbs. Mumps (choice D) is characterized by fever, malaise, parotitis, and orchitis, but not a rash.

20>The correct answer is C. The vein described is the greater (long) saphenous vein, which starts on the dorsal surface of the foot, wraps proximally to follow the medial aspect of the leg below and past the knee, and then dives into the deep fascia through the fossa ovalis (also called the saphenous opening) to reach the femoral vein, which becomes the external iliac vein shortly after it is joined by the greater saphenous vein. The anatomic snuff box (choice A) is on the wrist. Some authors also refer to an "anatomic snuff box of the foot," through which the saphenous vein does pass, but this is early in its course, and not just before it joins the femoral vein. The antecubital fossa (choice B) is at the elbow. The inguinal canal (choice D) contains structures going to and from the testes. The saphenous vein passes near, but not through, the popliteal fossa (choice E) to cross the knee. 21>The correct answer is E. Cases of severe idiosyncratic hepatocellular injury have been reported following the administration of troglitazone. The hepatic injury is usually reversible, but rare cases of hepatic failure leading to death or liver transplantation have been reported. The initial signs and symptoms of hepatic dysfunction include recent onset of nausea, vomiting, abdominal pain, anorexia, and a dark colored urine. Once these signs and symptoms begin to appear, the patient taking troglitazone should have liver function tests performed. An AST and ALT of greater than 3 times the normal limits and/or the appearance of jaundice are typical. Acarbose (choice A) is an alpha-glycosidase inhibitor used as an adjunctive treatment measure for NIDDM; the most common side effects are abdominal discomfort and flatulence. Glipizide (choice B) is a sulfonylurea oral hypoglycemic agent associated with the development of hypoglycemia and cholestatic jaundice (a rare complication). Metformin (choice C) is a biguanide oral hypoglycemic agent associated with the development of lactic acidosis and malabsorption of amino acids. Repaglinide (choice D) is the non-sulfonylurea moiety of glyburide; it is commonly associated with hypoglycemia, nausea and vomiting.

22>The correct answer is A. Classical conditioning involves the response toward one stimulus being transferred to another stimulus. For example, a patient who fears going to the doctor experiences heightened anxiety as the physician enters the room wearing a white coat. The patient's fear then becomes associated with the white coat itself, such that future exposure to this symbol evokes similar apprehension in the patient. Extinction (choice B) means that when a behavior is no longer reinforced, it will disappear.

Habit hierarchies (choice C) are ordered statements about the probability of occurrence of behaviors. Those behaviors that have been reinforced more strongly will be more likely to occur and will therefore be ranked higher in the response hierarchy. Negative reinforcement (choice D) occurs when, in response to a behavior, an aversive condition is removed rather than a positive reward being given. For example, a teenager may finally take out the garbage in order to stop his mother from nagging him. This is a method involved in operant conditioning (choice E), which is based on the relationship between a response and the consequences (reinforcement) that follow that response.

23>The correct answer is C. The pretracheal layer of the cervical fascia runs from the investing layers in both sides of the lateral neck and splits to enclose the thyroid gland. Superiorly, it attaches to the laryngeal cartilages; inferiorly, it fuses with the pericardium. As a result of these connections, the thyroid gland moves with laryngeal movements. The carotid sheath (choice A) contains the vagus nerve, internal jugular vein, carotid artery, and lymph nodes. The investing layer of the deep cervical fascia (choice B) splits to enclose the trapezius and sternocleidomastoid muscles. The prevertebral fascia (choice D) covers muscles arising from the vertebrae. The superficial fascia (choice E) is immediately deep to the platysma muscle

25>The correct answer is B. Streptococcus bovis is a Group D streptococcus. There is a significant association between S. bovis bacteremia and endocarditis with carcinoma of the colon and other colonic diseases. Every patient with S. bovis bacteremia should undergo gastrointestinal and cardiac evaluation. Up to 50% of patients with S. bovis bacteremia are reported to have underlying colonic malignancies. In another study, 25-50% of cases of S. bovis bacteremia were associated with endocarditis, especially in patients with preexisting valvular lesions. Streptococcus agalactiae (choice A) is an important cause of maternal and neonatal bacteremia and neonatal meningitis. It is part of the normal flora of the gastrointestinal tract and the female genital tract. Streptococcus pneumoniae (choice C) is a leading cause of community-acquired pneumonia, meningitis in adults, otitis media (especially in children), and sinusitis. Spontaneous peritonitis due to S. pneumoniae is reported in children with ascites from nephrotic syndrome. Asplenia predisposes patients to severe infections with S. pneumoniae and other encapsulated organisms. S. pneumoniae infections are also more frequent and unusually severe in patients with sickle cell anemia, multiple myeloma, alcoholism, and hypogammaglobulinemia. S. pneumoniae is now the leading cause of invasive bacterial respiratory disease in patients with AIDS. Streptococcus pyogenes (choice D) is the most common cause of bacterial pharyngitis. Complications include paratonsillar abscesses, otitis media, and sinusitis. Long-term sequelae include rheumatic fever and poststreptococcal glomerulonephritis. S. pyogenes is also responsible for many skin and soft tissue infections. The organism also produces many toxins that produce a variety of diseases. Streptococcus viridans (choice E), or the viridans Streptococci, are the most common cause of subacute bacterial endocarditis, which should be suspected in cases of viridans streptococcal bacteremia. One species of viridans Streptococci, Streptococcus milleri, is frequently associated with pyogenic abscesses, especially of the liver.

26>The correct answer is E. Rotavirus is the major cause of diarrhea in infants and children under the age of 2. The replicates in the intestinal mucosa, producing a profuse, watery, nonbloody diarrhea, often coupled with nausea and vomiting. Transmission is by the fecal-oral route. Coronaviruses (choice A) usually cause cold-like illnesses. Lymphocytic choriomeningitis virus (choice B) can cause headache, malaise, myalgia, conjunctivitis, and, occasionally, meningitis. Norwalk agent (choice C) can also cause diarrhea, but usually affects patients older than 2 years. Orbivirus (choice D) is the cause of Colorado tick fever, which is the only tick-borne viral disease in the United States.

27>The correct answer is A. While most of the liver is covered with peritoneum, there are several reflections of the peritoneum (commonly called "ligaments") on the posteroinferior surface of the liver. When the opposing layers of the reflections are separated, a "bare area" on the liver is produced. The largest bare area contains on one end the inferior vena cava and is bounded by a continuous irregular ring of ligament that is somewhat arbitrarily divided into sections called the anterior and posterior layers of the coronary ligaments. It is the anterior layer of the coronary ligament that would be felt in the maneuver described in the question stem. A fissure for the ligamentum venosum (choice B) is to the left of the coronary ligaments on the posteroinferior surface of the liver. The left triangular ligament (choice C) is an outpouching on the left side of the falciform ligament. The posterior layer of the coronary ligament (choice D) is inferior to the anterior layer. The right triangular ligament (choice E) is the name given for the area where the anterior and posterior reflections of the coronary ligament merge on the inferior part of the posteroinferior surface of the liver.

28>The correct answer is B. The most probable etiology of bacterial endocarditis involving the tricuspid valve is illicit intravenous drug use, which can introduce skin organisms into the venous system that then attack the tricuspid valve. Staphylococcus aureus accounts for between 60% and 90% of cases of endocarditis in intravenous drug users. The endocarditis associated with congenital heart disease (choice A) typically involves either damaged valves or atrial or ventricular septal defects. The tricuspid valve is not particularly vulnerable. Rheumatic fever (choice C) most commonly damages the mitral and aortic valves, and tricuspid damage is usually less severe and seen only when the mitral and aortic valves are heavily involved. Consequently, secondary bacterial endocarditis involving only the tricuspid valve in a patient with a history of rheumatic fever would be unusual. Rheumatoid arthritis (choice D) is not associated with bacterial endocarditis. Systemic lupus erythematosus (choice E) can produce small, aseptic vegetations on valves, but is not associated with bacterial endocarditis.

29>The correct answer is A. Most of the venous drainage of the skin of the lower extremity is to the long saphenous vein, the accompanying lymphatics of which drain into the superficial group of the inguinal lymph nodes. However, the skin drained by the short saphenous vein, including that of the lateral aspect of the dorsum of the foot, is an exception to this rule.

Lymphatic fluid from this area drains into lymphatics accompanying the short saphenous vein, then drains into lymph nodes behind the knee in the popliteal fossa. The lateral side of the thigh (choice B), the medial side of the leg below the knee (choice C), the medial side of the sole of the foot (choice D), and the medial side of the thigh (choice E) all drain to the superficial inguinal nodes.

30>The correct answer is E. Testicular feminization is a disorder of the androgen receptor. Phenotypically, the patient appears female, but has a blindly ending vagina and lacks a uterus or other female internal reproductive organs. The patient has an XY genotype. Since the gene for testes determining factor (TDF) is on the Y chromosome, TDF will cause the indifferent gonad to develop into a testis containing Sertoli cells. Sertoli cells at this stage will secrete MIF, a substance that suppresses the paramesonephric ducts, preventing the formation of female internal reproductive organs. This patient would not have a streak ovary (choice A), a finding in Turner's syndrome that is associated with a 45,XO genotype. In fact, the patient would have testes, since the genetic complement contained a Y chromosome. The testes in individuals with testicular feminization syndrome are often undescended and are usually removed surgically. This patient would not possess a uterus (choice B) or an oviduct (choice C). Both of these structures are derived from the paramesonephric duct, which is suppressed by MIF. Depressed levels of testosterone (choice D) would not occur in this patient. In fact, individuals with testicular feminization syndrome have normal or even slightly elevated levels of testosterone. The development of female external genitalia is the result of defective androgen receptors, not depressed levels of testosterone.

31>The correct answer is E. Weight loss of more than 5% of body weight is considered a very adverse prognostic feature in cancer since it usually indicates the presence of widespread disease. (Uncommonly, a relatively small primary lesion that has not yet metastasized can cause cachexia.) Both tumor necrosis factor (TNF) and interleukin 1-beta have been implicated in the production of cachexia with weight loss, loss of appetite, and alteration in taste. Large tumor burdens may additionally alter protein and energy balance, often with negative nitrogen balance. Therapy, in whatever form (surgery, radiation, chemotherapy), may also contribute to cachexia late in the course secondary to effects on the digestive system. Clathrin (choice A) is a protein that helps to form pinocytotic vesicles. Histamine (choice B) is released by mast cells and basophils and contributes to allergic responses. Interferon (choice C) is important in the body's response to viral infection. Interleukin 1-beta, not 2 (choice D), is produced by activated monocytes and macrophages and has been implicated in cachexia. Interleukin 2 is released by helper T cells and augments B-cell growth as well as antibody production.

32>The correct answer is E. The condition described is spinal bifida with myelomeningocele. A failure of the posteriorly located vertebral arches to fuse posteriorly causes spina bifida, which can vary in severity from a completely asymptomatic minor abnormality to protrusion of the spinal cord and roots through an open skin defect, with a very real risk of minor trauma or infection causing paralysis. Failure of development of one of the paired primary ossification centers (choice A) of the body can produce very severe scoliosis.

The bodies of the vertebrae (choice B) are the stacking ovoid structures on the anterior aspect of the spinal canal. The pedicles (choice C) attach the body ring that surrounds the spinal canal to the body of the vertebrae. The superior articular process (choice D) articulates with the inferior articular facet of the vertebra above it.

33>The correct answer is E. Both the CSF glucose level and the small number of lymphocytes present are within normal limits. It is normal for the CSF glucose to be less than serum glucose, often about 2/3 of the serum value. Bacterial meningitis (choices A and C) can profoundly lower CSF glucose levels. CSF from bacterial meningitis cases also usually shows large numbers of neutrophils. Viral meningitis (choices B and D) will not alter the CSF glucose level, but the CSF often contains many lymphocytes.

34>The correct answer is E. Hairy cell leukemia is characterized by pancytopenia and splenomegaly. Lymphadenopathy is unusual. The proliferating cells express the pan B-cell markers (CD19 and CD20), the monocyte marker (CD11c), the interleukin-2 receptor (CD25), and plasma cell-associated antigen-1 (PCA-1). Histologically, the cells display fine, hairlike projections when viewed with phase-contrast microscopy. A "fried-egg" appearance on stained bone marrow biopsy arises because of fixation artifacts that occur as a result of the hairlike projections on many of the cells. Tartrate-resistant acid phosphatase is virtually diagnostic of hairy cell leukemia. CD4 (choice A) is a cluster designation antigen that is displayed on the surfaces of T cells and maturing thymocytes. GpIIb/IIIa (choice B) is a platelet membrane receptor for fibrinogen, fibronectin, and von Willebrand's factor. Myeloperoxidase (choice C) is a marker for late myeloblasts and mature granulocytes. Monocytes also stain to some extent. Diffuse nonspecific esterase (choice D) staining is used to identify cells in the monocytic lineage. Punctate nonspecific esterase staining is observed in T cells.

35>The correct answer is E. The disease is necrotizing enterocolitis, which is a common cause of gastrointestinal emergency in premature and low-birth-weight infants. Typically, the infants are bottle-fed and develop severe abdominal distress in the first week of life. Contributing factors include intestinal ischemia, poor neonatal immune response, and microbial agents. Both the small and large bowel may be affected. Necrotizing enterocolitis may be complicated by intestinal gangrene, gastrointestinal bleeding, intestinal perforation, and sepsis. Survivors of severe necrotizing enterocolitis may have had significant lengths of bowel surgically removed, and later suffer from malabsorption and stricture formation. Histologically, the appearance varies with disease stage, but typically shows varying degrees of necrosis (transmural if perforation has occurred), inflammation, hemorrhage, and edema. A pseudomembrane composed of coagulated fibrin, neutrophils, and cellular debris may overlie the mucosa. Inflammatory polyps (choice A) can be seen following reepithelialization of ulcers, typically in ulcerative colitis, which would not be seen in the first week of life. Multiple diverticula (choice B) are seen in diverticulosis, which does not usually develop before middle age.

Neoplastic (precancerous) polyps (choice C), even in familial syndromes with a high colonic cancer rate, would not be expected to cause an acute abdominal emergency in a neonate. A thickened collagenous band (choice D) between surface epithelial cells and the lamina propria is seen with episodic watery diarrhea, usually in adults.

36>The correct answer is E. The child is likely suffering from cystic fibrosis. In this disorder, an abnormality of chloride channels causes all exocrine secretions to be much thicker, and more viscous than normal. Pancreatic secretion of digestive enzymes is often severely impaired, with consequent steatorrhea and deficiency of fat-soluble vitamins, including vitamin A. Cystinuria (choice A) is a relatively common disorder in which a defective transporter for dibasic amino acids (cystine, ornithine, lysine, arginine; COLA) leads to saturation of the urine with cystine, which is not very soluble in urine, and precipitates out to form stones. Hypoglycemia (choice B) is not a prominent feature of children with cystic fibrosis who are on a normal diet. Hyperglycemia may occur late in the course of the disease. Iron deficiency anemia (choice C) is not found with any regularity in children with cystic fibrosis. Sphingomyelin accumulation (choice D) is generally associated with deficiency of sphingomyelinase, as seen in Niemann-Pick disease.

37>The correct answer is D. The purpose of the time out is to remove the girl from stimuli to facilitate the extinction of unwanted behavior. To be effective, time out must be used consistently and predictably. If the child protests during a time out, as in this case, additional time is added to the period to extinguish the protest behaviors. The goal is to convey the clear message that the time out will be ended only when unacceptable behaviors are ended. To impact behavior, the intervention must be closely associated with the behavior. To delay in responding to the girl's protests (choice A) makes it harder for her to realize that the additional time is a direct consequence of her behavior. At age 3, reasoned, rational explanations (choice B) are unlikely to have any impact on the child's behavior. The child probably lacks the cognitive capacity to grasp the abstract rationale for why she is being disciplined. Paddling (choice C) is a type of attention, and can actually reinforce the behavior the parents are trying to extinguish. The child learns that protestation will bring the parents and their attention, even if it is negative attention. In addition, as a general rule, any response option on the USMLE exam that has someone hitting a child will almost certainly be scored as a wrong answer! This option encourages the child to cry and then demand a treat to become quiet (choice E), a kind of juvenile blackmail. Avoiding bad behavior is a baseline and need not be specially rewarded.

38>The correct answer is C. A pregnant patient is considered to be in preeclampsia if she develops hypertension, proteinuria, and edema. Eclampsia includes the addition of seizures to the triad. Approximately 7 percent of pregnant women develop preeclampsia, typically between 20 weeks gestation to 6 weeks postpartum. Predisposing conditions include preexisting hypertension, diabetes (choice A), and autoimmune diseases such as lupus (choice D). Laboratory features can include hyperuricemia (choice B) and thrombocytopenia (choice E), but these are not used to define the presence of eclampsia.

39>The correct answer is A. The patient is presenting with signs and symptoms of acute cholecystitis, which is associated with gallstones in more than 90% of all cases. This condition occurs when a stone becomes impacted in the cystic duct and inflammation develops behind the obstruction. The acute attack is often precipitated by a large fatty meal, and is characterized by the sudden appearance of severe, steady pain localized to the epigastrium or right hypochondrium. Laboratory findings often include elevated white blood cells (2,000 - 15,000/mL). Total serum bilirubin values of 1-4 mg/dL may be seen in some instances, and serum amylase may be elevated. In noncomplicated cases, treatment often includes IV alimentation, analgesics, and antibiotics, as well as withholding of oral feedings. Meperidine is the narcotic of choice since it is least likely to cause spasm of the sphincter of Oddi, probably because of its antimuscarinic properties. It is therefore preferred over morphine (choice B), oxycodone (choice D), and propoxyphene (choice E). Furthermore, propoxyphene is a narcotic agonist with mild analgesic properties; hence, it would most likely not be able to effectively treat this patient's severe pain. Naproxen (choice C) is a nonsteroidal anti-inflammatory drug (NSAID) indicated for the treatment of mild to moderate pain; this agent would most likely not provide sufficient pain control for this patient.

40>The correct answer is D. Many people who request physician-assisted suicide have one of two conditions present: either a poorly controlled painful condition or severe depression. If the painful condition is adequately treated or the depression is brought under good medical control, the request for physician assistance in terminating the situation is typically withdrawn. It is important to note that bringing these conditions under control requires the intervention of caregivers who are specifically trained in the management of these two conditions; primary care physicians usually are not adequately trained to address these difficult presentations. While patients who are diagnosed as bipolar disorder (choice A), borderline personality disorder (choice B), and schizophrenic disorder (choice E) often make suicide attempts (and frequently complete those attempts), they do not generally ask their physician for assistance in the suicide. Persons with factitious disorder (choice C) are seeking primary gain, often for dependency needs, and are seeking to enter the "sick role" not the "dead role."

41>The correct answer is E. The disease is myotonic dystrophy, which is an autosomal dominant disease; the affected gene has been localized to chromosome 19. Myotonic dystrophy is relatively common and is best thought of as a systemic disease, since it causes cataracts, testicular atrophy, heart disease, dementia, and baldness in addition to muscular weakness. A mutation on the X chromosome (choice A) causes Duchenne muscular dystrophy. None of the muscle diseases are known to be related to defects on the Y chromosome (choice B). Facioscapulohumeral dystrophy is associated with a defective gene on chromosome 4 (choice C). Infantile hypotonia has been related to defective genes on chromosome 5 (choice D).

42>The correct answer is D. This patient has a family history of diabetes. Steroid-induced diabetes mellitus is a frequent consequence of long-term corticosteroid therapy. It can be triggered by prednisone with or without a family history, but a predisposition may increase

the risk. Symptoms such as polyuria and weight loss may be masked by the disease for which the patient is taking steroids. Measurement of 1,25-dihydroxy vitamin D (choice A), the active vitamin D metabolite, would not be recommended. Corticosteroids can alter calcium balance mainly to due vitamin D deficiency secondary to impaired intestinal absorption of calcium, but 25-hydroxy vitamin D is a better marker for assessing nutrition. PTH, an 84 amino acid polypeptide, can be cleaved into an active N-terminal fragment and an inactive C-terminal fragment. Measurement of C-terminal PTH (choice B) is not recommended. Although PTH is a regulator of calcium homeostasis, these fragment molecule measurements have not been found to correlate well with true PTH activity on bone. Although PTH is a calcium regulator in the body, it is not considered a major contributor to corticosteroid-induced bone loss, so measurement of intact parathyroid hormone (choice C) is not the best choice. It is only significant if a person has underlying malabsorption such as inflammatory bowel disease. Serum protein electrophoresis (choice E) is used mainly for the diagnosis of multiple myeloma in patients with pathologic fractures or a high clinical suspicion of myeloma.

43>The correct answer is E. Von Gierke's disease is a glycogen storage disease caused by a deficiency of glucose-6-phosphatase. It typically presents with neonatal hypoglycemia, hyperlipidemia, lactic acidosis, and ketosis. Failure to thrive is common in early life; convulsions may occur due to profound hypoglycemia. The glycogen accumulation in von Gierke's disease occurs primarily in the liver and kidneys, accounting for the enlargement of these organs. Gout may develop later because of the derangement of glucose metabolism. Even if you don't remember all of the details of the presentation of these genetic diseases, you should be able to narrow the choices: Gaucher's disease (choice A) and Niemann-Pick disease (choice C) are lipid storage diseases, and would not be expected to produce hypoglycemia. The other diseases are glycogen storage diseases, but McArdle's (choice B) and Pompe's (choice D) disease affect muscle rather than liver, and would not be expected to produce profound hypoglycemia since the liver is the major source for blood glucose.

44>The correct answer is A. The graph is that of a log dose response curve of norepinephrine on alpha-1 receptors of vascular smooth muscle. Norepinephrine alone (control curve) is expected to show an increased response as the dose is increased. A shift to the left indicates potentiation (less norepinephrine is needed to give the same size response), a shift to the right indicates antagonism (more norepinephrine is needed to see a given response). Curve X shows potentiation, curve Y shows competitive antagonism and curve Z shows noncompetitive blockade of the alpha-1 receptors found on vascular smooth muscle. The answer must therefore include an indirect agonist, a competitive blocker, and a non-competitive blocker of alpha-1 receptors. Cocaine is an indirect agonist that acts by blocking monoamine reuptake, thereby allowing norepinephrine to stay longer and at higher concentration in its synapse, potentiating its action (curve X). (It also blocks the reuptake of dopamine and serotonin, potentiating them in the same way.) Prazosin is a competitive alpha-1 receptor blocker used in treatment of hypertension because of its vasodilatory effect, and would produce a right-shift of the doseresponse curve (curve Y). Phenoxybenzamine is the only non-competitive alpha-1 blocker used therapeutically in cases of malignant hypertension and pheochromocytomas. The excessive vasodilation produced by this agent is the result of irreversible binding to the receptor, thereby decreasing the efficacy (decreased curve height) of norepinephrine (curve Z).

Fluoxetine (choices B and C) is a serotonin specific reuptake blocker that would potentiate the action of serotonin, but not norepinephrine. It is also a weak alpha-1 blocker, which explains its side-effect of orthostatic hypotension. Propranolol (choices B and E) is a non-selective beta-blocker that would not directly effect the norepinephrine response at alpha-1 receptors. Although norepinephrine is also a beta-1 receptor agonist, beta-1 receptors are not present on blood vessels. Phentolamine (choice D) is a non-selective competitive alpha-blocker that has been largely supplanted by more selective alpha-1 blockers.

45>The correct answer is B. A typical menstrual cycle lasts around 26-30 days. The luteal phase (post-ovulation) generally lasts fourteen days; the length of the follicular phase (preovulation) is far more variable, and accounts for most of the variability observed in the length of the menstrual cycle. Just before menstruation, sex steroid levels are low, but gonadotropin levels (especially FSH) begin rising slightly. Basal body temperature remains high during the luteal phase of the menstrual cycle, but falls precipitously a few days before the onset of menstruation. Markedly increased inhibin levels (choice A) are seen in the middle of the luteal phase, dropping to low levels just before menstruation. LH levels peak approximately 36 hours before ovulation (choice C), then decrease rapidly (choice D) within a few days to a low level during the mid-luteal phase, gradually decreasing until menstruation. The basal body temperature significantly increases (choice E) shortly after ovulation, due to the metabolic effects of progesterone produced by the corpus luteum.

46>The correct answer is D. Rib fractures are very painful (it hurts to breathe deeply) and can compromise the normal chest morphology (the chest can't change shape normally), both of which can impair ventilation at the peripheral level. Ventilation is the term used for the mechanical part of breathing: the air goes in and the air goes out. Other causes of hypoventilation of peripheral origin include phrenic nerve paralysis, suffocation, submersion, poliomyelitis, tetanus, and the Pickwickian syndrome. Decreased diffusion capacity (choice A) can occur when the blood-gas barrier is thickened (e.g., diffuse interstitial fibrosis, sarcoidosis, asbestosis, hyaline membrane disease), when the surface area of the blood-gas barrier is reduced (e.g., pneumonectomy, emphysema), or when less hemoglobin is available to pick up the oxygen (e.g., anemia, pulmonary embolism). Decreased surface area of alveolar capillary membranes (choice B) occurs after lung resection or in disease (e.g., emphysema). Hypoventilation of central origin (choice C) involves the central respiratory center of the brain, and is most commonly seen in morphine or barbiturate overdose. Inequalities of ventilation and perfusion (choice E) are common in chronic obstructive lung disease (both emphysema and chronic bronchitis), asthma, bronchiectasis, pneumonia, and granulomatous diseases.

47>The correct answer A. Release of cholecystokinin is stimulated by the presence of peptides, amino acids, or fatty acids in the small intestine. Cholecystokinin acts on the pancreas to stimulate secretion of pancreatic enzymes that aid in the digestion of these compounds. Gastrin (choice B) secretion is stimulated by the presence of peptides or amino acids in the lumen of the stomach, and produces an increase in gastric H+ secretion.

Motilin (choice C) is a hormone that regulates the migrating myoelectric complex, a series of contractions that occur during fasting, clearing the stomach and small intestine of any residual food. Secretin (choice D) secretion is stimulated by the presence of H+ and fatty acids in the duodenum, and causes an increase in pancreatic and biliary HCO3- release and a decrease in gastric H+ release. Somatostatin (choice E) secretion is stimulated by the presence of H+ in the lumen, and results in decreased release of all gastrointestinal hormones and decreased H+ secretion in the stomach.

48>The correct answer is E. The majority of circulating testosterone is bound to plasma protein (around 98%), rather than existing in free form (choice C). Of this, a majority is bound to a specific sex (or gonadal) steroid-binding protein (choice E), and a minority is bound to albumin (choice D). Dihydrotestosterone is produced from testosterone in the tissues by a specific enzyme, 5-alpha-reductase, rather than circulating in bound (choice A) or free (choice B) form.

49>The correct answer is E. The thyroglossal duct develops as an evagination of the floor of the pharynx in the region where the tongue develops. The adult foramen cecum of the tongue marks the site of this evagination. The distal end of this duct normally forms the thyroid gland; the proximal part of the duct normally degenerates. Failure of a part of the duct to degenerate may lead to a thyroglossal duct cyst or median cervical cyst, as seen in this patient. The first pharyngeal cleft (choice A) forms the external ear canal. This cleft normally remains patent. The first pharyngeal pouch (choice B) forms the middle ear cavity and the auditory tube. This pouch normally remains patent. The second pharyngeal cleft (choice C) normally does not remain patent. It is typically covered over by the overgrowth of the second pharyngeal arch. If part of this pouch does remain patent, it may form a lateral cervical cyst, which is seen on the lateral side of the neck along the posterior border of the sternocleidomastoid muscle. The second pharyngeal pouch (choice D) forms the tonsillar fossa of the pharynx. The pharyngeal mucosa in this area arises from the endoderm of the pouch. Ingrowth of mesoderm cells results in the formation of the palatine tonsil.

50>The correct answer is A. Fascial straps (retinacula) and fascial coverings of muscles or muscle groups characteristically attach to nearby bones by blending with the covering periosteum. No deep attachments are usually made by fascia. Cancellous bone (choice B) is spongy bone, which is usually found in marrow, and is not the site for fascial attachment. Fascia do not usually attach to cartilage (choice C). Fascia attaches to bony shafts, or diaphyses (choice D), superficially via the periosteum. Fascia do not penetrate the bone to reach the marrow (choice E). 1>A 48-year-old white female secretary presents with progressive difficulty typing over the past month. She also notes that her hands begin to feel numb and weak after typing for long periods of time. Upon testing, which of the following deficits would be predicted? A. Difficulty in abducting the fifth finger

B. C. D. E. F. G. Anwser

Difficulty in adducting the thumb Difficulty in flexing digits two and three at the metacarpophalangeal joints Loss of sensation over the lateral half of the dorsum of the hand Loss of sensation over the lateral half of the palm Loss of sensation over the medial half of the dorsum of the hand Loss of sensation over the medial half of the palm

2>The smooth part of the right atrium derives from which of the following embryonic structures? A. Bulbus cordis B. Primitive atrium C. Primitive ventricle D. Sinus venosus E. Truncus arteriosus Anwser

3>A 66-year-old male presents with chronic fatigue. On examination, the patient is noted to have lymphadenopathy and an enlarged liver and spleen. Laboratory examination reveals a white blood cell count of 25,000/mL with 93% lymphocytes; the lymphocytes appear small and mature. Both the hematocrit and platelet counts are within normal limits; however, hypogammaglobulinemia is also noted. Which of the following agents is indicated for treatment of this patient's condition? A. Chlorambucil B. Cisplatin C. Dacarbazine D. Tamoxifen E. Vinblastine Anwser

4>A patient who has suffered severe chest trauma in an automobile accident is found to have fluid in the right pleural space. A thoracentesis reveals the presence of chylous fluid in the pleural space, suggesting a rupture of the thoracic duct. In which regions of the thorax is the thoracic duct found? A. Anterior and middle mediastinum B. Anterior and superior mediastinum C. Middle and posterior mediastinum D. Middle and superior mediastinum E. Posterior and superior mediastinum Anwser

5>A 15-year-old boy is evaluated by a clinician for failure to develop norma

l male secondary sexual characteristics. Physical examination reveals small testes, a small penis, and gynecomastia. The boy has had some difficulties in school, and the parents say that the school psychometrist said he had an IQ of 90. This patient's condition is most likely to be related to which of the following? A. Deletion B. Nondisjunction of an autosomal chromosome C. Nondisjunction of a sex chromosome D. Non-Robertsonian translocation E. Robertsonian translocation Anwser

6>Careful testing of the visual fields in a patient complaining of difficulty reading demonstrates a central scotoma involving one visual field. This defect is most likely due to a lesion involving which of the following structures? A. Macula B. Optic chiasm C. Optic radiations in the parietal lobe D. Optic radiations in the temporal lobe E. Optic tract Anwser

7>A 70-year-old woman with a history of multiple small strokes reports to her physician that she has had multiple recent experiences that something or someone seemed very familiar, when in reality they were not familiar to her. This type of experience is called which of the following? A. Anterograde amnesia B. Confabulation C. Deja vu D. Jamais vu E. Retrograde amnesia Anwser

8>A 33-year-old single mother of two young children visits her physician because of an oral ulcer. A review of systems is significant for fatigue, myalgia, and joint pain. Laboratory results demonstrate leukopenia, and a high-titered antinuclear antibody. A speckled staining pattern due to anti-Sm is seen with immunofluorescence; urinary protein is elevated. Which of the following is the most likely diagnosis? A. Generalized fatigue B. Goodpasture's syndrome C. Mixed connective tissue disease D. Scleroderma E. Systemic lupus erythematosus Anwser

9>Researchers are assessing the specificity of a screening procedure for breast cancer in a population of 3000 women whose mothers had the disease. The presence or absence of a malignant condition is established by conventional mammography, which is assumed to be definitive for the purposes of comparison. The following data are collected: Positive Negative Total Cancer 90 10 100 No cancer 360 2540 2900 Total 450 2550 3000 What is the specificity of the test? A. 90/100 B. 90/450 C. 2540/2550 D. 2540/2900 E. (90+2540)/3000 Anwser

10>A patient develops fever, shortness of breath, and appears to be quite ill. X-ray demonstrates bilateral interstitial lung infiltrates. Bronchial washings demonstrate small "hat-shape" organisms visible on silver stain within alveoli. Which predisposing condition is most likely to be present in this patient? A. AIDS B. Congestive heart failure C. Pulmonary embolus D. Rheumatoid arthritis E. Systemic lupus erythematosus Anwser

11>A 35-year-old retarded man with a strong history of mental retardation among male relatives undergoes genetic testing. His lymphocytes are cultured in a medium containing methotrexate and 4% of the metaphase chromosomes in the lymphocytes show a breakpoint at q27.3 on the X chromosome. This man is at increased risk for which of the following cardiovascular disorders? A. Aortic stenosis B. Atrial septal defect C. Mitral valve prolapse D. Tricuspid atresia E. Ventricular septal defect Anwser

12>While lying supine in bed eating, a child aspirates a peanut. Which of the following bronchopulmonary segments would this foreign object mos t likely enter? A. Apical segment of the left upper lobe B. Apical segment of the right upper lobe C. Medial segment of the right middle lobe D. Posterior basal segment of the left lower lobe E. Superior segment of the right lower lobe Anwser

13>A 43-year-old man is brought to the general medicine clinic by his wife. She states that his memory has progressively deteriorated over the last several years, and that his personality has been changing. On examination, the physician notes abnormal, writhing movements of the man's limbs and hyperreactive patellar reflexes. An MRI of the head reveals a loss of volume in the neostriatum and cortex. A family history reveals that similar symptoms occurred in several members of the patient's family. Which of the following genetic mechanisms has been implicated in this disorder? A. Expanded trinucleotide tandem repeat B. Genomic imprinting C. Large deletion in one gene D. Single amino acid substitution E. Translocation Anwser

14>During a routine physical examination of a 74-year-old man, a physician palpates a large, pulsating mass in the lower abdomen. To which of the following is this mass most likely etiologically related? A. Atherosclerosis B. Bacterial infection C. Congenital anomaly D. Cystic medial degeneration E. Syphilis Anwser

15>The cell in the center of the electron micrograph above is important in wound healing and plays a role in the pathological process underlying Dupuytren's contracture. Which of the following cell types is depicted? A. Endothelial cell B. Myoepithelial cell C. Myofibroblast D. Pericyte E. Smooth muscle cell Anwser

16>Damage to which of the following structures might produce hair cell loss? A. Basilar membrane B. Organ of Corti C. Reissner's membrane D. Scala tympani E. Scala vestibuli Anwser

17>A thyroid mass usually moves with swallowing because the thyroid gland is enclosed by which of the following fascia? A. Carotid sheath B. Investing layer of the deep cervical fascia C. Pretracheal fascia D. Prevertebral fascia

E. Anwser

Superficial fascia

18>The blood from an 8-year-old boy was analyzed by flow cytometry . The exact number of B cells was counted. Which of the following cell surface markers was likely used to identify the B cells in this blood sample? A. CD3 B. CD4 C. CD8 D. CD19 E. CD56 Anwser

19>A child who has had abnormal development of the membranous bones has a broad skull with associated facial and dental anomalies. Which other bones are most likely to also be affected? A. Clavicles B. Femurs C. Metatarsals D. Phalanges E. Tibias Anwser

20>Which of the following drugs used in the treatment of noninsulin-dependent diabetes mellitus (NIDDM) has no effect on the secretion of insulin? A. Acetohexamide B. Chlorpropamide C. Glyburide D. Metformin E. Tolbutamide Anwser

21>A 57-year-old man presents with a steady, severe pain in the right hypochondrium, nausea, vomiting, and a temperature of 102 F. He states that his signs and symptoms began shortly after eating his favorite pizza with extra cheese, pepperoni, and sausage. Laboratory examination reveals a white blood cell count of 13,400/mL and a serum bilirubin value of 2.8 mg/dL. If hepatobiliary imaging reveals an obstructed cystic duct, which of the following agents would be the drug of choice for the treatment of this patient's pain? A. Meperidine B. Morphine

C. D. E. Anwser

Naproxen Oxycodone Propoxyphene

22>After falling on his laterally outstretched arm, a patient suffered a dislocation of the glenohumeral joint. Which of the following nerves is most likely to have been injured from this dislocation? A. Axillary nerve B. Dorsal scapular nerve C. Lateral pectoral nerve D. Medial pectoral nerve E. Suprascapular nerve Anwser

23>A 45-year-old woman presents to her physician because of a severe "sore throat." Physical examination demonstrates fever and an extremely tender, enlarged thyroid gland, but no throat erythema. Serum thyroid studies demonstrate a mild degree of hyperthyroidism. Two months later, the patient is asymptomatic, and thyroid function tests have returned to normal. She never again experiences difficulty with her thyroid function. Which of the following was the most likely cause of her hyperthyroidism? A. Diffuse nontoxic goiter B. Graves disease C. Hashimoto's thyroiditis D. Subacute granulomatous thyroiditis E. Subacute lymphocytic thyroiditis Anwser

25>A patient has an insulin-secreting tumor that is localized to the tail of the pancreas. Which of the following would most likely be an associated finding during fasting? A. Glycosylated hemoglobin level is increased B. Plasma concentration of C peptide is decreased C. Plasma concentration of glucagon is decreased D. Plasma concentration of glucose is increased E. Plasma concentration of proinsulin is increased Anwser

26>A 14-year-old girl with a high fever and sore throat presents to the emergency room. A complete blood count with differential implies the presence of a viral infection. Which of the following best describe s the cells that indicate a viral etiology to her illness?

A. B. C. D. E. Anwser

They are basophilic with spherical dark-stained nuclei They are precursors of osteoclasts and liver Kupffer cells They contain a peripheral hyalomere and central granulomere They have azurophilic granules and multilobed nuclei They remain in the circulation approximately 120 days

27>A 35-year-old woman notices a change in the appearance of a mole on her neck. Physical examination reveals that the lesion is an irregular, nodular, superficial mass with a variegated appearance. Biopsy demonstrates a primary malignant tumor. Which of the following factors is most predictive of the patient's long term prognosis? A. Circumference of lesion B. Darkness of lesion C. Degree of color variation D. Depth of lesion E. Sharpness of border between lesion and adjacent skin Anwser

28>A patient develops a swollen and tender lymph node in his popliteal fossa. An infected skin lesion in which of the following sites would most likely induce lymphadenopathy in this region? A. Lateral side of the dorsum of the foot B. Lateral side of the thigh C. Medial side of the leg below the knee D. Medial side of the sole of the foot E. Medial side of the thigh Anwser

29>A 4-year-old child living in a slum is bitten by a rat while sleeping. Two days later, the child develops a rash characterized by discrete erythematous 1-4 mm macules on the extremities and face, most obvious on the palms and soles. Which of the following organisms is the most likely cause of this child's disease? A. Borrelia burgdorferi B. Pseudomonas mallei C. Pseudomonas pseudomallei D. Spirillium minus E. Streptobacillus moniliformis Anwser

30>A 25-year-old woman develops extensive pruritic wheals following ingestion of seafood to which she was allergic. While these lesions

are usually not biopsied, a biopsy would probably show which of the following features? A. Dilated superficial lymphatic channels B. Granular complement and IgG at dermal/epidermal junction C. Microscopic blisters D. Munro microabscesses E. Solar elastosis Anwser

31>A 43-year-old man presents complaining of pain in the groin. On examination, his physician palpates a bulge in the region of the superficial inguinal ring, which he diagnoses as a direct inguinal hernia. The hernial sac most likely A. is covered by all three layers of the spermatic fascia B. passes medial to the inferior epigastric artery C. passes medial to the lateral border of the rectus abdominis muscle D. passes posterior to the inguinal ligament E. passes through the deep inguinal ring Anwser

32>A 60-year-old alcoholic smoker abruptly develops high fever, shakes, a severe headache, and muscle pain. He initially has a dry, insignificant cough, but over the next few days he develops marked shortness of breath requiring assisted ventilation. Chest x-ray demonstrates homogeneous radiographic shadowing that initially involves the left lower lobe but continues to spread until both lungs are extensively involved. Culture of bronchoalveolar lavage fluid on buffered charcoal yeast extract (BCYE) demonstrates a coccobacillary pathogen. Which of the following is the most likely causative organism? A. Legionella pneumophila B. Listeria monocytogenes C. Spirillium minus D. Staphylococcus aureus E. Streptococcus pneumoniae Answer

33>An experimental serologic test is developed to detect the presence of HIV antibody. Epidemiological analysis reveals the results shown below. People with HIV antibody People without HIV antibody Positive test 100 50 Negative test 20 950 What is the sensitivity of this test? A. 11% B. 67% C. 83%

D. E. Anwser

95% 98%

34>A 30-year-old pregnant woman of Jewish descent presents to a physician with painful oral ulcers. Physical examination demonstrates widespread erosions of her mucous membranes. Close examination reveals a friable mucosa, but no well-defined aphthous ulcers. Biopsy of perilesional mucosa demonstrates acantholysis; direct immunofluorescence demonstrates an intraepidermal band of IgG and C3. Which of the following is the most likely diagnosis? A. Bullous pemphigoid B. Dermatitis herpetiformis C. Herpes simplex I D. Herpes simplex II E. Pemphigus vulgaris Anwser

35>A 40-year-old woman presents to the emergency department because of hematuria. Laboratory analyses show significant proteinuria, bacteria and white cells in the urine, and a blood urea nitrogen (BUN) of 40 mg/dL with a creatinine of 4.0 mg/dL. Ultrasonography reveals enlarged kidneys, and she is given a provisional diagnosis of polycystic renal disease. Which of the following is likely to be decreased in this patient? A. Creatinine clearance B. Extracellular sodium concentration C. Glucose clearance D. Plasma creatinine levels E. Plasma inulin levels Anwser

36>During development, the formation of the kidney is induced by which of the following structures? A. Allantois B. Mesonephric duct C. Mesonephros D. Metanephric duct E. Urogenital ridge Anwser

37>A premature infant develops progressive difficulty breathing over the first few days of life. Deficient surfactant synthesis by which of the following

cell types may have contributed to the baby's respiratory problems? A. Alveolar capillary endothelial cells B. Bronchial mucous cells C. Bronchial respiratory epithelium D. Type I pneumocytes E. Type II pneumocytes Anwser

38>A surgeon performs an exploratory laparotomy, producing a large incision in the patient's abdomen. Poor blood supply to which of the following is most likely to cause problems during the healing process? A. Adipose tissue B. Aponeuroses C. Loose connective tissue D. Muscle E. Skin Anwser

39>Which of the following would be expected to be decreased in a patient with chronic hypertension secondary to renal artery stenosis? A. Atrial natriuretic peptide levels B. Blood urea nitrogen (BUN) levels C. Glomerular filtration rate in response to captopril D. Net acid excretion E. Potassium secretion Anwser

40>A patient, who appears to be female, is found to be 46,XY. The patient's vagina is very shallow, ending in a blind pouch, and there are palpable masses in the labia. The diagnosis of testicular feminization syndrome is made. Which of the following was most likely present during the early fetal life of this individual? A. A streak ovary B. A uterus C. An oviduct D. Depressed levels of testosterone E. MIF (Mullerian inhibitory factor) Anwser

41>A healthy 42-year-old woman with a history of anxiety attacks sits in the hospital waiting room as her 3-year-old daughter undergoes open heart surgery for a septal malformation. The woman experiences a feeling of suffocation and is obviously hyperventilating. She informs her husband that she feels faint and has blurred vision. Which of the following is

most likely to relieve the symptoms caused by hyperventilation? A. Breathing a 10% oxygen/90% nitrogen mixture B. Breathing 100% nitrogen C. Breathing in and out of a plastic bag D. Intravenous administration of bicarbonate E. Lying down Anwser

42>Which of the following occurs at the darkly stained band indicated by the arrow? A. Acrosome reaction B. Aromatase acts on testosterone C. Capacitation D. Implantation receptors are exhibited E. Meiosis is resumed Anwser

43>A 38-year-old AIDS patient presents to his physician's office in Kansas City, Missouri, complaining of fever for the past week and an increasing headache. He also states that sunlight hurts his eyes and that he has

been feeling nauseated and weak. His past medical history is significant for Pneumocystis pneumonia and a total CD4 count of 89. Current medications are trimethoprim/sulfa and indinavir. Cerebrospinal fluid (CSF) reveals 4 WBC, and budding encapsulated yeast forms grow on Sabouraud's agar. Which of the following is an accurate description of the morphology of the infectiou s form of the organism responsible for the man's illness? A. Broad-based, budding yeasts B. Budding yeasts in a "pilot's wheel" arrangement C. Cylindrical arthroconidia D. Encapsulated budding yeasts E. Filamentous molds F. Septate hyphae with microconidia and macroconidia Anwser

44>To which of the following diseases is pyruvate kinase deficiency most similar clinically? A. a-thalassemia B. b-thalassemia C. Glucose-6-phosphate dehydrogenase deficiency D. Hereditary spherocytosis E. Iron deficiency anemia Anwser

45>A 60-year-old male with angina comes to the emergency room with severe chest pain unresponsive to sublingual nitroglycerin. An EKG shows ST segment elevation in the anterolateral leads, and thrombolytic therapy is initiated. If streptokinase is given to this patient, it may produce thrombolysis after binding to which of the following proteins? A. Antithrombin III B. Fibrin C. Plasminogen D. Protein C E. Thrombomodulin Anwser

46>A child is brought to the pediatrician because of perianal itching, which has been disturbing the child's sleep. Physical examination reveals scaly skin in the perianal region. The physician instructs the parents to place transparent tape on the perianal region the next morning, and then retur n to the office. In the office, the tape is transferred to a microscope slide, and low-power examination of the tape reveals oval eggs that are flattened along one side. The microorganism most likely responsible for the child's symptoms is A. Ancylostoma duodenale B. Ascaris lumbricoides

C. D. E. Anwser

Enterobius vermicularis Necator americanus Trichuris trichiura

47>A healthy, 37-year-old, recently divorced woman loses her job at the auto factory. She picks up her three young children from the factory day care center and gets into an automobile accident on the way home. Her 5-year-old son, who was not wearing a seat belt, sustains a severe head injury. The woman was not hurt in the accident, but is hyperventilating as she sits in the waiting room at the hospital. She complains of feeling faint and has blurred vision. Which of the following is decreased in this woman? A. Arterial oxygen content B. Arterial oxygen tension (PO2) C. Arterial pH D. Cerebral blood flow E. Cerebrovascular resistance Anwser

48>A 66-year-old man with urinary retention secondary to prostatic hyperplasia develops a spiking fever and tachypnea. Physical exam reveals intercostal muscle retractions and bilateral inspiratory crackles. A chest x-ray exhibits bilateral interstitial and alveolar infiltrates. Arterial blood gases demonstrate severe hypoxemia. Blood cultures would most likely reveal A. gram-negative diplococci B. gram-negative rods C. gram-positive cocci D. gram-positive diplococci E. gram-positive rods Anwser

49>A patient arrives in the emergency room after having attempted suicide by lacerating his wrist. No major artery was damaged, but the nerve that is immediately lateral to the flexor digitorum superficialis tendon is cut. Which of the following actions will no longer be possible? A. Abduction of the second digit B. Adduction of the second digit C. Adduction of the thumb D. Flexion at the interphalangeal joint of the thumb. E. Opposition of the thumb Anwser

50>A 48-year-old female is being treated for breast carcinoma. Over the past few days, she has been complaining of dysuria and frequency. Laboratory examination revealed the presence of microscopic hematuria. The next day the patient developed gross hematuria. Which of the following agents most likely caused the development of these signs and symptoms? A. Cyclophosphamide B. Mitomycin C. Paclitaxel D. Tamoxifen E. Vincristine Anwser

Answers

1>The correct answer is C. This is a classic presentation of a patient with carpal tunnel syndrome, which typically affects females between the ages of 40 and 60 who chronically perform repetitive tasks that involve movement of the structures that pass through the carpal tunnel. One important structure that passes through the carpal tunnel is the median nerve. Patients often note a tingling, a loss of sensation, or diminished sensation in the digits. There is also often a loss of coordination and strength in the thumb, because the median nerve also sends fibers to the abductor pollicis brevis, flexor pollicis brevis, and the opponens pollicis. A final function of the median nerve distal to the carpal tunnel is control of the first and second lumbricals which function to flex digits two and three at the metacarpophalangeal joints and extend interphalangeal joints of the same digits. Abduction of the fifth digit (choice A) is a function controlled by the ulnar nerve, which does not pass through the carpal tunnel. Adduction of the thumb (choice B) is a function of the adductor pollicis, which is the only short thumb muscle that is not innervated by the median nerve, but rather by the deep branch of the ulnar nerve. Sensation of the lateral half of the dorsum of the hand (choice D) is mediated by the radial nerve, which also does not pass through the carpal tunnel. Sensation over the lateral aspect of the palm (choice E) is mediated by the median nerve, however the branch innervating the palm (palmar cutaneous branch of the median nerve) passes superficial to the carpal tunnel. Sensation over the medial aspect of the dorsum of the hand (choice F) is mediated by the ulnar nerve. Sensation over the medial aspect of the palm (choice G) is mediated by the ulnar nerve.

2> The correct answer is D. The smooth part of the right atrium (the sinus venarum) is derived from the sinus venosus. The coronary sinus and the oblique vein of the left atrium also derive from the sinus venosus.

The bulbus cordis (choice A) gives rise to the smooth part of the right ventricle (conus arteriosus) and the smooth part of the left ventricle (aortic vestibule). The primitive atrium (choice B) gives rise to the trabeculated part of the right and left atria. The primitive ventricle (choice C) gives rise to the trabeculated part of the right and left ventricles. The truncus arteriosus (choice E) gives rise to the proximal part of the aorta and the proximal part of the pulmonary artery.

3>The correct answer is A. Chronic lymphocytic leukemia (CLL) is typically a disease of the elderly, with 90% of cases occurring after the age of 50; the median age is 65. Patients will typically present with a complaint of chronic fatigue and/or lymphadenopathy. Approximately 50% of all patients with CLL present with an enlarged liver and/or spleen. CLL typically pursues an indolent course but can occasionally present as a rapidly progressive disease. The hallmark of CLL is the isolated lymphocytosis in which the white blood cell count is usually greater than 20,000/mL and between 75% and 98% of the circulating cells are small "mature" lymphocytes. Chlorambucil is classified as a nitrogen mustard, a subcategory of the alkylating agents. It is primarily used to treat chronic lymphocytic leukemia and ovarian carcinoma; it can also be used to treat Hodgkin's disease and various other lymphomas. Cisplatin (choice B) is an alkylating agent indicated for the treatment of metastatic testicular and ovarian tumors in combination with other agents. Dacarbazine (choice C) is a cytotoxic agent with alkylating properties. It is used as a single agent or in combination with other antineoplastics in the treatment of metastatic malignant melanoma, refractory Hodgkin's disease, and various sarcomas. Tamoxifen (choice D) is an antiestrogen hormone used in the palliative treatment of breast cancer in patients with estrogen-receptor-positive breast cancer. Vinblastine (choice E) is a mitotic inhibitor antineoplastic agent indicated for the treatment of Hodgkin's disease and non-Hodgkin's lymphomas, choriocarcinoma, lymphosarcoma, and neuroblastoma, as well as various other types of cancer.

4>The correct answer is E. The mediastinum is divided into four regions. The region above the manubriosternal junction (level of fourth thoracic vertebra) is the superior mediastinum. The region below the manubriosternal junction is divided into the anterior mediastinum (anterior to the pericardium), the middle mediastinum (within the pericardium), and the posterior mediastinum (posterior to the pericardium). The thoracic duct enters the thorax through the aortic hiatus of the diaphragm. At this point it lies in the posterior mediastinum, the region posterior to the pericardium. As it ascends through the thorax and passes the level of the fourth thoracic vertebra, it enters the superior mediastinum. The anterior mediastinum (choices A and B) contains the thymus and fatty connective tissue. The middle mediastinum (choices A, C, and D) contains the heart and the roots of the great vessels. In addition to the thoracic duct, the superior mediastinum (choices B, D, and E) contains the ascending aorta, aortic arch, branches of the aortic arch, descending aorta, superior vena cava, brachiocephalic veins, thymus, trachea and esophagus. In addition to the thoracic duct, the posterior mediastinum (choices C and E) contains the descending aorta, azygos vein, hemiazygos vein and the esophagus

5The correct answer is C. The boy probably has Klinefelter's syndrome (47, XXY), which has the typical presentation described in the question. The condition arises as a result of failure of separation (nondisjunction) of the sex chromosomes, and can be related to either paternal nondisjunction (slightly more common) or maternal nondisjunction. Deletions (choice A) are a common form of genetic disease and contribute to many genetic recessive diseases. Examples of nondisjunction of autosomes (choice B) include trisomies such as most cases of Down's syndrome (trisomy 21), Edwards' syndrome (trisomy 18), and Patau syndrome (trisomy 13). There are two types of translocations: non-Robertsonian (choice D) and Robertsonian (choice E). Non-Robertsonian (reciprocal) translocations result when two non-homologous chromosomes exchange genetic material. Robertsonian translocations are a special type of translocation that involve exchange of genetic material from the long arms of one acrocentric chromosome to the long arms of another acrocentric chromosome, with fusion of the centromeres. Four percent of cases of Down's syndrome are caused by this mechanism.

6>The correct answer is A. The probable location of lesions producing visual defects is a favorite USMLE topic (and is also well worth knowing if you have occasion to work up such a patient). Here is a list that may help you sort through these problems: Central scotoma ~ macula Ipsilateral blindness ~ optic nerve Bitemporal hemianopia ~ optic chiasm (choice B) Homonymous hemianopia ~ optic tract (choice E) Upper homonymous quadrantanopia ~ temporal optic radiations (choice D) Lower homonymous quadrantanopia ~ parietal optic radiations (choice C) Also, cortical lesions produce defects similar to those of the optic radiations, but may spare the macula. 7>The correct answer is C. This is deja vu ("seen before"), which is the experience of an event, person, or thing as familiar, even though it has never previously been experienced. Severe cases often accompany an underlying neurologic problem. Anterograde amnesia (choice A) is the inability to learn new facts. Most commonly, it involves both verbal and nonverbal material, but it can involve one or the other. In confabulation (choice B), a patient reports "memories" of events that did not take place at the time in question. In jamais vu (choice D), a patient fails to recognize familiar events that have been encountered before. In retrograde amnesia (choice E), a patient fails to remember facts or events that occurred before the onset of amnesia. 8>The correct answer is E. Systemic lupus erythematosus (SLE) is a prototype connective tissue disease. The diagnosis requires four criteria to be met from a list of eleven possible criteria: malar rash, discoid rash, photosensitivity, oral ulcers, arthritis, serositis, renal disorder, neurologic disorder, hematologic disorder, immunologic disorder, and antinuclear antibody. This patient also has anti-Sm, which is pathognomonic for SLE, but is only found in 30% of the affected patients. Antinuclear antibodies (ANA) are present in 95-100% of cases of SLE; anti-double-stranded DNA is found in 70% of the cases.

Generalized fatigue (choice A) due to being a single working mother of two children could well be a possibility, but the presence of the other criteria make SLE more likely. Goodpasture's syndrome (choice B) is characterized by linear disposition of immunoglobulin, and often C3, along the glomerular basement membrane (GBM). Glomerulonephritis, pulmonary hemorrhage, and occasionally idiopathic pulmonary hemosiderosis occur. Mixed connective tissue disease (choice C) is an overlap syndrome characterized by a combination of clinical features similar to those of SLE, scleroderma, polymyositis, and rheumatoid arthritis. These patients generally have a positive ANA in virtually 100% of the cases. High titer anti-ribonucleoprotein (RNP) antibodies may be present, generating a speckled ANA pattern. Anti-RNP is not pathognomonic for mixed connective tissue disease, since it can be found in low titers in 30% of the patients with SLE. Scleroderma (choice D) is characterized by thickening of the skin caused by swelling and thickening of fibrous tissue, with eventual atrophy of the epidermis. ANA are often associated with the disease, but the staining pattern is generally nucleolar. 9>The correct answer is D. Specificity refers to how well a test identifies persons who do not have the disease in question. In the example, 2900 women do not have breast cancer, and 2540 of these women have a negative test. Specificity is given by (true negatives)/ (true negatives + false positives) = 2540/(2540+360) = 2540/2900. Choice A, 90/100, represents the sensitivity of the test; that is, the proportion of women with the condition who test positive. Choice B, 90/450, gives the predictive value of a positive test. Of the 450 women who tested positive, 90 actually had the condition. Choice C, 2540/2550, gives the predictive value of a negative test. Of the 2550 who tested negative, 2540 did not have cancer. Choice E, (90+2540)/3000, refers to the efficiency of a test; that is, the proportion of all subjects who were correctly classified by the test. 10>The correct answer is A. The disease is Pneumocystis pneumonia, which is caused by an agent now believed to be a fungus rather than a true bacteria. Pneumocystis carinii pneumonia is seen in immunocompromised patients, particularly in those with AIDS, cancer, and in malnourished children. It can be the AIDS-defining illness. Congestive heart failure (choice B) predisposes the patient to pulmonary edema. Pulmonary embolus (choice C) can cause pulmonary infarction or sudden death. Rheumatoid arthritis (choice D), particularly in miners, can cause formation of lung nodules similar to subcutaneous rheumatoid nodules. Systemic lupus erythematosus (choice E) can cause pleuritis, but is not associated with a significantly increased incidence of pneumonia. 11>The correct answer is C. The disease is Fragile X Syndrome, which is a familial form of mental retardation that is roughly as common as Down's syndrome. The phenotype has a variable expression, but can include large head circumference at birth, perinatal complications (premature birth, asphyxia, seizures), and possibly increased incidence of sudden infant death syndrome. Later, mental retardation, particularly involving language, and symptoms suggestive of attention deficit disorder and/or autism may appear. Features suggestive of connective tissue disorder (lax skin and joints, flat feet, large ears) are common. After puberty, there may be a long narrow face with prominent jaw and nasal bridge. Macroorchidism is also common after puberty. Mitral valve prolapse and aortic root dilatation, which may appear in late adolescence or adulthood, are among the most serious complications of this disorder. Aortic regurgitation related to aortic root dilatation, not stenosis (choice A), can be a problem in this population.

Common congenital cardiac malformations such as atrial septal defect (choice B) or ventricular septal defect (choice E) are not features of Fragile X syndrome, but can be seen with Down's syndrome. Tricuspid atresia (choice D) is a serious congenital cardiac malformation limiting flow into the right ventricle, but it is not part of Fragile X syndrome. 12>The correct answer is E. Because the right main bronchus is wider and more vertical than the left, foreign objects are more likely to be aspirated into the right main bronchus. The superior segmental bronchus of the lower lobar bronchus is the only segmental bronchus that exits from the posterior wall of the lobar bronchi. Therefore, if a patient is supine at the time of aspiration, the object is most likely to enter the superior segmental bronchus of the lower lobe. None of the segmental bronchi of the left lung (choices A and D) are likely to receive the object because the object is less likely to enter the left main bronchus. The apical segment of the right upper lobe (choice B) is not likely to receive the foreign object because of the sharp angle that the upper lobar bronchus makes with the right main bronchus and the sharp angle that the apical segmental bronchus makes with the lobar bronchus. The medial segmental bronchus of the right middle lobe (choice C) arises from the anterior wall of the right middle lobar bronchus. Therefore, when the patient is supine, the effect of gravity will tend to prevent the object from entering this segmental bronchus. 13>The correct answer is A. The disease described is Huntington's disease, which is now known to be related to an expanded trinucleotide tandem repeat on the short arm of chromosome 4. The number of trinucleotide repeats frequently increases in succeeding generations during the process of spermatogenesis. Prader-Willi and Angelman syndromes are frequently cited examples of genetic diseases involving genomic imprinting (choice B). Duchenne's muscular dystrophy is an example of a disease that is frequently due to a large deletion in a single gene (choice C). Single amino acid substitutions (choice D) are common in recessive diseases such as sickle cell anemia. Translocations (choice E) occur in disorders such as chronic myelogenous leukemia (CML; Philadelphia chromosome) and some cases of Down's syndrome. 14>The correct answer is A. The mass is an abdominal aortic aneurysm, typically found in older men. Such aneurysms are almost always related to the formation of complicated atherosclerotic plaques in the aorta. Associated coronary artery disease is commonplace. Bacterial infection (choice B) can cause "mycotic" aneurysms; these usually involve smaller vessels. The small berry aneurysms that can involve the circle of Willis are congenital anomalies (choice C). Cystic medial degeneration (choice D) is related to the development of dissecting aneurysms (actually dissecting hematomas). Tertiary syphilis (choice E) typically causes aneurysms of the root and arch of the aorta, rather than the descending aorta. 15>The correct answer is C. The cell is spindle-shaped like a fibroblast; however, the difference is that the cytoplasm contains several bundles of microfilaments. These bundles are parallel to the long axis of the cell and are seen immediately beneath the cell membrane and within the cytoplasm. Densities, comparable to Z-lines, can be seen along some of these bundles. The microfilaments are responsible for the contractile properties of this cell. These

contractile properties, in addition to the cell's ability to link with collagen, function in wound closure in the healing process. Dupuytren's contracture, which is a contracture of the palmar fascia, is caused by interaction of these cells with collagen fibrils of the fascia. The endothelial cell (choice A) lines vessels. There are no vessels in the photomicrograph. The myoepithelial cell (choice B) contains microfilaments and is contractile. However, it is closely associated with glandular epithelium (not apparent here). The pericyte (choice D) is a multipotential connective tissue cell found near or around blood vessels, but it does not contain microfilament bundles such as these. There are no vessels apparent in the photomicrograph. The smooth muscle cell (choice E) is joined by junctions to other smooth muscle cells, arranged in bundles. Microfilaments make up most of the cytoplasm of such cells, with the nucleus in a central location. 16>The correct answer is B. The structure of the cochlea is complex. The organ of Corti contains hair cells from the cochlear branch of the vestibulocochlear nerve (CN VIII). These cells rest on the basilar membrane (choice A), which separates the scala tympani (choice D) from the scala media. The hairs of the hair cells are embedded in the tectorial membrane, and movement of the basilar membrane below the cells tends to bend the hairs, which generates action potentials by the hair cells. The tectorial membrane that lies on the hair cells does not form a boundary between the different scala; the membrane separating the scala media from the scala vestibuli (choice E) is Reissner's (vestibular) membrane (choice C). 17>The correct answer is C. The pretracheal layer of the cervical fascia runs from the investing layers in both sides of the lateral neck and splits to enclose the thyroid gland. Superiorly, it attaches to the laryngeal cartilages; inferiorly, it fuses with the pericardium. As a result of these connections, the thyroid gland moves with laryngeal movements. The carotid sheath (choice A) contains the vagus nerve, internal jugular vein, carotid artery, and lymph nodes. The investing layer of the deep cervical fascia (choice B) splits to enclose the trapezius and sternocleidomastoid muscles. The prevertebral fascia (choice D) covers muscles arising from the vertebrae. The superficial fascia (choice E) is immediately deep to the platysma muscle 18>The correct answer is D. The best markers for identification of B cells are CD19, CD20, and CD21. The CD21 marker is a receptor for EBV (Epstein-Barr Virus). The CD3 marker (choice A) is present on all T cells with either a CD4 or CD8 marker. This is the marker that is used to identify total T cell count in a blood sample. The CD3 marker is used for signal transduction in the different T cells. The CD4 marker (choice B) is used to identify T helper cells. These are the cells that recognize exogenous peptides presented on MHC class II molecules by macrophages. CD4+ T helper cells are also involved in cell-mediated delayed hypersensitivity, production of cytokines for stimulation of antibody production by B cells, and stimulation of macrophages. The CD8 marker (choice C) is used to identify cytotoxic T cells. These are the cells that recognize viral epitopes attached to the MHC class I molecules of a virally infected cell. The CD56 marker (choice E) is used to identify NK(natural killer) cells. These cells are important in innate host defense, specializing in killing virally infected cells and tumor cells by secreting granzymes and perforins. 19>The correct answer is A. In a syndrome called cleidocranial dysostosis, absence of part of the clavicles accompanies a broad skull, and facial and dental anomalies. Note that you could also have answered this question by noting that of the bones listed, only the clavicles form by intramembranous ossification.

The femurs (choice B), metatarsals (choice C), phalanges (choice D), and tibias (choice E) are cartilaginous (formed by endochondral ossification) rather than membranous bones. 20>The correct answer is D. Metformin is a drug that is often used in conjunction with oral hypoglycemic agents for the treatment of NIDDM. Its mechanism of action is two-fold: (1) it decreases the production of glucose in the liver; (2) it increases the uptake of glucose in the liver. Metformin has no effect on the secretion of pancreatic insulin. Acetohexamide (choice A) is an oral hypoglycemic agent that is a sulfonylurea derivative. It stimulates secretion of insulin from the pancreas. Chlorpropamide (choice B) is an oral hypoglycemic agent that is a sulfonylurea derivative. It stimulates secretion of insulin from the pancreas. Glyburide (choice C) is a sulfonylurea derivative that stimulates insulin secretion from the pancreas. Tolbutamide (choice E) is a sulfonylurea derivative that stimulates insulin secretion from the pancreas.

21The correct answer is A. The patient is presenting with signs and symptoms of acute cholecystitis, which is associated with gallstones in more than 90% of all cases. This condition occurs when a stone becomes impacted in the cystic duct and inflammation develops behind the obstruction. The acute attack is often precipitated by a large fatty meal, and is characterized by the sudden appearance of severe, steady pain localized to the epigastrium or right hypochondrium. Laboratory findings often include elevated white blood cells (2,000 - 15,000/mL). Total serum bilirubin values of 1-4 mg/dL may be seen in some instances, and serum amylase may be elevated. In noncomplicated cases, treatment often includes IV alimentation, analgesics, and antibiotics, as well as withholding of oral feedings. Meperidine is the narcotic of choice since it is least likely to cause spasm of the sphincter of Oddi, probably because of its antimuscarinic properties. It is therefore preferred over morphine (choice B), oxycodone (choice D), and propoxyphene (choice E). Furthermore, propoxyphene is a narcotic agonist with mild analgesic properties; hence, it would most likely not be able to effectively treat this patient's severe pain. Naproxen (choice C) is a nonsteroidal anti-inflammatory drug (NSAID) indicated for the treatment of mild to moderate pain; this agent would most likely not provide sufficient pain control for this patient. 22>The correct answer is A. When the head of the humerus dislocates from the glenohumeral joint, it exits inferiorly, where the joint capsule is the weakest. Immediately inferior to the glenohumeral joint, the axillary nerve exits from the axilla by passing through the quadrangular space. At this location, the downward movement of the head of the humerus can stretch the axillary nerve. The axillary nerve innervates the deltoid muscle after leaving the axilla. The dorsal scapular nerve (choice B) passes along the medial border of the scapula to innervate the rhomboid muscles. The nerve does not pass in the region of the glenohumeral joint. The lateral and medial pectoral nerves (choices C and D) branch from the lateral and medial cords of the brachial plexus, respectively, and exit through the anterior wall of the axilla to innervate the pectoralis major and minor. These nerves do not pass in the region of the glenohumeral joint. The suprascapular nerve (choice E) is a branch of the upper trunk of the brachial plexus and passes over the superior border of the scapula to innervate the supraspinatus and infraspinatus muscles. This nerve does not pass in the region of the glenohumeral joint.

23>The correct answer is D. This patient most likely has subacute granulomatous (de Quervain's) thyroiditis, which frequently develops after a viral infection. Microscopically, it is characterized by microabscess formation within the thyroid, eventually progressing to granulomatous inflammation with multinucleated giant cells. Clinically, patients may experience fever, sudden painful enlargement of the thyroid, and/or symptoms of transient hyperthyroidism. The disease usually abates within 6 to 8 weeks. Diffuse nontoxic goiter (choice A) by definition does not produce hyperthyroidism. The hyperthyroidism of Graves disease (choice B) does not spontaneously remit. Hashimoto's thyroiditis (choice C) can cause transient hyperthyroidism, but then goes on to cause hypothyroidism. Subacute lymphocytic thyroiditis (choice E) can cause transient hyperthyroidism, but is characteristically painless.

25> The correct answer is E. Hypersecretion of insulin by a pancreatic b cell tumor is a major cause of fasting hypoglycemia (plasma glucose is not increased, choice D). Symptoms are related to neuroglycopenia and could include recurrent central nervous system dysfunction during fasting or exercise. While proinsulin only makes up approximately 20% of plasma immunoreactive insulin in normal individuals, in patients with an insulinoma it contributes 30-90% of the immunoreactive insulin. Hence, plasma levels of proinsulin are increased. The increased secretion of insulin by the tumor will also lead to an increase in C peptide secretion (not decreased, choice B) since b cells secrete insulin and C peptide on a one-to-one molar ratio. Given the prolonged hypoglycemia, the amount of glycosylated hemoglobin may also be decreased, although this is not a universal finding. Certainly, an increase in glycosylated hemoglobin would not be expected (choice A). Glucagon secretion is increased by hypoglycemia and its plasma level in a patient with an insulinoma would be expected to be increased compared to normal (not decreased, choice C 26>The correct answer is A. This question is really asking you two things. First, it tests whether you know that lymphocytosis is associated with viral infection. Second, it tests your knowledge of lymphocytes' histological appearance. Note that these cells are generally small and normally constitute 25%-33% of leukocytes. Two types of lymphocytes have been distinguished: T cells (involved in cell-mediated immunity) and B cells (involved in humoral immunity). Monocytes are precursors of osteoclasts and liver Kupffer cells (choice B) and also give rise to tissue macrophages and alveolar macrophages. Platelets contain a peripheral hyalomere and central granulomere (choice C). Neutrophils have azurophilic granules and multilobed nuclei (choice D). They increase in number in response to bacterial infection. Erythrocytes remain in the circulation for about 120 days (choice E). 27>The correct answer is D. The lesion is a malignant melanoma. Melanomas can develop either de novo or in an existing mole. Sunlight exposure is a significant risk factor and fairskinned persons are at increased risk of developing melanoma. The most significant factor for long term prognosis is the depth of the lesion, since the superficial dermis lies about 1 mm under the skin surface, and penetration to this depth is associated with a much higher incidence of metastasis than is seen with a more superficial location. The circumference of the lesion (choice A) is much less important than depth, since one form of melanoma (superficial spreading) can still have good prognosis despite large size, if it has not extended to the depth of the superficial dermal lymphatic bed.

The darkness (choice B) or degree of variation in color (choice C) do not have prognostic significance once melanoma is diagnosed. Irregularity, or fuzziness at the border (choice E) of a mole-like lesion is a good clue to potential malignancy, but does not affect prognosis once a melanoma is diagnosed. 28>The correct answer is A. Most of the venous drainage of the skin of the lower extremity is to the long saphenous vein, the accompanying lymphatics of which drain into the superficial group of the inguinal lymph nodes. However, the skin drained by the short saphenous vein, including that of the lateral aspect of the dorsum of the foot, is an exception to this rule. Lymphatic fluid from this area drains into lymphatics accompanying the short saphenous vein, then drains into lymph nodes behind the knee in the popliteal fossa. The lateral side of the thigh (choice B), the medial side of the leg below the knee (choice C), the medial side of the sole of the foot (choice D), and the medial side of the thigh (choice E) all drain to the superficial inguinal nodes. 29>The correct answer is E. The child has "rat-bite fever." This occurs in two forms with somewhat similar clinical manifestations. The form this child has is the Haverhill fever form, caused by Streptobacillus moniliformis and characterized by a short (often 1-3 days) incubation period. The Haverhill form is more common in the United States than the Sodoku form, which is caused by Spirillium minus, has a 1-4 week incubation period, and is most prevalent in Japan. One of the problems with diagnosing these diseases is that the victims are usually young children, and the bite site may be inapparent by the time the disease becomes severe enough for the child to be taken to a doctor. Borrelia burgdorferi (choice A) causes Lyme disease, which is characterized by an expanding erythematous rash, arthralgias, and eventual nervous system involvement. Pseudomonas mallei (choice B) causes glanders, which generally affects horses or humans in close contact with equines. Pseudomonas pseudomallei (choice C) causes melioidosis, a rare pulmonary disease found mostly in Southeast Asia. Spirillium minus (choice D) causes the Sodoku form of rat-bite fever. 30>The correct answer is A. Urticaria (hives) are pruritic wheals that form after mast cells degranulate and trigger localized dermal edema with dilated superficial lymphatic channels. The mast cell degranulation is sometimes, but not always, triggered by IgE-antigen interactions. Granular complement and IgG deposition at the dermal/epidermal junction (choice B) is a characteristic of systemic lupus erythematosus. Microscopic blisters (choice C) are a characteristic of dermatitis herpetiformis. Munro abscesses (choice D) are a characteristic of psoriasis. Solar elastosis (choice E) is found in actinic keratoses. 31>The correct answer is B. Direct inguinal hernias enter the inguinal canal by tearing through the posterior wall of that structure. The typical location for this type of hernia is through the inguinal triangle, bounded laterally by the inferior epigastric artery, medially by the lateral border of the rectus abdominis, and inferiorly by the inguinal ligament. Direct inguinal hernias pass medial to the inferior epigastric artery, whereas indirect inguinal hernias pass lateral to the inferior epigastric artery because the deep inguinal ring is lateral to the artery. Indirect inguinal hernias are covered by all three layers of the spermatic fascia (choice A). Direct inguinal hernias are covered by fewer than all three layers because the direct inguinal hernia tears through one or more layers of fascia as it emerges though the abdominal wall.

The lateral border of the rectus abdominis muscle (choice C) forms the medial border of the inguinal triangle. All inguinal hernias pass lateral to the rectus abdominis. Femoral hernias pass posterior to the inguinal ligament (choice D). Inguinal hernias emerge through the superficial inguinal ring, which is superior to the inguinal ligament. Inguinal hernias that descend below the inguinal ligament pass anterior to the ligament. Indirect inguinal hernias pass through the deep inguinal ring (choice E); direct inguinal hernias do not. Both types of inguinal hernias pass through the superficial inguinal ring.

32>The correct answer is A. The patient has a severe, potentially fatal, pneumonia with prominent systemic symptoms. Culture on BCYE is the specific clue that the organism is Legionella pneumophila. The disease is respiratory Legionellosis, also known as Legionnaire's disease, because the disease was first described when it occurred in epidemic form following an American Legion convention at a Philadelphia hotel. Patients tend to be older (40-70 years old) and may have risk factors including cigarette use, alcoholism, diabetes, chronic illness, or immunosuppressive therapy. Listeria monocytogenes (choice B) causes listeriosis and is not a notable cause of pneumonia. Spirillium minus (choice C) is a cause of rat-bite fever and is not a notable cause of pneumonia. Staphylococcus aureus (choice D) can cause pneumonia, but is easily cultured on routine media. Streptococcus pneumoniae (choice E) can cause pneumonia, but is easily cultured on routine media.

33The correct answer is C. Sensitivity is defined as the ability of a test to detect the presence of a disease in those who truly have the disease. It is calculated as the number of people with a disease who test positive (true positive) divided by the total number of people who have the disease (true positive + false negative). In this case, sensitivity equals the number of people with HIV antibody who test positive (100) divided by the total number of people who have HIV antibody (120). This yields 100/120 = 83% (not a very sensitive test). 11% (choice A) corresponds to the prevalence of the disease in the tested population, which in this case equals the total number of people with HIV antibody (true positive + false negative = 100 + 20 = 120) divided by the total number of people tested (100 + 20 + 50 + 950 = 1120). This yields 120/1120 = 11%. 67% (choice B) corresponds to the positive predictive value of the test, which equals the number of people with the disease who test positive (true positives = 100) divided by the total number of people testing positive (all positives = 50). This yields 100/150 = 67%. 95% (choice D) corresponds to the specificity of the test, which equals the number of people without HIV antibody who test negative (950) divided by the total number of people without HIV antibody (1000). This yields 950/1000 = 95%. 98% (choice E) corresponds to the negative predictive value of the test, which equals the number of people without HIV antibody who test negative (950) divided by the total number of people testing negative (970). This yields 950/970 = 98%. An easy way to remember these concepts is: Sensitivity = true positives/all diseased Specificity = true negatives/all normal PPV = true positives/all positives NPV = true negatives/all negatives

Prevalence = all diseased/total population If you prefer charts and formulas: (Diseased) (Normal) People with HIV antibody People without HIV antibody Positive test a, true pos. b, false pos. Negative test c, false neg d, true neg. Sensitivity = a/(a + c) Specificity = d/(b + d) PPV = a/(a + b) NPV = d/(c + d) Prevalence = (a + c)/(a + b + c + d) Choose your favorite approach. Just make sure you know this stuff, as it is almost always tested and gains you easy points once you have mastered the concepts. 34>The correct answer is E. This is pemphigus vulgaris, in which autoantibody directed against transmembrane cadherin adhesion molecules induces acantholysis (breakdown of epithelial cell-cell connections) with resulting intraepidermal blister formation. It may develop spontaneously or following triggers such as drugs (thiols, penicillamine), physical injury (burns), cancer, pregnancy, other skin diseases, and emotional stress. Pemphigus vulgaris is a relatively rare blistering disease; it is seen more commonly in patients with Jewish or Mediterranean heritage. In addition to the usually prominent oral ulcers, uncomfortable skin erosions can also occur when the blisters rupture rapidly and are not observed. The epidermis at the edge of these erosions is often easily disrupted by sliding pressure (Nikolsky sign). Bullous pemphigoid (choice A) is characterized by deeper blisters, occurring at the dermalepidermal junction. Dermatitis herpetiformis (choice B) is characterized by severe, intense pruritus and groups of papules and vesicles. Herpes simplex I (choice C) or II (choice D) can show multinucleated giant cells on scrapings of the ulcer base. 35>The correct answer is A. Polycystic kidney disease leads to progressive decrements in renal function, eventually resulting in renal failure (evidenced by the increased BUN and creatinine). These abnormalities are caused by a reduction in glomerular filtration rate (GFR), which produces a decrease in creatinine clearance. The production of creatinine, a waste product of metabolism, bears a direct relation to the muscle mass of an individual and is independent of renal function. Because creatinine is freely filtered by the glomerulus, but not secreted or reabsorbed to a significant extent, the renal clearance of creatinine is approximately equal to the GFR. Therefore, creatinine clearance is commonly used to assess renal function in the clinical setting. The extracellular sodium concentration (choice B) is not expected to change significantly in this patient. Glucose (choice C) is not normally excreted, so glucose clearance is normally zero. Thus, is not possible for glucose clearance to be decreased. Plasma creatinine concentration (choice D) increases when GFR decreases. Inulin clearance is used to estimate GFR. However, inulin is foreign to the body, and inulin plasma levels (choice E) are normally zero. 36>The correct answer is D. The metanephric duct (also known as the ureteric bud) is a diverticulum of the mesonephric duct. It grows to the metanephric mass of the urogenital ridge. It induces the development of the metanephros, which will give rise to the excretory

units of the definitive kidney. The metanephros, in turn, induces the metanephric duct to divide into the calyces and the collecting tubules. The allantois (choice A) is an endodermal diverticulum of the yolk sac. It becomes incorporated into the urogenital sinus and contributes to the formation of the urinary bladder. It is not involved with the formation of the kidney. The mesonephric duct (choice B) is a mesodermal duct into which the mesonephric tubules drain. The mesonephric duct is the same as the pronephric duct, but at a later stage of development. The mesonephric duct develops into the ductus deferens in the male. The metanephric duct is a diverticulum of the mesonephric duct. The mesonephros (choice C) is the embryonic kidney, which functions in the embryo before the metanephros (or definitive kidney) develops. The mesonephros develops from the urogenital ridge. The urogenital ridge (choice E) is a longitudinal elevation of the intermediate mesoderm. The embryonic and adult kidneys, as well as the gonads, develop from this mesoderm. 37>The correct answer is E. The child has neonatal respiratory distress syndrome (hyaline membrane disease). This condition is caused by the inability of the immature lungs to synthesize adequate amounts of surfactant. Surfactant, which reduces surface tension, helps keep alveoli dry and aids in expansion of the lungs, is synthesized by type II pneumocytes. Alveolar capillary endothelial cells (choice A) are important in maintaining the capillary structure and permitting flow of gases into and out of the blood stream. Bronchial mucous cells (choice B) produce the usually thin (in healthy individuals) coat of mucus that lines the bronchi. The ciliated bronchial respiratory epithelium (choice C) is responsible for moving the dust coated mucus layer out of the bronchi. Type I pneumocytes (choice D) are the squamous cells that line alveoli and permit easy gas exchange. These cells tend to be immature (and thick) in premature infants, but do not produce surfactant. 38>The correct answer is A. Surgeons worry about their obese patients more than their skinny ones, because a thick layer of relatively poorly vascularized subcutaneous fatty tissue is both mechanically unstable (it holds stitches poorly) and heals very slowly. These patients have a frequent rate of dehiscence (tearing open of the incisional site) with subsequent, difficult-to-control infection (access by antibiotics, leukocytes, and serum antibodies are all hampered by the poor blood supply). Aponeuroses (choice B) are strong thickenings of muscle sheath that usually suture and heal well after surgery. Loose connective tissue (choice C) is well vascularized and surgeons do not usually worry much about it during the healing process. Muscle (choice D) usually heals well after surgery. Skin (choice E) usually heals well, unless it becomes infected.

39The correct answer is C. Renal artery stenosis can decrease the renal perfusion pressure sufficiently to increase renin secretion significantly, which increases angiotensin II (AII), which, in turn, increases aldosterone. Chronic hypertension due to renal artery stenosis is the result of elevated levels of AII and aldosterone. Aldosterone increases retention of sodium from the collecting duct, and water follows; AII increases reabsorption of sodium from the proximal tubule, and water follows. AII is also a vasoconstrictor, increasing peripheral vascular resistance. Vasoconstriction of the renal vasculature decreases renal plasma flow, which would be expected to decrease glomerular filtration rate proportionately. AII, however, preferentially vasoconstricts the efferent arteriole in the nephron, maintaining a reasonable

glomerular filtration rate even with the reduced renal plasma flow. Captopril (an angiotensinconverting enzyme inhibitor) inhibits the conversion of angiotensin I to AII. The captoprilmediated decrease of AII will actually decrease glomerular filtration in the kidney with renal artery stenosis, because decreasing efferent constriction causes the glomerular capillary pressure to fall. Atrial natriuretic peptide (choice A) levels would be expected to increase with increased water and sodium retention due to renal artery stenosis. BUN (choice B) would be expected to increase or stay the same with renal artery stenosis, depending on the extent of AII-mediated efferent arteriole vasoconstriction. Metabolic alkalosis, due to the increased net acid secretion (compare with choice D) from hyperaldosteronism, is typical in renal artery stenosis. Potassium secretion would increase, rather than decrease (choice E), due to the effects of excessive aldosterone secondary to renal artery stenosis. 40>The correct answer is E. Testicular feminization is a disorder of the androgen receptor. Phenotypically, the patient appears female, but has a blindly ending vagina and lacks a uterus or other female internal reproductive organs. The patient has an XY genotype. Since the gene for testes determining factor (TDF) is on the Y chromosome, TDF will cause the indifferent gonad to develop into a testis containing Sertoli cells. Sertoli cells at this stage will secrete MIF, a substance that suppresses the paramesonephric ducts, preventing the formation of female internal reproductive organs. This patient would not have a streak ovary (choice A), a finding in Turner's syndrome that is associated with a 45,XO genotype. In fact, the patient would have testes, since the genetic complement contained a Y chromosome. The testes in individuals with testicular feminization syndrome are often undescended and are usually removed surgically. This patient would not possess a uterus (choice B) or an oviduct (choice C). Both of these structures are derived from the paramesonephric duct, which is suppressed by MIF.

41>The correct answer is C. Hyperventilation associated with states of anxiety can lead to feelings of faintness, suffocation, tightness in the chest, and blurred vision. Individuals undergoing such an attack may not be aware of overbreathing. The anxious, hyperventilating woman is "blowing off" carbon dioxide, which lowers her arterial PCO2. Many of the symptoms associated with anxiety attacks are probably caused by a decrease in cerebral blood flow secondary to low arterial PCO2. Recall that carbon dioxide is a major regulator of cerebral blood flow, i.e., carbon dioxide dilates the brain vasculature, and conversely, the vasculature constricts when carbon dioxide levels are low. The decrease in cerebral blood flow leads to cerebral hypoxia, which is probably responsible for the fainting and blurred vision. An attack may be terminated by breathing in and out of a plastic bag because this can increase carbon dioxide levels in the blood. Inhaling a 5% carbon dioxide mixture would also be effective. Breathing a mixture of 10% oxygen/90% nitrogen (choice A) or 100% nitrogen (choice B) can decrease oxygen delivery to the brain and thereby worsen the symptoms caused by hyperventilation. Hyperventilation results in hypocapnia (low PCO2), which causes alkalosis (high blood pH). Bicarbonate (choice D) should not be administered to an alkalotic patient. The feelings of faintness and blurred vision resulting from hyperventilation are not relieved by lying down (choice E). 42>The correct answer is A. The photomicrograph depicts an oocyte. The zona pellucida at the arrow is similar to a thick basal lamina and is composed of glycoproteins that bind to the cell membrane of the sperm head. This binding triggers the acrosome reaction, which

involves fusion of the acrosomal membrane with the overlying sperm membrane. The acrosomal enzymes are released and digest the zona pellucida, allowing the spermatozoon to make contact and fuse with the ovum cell membrane. The enzyme aromatase (choice B) is found in the granulosa cells, which surround the oocyte and the follicular wall. Testosterone, produced by the theca cells, diffuses through the basal lamina of the follicle and is converted to estradiol by aromatase. Capacitation (choice C) refers to changes that occur in the spermatozoa during their transit through the female reproductive tract. These changes occur in the oviducts and the uterus. Sperm become motile in the epididymis. The oocyte divides many times as it moves toward the uterus, the zona pellucida disappearing. A portion of these cells will exhibit implantation receptors (choice D) and become an implantation site for the cell mass in the uterine wall. Meiosis is resumed (choice E) in the oocyte shortly before ovulation. The nucleus of the oocyte can be seen in the center. The oocyte and the surrounding granulosa cells make up this structure, known as an antral or secondary follicle. 43>The correct answer is D. This is a classic case of Cryptococcus neoformans meningitis. Clues included the patient population (HIV positive), geographic area (Mississippi and Missouri river beds), and diagnostic form (encapsulated yeast). Cryptococcus is a monomorphic fungus, unlike many of the classic pathogens within the fungal group, so the encapsulated yeast form would be found both in clinical specimens and in the environment as the infectious form. Broad-based, budding yeasts (choice A) would be the forms expected to be found in clinical specimens (not environmental forms) from patients infected with Blastomyces dermatitidis, which is far more likely to present with skin and bone lesions than with meningitis. Budding yeasts in a "pilot's wheel" arrangement (choice B) would be the form expected to be found in clinical specimens (not environmental forms) from patients infected with Paracoccidioides brasiliensis, which is limited in geographic region to Central and South America and typically presents as a primary pulmonary disease. Cylindrical arthroconidia (choice C) would be the transmission forms characteristic of Coccidioides immitis, which may be a cause of fungal meningitis in immunologically compromised individuals, but is geographically restricted to the sub-Sonoran desert zone of the U.S. (San Joaquin valley fever). Filamentous molds (choice E) are the transmission forms of several of the fungal agents (eg, Coccidioides, Blastomyces, Paracoccidioides) but Cryptococcus does not have a filamentous form. Septate hyphae with microconidia and macroconidia (choice F) are the transmission (environmental) forms of Histoplasma capsulatum, which is not an encapsulated yeast in spite of its name. It is primarily a pulmonary infection acquired by exposure to the droppings of birds or bats. 44>The correct answer is C. Both pyruvate kinase deficiency and glucose-6-phosphate dehydrogenase deficiency are red cell enzyme deficiencies characterized clinically by long "normal" periods interspersed with episodes of hemolytic anemia triggered by infections and oxidant drug injury (antimalarial drugs, sulfonamides, nitrofurans). In both of these conditions, the cell morphology between hemolytic episodes is usually normal or close to normal. The a (choice A) and b (choice B) thalassemias, in their major forms, are characterized by persistent severe anemia. In the trait forms, they are charactertized by mild anemia. Hereditary spherocytosis (choice D) is characterized by intermittent hemolysis, but, unlike pyruvate kinase deficiency and glucose-6-phosphate dehydrogenase deficiency, oxidant drugs are not a specific trigger for hemolysis.

Iron deficiency anemia (choice E) is characterized by chronic anemia with hypochromic, microcytic erythrocytes. 45>The correct answer is C. The fibrinolytic activity of streptokinase is due to its ability to bind and cleave plasminogen, producing plasmin. Plasmin directly cleaves fibrin, both between and within the fibrin polymers, thus breaking up thrombi and potentially restoring blood flow to ischemic cardiac muscle. This same mechanism of fibrinolysis is shared by urokinase and tissue-plasminogen activator (tPA). Antithrombin III (choice A) is a coagulation inhibitor that binds to and inactivates thrombin. Antithrombin III is anticoagulant, not fibrinolytic. Fibrin (choice B) is not directly acted upon by streptokinase. It is indirectly cleaved through the action of plasmin. Protein C (choice D) is a glycoprotein that modulates coagulation by inhibiting the procoagulant activities of factors V/Va and VIII/VIIIa. Protein C has no inherent fibrinolytic activity. Thrombomodulin (choice E) is an anticoagulant protein that binds to thrombin and diminishes its capacity to activate fibrinogen, Factor V, and platelets. Thrombomodulin has no fibrinolytic activity. 46>The correct answer is C. Enterobius vermicularis (pinworm) inhabits the large intestine, and the gravid females migrate at night into the perianal region to lay eggs, which can be identified by placing cellophane tape on the perianal skin and then looking at the tape with a microscope. Enterobiasis is characterized by extreme pruritus and is very contagious, transmitted by ingestion of the eggs of the organism. The infection is easily treated with a single dose of mebendazole. Ancylostoma duodenale (choice A) and Necator americanus (choice D) are hookworms, and typically cause anemia. Ascaris lumbricoides (choice B) is a large, intestinal roundworm that is very common, especially in the tropics. Infection may be asymptomatic or can cause abdominal symptoms. Trichuris trichiura (choice E) is the whipworm, which can cause rectal prolapse with heavy infestations. 47>The correct answer is D. The key symptom is hyperventilation. Hyperventilation results in hypocapnia, alkalosis, increased cerebrovascular resistance, and decreased cerebral blood flow. Carbon dioxide plays an important role in the control of cerebral blood flow. An increase in arterial PCO2 dilates blood vessels in the brain and a decrease in PCO2 causes vasoconstriction. The anxious, hyperventilating woman is "blowing off" carbon dioxide, which lowers her arterial PCO2. This decrease in PCO2 has caused the cerebrovascular resistance (choice E) to increase, thereby decreasing cerebral blood flow. The decrease in cerebral blood flow has caused the woman to feel faint and to have blurred vision. Other symptoms commonly associated with the hyperventilation of anxiety states are feelings of tightness in the chest and a sense of suffocation. Hyperventilation increases the arterial oxygen content (choice A) and PO2 (choice B) in a normal person. A decrease in arterial PCO2 causes the arterial pH (choice C) to increase, i.e., the patient becomes alkalotic. 48>The correct answer is B. Escherichia coli is a very common pathogen associated with urinary tract infections and is a common cause of cystitis. It is part of the normal flora of the GI tract. Patients with cystitis can develop bacteremia and subsequent septic shock and adult respiratory distress syndrome (ARDS). The patient described in the history has an obstructive

lesion of the urinary tract that predisposes him to the overgrowth of microorganisms such as E. coli. Pulmonary symptoms are consistent with ARDS. E. coli is a gram-negative rod. Gram-negative diplococci (choice A) might be Neisseria spp. or Moraxella catarrhalis. Neisseria gonorrhea is the cause of gonorrhea, a sexually transmitted disease that presents with urethritis, or may be asymptomatic. Patients are usually younger, sexually active males. Moraxella spp. and Kingella kingae are gram-negative cocci that can cause a wide variety of infections. Moraxella catarrhalis is usually implicated as a cause of otitis media and sinusitis in children, or as a cause of purulent tracheobronchitis and pneumonia in a population of patients who are over 50 and have underlying obstructive lung disease. Gram-positive cocci (choice C), such as Staphylococcus aureus and S. epidermidis and Streptococci, rarely cause cystitis. Staphylococcus saprophyticus causes urinary tract infections, but the patients are typically young, sexually active women. Gram-positive diplococci (choice D) would be a description of Streptococcus pneumoniae, which is the most common cause of community-acquired pneumonia. Gram-positive rods (choice E) would include members of the following genera: Clostridium, Bacillus, Listeria, and the coryneform bacteria. The only significant member of this group to produce urinary tract infections is Corynebacterium urealyticum. (C. jeikeium). The organism creates an alkaline urine environment with the potential for stone formation. Patients are usually immunocompromised or have had recurrent urinary tract infections. 49>The correct answer is E. The nerve that was cut is the median nerve. The median nerve innervates all of the thenar compartment muscles at the base of the thumb: the abductor pollicis brevis, flexor pollicis brevis, and opponens pollicis. Paralysis of the opponens pollicis will prevent the patient from opposing the thumb. Abduction of the second digit (choice A) is performed by the first dorsal interosseous muscle. All of the interosseous muscles are innervated by the ulnar nerve. Adduction of the second digit (choice B) is performed by the first palmar interosseous muscle. All of the interosseous muscles are innervated by the ulnar nerve. Adduction of the thumb (choice C) is performed by the adductor pollicis muscle, which is innervated by the ulnar nerve. Flexion of the interphalangeal joint of the thumb (choice D) is performed by the flexor pollicis longus muscle, which is in the proximal forearm and is innervated by the median nerve proximal to the site of the injury. The flexor pollicis brevis muscle causes flexion at the metacarpophalangeal joint of the thumb.

50> The correct answer is A. Cyclophosphamide is metabolized to acrolein, which is excreted in the urine. If the patient's urine is concentrated, the toxic metabolite may cause severe bladder damage. Early symptoms of bladder toxicity include dysuria and frequency. This can be distinguished from a urinary tract infection, since there is no bacteriuria with cyclophosphamide-induced bladder toxicity. However, microscopic hematuria is often present on urinalysis. In severe hemorrhagic cystitis, large segments of the bladder mucosa may be shed which can lead to prolonged, gross hematuria. The incidence of cyclophosphamide-induced hemorrhagic cystitis can be decreased by ensuring that the patient maintains a high fluid intake. Cyclophosphamide is an alkylating agent used in the treatment of breast carcinoma, malignant lymphoma, multiple myeloma, and adenocarcinoma of the ovary, as well as various other forms of cancer. The major toxic reactions commonly seen with this agent include mucositis, nausea, hepatotoxicity, sterile hemorrhagic and nonhemorrhagic cystitis, leukopenia, neutropenia, and interstitial pulmonary fibrosis 1> A normal, healthy, 25-year-old man lives at the beach. His twin brother has been living in a mountain cabin for the past 2 years. Which of the

following indices would be expected to be higher in the man living at sea level? A. Diameter of pulmonary vessels B. Erythropoietin production C. Mitochondrial density in a muscle biopsy D. Renal bicarbonate (HCO3-) excretion E. Respiratory rate Answer

2>A woman presents to a dermatologist because she has lost almost all the hair on her body, including scalp hair, eye brows, eye lashes, arm pit and groin hair, and the fine hairs on her body and extremities. She most likely has a variant of which of the following? A. Alopecia areata B. Androgenic alopecia C. Chronic cutaneous lupus erythematosus D. Lichen planopilaris E. Trichotillomania Answer

3>The greater omentum is derived from which of the following embryonic structures? A. Dorsal mesoduodenum B. Dorsal mesogastrium C. Pericardioperitoneal canal D. Pleuropericardial membranes E. Ventral mesentery Answer

4>A 34-year-old woman is prescribed an antidepressant, which she has taken for the past 3 months. She is on no other medications and is in generally good health. After attending a party, at which she consumed wine and cheese, she is rushed to the emergency room with tachycardia, headache, and a blood pressure of 200/100. Which antidepressant is she most likely taking? A. Amitriptyline B. Fluoxetine C. Phenelzine D. Sertraline E. Trazodone Answer

5>Which of the following hormones is secreted by anterior pituitary cells that stain with acidic dyes? A. ACTH

B. C. D. E.

FSH LH Prolactin TSH

6>A 23-year-old male graduate student gets into a serious argument with one of his college professors, making a physical threat to the professor, and necessitating a call to campus security. The argument was precipitated by an incident between the professor and the student's girlfriend; when the professor corrected the student's girlfriend in class, the student felt the professor was verbally abusive. Which of the following is the most likely diagnosis ? A. Dependent personality disorder B. Histrionic personality disorder C. Narcissistic personality disorder D. Paranoid personality disorder E. Passive aggressive personality disorder Answer

7>Which of the following would shift the oxygen-hemoglobin dissociation curve to the right? A. Carbon monoxide poisoning B. Decreased PCO2 C. Decreased pH D. Decreased temperature E. Decreased 2,3-DPG Answer

8>The wife of a 48-year-old male patient brings him to the emergency room and says that his memory has progressively gotten worse over the last several years. She also says his personality has been changing. The physician notes abnormal writhing movements of the man's limbs and hyperreactive reflexes . MRI reveals a loss of volume in the neostriatum and cortex. This disease is inherited via an A. autosomal dominant trait B. autosomal recessive trait C. x-linked dominant trait D. x-linked recessive trait Answer

9>A man presents to a dermatologist because of a severe mucocutaneous rash that involves most of his body, including his palms and soles. Questioning reveals that he is a merchant marine who several months previously had an encounter with a prostitute in Southeast Asia. Which of the following is the most likely causative agent of this rash? A. Herpes simplex I

B. C. D. E. Answer

Herpes simplex II HIV Neisseria gonorrhoeae Treponema pallidum

10>A patient with familial hypercholesterolemia undergoes a detailed serum lipid and lipoprotein analysis. Studies demonstrate elevated cholesterol in the form of increased LDL without elevation of other lipids. This patient's hyperlipidemia is best classified as which of the following types? A. Type 1 B. Type 2a C. Type 2b D. Type 3 E. Type 5 Answer

11>A mutation affecting the development of the diencephalon could interfere with the secretion of which of the following hormones? A. Adrenocorticotrophic hormone (ACTH) B. Epinephrine C. Oxytocin D. Prolactin E. Thyroid stimulating hormone (TSH) Answer

12>Which of the following organisms is the most common cause of community-acquired pneumonia? A. Chlamydia pneumoniae B. Haemophilus influenzae C. Mycoplasma pneumoniae D. Staphylococcus aureus E. Streptococcus pneumoniae Answer

13>A 54-year-old male with acute lymphocytic leukemia develops a blast crisis. He is treated with intensive systemic chemotherapy. Following treatment, the patient will be at increased risk for the development of A. bile pigment gallstones B. cholesterol gallstones C. cystine kidney stones D. struvite kidney stones E. uric acid kidney stones

Answer

14>A 65-year-old man with mild heart failure is treated with a loop diuretic . A few days later the man complains of muscle weakness. Laboratory results are shown below. Arterial PCO2: 48 mm Hg Arterial pH: 7.49 Plasma HCO3-: 35 mEq/L Which of the following is most likely decreased in this man? A. Plasma aldosterone B. Plasma potassium C. Potassium excretion D. Renin secretion E. Sodium excretion Answer

15>A 27-year-old white male presents with a 3-week history of several swollen and painful toes and knees. He has a past history of conjunctivitis. He also describes some low back stiffness that is more severe in the morning. Which of the following is the most likely diagnosis? A. Gout B. Lyme disease C. Reiter's syndrome D. Rheumatoid arthritis E. Septic arthritis Answer

16>A 37-year-old woman who was diagnosed with AIDS 3 years earlier is unable to work, is physically debilitated, and requests her physician to provide her with medications with which to take her own life. The most common emotional disorder that results in such requests by patients is A. bipolar I disorder, manic type B. borderline personality disorder C. factitious disorder D. major depressive disorder E. schizophrenic disorder Answer

17> A 25-year-old man presents with a chief complaint of persistent, high-pitched ringing noises in his ears. Questioning reveals that he has also been losing his balance lately. CT of the head demonstrates bilateral tumors involving the vestibulocochlear nerve. Which of the following chromosomes contains the tumor suppressor gene most likely to be involved in this case? A. 5q B. 13q

C. D. E. Answer

17q 18q 22q

18> An autopsy is performed on a man who suddenly began vomiting voluminous quantities of blood and exsanguinated. Which of the following organisms is most likely implicated in the pathogenesis of this disease? A. Cryptosporidium parvum B. Entamoeba histolytica C. Escherichia coli D. Helicobacter pylori E. Mycobacterium tuberculosis Answer

19>During embryological development, hematopoiesis occurs in different organs at different times. Which of the following are the correct organs, in the correct sequence, at which hematopoiesis occurs embryologically? A. Amnion, yolk sac, placenta, bone marrow B. Placenta, liver and spleen, yolk sac, bone marrow C. Placenta, spleen and lymphatic organs, bone marrow D. Yolk sac, bone marrow, liver and spleen E. Yolk sac, liver, spleen and lymphatic organs, bone marrow Answer

20>A 27-year-old male is brought into the emergency room by the police, who found him walking aimlessly, shouting the names of former Presidents. Urine toxicology is negative, and the man appears to be oriented with respect to person, place, and time. He has had five similar admissions over the past year. Attempts to interview the patient are fruitless, as he seems easily derailed from his train of thought. A phone call to a friend listed in the chart provides the additional information that the man is homeless, and unable to care for himself. This patient is exhibiting the signs and symptoms of A. schizoaffective disorder B. schizoid personality disorder C. schizophrenia D. schizophreniform disorder E. schizotypal personality disorder Answer

21>Molecular genetic studies are performed on a family with known familial

hypercholesterolemia. In this particular family, the defect in the LDL receptor gene involves a messenger mutation near the 11th exon, in the region of homology with epidermal growth factor receptor precursor. A defect at this site would be most likely to produce which of the following effects? A. Decreased transcription of LDL receptor gene B. Poor internalization of LDL bound to LDL receptor C. Poor retention of the LDL receptor in the membrane D. Reduced binding of LDL E. Trapping of the LDL receptor in the endoplasmic reticulum Answer

22>A 27-year-old woman is giving birth. During the birth, the placental membranes tear and amniotic fluid is expressed into a lacerated cervical vein. Which of the following is the woman most likely to experience immediately following this event? A. Hemiplegia B. Placental abruption C. Renal failure D. Respiratory distress E. Splinter hemorrhages Answer

23>A 30-year-old pregnant woman complains to her physician of feeling very tired during her pregnancy. A complete blood count with differential reveals a hematocrit of 30%, with hypersegmented neutrophils and large, hypochromic red cells. Deficiency of which of the following would be most likely to produce these findings? A. Ascorbic acid B. Calcium C. Copper D. Folate E. Iron Answer

24>An otherwise healthy 3-year-old child is brought to the pediatrician with umbilicated, flesh-colored papules on his trunk. This condition is related to infection with which of the following viruses? A. Cytomegalovirus B. Herpesvirus 6 C. Parvovirus D. Poxvirus E. Variola Answer

25>Which of the following renal structures is most medially located? A. Major calyx B. Minor calyx C. Renal cortex D. Renal pelvis E. Renal pyramid Answer

26>A 48-year-old female is being treated for breast carcinoma. Over the past few days, she has been complaining of dysuria and frequency. Laboratory examination revealed the presence of microscopic hematuria. The next day the patient developed gross hematuria. Which of the following agents most likely caused the development of these signs and symptoms? A. Cyclophosphamide B. Mitomycin C. Paclitaxel D. Tamoxifen E. Vincristine Answer

27>A child who has had abnormal development of the membranous bones has a broad skull with associated facial and dental anomalies. Which other bones are most likely to also be affected? A. Clavicles B. Femurs C. Metatarsals D. Phalanges E. Tibias Answer

28>A 3-year-old child is referred to a major medical center because of an abdominal mass arising from his right adrenal gland. Biopsy of the lesion demonstrates sheets of small cells with hyperchromatic nuclei containing occasional pseudorosettes composed of circles of tumor cells with central young nerve fibers arising from the tumor cells. Which of the following oncogenes is associated with this patient's tumor? A. erb-B2 B. c-myc C. L-myc D. N-myc E. ret Answer

29>A 3-year-old child develops headaches and is brought to the family doctor. Funduscopic examination reveals papilledema; one retina also shows a very vascular tumor. CT of the head demonstrates a cystic tumor of the cerebellum. This child has a high likelihood of later developing which of the following? A. Berry aneurysm of the basilar system B. Bilateral renal cell carcinoma C. Cancer of a peripheral nerve D. Choreiform movements related to decreased GABA and acetylcholine E. Serum cholesterol of greater than 700 mg/dL Answer

30>Administration of an experimental drug that acts on PNS myelin is shown to increase the space constant of an axon in a peripheral nerve. Action potentials traveling down the axon would be predicted to be A. faster B. larger C. slower D. smaller E. unchanged Answer

31>A 26-year-old man presents to his physician with a chronic cough. The man is a smoker, and states that he also gets frequent headaches and aches in his legs when he exercises. Chest x-ray demonstrates notching of his ribs. Which of the following undiagnosed congenital defects may be responsible for these findings? A. Coarctation of the aorta B. Eisenmenger's syndrome C. Tetralogy of Fallot D. Transposition of great vessels E. Ventricular septal defect Answer

32>A 36-year-old Asian male complains of difficulty swallowing. Esophagoscopy reveals a polypoid mass that is subsequently biopsied. In addition to tumor cells, the esophageal biopsy show normal smooth muscle and striated muscle in the same section. Which portion of the esophagus was the source of this biopsy? A. Lower esophageal sphincter B. Lower third of the esophagus C. Middle third of the esophagus D. Upper esophageal sphincter E. Upper third of the esophagus Answer

33> A 25-year-old woman with sickle cell anemia complains of steady pain in her right upper quadrant with radiation to the right shoulder, especially after large or fatty meals. Her physician diagnoses gallstones. Of which of the following compounds are these stones most likely composed? A. Calcium bilirubinate B. Calcium oxalate C. Cholesterol D. Cholesterol and calcium bilirubinate E. Cystine Answer

34>A 54-year-old alcoholic presents with complaints of tremors and muscle twitching. Physical examination reveals the presence of Trousseau's sign. Laboratory data show that serum magnesium is < 1 mEq/L (normal, 1.4 - 2.2 mEq/L). Which of the following findings would be most consistent with this information? A. Decreased serum calcium B. Decreased serum phosphate C. Increased bone density D. Increased plasma parathyroid hormone concentration E. Increased urinary cAMP concentration Answer

35>A young boy presents with failure to thrive. Biochemical analysis of a duodenal aspirate after a meal reveals a deficiency of enteropeptidase (enterokinase). The levels of which of the following digestive enzymes would be affected? A. Amylase B. Colipase C. Lactase D. Pepsin E. Trypsin Answer

36>A Guatemalan child with a history of meconium ileus is brought to a clinic because of a chronic cough. The mother notes a history of respiratory tract infections and bulky, foul-smelling stools. After assessment of the respiratory tract illness, the physician should also look for signs of A. cystinuria B. hypoglycemia C. iron deficiency anemia D. sphingomyelin accumulation

E. Answer

vitamin A deficiency

37>An infant is born with an abnormally developed falciform ligament. The hepatogastric and hepatoduodenal ligaments are also malformed . These developmental anomalies are most likely due to abnormal development of the A. dorsal mesoduodenum B. dorsal mesogastrium C. pericardioperitoneal canal D. pleuropericardial membranes E. ventral mesentery Answer

38>A 26-year-old man is admitted through the emergency department to the hospital for a heroin overdose. His heart rate is 45 beats/min, and his blood pressure is 75/40 mm Hg. Which of the following best depicts the results from an arterial blood sample ? pH PaCO2 (mm Hg) HCO3- (mEq/L) A. 7.22 66 26 B. 7.34 29 15 C. 7.40 40 24 D. 7.47 20 14 E. 7.49 48 35 Answer

39>A 15-year-old boy presents to his physician with several weeks of slowly worsening pruritus of both of his feet. He is otherwise well and taking no medications. On examination, he has bilateral, erythematous, dry scaling lesions that are most obvious in the interdigital web spaces and on the soles. There is no bleeding or exudate. What would most likely be found in a potassium hydroxide (KOH) mount of a scrapin g of the affected skin? A. Branching hyphae with rosettes of conidia B. Branching, septate hyphae C. Budding yeasts D. Hyphae, arthroconidia, and blastoconidia E. Pigmented, septate hyphal fragments F. Short, curved hyphae and round yeasts Answer

40>A 48-year-old white female secretary presents with progressive difficulty typing over the past month. She also notes that her hands begin to feel numb and weak after typing for long periods of time. Upon testing,

which of the following deficits would be predicted? A. Difficulty in abducting the fifth finger B. Difficulty in adducting the thumb C. Difficulty in flexing digits two and three at the metacarpophalangeal joints D. Loss of sensation over the lateral half of the dorsum of the hand E. Loss of sensation over the lateral half of the palm F. Loss of sensation over the medial half of the dorsum of the hand G. Loss of sensation over the medial half of the palm Answer

41>A 15-year-old girl is brought into the emergency room with severe abdominal pain and a fever. Laboratory examination is remarkable for an elevated white blood cell count and a pregnancy test is positive. Upon questioning, it is determined that she attempted to terminate her pregnancy by inserting a sharp object into her vagina. The physician determines that the wall of the posterior fornix of the vagina has been penetrated. Into what region did the sharp object penetrate? A. Deep perineal pouch B. Ischioanal space C. Rectouterine space D. Rectovesical space E. Vesicouterine space Answer

42>Which of the following is found in the respiratory zone of the lung? A. Goblet cells B. Main bronchi C. Mucous cells D. Terminal bronchioles E. Type I epithelial cells Answer

43>A patient presents with a bulge in the groin, which his physician diagnoses as an inguinal hernia. To determine whether it is an indirect or direct inguinal hernia, the physician applies pressure over the deep inguinal ring while palpating over the superficial inguinal ring. The patient is then asked to cough. The physician notes that the hernia does not push out of the abdomen and concludes that it is an indirect inguinal hernia. Where did the physician apply pressure? A. Immediately lateral to the lacunar ligament B. Immediately lateral to the pubic tubercle C. Immediately medial to the femoral vein D. One half inch above the midpoint of the inguinal ligament E. One half inch below the midpoint of the inguinal ligament Answer

44>A 68-year-old woman presents for a routine check-up. Her only complaint is that she occasionally experiences a little swelling in her ankles. Her serum potassium is 3.5 mEq/L, so the physician wants to avoid unnecessary potassium losses. Which of the following diuretics would be most appropriate for this patient? A. Furosemide B. Hydrochlorothiazide C. Indapamide D. Metolazone E. Spironolactone Answer

45>A 15-year-old boy is evaluated by a clinician for failure to develop normal male secondary sexual characteristics. Physical examination reveals small testes, a small penis, and gynecomastia. The boy has had some difficulties in school, and the parents say that the school psychometrist said he had an IQ of 90. This patient's condition is most likely to be related to which of the following? A. Deletion B. Nondisjunction of an autosomal chromosome C. Nondisjunction of a sex chromosome D. Non-Robertsonian translocation E. Robertsonian translocation Answer

46>A 5-year-old boy falls off his bike and fractures his humerus. He is taken to the emergency room, and the bone is set by one of the emergency room physicians. Which of the following is responsible for producing the majority of the new bone that will reunite the two fragments? A. Cancellous bone B. Cartilage C. Compact bone D. Marrow E. Periosteum Answer

47>A 25-year-old man presents with a 4-cm mass above the clavicle. Chest X-ray demonstrates marked mediastinal widening. Excisional biopsy of the supraclavicular mass demonstrates areas with the appearance shown in the photomicrograph above. The large cell (indicated with the arrow) is most likely which of the following? A. Langhans cell B. LE cell

C. D. E. Answer

Mott cell Reed-Sternberg cell Touton cell

48>A 50 -year-old electrician reports pain in his left upper extremity and tingling and numbness in his 4th and 5th digits of his left hand. Ther e is mild swelling of the left hand. The man reports most of his pain and numbness occurs when he is doing electrical work with his arms overhead. X-ray reveals the presence of a cervical rib. Which of the following structures is most likely being compressed? A. Axillary artery B. Brachial artery C. Brachiocephalic artery D. Subclavian artery E. Subscapular artery Answer

49>The left adrenal vein drains directly into which of the following veins? A. Hemiazygos vein B. Inferior vena cava C. Left renal vein D. Splenic vein E. Superior mesenteric vein Answer

50>To which of the following diseases is pyruvate kinase deficiency most similar clinically? A. a-thalassemia B. b-thalassemia C. Glucose-6-phosphate dehydrogenase deficiency D. Hereditary spherocytosis E. Iron deficiency anemia Answer

Answers

1>The correct answer is A. A number of physiologic changes occur in a person living at high altitude. The diminished barometric pressure at high altitude causes alveolar hypoxia and arterial hypoxia. Pulmonary vasoconstriction occurs in response to alveolar hypoxia; therefore, the diameter of the pulmonary vessels would be greater in the brother living at sea level. All the other choices describe physiologic processes that would be enhanced by living at high altitude. Increased erythropoietin production (choice B), caused by arterial hypoxia, leads to increases in hematocrit in people living at high altitude. Mitochondrial density increases (choice C) in people chronically exposed to the hypoxemia caused by living at high altitude. At high altitudes, the ventilation rate increases, causing a respiratory alkalosis. The kidney then compensates by increasing the excretion of HCO3- (choice D). Increasing the rate of respiration (choice E) is a very useful adaptation to the hypoxic conditions of high altitude. The primary stimulus is the hypoxic stimulation of peripheral chemoreceptors.

2>The correct answer is A. Alopecia areata is caused by an autoimmune attack on hair follicles. It has a wide range of clinical severity, with most cases involving a localized patch

of hair (which regrows within 1 year in half of the patients). The hair that does regrow may be gray or depigmented. More severe cases can involve the entire scalp (alopecia totalis) or, as in this patient, the entire body surface (alopecia universalis). These more severe cases are less likely to resolve adequately. Treatment of alopecia areata is often unsuccessful, but topical steroids are typically tried. Androgenic alopecia (choice B) is common male pattern baldness. Chronic cutaneous lupus erythematosus (choice C) can produce localized baldness. Lichen planopilaris (choice D) can produce localized baldness. Trichotillomania (choice E), also called traumatic alopecia, is alopecia due to trauma, such as hair pulling or tight braids. 3>The correct answer is B. Both the omental bursa and the greater omentum are derived from the dorsal mesogastrium, which is the mesentery of the stomach region. The dorsal mesoduodenum (choice A) is the mesentery of the developing duodenum, which later disappears so that the duodenum and pancreas come to lie retroperitoneally. The pericardioperitoneal canal (choice C) embryologically connects the thoracic and peritoneal canals. The pleuropericardial membranes (choice D) become the pericardium and contribute to the diaphragm. The ventral mesentery (choice E) forms the falciform ligament, ligamentum teres, and lesser omentum. 4>The correct answer is C. Wine and cheese (and many other fermented foods) contain tyramine, an indirect sympathomimetic that can trigger excess catecholamine release and lead to a hypertensive crisis when ingested by patients taking MAO inhibitors. The only such drug listed among the answer choices is phenelzine. Other MAO inhibitors with similar effects include tranylcypromine, isocarboxazid, and iproniazid. Whenever this particular drug class is mentioned in a question stem, consider the possibility of interactions with foods or other medications the patient may have taken. Amitriptyline (choice A) is a tricyclic antidepressant. Tricyclic antidepressant drugs (particularly amitriptyline) are known for their anticholinergic side effects. They also produce postural hypotension (because they block alpha-adrenergic receptors) and are sedative. Fluoxetine and sertraline (choices B and D) are antidepressants that are selective serotonin reuptake inhibitors (SSRIs). Fluoxetine is also useful in treatment of obsessive-compulsive disorders. Trazodone (choice E) is an atypical antidepressant with substantial sedative side effects. Its most serious side effect is priapism, a medical emergency. 5>The correct answer is D. The cells of the anterior pituitary can be classified as chromophils (love dyes) or chromophobes (do not stain with dyes). The chromophils can be further divided into acidophils (stain with acidic dyes) and basophils (stain with basic dyes). The acidophils include the somatotropes, which secrete growth hormone, and the mammotropes, which secrete prolactin. The basophils include the corticotropes, which secrete ACTH (choice A), the gonadotropes, which secrete FSH and LH (choices B and C), and the thyrotropes, which secrete TSH (choice E). 6>The correct answer is D. Persons with this condition often perceive attacks and danger in relatively innocuous situations. They are quick to respond with anger, and, because personality disorders are ego-syntonic, individuals with personality disorders do not believe themselves to be in error. The individual with dependent personality disorder (choice A) does not confront others but wants others to take care of him.

The individual with histrionic personality disorder (choice B) is flamboyant and seductive, not confrontational and angry. The individual with narcissistic personality disorder (choice C) is characterized by feelings of entitlement because they are so "special." And the individual with passive aggressive personality disorder (choice E) expresses anger indirectly (e.g., always being late) rather than confronting 7>The correct answer is C. The loading of O2 is facilitated when the oxygen dissociation curve shifts to the left, and the unloading of O2 is facilitated when the oxygen dissociation curve shifts to the right. A good way to remember the conditions that promote dissociation of O2 is to think of exercising muscle, which has decreased pH (choice C) because of the accumulation of lactic acid, increased PCO2 (compare with choice B) because of the increased rate of aerobic metabolism, increased temperature (compare with choice D), and increased 2,3-DPG (2,3-diphosphoglycerate; compare with choice E) because of increased glycolysis. Carbon monoxide poisoning (choice A) left-shifts the oxygen dissociation curve, which interferes with the unloading of O2. Carbon monoxide also strongly binds to available sites on hemoglobin. 8>The correct answer is A. This patient has Huntington's disease, which has autosomal dominant inheritance. It is characterized by severe degeneration of the caudate nucleus along with degenerative changes in the putamen and cortex. In addition to chorea, these patients frequently suffer from athetoid (writhing) movements, progressive dementia, and behavioral disorders. 9>The correct answer is E. The rash described is that of secondary syphilis, caused by Treponema pallidum. Involvement of palms and soles by a rash is unusual, and secondary syphilis should come to mind. Not all patients with secondary syphilis have a severe form of the rash, and consequentially some cases are missed. Primary syphilis takes the form of a painless, button-like mass called chancres. Tertiary syphilis, which is now rare, has a propensity for involving the aorta and central nervous system and can also cause "gummas" (granulomatous-like lesions) in many sites, notably including liver and bone. Herpes simplex I (choice A) usually causes perioral vesicular lesions. Herpes simplex II (choice B) usually causes genital vesicular lesions. HIV (choice C) does not itself cause a rash, although co-infection with other organisms can result in a rash. Neisseria gonorrhoeae (choice D) does not typically cause a rash. 10>The correct answer is B. Hyperlipidemia has been subclassified based on the lipid and lipoprotein profiles. Type 2a, which this patient has, can be seen in a hereditary form, known as familial hypercholesterolemia, and also in secondary, acquired forms related to nephritic syndrome and hyperthyroidism. The root problem appears to be a deficiency of LDL receptors, which leads to a specific elevation of cholesterol in the form of increased LDL. Heterozygotes for the hereditary form generally develop cardiovascular disease from 30 to 50 years of age. Homozygotes may have cardiovascular disease in childhood. Type 1 (choice A) is characterized by isolated elevation of chylomicrons. Type 2b (choice C) is characterized by elevations of both cholesterol and triglycerides in the form of LDL and VLDL. Type 3 (choice D) is characterized by elevations of triglycerides and cholesterol in the form of chylomicron remnants and IDL. Type 5 (choice E) is characterized by elevations of triglycerides and cholesterol in the form of VLDL and chylomicrons.

11The correct answer is C. The neurohypophysis (posterior pituitary) is derived from an evagination of diencephalic neurectoderm. This structure is responsible for releasing oxytocin and vasopressin to the general circulation. Both hormones are synthesized in cell bodies contained within the hypothalamus. ACTH (choice A), prolactin (choice D), and TSH (choice E) are all synthesized and released by the anterior pituitary, or adenohypophysis, which is derived from an evagination of the ectoderm of Rathke's pouch, a diverticulum of the primitive mouth. Remnants of this pouch may give rise to a craniopharyngioma in later life. Epinephrine (choice B) is synthesized and released into the circulation by the adrenal medulla, a neural crest derivative. 12>The correct answer is E. The most common bacteria implicated in community-acquired pneumonia is the pneumococcus, Streptococcus pneumoniae. Other organisms frequently implicated in patients less than age 60 without comorbidity include Mycoplasma pneumoniae, respiratory viruses, Chlamydia pneumoniae, and Haemophilus influenzae. When community-acquired pneumonia occurs in elderly patients or patients with comorbidity, aerobic gram-negative bacilli and Staphylococcus aureus are added to the list. The organisms listed in choices A, B, and C are important causes of community-acquired pneumonia, but are not the most frequent causes. Staphylococcus aureus (choice D) is an important cause of community-acquired pneumonia (particularly in the elderly and in patients with comorbidity), but is not the most frequent cause. 13>The correct answer is E. Uric acid kidney stones in patients with leukemia are secondary to increased production of uric acid from purine breakdown during periods of active cell proliferation, especially following treatment. Vigorous hydration and diuresis are generally instituted after the diagnosis of acute leukemia is made. Uric acid kidney stones are also associated with inborn errors of purine metabolism, such as gout. Pigment gallstones (choice A) are associated with hemolytic disease. The incidence of this type of gallstone is not increased in treated leukemias. Cholesterol gallstones (choice B) are associated with diabetes mellitus, obesity, pregnancy, birth control pills, and celiac disease. Cystine kidney stones (choice C) are rare; they are found in cystinuria. Struvite kidney stones (choice D) are associated with infection by urea-splitting organisms, such as Proteus. 14>The correct answer is B. The data shown in the table indicate that the man has developed metabolic alkalosis (increased PCO2, pH, and HCO3-), which occurs commonly with overuse of diuretics (thiazides and loop diuretics). The overuse of a loop diuretic increases the excretion of sodium (choice E) and potassium (choice C) by the kidneys. The increase in potassium excretion leads to a decrease in plasma potassium levels (choice B). The decrease in plasma potassium stimulates aldosterone secretion, which raises plasma aldosterone levels (choice A). The sodium depletion stimulates renin secretion (choice D), which in turn raises angiotensin II levels in the plasma (which also stimulates aldosterone secretion 15>The correct answer is C. This is a case of Reiter's syndrome. Patients typically present with the acute onset of arthritis (usually asymmetric and additive), with involvement of new joints occurring over a period of a few days to 2 weeks. Joints of the lower extremities are the most commonly involved, but wrists and fingers can also be affected. Dactylitis (sausage digit), a diffuse swelling of a solitary finger or toe, is a distinctive feature of Reiter's arthritis and psoriatic arthritis. Tendonitis and fasciitis are common. Spinal pain and low back pain are

common. Conjunctivitis, urethritis, diarrhea, and skin lesions are also associated with Reiter's syndrome. Up to 75% of patients are HLA-B27 positive. Microorganisms which can trigger Reiter's syndrome include Shigella spp., Salmonella spp., Yersinia spp., Campylobacter jejuni, and Chlamydia trachomatis. Most patients are younger males. Gout (choice A) usually presents as an explosive attack of acute, very painful, monarticular inflammatory arthritis. Hyperuricemia is the cardinal feature and prerequisite for gout. The first metatarsophalangeal joint is involved in over 50% of first attacks. Lyme disease (choice B), caused by Borrelia burgdorferi, presents with a red macule or papule at the site of the tick bite. This lesion, called erythema chronicum migrans, slowly expands to form a large annular lesion with a red border and central clearing. The lesion is warm, but usually not painful. The patient also has severe headache, stiff neck, chills, arthralgias, and profound malaise and fatigue. Untreated infection is associated with development of arthritis. The large joints (e.g., knees) are usually involved with the arthritis lasting for weeks to months. Rheumatoid arthritis (choice D) begins insidiously with fatigue, anorexia, generalized weakness, and vague musculoskeletal symptoms leading up to the appearance of synovitis. Pain in the affected joints, aggravated by movement, is the most common manifestation of established rheumatoid arthritis. Generalized stiffness is frequent and is usually greatest after periods of inactivity. Morning stiffness of greater than 1 hour in duration is very characteristic. Rheumatoid arthritis is more common in females. The metacarpophalangeal and proximal interphalangeal joints of the hands are characteristically involved. Septic arthritis (choice E) is caused by a variety of microorganisms, including Neisseria gonorrhoeae and Staphylococcus aureus. Hematogenous spread is the most common route in all age groups. 90% of patients present with involvement of a single joint, usually the knee. The usual presentation is moderate-to-severe pain, effusion, muscle spasm, and decreased range of motion. Peripheral leukocytosis and a left shift are common. Disseminated gonococcal infections present as fever, chills, rash, and articular symptoms. Papules progressing to hemorrhagic pustules develop on the trunk and extensor surfaces of the distal extremities. Migratory arthritis and tenosynovitis of multiple joints is common. 16>The correct answer is D. Many people who request physician-assisted suicide have one of two conditions present: either a poorly controlled painful condition or severe depression. If the painful condition is adequately treated or the depression is brought under good medical control, the request for physician assistance in terminating the situation is typically withdrawn. It is important to note that bringing these conditions under control requires the intervention of caregivers who are specifically trained in the management of these two conditions; primary care physicians usually are not adequately trained to address these difficult presentations. While patients who are diagnosed as bipolar disorder (choice A), borderline personality disorder (choice B), and schizophrenic disorder (choice E) often make suicide attempts (and frequently complete those attempts), they do not generally ask their physician for assistance in the suicide. Persons with factitious disorder (choice C) are seeking primary gain, often for dependency needs, and are seeking to enter the "sick role" not the "dead role." 17>The correct answer is E. The patient has bilateral acoustic neuromas, probably due to neurofibromatosis type II (over 90% of patients with NF-2 develop bilateral acoustic neuromas). This condition is a associated with the NF-2, gene, located on 22q (note all the 2's). Patients often develop meningiomas, gliomas, and schwannomas of cranial and spinal nerves. 5q (choice A) contains the APC tumor suppressor gene, which is associated with familial and sporadic colorectal cancers.

13q (choice B) contains the Rb tumor suppressor gene, which is associated with retinoblastoma and osteosarcoma. 17q (choice C) contains both the NF-1 tumor suppressor gene, which is associated with neurofibromatosis type I, and the p53 tumor suppressor gene, associated with many human cancers. 18q (choice D) contains both the DCC gene, which is associated with colon and gastric carcinomas and the DPC gene, associated with pancreatic cancer.

18> The correct answer is D. Perforation of a peptic ulcer is potentially fatal, because of either peritonitis with sepsis or sudden exsanguination (if the perforation damages one of the many arteries of the stomach). Peptic ulcer disease, gastritis, and possibly gastric carcinoma and gastric lymphoma have been strongly associated with Helicobacter pylori colonization of the mucus layer covering the gastric mucosa. Colonization is associated with destruction of the mucus layer, thereby destroying its protective function. Cryptosporidium parvum (choice A) causes diarrhea that is severe in immunocompromised patients. Entamoeba histolytica (choice B) produces dysentery-like symptoms or can cause liver abscess. Escherichia coli (choice C) causes a variety of diarrheal diseases and can infect the bladder and soft tissues. Mycobacterium tuberculosis (choice E) causes tuberculosis, characterized by granuloma formation, especially in the lungs. 19>The correct answer is E. By the third week of development, hematopoiesis begins in the blood islands of the yolk sac. Beginning at 1 month of age and continuing until 7 months of age, blood elements are also formed in the liver. Hematopoiesis occurs in the spleen and lymphatic organs between 2 and 4 months, and in the bone marrow after 4 months.

15>The correct answer is C. The patient is suffering from schizophrenia. The key to the diagnosis of psychosis is that there has been a marked decline in the level of functioning (i.e., the man is homeless and cannot care for himself). Although hallucinations or delusions are not mentioned in the case history, the presence of disorganized speech, grossly disorganized behavior, and the duration of symptoms (longer than six months) suggest a diagnosis of schizophrenia. In schizoaffective disorder (choice A), alterations in mood are present during a substantial portion of the illness. Although schizoid personality disorder (choice B) produces detachment from social relationships and is characterized by restriction of emotional expression, it is not accompanied by a marked decline in occupational functioning. Schizophreniform disorder (choice D) is characterized by schizophrenic-like symptoms, but the duration of symptoms is, by definition, less than six months. Schizotypal personality disorder (choice E) is characterized by eccentricities of behavior, odd beliefs or magical thinking, and difficulties with social and interpersonal relationships. Unlike schizophrenia, schizotypal personality disorder is not characterized by a formal thought disorder.

21>The correct answer is E. Familial hypercholesterolemia, which is due to defective function of the LDL receptor, is an area of intense research. The molecular basis of LDL receptor abnormalities is becoming better understood, and more than 200 mutations in the gene for the LDL receptor have been identified. The gene has 5 general domains and 18 exons. Defects near exons 7 to 14 (including this case) are in the region of homology with epidermal growth factor receptor precursor. This region of the molecule is needed for dissociation of LDL from the receptor in the endosome. Receptors with a defect in this area (sometimes called class II mutations) also have trouble being initially transported to the Golgi complex (transport-deficiency alleles) and become trapped in endoplasmic reticulum. Decreased transcription of the LDL receptor gene (choice A) is considered a class I mutation and involves the signal sequence domain near exon 1. Poor internalization of LDL bound to LDL receptor (choice B) is considered a class IV mutation. Such mutations are associated with the membrane-spanning/cytoplasmic domain, specifically near exon 18. Poor retention of the LDL receptor in the membrane (choice C) is considered a class IV mutation and is associated with the membrane-spanning/cytoplasmic domain, specifically near exons 2-6. Reduced binding of LDL (choice D) is considered a class III mutation and involves the LDL binding domain near exons 2-6. 22>The correct answer is D. Respiratory distress immediately follows amniotic fluid embolism as the emboli consisting of squamous cells, lanugo, and mucus deposit in the pulmonary microcirculation, producing numerous tiny pulmonary infarcts. The dramatic respiratory distress may also reflect the action of prostaglandins and other bioactive compounds present in high concentrations in the amniotic fluid embolus. Hemiplegia (choice A) would reflect an ischemic injury to one hemisphere of the cerebrum or the brainstem. A venous embolus would not produce such an insult. Placental abruption (choice B) is partial, premature separation of the placental disc from the endometrium. Although abruption may occur in this setting, it is not a result of an amniotic fluid embolism. There are numerous causes of renal failure (choice C); the most likely ones in the peripartum interval include eclampsia, hypovolemic shock, and ascending infections. Amniotic fluid embolism would be expected to produce severe dyspnea well before shock and renal failure might arise. Splinter hemorrhages (choice E) are small hemorrhages seen on toes and fingers due to a shower of microemboli arising in the arterial circulation. Amniotic fluid emboli arise in the veins and deposit in the lungs. 23>The correct answer is D. The patient has a megaloblastic anemia, which can be due to deficiency of folate or B12. Pregnancy increases the need for folate and other nutrients used by both baby and mother, and may "unmask" a borderline dietary deficiency. For this reason, most obstetricians recommend vitamin supplements for pregnant women. Ascorbic acid (choice A) is vitamin C, and its deficiency predisposes for capillary fragility and oral lesions. Calcium deficiency (choice B) predisposes for osteoporosis/osteopenia. Copper deficiency (choice C) is rare; when it occurs, it may cause a hypochromic anemia, neutropenia, osteoporosis, or hypotonia. Iron deficiency (choice E) causes a microcytic, hypochromic anemia, with reduced mental and physical performance.

24>The correct answer is D. The lesions are characteristic of molluscum contagiosum, which is a typically benign and self-limited condition caused by a poxvirus. The disease can be transmitted either venereally or through non-venereal contact. The other viruses listed do not cause similar skin lesions. Patients with advanced HIV infection may develop a severe, generalized, and persistent eruption, often involving the face and upper body. Cytomegalovirus (choice A) causes congenital infections and disseminated infections in immunosuppressed patients. Herpesvirus 6 (choice B)causes roseola (exanthem subitum). Parvovirus (choice C) causes aplastic crises in patients with hemolytic anemia. Variola (choice E) is the smallpox virus. 25>The correct answer is D. This is a relatively simple question that requires you to visualize the relationship among the key parts of the kidney and to identify the one that lies most medially. If you think about it for a second, since the kidneys ultimately drain into the ureter at their medial poles, you are looking for the structure that is closest to the ureter. The correct answer is the renal pelvis. The renal pelvis is the dilated upper portion of the ureter that receives the major calyces. In terms of the other answer choices, the order from most lateral to most medial is: renal cortex (choice C), renal pyramid (choice E), minor calyx (choice B), major calyx (choice A), and then the renal pelvis (choice D).

26> The correct answer is A. Cyclophosphamide is metabolized to acrolein, which is excreted in the urine. If the patient's urine is concentrated, the toxic metabolite may cause severe bladder damage. Early symptoms of bladder toxicity include dysuria and frequency. This can be distinguished from a urinary tract infection, since there is no bacteriuria with cyclophosphamide-induced bladder toxicity. However, microscopic hematuria is often present on urinalysis. In severe hemorrhagic cystitis, large segments of the bladder mucosa may be shed which can lead to prolonged, gross hematuria. The incidence of cyclophosphamide-induced hemorrhagic cystitis can be decreased by ensuring that the patient maintains a high fluid intake. Cyclophosphamide is an alkylating agent used in the treatment of breast carcinoma, malignant lymphoma, multiple myeloma, and adenocarcinoma of the ovary, as well as various other forms of cancer. The major toxic reactions commonly seen with this agent include mucositis, nausea, hepatotoxicity, sterile hemorrhagic and nonhemorrhagic cystitis, leukopenia, neutropenia, and interstitial pulmonary fibrosis. Mitomycin (choice B) is an antibiotic antineoplastic agent used in the treatment of breast carcinoma, adenocarcinoma of the pancreas and stomach, as well as various other forms of cancer. The major toxic reactions commonly seen with this agent include bone marrow depression, nausea, hepatotoxicity, acute bronchospasm, thrombocytopenia, and interstitial pneumonitis. Paclitaxel (choice C) is an antineoplastic agent primarily used in the treatment of ovarian and breast cancer. The major toxic reactions commonly seen with this agent include bone marrow depression, nausea, hepatotoxicity, bronchospasm, thrombocytopenia, and neutropenia. Tamoxifen (choice D) is an antineoplastic hormone primarily used in the palliative treatment of estrogen-receptor positive breast cancer patients. The major toxic reactions commonly seen with this agent include depression, dizziness, thrombosis, mild leukopenia or thrombocytopenia. Vincristine (choice E) is a mitotic inhibitor antineoplastic agent used in the treatment of breast cancer, Hodgkin's disease, non-Hodgkin's lymphoma, advanced testicular cancer and various other types of cancer. The major toxic reactions commonly seen with this agent

include mental depression, hemorrhagic enterocolitis, bone marrow depression, nausea, thrombocytopenia, and leukopenia 27>The correct answer is A. In a syndrome called cleidocranial dysostosis, absence of part of the clavicles accompanies a broad skull, and facial and dental anomalies. Note that you could also have answered this question by noting that of the bones listed, only the clavicles form by intramembranous ossification. The femurs (choice B), metatarsals (choice C), phalanges (choice D), and tibias (choice E) are cartilaginous (formed by endochondral ossification) rather than membranous bones. 28>The correct answer is D. The tumor is a neuroblastoma, which is one of the principal forms of cancer in children. Neuroblastoma typically occurs before age 5, with many presenting before age 2. Neuroblastoma can arise from neural crest cells throughout the body, but the adrenal medulla is the most common site. Homer-Wright pseudorosettes are circles of tumor cells with central young nerve fibers arising from the tumor cells. The oncogene associated with neuroblastoma is N-myc. erb-B2 (choice A) is associated with breast, ovarian, and gastric carcinomas. c-myc (choice B) is associated with Burkitt's lymphoma. L-myc (choice C) is associated with small cell carcinoma of the lung. ret (choice E) is associated with multiple endocrine neoplasia, types II and III. 29>The correct answer is B. The disease is von Hippel-Landau disease, which is associated with a deletion involving the VHL gene on chromosome 3 (3p). Affected individuals develop vascular tumors (hemangioblastomas) of the retina, cerebellum, and/or medulla. Roughly half of the affected individuals later develop multiple, bilateral renal cell carcinomas. Berry aneurysms (choice A) are unrelated to hemangioblastomas, but are instead associated with adult polycystic disease. Peripheral nerve cancers (choice C) are a feature of von Recklinghausen's disease (neurofibromatosis type I). Choreiform movements, related to decreased GABA and acetylcholine (choice D), are a feature of Huntington's disease. Extremely high serum cholesterol (choice E) suggests the homozygous form of familial hypercholesterolemia. 30>The correct answer is A. The space constant of an axon reflects the amount of passive or electrotonic spread of current within an axon. The larger the space constant, the further the current can spread, allowing action potentials to propagate faster. This is why myelin increases the conduction velocity of action potentials down an axon. Conversely, demyelination decreases the space constant and slows action potential conduction. 31>The correct answer is A. Coarctation of the aorta occurs in two patterns. In the infantile type, the stenosis is proximal to the insertion of the ductus arteriosus (preductal); this pattern is associated with Turner's syndrome. In the adult form, the stenosis is distal to the ductus arteriosus (postductal) and is associated with notching of the ribs (secondary to continued pressure from the aorta on them), hypertension in the upper extremities, and weak pulses in the lower extremities. Headache, cold extremities, and lower extremity claudication with exercise are typical if the patient is symptomatic (many adults with mild distal coarctation may remain asymptomatic for years). Upper extremity hypertension with weak pulses in the lower extremities, and a midsystolic (or continuous) murmur over the chest or back may be the only obvious signs in some. Note that the chronic cough is probably related to the man's smoking, and is not caused by the coarctation.

Eisenmenger's syndrome (choice B) is a shift from a left-to-right shunt to a right-to-left shunt secondary to pulmonary hypertension. Tetralogy of Fallot (choice C) and transposition of great arteries (choice D) cause cyanosis and are usually diagnosed in infancy. Ventricular septal defect (choice E) might remain undiagnosed until adulthood, but would not cause notching of the ribs. 32>The correct answer is C. The muscularis of the upper third of the esophagus (choice E) is composed entirely of striated muscle. The middle third (choice C) contains both striated and smooth muscle. The lower third (choice B) and lower esophageal sphincter (choice A) contain only smooth muscle. There is no such thing as the upper esophageal sphincter (choice D). 33>The correct answer is A. Bilirubin is a degradative product of hemoglobin metabolism. Bilirubin (pigment) stones are specifically associated with excessive bilirubin production in hemolytic anemias, including sickle cell anemia. Bilirubin stones can also be seen in hepatic cirrhosis and liver fluke infestation. Calcium oxalate stones (choice B) and cystine stones (choice E) are found in the kidney, rather than the gallbladder. Pure cholesterol stones (choice C) are less common than mixed gallstones, but have the same risk factors, including obesity and multiple pregnancies. Mixed stones (choice D) are the common "garden variety" gallstones, found especially in obese, middle aged patients, with a female predominance

34> The correct answer is A. Malnutrition associated with chronic alcoholism can lead to a severe magnesium deficiency. The effect of low serum magnesium on parathyroid hormone secretion (PTH) depends on severity and duration. An acute decrease in serum magnesium will increase PTH secretion, while a prolonged severe deficiency results in decreased PTH secretion. There is also evidence that the action of PTH is decreased with chronic magnesium deficiency. Hence, this patient is suffering from "functional" hypoparathyroidism. The low serum calcium can produce weakness, tremors, muscle fasciculations, and seizures. A positive Trousseau's sign indicates the presence of latent tetany. It is observed by inflating a blood pressure cuff above systolic blood pressure for at least 2 minutes. A positive reaction consists of the development of carpal spasm, with relaxation occurring within seconds after deflating the cuff. In patients with magnesium deficiency, magnesium administration will produce a prompt rise in plasma PTH with subsequent restoration of serum calcium concentration to normal. With functional hypoparathyroidism bone density would be decreased (not increased, choice C). The combination of decreased PTH secretion (not increased, choice D) and decreased effectiveness of PTH produce hypocalcemia and hyperphosphatemia (not hypophosphatemia, choice B). Urinary cAMP would probably be decreased (not increased, choice E), given the low PTH. 35>The correct answer is E. Enteropeptidase, formerly called enterokinase, activates trypsinogen by limited proteolytic digestion to give trypsin. Trypsin is itself capable of activating trypsinogen, which produces a positive feedback effect. Trypsin also activates chymotrypsinogen (and several other proteolytic enzymes), so deficiency of enteropeptidase results in a severe deficiency of enzymes that digest protein.

Amylase (choice A) aids in the breakdown of starches to oligosaccharides, maltose, and maltotriose. Colipase (choice B), along with other lipases, functions to digest fats. Lactase (choice C) is a brush-border disaccharidase that hydrolyzes the bond between galactose and glucose in lactose. Pepsin (choice D) is a proteolytic enzyme secreted in an inactive form (pepsinogen) by the chief cells of the stomach. Pepsinogen is activated by stomach acid, and so is not dependent on enteropeptidase. Pepsin alone will not replace the activities of other proteolytic enzymes, partly because food does not remain in the stomach for an extended period of time. 36>The correct answer is E. The child is likely suffering from cystic fibrosis. In this disorder, an abnormality of chloride channels causes all exocrine secretions to be much thicker, and more viscous than normal. Pancreatic secretion of digestive enzymes is often severely impaired, with consequent steatorrhea and deficiency of fat-soluble vitamins, including vitamin A. Cystinuria (choice A) is a relatively common disorder in which a defective transporter for dibasic amino acids (cystine, ornithine, lysine, arginine; COLA) leads to saturation of the urine with cystine, which is not very soluble in urine, and precipitates out to form stones. Hypoglycemia (choice B) is not a prominent feature of children with cystic fibrosis who are on a normal diet. Hyperglycemia may occur late in the course of the disease. Iron deficiency anemia (choice C) is not found with any regularity in children with cystic fibrosis. Sphingomyelin accumulation (choice D) is generally associated with deficiency of sphingomyelinase, as seen in Niemann-Pick disease. 37>The correct answer is E. The ventral mesentery forms the falciform ligament, ligamentum teres, and lesser omentum, which can be divided into the hepatogastric and hepatoduodenal ligament. The dorsal mesoduodenum (choice A) is the mesentery of the developing duodenum, which later disappears so that the duodenum and pancreas lie retroperitoneally. Both omental bursa and the greater omentum are derived from the dorsal mesogastrium (choice B), which is the mesentery of the stomach region. The pericardioperitoneal canal (choice C) embryologically connects the thoracic and peritoneal canals. The pleuropericardial membranes (choice D) become the pericardium and contribute to the diaphragm. 38>The correct answer is A. This man has a respiratory acidosis. Overdose with drugs that suppress ventilation (e.g., heroin, morphine, barbiturates, methaqualone, and "sleeping pills") often causes hypercapnia. In patients with an intact renal response, the respiratory acidosis causes a compensatory rise in plasma HCO3-, which lessens the fall in pH. However, the renal response requires several days to develop fully. The plasma HCO3- of 26 mEq/L (normal: 22-28 mEq/L) for this man is typical of acute respiratory acidosis with little or no renal compensation. Choice B reflects metabolic acidosis. Choice C is normal. Choice D reflects respiratory alkalosis. Choice E reflects metabolic alkalosis. 39>The correct answer is B. This is a case of tinea pedis, or athlete's foot, caused by a variety of dermatophytic fungi, which are easily detected on alkali mounts of scraped skin as colorless, branching hyphae with cross-walls.

Hyphae with rosettes of conidia (choice A) describes the environmental/transmission form for Sporothrix schenckii, the agent of rose gardener's disease, which is a subcutaneous mycosis. Budding yeasts (choice C) describes the form found in clinical specimens from patients with sporotrichosis. Hyphae, arthroconidia, and blastoconidia (choice D) would be found in clinical specimens from patients infected with Trichosporon beigelii (white piedra), which is a superficial mycosis of the hair of the head. Pigmented, septate hyphal fragments (choice E) would be found in cases of phaeohyphomycosis, a diverse group of cyst-forming subcutaneous, pigmented (dematiaceous) fungi, rare in the U.S. Short, curved hyphae and round yeasts (choice F), or the "spaghetti and meatball" presentation in clinical specimens, are characteristic of Malassezia furfur, the agent of pityriasis versicolor. 40>The correct answer is C. This is a classic presentation of a patient with carpal tunnel syndrome, which typically affects females between the ages of 40 and 60 who chronically perform repetitive tasks that involve movement of the structures that pass through the carpal tunnel. One important structure that passes through the carpal tunnel is the median nerve. Patients often note a tingling, a loss of sensation, or diminished sensation in the digits. There is also often a loss of coordination and strength in the thumb, because the median nerve also sends fibers to the abductor pollicis brevis, flexor pollicis brevis, and the opponens pollicis. A final function of the median nerve distal to the carpal tunnel is control of the first and second lumbricals which function to flex digits two and three at the metacarpophalangeal joints and extend interphalangeal joints of the same digits. Abduction of the fifth digit (choice A) is a function controlled by the ulnar nerve, which does not pass through the carpal tunnel. Adduction of the thumb (choice B) is a function of the adductor pollicis, which is the only short thumb muscle that is not innervated by the median nerve, but rather by the deep branch of the ulnar nerve. Sensation of the lateral half of the dorsum of the hand (choice D) is mediated by the radial nerve, which also does not pass through the carpal tunnel. Sensation over the lateral aspect of the palm (choice E) is mediated by the median nerve, however the branch innervating the palm (palmar cutaneous branch of the median nerve) passes superficial to the carpal tunnel. Sensation over the medial aspect of the dorsum of the hand (choice F) is mediated by the ulnar nerve. Sensation over the medial aspect of the palm (choice G) is mediated by the ulnar nerve. 41>The correct answer is C. The posterior fornix is in contact with the floor of the rectouterine space. The rectouterine space is the lowest part of the peritoneal cavity in the female pelvis. The patient has introduced bacteria into the peritoneal cavity by the penetration of the sharp object, producing sepsis. The deep perineal pouch (choice A) is the middle layer of the urogenital diaphragm containing the sphincter urethrae muscle. The vagina passes through this region but the posterior fornix is not related to it. The ischioanal space (choice B) is below and lateral to the pelvic diaphragm. The vagina does not pass through this space. The rectovesical space (choice D) is the region in the peritoneal cavity of the male pelvis between the urinary bladder and the rectum. This space does not exist in the female pelvis.

The vesicouterine space (choice E) is the region within the peritoneal cavity of the female pelvis between the urinary bladder and the uterus. This space is not related to the posterior fornix of the vagina. 42>The correct answer is E. There are two zones in the lung-the conducting zone (where there is no gas exchange) and the respiratory zone (where there is gas exchange). Of all of the structures listed, only Type I epithelial cells are located in the respiratory zone. Type I epithelial cells are the primary structural cell of the alveolar wall. Type II epithelial cells, also located in the alveoli, are the cells that produce surfactant. Goblet cells (choice A), which are mucus-secreting cells, are present in the conducting airways. The main bronchi (choice B) are part of the conducting airways. Mucous cells (choice C), which are mucus-secreting cells, are present in the conducting airways. Terminal bronchioles (choice D) are the most distal part of the conducting airways. Respiratory bronchioles, which are just distal to the terminal bronchioles, are part of the respiratory zone. These two types of bronchioles can be differentiated from each other by whether they have alveoli budding from their walls. Respiratory bronchioles have alveoli, terminal bronchioles do not. 43>The correct answer is D. The inguinal canal lies entirely above the inguinal ligament. The deep inguinal ring is about one-half inch above the midpoint of the inguinal ligament. The superficial inguinal ring is superolateral to the pubic tubercle. Indirect inguinal hernias enter the inguinal canal through the deep inguinal ring. The femoral ring is posterior to the inguinal ligament, lateral to the lacunar ligament (choice A), and medial to the femoral vein (choice C). Femoral hernias pass through the femoral ring. The superficial inguinal ring is superomedial to the pubic tubercle (choice B). Indirect and direct inguinal hernias pass through the superficial inguinal ring, but only indirect inguinal hernias pass through the deep inguinal ring. The inguinal canal is entirely above the inguinal ligament. The thigh is below the inguinal ligament (choice E). 44>The correct answer is E. Potassium is responsible for maintenance of intracellular tonicity, transmission of nerve pulses, contraction of muscle (striated and smooth), and maintenance of renal function. The normal blood level of potassium ranges from 3.5 to 5.0 mEq/L. In potassium depletion, a decrease in the blood potassium level by 1 mEq/L equals a loss of 100-200 mEq from potassium stores in the body. Depletion can result in the development of muscular weakness, paralysis, and mental confusion. Since this patient is borderline hypokalemic, she should receive a potassium-sparing diuretic, such as spironolactone, amiloride, or triamterene. These agents are all indicated for the treatment of edematous states as well as the prophylaxis and treatment of hypokalemia. These agents are commonly combined with other non-potassium-sparing diuretics to prevent the appearance of hypokalemia during therapy. Furosemide (choice A) is a loop diuretic indicated for the treatment of edematous states in hypertension and is commonly associated with the development of hypokalemia. Hydrochlorothiazide (choice B), indapamide (choice C), and metolazone (choice D) are thiazide diuretics indicated for the treatment of edematous states in hypertension and are also commonly associated with the development of hypokalemia. 45>The correct answer is C. The boy probably has Klinefelter's syndrome (47, XXY), which has the typical presentation described in the question. The condition arises as a result of

failure of separation (nondisjunction) of the sex chromosomes, and can be related to either paternal nondisjunction (slightly more common) or maternal nondisjunction. Deletions (choice A) are a common form of genetic disease and contribute to many genetic recessive diseases. Examples of nondisjunction of autosomes (choice B) include trisomies such as most cases of Down's syndrome (trisomy 21), Edwards' syndrome (trisomy 18), and Patau syndrome (trisomy 13). There are two types of translocations: non-Robertsonian (choice D) and Robertsonian (choice E). Non-Robertsonian (reciprocal) translocations result when two non-homologous chromosomes exchange genetic material. Robertsonian translocations are a special type of translocation that involve exchange of genetic material from the long arms of one acrocentric chromosome to the long arms of another acrocentric chromosome, with fusion of the centromeres. Four percent of cases of Down's syndrome are caused by this mechanism. 46>The correct answer is E. When the periosteum is torn during a fracture, it supplies cells that develop into osteoblasts and are the major producers of the new bone that reunites the two ends. Heterotopic ossification (bone formed outside the regular bone) can occur as a complication of fracture if some of the osteoblastic cells are misdirected into adjacent tissues. Preexisting cancellous bone (choice A) and compact bone (choice C) are not the major source of osteoblasts that form the new bone. Cartilage (choice B) and marrow (choice D) do not contribute to new bone formation after fracture. 47>The correct answer is D. The cell illustrated is a Reed-Sternberg cell. These cells characteristically are neoplastic giant cells with a bilobed mirror-image nucleus that may have large ("owl-eyes") nucleoli surrounded by a clear halo. Most commonly, these cells are associated with Hodgkin's disease, but it is worth knowing that in real life, a surprising variety of other lymphomas and some other diseases may have at least occasional ReedSternberg look-alikes. For that reason, the diagnosis of Hodgkin's disease often requires confirmatory immunohistochemical staining. The Langhans cell (choice A) is a giant cell with peripherally arranged nuclei found in granulomas. The LE cell (choice B) is a degenerating neutrophil seen in lupus erythematosus in in vitro preparations. The Mott cell (choice C) is a "constipated" plasma cell filled with immunoglobulins, producing a grape-cluster appearance to the cell. Mott cells are seen in multiple myeloma and some parasitic infestations. The Touton giant cell (choice E) has distributed nuclei and is found in tumors other than Hodgkin's lymphoma. 48>The correct answer is D. The subclavian artery passes laterally over the upper surface of the first rib and lies posterior to the scalenus anterior. In the case of thoracic outlet syndrome, this artery is usually compressed between the scalenus anterior and a cervical rib. Thoracic outlet syndrome is a broad term for a group of disorders in which there is compression of certain neurovascular bundles. The presence of a cervical rib adds to the compression, and repetitive motion and poor posture are other predisposing factors. When the neurovascular bundle is entrapped, the patient presents with neurological and/or circulatory changes in the upper extremity on the involved side. The axillary artery (choice A) is the continuation of the subclavian artery. This artery begins at the outer border of the first rib and continues through the axilla to the lower border of the teres major.

The brachial artery (choice B) is the continuation of the axillary artery in the upper extremity and can not be compressed by a cervical rib. The brachiocephalic artery (choice C) arises from the arch of the aorta. At the level of the right sternoclavicular joint, it separates into the right common carotid artery and the right subclavian artery. The subscapular artery (choice E) is the largest branch of the axillary artery. It supplies muscles on the lateral thoracic wall and scapular muscles. 49>The correct answer is C. The left adrenal vein and the left gonadal vein (either testicular or ovarian) drain into the left renal vein. The left renal vein then drains into the inferior vena cava. In contrast, the right adrenal vein and right gonadal vein drain directly into the inferior vena cava. The hemiazygos vein (choice A) receives the venous drainage from the body wall on the left side of the thorax and abdomen. No visceral organs drain directly to the azygos or hemiazygos veins. The inferior vena cava (choice B) receives the direct venous drainage from the right adrenal vein, but not the left adrenal vein. Remember, the inferior vena cava is on the right side of the abdomen. The splenic vein (choice D) receives the venous drainage from the spleen and part of the pancreas and stomach. The splenic vein is part of the portal venous system. The superior mesenteric vein (choice E) receives venous drainage from much of the intestinal tract. It is part of the portal venous system and joins with the splenic vein to form the portal vein. 50>The correct answer is C. Both pyruvate kinase deficiency and glucose-6-phosphate dehydrogenase deficiency are red cell enzyme deficiencies characterized clinically by long "normal" periods interspersed with episodes of hemolytic anemia triggered by infections and oxidant drug injury (antimalarial drugs, sulfonamides, nitrofurans). In both of these conditions, the cell morphology between hemolytic episodes is usually normal or close to normal. The a (choice A) and b (choice B) thalassemias, in their major forms, are characterized by persistent severe anemia. In the trait forms, they are charactertized by mild anemia. Hereditary spherocytosis (choice D) is characterized by intermittent hemolysis, but, unlike pyruvate kinase deficiency and glucose-6-phosphate dehydrogenase deficiency, oxidant drugs are not a specific trigger for hemolysis. Iron deficiency anemia (choice E) is characterized by chronic anemia with hypochromic, microcytic erythrocytes. (9)<1>Most fascia of the body that attach to bones attach by which of the following mechanisms? A. Blending with the covering periosteum B. Inserting deeply into the cancellous bone C. Inserting deeply into the cartilage D. Inserting deeply into the diaphysis E. Inserting deeply into the marrow Answer

<2>A 54-year-old male with acute lymphocytic leukemia develops a blast crisis. He is treated with intensive systemic chemotherapy. Following treatment, the patient will be at increased risk for the development of

A. B. C. D. E. Answer

bile pigment gallstones cholesterol gallstones cystine kidney stones struvite kidney stones uric acid kidney stones

<3>A 62-year-old man presents to the emergency department with acute onset of severe ocular pain accompanied by blurred vision that is associated with halos around lights. On examination, the left eye is red and hard; the cornea is described as having a steamy appearance, and mydriasis is noted. The most appropriate agent for the treatment of this patient's acute signs and symptoms is A. acetazolamide (IV) B. dorzolamide (topical) C. epinephrine (IV) D. latanoprost (topical) E. timolol (topical) Answer

<4>A chronic alcoholic develops severe memory loss with marked confabulation. Deficiency of which of the following vitamins would be most likely to contribute to the neurologic damage underlying these symptoms? A. Folic acid B. Niacin C. Riboflavin D. Thiamine E. Vitamin B12 Answer

<5>In the transition from a Graafian follicle to a functional corpus luteum, which of the following cellular events occurs? A. Granulosa cells begin to express aromatase B. Granulosa cells begin to express FSH receptors C. Granulosa cells begin to express LH receptors D. Theca cells begin to express LH receptors E. Theca cells begin to express side-chain cleavage enzyme Answer

<6>A 58-year-old homeless man is brought in to the emergency room by police. His temperature is 101.8°F rectally, and he smells of cheap wine. Physical examination is remarkable for dullness to percussion, increased vocal

fremitus, and decreased breath sounds and wet crackles on the right. Chest x-ray reveals consolidation of the right upper lobe. One of the nurses notes the production of thick, bloody sputum when the man coughs. The most likely causative organism is A. Haemophilus influenzae B. Klebsiella pneumoniae C. Pseudomonas aeruginosa D. Staphylococcus aureus E. Streptococcus pneumoniae Answer

<7>A pastry chef cut his finger while slicing a cake. After a week, the site of the injury is warm, red, and swollen, and begins draining pus. While preparing some cream pies, he contaminates the custard with drainage from the lesion. The pies were eaten several days later by patrons of the restaurant. Within 4 hours they developed diarrhea and vomiting with no fever. Which of the following organisms would be most likely to cause these symptoms? A. Bacillus cereus B. Clostridium perfringens C. Escherichia coli D. Shigella sonnei E. Staphylococcus aureus Answer

<8>A mutation affecting the development of the diencephalon could interfere with the secretion of which of the following hormones? A. Adrenocorticotrophic hormone (ACTH) B. Epinephrine C. Oxytocin D. Prolactin E. Thyroid stimulating hormone (TSH) Answer

<9>A researcher is examining the distribution of an ion channel protein in the kidney. She incubates slices of kidney tissue in a dilute solution of a specific antibody directed against the protein, then uses the immunoperoxidase method to localize the ion channel proteins. She notes the presence of brown pigment in a population of epithelial cells, which on closer examination, have a brush border. The researcher concludes that the protein is probably present in cells of the A. collecting duct B. deep portion of loop of Henle C. distal convoluted tubule

D. E. Answer

glomerulus proximal convoluted tubule

<10>A 45-year-old homeless man has a chronic cough, a cavitary lesion of the lung, and is sputum positive for acid-fast bacilli. Which of the following is the principle form of defense by which the patient's body fights this infection? A. Antibody-mediated phagocytosis B. Cell-mediated immunity C. IgA-mediated hypersensitivity D. IgE-mediated hypersensitivity E. Neutrophil ingestion of bacteria Answer

<11>A football player is examined by the team doctor following a shoulder injury during a game. Preliminary x-rays show an inferior dislocation of the humerus. On further examination, there is weakness in lateral rotation and abduction of the arm. The nerve most likely affected is the A. axillary nerve B. dorsal scapular nerve C. radial nerve D. suprascapular nerve E. thoracodorsal nerve Answer

<12>Which of the following is specifically associated with infection with Schistosoma haematobium? A. Adenocarcinoma of the bladder B. Adenocarcinoma of the renal pelvis C. Squamous cell carcinoma of the bladder D. Transitional cell carcinoma of the bladder E. Transitional cell carcinoma of the renal pelvis Answer

<13>A couple brings in their 6-month-old child because they are concerned about the child's inability to sit without support. The physician interviews the parents and ascertains that they are both Ashkenazic Jews. The doctor should inform them that, because of their heritage, their child may have an increased risk of which of the following disorders? A. Albinism and galactosemia B. Cystic fibrosis and Lesch-Nyhan disease C. Gaucher's disease and Tay-Sachs disease D. Krabbe's disease and Niemann-Pick disease

E. Answer

Metachromatic leukodystrophy and phenylketonuria

<14>A three-year-old child is brought to the emergency room after inhaling a peanut. The peanut has lodged in the right mainstem bronchus, largely occluding it. The child is cyanotic, and non-invasive transcutaneous monitoring reveals a PO2 of 60 mm Hg. Which of the following mechanisms best accounts for the child's hypoxemia? A. Decreased capacity of pulmonary diffusion B. Decreased PO2 in inspired air C. Hypoventilation of central origin D. Hypoventilation of peripheral origin E. Inequalities of ventilation and perfusion Answer

<15>A strict vegetarian is not getting sufficient vitamin D in his diet, and he develops osteomalacia. This disease is characterized by which of the following changes in his bones? A. Decreased osteoblasts B. Increased osteoclast activity C. Increased osteoid D. Marrow fibrosis E. Sparse bony trabeculae Answer

<16>A newborn infant has multiple, hemorrhagic, cutaneous lesions and does not respond to sound. Head CT scan shows periventricular calcifications. Which of the following infectious agents is the most likely cause of this child's presentation? A. Cytomegalovirus B. Herpes simplex C. Rubella D. Syphilis E. Toxoplasmosis Answer

<17>Deficiency in which of the following usually predisposes to thrombosis rather than bleeding? A. Factor V B. Factor VIII C. Factor IX D. Factor X E. Factor XII

Answer

<18>A 30-year-old man is found to have a mass in his left anterior neck. Chest x-ray films are normal. A CT scan of the thorax and abdomen shows a hemorrhagic right adrenal mass. Serum electrolytes are remarkable for decreased calcium levels. Which of the following neoplasms is most likely responsible for the depression of calcium levels in this patient? A. Follicular thyroid carcinoma B. Hurthle cell carcinoma C. Medullary thyroid carcinoma D. Parathyroid carcinoma E. Pheochromocytoma Answer

<19>A research physiologist is performing an experiment in which he stimulates sympathetic cholinergic neurons. Which of the following responses is expected? A. Bradycardia B. Bronchoconstriction C. Diaphoresis D. Increased gastrointestinal motility E. Increased peripheral vascular resistance Answer

>20>A patient with familial hypercholesterolemia undergoes a detailed serum lipid and lipoprotein analysis. Studies demonstrate elevated cholesterol in the form of increased LDL without elevation of other lipids. This patient's hyperlipidemia is best classified as which of the following types? A. Type 1 B. Type 2a C. Type 2b D. Type 3 E. Type 5 Answer

<21>A 20-year-old woman presents to the emergency room in labor. She has had no prenatal care. The patient is noted to be very restless, with fever, profuse sweating, marked tachycardia, and a marked tremor. Over the next hour, she develops delirium, nausea, vomiting and abdominal pain between contractions. This potentially fatal condition is most likely related to which of the following thyroid diseases? A. De Quervain's thyroiditis B. Follicular carcinoma

C. D. E. Answer

Graves' disease Hashimoto's thyroiditis Papillary carcinoma

<22>A 55-year-old male with hypertension and a past medical history of myocardial infarction is prescribed atenolol. This medication will lower his blood pressure by A. blocking catecholamine release B. blocking the conversion of angiotensin I to angiotensin II C. decreasing cardiac output D. decreasing intravascular volume E. increasing renin release from the kidney Answer

<23>An endocrinologist examines a patient suspected of having Riedel thyroiditis. Which of the following findings on physical examination would best help confirm the diagnosis? A. Eyeball protrusion B. Massive soft thyroid gland C. Single large thyroid nodule D. Very tender and painful thyroid E. "Woody" thyroid gland Answer

<24>Evaluation of an infant with a variety of congenital abnormalities reveals hypocalcemia due to a lack of parathyroid hormone. On x-ray, the thymic shadow is absent. A failure of development and differentiation of which of the following embryonic structures would most likely be responsible for the observed presentation? A. Second pharyngeal arch B. Second pharyngeal cleft C. Second pharyngeal pouch D. Third pharyngeal arch E. Third pharyngeal pouch Answer

<25>During embryological development, hematopoiesis occurs in different organs at different times. Which of the following are the correct organs, in the correct sequence, at which hematopoiesis occurs embryologically? A. Amnion, yolk sac, placenta, bone marrow B. Placenta, liver and spleen, yolk sac, bone marrow C. Placenta, spleen and lymphatic organs, bone marrow D. Yolk sac, bone marrow, liver and spleen

E. Answer

Yolk sac, liver, spleen and lymphatic organs, bone marrow

<26>Which of the following hormones is secreted by anterior pituitary cells that stain with acidic dyes? A. ACTH B. FSH C. LH D. Prolactin E. TSH Answer

<27>A patient with rheumatoid arthritis mentions to her physician that after many years without dental problems, she has recently had seven dental caries filled. This finding suggests that she should be evaluated for which of the following diseases? A. Oral squamous cell carcinoma B. Polyarteritis nodosa C. Sjögren's syndrome D. Systemic lupus erythematosus E. Thyrotoxicosis Answer

28>A 14-year-old patient is brought in by his parents because of a sore throat. On physical examination, he is febrile, and has pharyngeal erythema with a tonsillar abscess. A throat culture on sheep blood agar yields colonies of gram-positive cocci that are surrounded by a zone of complete hemolysis. The organism was also plated on mannitol salt agar; it grew well and caused the medium to turn yellow. Which of the following microorganisms is the most likely cause of the patient's illness? A. Corynebacterium diphtheriae B. Haemophilus influenzae C. Staphylococcus aureus D. Streptococcus salivarius E. Streptococcus pyogenes Answer

<29>A 25-year-old man presents with a chief complaint of persistent, high-pitched ringing noises in his ears. Questioning reveals that he has also been losing his balance lately. CT of the head demonstrates bilateral tumors involving the vestibulocochlear nerve. Which of the following chromosomes contains the tumor suppressor gene most likely to be involved in this case?

A. B. C. D. E. Answer

5q 13q 17q 18q 22q

<30>A 14-year-old boy has just moved with his family from Brazil to the U.S. He starts complaining of shortness of breath and palpitations. Chest x-ray films demonstrate pulmonary congestion, and ECG shows alterations in heart rhythm. Echocardiography reveals biventricular dilatation with massive cardiac enlargement. An endomyocardial biopsy shows diffuse interstitial fibrosis, myocyte necrosis, chronic inflammation, and the presence of intracellular protozoan parasites. The patient may also develop which of the following complications? A. Achalasia B. Chronic arthritis C. Cysts in the brain D. Pleuritis E. Splenomegaly Answer

<31>A young man recently died during surgery under general anesthesia. Symptoms prior to his death included muscle spasms, hyperthermia, acidosis, and cardiac arrest. His family history is significant for his father dying under similar conditions and an aunt having survived the same complications during a hip replacement surgery. He is survived by his wife, a son, and a daughter. DNA has been isolated from family members and a Southern blot of restriction fragments from a specific region of chromosome 19 reveals the following pattern: Band Size Father Mother Daughter Son Paternal Grandfather 12 kb ___ ___ ___ 11 kb ___ 9 kb ___ ___ ___ ___ 7 kb ___ ___ ___ Which of the following conclusions can reasonably be drawn from these data? A. The 11 kb band from the father carries the probable mutation and his children will not be affected B. The 7 kb band carries the probable mutation and the son should not undergo general anesthesia with halothane C. The 9 kb band carries the probable mutation and the daughter should not receive succinylcholine as a neuromuscular relaxant D. The disease is X-linked recessive, so the daughter will not develop lifethreatening side-effects during general anesthesia E. The transmission of the disease is via mitochondrial inheritance, so the son will be unaffected Answer

<32>A 15-year-old boy is evaluated by a clinician for failure to develop normal male secondary sexual characteristics. Physical examination reveals small testes, a small penis, and gynecomastia. The boy has had some difficulties in school, and the parents say that the school psychometrist said he had an IQ of 90. This patient's condition is most likely to be related to which of the following? A. Deletion B. Nondisjunction of an autosomal chromosome C. Nondisjunction of a sex chromosome D. Non-Robertsonian translocation E. Robertsonian translocation Answer

<33>A newborn boy does not pass meconium until 48 hours after his birth . Two weeks later his mother reports that he has not been passing stool regularly. Anorectal manometry reveals increased internal anal sphincter pressure on rectal distention with a balloon. Radiographic studies revea l massive dilation of the colon proximal to the rectum. This indicates a developmental abnormality in which of the following embryonic tissues? A. Ectoderm B. Endoderm C. Neural crest D. Neural ectoderm E. Splanchnic mesoderm Answer

<34>In a genotypic male, the testes fail to develop, and do not secrete testosterone or Müllerian regression factor. Which of the following best describes the in utero reproductive system development of this individual? A. Both male- and female-type internal reproductive tracts and male-type external genitalia B. Female-type internal reproductive tract and female-type external genitalia C. Female-type internal reproductive tract and male-type external genitalia D. Male-type internal reproductive tract and female-type external genitalia E. Male-type internal reproductive tract and male-type external genitalia Answer

<35>A 2-year-old child presents to the pediatrician with hematuria. Examination reveals hypertension and an abdominal mass. A tumor is localized to the right kidney and biopsy reveals a stroma containing smooth and striated muscle, bone, cartilage, and fat, with areas of necrosis. The gene for this disorder has been localized to which of the following chromosomes? A. 5

B. C. D. E. Answer

11 13 17 22

<36>A patient develops an acute febrile illness with shivers, nonproductive cough, and pleuritic chest pain. Five days later, he presents to the emergency room after abruptly having "coughed up" nearly a cup of blood-stained sputum. Which of the following is most likely to be seen on chest x-ray? A. A cavity with a fluid level B. Blunting of diaphragmatic costal angles C. Complete opacification of one lobe with no additional findings D. Patchy consolidation centered on bronchi E. Prominent bronchi that can be followed far out into the lung fields Answer

<37>An elderly woman with a history of multiple oral ulcers presents with flaccid bullae on her scalp, face, and trunk. Manual pressure on the skin produces separation of the upper layer of the epidermis, followed by eventual sloughing of the skin. The patient has been in relatively good health until recently, and denies taking any medications. A biopsy of one of the skin lesions reveals separation of epithelial cells above the basal layer. Autoantibodies to which of the following components would most likely be found in this patient? A. Epidermal basement membrane proteins B. Glycoprotein IIb/IIIa C. Intercellular junctions of epidermal cells D. Intrinsic factor E. Type IV collagen Answer

<38>Routine physical examination of a 55-year-old man demonstrates marked finger clubbing. Radiography of the hand shows new bone formation beneath the periosteum. With which of the following disorders is this finding most strongly associated? A. Chronic renal failure B. Colon cancer C. Endocrine adenomas D. Intrathoracic cancer E. Profound anemia Answer

<39>A 32-year-old pregnant woman is told by her physician to avoid taking aspirin. Use of aspirin is contraindicated, especially during the last part of pregnancy, because aspirin affects which of the following hematologic parameters? A. Activated partial thromboplastin time B. Bleeding time C. Platelet count D. Prothrombin time E. Thromboplastin time Answer

<40>A 32-year-old, blood type A positive male receives a kidney transplant from a blood type B positive female donor with whom he had a 6-antigen HLA match. Once the kidney is anastomosed to the man's vasculature, the transplant team immediately begins to observe swelling and interstitial hemorrhage. After the surgery, the patient developed fever and leukocytosis and produced no urine. Which of the following is the most likely explanation? A. Acute rejection due to antibody-mediated immunity B. Acute rejection due to cell-mediated immunity C. Chronic rejection due to cell-mediated immunity to minor HLA antigens D. Hyperacute rejection due to lymphocyte and macrophage infiltration E. Hyperacute rejection due to preformed ABO blood group antibodies Answer

<41>A 25-year-old woman with sickle cell anemia complains of steady pain in her right upper quadrant with radiation to the right shoulder, especially after large or fatty meals. Her physician diagnoses gallstones. Of which of the following compounds are these stones most likely composed? A. Calcium bilirubinate B. Calcium oxalate C. Cholesterol D. Cholesterol and calcium bilirubinate E. Cystine Answer

<42>Which of the following developmental abnormalities might account for unexplained small intestinal bleeding? A. Central nervous system heterotopia B. Gastric heterotopia C. Pancreatic heterotopia D. Parathyroid heterotopia E. Thyroid heterotopia Answer

<43>A surgeon performs an exploratory laparotomy, producing a large incision in the patient's abdomen. Poor blood supply to which of the following is most likely to cause problems during the healing process? A. Adipose tissue B. Aponeuroses C. Loose connective tissue D. Muscle E. Skin Answer

<44>A healthy, 37-year-old, recently divorced woman loses her job at th e auto factory. She picks up her three young children from the factory day care center and gets into an automobile accident on the way home. Her 5-year-old son, who was not wearing a seat belt, sustains a severe head injury. The woman was not hurt in the accident, but is hyperventilating as she sits in the waiting room at the hospital. She complains of feeling faint and has blurred vision. Which of the following is decreased in this woman? A. Arterial oxygen content B. Arterial oxygen tension (PO2) C. Arterial pH D. Cerebral blood flow E. Cerebrovascular resistance Answer

<45>A 45-year-old male presents to the physician with muscle cramps, perioral numbness, and irritability over the past 3 to 4 months. Lab results reveal hypocalcemia, normal albumin level, and hyperphosphatemia . Parathyroid hormone level is decreased. Alkaline phosphatase level is normal. Which of the following is most likely causing this clinical scenario? A. Bone metastases B. Hashimoto's thyroiditis C. Hypervitaminosis D D. Hypomagnesemia E. Previous subtotal thyroidectomy Answer

<46>To provide anesthesia to a patient in the third stage of labor, an obstetrician palpates the ischial spine transvaginally, then injects a local anesthetic. Injection of anesthetic at this approximate location will most likely block which of the following nerves? A. Inferior gluteal nerve

B. C. D. E. Answer

Lateral femoral cutaneous nerve Obturator nerve Pudendal nerve Superior gluteal nerve

47>A 4-year-old boy presents to the emergency room with muscle spasms. His past medical history is significant for recurrent infections and neonatal seizures. Evaluation of his serum electrolytes reveals hypocalcemia. This patient would be most susceptible to which of the following diseases? A. Chickenpox B. Diphtheria C. Gas gangrene D. Gonorrhea E. Tetanus Answer

<48>A Guatemalan child with a history of meconium ileus is brought to a clinic because of a chronic cough. The mother notes a history of respiratory tract infections and bulky, foul-smelling stools. After assessment of the respiratory tract illness, the physician should also look for signs of A. cystinuria B. hypoglycemia C. iron deficiency anemia D. sphingomyelin accumulation E. vitamin A deficiency Answer

<49>During a barroom fight, a 24-year-old man is hit with a bottle on the lateral aspect of the lower leg. The man receives a deep laceration about halfway down his lower leg, in the vicinity of the fibula. Following the injury, he loses sensation over most of the dorsum of the foot. Which of the following muscles is also innervated by the nerve that was likely damaged? A. Extensor digitorum brevis B. Extensor digitorum longus C. Extensor hallucis longus D. Peroneus longus E. Peroneus tertius Answer

<50>Which of the following hormones is most important in the initiation of gallbladder contraction following a fatty meal? A. CCK

B. C. D. E. Answer

Gastrin GIP Secretin VIP

\ Answer

1The correct answer is A. Fascial straps (retinacula) and fascial coverings of muscles or muscle groups characteristically attach to nearby bones by blending with the covering periosteum. No deep attachments are usually made by fascia. Cancellous bone (choice B) is spongy bone, which is usually found in marrow, and is not the site for fascial attachment. Fascia do not usually attach to cartilage (choice C). Fascia attaches to bony shafts, or diaphyses (choice D), superficially via the periosteum. Fascia do not penetrate the bone to reach the marrow (choice E).

2The correct answer is E. Uric acid kidney stones in patients with leukemia are secondary to increased production of uric acid from purine breakdown during periods of active cell proliferation, especially following treatment. Vigorous hydration and diuresis are generally instituted after the diagnosis of acute leukemia is made. Uric acid kidney stones are also associated with inborn errors of purine metabolism, such as gout. Pigment gallstones (choice A) are associated with hemolytic disease. The incidence of this type of gallstone is not increased in treated leukemias. Cholesterol gallstones (choice B) are associated with diabetes mellitus, obesity, pregnancy, birth control pills, and celiac disease. Cystine kidney stones (choice C) are rare; they are found in cystinuria. Struvite kidney stones (choice D) are associated with infection by urea-splitting organisms, such as Proteus.

3The correct answer is A. The patient is clearly presenting with signs and symptoms of acute angle-closure glaucoma. Primary acute angle-closure glaucoma occurs because of closure of a preexisting narrow anterior chamber angle, as is commonly found in the elderly, hyperopes, and Asians. Patients often seek immediate medical attention because of the intense pain and blurred vision. The blurred vision is characteristically associated with halos around lights. The eye is often very red and steamy, and the pupil is dilated and nonreactive to light; tonometry reveals elevated intraocular pressure. The treatment considerations are as follows: immediate lowering of intraocular pressure (IOP) is achieved with a single dose of 500 mg IV acetazolamide, followed by 250 mg PO qid. Osmotic diuretics such as oral glycerol and IV urea or mannitol may also be used. Acetazolamide is an agent that inhibits the enzyme carbonic anhydrase, leading to reduced production of aqueous humor and a concomitant reduction in IOP.

Dorzolamide (choice B) is also a carbonic anhydrase inhibitor. This agent is indicated for the chronic lowering of IOP in patients with open-angle glaucoma. Epinephrine (choice C) is indicated for lowering of IOP in patients with open-angle glaucoma in combination with miotics, beta blockers, hyperosmotics, or carbonic anhydrase inhibitors. However, this agent is contraindicated in patients with narrow-angle glaucoma. Latanoprost (choice D) is a prostaglandin F2 analog that is believed to reduce IOP by increasing the outflow of aqueous humor. It is indicated for lowering IOP in patients with open-angle glaucoma and ocular hypertension who are intolerant to other agents. Timolol (choice E) is a beta adrenergic receptor antagonist that has peak ocular hypotensive effects at 1-2 hours post-dosing. This agent decreases IOP with little or no effect on pupil size or accommodation. It is indicated for chronic lowering of IOP in patients with open-angle glaucoma. 4The correct answer is D. Wernicke-Korsakoff syndrome refers to the constellation of neurologic symptoms caused by thiamine deficiency. Among these, a severe memory deficit, which the patient may attempt to cover by making up bizarre explanations (confabulation), is prominent. Anatomical damage to the mamillary bodies and periventricular structures has been postulated as the cause. In the U.S., severe thiamine deficiency is seen most commonly in chronic alcoholics. Thiamine deficiency can also damage peripheral nerves ("dry" beriberi) and the heart ("wet" beriberi). Folic acid deficiency (choice A) produces megaloblastic anemia without neurologic symptoms. Niacin deficiency (choice B) produces pellagra, characterized by depigmenting dermatitis, chronic diarrhea, and anemia. Riboflavin deficiency (choice C) produces ariboflavinosis, characterized by glossitis, corneal opacities, dermatitis, and erythroid hyperplasia. Vitamin B12 deficiency (choice E) produces megaloblastic anemia accompanied by degeneration of the posterolateral spinal cord.

5The correct answer is C. The secretion of estrogen by the developing follicle can best be explained using the "two cell" hypothesis. Theca cells are stimulated by LH (theca cells express LH receptors prior to formation of the corpus luteum, choice D) to secrete the androgens androstenedione and testosterone. The androgens then diffuse into the granulosa cells, where they are aromatized to estrogens. Hence, theca cells express side-chain cleavage enzyme (first step in steroidogenesis) prior to the formation of the corpus luteum (choice E). FSH stimulates aromatase activity in the granulosa cells (receptors for FSH and aromatase enzyme are present prior to the formation of the corpus luteum, choices A and B). The granulosa cells apparently have the ability to produce steroids (progesterone), but lack 17ahydroxylase activity and cannot synthesize estrogen themselves. Only as the follicle approaches ovulation do LH receptors begin to be expressed by the granulosa cells. Estrogen and FSH probably are responsible for the change. After ovulation, the scar of the follicle undergoes luteinization. The theca cells decrease 17a-hydroxylase activity and secrete more progesterone. The granulosa cells decrease aromatase activity and also secrete more progesterone. 6The correct answer is B. Although it is far better to rely on microbiology lab results than physical exam and history, some classic clues for an infection with Klebsiella pneumoniae are a patient who is an elderly alcoholic or diabetic, "currant-jelly" sputum (containing blood clots), and lobar pneumonia. Hemophilus influenzae (choice A) is a frequent cause of community-acquired pneumonia, but does not classically produce lobar pneumonia or currant-jelly sputum.

Pseudomonas aeruginosa (choice C) classically produces greenish sputum, and is associated with cystic fibrosis rather than alcoholism. Staphylococcus aureus (choice D) often produces pulmonary abscess, but may also produce an ordinary bronchopneumonia. Streptococcus pneumoniae (choice E) is a classic cause of lobar pneumonia, but does not produce currant-jelly sputum or show a particular predilection for alcoholics. 7The correct answer is E. The chef had a staphylococcal abscess on his finger. S. aureus, produces enterotoxin A, which was likely present in the cream pies. When ingested, the toxin causes severe nausea and vomiting within a few hours (the average incubation time is 3-6 hours). There is little diarrhea associated with this type of food poisoning outbreak. Bacillus cereus (choice A) is a gram-positive spore-forming rod that is associated with food poisoning outbreaks following the ingestion of fried rice. The time of onset and symptoms would mimic staphylococcal disease; the major differentiating feature is the food involved. The organism survives the boiling of the rice because it is a spore-former. It germinates as the rice cools, grows, and elaborates an enterotoxin that is responsible for the nausea and vomiting characteristic of the disease. Clostridium perfringens (choice B) is a gram-positive spore-forming anaerobe that can cause a longer incubation (18-24 hour) food poisoning, typically with marked diarrhea. Once again, the spores allow the organism to survive the heating process used in the preparation of the food. Both Clostridium perfringens and Clostridium botulinum are associated with homecanned vegetable and sausages. The symptoms of Escherichia coli (choice C) food poisoning are usually watery diarrhea (traveler's diarrhea) with minimal nausea and vomiting, or a bloody diarrhea caused by enteroinvasive strains of the agent. Also, E. coli would be an unlikely cause of the primary infection in the chef. Shigella sonnei (choice D) causes enterocolitis characterized by fever, cramps, and diarrhea after an incubation period of one to four days. Transmission is fecal-oral, associated with poor hygiene. A wide range of foods has been implicated. 8The correct answer is C. The neurohypophysis (posterior pituitary) is derived from an evagination of diencephalic neurectoderm. This structure is responsible for releasing oxytocin and vasopressin to the general circulation. Both hormones are synthesized in cell bodies contained within the hypothalamus. ACTH (choice A), prolactin (choice D), and TSH (choice E) are all synthesized and released by the anterior pituitary, or adenohypophysis, which is derived from an evagination of the ectoderm of Rathke's pouch, a diverticulum of the primitive mouth. Remnants of this pouch may give rise to a craniopharyngioma in later life. Epinephrine (choice B) is synthesized and released into the circulation by the adrenal medulla, a neural crest derivative. 9The correct answer is E. The immunoperoxidase method uses horseradish peroxidase to produce a visible pigment when a specific antibody binds to antigenic sites in the tissue. Binding of the antibody to the epithelial cells indicates that the protein in question is being expressed by those cells. The positive immunoperoxidase results obtained here suggests that the channel protein is expressed in proximal convoluted tubular epithelium, since this is the only site in the kidney at which the epithelial cells have a "brush border." The brush border is made of microvilli, which enhance the proximal tubules' ability to reabsorb plasma constituents filtered at the glomeruli. 10The correct answer is B. The principle host defense in mycobacterial infections (such as this patient's tuberculosis) is cell-mediated immunity, which causes formation of granulomas.

Unfortunately, in tuberculosis and in many other infectious diseases characterized by granuloma formation, the organisms may persist intracellularly for years in the granulomas, only to be a source of activation of the infection up to decades later. While antibody-mediated phagocytosis (choice A) is a major host defense against many bacteria, it is not the principle defense against Mycobacteria. IgA-mediated hypersensitivity (choice C) is not involved in the body's defense against Mycobacteria. IgE-mediated hypersensitivity (choice D) is not involved in the body's defense against Mycobacteria. It is important in allergic reactions. Neutrophil ingestion of bacteria (choice E) is a major host defense against bacteria, but is not the principle defense against Mycobacteria. 11The correct answer is A. Because of the proximity of the axillary nerve to the glenohumeral joint, a fracture of the surgical neck of the humerus or an inferior dislocation of the humerus could damage the nerve. The axillary nerve innervates the deltoid muscle. The deltoid abducts, adducts, flexes, extends, and rotates the arm medially. The axillary nerve also innervates the teres minor, which rotates the arm laterally. The dorsal scapular nerve (choice B) innervates both the rhomboid major and minor. These muscles raise the medial border of the scapula upward and laterally. The radial nerve (choice C) innervates muscles involved in the movement of the forearm and hand. The suprascapular nerve (choice D) innervates the supraspinatus and infraspinatus. The supraspinatus abducts the arm, while the infraspinatus rotates the arm laterally. This nerve travels along the posterior aspect of the scapula and would not easily be subjected to injury in a dislocation of the shoulder joint. The thoracodorsal nerve (choice E) innervates the latissimus dorsi, which adducts, extends, and rotates the arm medially. 12The correct answer is C. Carcinomas of the bladder and renal pelvis are usually transitional cell (choices D and E) carcinomas. However, Schistosoma haematobium infection (where Schistosomes lay eggs in the veins near the bladder, thereby inducing a marked inflammatory response) is associated with squamous metaplasia and squamous cell carcinoma of the bladder. Some authors have suggested that medications used to kill the worms may contribute to the etiology. Adenocarcinomas of the renal pelvis and bladder (choices A and B) are rare 13The correct answer is C. You should associate Ashkenazic (Eastern European) Jews with two diseases: Tay-Sachs disease and Type I Gaucher's disease. Both of these diseases are sphingolipidoses. Tay-Sachs disease is the more devastating of the two, and is characterized by progressive neurologic (including visual) deterioration beginning at about 6 months of age and leading to death by age 3. In contrast, Type I Gaucher's disease is compatible with a normal life span and causes hepatosplenomegaly with CNS involvement. (The infantile Type II and the juvenile Type III forms cause more serious disease but are not seen with increased incidence in Ashkenazic Jews.) None of the other conditions listed occur with greater frequency in Ashkenazic Jews. In this case, also note that many perfectly normal children cannot sit without support at 6 months of age, so the child may well be healthy. 14The correct answer is E. Inequalities of ventilation and perfusion contribute to hypoxia in many settings. In this case, blood goes to both lungs (perfusion), but air is prevented from entering one of the lungs (ventilation). Because the right lung is being perfused, but not ventilated, hypoxemia ensues when the deoxygenated blood from the right lung mixes with oxygenated blood from the left lung. If the inadequate ventilation of the lung persists long enough, the lung tissue itself can be damaged, causing a secondary local dilation of arterioles,

making the problem even worse. Peanuts are notorious for producing this type of problem in young children because of their size and shape, which allows them to lodge in the trachea or main bronchus after aspiration. Decreased diffusion capacity (choice A) can occur when the blood-gas barrier is thickened (e.g., diffuse interstitial fibrosis, sarcoidosis, asbestosis, respiratory distress syndrome), when the surface area of the blood-gas barrier is reduced (e.g., pneumonectomy, emphysema), or when less hemoglobin is available to carry oxygen (e.g., anemia, pulmonary embolism). Decreased PO2 in inspired air (choice B) is seen at high altitudes and when the settings are wrong during artificial ventilation. Hypoventilation of central origin (choice C) is seen in morphine and barbiturate overdose. Hypoventilation of peripheral origin (choice D) is seen in poliomyelitis and chest trauma. 15The correct answer is C. The hallmark of osteomalacia is widened osteoid seams. Although the trabeculae are normal in number and size, they do not mineralize effectively, and the rim of uncalcified osteoid is much larger than normal. Osteoclast activity is normal in osteomalacia. Increased osteoclast activity (choice B) is typical of hyperparathyroidism and Paget's disease of bone. There are increased numbers of osteoblasts in osteomalacia (compare to choice A), which lay down increased quantities of osteoid in an effort to strengthen the bone. Unfortunately, the increased osteoid is not mineralized and the bone remains soft and weak. The bone marrow space is normal in osteomalacia. Marrow fibrosis (choice D) is more typical of hematopoietic disorders, although hyperparathyroidism may also lead to bone marrow fibrosis. Although poorly mineralized, the bony trabeculae are of normal abundance in osteomalacia. Sparse trabeculae (choice E) is characteristic of osteoporosis 16The correct answer is A. The infectious agents listed are all important causes of congenital disease. The triad of cutaneous hemorrhages ("blueberry muffin baby"), deafness, and periventricular CNS calcifications suggests congenital CMV infection, the most common cause of intrauterine fetal viral infection. Other manifestations include microcephaly and hepatosplenomegaly. Neonatal herpes (choice B) may be congenital, but more commonly is acquired during vaginal delivery. The infection is characterized by vesicles on the skin and mucous membranes, encephalitis, or disseminated disease. Congenital rubella (choice C) can cause mental retardation, heart abnormalities, blindness, encephalitis, and motor abnormalities. Congenital syphilis (choice D) can cause death in utero, or a variety of problems including abnormal teeth, bones, and central nervous system. Toxoplasmosis (choice E) can be either acquired during delivery (mild) or congenital (severe). Severe infections can cause stillbirth, chorioretinitis, intracerebral calcifications, and hydro- or microcephaly. 17The correct answer is E. Factor XII is unusual among coagulation factors in that its deficiency is associated with thrombosis rather than hemorrhage. The mechanism appears to be a deficient activation of fibrinolysis, and both thrombophlebitis and myocardial infarction have occurred in severely affected patients. The condition is inherited in an autosomal recessive manner. Many patients with mild-to-moderate factor XII deficiency are never detected; others are identified when a routine preoperative clotting screen demonstrates a greatly prolonged partial thromboplastin time. Deficiency of each of the other factors (choices A, B, C, and D) is associated with hemorrhage.

18The correct answer is C. Medullary thyroid carcinoma is a tumor that arises from the parafollicular or "C" cells of the parathyroid gland. These are the cells that release the calcium-lowering hormone, calcitonin. This tumor either is associated with multiple endocrine neoplasia syndrome (MEN) 2a and 2b or can be sporadic. Familial syndromeassociated tumors tend to occur in younger patients like this one. Pheochromocytoma is also associated with MEN 2a and 2b, accounting for the adrenal mass on CT scan. Follicular thyroid carcinoma (choice A) arises from the follicular cells of the thyroid. These cells normally produce thyroid hormone, but the neoplastic cells do not, so there is no hormonal syndrome. The clinical symptoms of follicular carcinoma usually involve neck mass, compression, or metastasis symptoms. Hurthle cell carcinoma (choice B) is considered by some to be a variant of follicular thyroid carcinoma. The follicular cells undergo acidophilic metaplasia and appear to have abundant pink cytoplasm due to mitochondrial packing in the cytoplasm. There are no hormonal changes associated with Hurthle cells. Parathyroid carcinoma (choice D) is a rare neoplasm involving the chief cells of the parathyroid gland. These cells produce parathyroid hormone, which increases serum calcium. Patients usually present with a palpable anterior neck mass and very high serum calcium levels. Pheochromocytoma (choice E) arises from the neuroendocrine cells of the adrenal medulla, which are related to sympathetic ganglia. Pheochromocytoma is mainly sporadic, but 10% to 20% are associated with MEN 2a and 2b. Patients usually present with hypertension due to excessive catecholamine secretion. 19The correct answer is C. The vast majority of sweat glands in the body are innervated by sympathetic cholinergic neurons. Sympathetic cholinergic neurons are sympathetic postganglionic neurons that happen to release acetylcholine instead of norepinephrine. Bradycardia (choice A), bronchoconstriction (choice B), and increased gastrointestinal motility (choice D) would all result from stimulating parasympathetic cholinergic neurons. Increased peripheral vascular resistance (choice E) would result from stimulating sympathetic adrenergic neurons. 20The correct answer is B. Hyperlipidemia has been subclassified based on the lipid and lipoprotein profiles. Type 2a, which this patient has, can be seen in a hereditary form, known as familial hypercholesterolemia, and also in secondary, acquired forms related to nephritic syndrome and hyperthyroidism. The root problem appears to be a deficiency of LDL receptors, which leads to a specific elevation of cholesterol in the form of increased LDL. Heterozygotes for the hereditary form generally develop cardiovascular disease from 30 to 50 years of age. Homozygotes may have cardiovascular disease in childhood. Type 1 (choice A) is characterized by isolated elevation of chylomicrons. Type 2b (choice C) is characterized by elevations of both cholesterol and triglycerides in the form of LDL and VLDL. Type 3 (choice D) is characterized by elevations of triglycerides and cholesterol in the form of chylomicron remnants and IDL. Type 5 (choice E) is characterized by elevations of triglycerides and cholesterol in the form of VLDL and chylomicrons. 21The correct answer is C. The patient is experiencing a thyrotoxic crisis, which occurs most commonly in patients with untreated or inadequately treated Graves' disease. The onset is typically abrupt and may be precipitated by stressors that can include infection, trauma, radio-iodine treatment, and childbirth. The condition, if unrecognized, may progress to congestive cardiac failure, pulmonary edema, and death.

De Quervain's thyroiditis (choice A), also known as subacute granulomatous thyroiditis, can produce transient hyperthyroidism, but does not usually produce a thyrotoxic crisis. Both follicular (choice B) and papillary (choice E) carcinomas of the thyroid gland are usually non-secretory and consequently do not produce hyperthyroidism. Hashimoto's thyroiditis (choice D) is an autoimmune thyroiditis that may transiently produce hyperthyroidism before producing hypothyroidism, but thyrotoxic crisis is not usually a feature. 22The correct answer is C. Atenolol is a beta-adrenergic receptor blocking agent used in the treatment of hypertension. Medications in this drug class lower blood pressure by reducing both cardiac output (choice C) and decreasing renin release from the kidney (to a lesser extent). Blocking catecholamine release from peripheral sympathetic nerves (choice A) is the antihypertensive effect seen with peripherally acting adrenergic neuron blockers (e.g., guanethidine and bretylium). Angiotensin converting enzyme (ACE) inhibitors block the conversion of angiotensin I to angiotensin II (choice B). Diuretics decrease intravascular volume (choice D), which ultimately leads to a reduction in blood pressure. Increasing renin release from the kidney (choice E) would increase, not decrease, blood pressure. 23The correct answer is E. Riedel thyroiditis, also called ligneous (rocklike) stroma, is a rare form of chronic thyroiditis characterized microscopically by a marked fibrous reaction that destroys most or all of the thyroid gland and may involve adjacent structures. The etiology is unknown. Clinically, this disease tends to affect middle-aged and older, mostly female patients and causes the thyroid to have a firm "woody" texture. It may be clinically mistaken for a neck malignancy and can cause symptoms of stridor, dyspnea, dysphasia, laryngeal nerve paralysis, or hypothyroidism. Eyeball protrusion (choice A) suggests the hyperthyroidism of Graves disease. A massive, soft thyroid gland (choice B) suggests multinodular goiter. A single large thyroid nodule (choice C) could be due to either a thyroid adenoma or thyroid cancer. A very tender and painful thyroid (choice D) suggests subacute granulomatous (de Quervain) thyroiditis. 24The correct answer is E. The third pharyngeal pouch normally gives rise to the inferior parathyroid glands and the thymus. Cells from these pouches migrate caudally in the embryo to the eventual location of these organs. The superior parathyroid glands are derived from the fourth pharyngeal pouch. The absence of these organs is found in DiGeorge syndrome, which typically presents with immunodeficiency and hypoparathyroidism. The second pharyngeal arch (choice A) gives rise to several skeletal and muscular structures. These include the stapes, styloid process, stylohyoid ligament, a portion of the hyoid bone, the stapedius muscle, stylohyoid muscle, posterior digastric muscle, and all of the muscles of facial expression. The second pharyngeal cleft (choice B) is normally obliterated. A persistence of this cleft may result in a lateral cervical cyst, sinus, or fistula. The second pharyngeal pouch (choice C) gives rise to the tonsillar fossa and the palatine tonsils. The third pharyngeal arch (choice D) gives rise to most of the hyoid bone and the stylopharyngeus muscle. The third aortic arch, which passes through the third pharyngeal arch, gives rise to the common carotid artery and the internal carotid artery.

25The correct answer is E. By the third week of development, hematopoiesis begins in the blood islands of the yolk sac. Beginning at 1 month of age and continuing until 7 months of age, blood elements are also formed in the liver. Hematopoiesis occurs in the spleen and lymphatic organs between 2 and 4 months, and in the bone marrow after 4 months. 26The correct answer is D. The cells of the anterior pituitary can be classified as chromophils (love dyes) or chromophobes (do not stain with dyes). The chromophils can be further divided into acidophils (stain with acidic dyes) and basophils (stain with basic dyes). The acidophils include the somatotropes, which secrete growth hormone, and the mammotropes, which secrete prolactin. The basophils include the corticotropes, which secrete ACTH (choice A), the gonadotropes, which secrete FSH and LH (choices B and C), and the thyrotropes, which secrete TSH (choice E). 27The correct answer is C. Rheumatoid arthritis can coexist with a variety of autoimmune diseases (including those listed in the answers), but is most frequently associated with Sjögren's syndrome. Sjögren's syndrome classically presents with keratoconjunctivitis (dry eyes) and xerostomia (dry mouth, often resulting in dental caries and fissures in the oral mucosa). These symptoms are due to autoimmune involvement with subsequent scarring of the salivary and lacrimal glands. Parotid gland enlargement is common, as is vasculitis, Raynaud's phenomenon, hyperviscosity syndrome, and peripheral neuropathy. The development of oral squamous cell carcinoma (choice A) is not related to the presence of dental caries. Polyarteritis nodosa (choice B) is a systemic necrotizing vasculitis. Patients typically present with low-grade fever, weakness, and weight loss. Abdominal pain, hematuria, renal failure, hypertension, and leukocytosis may occur. Systemic lupus erythematosus (choice D) is an autoimmune disease characterized by vasculitis, rash, renal disease, hemolytic anemia, and neurologic disturbances. Thyrotoxicosis (choice E) is not related to the development of dental caries

28>The correct answer is C. The description of the agent is consistent with a staphylococcal organism (catalase-positive, gram-positive cocci that grows on mannitol salt agar. The organism is most likely S. aureus, as it was able to ferment mannitol (as evidenced by the color change in the mannitol salt agar after incubation) and was beta-hemolytic. Other characteristics of this organism are coagulase production and excretion of DNAse from colonies. Staphylococcal organisms are also notorious for formation of abscesses; the patient had an abscess in the tonsillar region. The diphtheria bacilli (Corynebacterium diphtheriae; choice A) are gram-positive, pleomorphic rods that are arranged in palisades. They are non-hemolytic and would not grow on mannitol salt agar. These organisms produce a whitish-gray pseudomembrane on the pharynx or the larynx; constitutional symptoms from toxemia are the major features of diphtheria. Epiglottitis is the most common disease of the upper respiratory tract produced by Haemophilus influenzae (choice B), a gram-negative, encapsulated rod. It is also a common cause of otitis media in children and may cause bronchitis, bronchiolitis, and pneumonia in adults. Streptococcus salivarius (choice D) is a gram-positive coccus that is usually alpha-hemolytic. It is normal flora of the oral cavity and is sometimes implicated in subacute bacterial endocarditis, but is not associated with tonsillar abscesses. Streptococcus pyogenes (choice E) is a beta-hemolytic, gram-positive coccus that grows in chains, as opposed to the random, grape-like clusters of the staphylococci. These organisms

are the most common cause of pharyngitis, which is usually manifested by severe sore throat, fever, a beefy red pharynx, and a tonsillar exudate.

29The correct answer is E. The patient has bilateral acoustic neuromas, probably due to neurofibromatosis type II (over 90% of patients with NF-2 develop bilateral acoustic neuromas). This condition is a associated with the NF-2, gene, located on 22q (note all the 2's). Patients often develop meningiomas, gliomas, and schwannomas of cranial and spinal nerves. 5q (choice A) contains the APC tumor suppressor gene, which is associated with familial and sporadic colorectal cancers. 13q (choice B) contains the Rb tumor suppressor gene, which is associated with retinoblastoma and osteosarcoma. 17q (choice C) contains both the NF-1 tumor suppressor gene, which is associated with neurofibromatosis type I, and the p53 tumor suppressor gene, associated with many human cancers. 18q (choice D) contains both the DCC gene, which is associated with colon and gastric carcinomas and the DPC gene, associated with pancreatic cancer.

30The correct answer is A. The patient has myocarditis due to Trypanosoma cruzi. This infectious condition, known as Chagas disease, is endemic in vast areas of South America and is transmitted from person to person by triatomids known as "kissing bugs." Experts assess the number of persons with Chagas disease at about 7 million with about 35 million at risk in South America. T. cruzi is an intracellular protozoon that localizes mainly in the heart and nerve cells of the myenteric plexus, leading to myocarditis and dysmotility of hollow organs, such the esophagus, colon, and ureter. Cardiac involvement manifests with ventricular dilatation and congestive heart failure secondary to myocyte necrosis and fibrosis. Intracellular parasites can be visualized in tissue sections. Chagas disease is a cause of acquired achalasia, in which the distal third of the esophagus dilates because of loss of its intrinsic innervation. A similar pathologic mechanism accounts for megacolon and megaureter in Chagas disease. The remaining choices refer to different infectious conditions that may also involve the myocardium: Chronic arthritis (choice B) is a manifestation of the chronic stage of Lyme disease, which is caused by Borrelia burgdorferi and is transmitted to humans by deer ticks. Skin, CNS, and heart are the main targets of this infection. Cysts in the brain (cysticerci) (choice C) may develop as a consequence of infestation by the tapeworm Taenia solium. Humans acquire this parasite by ingesting the eggs from undercooked pork. Cysticercosis may also affect the heart, skeletal muscle, and skin. Group B coxsackievirus infections cause pleuritis (choice D) and myocarditis, manifesting with fever, chest pain, and, if myocarditis is severe, congestive heart failure. As in any form of viral myocarditis, the myocardium is infiltrated by lymphocytes, but there are no morphologic markers specific for Coxsackievirus infection. Splenomegaly (choice E), often of massive proportions, is seen in patients with malaria. Plasmodium organisms can also invade the myocardium, leading to myocarditis.

31The correct answer is B. The history suggests an autosomal dominant disorder (the father died, the grandfather and an aunt suffered similar conditions). Limited information through 3 generations shows no skipping of generations (dominance), and a affected female confirms the autosomal transmission. The symptoms of hyperthermia, muscle spasm, autonomic and electrolyte disturbances during general anesthesia, and the pedigree argue for a diagnosis of malignant hyperthermia. In this disorder, a mutation in the ryanodine receptor-gated calcium channel of the sarcoplasmic reticulum of skeletal muscle leads to increased sensitivity to halothane and depolarizing agents. In an autosomal dominant pattern, one defective allele is sufficient to develop the trait. The father can pass on an 11 kb, a 9 kb or a 7 kb band to his children, whereas the mother can pass on a 12 kb or a 9 kb band. The DNA pattern of the father and grandfather can be compared, and the likely restriction fragment involved in the inheritance ofmalignant hyperthermia is the 7 kb band. The 11 kb band from the father (choice A) does not carry the defective allele, since the grandfather did not share that same banding pattern: the only similarity between the father and his own father is the 7 kb band. However, if the statement had been true, then his children would not have a risk of malignant hyperthermia, because they do not carry the allele. The 9 kb band does not appear to carry the defective allele (choice C), however, if it did, the daughter would have a major risk of developing malignant hyperthermia when succinylcholine was used as a neuromuscular blocking agent, because it is a depolarizing drug. The disease is not X-linked recessive (choice D) because an aunt had a similar problem, but was resuscitated. If it were X-linked, only males would be affected, so the daughter would not be affected. Mitochondrial inheritance (choice E) would be inconsistent with the observed transmission of the defective allele from males to their offspring. 32The correct answer is C. The boy probably has Klinefelter's syndrome (47, XXY), which has the typical presentation described in the question. The condition arises as a result of failure of separation (nondisjunction) of the sex chromosomes, and can be related to either paternal nondisjunction (slightly more common) or maternal nondisjunction. Deletions (choice A) are a common form of genetic disease and contribute to many genetic recessive diseases. Examples of nondisjunction of autosomes (choice B) include trisomies such as most cases of Down's syndrome (trisomy 21), Edwards' syndrome (trisomy 18), and Patau syndrome (trisomy 13). There are two types of translocations: non-Robertsonian (choice D) and Robertsonian (choice E). Non-Robertsonian (reciprocal) translocations result when two non-homologous chromosomes exchange genetic material. Robertsonian translocations are a special type of translocation that involve exchange of genetic material from the long arms of one acrocentric chromosome to the long arms of another acrocentric chromosome, with fusion of the centromeres. Four percent of cases of Down's syndrome are caused by this mechanism. 33The correct answer is C. The baby has Hirschsprung's disease, which is due to an absence of ganglion cells in the wall of the colon. Neural crest cells contribute to the formation of many adult structures. Among these are all of the postganglionic neurons of the autonomic nervous system and the sensory neurons of the peripheral nervous system. Ectoderm (choice A) forms the epidermis of the skin and the parenchymal cells of glands associated with the skin such as the sweat glands, sebaceous glands, and mammary glands. Endoderm (choice B) forms the epithelial lining of the gut tube and the parenchymal cells of glands associated with the gut tube, such as the liver and pancreas.

Neural ectoderm (choice D) forms the central nervous system, the somatic motor neurons of the peripheral nervous system, and the preganglionic neurons of the autonomic nervous system. Splanchnic mesoderm (choice E) forms the visceral peritoneum, visceral pleura, visceral pericardium, and the stroma and muscle of the wall of the gut, among other structures. 34The correct answer is B. The description is that of gonadal dysgenesis. In the absence of testosterone, the Wolffian ducts will regress and fail to differentiate into normal male internal reproductive tracts. In the absence of Müllerian regression factor, the Müllerian ducts will automatically differentiate into oviducts and a uterus. Differentiation of the male external genitals is dependent on adequate dihydrotestosterone (via an action of 5 a-reductase on testosterone). In the absence of testosterone, female-type external genitalia will develop. Selective dysgenesis of the Sertoli cells could produce the situation described in choice A. Normal Leydig cells would secrete testosterone and produce normal male-type internal and external tracts. However, the absence of Müllerian regression factor, which is secreted by the Sertoli cells, would allow formation of female-type internal structures as well. Female-type internal reproductive tract and male-type external genitalia (choice C) would not be likely to occur under any circumstances. The situation described in choice D could occur with 5 a-reductase deficiency. Normal maletype internal tracts can form because there is no requirement for dihydrotestosterone. Müllerian regression factor will prevent differentiation of female-type internal tracts. Since differentiation of the normal male external genitals requires dihydrotestosterone, 5 areductase deficiency will lead to feminization. The situation described in choice E is normal, and would not occur in the individual described who has testicular dysgenesis. 35The correct answer is B. This is a tough two-step style question. You first needed to make the diagnosis, and then you needed to recall the localization of this particular disease to a specific chromosome. In this case, everything in the vignette leads you to a diagnosis of Wilms' tumor. Wilms' tumor occurs in children and typically presents with an abdominal mass as well as with hypertension, hematuria, nausea, and intestinal obstruction. Because the tumor is derived from mesonephric mesoderm, it can include mesodermal derivatives such as bone, cartilage, and muscle. The Wilms' tumor suppressor gene (WT-1) has been localized to chromosome 11 (11p). The remaining answer choices provide us the opportunity to discuss some other known relationships between genes and disease. This is a topic of intense research that is likely to become more and more emphasized on the USMLE examinations. Chromosome 5 (choice A) is the site of the tumor suppressor gene APC, which is involved in the pathogenesis of colon cancer and familial adenomatous polyposis. Chromosome 13 (choice C) is the site of the tumor suppressor gene for retinoblastoma and osteosarcoma (Rb) as well as the BRCA-2 gene for breast cancer. Chromosome 17 (choice D) is the site of p53 (involved in most human cancers), NF-1 (neurofibromatosis type I), and BRCA-1 (breast and ovarian cancer). Chromosome 22 (choice E) is home to the NF-2 gene, which is involved in neurofibromatosis type II. 36The correct answer is A. This is a classic presentation of a pulmonary abscess. Chronic courses with less severe symptoms (with intermittent improvement following short courses of antibiotics) are also sometimes seen, particularly if the diagnosis was not suspected. Chest xray typically shows pneumonic opacification in which a cavity, often with a fluid level, is visible. Pulmonic abscesses can be caused by anaerobes (most common, particularly if aspiration initiated the abscess), gram-negative aerobic bacilli, and Staphylococci. Therapy is

based on the organisms isolated, and should be continued for at least 4 to 6 weeks. In cases that fail to resolve, the possibility of coexisting carcinoma should be considered. Choice B is the x-ray appearance of pleural effusion. Choice C is the x-ray appearance of lobar pneumonia. Choice D is the x-ray appearance of bronchopneumonia. Choice E is the x-ray appearance of bronchiectasis. 37The correct answer is C. Bullae with the cleavage plane above the basal layer of the epidermis suggests pemphigus vulgaris, which is caused by autoantibodies to intercellular junctions of epidermal cells. The autoantibodies decrease the ability of the keratinocytes to adhere to one another, permitting formation of vesicles and bullae. Oral involvement is common, and often precedes the characteristic skin lesions. Separation of the epidermis upon manual stroking of the skin is known as Nikolsky's sign. This sign is present in other disorders such as Stevens-Johnson syndrome, but we are told the woman is not taking any medications, a typical cause of Stevens-Johnson syndrome in the adult population. Antibodies to epidermal basement membrane proteins (choice A) are seen in bullous pemphigoid, which is a bullous disease characterized by blisters with a cleavage line between the epidermis and dermis. Antibodies to glycoprotein IIb/IIIa (choice B) are seen in autoimmune thrombocytopenic purpura. Antibodies to intrinsic factor (choice D) are seen in pernicious anemia. Antibodies to Type IV collagen (choice E) are seen in Goodpasture's syndrome 38The correct answer is D. Enlargement of the distal segments of the fingers and toes due to proliferation of connective tissue is known as clubbing. Clubbing may be associated with lung cancer, mesothelioma, bronchiectasis, and hepatic cirrhosis. In these conditions, the clubbing is accompanied by formation of new subperiosteal bone (hypertrophic osteoarthropathy). Chronic renal failure (choice A) causes renal osteodystrophy, which may manifest as a combination of osteitis fibrosa cystica and osteomalacia. Multiple exostoses are sometimes associated with multiple colonic polyps and colon cancer (choice B) in Gardner's syndrome. A variety of endocrine adenomas (choice C) can be seen in polyostotic fibrous dysplasia. Profound anemia (choice E) can be seen in diseases that destroy the marrow, such as osteopetrosis. 39The correct answer is B. Aspirin irreversibly acetylates platelet cyclooxygenase, thereby inactivating this enzyme and preventing the production of thromboxane A2. In this manner, aspirin therapy interferes with secondary aggregation. The result is a prolonged bleeding time related to platelet dysfunction rather than to dysfunction of the coagulation process, as would be implied by prolongation of the activated partial thromboplastin time (choice A), prothrombin time (choice D), or thromboplastin time (choice E). The platelet count (choice C) is not affected by aspirin. 40The correct answer is E. The patient is suffering from hyperacute rejection due to the preformed anti-B ABO blood group antibody found in all type A positive individuals. Hyperacute rejection occurs within minutes to a few hours of the time of transplantation, and is due to the destruction of the transplanted tissue by preformed antibodies reacting with antigens found on the transplanted tissue that activate complement and destroy the target tissue. Preformed antibodies can also be due to presensitization to a previous graft, blood transfusion, or pregnancy.

Acute rejection due to antibody-mediated immunity (choice A) is incorrect because this patient suffered from hyperacute rejection (immediate) occurring within minutes to hours, rather than days. Acute rejection due to cell-mediated immunity (choice B) will not occur until several days or a week following transplantation. Acute rejection is due to type II and type IV reactions. Chronic rejection, due to the presence of cell-mediated immunity to minor HLA antigens (choice C), occurs in allograft transplantation months to even years after the transplant. Chronic rejection is generally caused by both humoral and cell-mediated immunity. An accelerated acute rejection, occurring in 3-5 days, can be caused by tissue infiltration and destruction by presensitized T lymphocytes and macrophages (choice D) and/or antibodydependent, cell-mediated cytotoxicity (ADCC). Note that this is not a hyperacute reaction. 41The correct answer is A. Bilirubin is a degradative product of hemoglobin metabolism. Bilirubin (pigment) stones are specifically associated with excessive bilirubin production in hemolytic anemias, including sickle cell anemia. Bilirubin stones can also be seen in hepatic cirrhosis and liver fluke infestation. Calcium oxalate stones (choice B) and cystine stones (choice E) are found in the kidney, rather than the gallbladder. Pure cholesterol stones (choice C) are less common than mixed gallstones, but have the same risk factors, including obesity and multiple pregnancies. Mixed stones (choice D) are the common "garden variety" gallstones, found especially in obese, middle aged patients, with a female predominance. 42The correct answer is B. Heterotopic rests are small areas of normal tissue in abnormal sites. These are usually clinically insignificant unless they form a noticeable mass or are misdiagnosed in a biopsy (raising suspicion of metastatic cancer). One exception is a gastric heterotopia, which typically occurs in the small intestine, and can produce enough acid to cause a peptic ulcer in adjacent mucosa. The ulcer may be a source of gastrointestinal bleeding. Heterotopias of the CNS (choice A), parathyroid (choice D), and thyroid(choice E) can occur, but would not be expected in the small intestine and would not be likely to cause bleeding if present. Pancreatic heterotopia (choice C) can occur in the small intestine, but does not cause bleeding. 43The correct answer is A. Surgeons worry about their obese patients more than their skinny ones, because a thick layer of relatively poorly vascularized subcutaneous fatty tissue is both mechanically unstable (it holds stitches poorly) and heals very slowly. These patients have a frequent rate of dehiscence (tearing open of the incisional site) with subsequent, difficult-tocontrol infection (access by antibiotics, leukocytes, and serum antibodies are all hampered by the poor blood supply). Aponeuroses (choice B) are strong thickenings of muscle sheath that usually suture and heal well after surgery. Loose connective tissue (choice C) is well vascularized and surgeons do not usually worry much about it during the healing process. Muscle (choice D) usually heals well after surgery. Skin (choice E) usually heals well, unless it becomes infected. 44The correct answer is D. The key symptom is hyperventilation. Hyperventilation results in hypocapnia, alkalosis, increased cerebrovascular resistance, and decreased cerebral blood flow. Carbon dioxide plays an important role in the control of cerebral blood flow. An increase in arterial PCO2 dilates blood vessels in the brain and a decrease in PCO2 causes

vasoconstriction. The anxious, hyperventilating woman is "blowing off" carbon dioxide, which lowers her arterial PCO2. This decrease in PCO2 has caused the cerebrovascular resistance (choice E) to increase, thereby decreasing cerebral blood flow. The decrease in cerebral blood flow has caused the woman to feel faint and to have blurred vision. Other symptoms commonly associated with the hyperventilation of anxiety states are feelings of tightness in the chest and a sense of suffocation. Hyperventilation increases the arterial oxygen content (choice A) and PO2 (choice B) in a normal person. A decrease in arterial PCO2 causes the arterial pH (choice C) to increase, i.e., the patient becomes alkalotic. 45The correct answer is E. This patient is experiencing symptoms of hypocalcemia secondary to diminished parathyroid hormone (PTH) secretion. This must always be considered in a patient who undergoes total or subtotal thyroidectomy because the parathyroids are nestled in the tissue surrounding the thyroid gland. Surgical attempts to leave portions of the parathyroids intact are sometimes unsuccessful. Other causes of decreased PTH include neck irradiation, autoimmune phenomena (polyglandular autoimmune syndromes), dysembryogenesis (as in DiGeorge's syndrome), or as a result of heavy metal damage (Wilson's disease, hemosiderosis, hemochromatosis). Bone metastases (choice A) would cause hypercalcemia, as a result of osteolysis. Hashimoto's thyroiditis (choice B) is the most common cause of hypothyroidism and results in decreased thyroid hormone and elevated TSH levels. Serum calcium and PTH should be normal. Hypervitaminosis D (choice C) would cause hypercalcemia. Hypomagnesemia (choice D) may cause a functional hypoparathyroidism because magnesium is needed for PTH activity in tissue. However, in such a case, actual PTH levels would not be decreased. 46The correct answer is D. The pudendal nerve is often anesthetized to provide obstetric anesthesia (although epidural blocks are now more commonly used in preparation for delivery). The pudendal nerve arises from sacral segments 2, 3, and 4. It exits the pelvis by way of the greater sciatic foramen and then courses around the ischial spine (and sacrospinous ligament) to pass through the lesser sciatic foramen. It then runs through Alcock's canal to supply the muscles and skin of the perineal area. The inferior gluteal nerve (choice A) leaves the pelvis by passing through the greater sciatic foramen to supply the gluteus maximus muscle. The lateral femoral cutaneous nerve (choice B) courses by the anterior superior iliac spine and supplies the anterolateral skin of the thigh. The obturator nerve (choice C) passes through the obturator foramen to supply muscles and skin in the medial thigh. The superior gluteal nerve (choice E) leaves the pelvis by passing through the greater sciatic foramen to supply the gluteus medius and minimus muscles.

47>The correct answer is A. This boy has DiGeorge's syndrome, as evidenced by his tetany (muscle spasms) due to hypocalcemia and his history of recurrent infections and neonatal seizures. The syndrome occurs because of an embryonic failure in the development of the third and fourth pharyngeal pouches. Patients have both hypoplastic parathyroids (producing hypocalcemia) and thymuses (producing T-cell deficiency and recurrent infections). Since cell-mediated immunity (which depends on T cells) is important in defense against infections caused by intracellular pathogens (such as viruses), patients with DiGeorge's are particularly

susceptible to viral infections, such as chickenpox (varicella). They also have trouble with fungal pathogens (e.g., Candida) and mycobacteria. Note that the USMLE might ask you other questions about DiGeorge's syndrome, so you should be able to recognize other clues to the diagnosis, including: congenital cardiac defects, esophageal atresia, bifid uvula, short philtrum, hypertelorism, antimongoloid palpebral slant, mandibular hypoplasia, and low-set ears. Diphtheria (choice B) is caused by Corynebacterium diphtheriae, which produces disease by the elaboration of a very potent exotoxin. Therefore, humoral immunity (antitoxin), which is not usually compromised in DiGeorge's patients, is essential for defense against the organism. (Note that the C. diphtheriae exotoxin acts by causing the ADP-ribosylation of elongation factor-2 of eukaryotic cells, thereby inhibiting protein synthesis). The disease can be avoided by immunization with diphtheria toxoid. Gas gangrene (choice C) is caused by Clostridium perfringens, which produces a potent alpha toxin that injures cell membranes. Therefore, humoral immunity would again play a predominant role in defense against this organism. Note that the disease occurs in wounds and would not be expected in an uninjured 4-year-old boy. Gonorrhea (choice D) is caused by Neisseria gonorrhoeae and would not be expected in a 4year-old boy unless there was evidence of sexual abuse. Virulence factors of this organism include pili, cell wall endotoxin and outer membrane, and secretory IgA protease. Antibody responses, neutrophils, and complement are of prime importance in defense against gonococcal infections. Tetanus (choice E) is caused by Clostridium tetani and serves as a tricky distracter, as you might have quickly associated the patient's muscle spasms with this answer choice. (This is why it is important to read the question stem carefully before prematurely jumping to the responses). C. tetani, which gains entry through deep wounds, produces tetanus toxin (exotoxin) and can be prevented by immunization with tetanus toxoid.

48The correct answer is E. The child is likely suffering from cystic fibrosis. In this disorder, an abnormality of chloride channels causes all exocrine secretions to be much thicker, and more viscous than normal. Pancreatic secretion of digestive enzymes is often severely impaired, with consequent steatorrhea and deficiency of fat-soluble vitamins, including vitamin A. Cystinuria (choice A) is a relatively common disorder in which a defective transporter for dibasic amino acids (cystine, ornithine, lysine, arginine; COLA) leads to saturation of the urine with cystine, which is not very soluble in urine, and precipitates out to form stones. Hypoglycemia (choice B) is not a prominent feature of children with cystic fibrosis who are on a normal diet. Hyperglycemia may occur late in the course of the disease. Iron deficiency anemia (choice C) is not found with any regularity in children with cystic fibrosis. Sphingomyelin accumulation (choice D) is generally associated with deficiency of sphingomyelinase, as seen in Niemann-Pick disease. 49The correct answer is D. The nerve in question is the superficial peroneal nerve (also called the musculocutaneous nerve), which innervates much of the skin of the dorsum of the foot (except for the first web space innervated by the deep peroneal nerve, and the medial and lateral borders of the foot innervated by the saphenous and sural nerves, respectively). The superficial peroneal nerve is a branch of the common peroneal nerve, and also innervates the peroneus longus and peroneus brevis muscles.

All of the other muscles (choices A, B, C, and E) are innervated by the deep peroneal nerve. 50The correct answer is A. Cholecystokinin, or CCK, is synthesized in the duodenal and jejunal mucosa and stimulates gallbladder contraction and pancreatic enzyme secretion. Other functions include slowing of gastric emptying, an atrophic effect on the pancreas, and secretion of antral somatostatin, which in turn, decreases gastric acid secretion. Gastrin (choice B) prepares the stomach and small intestine for food processing, including stimulating secretion of HCl, histamine, and pepsinogen, increasing gastric blood flow, lower esophageal sphincter tone, and gastric contractions. Gastric inhibitory peptide, or GIP (choice C), stimulates pancreatic insulin secretion at physiologic doses and inhibits gastric acid secretion and gastric motility at pharmacologic doses. Secretin (choice D) stimulates secretion of bicarbonate-containing fluid from the pancreas and biliary ducts. Vasoactive intestinal polypeptide, or VIP (choice E), relaxes intestinal smooth muscle and stimulates gut secretion of water and electrolytes. (10)<1>A 68-year-old female who recently had a cholecystectomy develops a fever of 103°F and has persistent drainage from her biliary catheter. She is given cephalothin and gentamicin for 10 days. Her serum creatinine level increases to 7.6 mg/dL. Her urine output is 1.3 L/day and has not diminished over the past few days. There is no history of hypotension and her vital signs are normal. Renal ultrasonography shows no evidence of obstruction. The most likely etiology of the patient's condition is A. acute glomerulonephritis B. acute renal failure secondary to cephalothin C. gentamicin nephrotoxicity D. renal artery occlusion E. sepsis Answer

<2>A 45-year-old man presents to a physician with back pain and facial pain. Physical examination demonstrates coarse facial features and kyphosis. Laboratory examination is remarkable for elevated alkaline phosphatase . X-ray studies demonstrate skull thickening with narrowing of foramina, and bowing of the femur and tibia. Bone biopsy reveals a mosaic pattern of bone spicules with prominent osteoid seams. Which of the following neoplasms occurs at an increased frequency in patients with this disorder? A. Astrocytoma B. Hodgkin's lymphoma C. Meningioma D. Non-Hodgkin's lymphoma E. Osteosarcoma Answer

<3> Which of the labeled structures is responsible for the secretion of renin? A. A B. B C. C

D. E. Answer

D E

<4>A 42-year-old African-American man sustains severe injuries in an automobile accident and is admitted to the intensive care unit. Examination of a peripheral blood smear on the 3rd day of admission reveals helmet cells, schistocytes, and decreased platelets. Which of the following is most strongly suggested by these findings? A. Autoimmune hemolysis B. Disseminated intravascular coagulation (DIC) C. Hereditary spherocytosis D. Megaloblastic anemia E. Sickle cell anemia Answer

<5>A 12-month-old child is diagnosed with an atrial septal defect. What is the most common cause of such a congenital heart malformation? A. Failure of formation of the septum primum B. Failure of formation of the septum secundum C. Incomplete adhesion between the septum primum and septum secundum

D. E. Answer

Malformation of the membranous interventricular septum Malformation of the muscular interventricular septum

<6>A 72-year-old man with prostate cancer is treated with leuprolide. What is the mechanism of action of this drug? A. It inhibits 5a-reductase B. It is a competitive antagonist at androgen receptors C. It is a competitive inhibitor of LH D. It is a synthetic analog of GnRH E. It is a testosterone agonist Answer

<7>An XX genotypic infant is born with ambiguous genitalia. Laboratory examination reveals hypoglycemia, hyperkalemia, and salt wasting. S erum 17-OH progesterone is markedly increased. Which of the following is the most likely diagnosis? A. 5-alpha-reductase deficiency B. 11-beta-hydroxylase deficiency C. 17-alpha-hydroxylase deficiency D. 21-hydroxylase deficiency E. Complete androgen resistance Answer

<8>A 57-year-old fisherman with a history of alcoholism is hospitalized in Gulfport, Mississippi with a 1-day history of severe, watery diarrhea after eating several raw oysters. He is badly dehydrated on admission, and within 12 hours, he becomes severely hypotensive and dies. Which of the following pathogens is the most likely cause of this man's death? A. Citrobacter diversus B. Enterotoxigenic E. coli C. Providencia stuartii D. Vibrio cholerae E. Vibrio vulnificus Answer

<9>An Hispanic male is referred to the dermatology clinic of a major medical center. On physical examination, the man has several disfiguring lesions on his face and there is loss of cutaneous sensation to fine touch, pain, and temperature. An acid-fast organism is observed in scrapings from a skin lesion. Which of the following organisms is the most likely cause of this patient's disease? A. Bartonella henselae B. Listeria monocytogenes C. Mycobacterium avium-intracellulare

D. E. Answer

Mycobacterium leprae Nocardia asteroides

<10>Microscopic examination of a section of a normal young adult ovary reveals large numbers of unusually large cells surrounded by a single layer of flat epithelial cells. In which phase of the cell cycle are these cells arrested? A. Diplotene stage of the 1st meiotic division B. Diplotene stage of the 2nd meiotic division C. Metaphase stage of mitosis D. Prophase stage of mitosis E. Prophase stage of the 2nd meiotic division Answer

<11>A 3-year-old child is seen by a pediatrician because he has developed multiple isolated lesions on his face and neck. Physical examination reveals many lesions up to 4 cm in diameter with golden crusts, while in other sites small blisters and weeping areas are seen. Which of the following is the most likely diagnosis? A. Aphthous ulcers B. Erysipelas C. Herpes simplex I D. Impetigo E. Measles Answer

<12>A 2-year-old-boy is brought to the pediatrician by his mother because he has had several episodes of rectal bleeding. Evaluation with a technetium-99m perfusion scan reveals a 3-cm ileal outpouching located 60 cm from the ileocecal valve. This structure likely contains which of the following types of ectopic tissue? A. Duodenal B. Esophageal C. Gastric D. Hepatic E. Jejunal Answer

<13>A 19-year-old college student presents to the student health clinic complaining of weakness, malaise, and a chronic cough. He has a fever of 100 degrees F and a dry cough; no sputum can be obtained for laboratory analysis, so a bronchial lavage is performed and the washings are submitted to the laboratory. The laboratory reports that the organism

is "slow-growing." Serodiagnosis reveals Strep MG agglutinins in the patient's serum. Which of the following organisms is the most likely cause of this student's illness? A. Klebsiella pneumoniae B. Mycoplasma pneumoniae C. Parainfluenza virus D. Respiratory syncytial virus E. Streptococcus pneumoniae Answer

<14>A 52-year-old male is brought into the emergency room by his wife because he has been complaining of a severe headache. Physical exam reveals ptosis of the right eyelid with the right eye facing down and out. There is a fixed and dilated right pupil with an inability to accommodate. Subarachnoid blood appears on noncontrast CT scan. Magnetic resonance angiography (MRA) would be expected to reveal an aneurysm of which of the following vessels? A. Anterior cerebral artery B. Anterior choroidal artery C. Anterior communicating artery D. Middle cerebral artery E. Ophthalmic artery F. Posterior communicating artery G. Posterior inferior cerebellar artery Answer

<15>A 24-year-old graduate student presents to a physician with complaints of severe muscle cramps and weakness with even mild exercise. Muscle biopsy demonstrates glycogen accumulation, but hepatic biopsy is unremarkable. Which of the following is the most likely diagnosis? A. Hartnup's disease B. Krabbe's disease C. McArdle's disease D. Niemann-Pick disease E. Von Gierke's disease Answer

<16>A baby is born with a flat facial profile, prominent epicanthal folds, and simian crease. She vomits when fed, and upper GI studies demonstrate a "double bubble" in the upper abdomen. Which of the following cardiovascular abnormalities might this child also have? A. Atrial septal defect B. Berry aneurysm C. Coarctation of the aorta D. Endocardial cushion defect

E. Answer

Tetralogy of Fallot

<17>An asymptomatic, 24-year-old African-American woman in her second trimester of pregnancy has the following laboratory findings: Based on the laboratory data, which of the following tests is necessary for fur ther evaluation of this patient? A. Creatinine clearance B. Oral glucose tolerance test C. Serum ferritin D. Sickle cell preparation E. No further study is necessary Answer

<18>Endometrial biopsy demonstrates a thick endometrium with long, coiled glands lined by a columnar epithelium with prominent cytoplasmic vacuoles adjacent to the gland lumen. Earlier in the menstrual cycle, the glands were much smaller and were lined with cells that did not have vacuoles. Which of the following hormones is primarily responsible for inducing this change in appearance? A. Aldosterone B. Cortisol C. Estrogen D. Progesterone E. Thyroxine Answer

<19>A 28-year-old man discovers a mass in his neck while buttoning his shirt collar. Physical examination reveals a 2 cm mass in one thyroid lobe, which is "cold" on scintiscan. Aspiration of the nodule demonstrates small "solid balls" of neoplastic follicular cells. Careful examination of these tissue balls reveals that they contain microscopic blood vessels and fibrous stroma in their centers. Which of the following is the most likely diagnosis? A. Follicular carcinoma B. Hashimoto's disease C. Medullary carcinoma D. Papillary carcinoma E. Thyroid adenoma Answer

<20>Nissl bodies correspond to which of the following cytoplasmic organelles? A. Golgi apparatus

B. C. D. E. Answer

Mitochondria Nucleoli Rough endoplasmic reticulum Smooth endoplasmic reticulum

<21>A 40-year-old man with sleep apnea participates in a sleep study. During his evaluation, normal sawtooth waves are observed on his EEG tracing. This pattern is associated with which period of sleep? A. REM B. Stage 1 C. Stage 2 D. Stage 3 E. Stage 4 Answer

<22>A United Nations representative from a poor African country has an influenza-like illness that resolves in a few days. Less than a week later, however, he develops muscle pain, spasms, and sensory disturbances. Two days after this, flaccid paralysis occurs. Which of the following is most likely to be immediately life-threatening in this patient? A. Acute renal failure B. Bowel paralysis C. Fulminant liver failure D. Gastrointestinal bleeding E. Respiratory paralysis Answer

<23>What is the normal myeloid to erythroid ratio in bone marrow? A. 1:1 B. 1:3 C. 1:10 D. 3:1 E. 10:1 Answer

<24>A 45-year-old male complains of fatigue and increased frequency of urination. Questioning reveals that he is somewhat confused. Physical examination reveals a 5'10", 240 lb. individual whose fat is centrally distributed. Urine is positive for glucose, but negative for ketones. A blood sample drawn from this patient is likely to exhibit which of the following compared to that of a normal individual? A. Decreased concentration of C-peptide B. Decreased pH

C. D. E. Answer

Increased antibodies against islet cell proteins Increased concentration of b-hydroxybutyrate Increased osmolarity

<25>At which of the following ages does fetal movement first occur? A. 1 month B. 2 months C. 4 months D. 6 months E. 7 months Answer

<26>A child with retinoblastoma is found to have a 13q14 deletion. The Rb gene, which resides at this locus, produces which kind of tumor-associated protein? A. Cell cycle regulator B. Growth factor C. Growth factor-binding protein D. Growth factor receptor E. Transcription activator Answer

<27>A 29-year-old woman is involved in an automobile accident, and is taken to the emergency room by paramedics. X-rays reveal a fracture of her pelvis. During the healing of the pelvic fracture, the obturator nerve becomes entrapped in the bone callus. Compression of this nerve by the growing bone may result in weakness of which of the following muscles? A. Adductor magnus B. Biceps femoris C. Rectus femoris D. Sartorius E. Vastus medialis Answer

<28>An African child develops massive unilateral enlargement of his lower face in the vicinity of the mandible. Biopsy demonstrates sheets of medium-sized blast cells with admixed larger macrophages. This type of tumor has been associated with which of the following? A. Epstein-Barr virus and t(8;14) B. Hepatitis B and t(9;22) C. Herpesvirus and CD5 D. Human immunodeficiency virus and CD4

E. Answer

Human papillomavirus and t(2;5)

<29>A 57-year-old man presents for a routine physical. His blood pressure is 161/98 mm Hg. The patient's only complaint is that over the past several months he has had difficulty urinating. His urine stream is intermittent, and he has recently begun experiencing nocturia and profound urinary urgency. Digital rectal exam reveals diffuse enlargement of the prostate. Which of the following agents would be most likely to effectively treat the man's urinary tract symptoms as well as his hypertension? A. Finasteride B. Guanfacine C. Hydralazine D. Labetalol E. Terazosin Answer

<30>A 54-year-old male with extensive, severe atherosclerosis sustains a thrombotic occlusion of the celiac trunk. The organs that receive their blood supply from this artery continue to function normally. Anastomoses between which of the following pairs of arteries would explain this phenomenon? A. Left gastric artery and right gastric artery B. Left gastroepiploic artery and right gastroepiploic artery C. Proper hepatic artery and gastroduodenal artery D. Right colic artery and middle colic artery E. Superior pancreaticoduodenal artery and inferior pancreaticoduodenal artery Answer

<31>A cardiovascular pharmacologist is researching the effects of new compounds on arteriolar resistance. Drug X maximally increases vascular resistance by 50% at a dose of 20 mg/mL. Drug Y maximally increases vascular resistance by 75% at a dose of 40 mg/mL. Which of the following conclusions can the researcher draw from this experiment? A. Drug X has a smaller volume of distribution than Drug Y B. Drug X has a shorter half-life than Drug Y C. Drug X is less efficacious than Drug Y D. Drug X is less potent than Drug Y E. Drug X has a lower LD50 than Drug Y Answer

<32>A 74-year-old woman, in otherwise good health, tripped and injured

her right leg 2 days previously and has been bedridden since the accident . Two hours ago, she became delirious. On physical examination, her temperature is 99 F, blood pressure is 120/70 mm Hg, heart rate is 110, and respiratory rate is 32. Pulse oximetry shows an oxygen saturation of 80%, and a chest x-ray film is normal. Which of the following is the most likely diagnosis? A. Acute cerebral hemorrhage B. Acute cerebral infarction C. Myocardial infarction D. Pulmonary infarction E. Pulmonary thromboembolism Answer

<33>A 25-year-old pregnant woman complains to her obstetrician of dysuria. Microscopic examination of the urine demonstrates many gram-negative rods, many neutrophils, and a few WBC casts. Which of the following is the specific significance of the presence of WBC casts? A. One or both kidneys are involved in the infection B. One or both ureters are involved in the infection C. The bladder is involved in the infection D. The urethra is involved in the infection E. The uterus is involved in the infection Answer

<34>A 45-year-old female with a long history of progressive myopia develops sudden patchy loss of vision in her right eye. She is very alarmed and rushes to her family doctor. Funduscopic examination reveals a large retinal detachment in the right eye. The retina in the left eye is normal. When the pupillary light reflex is tested by shining a light in the right eye, the physician would likely note A. constriction of the right pupil and constriction of the left B. constriction of the right pupil and dilatation of the left C. dilatation of the right pupil and constriction of the left D. dilatation of the right pupil and dilatation of the left E. no reaction of the right pupil and constriction of the left Answer

<35>Physical examination of a young boy reveals discharge of urine from the umbilicus. The physician concludes that the urachus has failed to fuse. Which of the following structures is the normal adult remnant of the fused urachus? A. Lateral umbilical fold B. Medial umbilical fold C. Medial umbilical ligament D. Median umbilical fold

E. Answer

Median umbilical ligament

<36> In this section of a healing bone fracture, which of the following best describes the cell at the arrow? A. Apoptotic cell B. Bone-lining macrophage C. Dividing osteoblast D. Necrotic cell E. Typical osteoblast Answer

<37>A retarded 45-year-old man living in Mexico becomes ill with pneumonia and his family brings him across the border to the United States. He succumbs to his illness and an autopsy is performed. Neuropathological examination of his brain reveals neuritic plaques and neurofibrillary tangles. Which of the following was the most likely cause of this man's retardation? A. Down's syndrome B. Edwards' syndrome C. Fragile X syndrome D. Patau syndrome E. Supernumerary Y syndrome

Answer

<38>A 59-year-old woman presents with complaints of "feeling tired." She also admits to frequent headaches, which occur on one side and are throbbing. Physical examination is remarkable for a temperature of 100°F (37.8°C) and tenderness over both temples. Laboratory tests reveal a slightly decreased hematocrit and an elevated erythrocyte sedimentation rate. This patient should be treated aggressively to prevent the development of A. blindness B. deafness C. loss of tactile sensation D. loss of the ability to speak E. paralysis Answer

<39>A newborn baby has projectile vomiting shortly after each feeding. It is determined that there is obstruction of the digestive tract as a result of an annular pancreas. Annular pancreas is a result of an abnormality in which of the following processes? A. Rotation of the dorsal pancreatic bud around the first part of the duodenum B. Rotation of the dorsal pancreatic bud around the second part of the duodenum C. D. E. Answer Rotation of the dorsal pancreatic bud around the third part of the duodenum Rotation of the ventral pancreatic bud around the first part of the duodenum Rotation of the ventral pancreatic bud around the second part of the duodenum

<40>A debilitated 72-year-old woman develops dry cough, fever, headache, and muscular pains. She treats herself with aspirin and ampicillin without any improvement. Her children take her to a local hospital, where chest x-ray films reveal scattered opacities, suggestive of interstitial infiltration. Laboratory investigations demonstrate the presence of cold agglutinins. She is treated with erythromycin, and her symptoms rapidly improve. Which of the following is the most likely etiologic agent of this patient's condition? A. Influenza virus B. Mycoplasma pneumoniae C. Pneumocystis carinii D. Respiratory syncytial virus E. Streptococcus pneumoniae Answer

<41>Which of the following hormones is most important in initiating gall bladder contraction? A. Cholecystokinin (CCK) B. Gastric inhibitory peptide (GIP) C. Gastrin D. Secretin E. Vasoactive intestinal polypeptide (VIP) Answer

>42>A patient complains to her family physician that "When it's time to go to work, I just can't seem to get out of the house. I have a lot of windows, and I need to check them all three times. Then, I can never be sure the door is locked, so I check it 3 times. I've been late for work a few times, but this is the only way I can be sure the house is safe. Sometimes I think I'm going to go crazy." Which of the following is the most likely diagnosis? A. Adjustment disorder with anxiety B. Agoraphobia without history of panic disorder C. Generalized anxiety disorder D. Obsessive compulsive disorder E. Panic disorder with agoraphobia Answer

<43>A 32-year-old male, infected with HIV, is diagnosed with Hodgkin's lymphoma. If the patient's CD4 count is 505/mm3, which of the following agents would be suitable for the treatment of this patient's lymphoma without further compromising his immune system? A. Busulfan B. Cisplatin C. Cyclophosphamide D. Paclitaxel E. Vincristine Answer

<44>A 62-year-old Type 2 diabetic patient presents with complaints of malaise, myalgias, respiratory distress, and increased somnolence. If laboratory examination reveals an anion gap of 26 mmol/L, HCO3- of 17 mmol/L and an arterial blood pH of 7.27, the patient is most likely receiving A. glyburide B. metformin C. repaglinide

D. E. Answer

miglitol troglitazone

<45>A 24-year-old delivery driver is involved in an accident and sustains a wide abrasion over his left elbow. The abrasion results in the total loss of epidermis over a large area of his left arm, but one month later, the abrasion has healed, with regrowth of the epidermis. Which of the following mechanisms accounts for the restoration of the epidermis over the abraded area? A. Growth of epidermis from hair follicles and sweat glands in the dermis B. Migration of endothelial cells from newly grown capillaries C. Transformation of dermal fibroblasts into epidermal cells D. Transformation of macrophages into epidermal cells E. Transformation of melanocytes into epidermal cells Answer

<46> The diagram above shows spirographic tracings of forced expirations from two different individuals. Trace X was obtained from a person with healthy lungs. Which of the following is most likely represented by trace Y? A. Asthma B. Bronchospasm C. Emphysema D. Interstitial fibrosis E. Old age Answer

<47>A patient has multiple, pearly papules on the face. Biopsy shows a malignant tumor. Which of the following features would most likely be seen on microscopic examination? A. Cytoplasmic viral inclusions B. Keratin "pearls" C. Melanin D. Palisading nuclei E. S-100 positivity Answer

<48>A neonate develops marked unconjugated hyperbilirubinemia. No hemolysis can be demonstrated and other liver function tests are normal. There is no bilirubin found in the urine. This infant's condition continues to deteriorate and he dies at 2 weeks of age. To which of the following conditions did the infant most likely succumb? A. Crigler-Najjar syndrome, Type I B. Crigler-Najjar syndrome, Type II C. Dubin-Johnson syndrome D. Gilbert's syndrome E. Rotor syndrome Answer

<49>A 41-year-old woman presents with chronic widespread musculoskeletal pain, fatigue, and frequent headaches. She states that her musculoskeletal pain improves slightly with exercise. On examination, painful trigger points are produced by palpitation of the trapezius and lateral epicondyle of the elbow. If objective signs of inflammation are absent and laboratory studies are normal, this patient would most likely be responsive to which of the following drugs? A. Amitriptyline B. Cefaclor C. Naproxen D. Oxycodone E. Prednisone Answer

<50>A 29-year-old medical student developed a positive PPD (purified protein derivative) test. She was started on isoniazid (INH) and rifampin prophylaxis. Three months into her therapy, she began to experience muscle fasciculations and convulsions. Administration of which of the following vitamins might have prevented these symptoms? A. Niacin B. Pyridoxine C. Riboflavin D. Thiamine E. Vitamin C Answer

Answers

1The correct answer is C. A small percentage of patients (5% to 10%) develop a nonoliguric form of acute renal failure when treated with aminoglycosides such as gentamicin. Gentamicin can accumulate in the kidney to produce a delayed form of acute renal failure resulting in an elevation of the serum creatinine level. The nonoliguric form of renal failure, seen in this patient, is the typical presentation for gentamicin nephrotoxicity. Acute glomerulonephritis (choice A) is typically associated with hypertension and the appearance of an active urinary sediment containing casts and red blood cells. Cephalothin (choice B) is a first-generation cephalosporin commonly used in the treatment of severe infection of the genitourinary tract, gastrointestinal tract, and respiratory tract, as well as skin infections. This antibiotic can produce an acute interstitial nephritis; however, the patient's presentation is consistent with gentamicin nephrotoxicity. Interstitial nephritis is commonly associated with the development of acute renal failure, fever, rash, and eosinophilia.

Renal artery occlusion (choice D) is commonly caused by thrombosis or embolism. The clinical features of acute renal artery occlusion are hematuria, flank pain, fever, nausea, elevated LDH, elevated SGOT and acute renal failure. Since the patient has normal vital signs and no history of hypotension, a diagnosis of sepsis (choice E) is unlikely. 2The correct answer is E. The phrase "mosaic pattern" of newly formed woven bone is a specific tip-off for Paget's disease of bone, and is not seen in other bone conditions. The clinical and radiologic presentation are typical; an increased hat size may also be a clue. In its early stages, Paget's disease is characterized by osteolysis, producing patchwork areas of bone resorption with bizarre, large osteoclasts. In the middle stage of the disease, secondary osteoblastic activity compensates with new bone formation, producing the mosaic pattern. In late Paget's, the bones are dense and osteosclerotic. Paget's disease is suspected to be related to prior viral infection, but the cause remains mysterious. Complications include myelophthisic anemia, high output cardiac failure, pain secondary to nerve compression, deformities secondary to skeletal changes, and in about 1% of patients, osteosarcoma or other sarcoma, typically involving the jaw, pelvis, or femur. An increased incidence of astrocytomas (choice A) is associated with tuberous sclerosis. Hodgkin's lymphoma (choice B) is usually a disease of young adults, although older patients may have the lymphocyte-depleted form. Meningiomas (choice C) are mostly benign tumors that affect adults, especially females. There may be an association with breast cancer, possibly related to high estrogen states. Non-Hodgkin's lymphoma (choice D) is more common in AIDS and other immunodeficiency states, although the incidence in the immunocompetent is increasing. 3The correct answer is C. This question required that you know two pieces of information: (1) renin is secreted from the juxtaglomerular (JG) cells; and (2) the location of the JG cells in a picture that includes both the glomerulus and the juxtaglomerular apparatus. Remember that renin is responsible for converting angiotensinogen to angiotensin I, which is subsequently converted to angiotensin II in the lungs by an important enzyme appropriately called angiotensin-converting enzyme. Angiotensin II helps preserve blood pressure both by its potent vasoconstrictor properties and by its ability to stimulate aldosterone secretion from the adrenal cortex. The label for choice A points to the glomerular basement membrane. The label for choice B points to the epithelium of Bowman's capsule. The label for choice D points to the macula densa cells, which are thought to sense sodium concentration in the distal convoluted tubule. The label for choice E points to the Polkissen cells. Their function is unknown. 4The correct answer is B. The findings suggest disseminated intravascular coagulation (DIC), which is a feared complication of many other disorders, such as obstetrical catastrophes, metastatic cancer, massive trauma, and bacterial sepsis. The basic defect in DIC is a coagulopathy characterized by bleeding from mucosal surfaces, thrombocytopenia, prolonged PT and PTT, decreased fibrinogen level, and elevated fibrin split products. Helmet cells and schistocytes (fragmented red blood cells) are seen on peripheral blood smear. Autoimmune hemolysis (choice A) and hereditary spherocytosis (choice C) would be characterized by spherocytes in the peripheral smear. Macro-ovalocytes and hypersegmented neutrophils can be seen in megaloblastic anemia (choice D). Sickle cells are seen in sickle cell anemia (choice E).

5The correct answer is C. The most common form of atrial septal defect is located near the foramen ovale (not to be confused with a patent foramen ovale, which is of little or no hemodynamic significance). They result from incomplete adhesion between the septum primum and the septum secundum during development. Atrial septal defects less commonly result from failures of formation of the septum primum (choice A) and septum secundum (choice B). Malformations of the interventricular septum (choices D and E) cause ventricular septal defects rather than atrial septal defects. 6The correct answer is D. Leuprolide is a GnRH analog. Given long-term in a continuous fashion, it will inhibit FSH and LH release, thereby decreasing testosterone production and exacting a chemical castration in men. It can be used in the treatment of prostate cancer, polycystic ovary syndrome, uterine fibroids, and endometriosis. Inhibition of 5a-reductase (choice A) is the mechanism of action of finasteride. It thereby inhibits the production of dihydrotestosterone. It is used in the treatment of benign prostatic hyperplasia (BPH). Flutamide is another drug used in the treatment of prostate cancer. It is a competitive antagonist at androgen receptors (choice B). Since LH activates interstitial cells to secrete testosterone, a synthetic analog of LH (choice C) would not be appropriate treatment for prostatic cancer. The same goes for a testosterone analog (choice E). Here is a brief chart that will aid you in remembering the actions of these similar sounding drugs: Drug Action Indication Leuprolide GnRh analog Prostate CA Flutamide Competitive androgen antagonist Prostate CA Finasteride 5a-reductase inhibitor BPH Remember, "loo"prolide and "floo"tamide are both used for prostate cancer. Finasteride is used for BPH.

7The correct answer is D. 21-hydroxylase deficiency is the most common form of congenital adrenal hyperplasia. The simple virilizing variant (without salt wasting) is most common, but with severe 21-hydroxylase deficiency, virilization and salt wasting occur. The infant described above exhibits salt wasting and hyperkalemia because aldosterone secretion is diminished by the enzyme deficiency. The hypoglycemia is due to cortisol deficiency. Because cortisol secretion is diminished in congenital adrenal hyperplasia, ACTH secretion from the anterior pituitary is increased due to loss of negative feedback inhibition. The high levels of ACTH are responsible for the adrenal hyperplasia and the increased secretion of the adrenal androgens, dehydroepiandrosterone and androstenedione, which are responsible for the virilization of the external genitalia. 17-OH progesterone is the steroid precursor just proximal to 21-hydroxylase and is also increased because of the excessive drive to the adrenal cortex by ACTH. 5-alpha-reductase deficiency (choice A) in male fetuses will produce normal differentiation of the internal reproductive tracts, but the external genitalia will be feminized. This is because testosterone needs to be converted to dihydrotestosterone (by 5-alpha-reductase) in the external genitalia and the prostate for normal differentiation into the male phenotype. 11-beta-hydroxylase deficiency (choice B) is another form of congenital adrenal hyperplasia. It is characterized by salt retention due to excessive secretion by the inner zones of the adrenal cortex of the weak mineralocorticoid, deoxycorticosterone. Again, the excessive drive to the adrenal cortex is due to increased ACTH resulting from diminished negative

feedback suppression by cortisol. The adrenal also secretes excessive androgens and virilization occurs in female fetuses. 17-alpha-hydroxylase deficiency (choice C) is another from of congenital adrenal hyperplasia that is accompanied by salt retention. The high levels of ACTH drive the adrenal cortex to secrete increased amounts of deoxycorticosterone and corticosterone, both of which have weak mineralocorticoid activity. Without the ability to 17-alpha-hydroxylate progesterone or pregnenolone, steroid-secreting cells cannot produce sex steroids. When 17-alphahydroxylase deficiency is present in the adrenal cortex, it is also present in the gonads. Hence, whether it occurs in a male or female fetus, sex steroid production will be diminished. Female fetuses will develop normal reproductive tracts and genitalia since these structures are programmed in utero to "automatically" become female. Male fetuses, however, will have their reproductive tracts and genitalia feminized. Complete androgen resistance (choice E) results in feminization of affected male fetuses. It is characterized by an XY genotypic male with phenotypically female external genitalia and a vagina that ends as a blind sac. 8The correct answer is E. Vibrio vulnificus is an extremely invasive organism, producing a septicemia in patients after eating raw shellfish, or causing wound infections, cellulitis, fasciitis, and myositis after exposure to seawater or after cleaning shellfish. Patients at high risk for septicemia include those with liver disease, congestive heart failure, diabetes mellitus, renal failure, hemochromatosis, and immunosuppression. Citrobacter diversus (choice A) produces neonatal meningitis and can be frequently cultured from the umbilicus. Enterotoxigenic E. coli (choice B) produces the classic traveler's diarrhea. The toxin is ingested in water and salads. The incubation period is approximately 12 hours. The diarrhea is non-inflammatory and treatment is supportive. Providencia stuartii (choice C) is a gram-negative rod related to Proteus. It is a common cause of nosocomial bacteremia in nursing home patients with chronic catheterization. Vibrio cholerae (choice D) produces a non-invasive, non-inflammatory, high-volume secretory diarrhea that is toxin-mediated. 9The correct answer is D. The disease in question is leprosy, or Hansen's disease. A key feature in the description is the fact that the organism is acid-fast. Both of the mycobacteria, M. avium-intracellulare and M. leprae are strongly acid-fast, that is they retain the carbol fuchsin dye in the face of acid-alcohol decolorization. M. leprae has a predilection for the skin and cutaneous nerves, thereby producing the symptoms of depigmentation and anesthetic cutaneous lesions. This loss of peripheral nerve function leads to many of the disfiguring features of the disease; because the patients do not have normal pain sensation, they sustain repeated injuries. In addition, the organism attacks cartilage and causes granuloma formation in the skin, leading to some of the facial disfigurement. Bartonella henselae (choice A) is a very small, gram-negative bacterium that is closely related to the rickettsia, although it is able to be cultured on lifeless media. It is the cause of cat-scratch disease, a local, chronic lymphadenitis most commonly seen in children, and bacillary angiomatosis, a disease seen particularly in AIDS patients. Listeria monocytogenes (choice B) is a ubiquitous microbe that causes disease in over 100 animal species. Although it is best known as an agent of meningitis in the newborn, it is a cause of multiple other diseases. A characteristic feature of these infections is the development of granulomas at the site of the infection. The organism is not acid-fast and has no particular predilection for skin or nervous tissues. M. avium-intracellulare (choice C) causes tuberculosis-like pulmonary disease in the immunosuppressed.

Nocardia asteroides (choice E) primarily produces pulmonary infections in humans. The organism is consider to be "weakly" acid-fast, meaning that if the amount of HCl used in the decolorization step is reduced, the organisms will retain the carbolfuchsin primary stain. 10The correct answer is A. The cells described are the primordial eggs, which remain stopped in the diplotene stage of the first meiotic division from before birth until fertilization, a period which may be 40 or more years. Choices B and E are incorrect because the oocytes are stopped in the first, not second meiotic division. Choices C and D are incorrect because the cells described are oocytes and are not in mitosis. 11The correct answer is D. This is impetigo, which is typically seen in preschool children with poor hygiene, particularly in the summer in warm climates. The characteristic lesion has a large golden crust. Most cases are caused by Staphylococcus aureus; Streptococcus pyogenes is occasionally implicated. Impetigo is highly infectious, and mini-epidemics can occur in daycare settings. The initial treatment is typically with penicillins and topical preparations. Methicillin-resistant strains are presently rare in this setting, but can occur. Aphthous ulcers (choice A), commonly known as "canker sores," are painful, shallow ulcers of the oral cavity. Erysipelas (choice B) is a different type of skin infection, often caused by Streptococcus pyogenes (also sometimes others including Staphylococcus), and is characterized by large erythematous patches. Herpes simplex I (choice C) causes tiny oral and perioral vesicles, but not large golden crusts. Measles (choice E) causes a blotchy erythematous rash. 12The correct answer is C. This little boy has a Meckel's diverticulum, an ileal outpocketing typically located within 50-75 cm of the ileocecal valve. It is a congenital anomaly resulting from the persistence of the vitelline (omphalomesenteric) duct. Approximately half cause ulceration, inflammation, and gastrointestinal bleeding due to the presence of ectopic acidsecreting gastric epithelium. Pancreatic tissue may sometimes occur in these diverticula as well. Note that this is the most common type of congenital gastrointestinal anomaly. Something else to keep in mind: A favorite question attendings ask on the wards is the rule of 2's associated with Meckel's diverticulum: it occurs in about 2% of children, occurs within approximately 2 feet of the ileocecal valve, contains 2 types of ectopic mucosa (gastric and pancreatic), and its symptoms usually occur by age 2. All of the other answer choices have no relationship to Meckel's diverticulum. 13The correct answer is B. The patient has primary atypical pneumonia caused by Mycoplasma pneumoniae. This organism is fastidious and difficult to culture in the laboratory, however serodiagnosis can be most helpful. Patients typically produce one or two heterophile antibodies during the course of the infection; one agglutinates human O+ RBCs in the cold (the cold hemagglutinin) while the other causes the agglutination of a strain of Streptococcus salivarius termed strain MG (the Strep MG agglutinins). Klebsiella pneumoniae (choice A) is readily cultured on routine laboratory media and characteristically produces pneumonia with blood clots in the sputum (red currant jelly sputum), which may be indicative of pulmonary abscess development. Parainfluenza viruses (choice C) cause croup, which is characterized by a dry, "barking" cough. It is more of a tracheitis, bronchitis, and bronchiolitis than a pneumonitis. No heterophile antibodies are produced in these patients. Respiratory syncytial virus (choice D) causes an atypical pneumonitis in infants. It is usually diagnosed by the observation of syncytial masses in respiratory secretions. Cold hemagglutinins and Strep MG agglutinins are absent.

Streptococcus pneumoniae (choice E) is the number one cause of pneumonia in adults. It also causes septicemia and meningitis in the elderly. The patient has a classical acute pneumonia with a productive cough, high fever with chills, leukocytosis, tachycardia, rapid respirations and other signs of serious respiratory disease. A vaccine, composed of the capsular carbohydrate of 23 serotypes of this organism, is routinely given to individuals over the age of 60, as well as to individuals with splenic abnormalities (e.g., sickle cell disease) who are at increased risk for pneumococcal sepsis. 14The correct answer is F. Aneurysm of the posterior communicating artery is the second most common aneurysm of the circle of Willis (anterior communicating artery is most common) and can result in third cranial nerve palsy (paralysis). The oculomotor nerve (CN III) innervates the levator palpebrae muscle. CN III paralysis would therefore result in ptosis (drooping of the upper eyelid). CN III also innervates all of the extraocular muscles, except for the superior oblique (CN IV) and the lateral rectus muscles (CNVI). Thus, CN III palsy would result in unopposed action of the superior oblique and lateral rectus muscles, causing the affected eye to look down and out. CN III also supplies parasympathetic innervation to the sphincter muscle of the iris (which constricts the pupil) and to the ciliary muscle. Interruption of this pathway leads to a dilated and fixed pupil and to paralysis of accommodation. Note that this question teaches you about another Boards-favorite pathology: subarachnoid hemorrhage (SAH). (In this case, it was due to rupture of a posterior communicating artery aneurysm). A classic clue to the diagnosis is a patient presenting with "the worst headache of their life." When you are presented a case of sudden severe headache, SAH should rank highly on your differential diagnosis list. The anterior cerebral artery (choice A) supplies the medial surface of the cerebral hemisphere, from the frontal pole to the parieto-occipital sulcus. Occlusion may produce hypesthesia and paresis of the contralateral lower extremity. The anterior choroidal artery (choice B) arises from the internal carotid artery and is not part of the circle of Willis. It perfuses the lateral ventricular choroid plexus, the hippocampus, parts of the globus pallidus and posterior limb of the internal capsule. The anterior communicating artery (choice C) connects the two anterior cerebral arteries. It is the most common site of aneurysm in the circle of Willis and may cause aphasia, abulia (impaired initiative), and hemiparesis. The middle cerebral artery (choice D) supplies the lateral convexity of the cerebral hemisphere, including Broca's and Wernicke's speech areas and the face and arm areas of the motor and sensory cortices. It also gives rise to the lateral striate arteries, which supply the internal capsule, caudate, putamen, and globus pallidus. The middle cerebral artery is the most common site of stroke. The ophthalmic artery (choice E) enters the orbit with the optic nerve (CN II) and gives rise to the central artery of the retina. Occlusion results in blindness. The posterior inferior cerebellar artery (choice G) supplies the dorsolateral medulla and the inferior surface of the cerebellar vermis. Occlusion may result in Wallenberg's syndrome: cerebellar ataxia, hypotonia, loss of pain and temperature sensation of the ipsilateral face, absence of corneal reflex ipsilaterally, contralateral loss of pain and temperature sensation in the limbs and trunk, nystagmus, ipsilateral Horner's syndrome, dysphagia, and dysphonia. 15The correct answer is C. A variety of glycogen storage diseases exist, corresponding to defects in different enzymes in glycogen metabolism; most of these involve the liver. McArdle's disease (Type V glycogen storage disease), due to a defect in muscle phosphorylase, is restricted to skeletal muscle. The presentation described in the question stem is typical. Many affected individuals also experience myoglobinuria. Definitive diagnosis is based on demonstration of myophosphorylase deficiency.

Hartnup's disease (choice A) is a disorder of amino acid transport. Krabbe's disease (choice B) is a lysosomal storage disease. Niemann-Pick disease (choice D) is a lysosomal storage disease. Von Gierke's disease (choice E) is a glycogen storage disease with prominent involvement of liver, intestine, and kidney. 16The correct answer is D. The disease is Down syndrome (trisomy 21). In addition to mental retardation and the characteristic physical findings described in the question stem, duodenal atresia is fairly common, as evidenced by the "double bubble" sign on x-ray. These children are also likely to have various cardiac anomalies; endocardial cushion defect is the most common. Atrial septal defect (choice A) is one of the most common genetic defects in the general population, but is less common than endocardial cushion defect in patients with Down syndrome. Berry aneurysms (choice B), also known as saccular aneurysms, are typically located in the circle of Willis on the ventral surface of the brain. They occur more frequently in patients with adult polycystic disease. Rupture can produce subarachnoid hemorrhage. Coarctation of the aorta (choice C) occurs more commonly in females with a 45, XO genotype (Turner syndrome). Tetralogy of Fallot (choice E) is the most common cause of early cyanosis, consisting of a ventricular septal defect, right ventricular outflow tract obstruction, an overriding aorta, and right ventricular hypertrophy. 17The correct answer is E. All of the laboratory data in this pregnant woman are normal, hence no further study is necessary. In a normal pregnancy, both the plasma volume and RBC mass are increased with a greater increase in the plasma volume than RBC mass (2:1 ratio). This has a dilutional effect on many laboratory tests. Increasing plasma volume in pregnancy increases the creatinine clearance (choice A) due to the expected elevation in the glomerular filtration rate (GFR). The reference intervals for serum blood urea nitrogen and creatinine are lower than normal, due to the dilutional effect of increased plasma volume and increased clearance of both analytes in the urine caused by the rise in the GFR. The threshold for glucose is reduced in pregnancy, so patients can have a positive dipstick test for glucose in the presence of a normal serum glucose. Therefore, an oral glucose tolerance test (choice B) is not indicated. The hemoglobin (Hb) concentration in pregnancy is normally decreased because of the dilutional effect of increased plasma volume. Since the Hb is normal (for a pregnant woman) in this patient, a serum ferritin (choice C) to rule out iron deficiency is unnecessary. Furthermore, iron deficiency is usually associated with a low MCV (microcytic anemia), and her MCV is normal. Although sickle disease is the most common genetic hemoglobinopathy among African Americans, the patient is not anemic, so there is no reason to order a sickle cell preparation (choice D). 18The correct answer is D. The endometrial phase with small glands is the proliferative phase; the one with large glands with secretory cells is the secretory phase. Estrogen (choice C) is necessary for both phases, but it is the addition of progesterone (choice D), secreted by the corpus luteum after the Graafian follicle ruptures, that triggers the switch from proliferative to secretory endometrium. Glucocorticoids (choice B) and the mineralocorticoid aldosterone (choice A) are secreted by the adrenal glands. They do not produce the endometrial changes described.

Thyroxine (choice E) is secreted by the thyroid gland, and is unrelated to the observed morphologic changes in the endometrium. 19The correct answer is D. The distinctive cell balls described are broken-off papillary clusters, and are considered pathognomic for papillary carcinoma of the thyroid. This is the most common form of thyroid carcinoma. It tends to present in the 3rd to 5th decade and shows a modest female predominance. Despite its propensity for local lymphatic intrusion (which may cause multifocality of tumor in the thyroid or cervical lymph node metastases), the tumor generally has an excellent prognosis with 90% 20-year survival. Follicular carcinoma (choice A) is characterized by follicular cells and colloid on aspiration, and cannot be reliably distinguished from thyroid adenoma. Distinctive features of Hashimoto's disease (choice B) on aspiration are lymphocytes, plasma cells, and macrophages. The most distinctive feature of medullary carcinoma (choice C) on aspiration is the presence of amyloid. Thyroid adenoma (choice E) shows follicular cells and colloid on aspiration, and cannot be reliably distinguished from follicular carcinoma. 20The correct answer is D. This is a straightforward question relating to the definition of Nissl bodies. Rough endoplasmic reticulum present in neurons are called Nissl bodies. They stain intensely with basic dyes and are found in the cell body and proximal dendrites, but not in the axon hillock or axon. 21The correct answer is A. Sawtooth waves appearing in bursts are associated with REM sleep. Stage 1 (choice B) is associated with 4-7 Hz theta waves. Stage 2 (choice C) is associated with 12-14 Hz sleep spindles and K-complexes. Stage 3 (choice D) is associated with < 4 Hz, high-amplitude delta waves. Stage 4 (choice E) is characterized by an EEG composed of about 50% delta waves. Note that beta waves (15-18 Hz) occur during periods of more intense mental activity while awake. Alpha waves (8-12 Hz) occur during awake, relaxed states. REM is the stage of sleep that most resembles the awake state on the EEG. 22The correct answer is E. The disease is poliomyelitis. Most infections with poliovirus cause only the influenza-like symptoms, but a small percentage progress to paralytic poliomyelitis. The most common causes of death are aspiration and airway obstruction as a result of bulbar paralysis and paralysis of respiratory muscles. Arrhythmias can also be lifethreatening. Acute renal failure (choice A) is usually not seen in poliomyelitis, although the bladder may become paralyzed. Bowel paralysis (choice B) can be seen, but is not usually life-threatening. Fulminant liver failure (choice C) is not a feature of poliomyelitis. Gastrointestinal bleeding (choice D) can be seen in poliomyelitis, but is not usually lifethreatening. 23The correct answer is D. The ratio of cells in bone marrow developing along myeloid lines to cells developing along erythroid lines is 3:1. An alternative way to remember the normal marrow composition is that it typically contains about 60% granulocytes and their precursors; 20% erythroid precursors; 10% lymphocytes, monocytes, and their precursors; and 10% unidentified or disintegrating cells. These numbers are worth remembering, because shifts away from normal values may be a subtle clue to marrow abnormalities.

24The correct answer is E. An obese adult with glucosuria, but not ketonuria, likely has type 2 diabetes mellitus. Type 2 diabetes is characterized by insulin resistance resulting in hyperglycemia and increased serum osmolarity. The dehydration associated with osmotic diuresis makes the hyperosmolarity worse. As the osmolarity increases above 330 mOsm/L, the osmotic loss of water from neurons is sufficient to produce coma. In nonketotic, hyperosmolar coma, blood glucose values can range from 800 to 2,400 mg/dL and produce serum osmolarities of 330-440 mOsm/L. Since type 2 diabetes is due to insulin resistance, plasma levels of insulin are usually normal to increased. Because b cells secrete insulin and C-peptide in a 1:1 ratio, plasma concentration of C-peptide would also be normal to increased (not decreased, choice A) in type 2 diabetes. Even small amounts of insulin are sufficient to prevent ketosis. In type 2 diabetes there is enough insulin effect to prevent significant lipolysis and subsequent formation of excess ketone bodies. Hence, acidosis (choice B) is not typically associated with this disorder. Since b-hydroxybutyrate is a ketone body, its concentration in plasma is not likely to be increased (choice D). While there is a significant autoimmune component to type 1 diabetes, type 2 diabetes is not associated with increased circulating antibodies (choice C) against b cell proteins such as glutamic acid decarboxylase. 25The correct answer is B. Neuromuscular development is sufficient to allow fetal movement in the eighth week of life. Other features of week 8 include the first appearance of a thin skin, a head as large as the rest of the body, forward-looking eyes, appearance of digits on the hands and feet, appearance of testes and ovaries (but not distinguishable external genitalia), and a crown-rump length of approximately 30 mm. By the end of the eighth week, nearly all adult structures have at least begun to develop, and the fetus "looks like a baby". 26The correct answer is A. The Rb gene is an example of a tumor suppressor gene. Tumor suppressor genes encode proteins that downregulate cell growth; consequently, their deletion leads to the development of cells with a growth advantage over normal cells. Even if you know nothing about the Rb protein, choice A is still the only logical answer because it is the only example of a protein that, if absent, would favor cell growth. The Rb protein binds to transcription factors in the nucleus, preventing cells from progressing from the S1 to M stages of the cell cycle. Children born with a 13q14 deletion have only one chromosome encoding Rb; therefore only a single "hit " is required to completely knock out Rb production and lead to the development of retinoblastoma. All of the incorrect choices are proteins encoded by oncogenes, rather than tumor suppressor genes. Oncogenes favor tumorigenesis through overexpression, not deletion. Growth factors (choice B) are oncoproteins that are produced by tumors and have a positive feedback effect. Examples of growth factors are PDGF and fibroblast growth factor; the oncogenes encoding them are sis and hst-1, respectively. The prototypical growth factor-binding protein (choice C) is ras, which is mutated in a large variety of cancers. Ras normally functions as an activator of protein kinases that regulate cell growth. Overactivity of the ras protein is highly mitogenic. Growth factor receptors (choice D) are either expressed as mutant forms or overexpressed in tumors, leading to upregulation of growth. An example of a growth factor receptor oncogene is erb-B2, present in some breast cancers. Transcription activators (choice E) are DNA-binding proteins that promote DNA transcription. Amplification of these oncogenes causes cancer by promoting the transcription of growth-related genes.

27The correct answer is A. The obturator nerve innervates the muscles of the medial compartment of the thigh. These include the adductor longus, adductor brevis, adductor magnus, and gracilis muscles. The adductor magnus is also innervated by the tibial nerve. The biceps femoris (choice B) is in the posterior compartment of the thigh. The long head of the biceps femoris is innervated by the tibial portion of the sciatic nerve, and the short head of the biceps femoris is innervated by the common peroneal portion of the sciatic nerve. The rectus femoris (choice C) and vastus medialis (choice E) are two of the four heads of the quadriceps femoris muscle. All four heads of the quadriceps femoris muscle are in the anterior compartment of the thigh, and are innervated by the femoral nerve. The sartorius muscle (choice D) is in the anterior compartment of the thigh, and is innervated by the femoral nerve.

28The correct answer is A. The patient has Burkitt's lymphoma. This type of lymphoma is a high-grade B-cell lymphoma that occurs in endemic form in Africa (it is the most common neoplasm in children in an equatorial belt that includes Africa and New Guinea) and sporadically in the United States and Europe. The sporadic form is often in an abdominal site and occurs in young adults. The African form of Burkitt's lymphoma has been strongly associated with antibodies directed against Epstein-Barr virus; the association is weaker in sporadic cases. A characteristic translocation, t(8;14) (q24.l3;q32.33) has been described. Hepatitis B (choice B) is associated with hepatocellular carcinoma. t(9;22) is the Philadelphia chromosome, which is seen in some cases of CML and AML. Herpesvirus (choice C) does not have a strong tumor association, although a link to cervical cancer has intermittently been proposed. CD5 is a marker seen in small lymphocytic and mantle cell lymphomas. HIV (choice D) is linked to Kaposi's sarcoma (and AIDS). Some patients also develop primary lymphomas (not usually Burkitt's). CD4 is a marker for helper T cells and some T cell lymphomas. Human papillomavirus (choice E) is linked with common warts, genital condylomata, and genital cancers. t(2;5) is linked to anaplastic large cell lymphoma. 29The correct answer is E. The patient is presenting with hypertension and signs and symptoms of benign prostatic hyperplasia (BPH). The essential diagnostic characteristics of BPH include a decrease in the force and caliber of the urinary stream, nocturia, high postvoid residual volume, urinary retention, and azotemia. Terazosin is an alpha-adrenergic antagonist that selectively blocks alpha-1 receptors in vascular smooth muscle producing relaxation. It is indicated for the treatment of both hypertension and BPH. Finasteride (choice A) is a specific inhibitor of 5-alpha reductase, an enzyme that converts testosterone into the potent androgen dihydrotestosterone (DHT) in the prostate gland. This agent is indicated only for the treatment of BPH. Guanfacine (choice B) is a centrally acting alpha-2 agonist indicated for the treatment of mild to moderate hypertension. Hydralazine (choice C) is a vasodilator indicated for the treatment of hypertension and to decrease afterload in patients with congestive heart failure. Labetalol (choice D) is both an alpha- and beta-receptor blocking agent indicated for the treatment of hypertension. 30The correct answer is E. The superior pancreaticoduodenal artery is a branch of the gastroduodenal artery, which is a branch of the common hepatic artery, itself a branch of the celiac trunk. The inferior pancreaticoduodenal artery is a branch of the superior mesenteric artery. Occlusion of the celiac trunk would allow blood from the superior mesenteric artery to

reach the branches of the celiac trunk via the connections between the superior and inferior pancreaticoduodenal arteries. The left gastric and right gastric arteries (choice A) both receive their blood from the celiac trunk. The left gastric artery is a direct branch of the celiac trunk. The right gastric artery is usually a branch of the proper hepatic artery, which is a branch of the common hepatic artery (a branch of the celiac trunk). The left and right gastroepiploic arteries (choice B) both receive their blood supply from the celiac trunk. The left gastroepiploic artery is a branch of the splenic artery, which is a branch of the celiac trunk. The right gastroepiploic artery is a branch of the gastroduodenal artery, which is a branch of the common hepatic artery (a branch of the celiac trunk). The proper hepatic and gastroduodenal arteries (choice C) are branches of the common hepatic artery, which is a branch of the celiac trunk. The right colic and middle colic arteries (choice D) are both branches of the superior mesenteric artery. 31The correct answer is C. The only conclusion that can be drawn from this data is that Drug X is less efficacious than Drug Y. Efficacy is defined as the maximum effect that can be produced by a drug, regardless of dose. Drug X can only produce a 50% change in resistance, whereas Drug Y can produce a 75% change in resistance. Therefore, Drug X is less efficacious than Drug Y. A volume of distribution (choice A) is the ratio of the amount of drug in the body to its plasma concentration. In this experiment, we do not know the total amount of drug used or the plasma concentration. For that matter, we do not even know if this is an in vivo experiment. Thus, no conclusions can be drawn about volume of distribution. The half-life (choice B) is the time it takes for the concentration of a drug to fall 50% from its previous measurement. There is no information given to determine half-life. The potency (choice D) is the dose or concentration required to produce 50% of the drug's maximal effect. We cannot determine the potency of Drug Y from this question. The LD50 (choice E) is the dose that causes death in 50% of a population of subject. The experiment described above does not describe a population study, nor does it give any indication about the toxicity of the drug. 32The correct answer is E. Hip fracture and prolonged bed rest are classic risk factors for the development of pulmonary thromboemboli (PE). Common clinical manifestations of PE are hypoxia (due to ventilation/perfusion mismatch) despite a normal chest x-ray, tachycardia, and delirium in older patients. Cerebral hemorrhage (choice A) might cause delirium but would not directly cause hypoxia unless the patient was hypoventilating (e.g., because of brainstem involvement). Cerebral infarction (choice B) could produce delirium but would not directly cause hypoxia unless the patient was hypoventilating. Myocardial infarction (choice C) could account for delirium and tachycardia, but not for hypoxia with a normal chest x-ray. Severe congestive heart failure after myocardial infarction could cause hypoxia due to pulmonary edema, but the chest x-ray would not be normal. Pulmonary infarction (choice D) may cause delirium, tachycardia, and hypoxia, but the chest x-ray may be abnormal. A chest x-ray performed within 12-36 hours after a pulmonary infarct may reveal a peripherally located, wedge-shaped infiltrate. 33The correct answer is A. The woman has a urinary tract infection. Pregnancy can predispose for urinary tract infection by compressing urinary tract structures and partially impairing urinary flow through the urinary tract. The presence of white blood cell casts specifically implies renal involvement, since these form when the leukocytes are compressed

together in the renal tubules. Similarly, the presence of red blood cell casts in a bloody urine would indicate that at least some of the bleeding was occurring in the kidney. Infection of other sites in the urinary tract, including ureters (choice B), bladder (choice C), and urethra (choice D), does not cause cast formation. While spread of a urinary tract infection to a pregnant uterus (choice E) is always of concern in a pregnant woman, the presence of casts does not specifically suggest that this has occurred. 34The correct answer is D. This patient is exhibiting the Marcus-Gunn phenomenon. When light strikes the retina, the pupillary light reflex is automatically triggered, leading to simultaneous constriction of both pupils. In the absence of adequate light entering the eye, for example following retinal detachment or optic neuritis, paradoxical dilatation of the pupils occurs. The retina receives far less light than it normally would, and the pupils dilate in order to absorb as much light as possible. 35The correct answer is E. The urachus is the derivative of the allantoic duct, which passes from the urogenital sinus to the umbilical cord. Normally, this duct fuses and is no longer patent. The adult derivative is the median umbilical ligament, which lies in the midline along the interior surface of the anterior abdominal wall. It passes from the upper end of the bladder to the umbilicus. The lateral umbilical fold (choice A) is the fold of parietal peritoneum that covers the inferior epigastric artery and vein on the interior surface of the anterior abdominal wall. The medial umbilical fold (choice B) is the fold of parietal peritoneum that covers the medial umbilical ligament, the adult derivative of the umbilical artery (see below). The medial umbilical ligament (choice C) is the adult derivative of the distal portion of the umbilical artery. The umbilical artery arises from the internal iliac artery. It passes along the bladder and then the anterior abdominal wall to reach the umbilicus. Prenatally, this artery carries fetal blood to the placenta, where it gains oxygen and nutrients. Postnatally, the proximal part of the umbilical artery remains patent and supplies blood to the superior surface of the bladder. Distal to the bladder, the artery becomes fibrotic and is known as the medial umbilical ligament. The median umbilical fold (choice D) is the fold of parietal peritoneum that covers the median umbilical ligament, the adult derivative of the urachus. 36The correct answer is A. Apoptosis refers to programmed cell death, and in this situation, appears to be a means for the elimination of unneeded osteoblasts as the extracellular matrix is reshaped and the healing process continues. Two basic morphologic features of apoptosis are seen in this cell. First, cytoplasmic blebbing, in which round, elongated structures (blebs) extend from the main cell body, is evident. Some blebs appear as though in clusters. Second, nuclear blebbing, in which the nucleus shows the same irregular type of blebs or protrusions, is apparent. This cell does not have features of a macrophage (choice B) such as lysosomes, or a heterogeneous cytoplasm. Ribosome-filled blebs are not features of macrophages. No chromosomes are present, hence this cannot be a dividing cell (choice C). Cytoplasmic and nuclear blebbing are not features of necrosis (choice D). In necrosis, nuclei are washed out (karyolysis), markedly compact (pyknotic), or fragmented (karyorrhexis). A typical osteoblast (choice E) is seen to the left of the blebbing cell. This cell has extensive rough endoplasmic reticulum and a Golgi apparatus with elliptical and round granules. 37The correct answer is A. Features of Down's syndrome (trisomy 21) in children include mental retardation, epicanthal folds, dysplastic ears, hypotonia, a horizontal palmar crease (simian crease), redundant neck skin, and a short trunk. However, most of these children

eventually grow to adulthood. At that point, the aging parents may have to deal with a physically strong and healthy mentally retarded individual who is experiencing a deterioration in mental function. This deterioration may be accompanied by aggressive behavior (as in the elderly with Alzheimer's disease) arising out of the patient's diminishing ability to reason or understand his environment. Edwards' syndrome (choice B), or trisomy 18, causes death in infancy. Characteristics include rocker-bottom feet, low-set ears, micrognathia, congenital heart disease, and mental retardation. Fragile X syndrome (choice C) is associated with enlarged testes as well as mental retardation. The condition is unusual in that it is related to expansion of a CGG repeat sequence located on the X chromosome. Patau syndrome (choice D), or trisomy 13, is characterized by severe mental retardation, microcephaly, microphthalmia, polydactyly, cleft lip and palate, renal defects, and cardiac abnormalities. Affected infants typically die before the age of 1. The effects of supernumerary Y chromosomes (choice E; most commonly XYY) include increased stature, aggressive behavior, and infertility, but a supernumerary Y chromosome is sometimes found in otherwise normal individuals. 38The correct answer is A. This woman is afflicted with temporal (giant cell) arteritis. This is a panarteritis that can involve any of the branches of the aortic arch, but which classically affects the branches of the carotid system. Temporal arteritis commonly (40-50%) produces visual disturbances, including blindness due to involvement of the ophthalmic artery. Biopsy of affected segments of arteries may be diagnostic, showing granulomatous lesions with giant cells, although non-specific inflammatory infiltrates and/or intimal fibrosis (generally with no disruption of the internal elastic lamina) are also seen with some frequency. Isolated deafness (choice B) is not commonly seen with temporal arteritis. Stroke may occur in temporal arteritis, but this would not likely produce loss of all tactile sensation (choice C). Loss of the ability to speak (choice D) might conceivably result from a stroke affecting the inferior frontal gyrus, or from a lesion of the brainstem centers controlling phonation, but visual disturbances are more common than stroke in temporal arteritis. Paralysis (choice E) is not a common complication of temporal arteritis. 39The correct answer is E. The ventral pancreatic bud normally rotates around the duodenum to fuse with the dorsal pancreatic bud. Both pancreatic buds form from evaginations from the second part of the duodenum, hence the rotation is around the second part of the duodenum. The normal rotation is around the right side of the embryonic duodenum. Annular pancreas results from the ventral pancreatic bud dividing and rotating around both the right and left sides of the second part of the duodenum, thus encircling it. The dorsal pancreatic bud (choices A, B, and C) does not rotate around the duodenum and therefore is not the cause of annular pancreas. The ventral pancreatic bud does not form from the first part of the duodenum (choice D) and therefore does not rotate around this part of the duodenum. 40The correct answer is B. The patient's clinical presentation is typical of primary atypical pneumonia. In contrast to bacterial pneumonia, primary atypical pneumonia presents with the following features: - Caused by M. pneumoniae; less frequently by viruses (influenza, respiratory syncytial virus, adenovirus, rhinoviruses, rubeola and varicella virus), Chlamydia, or Coxiella burnetii - Characterized pathologically by interstitial, rather than intra-alveolar, inflammation - Characterized clinically by nonspecific symptomatology and few "localizing" symptoms

Why is M. pneumoniae, and not influenza virus (choice A) or respiratory syncytial virus (choice D), the cause of this patient's pneumonia? First, M. pneumoniae infections are often associated with the appearance of cold agglutinins in the serum, detection of which is diagnostically important. Second, the patient responded quickly to treatment with erythromycin, an antibiotic effective against M. pneumoniae, but obviously not effective in treating viral infections. Pneumocystis carinii (choice C) is a fungal organism causing pneumonia in severely immunocompromised hosts, especially AIDS patients. P. carinii pneumonia (PCP) is characterized by accumulation of a frothy exudate containing numerous organisms within alveolar spaces. Also, P. carinii is not sensitive to erythromycin. The drug of choice for treatment of PCP is trimethoprim-sulfamethoxazole. Streptococcus pneumoniae (choice E) is the usual causative agent of lobar pneumonia, characterized by consolidation of a single lobe due to intra-alveolar acute inflammatory exudation. Lobar pneumonia is more prevalent in young, healthy individuals, whereas primary atypical pneumonia favors old, debilitated patients. S. pneumoniae is highly sensitive to penicillin. 41The correct answer is A. Cholecystokinin, or CCK, is synthesized in the duodenal and jejunal mucosa and stimulates gall bladder contraction and pancreatic enzyme secretion. Other functions include slowing of gastric emptying, an atrophic effect on the pancreas, and secretion of antral somatostatin, which in turn, decreases gastric acid secretion. Gastric inhibitory peptide, or GIP (choice B), stimulates pancreatic insulin secretion at physiologic doses and inhibits gastric acid secretion and gastric motility at pharmacologic doses. Gastrin (choice C) prepares the stomach and small intestine for food processing, including stimulating secretion of HCl, histamine, and pepsinogen. It also increases gastric blood flow, lower esophageal sphincter tone, and gastric contractions. Secretin (choice D) stimulates secretion of bicarbonate-containing fluid from the pancreas and biliary ducts. Vasoactive intestinal polypeptide, or VIP (choice E), relaxes intestinal smooth muscle and stimulates gut secretion of water and electrolytes. 42The correct answer is D. This patient expresses feelings of anxiety which are only relieved by compulsive ritual behavior (checking the doors and windows excessively). Adjustment disorder with anxiety (choice A) generally occurs in response to an identifiable stressor. Agoraphobia without a history of panic disorder (choice B) is characterized by a fear of all large enclosed or open spaces when alone. In generalized anxiety disorder (choice C), excessive worry or anxiety is present most of the time the person is awake, not just in a specific situation. In panic disorder with agoraphobia (choice E), panic attacks occur in uncued situations. This patient's symptoms appear consistently when she leaves for work in the morning. 43The correct answer is E. Bone marrow suppression, diarrhea, and alopecia are the most common side effects seen with cancer chemotherapy regimens. Vincristine, a mitotic inhibitor, is a chemotherapeutic agent that is not associated with the development of bone marrow suppression and would be the most appropriate agent to use in this patient. Vincristine is effective in the treatment of acute lymphoblastic leukemia and other leukemias, Hodgkin's disease, lymphosarcoma, neuroblastoma, and various other types of cancer. Bleomycin is another antineoplastic agent that does not cause bone marrow suppression.

Busulfan (choice A) is an alkylating agent primarily used in the palliative treatment of chronic myelogenous leukemia; it is known to cause severe bone marrow suppression. As a general rule, the alkylating agents typically produce severe immunosuppressive effects. Cisplatin (choice B) is another alkylating agent indicated for the treatment of metastatic testicular and ovarian tumors in combination with other agents. This agent can also cause profound bone marrow suppression. Cyclophosphamide (choice C) is classified as a nitrogen mustard, a subcategory of the alkylating agents. It is primarily used to treat breast, testicular, and other solid tumors, as well as leukemia and lymphoma. This drug suppresses bone marrow. Paclitaxel (choice D) is an antimicrotubule agent typically used in the treatment of ovarian and breast cancer. Profound neutropenia is typically seen with this agent. 44The correct answer is B. Lactic acidosis, characterized by elevated blood lactate, decreased arterial blood pH, decreased bicarbonate, and electrolyte imbalances with an elevated anion gap (normal = 10 - 12), is a rare but serious complication of metformin administration. The onset of lactic acidosis is usually accompanied by several non-specific signs and symptoms including malaise, myalgias, respiratory distress and increased somnolence. There may be associated hypothermia, hypotension, and resistant bradyarrhythmias as the condition progresses. Glyburide (choice A) is a sulfonylurea associated with the development of hypoglycemia and cholestatic jaundice (a rare complication). Miglitol (choice C) is an alpha-glucosidase inhibitor commonly associated with the development of abdominal discomfort and flatulence. Repaglinide (choice D) is the non-sulfonylurea moiety of glyburide; it is commonly associated with hypoglycemia, nausea and vomiting. Idiosyncratic hepatocellular injury has been reported during the usage of troglitazone (choice E). The hepatic injury is usually reversible, but rare cases of hepatic failure requiring liver transplantation or leading to death have been reported with this agent. 45The correct answer is A. The dermis contains skin appendages (e.g., hair follicles) that contain epithelial stem cells. In the process of healing a large area where the epidermis has been lost, but the dermis is intact, re-epithelialization occurs by ingrowth of epidermal cells from the underlying skin appendages, as well as from the intact epidermis along the wound edges. None of the other cell types are known to directly contribute to the regeneration of epidermis over abraded skin. 46The correct answer is D. A forced expiration is the simplest test of lung function. The individual breathes in as much air as the lungs can hold and then expels the air as rapidly and as far as possible. The forced vital capacity (FVC) is the vital capacity measured with a forced expiration (FVC = 3 L for patient Y). The forced expiratory volume in one second (FEV1) is the amount of air that can be expelled from the lungs during the first second of a forced expiration (FEV1 = 2.7 L for patient Y). The FEV1/FVC ratio has diagnostic value for differentiating between normal, obstructive, and restrictive patterns of a forced expiration. The FEV1/FVC ratio for the healthy individual (X) is 4 L/5 L = 80% and the FEV1/FVC for patient Y is 2.7/3.0 = 90%. FEV1/FVC is a function of airway resistance. Increases in airway resistance associated with asthma (choice A), bronchospasm (choice B), emphysema (choice C), and old age (choice E) tend to decrease the FEV1/FVC ratio below its typical normal value of 80%. FEV1/FVC is often increased with interstitial fibrosis because of increased radial traction of the airways, i.e., the airways are held open to a greater extent at any given lung volume, reducing their resistance to air flow. The increase in elastic recoil also makes it difficult to breathe deeply,

which decreases FVC. This combination of decreased FVC along with normal or slightly increased FEV1/FVC is characteristic of fibrotic lung disease. 47The correct answer is D. The malignant skin tumor that forms "pearly papules" on sunexposed skin is basal cell carcinoma. A characteristic feature of this tumor is palisading of the basal cell-like nuclei at the edge of clusters of cells penetrating into the dermis. Basal cell carcinomas almost never metastasize, but can be very locally destructive, and resection of large ones on the face may produce disfiguring scars. Viral cytoplasmic inclusions (choice A) are a feature of the infectious lesion molluscum contagiosum. Keratin pearls (choice B) are a feature of squamous cell carcinoma. Melanin (choice C) and S-100 positivity (choice E) with immunohistochemical stains are features of melanoma. 48The correct answer is A. The diseases listed in the answers are all inherited disorders of bilirubin metabolism that are usually discussed together. Crigler-Najjar syndrome (choices A and B) and Gilbert's syndrome (choice D) are both unconjugated hyperbilirubinemias, while Dubin-Johnson syndrome (choice C) and Rotor syndrome (choice E) are conjugated hyperbilirubinemias. Crigler-Najjar syndrome (particularly the type I variant) is rare and extremely serious (with the presentation given in the question stem) while Gilbert's syndrome is completely benign. The type II variant of Crigler-Najjar is intermediate in severity between Gilbert's and the Type I. Dubin-Johnson and Rotor syndrome are also relatively benign; Dubin-Johnson is distinguished from Rotor syndrome by the presence of a black pigment of unknown composition in the liver. 49The correct answer is A. The patient is presenting with signs and symptoms of fibrositis (fibromyalgia). This disorder is most commonly seen in women between the ages of 20 and 50, and is associated with widespread chronic musculoskeletal pain that improves with exercise, chronic fatigue, and sometimes, severe headaches. Examination typically reveals painful trigger points produced by palpation of the trapezius and the lateral epicondyle of the elbow. Objective signs of inflammation are absent and laboratory studies are normal. Patients with this disorder are likely to respond to treatment with tricyclic antidepressants or skeletal muscle relaxants with strong anticholinergic side effects, such as cyclobenzaprine. One of the most effective agents in the treatment of this disorder is amitriptyline, a tricyclic antidepressant commonly used in the treatment of depression, and as an adjunctive pain medication. Cefaclor (choice B) is a second generation cephalosporin. Since fibromyalgia is not an infectious disorder, this agent would be ineffective in this patient. Naproxen (choice C) is a non-steroidal anti-inflammatory drug indicated for the treatment of mild-to-moderate pain. NSAIDs are generally ineffective in the treatment of this disorder. Oxycodone (choice D) is an opioid analgesic indicated for the treatment of moderate to severe pain; opioids are ineffective in the treatment of fibromyalgia. Prednisone (choice E) is a corticosteroid indicated for the treatment of a variety of disorders caused by inflammation. Since this disease is not an inflammatory condition, prednisone would be not be indicated for this patient. 50The correct answer is B. Pyridoxine, or vitamin B6, is sometimes depleted with isoniazid (INH) use. Patients with pyridoxine deficiency may experience neurologic symptoms, such as convulsions and fasciculations. The treatment of this disorder is slow IV administration of 25 g of pyridoxine. Niacin (choice A) deficiency, also known as pellagra, is a disease that involves several organs, including the skin, the gastrointestinal system, and the nervous system. A useful

mnemonic for remembering the symptoms of pellagra is the "4 D's": dermatitis, dementia, diarrhea, and death. These symptoms are not consistent with the patient history described in the question. Riboflavin (choice C) deficiency is not typically seen alone, but rather in conjunction with other vitamin deficiencies. Dermatitis and glossitis are the most frequent clinical manifestations. Thiamine (choice D) deficiency, or beri-beri, presents with dry skin and paralysis, rather than convulsions. Severe thiamine deficiency produces Wernicke's encephalopathy, with disorientation, ataxia, and ophthalmoplegia. This deficiency is typically seen in alcoholic patients. Vitamin C (choice E) deficiency, or scurvy, causes defective growth and maintenance of gums, blood vessels, joints, and teeth. These symptoms are due to impaired collagen hydroxylation, a process that requires vitamin C.

(11) <1>A 61-year-old woman with leukemia abruptly develops an intensely itchy rash. Physical examination demonstrates multiple erythematous patches of the distal arms and legs, some of which involve the palms and soles. Some of the patches show central clearing with surrounding erythematous rings. Which of the following is the most likely diagnosis? A. Erythema migrans chronicum B. Erythema multiforme C. Kaposi's sarcoma D. Psoriasis E. Urticaria Answer

<2>A 52-year-old woman presents to her physician for a check-up. She is recovering from a wrist fracture after a fall. Dual energy x-ray absorptiometry of the hip had shown her to have osteoporosis. She became menopausal at age 50 and did not begin hormone replacement therapy because of a strong family history of breast cancer. She now fears a future hip fracture and would like to begin a bone loss prevention regime.Which of the following pharmaceutical agents is most appropriate for this patient? A. Calcitonin nasal spray B. Oral conjugated estrogen C. Raloxifene D. Tamoxifen E. Transdermal estradiol Answer

<3>A fracture of the humerus neck damages a nerve running around the humeral neck. After the fracture heals, the patient notices a marked decrease in his ability to raise his arm over his head. The denervated muscle arises from which of the following? A. Acromion alone B. Clavicle and acromion

C. D. E. Answer

Clavicle and coracoid Coracoid alone Coracoid and acromion

<4>A patient is admitted to a psychiatric hospital after having been picked up by the police for making inappropriate sexual advances. A detailed psychiatric interview demonstrates deficits in memory, insight, judgement, personal appearance, and social behavior. The patient is witnessed experiencing a possible epileptic seizure. Over a period of several years, motor findings also develop, including relaxed, but expressionless facies, tremor, dysarthria, and pupillary abnormalities. Which of the following tests performed on his cerebrospinal fluid would most likely be diagnostic? A. CSF glucose B. FTA-ABS C. Gram's stain D. Lymphocyte count E. Neutrophil count Answer

5>A 29-year-old single man seeks psychiatric treatment to help him deal with difficulties in his personal life. Although the man is a successful computer programmer, he feels unsatisfied with his interpersonal relationships. He reports being attracted to several of his female coworkers, but is "too shy" to talk to them about anything other than superficial subjects such as the weather. He would like to ask one of the women out on a date, but is afraid of being rejected. Which of the following diagnoses is most appropriate? A. Avoidant personality disorder B. Borderline personality disorder C. Dependent personality disorder D. Narcissistic personality disorder E. Schizotypal personality disorder Answer

<6>A 3-month-old infant presents with a 3-day history of fever, cough, and poor feeding. On examination, the baby appears ill and has a temperature of 102 F and a respiratory rate of 32. A chest x-ray film shows bilateral patchy infiltrates in the lungs. Which of the following is the most likely etiologic agent? A. Coronavirus B. Influenza type A C. Parainfluenza type 1 D. Respiratory syncytial virus

E. Answer

Rhinovirus

<7>A 35-year-old male presents to the urologist for an infertility evaluation. A biopsy of his testis is performed to check sperm production and maturation. A microscopic section reveals only a few germ cells near the basal lamina in the seminiferous tubule. Which of the following cells is the germ cell closest to the basal lamina in the seminiferous tubule? A. Primary spermatocyte B. Secondary spermatocyte C. Spermatid D. Spermatogonia E. Spermatozoa Answer

<8>A 30-year-old otherwise healthy woman presents to her physician with complaints of fatigue and dyspnea. Physical examination reveals normal breath sounds and the presence of third and fourth heart sounds. Chest x-ray shows clear lung fields but right ventricular enlargement, main pulmonary artery enlargement, and "pruning" of the peripheral vasculature. Electrocardiogram shows right axis deviation and right ventricular hypertrophy. Left ventricular function appears normal on echocardiography. Serologic studies show antinuclear antibodies. Which of the following pathological findings would this patient also show, either at autopsy or if an appropriate biopsy was taken? A. Mural thrombus of the right atrium B. Necrosis and scarring of the left ventricle C. Plexogenic pulmonary vasculopathy D. Pulmonary artery stenosis E. Severe pulmonary fibrosis Answer

<9>During an abdominal surgical procedure, the surgeon wishes to locate the ureter in order to ensure that it is not injured. The ureter may be found immediately anterior to the origin of the A. common iliac artery B. external iliac artery C. internal iliac artery D. gonadal artery E. renal artery Answer

<10>A patient with mild congestive heart failure is treated with high-dose

furosemide and diureses 25 pounds of fluid. A complete blood count (CBC) taken before the diuresis shows an RBC count of 4 million/mm3; a CBC taken after diuresis shows a RBC count of 7 million/mm3. Which of the following is the most likely explanation? A. Cyanotic heart disease B. Increased erythropoietin C. Polycythemia vera D. Relative polycythemia E. Renal cell carcinoma Answer

<11>A newborn male child is noted to have hypospadias. A complete evaluation determines that the child has no other genitourinary anomalies. Nonetheless, hypospadias repair will be performed to prevent which of the following possible sequelae? A. Bladder exstrophy B. Hydrocele C. Phimosis D. Urachal cysts E. Urinary tract infection Answer

<12>During the passage of an intravenous catheter, numerous endothelial cells are dislodged from the lining of the popliteal vein. What substance allows platelet adhesion to the exposed collagen fibers? A. Factor VIII B. Factor IX C. Fibronectin D. Tissue factor E. Von Willebrand factor Answer

<13>A 57-year-old man presents to the emergency department with a nosebleed for the past 2 hours. The patient received a prosthetic heart valve 5 months ago and is currently taking warfarin (7.5 mg per day) and oral antibiotics. Laboratory evaluation reveals an INR (international normalized ratio, the ratio of patient to normal prothrombin times) of 6.4. Which of the following antibiotics is the patient most likely taking? A. Ampicillin B. Cephalexin C. Nitrofurantoin D. Norfloxacin E. Phenazopyridine Answer

<14>A 47-year-old woman presents with complaints of nervousness and increased sensitivity to hot weather. She is diagnosed with hyperthyroidism and prescribed propylthiouracil. What is the principal mechanism by which this drug acts? A. Decreasing the efficacy of TSH binding to the thyroid TSH receptor B. Decreasing the rate of proteolysis of thyroglobulin C. Increasing the amount of 3,3',5'-triiodothyronine (reverse T3; rT3) D. Inhibiting deiodination of thyroxine (T4) E. Inhibiting the uptake of iodide into the thyroid gland Answer

<15>Which of the following neurotransmitters is most important for the induction of REMsleep? A. Acetylcholine B. Dopamine C. Epinephrine D. Norepinephrine E. Serotonin Answer

<16>A 37-year-old woman presents with 3 days of progressive joint pain in her ankles, knees, and wrists. She recalls three similar episodes over the past several years. On examination, she has a temperature of 38.7 C, her blood pressure is 110/70 mm Hg, and her heart rate is 90/min. She has a diffuse petechial rash over her trunk and extensor surfaces. Her ankles and knees are swollen, red, and tender with decreased range of motion, and there is tenderness over the tendon sheaths of her hands and forearms. Blood cultures are negative. Aspiration of joint fluid reveals a white cell count of 22,000/mm3 with no visible organisms, but culture on chocolate agar is positive. Which of the following is an attribute of the causative organism that allows it to produce recurrent infections? A. It is an intracellular pathogen B. It is resistant to ceftriaxone C. It is resistant to complement-mediated lysis D. Its capsule is not immunogenic E. Its pili undergo antigenic and phase variation Answer

<17>The data presented below compares the results of a diagnostic test in the presence and absence of a disease. Disease present Disease absent Positive test 40 5

Negative test 10 95 Total 50 100 The specificity of the test is A. 0.05 B. 0.40 C. 0.80 D. 0.90 E. 0.95 Answer

<18>Blood stored in a blood bank tends, with time, to become relatively depleted of 2,3diphosphoglycerate. What effect does this have on the hemoglobin-oxygen dissociation curve? A. Shifts the curve to the left, so that the hemoglobin has a decreased oxygen affinity B. Shifts the curve to the left, so that the hemoglobin has an increased oxygen affinity C. Shifts the curve to the right, so that the hemoglobin has a decreased oxygen affinity D. Shifts the curve to the right, so that the hemoglobin has an increased oxygen affinity E. Does not change the dissociation curve Answer

<19>A psychotic, indigent man with a history of multisubstance abuse has been involuntarily hospitalized for 1 week. Because of persistent diarrhea, stools are sent for ova and parasites, revealing numerous granular, spherical, thin-walled cysts measuring 10-20 mm in diameter. Trichrome stains show up to four nuclei in most of the cysts. These finding are consistent with an infection by which of the following organisms? A. Cryptosporidium parvum B. Dientamoeba fragilis C. Entamoeba histolytica D. Giardia lamblia E. Isospora belli Answer

<20>A child who understands that the volume of a liquid poured out of a narrow glass remains the same when poured into a wider glass is at which of Piaget's stages of intellectual development? A. Concrete operations B. Formal operations C. Preoperational D. Sensorimotor Answer

<21>A 4-year-old girl is brought to a specialty clinic by her foster parents because of a limp in her right leg and a serum alkaline phosphatase (ALP) that is 10 times the adult upper limit of normal for the test. The child is withdrawn and clinging to her foster mother. Physical examination is remarkable for a blue-green discoloration of the skin overlying a tender, 3-cm mass on the anterior portion of the right mid-thigh. An x-ray of the right thigh reveals a dense mass within the femur that extends into the surrounding tissue. Which of the following best describes the increased alkaline phosphatase and physical findings in this case? A. ALP is abnormal for her age and the bone lesion represents an area of aseptic necrosis B. ALP is abnormal for her age and the bone lesion represents repair of a femoral fracture C. ALP is abnormal for her age and is unrelated to the bone lesion D. ALP is normal for her age and the bone lesion is an osteogenic sarcoma E. ALP is normal for her age and is unrelated to the bone lesion Answer

<22>Which of the following drugs antagonizes both the vascular and cardiac actions of norepinephrine? A. Atenolol B. Esmolol C. Labetalol D. Metaproterenol E. Prazosin Answer

<23>During surgery to treat an ischioanal abscess, the inferior rectal nerve is damaged. This nerve is a direct branch of which of the following nerves? A. Inferior gluteal nerve B. Pelvic splanchnic nerve C. Pudendal nerve D. Sciatic nerve E. Superior gluteal nerve Answer

<24>A 15-year-old girl is evaluated for failure to begin menstruation. Physical examination demonstrates short stature and a webbed neck. Chromosomal analysis demonstrates a lack of one X chromosome. This patient should be specifically evaluated for which of the following cardiovascular anomalies? A. Coarctation of the aorta B. Dextrocardia C. Ostium primum septal defect

D. E. Answer

Pulmonary stenosis Tetralogy of Fallot

<25>A baby is born with a testicular mass. Histologic sections made of the homogeneous yellow-white mass after its removal demonstrate epithelial-lined spaces that have flattened-to-cuboidal epithelial cells with vacuolated cytoplasm containing eosinophilic, hyaline-like globules. Scattered structures resembling primitive glomeruli (endodermal sinuses) are also seen. If appropriate immunohistochemical stains are performed, the eosinophilic cytoplasmic globules would most likely contain which of the following? A. Alpha-fetoprotein B. Estrogen receptors C. Human chorionic gonadotropin D. Human papilloma virus E. Melanin Answer

<26>A surgeon wishes to perform a splenectomy on a patient who has been in an automobile accident. Before removing the spleen, the splenic artery and splenic vein are ligated. Within which of the following peritoneal structures are the splenic artery and vein found? A. Gastrocolic ligament B. Gastrosplenic ligament C. Lesser omentum D. Splenorenal ligament Answer

<27>A 65-year-old woman with a long-standing disease has bone marrow fibrosis and increased bone remodeling, with bone resorption exceeding bone formation. She has a history of passing calcium-oxalate kidney stones. Which of the following lab result profiles would be expected in the serum of this patient? Calcium Phosphate PTH A. decreased decreased increased B. decreased increased decreased C. decreased increased increased D. increased decreased increased E. increased increased increased Answer

<28>Upon examination of a newborn male, a cystic structure is found in the scrotum. It is determined that there is a hydrocele of the

spermatic cord. Which of the following is the most likely etiology of this finding? A. Communication between the epididymis and the tunica vaginalis B. Failure of the processus vaginalis to form C. Failure of the processus vaginalis to fuse D. Incomplete fusion of the processus vaginalis E. Varicosities of the spermatic vein Answer

<29>A Brazilian immigrant is hired at a meat-packing plant, and undergoes an employment physical. Chest x-ray demonstrates a patchy, bilateral pneumonia and a lung mass, and he is referred to a specialist. Biopsy of the mass demonstrates fungal organisms with a few very distinctive "pilot's wheel" yeast forms. Which of the following is the most likely diagnosis? A. Blastomycosis B. Coccidioidomycosis C. Histoplasmosis D. Paracoccidioidomycosis E. Sporotrichosis Answer

<30>A 34-year-old female is brought to the emergency room with severe muscle cramps and carpopedal spasms. The patient was noted to be extremely irritable and was complaining of tingling around the mouth and in the hands and feet. A few hours later, laboratory examination reveals sodium 140 mEq/L, potassium 4.2 mEq/L, chloride 101 mEq/L, calcium 6.4 mg/dL, phosphate 5.1 mg/dL, magnesium 2.4 (normal 1.8-3.8 mg/dL) and alkaline phosphatase 67 U/L. A CT scan of the head shows basal ganglia calcifications. Prolonged QT intervals and T wave abnormalities are noted on electrocardiogram. The history is pertinent for a thyroidectomy two months prior to admission. Which of the following conclusions is most consistent with these data? A. An increase in dietary vitamin D is warrante B. Hepatocytes have a low 25-hydroxylase activity C. Intestinal cells are underexpressing calcium transporter genes D. Isolated cells from the kidney have high 1-hydroxylase activity E. The levels of 1,25-dihydroxy vitamin D are normal Answer

<31>A 48-year-old man presents to his physician with complaints of dizziness and fatigue. Physical examination reveals a blood pressure of 130/50 mm Hg and a heart rate of 100 beats per minute. On examination, the physician notes a large scar on the patient's abdomen. The man states that he was severely injured in an automobile accident several years ago, and required abdominal surgery at that time. Which of the following is the most likely

diagnosis? A. B. C. D. E. Answer

Arteriovenous fistula Cardiac tamponade Heart failure Hypovolemia Shock

<32>A renal pathologist examining the day's kidney biopsies notes that one biopsy shows amorphous red nodules within the glomerular mesangium in hematoxylin and eosin stained material. Congo red stain of the biopsy demonstrates apple-green birefringence of these nodules. These nodules are most likely to be related to which of the following? A. Acute urinary tract infection B. Diabetes mellitus C. Sarcoidosis D. Systemic lupus erythematosus E. Tuberculosis Answer

<33>A patient goes to his family doctor complaining of persistent and severe headaches. His physician diagnoses migraine headaches and prescribes sumatriptan. What is the mechanism of action of this drug? A. Dopamine1 agonist B. GABAB antagonist C. Muscarinic3 antagonist D. Non-selective beta antagonist E. Serotonin1D agonist Answer

<34>A 60-year-old man presents to his physician after a routine screening test indicates hyperlipidemia. Physical examination reveals raised, irregular, yellow papules in the skin of the soft tissues below the eyes. Biopsy of these lesions would most likely show which of the following? A. Benign nevus cells B. Malignant nevus cells C. Microscopic blisters D. Munro microabscesses E. Multinucleated giant cells Answer

<35> Trisomy 21 Positive test 100 Negative test 100

Normal karyotype 50 250

An experimental diagnostic test is developed to noninvasively detect the presence of trisomy 21, Down's syndrome. The test is administered to a group of 500 women considered to be at risk for a Down's fetus based on blood tests. The results of this test are shown above. What is the sensitivity of this new test? A. 40% B. 50% C. 67% D. 71% E. 83% Answer

<36>An autopsy is performed on a 60-year-old man who developed progressive dementia, parkinsonism, and visual hallucinations beginning 5 years prior to death. Histopathologic examination reveals numerous eosinophilic intracytoplasmic inclusions within neurons of substantia nigra, limbic cortex, and basal nucleus of Meynert. These inclusions are immunoreactive for ubiquitin. Which of the following is the most likely postmortem diagnosis? A. Alzheimer disease B. Amyotrophic lateral sclerosis (ALS) C. Diffuse Lewy body disease (dementia with Lewy bodies) D. Parkinson disease E. Pick disease Answer

<37>A 60-year-old factory worker reports to his physician that he can no longer push heavy boxes across the floor. Upon examination it is noted that the patient elevates the right shoulder when attempting shoulder flexion, but shoulder abduction is not impaired. The medial border of the right scapula is very prominent. Which of the following nerves innervates the affected muscle? A. Long thoracic nerve B. Lower subscapular nerve C. Musculocutaneous nerve D. Suprascapular nerve E. Upper subscapular nerve Answer

<38>The American Diabetes Association (ADA) recently lowered the cutoff value for fasting glucose used in diagnosing diabetes mellitus from 140 mg/dL to 126 mg/dL. This reference interval change would be expected to produce which of the following alterations? A. Decrease the test's sensitivity B. Increase the test's false negative rate C. Increase the test's negative predictive value

D. E. Answer

Increase the test's positive predictive value Increase the test's specificity

<39>An emergency room physician examines a patient who has fallen from a motorcycle and injured his shoulder. The clinician notices a loss of the normal contour of the shoulder and a abnormal-appearing depression below the acromion. Which of the following injuries did the patient most likely sustain? A. Avulsion of the coronoid process B. Dislocated shoulder joint C. Fracture of the mid shaft of the humerus D. Fracture of the surgical neck of the humerus E. Laceration of the axillary branch of the posterior cord Answer

<40>A 7-month-old child with failure to thrive is found to have a hemoglobin of 4.4 g/dL. The peripheral smear shows very small red cells with marked pallor. It is determined that the child has very low levels of hemoglobin A, with elevated fractions of hemoglobin A2 and hemoglobin F. Which of the following underlying mechanisms is most likely related to the observed findings? A. Amino acid substitution on b globin B. Antibody against fetal blood cells C. Cytoskeletal protein defect D. Insufficient production of b globin E. Iron deficiency Answer

<41>During a routine pelvic examination, a 20-year-old woman is found to have an enlarged uterus. Ultrasound studies demonstrate a multiloculated cystic structure within the uterine cavity, but no baby is identified. This mass is removed with dilation and curettage of the uterus, and placental-like tissue is observed during pathologic examination. Which of the following tumor markers would be most useful in establishing that residual tumor does not remain in the uterus? A. b-hCG B. Bombesin C. CEA D. PSA E. S-100 Answer

<42>On physical examination of a 7-year-old boy, the child's upper body

appears much more developed than his lower body. Blood pressure in the upper extremities exceeds that of the lower extremities. On cardiac examination, there is a midsystolic murmur over the anterior chest and back. The child's lower extremities are cold, and femoral pulses are absent. The part of the vascular system that is affected in this disorder is derived from which of the following embryologic structures? A. Bulbus cordis B. Ductus arteriosus C. Left horn of sinus venosus D. Right common cardinal vein E. Right horn of sinus venosus F. Third, fourth, and sixth aortic arches Answer

<43>A 42-year-old obese woman experiences episodic abdominal pain. She notes that the pain increases after the ingestion of a fatty meal. The action of which of the following hormones is responsible for the postprandial intensification of her symptoms? A. Cholecystokinin B. Gastrin C. Pepsin D. Secretin E. Somatostatin Answer

<44>A 42-year-old man was in an automobile accident and suffered severe pelvic trauma. The bulb of the penis and the urethra were torn from the inferior surface of the urogenital diaphragm. This has allowed urine to extravasate from the urethra. Into which of the following regions will the urine flow? A. Deep perineal space B. Ischioanal space C. Rectovesical pouch D. Retroperitoneal space E. Superficial perineal space Answer

<45>Karyotypic analysis of a spontaneously aborted fetus demonstrates trisomy of one of the chromosomes. Which chromosome is most likely to be affected? A. 8 B. 13 C. 16 D. 18 E. 21

Answer

<46>At which of the following locations might a penetrating wound to the heart damage the AV node? A. Apex of the heart B. Interatrial septum C. Interventricular septum D. Wall of the right atrium E. Wall of the left atrium Answer

<47>A 9-month-old infant is brought to the Health Department to receive the second dose of OPV (oral polio vaccine) 2 weeks after the first vaccination. The child has mild diarrhea, so the decision is made to defer further immunizations. Bacteriologic examination of a stool culture is unremarkable; however, a small, single-stranded, positive RNA virus is isolated from the specimen. This same agent was isolated from sewage effluent the preceding week. The viral isolate was not inactivated by ether. Which of the following viruses was most likely isolated? A. Adenovirus B. Hepatitis C C. Parvovirus B19 D. Poliovirus E. Rotavirus Answer

<48> The photomicrograph shows a section of synovium from the knee joint of a patient with rheumatoid arthritis (RA). Which of the following are the most abundant cells in the inflammatory infiltrate? A. Eosinophils B. Langhans type giant cells C. Lymphocytes and plasma cells D. Neutrophils E. Type A and B synovial cells Answer

<49>A 54-year-old African-American female patient undergoes a routine insurance physical examination. Chest x-ray reveals bilateral hilar masses. Biopsy of the masses shows granulomata, but acid-fast and fungal stains are negative for organisms. Which of the following diseases should be suspected? A. Caroli's disease B. Raynaud's disease C. Sarcoidosis D. Scleroderma E. Systemic lupus erythematosus Answer

<50>A neuroscientist discovers a way to selectively label neural crest cells in a developing laboratory animal. After birth, he sacrifices the animal and examines the tissue to search for labeled cells. Which of the following cell types will contain the label? A. Astrocytes B. Ependymal cells C. Microglia D. Oligodendroglia E. Pseudounipolar cells

Answer

Answers

1The correct answer is B. The most specific clue in the description is the presence of erythematous patches with central clearing, known clinically as "target lesions," which are associated with erythema multiforme. Both erythema multiforme and its severe, lifethreatening version, known as Stevens-Johnson syndrome, are produced by immune complex deposition in dermal blood vessels. In approximately 50% of patients, no specific precipitating cause is identified. In the remainder of patients, however, a variety of causes have been implicated, including certain infections (herpes simplex, enteroviruses, Mycoplasma pneumoniae, Chlamydia, histoplasmosis), drugs (penicillin, sulfonamides, phenytoin, aspirin, corticosteroids, cimetidine, allopurinol, oral contraceptives), neoplasia (leukemia, lymphoma, multiple myeloma, internal malignancy), sarcoidosis, and foods (notably emulsifiers in margarine). Erythema migrans chronicum (choice A) also produces an annular erythematous rash with central clearing, but usually affects the thigh, groin, and axilla; it is associated with Lyme disease. Kaposi's sarcoma (choice C) causes purple lesions with no target lesions. Psoriasis (choice D) causes erythematous plaques with silvery scale but does not produce target lesions. Urticaria (choice E) causes wheals that are intensely pruritic, but does not produce target lesions. 2The correct answer is C. Raloxifene is a selective estrogen receptor modulator that helps prevent osteoporosis by lessening bone resorption and reducing bone turnover. It lowers risk for vertebral fractures by 40% to 50%. It is a bone-preserving alternative for women who prefer to avoid estrogen. Raloxifene does not cause breast pain and may lessen the risk for breast cancer in menopausal women. There is also a favorable effect on LDL and cholesterol. Calcitonin nasal spray (choice A) is an osteoclastic bone resorption inhibitor that modestly increases bone mineral density and reduces the incidence of vertebral fracture. Although it is an estrogen alternative for bone preservation, its impact on hip fracture is not known. It is also lacks the anti-breast cancer properties of raloxifene. Oral conjugated estrogen (choice B) and transdermal estradiol (choice E) are not the best choices, as this patient wants to avoid estrogen because of a strong family history of breast cancer. The route of administration of estrogen has been shown to have similar effects on bone preservation, even though the transdermal dosage is generally half that of the oral dosage. Breast cancer risk, however, is slightly increased with the unopposed higher dosage oral estrogen replacement. Tamoxifen (choice D), while indicated in the long-term care of breast cancer patients, is not alone useful for treatment or prevention of osteoporosis. Tamoxifen is an anti-estrogen agent that competes with estrogen for binding sites. 3The correct answer is B. The nerve is the axillary branch of the posterior cord (also called the axillary nerve), which can be damaged by either fracture or dislocations of the humeral neck. The muscle is the deltoid muscle, which is supplied by this nerve. The deltoid arises

from the lateral portions of the clavicle and the acromion and inserts into the deltoid tuberosity of the humerus. The deltoid arises from both the acromion (choice A) and the clavicle. The deltoid does not arise from the coracoid process (choices C, D, and E). 4The correct answer is B. The patient has neurosyphilis, specifically general paresis, a term that means "general paralysis of the insane." In this late sequela of syphilitic infection which occurs 5 to 20 years after infection, patients develop mental deterioration, which precedes motor system deterioration, leading eventually to "general paralysis" with mutism and incontinence. The abnormalities may be conveniently recalled using paresis as a mnemonic for personality, affect, hyperactive reflexes, Argyll Robertson pupils in the eyes, defects in the sensorium, intellectual decline and deficient speech. Specific anti-treponemal tests such as FTA-ABS are usually positive on both serum and cerebrospinal fluid. The cerebrospinal (CSF) glucose (choice A) in neurosyphilis is usually normal. Gram's stain (choice C) of CSF will not demonstrate spirochetes in neurosyphilis. The CSF lymphocyte count (choice D) is typically elevated in neurosyphilis, but this is a nonspecific finding. The CSF neutrophil count (choice E) is usually normal in neurosyphilis.

5>The correct answer is A. The man described is probably suffering from avoidant personality disorder, characterized by feelings of inadequacy and extreme sensitivity to criticism, leading to social inhibition and withdrawal. These individuals often avoid interpersonal relationships entirely rather than subject themselves to the potential risk of criticism or rejection, although they may yearn for a more satisfying personal life. Borderline personality disorder (choice B) is characterized by unstable interpersonal relationships, instability of affect, impulsivity, feelings of emptiness or anger and, in some cases, paranoid or dissociative symptoms. Dependent personality disorder (choice C) is characterized by the need for constant support and reassurance, with unrealistic anxieties over being forced to fend for oneself. Narcissistic personality disorder (choice D) is characterized by excessive grandiosity and an exaggerated sense of self-importance, accompanied by a feeling of entitlement and a need for attention or admiration. Schizotypal personality disorder (choice E) is characterized by eccentricities of behavior, odd beliefs or magical thinking, and difficulties with social and interpersonal relationships.

6The correct answer is D. Respiratory syncytial virus is the most common cause of bronchiolitis and pneumonia in children younger than 1 year. Outbreaks occur seasonally in winter and early spring. Infection does not result in lasting immunity, and reinfection can occur. Coronavirus (choice A) causes the common cold (nasal obstruction and discharge, sneezing, no fever or mild fever, occasional sore throat, and/or cough) and acute pharyngitis (sore throat, with or without cervical adenopathy, ulceration, and conjunctivitis). Influenza type A (choice B) is the leading cause of influenza. Influenza is a systemic illness characterized by the sudden onset of fever, headache, myalgias, malaise, and prostration,

followed by cough, nasal obstruction, and sore throat. The lower respiratory tract may also be involved. Parainfluenza viruses (choice C) are the leading cause of croup, or acute laryngotracheobronchitis, in children. This infection involves both the upper and lower respiratory tracts. Inflammation in the subglottal area leads to hoarseness, dyspnea, a barking cough, and inspiratory stridor. Rhinovirus (choice E) is the most common cause of the common cold. 7The correct answer is D. Maturation of germ cells (spermatogenesis) within the seminiferous tubules occurs in a concentric pattern with the less mature spermatogonia near the basal lamina and the mature forms near the tubule center. Spermatogonia are 2N cells and mature into larger primary spermatocytes (4N) (choice A). These mature into secondary spermatocytes (2N) (choice B), and finally into spermatids (1N) (choice C). Spermatids undergo spermiogenesis to become mature spermatozoa (choice E). Acrosomes form from the Golgi apparatus and a flagellum forms from microtubules. Unneeded organelles are shed. The seminiferous tubules of a reproductive-age male should exhibit all stages of maturation, with mature flagellated sperm in their centers.

8The correct answer is C. The presentation described is classic for pulmonary hypertension, and, more specifically, the primary idiopathic form of pulmonary hypertension. This rare condition is suspected of being related to the collagen vascular diseases, since up to 50% of patients have antinuclear antibodies (despite the absence of frank presentation of other autoimmune disease). Also, a similar, known secondary form of pulmonary hypertension is sometimes seen in patients with a wide variety of collagen vascular diseases, including systemic lupus erythematosus, polymyositis, dermatomyositis, systemic sclerosis, and adult and juvenile forms of rheumatoid arthritis. A wide variety of other conditions have also been associated with secondary pulmonary hypertension, including shunts, left atrial hypertension, chronic hypoxia, pulmonary embolism, drug reaction, hepatic cirrhosis, and sickle cell disease. Both primary and secondary forms of pulmonary hypertension are associated with prominent changes in the pulmonary vasculature, which can include muscularization of smaller arterioles, concentric hypertrophy of the intima ("onion skinning"), and a distinctive plexiform lesion (plexogenic pulmonary vasculopathy) in which the smallest arterioles become markedly dilated with lumens partially occluded by endothelial (or possibly mesenchymal) cells and sometimes, thrombus. The prognosis of untreated pulmonary hypertension is poor. However, the use of the vasodilator hydralazine with anticoagulation can slow the course (fatal in about 3 years in untreated patients). If the pulmonary hypertension is secondary, therapy of the primary disease can be helpful. Unlike cor pulmonale, atrial fibrillation with mural thrombus (choice A) formation is uncommon in primary pulmonary hypertension. The absence of left ventricular findings on echocardiography tends to exclude myocardial infarction as the source of the patient's findings (choice B). The presence of enlargement of the main pulmonary artery excludes pulmonary artery stenosis (choice D). The clear lung fields exclude severe pulmonary fibrosis (choice E). 9The correct answer is B. The ureter leaves the renal pelvis and lies on the posterior abdominal wall as it descends to the pelvis. It crosses the pelvic brim at the level of the bifurcation of the common iliac artery. At this point it crosses anterior to the origin of the external iliac artery to enter the pelvis.

The origin of the common iliac artery (choice A) is at the bifurcation of the abdominal aorta, which occurs at the level of the fourth lumbar vertebra in the midline of the abdomen. Both ureters are lateral to the aortic bifurcation. The origin of the internal iliac artery (choice C) is at the bifurcation of the common iliac artery, which occurs at about the level of the first sacral vertebra. The ureter and the internal iliac artery both enter the pelvis with the ureter on the lateral side of the artery. The origin of the gonadal artery (choice D) (either the testicular artery or the ovarian artery) is from the abdominal aorta at a variable level, usually between the renal artery and the inferior mesenteric artery. The ureters are lateral to the origin of this artery. The origin of the renal artery (choice E) is from the abdominal aorta at about the level of the second lumbar vertebra. The renal arteries pass laterally to enter the renal pelvis. At this site, the ureter is posterior to the artery. 10The correct answer is D. This is an example of relative polycythemia, in which there is an increased hematocrit or RBC count without a true increase in the total number of body RBCs. What usually happens in these cases is a significant reduction in plasma volume due to processes such as dehydration, vomiting, diarrhea, or diuresis. Cyanotic heart disease (choice A), via appropriate erythropoietin secretion, can cause secondary absolute polycythemia. Increased erythropoietin (choice B), whether appropriately or inappropriately secreted, can cause secondary absolute polycythemia. Polycythemia vera (choice C) causes primary absolute polycythemia with usually low erythropoietin levels. Renal cell carcinoma (choice E), via inappropriate erythropoietin secretion, can cause secondary absolute polycythemia. 11The correct answer is E. Hypospadias, which is congenital displacement of the urethral opening onto the ventral surface (underside) of the penis, is due to malformation of the urethral groove and canal. Hypospadias frequently accompanies other genitourinary anomalies, especially cryptorchidism. Isolated hypospadias is repaired because the abnormal opening is often constricted, leading to urinary retention and ascending urinary tract infections. Another important consequence of hypospadias is sterility, which occurs if the opening is too close to the base of the penis to permit normal ejaculation. Although hypospadias can occur in isolation, it is strongly associated with other urogenital anomalies. Bladder exstrophy (choice A) is a completely unrelated congenital malformation in which the abdominal wall and anterior bladder wall form incompletely, and the bladder mucosa is exposed to the environment. Hydrocele (choice B) is a serous accumulation in the tunica vaginalis, often producing a readily apparent scrotal mass. Hydrocele usually arises without any obvious cause. Phimosis (choice C) is the condition in which the foreskin cannot be retracted over the head of the penis. It is usually either a congenital malformation or a consequence of scarring. Urachal cysts (choice D) are produced by areas of persistent urachal epithelium, which may be present anywhere between the bladder and the umbilicus. 12The correct answer is E. Von Willebrand factor (vWF) is a self-polymerizing clotting protein present in the serum and the subendothelial basal lamina, which has binding sites for collagen, platelets, and fibrin. At a site of injury, vWF forms the bridge between the exposed collagen fibers and platelets in circulation, stimulating platelet degranulation and initiating the cellular component of the clotting cascade. An equally important role for vWF is binding platelets to the newly formed fibrin strands in a blood clot.

Factor VIII (choice A) and Factor IX (choice B) are clotting proteins of the intrinsic pathway. Factor VIII acts in concert with activated Factor IX (IXa) to cleave Factor X to Xa. Xa is the prothrombin activator central to both the intrinsic and extrinsic pathways. Fibronectin (choice C) is a serum protein that acts as an opsonin for phagocytic cells in clots. Fibronectin binds non-specifically to bacteria and other materials in the newly forming clots, and draws the cell membrane of phagocytes into contact with these substances. Tissue factor (choice D) is a protein released from injured tissues that works in concert with Factor VII to initiate the extrinsic pathway of coagulation. Like Factors VIII and IX, tissue factor and Factor VII cleave Factor X to Xa. 13The correct answer is D. The patient is most likely experiencing a potentiation of the effects of warfarin by norfloxacin, which decreases the metabolism of the warfarin. The increased warfarin effect produces an increase in the INR. (The target INR for patients with prosthetic heart valves is usually 1.5-4, depending on the type of valve.) Although norfloxacin is the most likely drug among the choices given to cause this effect in this patient, the antibiotics most commonly associated with this type of interaction are the macrolides, such as erythromycin, metronidazole, and the sulfonamide antibiotics. Oral doses of penicillins, such as ampicillin (choice A), are generally not associated with a potentiation of warfarin's effect, although large IV doses of penicillin may be. Cephalexin (choice B) is a first-generation cephalosporin that can be used in the treatment of acute cystitis. Although this agent is generally not associated with an increased hypoprothrombinemic effect when given with warfarin, the cephalosporins with a methyltetrazolethiol side chain, such as cefazolin, cefmetazole, and cefoperazone, are known to increase warfarin's therapeutic effect. Nitrofurantoin (choice C) is a urinary anti-infective agent that does not interact with warfarin. Phenazopyridine (choice E) is a urinary tract analgesic that does not interact with warfarin, although it commonly changes the color of urine to a bright orange/red color, which the patient may mistake as blood in the urine. 14The correct answer is D. Propylthiouracil works primarily by inhibiting the peripheral conversion of T4 to T3. The thyroid extracts iodide from the plasma and, in an oxidative process, iodinates tyrosine residues in thyroglobulin molecules. Monoiodotyrosines and diiodotyrosines are formed and then coupled to produce either thyroxine (tetraiodothyronine, T4) or triiodothyronine (T3). Proteolytic cleavage of thyroglobulin molecules leads to free T3 or T4, which is then released into the circulation; T3 is several times more potent than T4. Peripheral deiodination of T4 at the 5' position leads to T3 formation (mainly in the liver); this step is inhibited by propylthiouracil. Decreasing the efficacy of TSH binding (choice A), decreasing the rate of thyroglobulin proteolysis (choice B), increasing the amount of rT3 formation (choice C), and inhibiting the uptake of iodide into the thyroid (choice E), would all tend to decrease the formation of thyroid hormones in the thyroid itself. 15The correct answer is A. Acetylcholine is the neurotransmitter of primary importance for the induction of REM sleep. Some of the other neurotransmitters do function in sleep, but REM sleep can occur in their absence. Dopamine (choice B) is a neurotransmitter with a role in voluntary movement, mood, cognition, and regulation of prolactin release. Epinephrine (choice C) is important in sympathetic nervous system responses. It is also a CNS neurotransmitter. Norepinephrine (choice D) is important in sympathetic nervous system responses. It is also a CNS neurotransmitter involved in attention, arousal, and mood.

Serotonin (choice E) is a CNS neurotransmitter that plays an important role in mood and sensation. In the periphery, it is involved in vascular regulation and digestive function. 16The correct answer is E. This is a case of Neisseria gonorrhoeae arthritis. Patients are continuously susceptible to reinfection because of antigenic variation and phase variation of the pili. N. gonorrhoeae is not an intracellular pathogen (choice A), although it may be found intracellularly in neutrophils after it has been phagocytized. Ceftriaxone (choice B) is the drug of choice for N. gonorrhoeae. Gonococci are especially susceptible to complement-mediated lysis, not resistant to it (choice C). N. gonorrhoeae has an insignificant capsule that does not play a major role in the pathogenesis, but its capsule is immunogenic (compare with choice D). Streptococcus pyogenes is the best known example of a nonimmunogenic capsule, made of hyaluronic acid, but virtually all other capsules are immunogenic. 17The correct answer is E. Specificity is the proportion of persons without the disease who are correctly identified by the test as being disease-free. It is given by TN/(FP + TN), where TN stands for true negatives (people who do not have the disease and test negative on the test) and FP stands for false positives (people who do not have the disease but test positive on the test). In this case, 95/(5 + 95) = 95/100 = 0.95. 18The correct answer is B. 2,3-diphosphoglycerate (2,3-DPG) is produced in red cells by a variation on the glycolytic pathway, and levels diminish when glycolysis by the red cells slows. The depletion of 2,3-DPG in stored blood causes the hemoglobin dissociation curve to shift to the left, leading to an increase in oxygen affinity. This increase is helpful in the picking up of oxygen by hemoglobin in the lungs, but can be very problematic in the release of oxygen from the blood in tissues. This is not just a theoretical point: considerable effort has been expended in developing improved solutions for storing packed red cells and methods for "restoring" older stored cells so that the 2,3-DPG levels are adequate. In practice, in otherwise reasonably healthy patients, older transfused blood will quickly regenerate 2,3DPG when placed in the glucose-containing environment of the serum, but even transiently decreased 2,3-DPG levels in a severely compromised patient can be dangerous. 19The correct answer is C. Entamoeba are relatively common enteric pathogens that can produce asymptomatic infection or more severe disease characterized by mucosal ulcerations and submucosal spread causing abdominal distress and liquid stools. Stools may show either trophozoite forms or the typical spherical cysts. Several species of Entamoeba are seen, including Entamoeba coli and E. hartmanni. E. histolytica cysts characteristically are spherical in shape, 10-20 mm in diameter, and have granular cytoplasm containing 1, 2, or 4 nuclei. Cryptosporidium parvum (choice A) infections occur in the immunocompromised population and may cause severe diarrhea. The organism presents as minute (2-5 mm) intracellular spheres or arc-shaped merozoites under normal mucosa, and can be difficult to appreciate by light microscopy. Cysts in the stool are too small (4-5 mm) to be confused with Entamoeba. Dientamoeba fragilis (choice B) is an intestinal amoeba that also may produce an infectious diarrhea. It does not have a cyst form, and only the trophozoite forms are seen in stools. Giardia lamblia (choice D) is a flagellate protozoan that infects the stomach and small intestine when contaminated water is ingested. Diagnosis is usually made by examining duodenal contents; however, the stools may contain the oval or elliptical cysts, which are thick-walled and measure 8-14 mm in diameter. Spherical cysts are not seen in Giardia infection.

Isospora belli (choice E) produces self-limited intestinal infections mostly in the tropics, where fever and diarrhea may last weeks to months. The stool-borne cysts are much larger than Entamoeba (30 x 15 mm), are asymetrical, and are typically almond-shaped. 20The correct answer is A. The concrete operational stage (age 7-11 years) is defined by the child's awareness of the conservation of volume, which demonstrates that the child is able to reason in a logical way in terms of the physical world. Note that the child does not develop understanding of abstract concepts until he or she has reached the formal operational stage (choice B), at age 11 to adulthood. The preoperational stage (choice C), ages 2 to 7 years, is associated with significant language development. However, the child has not yet developed the ability to take the perspective of others, and thus the child's thinking tends to remain egocentric. The sensorimotor stage (choice D) corresponds to ages 0 to 2 years and is characterized by the infant developing increasingly sophisticated sensorimotor skills and behavior patterns. 21The correct answer is B. The reference intervals for serum alkaline phosphatase (ALP) and serum phosphate are higher in children than in adults. Growing bone in children requires alkaline phosphatase secreted by osteoblasts and an increase in serum phosphate to provide a proper solubility product ([calcium] x [phosphorus]) for mineralization of bone. However, the normal serum ALP in children is no greater than 5-times the upper limit of normal for adults, hence this patient's ALP is abnormally elevated. The most likely scenario is that the child is a victim of abuse and has suffered a femoral fracture that is healing. Bone repair further increases the serum ALP owing to the increase in osteoblastic activity. Aseptic necrosis of bone in the leg (choice A) is more likely to occur in the femoral head (Legg-Calve-Perthes disease). This disease is more common in boys than girls and occurs in the 3- to 10-year-old age bracket. Although aseptic necrosis is associated with dense bone formation, it does not extend out into the soft tissue nor would it produce skin discoloration directly over the lesion (due to trauma in this case). Since the elevation in serum ALP is increased for age and related to the bone lesion, choice C is incorrect. Since the serum ALP is not normal for the age of this patient, choices D and E are incorrect. Furthermore, osteogenic sarcoma (choice D) does not normally occur in the first decade and favors the metaphysis of the distal femur or proximal tibia 22The correct answer is C. Norepinephrine (NE) is an agonist at alpha1-, alpha2- and beta1receptors. NE exerts its vascular actions via alpha (predominantly alpha1) receptors and its cardiac actions via beta1-receptors. Labetalol is a nonselective antagonist at alpha- and betareceptors, and therefore, could prevent all actions of NE. Atenolol (choice A) is a selective beta1 antagonist, and therefore would block only norepinephrine's cardiac effects. Esmolol (choice B) is a selective beta1 antagonist, and therefore would block only norepinephrine's cardiac effects. Metaproterenol (choice D) is a selective beta2 agonist and so would not block NE's effects. Prazosin (choice E) is a selective alpha1 antagonist and would therefore block most of norepinephrine's actions in the vasculature, but would not antagonize other effects. 23The correct answer is C. The pudendal nerve is a branch of the sacral plexus that exits from the greater sciatic foramen and then enters the lesser sciatic foramen to lie in the pudendal canal on the lateral wall of the ischioanal fossa. The inferior rectal nerve is a branch of the pudendal nerve, which crosses the ischioanal fossa to reach the anal canal where it innervates the external anal sphincter and provides sensory innervation to the area.

The inferior gluteal nerve (choice A), a branch of the sacral plexus, exits through the greater sciatic foramen and innervates the gluteus maximus muscle. The pelvic splanchnic nerves (choice B) are branches of the second, third, and fourth sacral nerves that carry preganglionic parasympathetic nerves to several pelvic organs. The sciatic nerve (choice D) is a branch of the lumbosacral plexus that exits through the greater sciatic foramen, then enters the lower limb to innervate muscles of the posterior thigh, the leg, and the foot, and provides sensory innervation to the area as well. The superior gluteal nerve (choice E) is a branch of the sacral plexus that exits through the greater sciatic foramen and innervates the gluteus medius, gluteus minimus, and tensor fascia latae muscles. 24The correct answer is A. The girl has Turner syndrome, which is specifically associated with coarctation of the aorta. Even when coarctation has not been diagnosed in early childhood and the patient appears to be doing well, surgical correction of any significant degree of coarctation is recommended. Uncorrected coarctation can cause death after about age 40 due to a variety of causes, including congestive heart failure, infective aortitis (analogous to infective endocarditis), and hypertension-induced intracranial hemorrhage or rupture of the damaged (pre-coarctation) aorta. Associate dextrocardia (choice B) with Kartagener syndrome. Associate ostium primum septal defect (choice C) with Down syndrome. Pulmonary stenosis (choice D) and tetralogy of Fallot (choice E) are not specifically associated with Turner syndrome. 25The correct answer is A. The malignant tumor is a yolk sac tumor, also known as infantile embryonal carcinoma and endodermal sinus tumor. The biggest tip-off in the question stem is the presence of endodermal sinuses that resemble primitive glomeruli. The cytoplasmic globules described contain alpha-fetoprotein, indicating yolk cell differentiation, and alpha-1antitrypsin. Alpha-fetoprotein can also be used as a serum marker for recurrent disease. Yolk sac tumors occur in pure form in infants and children and may be part of mixed tumors in adults. Estrogen receptors (choice B) are important markers in breast cancer because they predict tumor response to hormonal manipulation. Human chorionic gonadotropin (choice C) is found in the syncytial cells of embryonal carcinoma. Human papilloma virus (choice D) can be found in condylomas, cervical cancer, penile cancer, laryngeal polyps, and warts. Melanin (choice E) can be found in melanomas. 26The correct answer is D. The splenorenal ligament is the portion of the dorsal mesentery between the posterior abdominal wall and the spleen. This mesentery transmits the splenic artery and vein from their retroperitoneal position in the proximal portion of their course to the peritoneal spleen. The gastrocolic ligament (choice A) is the portion of the greater omentum between the greater curvature of the stomach and the transverse colon. This portion of mesentery is not related to the spleen. The gastrosplenic ligament (choice B) is the portion of the dorsal mesogastrium between the greater curvature of the stomach and the spleen. There are no splenic vessels in this mesentery. The lesser omentum (choice C) is derived from the ventral mesentery. It is the mesentery between the lesser curvature of the stomach and the liver and between the first portion of the duodenum and the liver. It is not related to the spleen.

27The correct answer is D. This is one of those questions for which having a good idea of what you are looking for before exploring the answer choices will certainly save you valuable time. The answers all look alike and you could have been easily confused if you were not confident of the answer before approaching the choices. This patient has long-standing hyperparathyroidism (elevated PTH), which predisposes to the development of osteitis fibrosa, her bone disease. PTH acts initially on osteocytes of bone tissue (osteocytic osteolysis) and subsequently on osteoclasts (osteoclastic resorption) to resorb calcium from bone matrix and make it available to the circulation. This increases plasma calcium levels. PTH also causes decreased phosphate reabsorption in the proximal renal tubule, yielding hypophosphatemia. Hypercalciuria is another sequela of excess PTH production, which predisposes the patient to the formation of calcium oxalate stones. Choices A and E correspond to neither hyper- nor hypoparathyroid states. Choice B is the profile of hypoparathyroidism. You should have quickly eliminated this choice since the PTH was decreased and you were looking for a profile consistent with HYPERparathyroidism. Choice C is the profile of secondary hyperparathyroidism. This occurs when there is parathyroid overproduction due to a nonparathyroid cause. By far, the most common cause is chronic renal failure. In such cases, there is decreased calcium absorption since the kidneys are involved in the conversion of 25(OH)D3 to the active form 1,25(OH)D3. The decreased calcium ion level stimulates the parathyroid, leading to elevated PTH levels. Hyperphosphatemia results from diminished renal synthesis of 1,25 dihydroxyvitamin D3, creating further calcium-phosphate imbalance and enhanced PTH production. 28The correct answer is D. The processus vaginalis is an evagination of the parietal peritoneum of the abdomen that descends through the inguinal canal before the descent of the testis. Normally, the distal end of this evagination remains patent as the tunica vaginalis and the remainder of the processus vaginalis fuses and becomes fibrous. If a part of the processus vaginalis does not fuse (incomplete fusion), the resulting cystic structure is a hydrocele of the spermatic cord. A communication between the epididymis and the tunica vaginalis (choice A) will result in the passage of sperm into the epididymis. This is a spermatocele. Failure of the processus vaginalis to form (choice B) would result in an absence of the tunica vaginalis. Total failure of the processus vaginalis to fuse (choice C) results in a persistent processus vaginalis. This results in congenital inguinal hernias. Varicosities of the spermatic cord (choice E) or the pampiniform plexus is termed a varicocele. 29The correct answer is D. Latin America and "pilot's wheel" budding yeast are clues for paracoccidioidomycosis. This disease is caused by Paracoccidioides brasiliensis, a dimorphic fungus that is found as a multiply-budding yeast in tissues. Clues for questions about blastomycosis (choice A) would include spending time in states east of the Mississippi River and fairly large yeast. Clues for questions about coccidioidomycosis (choice B) would be spending time in the southwestern deserts of the United States and spherules filled with endospores. Clues for questions about histoplasmosis (choice C) would be spending time in the Ohio, Mississippi, and Missouri River Valleys and finding tiny yeast forms in macrophages. Clues for questions about sporotrichosis (choice E) would be skin lesions in rose gardeners. 30The correct answer is C. The patient presents with the classic symptoms of acute hypocalcemia secondary to hypoparathyroidism, itself the result of overzealous thyroid removal by the surgeon causing damage to the nearby parathyroid glands. Other classic

findings would have been Trousseau's sign (carpal spasm after application of a blood pressure cuff) and the Chvostek's sign (facial muscle contraction on tapping in front of the ear). Serum calcium is low and serum phosphate is high, with normal alkaline phosphatase. The magnesium is normal, ruling it out as a cause of the tetany (and also indirectly ruling out chronic alcoholism or renal losses as causes). The calcifications seen on CT scan are a sign of overmineralization due to an unfavorable [calcium] x [phosphate] product. Acute treatment with calcium gluconate and, if possible, 1,25-dihydroxy vitamin D3 (cholecalciferol) is necessary. Hypocalcemia normally triggers parathyroid hormone (PTH) release from the parathyroid glands. PTH can increase bone resorption by stimulating osteoclastic activity and can promote calcium reabsorption at the level of the kidney distal tubule (to the expense of phosphate), but has no direct effect on intestinal absorption of calcium and phosphate, which are under vitamin D control. However, PTH is required to activate 1-hydroxylase in the kidney, the rate-limiting step in metabolism of Vitamin D3 to its active metabolite, 1,25dihydroxy-D3. This metabolite helps to raise serum calcium by increasing proximal intestinal absorption of calcium. The lack of 1,25-dihydroxy-D3 would be expected to prevent expression of these calcium transporters. The active metabolite works in concert with PTH to increase osteoclastic activity, promote calcium reabsorption in the kidney, oppose the phosphate losses, and most uniquely, promote calcium and phosphate intestinal absorption. An increase in dietary vitamin D (choice A) would not be helpful at this time, particularly since the lack of PTH would preclude the activation of the precursor vitamin to the dihydroxylated metabolite. Rather oral calcium would be eventually needed on a chronic basis. Hepatocytes would not have a low 25-hydroxylase activity (choice B) for two reasons: PTH has no effect on this first hydroxylation step and, more generally, it is not a controlled enzymatic reaction. Isolated cells from the kidney do not have high 1-hydroxylase activity (choice D) since PTH is no longer present to activate this step. The levels of 1,25-dihydroxy vitamin D (choice E) would be found to be abnormally low.

31The correct answer is A. The patient has an acquired arteriovenous fistula, probably caused by previous abdominal surgery. The decrease in peripheral resistance associated with an arteriovenous fistula causes an increase in cardiac output when the fistula is large (which usually requires involvement of a major artery such as the aorta, subclavian artery, femoral artery, common carotid artery, or iliac artery). The increase in cardiac output caused by the fistula is roughly equal to the blood flow through the fistula. The increase in cardiac output is associated with increases in both heart rate and stroke volume. The diastolic blood pressure falls because blood can rapidly exit the arterial system through the fistula, but mean blood pressure is maintained relatively constant because the normal long-term blood pressure regulating mechanisms (e.g., renal body fluid feedback mechanism) still operate normally. The decrease in diastolic pressure with a normal or slightly increased systolic pressure causes the arterial pulse pressure to increase in arteriovenous fistula (note that pulse pressure is 80 mm Hg in this problem; normal is ~40 mm Hg). The pulse pressure is decreased in cardiac tamponade (choice B), heart failure (choice C), hypovolemia (choice D), and shock (choice E). 32The correct answer is E. Glomerular nodules may be either the Kimmelstiel-Wilson nodules of diabetes mellitus or may be composed of amyloid. An amyloid origin can be confirmed by staining with Congo red, which causes the nodules to stain red with ordinary light but exhibit a distinctive "apple-green" birefringence when viewed with polarized light.

The most common type of amyloid (type AA) is due to deposition of altered immunoglobulin light chains and is seen in diseases with chronic antigenic stimulation, such as tuberculosis. Acute urinary tract infection (choice A) is an infection of too short a duration to cause amyloidosis. Diabetic mellitus (choice B) is associated with glomerular nodules called KimmelstielWilson nodules, but these will not show apple-green birefringence when viewed with polarized light. Sarcoidosis (choice C) typically involves the lymph nodes, lungs, spleen, and to a lesser extent, the skin and eye. It is unrelated to amyloidosis. Systemic lupus erythematosus (choice D) can produce a wide range of renal lesions, but amyloid nodules are not among the likely manifestations 33The correct answer is E. Sumatriptan is a serotonin1D agonist that is used to abort migraine headaches. It is also effective in the treatment of cluster headaches. Currently, no dopamine1 (D1) agonists (choice A), GABAB antagonists (choice B), or muscarinic3 (M3) antagonists (choice C) are used clinically. Propranolol is an example of a non-selective beta antagonist (choice D). 34The correct answer is E. The lesions are xanthomas, which are tumor-like dermal collections of foamy histiocytes containing cholesterol and lipids. The lesions may also contain multinucleated giant cells (Touton giant cells) with clustered nuclei and foamy cytoplasm. Xanthomas may be idiopathic or may be related to hyperlipidemia or lymphoproliferative malignancies (e.g., leukemias and lymphomas). Nevus cells are a type of melanocyte. Benign nevus cells (choice A) are a feature of the common nevus, or mole. Malignant nevus cells (choice B) are a feature of malignant melanoma. Microscopic blisters (choice C) at the dermal/epidermal junction are a feature of dermatitis herpetiformis. Munro microabscesses (choice D), small collections of neutrophils in the cornified epidermis, occur in psoriasis. 35The correct answer is B. Sensitivity is defined as the ability of a test to detect the presence of a disease in those who truly have the disease. It is calculated as the number of people with a disease who test positive (true positive) divided by the total number of people who have the disease (true positive + false negative). In this case, sensitivity equals the number of babies born with trisomy 21 whose mothers tested positive (100) divided by the total number of babies born with trisomy 21. This yields 100/200 = 50% (not a very sensitive test). 40% (choice A) corresponds to the prevalence of the disease in the tested population, which in this case equals the total number of babies with Down's syndrome (true positive + false negative = 100 + 100= 200) divided by the total number of people tested (500). This yields 200/500= 40%. 67% (choice C) corresponds to the positive predictive value of the test, which equals the number of babies with Down's whose mothers test positive (true positives = 100) divided by the total number of mothers testing positive (true positive + false positive = 150). This yields 100/150 = 67%. 71% (choice D) corresponds to the negative predictive value of the test, which equals the number of normal babies whose mothers tested negative (250) divided by the total number of people testing negative (350). This yields 250/350 = 71%. 83% (choice E) corresponds to the specificity of the test, which equals the number of babies without Down's whose mothers tested negative (250) divided by the total number of babies without Down's (300). This yields 250/300 = 83%. An easy way to remember these concepts is:

Sensitivity = true positives/all diseased Specificity = true negatives/all normal PPV = true positives/all positives NPV = true negatives/all negatives Prevalence = all diseased/total population 36The correct answer is C. This question focuses on neurodegenerative and dementing illnesses. The correct answer can be deduced by combining clinical and pathologic features. Dementia with Lewy bodies (or diffuse Lewy body disease) is characterized by widespread formation of Lewy bodies within neurons of substantia nigra, cholinergic nuclei (basal nucleus of Meynert), and limbic cortex (especially cingulate gyrus), for example. Once thought to be infrequent, recent clinicopathologic investigations have suggested that this might be one of the most frequent causes of dementia in industrialized countries, perhaps second only to Alzheimer disease. Peculiar to this dementing disorder is the presence of extrapyramidal symptoms and visual hallucinations, as well as an undulating clinical course. Alzheimer disease (choice A) accounts for at least 60% of all cases of dementia in industrialized countries and is characterized by high numbers of senile plaques and neurofibrillary tangles in the hippocampus, neocortex, and cholinergic nuclei of the basal forebrain. There is no involvement of the substantia nigra and thus no extrapyramidal symptoms. ALS (choice B) can be ruled out because of the clinical picture. ALS is caused by degeneration of motor neurons in the anterior horns of the spinal cord and/or large pyramidal neurons in the primary motor cortex (area 4). Thus, this condition will manifest with progressive weakness involving lower and upper extremities. Skeletal muscles become atrophic (hence the term amyotrophic) and show a denervation pattern on biopsy. Occasionally, dementia may be associated. Parkinson disease (choice D) is due to degeneration of dopaminergic neurons in the substantia nigra and manifests with tremor, rigidity, and akinesia. A subset of patients with Parkinson disease develops dementia. Thus, Parkinson disease may be difficult to differentiate from dementia with Lewy bodies. However, Lewy bodies are absent in cortical regions of patients with classic Parkinson disease. Pick disease (choice E) is the most frequent of dementing disorders in the category of frontotemporal dementia. This condition leads to extreme atrophy of frontal and temporal cortex, with relative sparing of the remaining neocortical regions. Neocortical neurons bear round intracytoplasmic inclusions, known as Pick bodies, which contain altered neurofilaments, tau, and ubiquitin. No inclusions are found in the substantia nigra. 37The correct answer is A. The muscle involved is the serratus anterior, which draws the scapula forward and rotates it upward. It is also the major muscle used in all reaching and pushing movements. When this muscle is paralyzed, the medial border of the scapula is prominent, known as winging of the scapula. This muscle is innervated by the long thoracic nerve, which originates from C5, 6, and 7. The lower subscapular nerve (choice B) innervates the subscapularis and the teres major. The subscapularis is one of the rotator cuff muscles and works with the supraspinatus, the infraspinatus, and the teres minor to maintain approximation of the head of the humerus in the glenoid cavity. The subscapularis also assists medial rotation of the arm while in a dependent position. The musculocutaneous nerve (choice C) supplies the coracobrachialis. When the arm is already in an extended position, this muscle will bring it forward and medially. The biceps brachii and the brachialis are also innervated by this nerve. The biceps brachii assists with shoulder flexion, elbow flexion, and supination of the forearm. The brachialis also flexes the elbow joint.

The suprascapular nerve (choice D) innervates the supraspinatus and the infraspinatus muscles. These muscles, along with the subscapularis and teres minor, are termed the rotator cuff muscles. The upper subscapular nerve (choice E), along with the lower subscapular nerve innervates the subscapularis. 38The correct answer is C. The negative predictive value of a test (PV-) refers to the percent chance that a normal test result is a true negative (TN; a healthy person with a normal test result) rather than a false negative (FN; a diseased person with a normal test result). It is expressed by the following formula: PV- = TN/(TN + FN) Similarly, the positive predictive value of a test (PV+) reflects the probability that an abnormal test result represents a true positive (TP) rather than a FP (a TP is an abnormal test result in an individual with disease, while a FP is an abnormal test result in a healthy person). PV+ is calculated using the following formula: PV+ = TP/(TP + FP) There is a relationship between the test's sensitivity (the ability of a test to detect disease in those who truly have the disease), specificity (ability of the test to correctly identify those without disease) and the PV- and PV+, respectively. Tests with 100% sensitivity (no FNs) and tests with 100% specificity (no FPs) automatically have a PV- and PV+ of 100%, respectively. Changing the reference interval of a test alters its sensitivity, specificity, PV+, and PV-. In this question, lowering the upper limit of the reference interval of a fasting glucose from 140 mg/dL to 126 mg/dL increases the test's sensitivity, since a lower glucose cut-off approaches the normal value for glucose in the normal population (70-110 mg/dL). Furthermore, increasing the test's sensitivity automatically increases the test's PV-, since there are fewer FNs. The test's sensitivity is increased (choice A) rather than decreased by the given change in the reference interval. Since the test's sensitivity is increased, the FN rate at the new reference interval is decreased (choice B). The test's positive predictive value (choice D) decreases, since the test's specificity, which ultimately determines its FP rate, decreases as the test's sensitivity increases. Stated another way, a greater number of normal individuals will have FP fasting glucose levels when the test's upper limit is decreased to 126 mg/dL. A test's sensitivity is inversely related to its specificity. For example, changing the reference interval of a test to increase its sensitivity automatically lowers its specificity (choice E), since the number of FPs will increase. Similarly, when altering a reference interval to increase a test's specificity, its sensitivity is reduced because of an increase in the number of FNs. In summary, lowering a test's upper limit of normal increases the test's sensitivity, which decreases the FN rate, and increases the PV-. Increasing the test's sensitivity also decreases the test's specificity. Decreasing a test's specificity increases the FP rate and decreases the PV+. 39The correct answer is B. The abnormal depression described is a characteristic tip-off for a dislocated shoulder joint. This is important to remember, as it may help you make a rapid diagnosis. Avulsion of the coronoid process (choice A) of the ulna (at the elbow) can occur following a severe contracture of brachialis. Fracture of the mid-shaft of the humerus (choice C) may produce a "bend" in the upper arm.

Fracture of the surgical neck of the humerus (choice D) can lacerate the axillary branch of the posterior cord (choice E, also called axillary), causing paralysis of the deltoid. 40The correct answer is D. This child most likely has b+ thalassemia, an autosomal recessive disease that, in the homozygous state, produces defects in the transcription, processing, or translation of b globin mRNA. The predominant hemoglobin switches from HbF (a2g2) to HbA (a2b2) at about 6 months of age, at which point these children become markedly anemic because of their inability to synthesize the b globin chain. The anemia of b thalassemia is microcytic and hypochromic with anisocytosis. Amino acid substitutions in b globin (choice A) lead to hemoglobinopathies, of which sickle cell anemia is the archetype. Homozygotes with these hemoglobin variants do not produce any HbA, but rather mutant types, such as HbS, HbC and HbM. Antibodies against fetal blood cells (choice B) are generally produced by a mother who has been sensitized to fetal blood antigens by transfusion or a previous pregnancy. Such immunemediated hemolysis leads to intrauterine anemia and hydrops fetalis. Cytoskeletal protein defects (choice C), such as spectrin deficiency causing hereditary spherocytosis, produce anemia and jaundice that are apparent at birth. The RBCs contain the normal types of hemoglobin. Iron deficiency anemia (choice E) is due to inadequate iron stores for the production of the heme iron in hemoglobin. Although iron deficiency anemia is not uncommon in infants because human breast milk has only small amounts of iron, the resultant microcytic anemia is not associated with abnormal types of hemoglo 41The correct answer is A. The lesion described is a hydatidiform mole, a tumor-like mass that typically forms when an egg that has lost its nucleus, containing only paternal chromosomes from two sperm, tries to develop. High levels of b-hCG (beta-human chorionic gonadotropin) are produced by these moles. Choriocarcinomas and gestational trophoblastic tumors can also produce high levels of b-hCG. Bombesin (choice B) is a useful tumor marker for neuroblastoma, small cell carcinoma, gastric carcinoma, and pancreatic carcinoma. CEA (choice C), or carcinoembryonic antigen, is a non-specific marker used to follow some colorectal, pancreatic, and less commonly gastric and breast carcinomas. PSA (choice D), or prostate-specific antigen, is a marker for prostatic carcinoma. S-100 (choice E), is a marker for melanoma, neural tumors, and astrocytoma 42The correct answer is F. This patient has coarctation of the aorta (constriction of the ascending aorta), which is suggested by a midsystolic murmur over the anterior part of the chest and back, hypertension in the upper extremities, and absent or delayed pulsations in the femoral arteries. The upper extremities and thorax may be more developed than the lower extremities. Patients with coarctation of the aorta may experience symptoms such as cold extremities as a result of tissue ischemia.The truncus arteriosus gives rise to the proximal portions of the ascending aorta and the pulmonary trunk. The third, 4th, and 6th aortic arches and the right and left dorsal aortae contribute to the remainder of the aorta. The bulbus cordis (choice A) gives rise to the right ventricle and the aortic outflow tract. 98% of cases of coarctation of the aorta take place immediately distal to the offshoot of the left subclavian artery, close to the junction of the ductus arteriosus (choice B) with the aorta. The left horn of the sinus venosus (choice C) gives rise to the coronary sinus. The right common cardinal vein (choice D) gives rise to the superior vena cava. The right horn of the sinus venosus (choice E) gives rise to the smooth part of the right atrium.

43The correct answer is A. This woman has a risk profile (female, fat, forties) and symptomatology consistent with gallstones (cholelithiasis). As would be expected, contraction of the gallbladder following a fatty meal often exacerbates the pain caused by gallstones. Cholecystokinin (CCK), the release of which is stimulated by dietary fat, is the hormone responsible for stimulation of gallbladder contraction. It is produced in I cells of the duodenum and jejunum. In addition to gallbladder contraction, CCK also stimulates pancreatic enzyme secretion and decreases the rate of gastric emptying. Gastrin (choice B) is produced by the G cells of the antrum and duodenum. Gastrin stimulates the secretion of HCl from the parietal cells and pepsinogen from the chief cells of the stomach. Gastrin secretion is stimulated by gastric distention, digestive products (e.g., amino acids), and vagal discharge. Pepsin (choice C) is a protease produced by the chief cells of the stomach (as pepsinogen). It is involved in the digestion of proteins. Pepsinogen release is stimulated by vagal stimulation, gastrin, local acid production, secretin, CCK, and histamine. Secretin (choice D) is produced by the S cells of the duodenum. It is secreted primarily in response to acidification of the duodenal mucosa. Secretin stimulates the secretion of bicarbonate-containing fluid from the pancreas and biliary ducts. This neutralization allows pancreatic enzymes to function. Secretin also inhibits gastric acid production and gastric emptying. Somatostatin (choice E) is produced by the D cells of the pancreatic islets and in the gastric and intestinal mucosa. Somatostatin is an inhibitory hormone-it inhibits most gastrointestinal hormones, gallbladder contraction, gastric acid and pepsinogen secretion, pancreatic and small intestinal fluid secretion, and both glucagon and insulin release. 44The correct answer is E. The bulb of the penis contains the urethra, and is found in the superficial perineal space. The superficial perineal space is found between the inferior fascia of the urogenital diaphragm (perineal membrane) and the superficial perineal fascia (Colles' fascia). The attachments of the superficial perineal fascia to the posterior edge of the urogenital membrane and to the ischiopubic rami prevent the urine from escaping posteriorly into the gluteal region or laterally into the thigh. The urine can escape anteriorly onto the anterior abdominal wall, where it will be deep to the superficial abdominal fascia (Scarpa's fascia). The deep perineal space (choice A) is the region within the urogenital diaphragm that contains the sphincter urethrae muscle and the bulbourethral (Cowper's) gland in the male. The ischioanal space (choice B) is the space between the pelvic diaphragm and the urogenital diaphragm that is continuous with the space between the pelvic diaphragm and the lateral pelvic wall. This space is mostly filled with fat. The rectovesical space (choice C) is within the peritoneal cavity of the male and is the region between the urinary bladder and the rectum. The retroperitoneal space (choice D) is the region between the parietal peritoneum and the endoabdominal fascia. This space contains connective tissue, fat, and several organs, including the kidney and ureter. 45The correct answer is C. Approximately half of all spontaneous abortions are of fetuses with major chromosomal defects, most commonly trisomy 16, triploidy (due to fertilization of an egg by two sperm), and 45 X,0 (Turner's syndrome). Trisomy 16 and triploidy do not produce viable offspring, unlike 45 X,0. Trisomy 8 (choice A) is one of the very rare causes of live birth trisomies. Trisomy 13 (choice B) is one of the more common live birth trisomy syndromes (Patau syndrome). Trisomy 18 (choice D) is one of the more common live birth trisomy syndromes (Edwards' syndrome)

Trisomy 21 (choice E) causes Down's syndrome. 46The correct answer is B. The atrioventricular (AV) node is in the subendocardium of the interatrial septum. From the AV node, the Purkinje fibers of the atrioventricular bundle enter the interventricular septum to carry impulses to the ventricle. The function of the AV node is to retard the conduction of the cardiac impulses so that ventricular systole occurs after atrial systole. The apex of the heart (choice A) is composed of ventricular wall musculature of the left ventricle. There is no nodal tissue in this region. The interventricular septum (choice C) contains the common bundle (AV bundle) and the right and left bundle branches of the cardiac conduction system. These bundles are composed of Purkinje fibers, which are specialized cardiac muscle cells. The sinoatrial (SA) node is located in the right atrial wall (choice D), near the entrance of the superior vena cava. The SA node contains specialized cardiac muscle cells that depolarize more rapidly than do typical cardiac muscle cells, thereby serving as the pacemaker of the heart. The wall of the left atrium (choice E) does not contain any nodal cells. 47The correct answer is D. Poliovirus, which is a single-stranded +RNA virus, is naked (i.e., non-enveloped) and hence will not be inactivated by lipid solvents such as ether. The live virus vaccine had colonized the intestinal tract of the infant and was still being shed 2 weeks after the earlier oral dose. This same virus, the vaccine strain, is likely to be found in sewage, as all vaccinated infants will shed virus for a period of time after immunization with OPV. Adenoviruses (choice A) and parvovirus B19 (choice C) also may cause diarrheal disease and both are non-enveloped; however, they both have a DNA genome. Hepatitis C (choice B) is an enveloped, single-stranded +RNA virus; its major target organ is the liver, not the intestinal tract. It is a fragile agent that does not survive well outside the body and would not be isolated from raw sewage effluent. Rotavirus (choice E) is the major cause of diarrheal disease in infants under the age of 2 years. It is a member of the reovirus family and, as such, is double-stranded. This virus causes hospitalization of 30% to 40% of the infected infants and kills hundreds of thousands of infants in developing nations where access to hospitals is not readily available. Therapy for the watery diarrhea produced by this agent is fluid and electrolyte replacement. 48The correct answer is C. Lymphocytes and plasma cells aggregate near and around blood vessels (perivascular accumulation) in this example of chronic inflammation of the synovium. Lymphocytes have dark nuclei with little visible cytoplasm. Plasma cells are larger with a distinct cytoplasm and an eccentric nucleus. The synovial lining is thickened from its normal 1-2 layers. Note that you did not have to be able to recognize lymphocytes and plasma cells in the photomicrograph to answer this question. Because RA is associated with a chronic inflammatory infiltrate, lymphocytes and plasma cells must be the correct answer. Eosinophils (choice A) are not evident here and do not seem to play a role in RA. Langhans type giant cells (choice B), or multinucleated histiocytes, are not evident here but may appear during the later stages of RA. Neutrophils (choice D) are not evident here; they are instead associated with acute inflammation. Type A and B synovial cells (choice E) are the two cell types of the synovial lining. They increase in number but are not the cells of the perivascular infiltrate. 49The correct answer is C. Sarcoidosis is a multisystem disease characterized by noncaseating granulomata in a variety of organs. The disease may be symptomatic (respiratory and constitutional symptoms) or may be discovered incidentally when chest x-ray or autopsy

reveals bilateral hilar adenopathy. Definitive diagnosis is based on biopsy, which reveals noncaseating granulomata that are negative for fungi or acid-fast bacilli. Sarcoidosis is more common in individuals of African descent. Caroli's disease (choice A) is a congenital malformation of the bile duct system. Raynaud's disease (choice B) is a vasospasm of vessels that causes temporary ischemia in the hands. Scleroderma (choice D), or progressive systemic sclerosis, is characterized by progressive fibrosis of skin and internal organs. Systemic lupus erythematosus (choice E) is an autoimmune disease characterized by vasculitis (which may produce a variety of symptoms depending on the site of the lesion), rash, renal disease, hemolytic anemia, and neurologic disturbances. 50The correct answer is E. Pseudounipolar cells of spinal and cranial nerve ganglia derive from the neural crest. Other cell types that derive from neural crest include Schwann cells, multipolar ganglion cells of autonomic ganglia, chromaffin cells of the adrenal medulla, odontoblasts, melanocytes, and cells that make the leptomeninges (pia and arachnoid). All of the other cell types listed derive from the neural tube. (12) <1>A 61-year-old woman with leukemia abruptly develops an intensely itchy rash. Physical examination demonstrates multiple erythematous patches of the distal arms and legs, some of which involve the palms and soles. Some of the patches show central clearing with surrounding erythematous rings. Which of the following is the most likely diagnosis? A. Erythema migrans chronicum B. Erythema multiforme C. Kaposi's sarcoma D. Psoriasis E. Urticaria Answer

<2>A 52-year-old woman presents to her physician for a check-up. She is recovering from a wrist fracture after a fall. Dual energy x-ray absorptiometry of the hip had shown her to have osteoporosis. She became menopausal at age 50 and did not begin hormone replacement therapy because of a strong family history of breast cancer. She now fears a future hip fracture and would like to begin a bone loss prevention regime.Which of the following pharmaceutical agents is most appropriate for this patient? A. Calcitonin nasal spray B. Oral conjugated estrogen C. Raloxifene D. Tamoxifen E. Transdermal estradiol Answer

<3>A fracture of the humerus neck damages a nerve running around the humera l neck. After the fracture heals, the patient notices a marked decrease in his ability to raise his arm over his head. The denervated muscle arises

from which of the following? A. Acromion alone B. Clavicle and acromion C. Clavicle and coracoid D. Coracoid alone E. Coracoid and acromion Answer

<4>A patient is admitted to a psychiatric hospital after having been picked up by the police for making inappropriate sexual advances. A detailed psychiatric interview demonstrates deficits in memory, insight, judgement, personal appearance, and social behavior. The patient is witnessed experiencing a possible epileptic seizure. Over a period of several years, motor findings also develop, including relaxed, but expressionless facies, tremor, dysarthria, and pupillary abnormalities. Which of the following tests performed on his cerebrospinal fluid would most likely be diagnostic? A. CSF glucose B. FTA-ABS C. Gram's stain D. Lymphocyte count E. Neutrophil count Answer

5.A 42-year-old man has just been informed that he has poorly differentiated small cell carcinoma of the lung. When asked if he understands the serious nature of his illness, the patient proceeds to tell his physician how excited he is about renovating his home. This patient is exhibiting A. denial B. displacement C. projection D. rationalization E. reaction formation F. sublimation Answer

<6>A 3-month-old infant presents with a 3-day history of fever, cough, and poor feeding. On examination, the baby appears ill and has a temperature of 102 F and a respiratory rate of 32. A chest x-ray film shows bilateral patchy infiltrates in the lungs. Which of the following is the most likely etiologic agent? A. Coronavirus B. Influenza type A C. Parainfluenza type 1 D. Respiratory syncytial virus E. Rhinovirus

Answer

<7>A 35-year-old male presents to the urologist for an infertility evaluation. A biopsy of his testis is performed to check sperm production and maturation. A microscopic section reveals only a few germ cells near the basal lamina in the seminiferous tubule. Which of the following cells is the germ cell closest to the basal lamina in the seminiferous tubule? A. Primary spermatocyte B. Secondary spermatocyte C. Spermatid D. Spermatogonia E. Spermatozoa Answer

<8>A 30-year-old otherwise healthy woman presents to her physician with complaints of fatigue and dyspnea. Physical examination reveals normal breath sounds and the presence of third and fourth heart sounds. Chest x-ray shows clear lung fields but right ventricular enlargement, main pulmonary artery enlargement, and "pruning" of the peripheral vasculature. Electrocardiogram shows right axis deviation and right ventricular hypertrophy. Left ventricular function appears normal on echocardiography . Serologic studies show antinuclear antibodies. Which of the following pathological findings would this patient also show, either at autopsy or if an appropriate biopsy was taken? A. Mural thrombus of the right atrium B. Necrosis and scarring of the left ventricle C. Plexogenic pulmonary vasculopathy D. Pulmonary artery stenosis E. Severe pulmonary fibrosis Answer

<9>During an abdominal surgical procedure, the surgeon wishes to locate the ureter in order to ensure that it is not injured. The ureter may be found immediately anterior to the origin of the A. common iliac artery B. external iliac artery C. internal iliac artery D. gonadal artery E. renal artery Answer

<10>A patient with mild congestive heart failure is treated with high-dose furosemide and diureses 25 pounds of fluid. A complete blood count (CBC) taken before the diuresis shows an RBC count of 4 million/mm3; a CBC taken after diuresis shows a RBC count of 7 million/mm3. Which of the following is the most likely explanation? A. Cyanotic heart disease B. Increased erythropoietin

C. D. E. Answer

Polycythemia vera Relative polycythemia Renal cell carcinoma

<11>A newborn male child is noted to have hypospadias. A complete evaluation determines that the child has no other genitourinary anomalies. Nonetheless, hypospadias repair will be performed to prevent which of the following possible sequelae? A. Bladder exstrophy B. Hydrocele C. Phimosis D. Urachal cysts E. Urinary tract infection Answer

<12>During the passage of an intravenous catheter, numerous endothelial cells are dislodged from the lining of the popliteal vein. What substance allows platelet adhesion to the exposed collagen fibers? A. Factor VIII B. Factor IX C. Fibronectin D. Tissue factor E. Von Willebrand factor Answer

<13>A 57-year-old man presents to the emergency department with a nosebleed for the past 2 hours. The patient received a prosthetic heart valve 5 months ago and is currently taking warfarin (7.5 mg per day) and oral antibiotics. Laboratory evaluation reveals an INR (international normalized ratio, the ratio of patient to normal prothrombin times) of 6.4. Which of the following antibiotics is the patient most likely taking? A. Ampicillin B. Cephalexin C. Nitrofurantoin D. Norfloxacin E. Phenazopyridine Answer

<14>A 47-year-old woman presents with complaints of nervousness and increased sensitivity to hot weather. She is diagnosed with hyperthyroidism and prescribed propylthiouracil. What is the principal mechanism by which this drug acts? A. Decreasing the efficacy of TSH binding to the thyroid TSH receptor B. Decreasing the rate of proteolysis of thyroglobulin C. Increasing the amount of 3,3',5'-triiodothyronine (reverse T3; rT3) D. Inhibiting deiodination of thyroxine (T4)

E. Answer

Inhibiting the uptake of iodide into the thyroid gland

<15>Which of the following neurotransmitters is most important for the induction of REM sleep? A. Acetylcholine B. Dopamine C. Epinephrine D. Norepinephrine E. Serotonin Answer

<16>A 37-year-old woman presents with 3 days of progressive joint pain in her ankles, knees, and wrists. She recalls three similar episodes over the past several years. On examination, she has a temperature of 38.7 C, her blood pressure is 110/70 mm Hg, and her heart rate is 90/min. She has a diffuse petechial rash over her trunk and extensor surfaces. Her ankles and knees are swollen, red, and tender with decreased range of motion, and there is tenderness over the tendon sheaths of her hands and forearms. Blood cultures are negative. Aspiration of joint fluid reveals a white cell count of 22,000/mm3 with no visible organisms, but culture on chocolate agar is positive. Which of the following is an attribute of the causative organism that allows it to produce recurrent infections? A. It is an intracellular pathogen B. It is resistant to ceftriaxone C. It is resistant to complement-mediated lysis D. Its capsule is not immunogenic E. Its pili undergo antigenic and phase variation Answer

<17>The data presented below compares the results of a diagnostic test in the presence and absence of a disease. Disease present Disease absent Positive test 40 5 Negative test 10 95 Total 50 100 The specificity of the test is A. 0.05 B. 0.40 C. 0.80 D. 0.90 E. 0.95 Answer

<18>Blood stored in a blood bank tends, with time, to become relatively depleted of 2,3-diphosphoglycerate. What effect does this have on the hemoglobin-oxygen dissociation curve?

A. Shifts the curve to the left, so that the hemoglobin has a decreased oxygen affinity B. Shifts the curve to the left, so that the hemoglobin has an increased oxygen affinity C. Shifts the curve to the right, so that the hemoglobin has a decreased oxygen affinity D. Shifts the curve to the right, so that the hemoglobin has an increased oxygen affinity E. Does not change the dissociation curve Answer

<19>A psychotic, indigent man with a history of multisubstance abuse has been involuntarily hospitalized for 1 week. Because of persistent diarrhea, stools are sent for ova and parasites, revealing numerous granular, spherical, thin-walled cysts measuring 10-20 mm in diameter. Trichrome stains show up to four nuclei in most of the cysts. These finding are consistent with an infection by which of the following organisms? A. Cryptosporidium parvum B. Dientamoeba fragilis C. Entamoeba histolytica D. Giardia lamblia E. Isospora belli Answer

<20>A child who understands that the volume of a liquid poured out of a narrow glass remains the same when poured into a wider glass is at which of Piaget's stages of intellectual development? A. Concrete operations B. Formal operations C. Preoperational D. Sensorimotor Answer

<21>A 4-year-old girl is brought to a specialty clinic by her foster parents because of a limp in her right leg and a serum alkaline phosphatase (ALP) that is 10 times the adult upper limit of normal for the test. The child is withdrawn and clinging to her foster mother. Physical examination is remarkable for a blue-green discoloration of the skin overlying a tender, 3-cm mass on the anterior portion of the right mid-thigh. An x-ray of the right thigh reveals a dense mass within the femur that extends into the surrounding tissue. Which of the followin best describes the increased alkaline phosphatase and physical findings in this case? A. ALP is abnormal for her age and the bone lesion represents an area of aseptic necrosis B. ALP is abnormal for her age and the bone lesion represents repair of a femoral fracture C. ALP is abnormal for her age and is unrelated to the bone lesion D. ALP is normal for her age and the bone lesion is an osteogenic sarcoma E. ALP is normal for her age and is unrelated to the bone lesion Answer

<22>Which of the following drugs antagonizes both the vascular and cardiac actions of norepinephrine? A. Atenolol B. Esmolol C. Labetalol D. Metaproterenol E. Prazosin Answer

<23>During surgery to treat an ischioanal abscess, the inferior rectal nerve is damaged. This nerve is a direct branch of which of the following nerves? A. Inferior gluteal nerve B. Pelvic splanchnic nerve C. Pudendal nerve D. Sciatic nerve E. Superior gluteal nerve Answer

<24>A 15-year-old girl is evaluated for failure to begin menstruation. Physical examination demonstrates short stature and a webbed neck. Chromosomal analysis demonstrates a lack of one X chromosome. This patient should be specifically evaluated for which of the following cardiovascular anomalies? A. Coarctation of the aorta B. Dextrocardia C. Ostium primum septal defect D. Pulmonary stenosis E. Tetralogy of Fallot Answer

<25>A baby is born with a testicular mass. Histologic sections made of the homogeneous yellow-white mass after its removal demonstrate epithelial-lined spaces that have flattened-to-cuboidal epithelial cells with vacuolated cytoplasm containing eosinophilic, hyaline-like globules. Scattered structures resembling primitive glomeruli (endodermal sinuses) are also seen. If appropriate immunohistochemical stains are performed, the eosinophilic cytoplasmic globules would most likely contain which of the following? A. Alpha-fetoprotein B. Estrogen receptors C. Human chorionic gonadotropin D. Human papilloma virus E. Melanin Answer

<26>A surgeon wishes to perform a splenectomy on a patient who has been in

an automobile accident. Before removing the spleen, the splenic artery and splenic vein are ligated. Within which of the following peritoneal structures are the splenic artery and vein found? A. Gastrocolic ligament B. Gastrosplenic ligament C. Lesser omentum D. Splenorenal ligament Answer

<27>A 65-year-old woman with a long-standing disease has bone marrow fibrosis and increased bone remodeling, with bone resorption exceeding bone formation. She has a history of passing calcium-oxalate kidney stones. Which of the following lab result profiles would be expected in the serum of this patient? Calcium Phosphate PTH A. decreased decreased increased B. decreased increased decreased C. decreased increased increased D. increased decreased increased E. increased increased increased Answer

<28>Upon examination of a newborn male, a cystic structure is found in the scrotum. It is determined that there is a hydrocele of the spermatic cord. Which of the following is the most likely etiology of this finding? A. Communication between the epididymis and the tunica vaginalis B. Failure of the processus vaginalis to form C. Failure of the processus vaginalis to fuse D. Incomplete fusion of the processus vaginalis E. Varicosities of the spermatic vein Answer

<29>A Brazilian immigrant is hired at a meat-packing plant, and undergoes an employment physical. Chest x-ray demonstrates a patchy, bilateral pneumonia and a lung mass, and he is referred to a specialist. Biopsy of the mass demonstrates fungal organisms with a few very distinctive "pilot's wheel" yeast forms. Which of the following is the most likely diagnosis? A. Blastomycosis B. Coccidioidomycosis C. Histoplasmosis D. Paracoccidioidomycosis E. Sporotrichosis Answer

<30>A 34-year-old female is brought to the emergency room with severe muscle cramps and carpopedal spasms. The patient was noted to be

extremely irritable and was complaining of tingling around the mouth and in the hands and feet. A few hours later, laboratory examination reveals sodium 140 mEq/L, potassium 4.2 mEq/L, chloride 101 mEq/L, calcium 6.4 mg/dL, phosphate 5.1 mg/dL, magnesium 2.4 (normal 1.8-3.8 mg/dL) and alkaline phosphatase 67 U/L. A CT scan of the head shows basal ganglia calcifications. Prolonged QT intervals and T wave abnormalities are noted on electrocardiogram. The history is pertinent for a thyroidectomy two months prior to admission. Which of the following conclusions is most consistent with these data? A. An increase in dietary vitamin D is warranted B. Hepatocytes have a low 25-hydroxylase activity C. Intestinal cells are underexpressing calcium transporter genes D. Isolated cells from the kidney have high 1-hydroxylase activity E. The levels of 1,25-dihydroxy vitamin D are normal Answer

<31>A 48-year-old man presents to his physician with complaints of dizziness and fatigue. Physical examination reveals a blood pressure of 130/50 mm Hg and a heart rate of 100 beats per minute. On examination, the physician notes a large scar on the patient's abdomen. The man states that he was severely injured in an automobile accident several years ago, and required abdominal surgery at that time. Which of the following is the most likely diagnosis? A. Arteriovenous fistula B. Cardiac tamponade C. Heart failure D. Hypovolemia E. Shock Answer

<32>A renal pathologist examining the day's kidney biopsies notes that one biopsy shows amorphous red nodules within the glomerular mesangium in hematoxylin and eosin stained material. Congo red stain of the biopsy demonstrates apple-green birefringence of these nodules. These nodules are most likely to be related to which of the following? A. Acute urinary tract infection B. Diabetes mellitus C. Sarcoidosis D. Systemic lupus erythematosus E. Tuberculosis Answer

<33>A patient goes to his family doctor complaining of persistent and severe headaches. His physician diagnoses migraine headaches and prescribes sumatriptan. What is the mechanism of action of this drug? A. Dopamine1 agonist B. GABAB antagonist C. Muscarinic3 antagonist

D. E. Answer

Non-selective beta antagonist Serotonin1D agonist

<34>A 60-year-old man presents to his physician after a routine screening test indicates hyperlipidemia. Physical examination reveals raised, irregular, yellow papules in the skin of the soft tissues below the eyes. Biopsy of these lesions would most likely show which of the following? A. Benign nevus cells B. Malignant nevus cells C. Microscopic blisters D. Munro microabscesses E. Multinucleated giant cells Answer

<35> Trisomy 21 Normal karyotype Positive test 100 50 Negative test 100 250 An experimental diagnostic test is developed to noninvasively detect the presence of trisomy 21, Down's syndrome. The test is administered to a group of 500 women considered to be at risk for a Down's fetus based on blood tests. The results of this test are shown above. What is the sensitivity of this new test? A. 40% B. 50% C. 67% D. 71% E. 83% Answer

<36>An autopsy is performed on a 60-year-old man who developed progressive dementia, parkinsonism, and visual hallucinations beginning 5 years prior to death. Histopathologic examination reveals numerous eosinophilic intracytoplasmic inclusions within neurons of substantia nigra, limbic cortex, and basal nucleus of Meynert. These inclusions are immunoreactive for ubiquitin. Which of the following is the most likely postmortem diagnosis? A. Alzheimer disease B. Amyotrophic lateral sclerosis (ALS) C. Diffuse Lewy body disease (dementia with Lewy bodies) D. Parkinson disease E. Pick disease Answer

<37>A 60-year-old factory worker reports to his physician that he can no longer push heavy boxes across the floor. Upon examination it is noted that the patient elevates the right shoulder when attempting shoulder

flexion, but shoulder abduction is not impaired. The medial border of the right scapula is very prominent. Which of the following nerves innervates the affected muscle? A. Long thoracic nerve B. Lower subscapular nerve C. Musculocutaneous nerve D. Suprascapular nerve E. Upper subscapular nerve Answer

<38>The American Diabetes Association (ADA) recently lowered the cutoff value for fasting glucose used in diagnosing diabetes mellitus from 140 mg/dL to 126 mg/dL. This reference interval change would be expected to produce which of the following alterations? A. Decrease the test's sensitivity B. Increase the test's false negative rate C. Increase the test's negative predictive value D. Increase the test's positive predictive value E. Increase the test's specificity Answer

<39>An emergency room physician examines a patient who has fallen from a motorcycle and injured his shoulder. The clinician notices a loss of the normal contour of the shoulder and a abnormal-appearing depression below the acromion. Which of the following injuries did the patient most likely sustain? A. Avulsion of the coronoid process B. Dislocated shoulder joint C. Fracture of the mid shaft of the humerus D. Fracture of the surgical neck of the humerus E. Laceration of the axillary branch of the posterior cord Answer

<40>A 7-month-old child with failure to thrive is found to have a hemoglobin of 4.4 g/dL. The peripheral smear shows very small red cells with marked pallor. It is determined that the child has very low levels of hemoglobin A, with elevated fractions of hemoglobin A2 and hemoglobin F. Which of the following underlying mechanisms is most likely related to the observed findings? A. Amino acid substitution on b globin B. Antibody against fetal blood cells C. Cytoskeletal protein defect D. Insufficient production of b globin E. Iron deficiency Answer

<41>During a routine pelvic examination, a 20-year-old woman is found to have an enlarged uterus. Ultrasound studies demonstrate a multiloculated

cystic structure within the uterine cavity, but no baby is identified. This mass is removed with dilation and curettage of the uterus, and placental-like tissue is observed during pathologic examination. Which of the following tumor markers would be most useful in establishing that residual tumor does not remain in the uterus? A. b-hCG B. Bombesin C. CEA D. PSA E. S-100 Answer

<42>On physical examination of a 7-year-old boy, the child's upper body appears much more developed than his lower body. Blood pressure in the upper extremities exceeds that of the lower extremities. On cardiac examination, there is a midsystolic murmur over the anterior chest and back. The child's lower extremities are cold, and femoral pulses are absent. The part of the vascular system that is affected in this disorder is derived from which of the following embryologic structures? A. Bulbus cordis B. Ductus arteriosus C. Left horn of sinus venosus D. Right common cardinal vein E. Right horn of sinus venosus F. Third, fourth, and sixth aortic arches Answer

<43>A 42-year-old obese woman experiences episodic abdominal pain. She notes that the pain increases after the ingestion of a fatty meal. The action of which of the following hormones is responsible for the postprandial intensification of her symptoms? A. Cholecystokinin B. Gastrin C. Pepsin D. Secretin E. Somatostatin Answer

<44>A 42-year-old man was in an automobile accident and suffered severe pelvic trauma. The bulb of the penis and the urethra were torn from the inferior surface of the urogenital diaphragm. This has allowed urine to extravasate from the urethra. Into which of the following regions will the urine flow? A. Deep perineal space B. Ischioanal space C. Rectovesical pouch D. Retroperitoneal space E. Superficial perineal space Answer

<45>Karyotypic analysis of a spontaneously aborted fetus demonstrates trisomy of one of the chromosomes. Which chromosome is most likely to be affected? A. 8 B. 13 C. 16 D. 18 E. 21 Answer

<46>At which of the following locations might a penetrating wound to the heart damage the AV node? A. Apex of the heart B. Interatrial septum C. Interventricular septum D. Wall of the right atrium E. Wall of the left atrium Answer

<47>A 9-month-old infant is brought to the Health Department to receive the second dose of OPV (oral polio vaccine) 2 weeks after the first vaccination. The child has mild diarrhea, so the decision is made to defer further immunizations. Bacteriologic examination of a stool culture is unremarkable; however, a small, single-stranded, positive RNA virus is isolated from the specimen. This same agent was isolated from sewage effluent the preceding week. The viral isolate was not inactivated by ether. Which of the following viruses was most likely isolated? A. Adenovirus B. Hepatitis C C. Parvovirus B19 D. Poliovirus E. Rotavirus Answer

<48> Section of synovium from the knee joint of a patient with rheumatoid arthritis (RA) is taken. Which of the following are the most abundant cells in the inflammatory infiltrate? A. Eosinophils B. Langhans type giant cells C. Lymphocytes and plasma cells D. Neutrophils E. Type A and B synovial cells Answer

<49>A 54-year-old African-American female patient undergoes a routine insurance physical examination. Chest x-ray reveals bilateral hilar masses. Biopsy of the masses shows granulomata, but acid-fast and fungal stains are negative for organisms. Which of the following diseases should be suspected? A. Caroli's disease B. Raynaud's disease C. Sarcoidosis D. Scleroderma E. Systemic lupus erythematosus Answer

<50>A neuroscientist discovers a way to selectively label neural crest cells in a developing laboratory animal. After birth, he sacrifices the animal and examines the tissue to search for labeled cells. Which of the following cell types will contain the label? A. Astrocytes B. Ependymal cells C. Microglia D. Oligodendroglia E. Pseudounipolar cells Answer

Answers

1>B 2>*** 33> 3>*** 4>*** 5>A 6>D 7>D 8>C 9>B 10>D

11>E 12>*** 43> C 13>D 14>E 15>*** 16>C 17>E 18>B 19>C 20>A

21>*** 22>C 23>*** 24>A 25>*** 26>B 27>*** 28>*** 29>D 30>***

31>A 32>*** 33>E 34>*** 35>B 36>C 37>A 38>C 39>B 40>D

41>A 42>*** 43>A 44>*** 45>C 46>B 47>D 48>C 49>C 50>E

23>

(13) <1>A pathologist is looking at a histological section of aorta stained to demonstrate the many wavy fibers that provide the aorta with the flexibility to stretch and then return to its original shape. These fibers are also found in substantial numbers in the

A. B. C. D. E. Answer

biceps muscle liver mesentery spleen vocal cords

<2>A 54-year-old truck driver in Oklahoma collides with a deer on the highway. He takes the deer home and butchers it. Five days later, he develops fever, non-productive cough, shortness of breath, and generalized lymphadenopathy. No skin lesions are noted. What is the most likely diagnosis? A. Anthrax B. Leptospirosis C. Pasteurella multocida infection D. Plague E. Tularemia Answer

<3>Pharmacokinetic parameters of a new antimicrobial agent are being determined during Phase I clinical trials. It has recently been determined that the half-life of this new agent is 9 hours, and studies to determine the safe limits of the clinical dose range are now being performed. One subject given a high drug dose began to seize when the drug reached steady state levels. The drug was immediately discontinued. How long will it take until his plasma drug levels are approximately 6% of steady state levels? A. 9 hours B. 18 hours C. 27 hours D. 36 hours E. 45 hours F. 54 hours Answer

<4>A small 9-month-old male with a history of recurrent pyogenic infections is seen in a clinic. Immunoglobulin levels and a CBC are performed. The CBC is normal except for slight neutropenia and thrombocytopenia. Determination of immunoglobulin levels indicates elevated IgM, but deficiencies of IgG and IgA. The underlying defect involves which of the following molecules? A. CD40 ligand (CD40L) on the T cell B. CD40 molecule on the B cell C. Gamma interferon D. Interleukin-2 (IL-2) E. Interleukin-3 (IL-3)

Answer

<5>An elderly woman is found dead in her home. Autopsy demonstrates an area of pallor on the apex of her heart. On microscopic examination, there is coagulative necrosis of the muscles accompanied by a modest neutrophilic infiltrate, which is focally heavy in some areas. No macrophages or fibroblasts are seen. Approximately how long before her death did this woman experience a myocardial infarction? A. 2 hours B. 18 hours C. 3 days D. 10 days E. 10 weeks Answer

<6> The vascular systems of five organs are arranged as shown in the drawing above. The vascular resistance of each organ is the same and the total resistance of the entire circuit is 0.05 mm Hg/mL/min. Which of the following values is the total resistance of the entire circuit if one of the organs was removed? A. 0.0625 mm Hg/mL/min B. 0.0725 mL/min/mm Hg C. 0.04 mm Hg/mL/min D. 0.03 mm Hg/mL/min E. 0.01 mm Hg/mL/min Answer

<7>A 27-year-old African-American male visits his primary care physician because of recent onset of "yellowness in the white of his eyes." His recent history is significant for a "chest cold" for which he is taking trimethoprim-sulfamethoxazole; he is also taking fluoxetine for depression. On exam, the sclera are icteric and the mucosa beneath the tongue appears yellow. No hepatosplenomegaly is present. Laboratory studies are as follows: Hemoglobin-11.1 g/dl Hematocrit-34% Total bilirubin-6.2 mg/dl Conjugated (direct) bilirubin-0.8 mg/dl Alkaline phosphatase-77 AST (SGOT)-24 ALT (SGPT)-22 The most likely cause of this patient's jaundice is A. acute infectious hepatitis B. cholestatic liver disease C. drug reaction from fluoxetine D. drug reaction from trimethoprim-sulfamethoxazole

Answer

<8>A 55-year-old woman stopped menstruating approximately 3 months ago. Worried that she may be pregnant, she decided to have a pregnancy test. The test came back negative. Which of the following series of tests results would confirm that the woman is postmenopausal? A. Decreased LH, decreased FSH, increased estrogen B. Decreased LH, increased FSH, decreased estrogen C. Increased LH, decreased FSH, decreased estrogen D. Increased LH, increased FSH, decreased estrogen E. Increased LH, increased FSH, increased estrogen Answer

<9>A 9-year-old boy has a history of degenerative changes and pain in both shoulders and his left knee. Physical exam reveals decreased range of motion. A complete blood count with differential is normal and the rheumatoid factor is negative. A sample of urine collected for routine urinalysis turns black upon standing at room temperature. Which of the following is the most likely diagnosis? A. Childhood polycystic disease B. Ochronosis C. Paroxysmal nocturnal hemoglobinuria D. Phenylketonuria E. Rhabdomyolysis Answer

<10>Surgical exploration of the ankle and foot demonstrates a muscle arising from the medial and lateral processes of the tuberosity of the calcaneus and inserting into the lateral side of the base of the proximal phalanx of the 5th toe. How does this muscle act on the 5th toe? A. Abduction B. Adduction C. Extension D. Flexion of the middle phalanx on the proximal phalanx E. Flexion of the proximal phalanx on the metatarsal Answer

<11>A 64-year-old man begins to show behavioral changes and irritability, and is found wandering in the park near his home. On neurological examination, there is evidence of mild aphasia and cognitive dysfunction, but motor function is preserved. CT scan of the head demonstrates selective atrophy of the cortex of the frontal lobes. Which of the following is the most likely diagnosis? A. Alzheimer's disease

B. C. D. E. Answer

Friedreich's ataxia Huntington's disease Parkinson's disease Pick's disease

<12> Under normal conditions virtually 100% of the filtered load of glucose is reabsorbed by the kidney tubules. Which part of the tubule shown above is expected to have the highest concentration of glucose under normal conditions? A. A B. B C. C D. D E. E Answer

<13>A 62-year-old woman in the hospital for a hip fracture develops a deep venous thrombosis that embolizes. The embolus lodges at the bifurcation of the pulmonary trunk, nearly completely occluding the vessel. Which part of the heart would be most significantly and immediately affected by this event? A. Left main coronary artery B. Left ventricle C. Right atrium D. Right main coronary artery E. Right ventricle Answer

<14>Physical examination of a 45-year-old man who looks much older than his stated age demonstrates thin arms and legs, a swollen abdomen, red tongue, dry, thin, and slightly yellow skin, gynecomastia, testicular atrophy, multiple spider angiomas, tremor, yellow discoloration of sclera, and short-term memory loss. Which of the following conditions is most strongly suggested by these findings? A. Bronchogenic carcinoma B. Colon carcinoma C. Congestive heart failure D. Glomerulonephritis E. Hepatic cirrhosis Answer

<15>A 47-year-old man presents to his neurologist with an unsteady broad-based gait and slow, slurred speech. Neurological examination

reveals dysdiadochokinesis, intention tremor, hypotonia, and nystagmus. The patient's lesion is in a brain structure that derives from which of the following embryonic structures? A. Diencephalon B. Mesencephalon C. Metencephalon D. Myelencephalon E. Telencephalon Answer

<16>Genetic analysis of a female baby with a broad, enlarged neck extending almost to the baby's shoulders demonstrates an XO karyotype. When the baby reaches puberty, hormone replacement therapy should be begun with which of the following agents? A. Estrogen only B. Estrogen and progestin C. Insulin D. Progestin only E. Thyroid hormone Answer

<17>A 32-year-old woman develops hyperthyroidism every time she gets pregnant. Serum T4 levels markedly increase during the first 10 weeks of the pregnancy and then decline and are only moderately increased during the remainder of the pregnancy. When she is not pregnant, her thyroid hormone status is completely normal. This condition can best be explained by a mutation in the A. T3 receptor, rendering it responsive to progesterone B. T3 receptor, rendering it responsive to estriol C. TSH receptor, rendering it responsive to human chorionic gonadotropin D. TRH receptor, rendering it responsive to human chorionic somatomammotropin E. TSH receptor, rendering it responsive to human chorionic somatomammotropin Answer

<18>A 58-year-old woman had a mitral valve replacement, and was placed on anticoagulants and prophylactic antibiotics following her surgery. Five days after her surgery, she developed a sharply demarcated, erythematous rash on her left thigh . Two days after the rash appeared, large hemorrhagic bullae began to form in the area of the rash. Which of the following medications most likely caused the patient's rash? A. Aspirin B. Cefazolin C. Heparin D. Vancomycin

E. Answer

Warfarin

<19>At 25 weeks of pregnancy, an unidentified infection greatly compromises the viability of a developing fetus. The level of which of the following hormones in the mother's blood is most likely to be affected? A. Estriol B. Free thyroxine C. Human chorionic gonadotropin D. Human chorionic somatomammotropin E. Progesterone Answer

<20>A 45-year-old man with cirrhosis due to a1-antitrypsin deficiency receives a liver transplant. Although currently in good health, he is at increased risk of developing which of the following types of emphysema? A. Centriacinar B. Compensatory C. Interstitial D. Panacinar E. Paraseptal Answer

<21>Many patients with cirrhosis, particularly alcoholic cirrhosis, develop gynecomastia, testicular atrophy, and impotence. Which of the following is thought to be the underlying mechanism producing these changes? A. Both decreased testosterone secretion and decreased extraction of androstenedione B. Decreased hepatic extraction of androstenedione C. Increased estrogen secretion by Leydig cells D. Increased estrogen secretion by Sertoli cells E. Testosterone deficiency alone Answer

<22>A 50-year-old man consults a physician because of a lesion on his nose. On examination, a flesh-colored lesion about 1 cm in diameter, with a rolled edge and central ulceration, is observed. Which of the following is the most likely diagnosis? A. Basal cell carcinoma B. Eczema C. Psoriasis D. Urticaria E. Verruca vulgaris Answer

<23>Biopsy of a skin lesion shows marked intercellular edema that splays apart adjacent cells, leaving only thin dark lines between the cells. What is this process called? A. Acantholysis B. Acanthosis C. Hyperkeratosis D. Parakeratosis E. Spongiosis Answer

<24>A 4-year-old boy is brought to the emergency room in extreme respiratory distress, with a temperature of 103.8 degrees Fahrenheit. He is drooling and has difficulty swallowing, and on physical examination, inspiratory stridor is noted. A lateral x-ray shows swelling of the epiglottis. He has had no previous vaccinations. Which of the following agents is the most likely cause of these symptoms? A. Haemophilus influenzae B. Klebsiella pneumoniae C. Legionella pneumophila D. Mycoplasma pneumoniae E. Streptococcus pyogenes Answer

<25>A 62-year-old man with congestive heart failure (CHF) and poorly controlled hypertension presents with new onset of anginal symptoms during periods of exertion. His physician prescribes a calcium channel blocker for angina prophylaxis and for his hypertension. Which of the following drugs would be most likely to exacerbate the patient's heart failure? A. Amlodipine B. Diltiazem C. Felodipine D. Isradipine E. Verapamil Answer

<26>A 22-year-old female flautist complains to her physician about pain in her left forearm and tingling in her left hand. Physical examination demonstrates decreased 2 point discrimination on the palmar aspect of the patient's 1st and 3rd digits and weakness of her 1st digit. An electromyogram would likely reveal weakness in which of the following muscles? A. Abductor pollicis longus

Adductor pollicis C. Extensor indicis D. Extensor pollicis longus E. Opponens pollicis Answer

B.

<27>A 70-year-old woman undergoes a gastrectomy for Zollinger-Ellison syndrome. Her doctor informs her that she will need to take intramuscular vitamin B12 shots for the rest of her life. Absence of which of the following cell types is responsible for this vitamin replacement requirement? A. Chief cells B. G cells C. Goblet cells D. Mucous neck cells E. Parietal cells Answer

<28>A 6-year-old, who is learning to ride a bike, falls and fractures he r clavicle. Which muscle will help prevent the fractured bone from damaging the subclavian vessels or large nerves of the arm? A. Deltoid B. Pectoralis major C. Sternocleidomastoid D. Subclavius E. Trapezius Answer

<29>A patient develops an ovarian mass that is picked up on pelvic examination. Resection of the mass demonstrates a lymphoma composed of small lymphocytes with interspersed macrophages, producing a starry sky pattern. This lesion would be most likely to be associated with which of the following? A. abl-bcr hybrid B. bcl-2 activation C. c-myc activation D. t(9,22) E. t(14,18) Answer

30>Which of the following diseases should be reported to the Department of Public Health? A. Candida albicans infection B. Condyloma acuminatum C. Gonorrhea

D. E. Answer

HIV infection Streptococcal pharyngitis

<31>A large tumor mass impinges on the splenic artery and its branches as the artery passes out from below the greater curvature of the stomach. Branches of which of the following arteries would most likely be affected by the pressure on the splenic artery? A. Left gastric B. Left gastroepiploic C. Right gastric D. Right gastroepiploic E. Short gastric Answer

<32>A Pap smear from a 30-year-old woman demonstrates protozoal parasites. These organisms are likely to be A. Cryptosporidium parvum B. Entamoeba histolytica C. Giardia lamblia D. Isospora belli E. Trichomonas vaginalis Answer

<33>A 35-year-old female, hospitalized after a motor vehicle accident, develops acute gastric stress ulcers. Increases in which of the following normal physiological parameters may have contributed to this condition? A. Bicarbonate transport B. Epithelial regenerative capacity C. Mucosal blood flow D. Mucus secretion E. Pepsin production Answer

<34>When examining a histological section of a normal ovary, a technician notices an oocyte surrounded by several layers of follicular cells. A small antrum is present. Which of the following is the correct term for the entire structure, composed of the oocyte, follicular cells, and antrum? A. Corpus luteum B. Graafian follicle C. Primary follicle D. Primordial follicle E. Secondary follicle

Answer

35>Which of the following cofactors is required for decarboxylation of alpha-ketoacids? A. Vitamin B1 B. Vitamin B2 C. Vitamin B3 D. Vitamin B5 E. Vitamin B6 Answer

36>An individual lacking the enzyme tyrosinase would be particularly predisposed to develop which of the following? A. Glioblastoma multiforme B. Hemangioblastoma C. Hepatoma D. Melanoma E. Renal cell carcinoma Answer

37>What is the role of class II MHC proteins on donor cells in the process of graft rejection? A. They are recognized by helper T cells, which then activate cytotoxic T cells to kill the donor cells B. They are the receptors for interleukin-2, which is produced by macrophages when they attack the donor cells C. They cause the release of perforins to lyse the cells D. They induce IgE, which mediates graft rejection E. They induce the production of blocking antibodies that protect the graft Answer

38>A seasoned marathon runner drinks a cup of strong black coffee about an hour before his race to enhance his performance. By which of the following mechanisms does caffeine directly contribute to enhanced performance? A. Allosteric activation of adenylyl cyclase B. Allosteric activation of glycogen phosphorylase C. Allosteric activation of hormone sensitive lipase D. Inhibition of dephosphorylation of protein kinase A E. Inhibition of phosphodiesterase Answer

39>Cefuroxime is believed to exert its antibacterial effect by which of the following mechanisms? A. Competitive inhibition of para-aminobenzoic acid (PABA) B. Inhibition of bacterial cell wall synthesis C. Inhibition of DNA-gyrase D. Irreversible binding to the 30S subunit of bacterial ribosomes E. Irreversible binding to the 50S subunit of bacterial ribosomes Answer

40. A 10-year-old male presents to the pediatrician because of problems while eating. He can chew food but has problems swallowing the chewed pieces, and feels them in his throat. A radiographic study is performed that shows normal musculature but abnormal esophageal peristalsis. No masses are seen. Which of the following nerves should be tested for abnormalities? A. Hypoglossal and phrenic B. Hypoglossal and splanchnic C. Glossopharyngeal and vagus D. Phrenic and vagus E. Splanchnic and vagus Answer

41 .A 40-year-old man with adult polycystic kidney disease is brought to the emergency room in a coma. CT scan of the head demonstrates a subarachnoid hemorrhage without parenchymal hemorrhage. Which of the following is the most likely source of the bleeding? A. AV malformation B. Bridging veins C. Charcot-Bouchard aneurysm D. Circle of Willis E. Middle meningeal artery Answer

42 .An unconscious patient with sepsis in the intensive care unit undergoes a 2-hour period of severe hypotension. Blood chemistries taken during the following 48 hours show rising creatine kinase MB fraction (CK-MB), peaking at 5 times the upper limit of normal. ECG findings are equivocal, with some degree of flat S-T segment depression over several leads. Which of the following is the most likely diagnosis? A. Prinzmetal angina B. Stable angina C. Subendocardial infarction D. Transmural infarction E. Unstable angina

Answer

43 .A 65 year-old man is admitted to the coronary care unit with a diagnosis of a large myocardial infarct (MI) of the left ventricle. On his 6th postinfarct day, he goes into shock and dies, manifesting signs and symptoms of cardiac tamponade. Which of the following complications is the most likely cause of this patient's death? A. Aortic dissection B. Extension of previous MI C. Fatal arrhythmia D. Rupture of the left ventricular wall E. Rupture of papillary muscle Answer

44 .A newborn appears normal at birth, but develops vomiting and diarrhea accompanied by jaundice and hepatomegaly within the first few weeks of life. Within months, the baby has obvious cataracts and ascites. The infant is switched to a milk-free diet, which stabilizes but does not completely reverse his condition. By one year of age, he has developed mental retardation. Which of the following is the most likely diagnosis? A. Cystic fibrosis B. Galactosemia C. McArdle's disease D. Von Gierke's disease E. Wilson's disease Answer

45 .A 25-year-old man presents with headache, dizziness, and claudication. Blood pressure measurements reveal hypertension in the upper limbs and hypotension in the lower limbs. Which of the following additional findings would be most likely in this case? A. Aortic valvular stenosis B. Notching of inferior margins of ribs C. Patent ductus arteriosus D. Pulmonary valvular stenosis E. Vasculitis involving the aortic arch Answer

46 .A patient has a tiny (0.2 cm), but exquisitely painful tumor under the nail of her index finger. Prior to surgery to remove it, local anesthetic block to a branch of which of

the following nerves would be most likely to achieve adequate anesthesia? A. Axillary nerve B. Median nerve C. Musculocutaneous nerve D. Radial nerve E. Ulnar nerve Answer

47 .Tissue from a spontaneous abortion is submitted to the laboratory, where an astute pathologist notes the presence of mature fetal tissue that contains Barr bodies. The fetus may have had which of the following genotypes? A. Classic Turner syndrome (45, X) B. Edward's syndrome (47, XY+18) C. Klinefelter's syndrome (47, XXY) D. Normal male (46, XY) E. XYY syndrome (47, XYY) Answer

48 .A 78-year-old woman is brought to the emergency department because of slowly developing confusion over the past ten days. Careful physical examination demonstrates a relatively small laceration of the scalp. CT of the head would be most likely to reveal which of the following? A. Epidural hematoma B. Mixed parenchymal and subarachnoid hemorrhage C. Multiple tiny hemorrhages of the putamen D. Subarachnoid hemorrhage E. Subdural hematoma Answer

49. A 22-year-old woman presents to her physician with amenorrhea, weight loss, anxiety, tremor, heat intolerance and palpitations. Laboratory examination is consistent with hyperthyroidism, and the physician prescribes propylthiouracil. The patient's response to propylthiouracil is disappointing, and the symptoms recur, then worsen. Subtotal thyroidectomy is successfully performed, but following the surgery, the woman is extremely hoarse, and can barely speak above a whisper. This hoarseness is most probably related to damage to a branch which of the following cranial nerves? A. Facial B. Glossopharyngeal C. Hypoglossal D. Trigeminal E. Vagus Answer

50 .A 24-year-old female is brought to the emergency room after threatening to kill herself by cutting her wrists. She has multiple scars on her wrists, which she admits were caused by prior suicide attempts. She states she is very angry at her boyfriend, who left her for another woman. She previously thought her boyfriend was an angel and now she thinks he is a monster. She feels very empty inside. While smiling, she states that she is depressed. During the interview, she drops to the ground, but continues to talk while lying on the floor. She believes nobody understands her. What is her underlying personality disorder? A. Antisocial B. Borderline C. Histrionic D. Narcissistic E. Schizoid Answer

Answers

1The correct answer is E. The fibers are elastic fibers. You should remember three specific sites where these are found: large arteries (particularly the aorta), vocal cords, and ligamenta flava (which connect the vertebrae). Small amounts of elastic tissue are also found in skin, and to a much lesser degree in other tissues. Elastic tissue is not found in muscle (choice A) or mesentery (choice C). Elastic tissue is not found in substantial amounts in the liver (choice B) or spleen (choice D). 2The correct answer is E. Tularemia is caused by Francisella tularensis. Fifty percent of the cases have been reported in Missouri, Arkansas, and Oklahoma. Infection can be transmitted by tick bites or by handling animal carcasses such as rabbits, squirrels, beavers, muskrats, and deer. The diagnosis is suggested by the history of exposure, clinical progression, and generalized lymphadenopathy. The ulceroglandular form of tularemia is the most common clinical presentation. Anthrax (choice A) is caused by Bacillus anthracis. Typically, infection with B. anthracis causes a localized skin lesion at the site of inoculation that develops into a black eschar surrounded by draining lymphadenitis. Woolsorter's disease is the inhalation form of anthrax. Leptospirosis (choice B) is an infection caused by contact with urine from infected animals such as rats and dogs. L. interrogans is the most common isolate. The disease is biphasic, with the leptospiremic phase characterized by abrupt-onset headache (98%), fever, chills, conjunctivitis, severe muscle aches, gastrointestinal symptoms, changes in sensorium, rash, and hypotension. This phase lasts from 3 to 7 days. The immune stage occurs after a relatively asymptomatic period of 1 to 3 days and is characterized by recurrence of fever and

generalized symptoms. Meningeal symptoms often develop during the immune period. In more serious cases, hepatic dysfunction and renal failure may develop. Pasteurella multocida (choice C) is associated with dog and cat bites. It causes a rapidly progressing cellulitis, bacteremia, and, occasionally, infective endocarditis. Plague (choice D) is caused by Yersinia pestis. It is enzootic in the southwestern United States. Rats and fleas are the vectors. Clinical presentations include lymphadenopathy with septicemia or pneumonia (which has the highest case-fatality rate). 3The correct answer is D. The rule of thumb is that the levels decrease by half every half-life. Therefore, 50% will remain after one half-life, 25% will remain after two half-lives, 12.5% will remain after three half-lives, and 6.25% will remain after four half-lives. The half-life of this drug is 9 hours, so it will reach approximately 6% of steady state levels in 36 hours. 4The correct answer is A. Patient's with hyper-IgM syndrome (HIGM) experience very little, if any, isotype switching. The B cells in these patients cannot undergo the switch from IgM to IgG, IgA, or IgE that normally occurs during B-cell maturation. When B cells undergo isotype switching they require two factors: IL-4, which binds to a specific receptor on the B cell, and the CD40 molecule on the B-cell surface, which binds to the CD40 ligand (CD40L) on an activated T-cell surface. The deficiency is due to mutations in the CD40L. This immunodeficiency results in patients who are IgG- and IgA-deficient, but synthesize large amounts of polyclonal IgM. Affected individuals are susceptible to pyogenic infections, and often form IgM autoantibodies to neutrophils, platelets, or tissue antigens. The disease is inherited as an X-linked recessive in 70% of the cases. The problem is due to mutations in the CD40L, not the CD40 molecule on the B cell (choice B). Gamma-interferon (choice C) is primarily a type I helper T cell (TH1) cytokine, although it does inhibit the TH2 lineage response to specific antigens. A decrease in IL-2 (choice D) would inhibit the cell-mediated immune response and the patient would be susceptible to infection with intracellular microorganisms. IL-3 (choice E) is considered a growth factor for hematopoietic stem cells and mast cells. The patient had a normal CBC except for slight neutropenia and thrombocytopenia. 5The correct answer is C. The findings suggest a 2-4 day old myocardial infarction (MI). An MI becomes visible grossly after about 12 hours (sometimes earlier) as an area of pallor and eventually, cyanosis. Neutrophils infiltrate the tissue anywhere from 12 to 72 hours after infarction, with increasing evidence of coagulative necrosis. At 2 hours (choice A), no changes would likely be evident in the infarcted myocardium. At about 18 hours (choice B), "waviness" of some myocardial fibers may be apparent microscopically, and subtle changes in the appearance of the myofibrils producing alternating densely-colored (contracted) and lightly-colored (expanded) areas can be observed. At 5 to 10 days (choice D), both macrophages and neutrophils are present and granulation tissue with fibroblasts is growing in from the edges. After 7 weeks (choice E), the area of infarction is typically completely replaced by scar tissue. 6The correct answer is A. This problem is relatively simple if you know that removing a parallel resistance from a circuit increases the total resistance of that circuit. Because the total resistance with all five organs in the circuit is 0.05 mm Hg/mL/min, removing an organ would produce a total resistance greater than 0.05 mm Hg/mL/min. Choice B can be rejected because the units are incorrect, and choices C, D, and E can be eliminated because the values of resistance are lower than the total resistance prior to removal of the organ.

The problem is more difficult when a mathematical solution is required. The equation for parallel resistances is the following: Because the total resistance (RT) is 0.05 mm Hg/mL/min, 1/ 0.05 = 20 = 1/R1 + 1/R2 + 1/R3 + 1/R4 + 1/R5. Therefore, each individual resistance must equal 0.25 mm Hg/mL/min since 1/0.25 = 4 and 4 x 5 = 20. Removing one of the resistances therefore yields the following: 1/RT = 1/0.25 + 1/0.25 + 1/0.25 + 1/0.25 = 16. Thus, RT = 1/16 = 0.625 mm Hg/mL/min. 7The correct answer is D. This man has G6PD deficiency (as do 10% of African-American males). G6PD serves to protect the RBC from oxidative damage by maintaining high intracellular levels of NADPH. People of Mediterranean descent can also have G6PD deficiency, but to a much greater degree. Therefore, hemolytic episodes in this population are more severe (and can be fatal) as compared to those of the African-American type, which are usually mild and self-limited. Common oxidative stressors that initiate hemolysis are drug reactions (especially sulfa drugs), febrile illnesses, and fava bean ingestion. Acute infectious hepatitis (choice A) would more likely present with abdominal pain, hepatomegaly, and high elevations of AST and ALT (often into the 1000s). Cholestatic liver disease (choice B) more often presents with elevation of alkaline phosphatase along with mild AST and ALT elevations. This patient has elevated unconjugated bilirubin levels, as in hemolytic disorders. Both hepatocellular (hepatitis) and cholestatic liver disease cause more conjugated (as opposed to unconjugated) hyperbilirubinemia. Fluoxetine's (a selective serotonin reuptake inhibitor; choice C) most common side effects are anxiety, agitation, and insomnia. 8The correct answer is D. During menopause, there is a loss of functioning follicles in the ovaries such that GnRH-stimulated LH and FSH secretion do not result in normal estrogen secretion. The low estrogen levels cannot inhibit gonadotropin secretion in a negativefeedback fashion, resulting in very high levels of LH and FSH. Choices A, B, C, and E do not accurately describe normal hormonal levels in menopause. 9The correct answer is B. This boy's presentation, including the negative rheumatoid factor, suggests osteoarthritis at a very early age. The urine turning black on standing is classically associated with alkaptonuria (ochronosis), an arthritic disease caused by a deficiency of homogentisic acid oxidase (homogentisate 1,2 dioxygenase). In this condition, homogentisic acid, an intermediate in the catabolism of tyrosine, accumulates in cells and body fluids, including synovial fluid and urine. Childhood polycystic kidney disease (choice A) is a rare autosomal recessive disorder characterized by cystic enlargement of the kidneys and, usually, the liver. Death often occurs in infancy. Paroxysmal nocturnal hemoglobinuria (choice C) is associated with hemolytic anemia and reddish brown urine. Phenylketonuria (choice D) is classically associated with a deficiency of phenylalanine hydroxylase and mental retardation. Rhabdomyolysis (choice E) may occur with traumatic injury, muscle ischemia, seizures, excessive exercise, heat stroke, malignant hyperthermia, alcoholism, and various infectious or metabolic disorders. It would be associated with reddish urine 10The correct answer is A. The muscle is the abductor digiti minimi, the function of which is to abduct (separate) the toe away from the 4th toe. The abductor digiti minimi is supplied by the lateral plantar nerve. This muscle also helps act as a "spring" on the sole of the foot during walking. Adduction (opposition of the toes, choice B) is supplied by the plantar interossei.

Extension (choice C) is supplied by the extensor digitorum longus. The flexor digitorum brevis flexes both the middle phalanx on the proximal phalanx (choice D) and the proximal phalanx on the metatarsal (choice E). 11The correct answer is E. Pick's disease is a condition that is clinically similar to Alzheimer's disease. It differs from Alzheimer's disease in that the pronounced brain atrophy characteristically involves the frontal and temporal lobes, with sparing of the posterior aspects of the cortex. Microscopically, the affected cortex contains characteristic ballooned neurons (Pick cells) or cytoplasmic inclusions (Pick bodies). Clinically, there is a slowly progressive dementia with language disturbances and behavioral changes that may eventually lead to mutism. The progressive nature of the dementing process has been termed a "descent into a sea of mindlessness." Alzheimer's disease (choice A) is characterized by dementia, but with diffuse brain atrophy. Friedreich's ataxia (choice B) characteristically affects the spinal cord, brainstem, and cerebellum, rather than cortex. Huntington's disease (choice C) characteristically affects the caudate nucleus and putamen. Motor symptoms such as choreoathetosis are prominent. Parkinson's disease (choice D) characteristically affects the substantia nigra, and produces prominent motor symptoms, including cogwheel rigidity, a resting tremor, and a festinating gait. 12The correct answer is A. Glucose is freely filtered by the glomerular capillary membrane and totally reabsorbed in the proximal tubule under normal conditions. Therefore, the concentration of glucose is highest in the proximal portion of the proximal tubule. The concentration of glucose is essentially zero in the thin descending limb of loop of Henle (choice B), distal convoluted tubule (choice C), cortical collecting tubule (choice D), and medullary collecting tubule (choice E). 13The correct answer is E. A massive pulmonary embolus, such as this patient sustained, can interrupt pulmonary blood flow, producing acute cor pulmonale with abruptly developing right ventricular dilatation. Other parts of the heart are secondarily affected somewhat later. Acute cor pulmonale is a surgical emergency requiring immediate correction of the underlying problem, which is usually a pulmonary embolus lodged early in the pulmonary circulation. Acute cor pulmonale is less common than chronic cor pulmonale, which is seen as a complication of many chronic lung diseases. The left main coronary artery (choice A) and right main coronary artery (choice D) would be affected secondarily to the reduced blood flow to the left heart and aorta, from which the coronary arteries arise. The left ventricle (choice B) would be affected secondarily by reduced blood flow from the pulmonary veins to the left atrium. The right atrium (choice C) would be affected after the right ventricle since it is farther from the circulatory block. 14The correct answer is E. The physical examination is typical for an advanced alcoholic with hepatic cirrhosis. It is important to recognize these symptoms, as these patients are notorious for "underestimating" and even denying their alcohol use. Bronchogenic carcinoma (choice A) typically presents with cough and/or respiratory changes, but can present with mass effects in the chest or involvement of mediastinal nerves or vessels. Colon cancer (choice B) typically presents with changes in the stool or bowel habits. Congestive heart failure (choice C) is typically heralded by shortness of breath or peripheral edema, or both.

Glomerulonephritis (choice D) typically presents with changes in quality or quantity of urine, and, possibly, fluid retention. 15The correct answer is C. The patient in question has a cerebellar lesion. Cerebellar dysfunction can lead to a variety of motor dysfunctions, including truncal ataxia (appearing similar to the gait of an intoxicated individual), intention tremor (uncontrolled shaking of affected extremity present only with purposeful movement), dysdiadochokinesia (the inability to perform rapid and regular alternating movements), dysmetria (inability to stop movements at the desired point), dysarthria (ataxic speech), hypotonia, and nystagmus. During the fourth week of embryonic development, the anterior end of the neural tube develops three vesicles, the prosencephalon (forebrain), the mesencephalon (midbrain), and the rhombencephalon (hindbrain). By the sixth week, five vesicles (listed in the answer options) have developed. The rhombencephalon has now developed into the metencephalon and myelencephalon. The cerebellum and pons derive from the metencephalon. The diencephalon (choice A), which is derived from the prosencephalon, develops into the thalamus, hypothalamus, epithalamus, subthalamus (everything with the word "thalamus"), posterior lobe of the pituitary, and neural retina. The mesencephalon (choice B), or midbrain, is the only brain vesicle that does not produce a secondary vesicle; it remains the mesencephalon. The myelencephalon (choice D), which is derived from the rhombencephalon, develops into the medulla oblongata. The telencephalon (choice E), which is derived from the prosencephalon, develops into the cerebral hemispheres (cerebral cortex, basal ganglia, and deep white matter).

16The correct answer is B. The baby has Turner's syndrome, in which only one sex chromosome, the X chromosome, is present as a result of chromosomal loss early after fertilization of the egg. The chromosome loss can either occur in all cells, or only in part of the body, due to random X-chromosome inactivation, producing the variant known as a Turner mosaic. Affected babies often have a prominent "webbed" neck related to lymphatic stasis in the neck, sometimes producing a frank cystic hygroma (large cystic mass composed of dilated lymphatic channels); edema of the dorsum of the hands and feet caused by similar mechanisms is also seen in these babies. A baby with these clinical features should have a chromosomal analysis. Affected babies should also be carefully checked for cardiac anomalies (notably preductal coarctation of the aorta and aortic stenosis with endocardial fibroelastosis), since congenital heart disease can cause early death. By puberty, the neck and extremity edema has resolved, but careful physical examination often reveals residual redundant skin of the neck and shoulders, producing the mature form of webbed neck. Mosaic patients and patients with partial deletions of one X chromosome may present only at puberty with the combination of short stature and primary amenorrhea. The ovaries (usually not biopsied in obvious cases) lose all of their oocytes by 2 years of age ("menopause before menarche") and become atrophic fibrous strands without ova or follicles ("streak ovaries"). Hormonal replacement in Turner patients should include both estrogens and progestins, since unopposed estrogens (choice A) can cause atypical adenomatous hyperplasia of the endometrium. Insulin (choice C) replacement is not required in these patients. Replacement of progestin alone (choice D) is not recommended. Thyroid hormone (choice E) replacement is not required in these patients.

17The correct answer is C. The key to answering this question is knowing the plasma concentration profile across the 40 weeks of pregnancy for each of the hormones mentioned.

Plasma concentration of human chorionic gonadotropin (hCG) doubles every 2 days during the first ten weeks of pregnancy and then declines to a level that is one tenth of the peak for the remainder of the pregnancy. hCG is in the same hormone family as TSH, FSH, and LH. These are all glycoprotein hormones with identical a subunits but different b subunits. Hence, there is a similarity in receptors for these hormones as well. A mutation in the TSH receptor that also made it responsive to hCG would result in increased thyroid hormone secretion during pregnancy due to the increased circulating hCG. Under non-pregnant conditions, thyroid hormone secretion would be normal. This mutation was actually found in a woman who had experienced several early miscarriages. When she was treated for hyperthyroidism with propylthiouracil during her pregnancy, her child was carried to full term. Plasma concentrations of progesterone and estrogen increase throughout pregnancy. By 40 weeks, the progesterone concentration may be 200 times greater than pre-pregnancy levels. Estradiol and estrone increase by about 50 fold, while estriol increases about 1000 fold. While the T3, estrogen, and progesterone receptors all originate from the same superfamily, it is unlikely that the woman's pregnancy-associated hyperthyroidism is due to an action of progesterone or estrogen on the T3 receptor (choices A and B). If this were the case, plasma levels of thyroid hormone would be expected to rise throughout pregnancy with highest concentration occurring just prior to birth. Furthermore, in the non-pregnant state, increases in estrogen during the follicular phase and increases in progesterone during the luteal phase would produce problems in thyroid hormone secretion. This patient had normal thyroid status when not pregnant. Human chorionic somatomammotropin (hCS) increases throughout pregnancy. It is related to the anterior pituitary hormones prolactin and growth hormone. A mutation in either the TRH receptor (choice D) or the TSH receptor (choice E) would be unlikely to be responsive to hCS because this hormone is unrelated to either TRH or TSH. Furthermore, if such a mutation could occur, it would produce maximal thyroid hormone concentration near the end of the pregnancy (not at 10 weeks). 18The correct answer is E. Warfarin is a coumarin anticoagulant used for the prophylaxis and treatment of thromboembolic complications associated with cardiac valve replacement and atrial fibrillation, as well as the prophylaxis and treatment of venous thrombosis and pulmonary embolism. Warfarin may cause necrosis of the skin (typically on the breasts, thighs, and buttocks) generally between the third and tenth days of therapy. The lesions are initially sharply demarcated, erythematous, and purpuric. They may resolve or progress to large, irregular, hemorrhagic bullae that can eventually lead to necrosis. The mechanism for this reaction is related to warfarin's ability to deplete protein C, which can lead to a state of hypercoagulability and thrombosis in the cutaneous microvasculature. Aspirin (choice A) is commonly used for its antiplatelet effect; however, it would not be indicated for anticoagulation of a patient with a recent cardiac valve replacement. Furthermore, aspirin is not associated with the development of this type of skin necrosis. Cefazolin (choice B) is a first-generation cephalosporin antibiotic commonly used as a perioperative prophylactic agent. If the patient was allergic to this antibiotic, an erythematous rash might have appeared. However, the rash would not lead to the appearance of large, hemorrhagic bullae. Heparin (choice C) is an intravenous anticoagulant indicated for the prophylaxis and treatment of thromboembolic complications associated with cardiac valve replacement and atrial fibrillation. It is also indicated for the prophylaxis and treatment of venous thrombosis, pulmonary embolism, and for treatment of some coagulopathies. Although heparin is associated with the development of thrombocytopenia, it is not associated with skin necrosis. Vancomycin (choice D) is an antibiotic typically reserved for treatment of life-threatening infections caused by gram-positive organisms. If vancomycin is administered too rapidly via

the intravenous route, a maculopapular rash may appear on the chest and on the extremities. However, once the administration is complete, the rash usually disappears in a few hours. 19The correct answer is A. Plasma levels of maternal estrogens during pregnancy are dependent on a functioning fetus. The fetal adrenal cortex and liver produce the weak androgens, DHEA-S and 16-OH DHEA-S, which are carried to the placenta by the fetal circulation. The placenta then desulfates the androgens and aromatizes them to estrogens (16OH DHEA-S, estriol) prior to delivery to the maternal circulation. Estradiol and estrone increase approximately 50 fold during pregnancy, but estriol increases about 1000 fold. When estriol is assayed daily, a significant drop may be a sensitive early indicator of fetal jeopardy. Total serum thyroxine concentration may be increased in pregnancy due to an increase in circulating TBG resulting from increased estrogen. However, free thyroxine (choice B) remains within the normal range because of feedback regulatory loops. The decline in estrogen with fetal compromise may gradually decrease serum thyroxine, but the free thyroxine will remain unchanged. Human chorionic gonadotropin (choice C) and human chorionic somatomammotropin (choice D) are both secreted by syncytiotrophoblasts of the placenta. As long as placental function is intact, blood levels of these two hormones should not change with fetal compromise. Placental secretion of progesterone (choice E) during pregnancy is also independent of any fetal contribution. The placenta relies on maternal cholesterol for progesterone production. Fetal death has no immediate influence on progesterone production by the placenta. 20The correct answer is D. There are two main morphologic forms of emphysema, centriacinar and panacinar. The panacinar variant is related to a1-antitrypsin deficiency; the entire acinus is enlarged, from the respiratory bronchiole to the distal alveoli. Centriacinar emphysema (choice A) is characterized by enlargement of the central portions of the acinus, i.e., the respiratory bronchiole, and its pathogenesis is related to exposure to tobacco products and coal dust. Interstitial emphysema (choice C) is not a true form of emphysema. It results from penetration of air into the pulmonary interstitium. This may occur when alveolar tears develop because of a combination of coughing and airway obstruction (e.g., children with whooping cough) or a chest wound that injures the underlying lung parenchyma (e.g., a fractured rib). Compensatory emphysema (choice B) and paraseptal emphysema (choice E) are associated with scarring. Both are frequent but usually clinically silent. Paraseptal emphysema, however, may lead to spontaneous pneumothorax in young patients. In fact, this form is more severe in areas adjacent to the pleura, where large, cystlike structures may develop and rupture into the pleural cavity. 21The correct answer is A. The secondary sexual changes seen in alcoholic cirrhosis appear to be due to both decreased testicular secretion of testosterone and decreased hepatic extraction of the androgen, androstenedione. Thus, androstenedione is available for extrasplanchnic aromatization (occurring mostly in peripheral adipose tissue) to form compounds with estrogenic activity. Choices B and E do not fully explain the secondary sexual changes. While tumors of Leydig and/or Sertoli cells may excrete both androgens and estrogens, the normal Leydig (choice C) and Sertoli cells (choice D) do not usually secrete estrogens. 22The correct answer is A. The description is typical for basal cell carcinoma. These skin cancers typically occur on sun-exposed areas of the head, neck, and upper trunk. Basal cell carcinoma only rarely metastasizes, but can become locally mutilating if neglected. When

located on the face, it may be difficult to adequately excise without damaging facial structures. Eczema (choice B) typically involves a larger area of skin and may cause dryness, discoloration, and thickening of the involved area. Blistering, erythema, or oozing may also be observed. Psoriasis (choice C) is characterized by erythematous plaques with a silvery surface. Urticaria (choice D) causes transient, nonpitting, erythematous wheals. Verruca vulgaris (choice E), the common wart, causes well-demarcated verrucous papules, often on the hands. 23The correct answer is E. Spongiosis is the name used for intercellular edema of the epidermis. Fluid accumulates between the cells, pulling them apart. However, the intercellular connections (desmosomes) remain largely intact. This produces a distinctive microscopic appearance in which each cell is surrounded by a broad white band with tiny dark cross-stripes, somewhat reminiscent of a closed zipper. The basic terms that describe skin lesions are a favorite target on examinations. Acantholysis (choice A) is the process of cell separation seen in some blistering diseases. The intercellular connections are broken in acantholysis, producing "rounded-up" cells that are dissociated from each other. Acanthosis (choice B) is a marked thickening of the epidermis due to an increase in the number and size of the epithelial cells. Hyperkeratosis (choice C) is an increase in the thickness of the superficial keratin layer of the epidermis. The term parakeratosis (choice D) is used when nuclei are present in the normally anuclear superficial keratin layer. 24The correct answer is A. Epiglottitis is the most common disease of the upper respiratory tract produced by Haemophilus influenzae type b, a gram-negative encapsulated rod. It is also a common cause of otitis media in children and may cause bronchitis, bronchiolitis, and pneumonia in adults. The incidence of serious disease caused by Haemophilus influenzae type b has decreased greatly with the introduction of an effective vaccine. The vaccine is composed of the H. influenzae type b capsular polysaccharides coupled to a carrier molecule, given to children between 2 and 15 months of age. The patient had not received the Hib conjugate vaccine and therefore was susceptible to this organism. Klebsiella pneumoniae (choice B) causes pneumonia and pulmonary abscesses, but is not considered to be a pathogen in the upper respiratory tract. Legionella pneumophila (choice C) causes pneumonia in man. The disease may be mild (an atypical pneumonia) or a fulminating disease with a high mortality (30%). Mycoplasma pneumoniae (choice D) causes community-acquired atypical pneumonia. It is the most common cause of pneumonia in young adults. Streptococcus pyogenes (choice E) is the most common cause of pharyngitis; however, this patient's presentation strongly suggests epiglottitis. 25The correct answer is E. Verapamil is a "first-generation" calcium channel blocker that has been associated with an accelerated progression of CHF in certain patients. This agent has a strong negative inotropic effect, which leads to a decrease in the force and velocity of myocardial contraction. Hence, this agent would most likely exacerbate the patient's heart failure. As a general rule, the use of calcium channel blockers in CHF is reserved for patients who also have hypertension and/or anginal symptoms. Amlodipine (choice A) and felodipine (choice C) are the most commonly used calcium channel blocking agents in patients with CHF. These two medications may actually produce a small increase in myocardial contractility and cardiac output.

Diltiazem (choice B) is generally avoided in patients with CHF, since it has mild-to-moderate negative inotropic effects leading to a small decrease in myocardial contractility. However, the negative inotropic effects of verapamil are much greater than those seen with diltiazem. Isradipine (choice D) is a calcium channel blocker that can safely be used at lower doses in patients with CHF; it seems to have no net effect on myocardial contractility 26The correct answer is E. The opponens pollicis muscle is innervated by the median nerve. This is the nerve that also supplies sensory innervation to the palmar aspect of the first and third digits. As the median nerve runs through the carpal tunnel at the wrist, it may be compressed between the carpal bones and the transverse ligament, thus producing pain, numbness, tingling, and weakness in the hand along the median nerve distribution. The abductor pollicis longus (choice A), the extensor indicis (choice C), and the extensor pollicis longus (choice D) are innervated by the posterior interosseous nerve, a branch of the radial nerve. The adductor pollicis (choice B) is innervated by the ulnar nerve. 27The correct answer is E. The parietal cells of the stomach produce intrinsic factor, a glycoprotein that binds vitamin B12 in the lumen of the stomach and facilitates its absorption in the terminal ileum. Patients without a stomach and those with pernicious anemia (autoimmune destruction of parietal cells) will require B12 replacement therapy. Recall that B12 deficiency will lead to megaloblastic anemia and the USMLE-favorite picture of a blood smear with hypersegmented neutrophils. Note that parietal cells also synthesize and secrete HCl. Chief cells (choice A) are responsible for secreting pepsinogen, the precursor to pepsin. G cells (choice B) are gastrin-secreting cells. Gastrin stimulates secretion of acid by the parietal cells found in the body and fundus of the stomach. Zollinger-Ellison syndrome is caused by a pancreatic or duodenal tumor that secretes gastrin (a gastrinoma). It is characterized by the development of severe peptic ulcer disease. Goblet cells (choice C) are part of the mucosa of the small intestine, not the stomach. They produce glycoproteins (mucins) that protect and lubricate the lining of the intestine. Mucous neck cells (choice D) are mucus-secreting cells located in the necks of the gastric glands. 28The correct answer is D. The clavicle is the most frequently broken long bone of the body. However, despite what one might expect, the underlying subclavian vessels and parts of the brachial plexus are only rarely injured. This is because the subclavius muscle, which occupies a small groove on the undersurface of the clavicle, apparently protects the underlying structures. Other functions of this small muscle are not well understood. The deltoid (choice A) originates from the lateral aspect of the clavicle and is a powerful abductor of the arm. The pectoralis major (choice B) originates from the medial aspect of the clavicle, and is not as important as the subclavius with regard to protecting underlying structures. The sternocleidomastoid (choice C), an important muscle of the anterior neck, attaches to the medial aspect of the posterosuperior border of the clavicle. The trapezius (choice E), an important muscle of the posterior neck, attaches to the lateral aspect of the posterosuperior border of the clavicle. 29The correct answer is C. The disease is Burkitt's lymphoma (the major clue is "starry sky" pattern), which occurs as a jaw lesion in epidemic form in Africa (associated with EpsteinBarr virus) and in a sporadic form that usually involves the pelvic or abdominal organs. Burkitt's lymphoma is associated with c-myc activation due to a t(8,14) translocation that

places the c-myc-containing segment of chromosome 8 near an actively transcribed gene for immunoglobulin heavy chains. t(9,22) (choice D) and abl-bcr hybrid (choice A) are associated with chronic myeloid leukemia (CML). t(14, 18) (choice E) and bcl-2 (choice B) are associated with follicular lymphomas, not Burkitt's lymphoma.

30>The correct answer is C. Gonorrhea is on the short list of reportable diseases, including AIDS (but not HIV positivity), chickenpox, hepatitis A and B, measles, mumps, rubella, salmonella, shigella, syphilis, and tuberculosis.

31The correct answer is E. The splenic artery passes behind the stomach and gives off the short gastric artery and the left gastroepiploic artery immediately after passing the greater curvature. The left gastroepiploic artery has a strong anastomotic connection to another arterial supply while the short gastric does not, so the area supplied by branches of the short gastric arteries is more vulnerable to ischemia in this setting. If the block had occurred proximal to, instead of at the branch point, the short gastric vessels could be supplied by backflow from the left gastroepiploic artery. The left gastric artery (choice A) is not supplied by the splenic artery. The left gastroepiploic artery (choice B) can be alternatively supplied by its anastomotic connection to the right gastroepiploic artery. The right gastric artery (choice C) is not supplied by the splenic artery. The right gastroepiploic artery (choice D) is normally supplied by the gastroduodenal artery. 32The correct answer is E. Trichomonas vaginalis (note "vagina" in the name) is the only organism listed to primarily affect the genital tract rather than the intestinal tract. The vaginitis it causes is characterized by a frothy, yellow discharge. The organism can be identified in Pap smears, or, more reliably, by special culture techniques that are becoming more widely available. Infection in men is usually asymptomatic, but prostatitis and urethritis can also occur. Treatment with metronidazole is indicated for both the patient and the sexual partner(s). The other organisms listed (choices A, B, C, and D) cause gastrointestinal disease. 33The correct answer is E. Pepsin production is a normal physiologic activity of the stomach that, in conditions of stress, may overwhelm the stomach's weakened defenses and result in gastric ulceration. Gastric acid production is another condition that may increase and cause acute ulceration. Furthermore, these two factors may remain unchanged and still result in gastric ulcers if the gastric defenses are weakened by stress. All of the other choices represent normal defensive forces in the stomach. Increased bicarbonate transport (choice A) would protect the gastric epithelium from the potentially harmful acidity of the gastric contents. The adherent mucus is relatively alkaline, providing local protection to the superficial mucosa. Gastric epithelial cells can normally replicate rapidly, allowing mucosal defects to be rapidly repaired. Increasing the regenerative capacity of the epithelium (choice B) would have a protective effect against ulceration. The gastric mucosa is richly supplied with blood, providing the epithelial cells with an ample supply of nutrients, oxygen, and bicarbonate to contend with the harsh gastric microenvironment. Stress ulcers are associated with compromised gastric blood flow, not increased flow (choice C).

Mucus protects the gastric epithelium by virtue of being water insoluble, impermeable to pepsin, and slowly permeated by acid (H+). Increasing mucus production (choice D) has a protective effect for the gastric mucosa.

34The correct answer is E. Follicles in different stages of maturation have different appearances. The most primitive follicles, primordial follicles (choice D), are inactive reserve follicles that contain primary oocytes (arrested in prophase of first meiotic division) surrounded by a single layer of flattened follicular cells. Primary follicles (choice C), the next stage, are slightly larger and contain a central oocyte surrounded by one or several cuboidal follicular cells. When several small spaces in the follicular mass fuse to form the antrum (follicular cavity), the follicle is termed a secondary follicle (choice E). The secondary follicles continue to enlarge, and develop a more complex structure that includes cumulus oophorus, corona radiata, theca interna, theca externa, and zona pellucida. The Graafian follicle (choice B) is the mature form of the follicle, which extends through the entire cortex and bulges out at the ovarian surface. After it ruptures and releases the ovum, the corpus luteum (choice A)develops as the cells of the follicle and the theca interna cells enlarge, become epithelioid, and secrete estrogen. The granulosa lutein cells contain yellow pigment and secrete progesterone. If pregnancy does not occur, the corpus luteum eventually degenerates; if pregnancy occurs, it is maintained throughout the pregnancy.

35>The correct answer is A. Vitamin B1, or thiamine, is the coenzyme required (as the pyrophosphate) for the decarboxylation of alpha-ketoacids. An example of this reaction is pyruvate decarboxylase reaction in alcoholic fermentation. Other reactions such as that catalyzed by pyruvate dehydrogenase also rely on thiamine pyrophosphate for decarboxylation, but require other cofactors as well. Thiamine is also required for the generation of pentose phosphates for nucleotide synthesis in the pentose phosphate pathway (hexose monophosphate shunt), serving as a cofactor for transketolase. Vitamin B2 (choice B), or riboflavin, is a constituent of FMN (flavin mononucleotide) and FAD (flavin adenine dinucleotide). It functions in hydrogen and electron transport. Vitamin B3 (choice C), or niacin (nicotinic acid), is a coenzyme that is also involved in hydrogen and electron transport. Nicotinic acid functions in the form of NAD and NADP. Vitamin B5 (choice D), or pantothenic acid, is conjugated with coenzyme A to act as a carboxylic acid carrier. Vitamin B6 (choice E), or pyridoxine, is required as a cofactor for pyridoxal phosphate and pyridoxamine phosphate. Both of these cofactors are essential to protein metabolism and energy production.

36>The correct answer is D. This question is simple if you know that tyrosinase is an enzyme in the biosynthetic pathway for melanin formation from tyrosine. A lack of tyrosinase causes one form of albinism; a second form is caused by defective tyrosine uptake. Patients with albinism are vulnerable to developing cancers of the skin of all types, including basal cell carcinoma, squamous cell carcinoma, and melanoma. The melanomas are unusual in that they are non-pigmented (amelanotic) rather than black, since the patients cannot form melanin.

37>The correct answer is A. Class II MHC proteins are expressed on the surfaces of macrophages, dendritic cells, and B cells; this complex of molecules is recognized by CD 4+ helper T cells. The T cells of the transplant recipient recognize allogeneic MHC molecules on the surface of an antigen-presenting cell of the donor. It is thought that interstitial dendritic cells of the donor are the most important immunogens because not only do they express class I and II HLA molecules, but they are also endowed with co-stimulatory molecules. CD 8+ cytotoxic T cells recognize the class I molecules. CD 4+ cells proliferate as Th1 cells and produce interleukin 2, which causes differentiation of the CD 8 cells. The CD 8+ cytotoxic cells of the recipient then cause lysis of the donor cells. Interleukin-2 (choice B) activates T cells by binding to high-affinity IL-2 receptors (IL-2R). Perforins (choice C) are produced by CD 8+ cytotoxic lymphocytes as they bind to Class I MHC molecules. The perforins damage the donor cell membranes, resulting in lysis. IgE-mediated reactions (choice D) are not associated with graft rejection. Blocking antibodies (choice E) are employed as a form of immunosuppressive therapy. Antilymphocyte globulins and monoclonal anti-T cell antibodies (monoclonal anti-CD3) are used to inhibit rejection of the graft. This process does not involve class II MHC proteins on donor cells.

38>The correct answer is E. Caffeine inhibits phosphodiesterase and thereby prevents cAMP from being degraded. Consequently, cAMP continues to activate protein kinase A, which results in both glycogen and triglyceride breakdown. Caffeine has no direct or indirect effect on adenylyl cyclase (choice A). Caffeine does not directly interact with glycogen phosphorylase (choice B) or hormonesensitive lipase (choice C) and cannot allosterically activate these enzymes. However, because cAMP is not degraded due to the action of caffeine on phosphodiesterase, the cAMP will continue to activate protein kinase A. In turn, activation of protein kinase A will lead to phosphorylation of glycogen phosphorylase and hormone-sensitive lipase, resulting in glycogen and triglyceride breakdown. Protein kinase A is not phosphorylated under normal physiological circumstances, and therefore caffeine cannot inhibit its dephosphorylation (choice D).

39>The correct answer is B. Cephalosporins, such as cefuroxime, are believed to exert their antibacterial effect by binding to one or more of the penicillin-binding proteins located on the cell walls of susceptible organisms. This action results in the inhibition of the third, and final, stage of bacterial cell wall synthesis. This is also the mechanism of action of the penicillins. Cefuroxime is a second generation cephalosporin used to treat infections in the lower respiratory and urinary tracts, as well as otitis media. It is also efficacious in the treatment of gonorrhea and is used for perioperative prophylaxis in various surgical procedures, such as coronary artery bypass grafting. Sulfonamide antibiotics, such as sulfamethoxazole-trimethoprim, exert their antibacterial effect through the competitive inhibition of para-aminobenzoic acid (PABA) (choice A), thereby inhibiting folic acid biosynthesis required for bacterial growth. Quinolone antibiotics, such as ciprofloxacin, inhibit DNA-gyrase (choice C), which is an enzyme necessary for bacterial DNA replication and repair. Aminoglycosides, such as gentamicin, irreversibly bind to the 30S subunit of bacterial ribosomes (choice D), inhibiting bacterial protein synthesis.

Lincosamides, such as clindamycin, irreversibly bind to the 50S subunit of bacterial ribosomes (choice E), suppressing bacterial protein synthesis. Note that macrolides, such as erythromycin, reversibly bind to the 50S subunit of bacterial ribosome.

40>C 41>D 42>C 46>B 47>C 48>E

43>D 49>E

44>B 50>B

45>B

(14) <1>A 26-year-old woman is undergoing surgery and is anesthetized with an inhalant anesthetic. She is also given an IV dose of succinylcholine. Within minutes, she develops a heart rate of 124 and increasing core body temperature. What is the mechanism of action of the drug of choice for this patient's condition? A. It interferes with the release of Ca2+ from the sarcoplasmic reticulum B. It is a competitive antagonist of ACh at the motor end plate C. It is a GABA receptor agonist that enhances inhibition of nerve impulses D. It uncouples oxidative phosphorylation, thereby preventing heat formation Answer

<2>An oncologist tells his patient that her laboratory results support a diagnosis of advanced malignant melanoma with multiple metastases to the liver and brain. He also advises her that the prognosis is poor. Which of the following is most likely to be the first statement that the patient will make? A. "Can you keep me alive until my daughter graduates from medical school?" B. C. D. E. stick." Answer "Damn you doctor, you should have caught this earlier!" "Doctor, you must be wrong." "I think it is time that I make a will and say good-bye to everyone." "It's no use, I always lose and get the short end of the

<3>An 18-year-old, previously healthy female presents to the student health service with fever, vomiting, and diarrhea. On physical examination, she is hypotensive and has an erythematous, red, sunburn-like skin rash. She is currently menstruating, and has been using super absorbent tampons. Which of the following findings from a positive blood culture would confirm your suspected diagnosis? A. Organisms are acid-fast B. Organisms are coagulase positive C. Organisms grow on EMB (eosin-methylene blue) agar D. Organisms grow on Thayer-Martin media E. Organisms have positive Quellung reaction Answer

<4>A child falls and bumps her head on the floor. Tissue factor is exposed beneath the endothelium of traumatized blood vessels. Which of the following procoagulant proteins binds to tissue factor and initiates the clotting cascade? A. Factor V B. Factor VII C. Factor X D. Fibrinogen E. Prothrombin Answer

<5>A patient is transported to the emergency room with a knife wound to the right fifth intercostal space at the midaxillary line. Which of the following structures is likely to have been damaged? A. Liver B. Right atrium C. Right pulmonary artery D. Superior vena cava E. Upper lobe of right lung Answer

<6>A 10 year-old child develops prolonged bleeding following a dental extraction. The child is referred to a hematologist; evaluation of the child's hematologic parameters demonstrates a prolonged partial thromboplastin time and an elevated bleeding time. Which of the following platelet abnormalities would most ikely be found in this child? A. Abnormal platelet morphology B. Impaired platelet adhesion C. Impaired platelet primary aggregation D. Impaired release of platelet vesicles E. Impaired secondary aggregation of platelets Answer

<7>A 60-year-old man is admitted to the hospital because of shortness of breath. The man's ankles have 4+ edema and his blood pressure is 75/50 mm Hg. Initial chemistry studies show serum urea nitrogen (BUN) 36 mg/dL and serum creatinine 1.0 mg/dL. A chest x-ray shows cardiac enlargement and perihilar infiltrates. Which of the following most likely accounts for the patient's BUN and creatinine levels? A. Decreased renal perfusion B. Distal urinary tract obstruction

C. D. E. Answer

Increased synthesis of urea Renal glomerular disease Renal tubulointerstitial disease

<8>A 47-year-old man with a history of sickle cell disease has had numerous hospitalizations requiring the placement of intravenous lines. The patient has poor peripheral venous access, and a catheter is placed in the right subclavian vein. The patient subsequently develops right arm discomfort and swelling and a temperature of 40.1 degrees C with chills. Multiple blood cultures are taken , and gram-positive cocci are isolated. The organism is catalase positive and grows on mannitol salt agar, but does not turn the agar yellow; the colonies are gamma-hemolytic on a sheep blood agar plate. Which of the following organisms is the most likely cause of this patient's symptoms? A. Enterococcus faecalis B. Staphylococcus aureus C. Staphylococcus epidermidis D. Streptococcus agalactiae E. Streptococcus pyogenes Answer

<9>A 7-month-old child is hospitalized for a yeast infection that does not respond to therapy. The patient has a history of multiple, acute pyogenic infections. Physical examination reveals that the spleen and lymph nodes are not palpable. A differential WBC count shows 95% neutrophils, 1% lymphocytes, and 4% monocytes. A bone marrow biopsy contains no plasma cells or lymphocytes. A chest x-ray reveals the absence of a thymic shadow. Tonsils are absent. These findings are most consistent with A. Bloom's syndrome B. chronic granulomatous disease C. severe combined immunodeficiency D. Waldenström's macroglobulinemia E. Wiskott-Aldrich syndrome Answer

<10>A 57-year-old man presents with an enlarged right inguinal lymph node on the medial side of the horizontal chain. Biopsy demonstrates a well-differentiated adenocarcinoma forming large glands and producing copious amounts of mucin. Which of the following is the most likely primary site for this cancer? A. Anorectal region B. Ascending colon C. Duodenum

D. E. Answer

Stomach Transverse colon

<11>Under normal conditions, the main drive for respiration is A. arterial PCO2 acting through central chemoreceptors B. arterial PCO2 acting through peripheral chemoreceptors C. arterial pH acting through central chemoreceptors D. arterial pH acting through peripheral chemoreceptors E. arterial PO2 acting through central chemoreceptors F. arterial PO2 acting through peripheral chemoreceptors G. Hering-Breuer reflex Answer

<12>A newborn baby who was apparently healthy at birth develops aspiration pneumonia in the first two days of life. All attempts to feed the infant cause it to cough and choke. Which of the following abnormalities is the most likely cause of the infant's difficulties? A. Bronchogenic cysts B. Congenital pulmonary cysts C. Posterior deviation of the tracheoesophageal septum D. Pulmonary immaturity E. Pulmonary sequestration Answer

<13>A neurologist notes that a patient has weakness when she attempts internal rotation of her right arm at the shoulder. This could be caused by weakness in which of the following muscles? A. Infraspinatus B. Pectoralis minor C. Subscapularis D. Supraspinatus E. Teres minor Answer

<14>Microscopic examination of a PAS-stained histological section through a Graafian follicle demonstrates a bright reddish-pink, acellular ring around the ovum. Which of the following terms most accurately describes this ring? A. Corona radiata B. Cumulus oophorus C. Theca externa D. Theca interna E. Zona pellucida

Answer

<15>From which of the following fetal vessels do the umbilical arteries arise? A. Aorta B. Carotid arteries C. Ductus arteriosus D. Iliac arteries E. Pulmonary arteries Answer

<16>A 55-year-old female presents for an annual exam. Her right breast is swollen, red, and tender. The physician palpates a firm area in the breast and suspects inflammatory breast cancer. Which of the following best describes the histological changes observed in this disorder? A. Acute inflammation in breast carcinoma B. Chronic inflammation in breast carcinoma C. Dermal lymphatic invasion by cancer cells D. Epidermal invasion by cancer cells E. Fat necrosis in breast carcinoma Answer

<17>Which of the following cell types is derived from neuroepithelial cells? A. Astrocytes B. Enterochromaffin cells C. Melanocytes D. Odontoblasts E. Schwann cells Answer

<18>A 23-year-old woman decides to donate her left kidney to her brother, who has bilateral renal failure. Blood flow was 600 mL/min and vascular resistance was 0.16 mm Hg/mL/min in her kidney before it was removed. Which of the following would be expected to increase following the removal of her kidney? A. Arterial blood pressure B. Cardiac output C. Pulmonary blood flow D. Total renal blood flow E. Total peripheral resistance Answer

<19>A 30-year old male complains of fatigue and diffuse skeletal pain. He has a history of Crohn's disease, which led to resection of the terminal ileum 3 years previously. Steatorrhea and diarrhea have continued since the surgery. Laboratory tests show that serum calcium is 7.5 mg/dL, serum phosphate is 2.5 mg/dL, and serum parathyroid hormone (N-terminal) is 750 pg/mL. Which of the following is the most likely cause of these findings? A. Osteoporosis B. Paget's disease C. Primary hypoparathyroidism D. Renal failure E. Vitamin D deficiency Answer

<20>A newborn infant has some of its abdominal viscera protruding through a defect in the abdominal wall. Which of the following is the likely cause of this defect? A. Failure of the intestinal loop to retract from the umbilical cord B. Failure of the yolk stalk to degenerate C. Failure of peritoneal fusion D. Incomplete fusion of the lateral body folds E. Umbilical herniation Answer

<21>A 75-year-old man with a 40-pack-year history of smoking and hypercholesterolemia has severe atherosclerosis. Occlusion of which of the following arteries would result in insufficient perfusion of the urinary bladder? A. External iliac B. Inferior epigastric C. Internal iliac D. Internal pudendal E. Lateral sacral Answer

<22>Following a difficult delivery accompanied by significant maternal hemorrhage, a new mother develops a severe retro-orbital hemorrhage with nausea and vomiting. The patient then develops fever and visual field loss, followed by impairment of medial and downward gaze accompanied by diplopia and ptosis. CT scan demonstrates hemorrhage in the pituitary gland with extension to the meninges. Immediate therapy with which of the following hormone combinations should be instituted? A. Glucocorticoids and estrogens B. Glucocorticoids and thyroid hormone C. Growth hormone and estrogens

D. E. Answer

Mineralocorticoids and growth hormone Prolactin and mineralocorticoids

<23>A Southeast Asian immigrant child is noted to be severely retarded. Physical examination reveals a pot-bellied, pale child with a puffy face. The child's tongue is enlarged. Dietary deficiency of which of the following substances can produce this pattern? A. Calcium B. Iodine C. Iron D. Magnesium E. Selenium Answer

<24>A 65-year-old Laotian immigrant has developed thick, erythematous nodules on her ears and nose with significant associated sensory loss. The nodules have grown slowly over the course of many years. Biopsy o f the lesions shows dermal granulomas with giant cells but no acid-fast bacteria. Culture on blood agar and Lowenstein-Jensen medium shows no growth. These findings are most consistent with which of the following diagnoses? A. Cutaneous leishmaniasis B. Onchocerciasis C. Rhinoscleroma D. Smallpox E. Tuberculoid leprosy Answer

<25>A 32-year-old TV cameraman complains of weakness and blurred vision. He notes that these symptoms are typically worsened with effort and improve with rest. Physical examination is remarkable for ptosis and weakness of limb muscles on repetitive testing. What is the mechanism of action of the agent that is commonly prescribed for the long-term amelioration of these symptoms? A. Carbamylation of acetylcholinesterase B. Competitive inhibition of acetylcholinesterase C. Dephosphorylation of acetylcholinesterase D. Direct muscarinic receptor agonist E. Direct muscarinic receptor antagonist F. Direct nicotinic receptor agonist G. Direct nicotinic receptor antagonist H. Phosphorylation of acetylcholinesterase Answer

<26>A 25-year-old female presents with a 12-month history of palpitations, intermittent diarrhea, anxiety, and a 1-month history of "bulging of both eyes." What is the most likely cause of her symptoms? A. Graves' disease B. Hashimoto's thyroiditis C. Multinodular toxic goiter D. Papillary carcinoma E. Subacute thyroiditis Answer

<27>Which of the following organisms would most likely be isolated from the vagina of a normal 5 year-old girl? A. Candida B. Lactobacillus C. Neisseria D. Staphylococcus E. Streptococcus Answer

<28>A 26-year-old woman with sickle cell anemia develops pneumonia, and as a complication, develops very painful focal ischemia in the muscles and joints. Which part of the renal vasculature would be most vulnerable to similar damage during this sickle cell crisis? A. Arcuate arteries B. Glomerular capillaries C. Interlobular arteries D. Renal artery E. Vasa recta Answer

<29>A 12-year-old boy presents with complaints of chronic cough and inability to keep up with his schoolmates during physical education class. The patient's mother states that he has just recovered from his fourth bout of pneumonia in the past 5 months. On examination , digital clubbing, hyperresonance to percussion, and basilar crackles are noted. The boy's sweat chloride concentration is 87 mEq/L. Which of the following agents would most likely serve to alleviate his chronic signs and symptoms? A. Dextromethorphan (PO) B. Ipratropium (aerosolized) C. N-acetylcysteine (aerosolized) D. Pentamidine (aerosolized) E. Vancomycin (IV) Answer

<30>A 72-year-old woman with insomnia participates in a sleep study. As part of the study protocol, she has EEG leads attached, then goes to sleep. At one point during the evening, 12-16 Hz sleep spindles and K-complexes are observed. Which of the following stages of sleep is associated with this pattern? A. REM B. Stage 1 C. Stage 2 D. Stage 3 E. Stage 4 Answer

<31>Which of the following directly inhibits insulin secretion? A. Alpha2-adrenergic agonist B. Beta2-adrenergic agonist C. Cholecystokinin D. Glucagon E. Ingestion of a high-sugar meal F. Muscarinic agonists Answer

<32>A 15-year-old boy is brought into the emergency department with several stab wounds inflicted during an attack by members of a rival street gang. One lesion, between the 9th and 10th ribs along the left posterior axillary line, penetrated to a depth of about 5 cm. Which of the following organs would be the first one pierced by the sharp object that caused this injury? A. Ascending colon B. Duodenum C. Left kidney D. Left lobe of the liver E. Spleen Answer

<33>A patient presents to a physician because of a markedly inflamed and painful great toe. Physical examination additionally demonstrates smal l nodules on the patient's external ear. Aspiration of the metatarsal-phalangeal joint of the affected toe demonstrates needle-shaped, negatively birefringent crystals. Of which of the following are the crystals most likely composed? A. Bile pigments B. Calcium pyrophosphate C. Cystine D. Monosodium urate

E. Answer

Struvite

<34>A 24-year-old male Asian immigrant presents with an ulcerative genital lesion. The lesion first appeared 1 month ago as a papule with an erythematous base, which eventually became ulcerated and painful. On physical examination, the man is afebrile. A tender ulcerative lesion is present on his prepuce, and inguinal adenopathy is evident. Which of the following would be the most likely microscopic finding in a scraping from the rash? A. Epithelial cells with intranuclear inclusion bodies B. Iodine-staining intracellular inclusion bodies C. Koilocytotic squamous epithelial cells D. Neutrophils containing gram-negative diplococci E. Pleomorphic gram-negative rods in a "school of fish" pattern F. Spirochetes visible by darkfield microscopy Answer

<35>A 36-year-old man with AIDS develops right-sided weakness involving the lower, but not the upper, limb. MRI scans reveal a ring-enhancing lesion within the white matter of the left frontal lobe. A biopsy shows coagulative necrosis of brain parenchyma with macrophage-rich chronic inflammatory infiltration admixed with microscopic cysts that contain characteristic bradyzoites. Which of the following is the most common source of this type of infection? A. Anopheles mosquitoes B. Bird droppings C. Cats D. Cooling systems E. Washbasins Answer

<36> A work diagram showing changes in left ventricular volume and pressure during one cardiac cycle is depicted above. To which of the following phases of the cardiac cycle does the portion of the graph labeled number 3 correspond? A. Isometric contraction B. Isometric relaxation C. Isotonic contraction D. Isotonic relaxation Answer

<37>A 50-year-old stockbroker presents with a chief complaint of generalized "stiffness" lasting a few hours each morning. The

patient acknowledges a recent 10 pound weight loss and a past medical history of duodenal ulcers. On examination, his temperature is 100.5 degrees Fahrenheit, there is lymphadenopathy and mild splenomegaly. Subcutaneous "nodules" are palpable over selected bony prominences. Based on this information, which of the following would be most recommended for the treatment of his acute pain symptoms? A. Acetaminophen B. Celecoxib C. Indomethacin D. Methotrexate E. Sulfasalazine Answer

<38>A 64-year-old woman had a cerebrovascular accident 6 months ago. Her past medical history is remarkable for hyperthyroidism and atrial fibrillation. She initially presented with slurred speech and right hemiparesis. The hemiparesis resolved, but her speech is still agrammatic and nonfluent, and she has difficulty finding words and completing sentences. Her comprehension is intact, and she appears frustrated when she attempts to speak. The remainder of the neurologic examination is normal. Which of the following best describes her deficit? A. Apraxia B. Broca aphasia C. Dysarthria D. Global aphasia E. Wernicke aphasia Answer

<39>A 35-year-old woman with a ten-year history of vague arthralgias and fevers has antibody studies performed that demonstrate autoantibody directed against double-stranded DNA. Later, she develops a photosensitive rash over her nose and cheeks. Biopsy of the rash would most likely demonstrate which of the following? A. Fibroblastic-like cells in a storiform pattern B. Granular complement and IgG at the dermal-epidermal junction C. Multiple horn cysts D. Pautrier microabscesses E. Sawtooth dermal/epidermal junction Answer

<40>A 65-year-old female with renal failure presents for hemodialysis. She is found to be anemic and is given a dose of erythropoietin along with her usual vitamin and mineral supplements. Erythropoietin stimulates which of the following intermediates in hematopoiesis?

A. B. C. D. E. Answer

Basophilic erythroblasts Colony forming units-erythroid Multipotential stem cells Proerythroblasts Reticulocytes

<41>An overweight 48-year-old male presents with complaints of increased thirst and frequent urination. Laboratory examination reveals a blood glucose level of 180 mg/dL. The patient's past medical history is unremarkable, except for an anaphylactic reaction that occurred one year ago when he was given trimethoprim-sulfamethoxazole for a sinus infection. Based on this information, which of the following agents should be prescribed? A. Chlorpropamide B. Glipizide C. Glucagon D. Metformin E. Propranolol Answer

<42>A patient presents with a severe form of atopic asthma. Which of the following changes would most likely be found in this patient's blood? A. Basophilic leukocytosis B. Eosinophilic leukocytosis C. Lymphocytosis D. Monocytosis E. Neutrophilic leukocytosis Answer

<43>A low-birth-weight neonate, who passed meconium on the first day of life, is started on formula at 2 days of age. The infant develops abdominal distension and tenderness, accompanied by findings suggestive of sepis, including hypotension and neutrophilia of the blood. What is most likely to be seen at emergency surgery? A. A massive thickening of the pylorus B. A massively dilated colon C. Bowel loops in the chest cavity D. Gangrene of the terminal ileum and ascending colon E. Normal-appearing gastrointestinal tract Answer

<44>A 9-year-old boy complains of sudden severe pain in his left hip.

There is no history of trauma. He says that he had a "cold" for a few days. An x-ray film obtained at the local emergency department shows an "Erlenmeyer flask shaped" distal femur. The medullary bone is hazy. There is osteosclerotic new bone formation, as well as areas of corticomedullary osteonecrosis. Other members of his family have been known to have bone pain. Which of the following findings would a biopsy of the marrow of the femur likely reveal? A. Abnormal osteoclasts and mosaic lamellar bone B. Accumulation of abnormal macrophages C. Benign reactive bone around an osteoid nidus D. Malignant sarcoma E. Well-differentiated cartilage Answer

<45>A 25-year-old woman complains of abdominal pain of rapid onset in the right lower quadrant. She subsequently undergoes surgery for suspected acute appendicitis. At surgery, however, a tubal pregnancy is discovered. The most frequent predisposing factor for this condition is A. endometriosis B. an intrauterine device C. leiomyomas of the uterus D. pelvic inflammatory disease E. previous surgery Answer

<46>A 2-year-old infant with uncomplicated coarctation of the aorta appears to be in good health. Growth and development are normal. The constriction is located just distal to the subclavian arteries. Which of the following is decreased in this patient? A. Blood flow in the upper body B. Blood flow in the lower body C. Blood pressure in the upper body D. Vascular resistance in the upper body E. Vascular resistance in the lower body Answer

<47>In a patient with a urine flow rate of 1 mL/minute, the tubular fluid with the lowest osmolarity would be found in the A. beginning of the proximal tubule B. end of the cortical collecting tubule or duct C. end of the papillary collecting tubule or duct D. macula densa E. tip of the loop of Henle Answer

<48>A 54-year-old man presents to a physician with headaches. A complete blood count demonstrates a hematocrit of 62%. The peripheral smear shows normocellular erythrocytes, with increased reticulocytes and nucleated red cells. Bone marrow biopsy demonstrates increased numbers of erythrocytic precursors. Cancer of which of the following organs would be most likely to cause these findings? A. Colon B. Kidney C. Ovary D. Prostate E. Thyroid Answer

<49>The interlobular arteries of the kidney result from subdivision of the A. afferent arterioles B. arcuate arteries C. interlobar arteries D. renal artery Answer

<50>A 16-year-old female patient presents with complaints of a non-productive cough, low-grade fever, and a headache. The physician also notes a non-purulent otitis media. She is treated with an antibiotic that inhibits the translocation of the growing peptide chain along the mRNA. The antibioti c the patient was given was A. chloramphenicol B. cycloheximide C. erythromycin D. puromycin E. streptomycin F. tetracycline Answer

Answers

1The correct answer is A. This is a three-step question. First you need to figure out the diagnosis, then you need to determine the drug of choice for this condition, and finally, you need to remember the mechanism of action of that drug. The clinical picture presented

suggests malignant hyperthermia. The treatment for this condition (a USMLE favorite) is dantrolene. Dantrolene prevents the release of Ca2+ from the sarcoplasmic reticulum, thereby reducing skeletal muscle contractions. Side effects include muscle weakness and hepatotoxicity (if used chronically). Other uses include spasticity, multiple sclerosis, and cerebral palsy. Nondepolarizing blockers competitively inhibit the activity of acetylcholine at the neuromuscular junction (choice B). Examples include curare, atracurium, and vecuronium. Baclofen is a GABAB receptor agonist that is inhibitory at synapses in the spinal cord (choice C). Uncouplers of oxidative phosphorylation (choice D) include dinitrophenol and thermogenin (found in brown fat mitochondria and acts to keep blood warm in a neonate). 2The correct answer is C. Kubler-Ross's death and dying sequence is a step-wise process with 5 identified stages. The order in which these stages appear is the following: 1. denial, 2. anger, 3. bargaining, 4. sadness, and 5. acceptance. "Doctor you must be wrong" is the correct answer since it reflects the patient's inability to accept the information and indicates the denial of the first stage. "Can you keep me alive until my daughter graduates from medical school" (choice A) is a statement from the 3rd, bargaining stage. "Damn you doctor, you should have caught this earlier" (choice B) is a statement from the 2nd or anger phase. "I think it is time that I make a will and say good-bye to everyone" (choice D) reflects the patient's acceptance of the reality and is a statement from the 5th phase (acceptance). "It's no use, I always lose and get the short end of the stick" (choice E) is a statement from the 4th phase (sadness). 3The correct answer is B. This is a multi-step microbiology question that requires you to diagnose the illness, identify the microorganism, and remember its key feature. The first part should be easy: everything about this vignette suggests toxic shock syndrome. The organism in question is therefore Staphylococcus aureus, which is coagulase positive. All of the other choices are classic features of other important pathogenic microorganisms: Acid-fast organisms (choice A), refers to Mycobacteria. (In addition, Nocardia species are partially acid fast). EMB agar (choice C) refers to a selective and differential medium used to isolate and identify enteric gram-negative bacteria. Gram-positive bacteria will not grow on EMB agar because the addition of eosin inhibits their growth. Nonlactose fermenters will have colorless colonies, while fermentation of this sugar will cause the colonies to appear pink or purple. Thayer-Martin media (choice D) is a growth medium for pathogenic Neisseria species. It contains the antibiotic vancomycin, which kills gram-positive organisms such as Staphylococcus aureus. The Quellung reaction (choice E) can be used to identify the capsule type of a microorganism. Encapsulated microorganisms, like the Pneumococci and Haemophilus, are mixed with specific antisera. If the antiserum is directed against the microorganism's capsule type, the capsule will be opsonized, absorb water, and become visible under a light microscope. 4The correct answer is B. The extrinsic pathway of clotting begins with tissue factor binding to Factor VII or Factor VIIa. All other clotting proteins require proteolytic cleavage to become active, however Factor VII has a low level of activity in its inactive form, and it can act with tissue factor and phospholipids to initiate the clotting cascade. In the extrinsic pathway, Factor VII cleaves Factor X to Xa (choice C) which acts in concert with Factor V (choice A) to cleave prothrombin to thrombin (choice E). The final step in the coagulation

pathway is the cleavage of fibrinogen to fibrin by thrombin (choice D). Fibrin polymerizes and crosslinks, thereby forming a hemostatic net of insoluble protein. 5The correct answer is A. Any perforating wound occurring below the level of the fourth intercostal space on the right side may damage the liver, which is protected by the rib cage, although it is an abdominal organ lying inferior to the diaphragm. At its most lateral aspect, the right atrium (choice B) forms the right border of the heart, which extends from the 3rd costal cartilage to the 6th costal cartilage just to the right of the sternum. The right pulmonary artery (choice C) enters the hilus of the lung at the level of the T5 vertebra. Since the ribs are angled downward as they pass forward, this entry occurs above the level of the 5th intercostal space at the midaxillary line. The superior vena cava (choice D) enters the right atrium at the level of the third costal cartilage. At the midaxillary line, the oblique fissure of the right lung (choice E) passes between the inferior and middle lobes. 6The correct answer is B. This child probably has autosomal dominant von Willebrand's disease, in which an abnormal von Willebrand's factor (which also carries factor VIII in the blood) causes a defect in the initial adhesion of normal platelets to a damaged vessel wall. Since factor VIII levels are also consequently low, the partial thromboplastin time is also prolonged. Defects in platelet adhesion are also seen in Bernard-Soulier disease. Abnormal platelet morphology (choice A) is not seen in von Willebrand's disease, but may be observed with infiltration of the bone marrow by tumor or fibrosis, or after splenectomy. Defects in primary platelet aggregation (choice C) are seen in thrombasthenia, which is caused by a deficiency or defect in the glycoprotein GpIIb-IIIa complex. Defects of release of platelet vesicles (choice D) or secondary aggregation (choice E) are seen in storage pool disease and aspirin use. 7The correct answer is A. The patient's ankle edema, shortness of breath, and relatively low blood pressure suggest the possibility of congestive heart failure, which is confirmed by the cardiac enlargement and perihilar infiltrates seen on chest x-ray. The serum urea nitrogen is elevated while serum creatinine is normal, suggesting a prerenal cause for the azotemia. Congestive heart failure with its resulting decreased blood pressure is a known, common cause of decreased renal perfusion leading to prerenal azotemia. Postrenal causes of azotemia are typically due to urinary tract obstruction distal to the kidney (choice B), and usually cause a rise in both urea and creatinine, with the rise in urea being larger than that in creatinine. Increased synthesis of urea (choice C) is seen in severe burns and prolonged high fever. Renal glomerular disease (choice D) severe enough to cause acute or chronic renal failure will cause urea and creatinine to rise together. Renal tubulointerstitial disease (choice E) severe enough to cause renal failure will cause both urea and creatinine to rise; the creatinine may rise out of proportion to the urea, particularly in acute tubular necrosis. 8The correct answer is C. The patient has developed bacteremia; the description of the causative agent is consistent with a staphylococcal organism (catalase positive, gram-positive cocci that grow on mannitol salt agar). The organism is most likely S. epidermidis as it was not able to ferment mannitol, and was not hemolytic. Both of those characteristics tend to rule out S. aureus (choice B). Two other tests that are commonly used are coagulase production and excretion of DNAse from colonies. S. aureus is positive in both tests, S. epidermidis is negative.

Enterococcus faecalis (choice A) might grow on the mannitol salt agar as it is relatively haloduric but these organisms are catalase negative. The enterococci are extremely variable in hemolytic ability so this characteristic is not useful in species identification. Both streptococcal organisms (choices D and E) are catalase negative and beta-hemolytic on sheep blood agar plates. Also, neither would grow on the mannitol salt agar. S. pyogenes is sensitive to growth inhibition by bacitracin while S. agalactiae (group B streptococci) is not. 9The correct answer is C. Severe combined immunodeficiency (SCID) is associated with deficiencies in both B and T cells due to a defect in differentiation of an early stem cell. Over 50% of the cases are caused by a gene defect on the X chromosome, resulting in a defective IL-2 receptor. The disease may exhibit a sex-linked or an autosomal recessive pattern of inheritance. The autosomal recessive variant is characterized by a deficiency of adenosine deaminase, which results in accumulation of metabolites that are toxic to both B and T stem cells in the bone marrow. Children usually die within the first 2 years of life with severe infections unless they receive bone marrow transplants. Bloom's syndrome (choice A) is an autosomal recessive disorder included in the chromosomal instability group of syndromes. It is associated with small body size, immunodeficiency, light-sensitive facial erythema, and a major predisposition to cancer. Chronic granulomatous disease (choice B) is caused by a deficiency of NADPH oxidase in neutrophils, resulting in loss of the first step of the myeloperoxidase system, and an absence of the respiratory burst. Patients are susceptible to staphylococcal infections and granulomatous infections. Waldenström's macroglobulinemia (choice D) is a monoclonal gammopathy characterized by high serum levels of IgM and hyperviscosity complications. Wiskott-Aldrich syndrome (choice E) is an immunodeficiency syndrome characterized by thrombocytopenia, eczema, and recurrent sinopulmonary infections. The patient has low levels of IgM and increased levels of IgG, IgA, and IgE. 10The correct answer is A. The lymph nodes of the groin are divided into superficial and deep groups. The superficial group is further divided into horizontal and vertical chains. It is worth remembering that tumors from the penis, vagina, and anal canal can drain to the medial side of the horizontal chain of the superficial group of inguinal lymph nodes. Tumors from the ascending colon (choice B) do not usually metastasize early to easily palpable lymph nodes. Tumors from the duodenum (choice C) do not usually metastasize early to easily palpable lymph nodes. Tumors from the stomach (choice D) can metastasize early to the easily palpable left supraclavicular nodes (also called Virchow's nodes or sentinel nodes). Tumors from the transverse colon (choice E) do not usually metastasize early to easily palpable lymph nodes. 11The correct answer is A. The most important factor in the control of minute-to-minute ventilation is arterial PCO2, which influences chemoreceptors located near the ventral surface of the medulla. As arterial PCO2 rises, CO2 diffuses from cerebral blood vessels into the cerebrospinal fluid. Carbonic acid is formed and dissociates into bicarbonate and protons. Protons directly stimulate these central chemoreceptors, resulting in hyperventilation. Hyperventilating reduces the PCO2 in the arterial blood and subsequently in the CSF. Peripheral chemoreceptors located in the carotid and aortic bodies respond to increases in PCO2 (choice B), but are less important than the central chemoreceptors. It is estimated that when a normal subject hyperventilates in response to inhalation of CO2, less than 20% of the response can be attributed to the peripheral receptors. However, they respond more quickly

than their central counterparts, and are thought to play a role in regulating ventilation after abrupt changes in PCO2. There are no known central chemoreceptors that respond to arterial pH (choice C). Carotid chemoreceptors (choice D) cause hyperventilation in response to decreases in arterial pH. However, the CO2 acting through central chemoreceptors is the most important regulator of ventilation under normal conditions. There are no known central chemoreceptors that respond to arterial PO2 (choice E). Peripheral chemoreceptors located in the carotid and aortic bodies respond to decreases in PO2 (choice F) and are solely responsible for the increase in ventilation due to arterial hypoxemia. However, the CO2 acting through central chemoreceptors is the most important regulator of ventilation under normal conditions. There are two types of Hering-Breuer reflexes (choice G). The Hering-Breuer inflation reflex increases the duration of expiration after steady lung inflation. The Hering-Breuer deflation reflex causes a decrease in the duration of expiration produced by substantial deflation of the lung. The degree of lung inflation is sensed by pulmonary stretch receptors thought to reside within the smooth muscle of the airways. This reflex was once thought to be an extremely important mechanism for regulation of ventilation. However, it is now known that this reflex does not become active unless tidal volumes exceed one liter (as in exercise). This reflex may also be important in newborns. 12The correct answer is C. The infant probably has esophageal atresia, which is typically caused by posterior deviation of the tracheoesophageal septum. Attempts at feeding cause fluid to spill into the trachea, and secondarily cause aspiration pneumonia. Emergent surgical correction is usually required. Bronchogenic cysts (choice A) are centrally located cysts that are often asymptomatic and may be associated with cysts of other organs. Congenital pulmonary cysts (choice B) are often multiple and located in the lung periphery without connection to the bronchi; they are vulnerable to infection and rupture complicated by pneumothorax and/or hemoptysis. Pulmonary immaturity (choice D) produces progressive difficulty in breathing beginning in the first few hours of life. Pulmonary sequestration (choice E) represents extrapulmonary lung tissue supplied by systemic blood vessels rather than by pulmonary arteries. 13The correct answer is C. The subscapularis muscle arises from the anterior surface of the scapula and inserts onto the lesser tubercle of the humerus. It is one of the rotator cuff muscles. Its tendon passes on the anterior side of the shoulder joint capsule, where it reinforces the capsule. Contraction of this muscle causes internal rotation of the arm at the shoulder. The infraspinatus muscle (choice A) arises from the posterior surface of the scapula in the infraspinous fossa and inserts on the greater tubercle of the humerus. It is one of the rotator cuff muscles. Its tendon passes along the posterior surface of the shoulder joint capsule, where it reinforces the capsule. Contraction of the infraspinatus causes external rotation of the arm at the shoulder. The pectoralis minor muscle (choice B) arises from the chest wall and inserts onto the coracoid process of the scapula. The pectoralis minor does not attach to the humerus and therefore does not cause movement of the humerus at the shoulder. The supraspinatus muscle (choice D) arises from the posterior surface of the scapula in the supraspinous fossa and inserts onto the greater tubercle. It is one of the rotator cuff muscles. Its tendon passes along the superior surface of the shoulder joint capsule, where it reinforces the capsule. Contraction of the supraspinatus causes abduction of the arm at the shoulder.

The teres minor muscle (choice E) arises from the axillary border of the scapula and inserts onto the greater tubercle of the humerus. It is one of the rotator cuff muscles. Its tendon passes along the posterior surface of the shoulder joint capsule, where it reinforces the capsule. Contraction of the teres minor causes external rotation of the arm at the shoulder. 14The correct answer is E. The ring described is the zona pellucida, which surrounds the ovum. The zona pellucida is rich in polysaccharides and glycoproteins and consequently stains brightly pink or red with PAS stain. Binding of the sperm cell membrane to the zona pellucida triggers the acrosome reaction, during which acrosomal enzymes are released that digest the zona pellucida, allowing the spermatozoon to contact and fuse with the ovum cell membrane. The follicular cells immediately outside the zona pellucida form the corona radiata (choice A). The larger cumulus oophorus (choice B) is the hill of follicular cells that surrounds the ovum. The theca interna (choice D) and externa (choice C) are formed from the connective tissue surrounding the follicle. 15The correct answer is D. The paired umbilical arteries arise from the iliac arteries. They supply unoxygenated fetal blood to the placenta. The single umbilical vein takes the newly oxygenated fetal blood from the placenta to the liver and then to the inferior vena cava via the ductus venosus. 16The correct answer is C. Inflammatory breast cancer is a pattern of invasive breast cancer in which the neoplastic cells infiltrate widely through the breast tissue. The cancer involves dermal lymphatics and therefore has a high incidence of systemic metastasis and a poor prognosis. If the lymphatics become blocked, then the area of skin may develop lymphedema and "peau d'orange," or orange peel appearance. The overlying skin in inflammatory breast cancer is usually swollen, red, and tender. Acute inflammation (choice A) is a rare finding in breast cancer and may be associated with secondary infection or abscess. Chronic inflammation in breast cancer (choice B) is a non-specific finding. In medullary breast cancer, a type of invasive ductal carcinoma, there are a large number of lymphocytes around the tumor and a desmoplastic reaction is often absent in the surrounding tissue. This type of cancer carries a somewhat better prognosis. Epidermal invasion by cancer cells (choice D) is a poor prognostic indicator. Intraepidermal malignant cells are called Paget cells. Paget's disease of the nipple is a type of ductal carcinoma that arises in large ducts and spreads intraepidermally to the skin of the nipple and areola. There is usually an underlying ductal carcinoma. Fat necrosis (choice E) is often seen following trauma to the breast, but is not specifically associated with a particular type of breast cancer, although it may be confused with breast cancer if areas of calcification are present. 17The correct answer is A. Astrocytes and oligodendrocytes are both derived from glioblasts, which, in turn, are derived from neuroepithelial cells. Other neuroepithelial cell derivatives include neuroblasts and ependymal cells. All the other choices are derived from neural crest cells. Other neural crest derivatives include the neurons of the parasympathetic and sympathetic ganglia (including the adrenal medulla), the dorsal root ganglia of the peripheral nervous system, the sensory ganglia of cranial nerves V, VII, IX, and X, and the leptomeninges (pia and arachnoid). 18The correct answer is E. The various organs of the body are arranged in parallel, and therefore contribute a parallel resistance to the peripheral circulation. You should recall that

adding resistances (R1, R2, R3...) in parallel reduces the total resistance (RT) of a circuit as follows (1/RT = 1/R1 + 1/R2 + 1/R3...) so that removing a parallel resistance (R1, R2, or R3) increases the total resistance (RT). For this reason, the total peripheral resistance increases when a kidney is removed. Another way to think about the problem is the following: each kidney provides a pathway for blood to flow from the aorta to the vena cava. When a kidney is removed, there is one less pathway through which blood can flow from the aorta to the vena cava, which means that the resistance to blood flow from the aorta to the vena cava (i.e., the total peripheral resistance) must be increased. Similar logic can be applied to any organ of the body. Removing a kidney should have not have a lasting effect on arterial pressure (choice A), assuming that the remaining kidney functions normally. The cardiac output (choice B) decreases when a kidney is removed. The pulmonary blood flow (choice C), which is equal to the cardiac output of the right heart, should decrease when a kidney is removed. The total renal blood flow (choice D) will decrease when a kidney is removed.

19The correct answer is E. Whenever serum calcium and phosphate are both decreased, vitamin D deficiency should be considered. In this case, the vitamin D deficiency is due to fat malabsorption, including the fat-soluble vitamin D, subsequent to ileal resection. If more than 100 cm of the ileum are removed, primary bile acid production by the liver cannot keep up with bile salt loss in the stool. The total bile salt pool decreases and fat absorption, including the fat-soluble vitamins is poor. Serum calcium is low because of decreased dietary absorption. Serum parathyroid hormone increases in response to the low calcium. Serum phosphate is low because of decreased dietary absorption and increased renal excretion (due to the increased parathyroid hormone). With vitamin D deficiency, the bones demineralize, producing osteomalacia. Clinical manifestations often go unnoticed. Vague complaints of weakness and bone pain may be present. Radiographs of bones in osteomalacia typically reveal the presence of pseudofractures along the inner aspects of the femur, the pubic rami, and the outer edges of the scapulas, upper fibula, and metatarsals. These radiolucent bands, which are perpendicular to the bone surface, may occur because of pulsations of major arteries that cross the bone. Osteoporosis (choice A) is characterized by loss of bone mass, both matrix and mineral. It is usually asymptomatic, and serum levels of calcium, phosphate, and parathyroid hormone are within the normal range. The first hint of bone loss comes because of a fracture in the wrist, hip, or vertebra. Dual-energy radiography, or other similar techniques, can be used to directly quantify the degree of bone loss. In Paget's disease (choice B), bone mineral turnover is increased compared to normal. Its cause is unknown, but may be due to a slow virus that infects osteoclast cells. Both osteoblast and osteoclast activity is increased in focal areas of the bone. The disease is usually asymptomatic, the chief complaint being bone pain over the lesions. Laboratory findings include increased serum alkaline phosphatase, but serum calcium and parathyroid hormone levels are usually normal. With primary hypoparathyroidism (choice C), serum calcium is decreased and serum parathyroid hormone is increased, but serum phosphate is also increased (not decreased). Serum phosphate is increased because urinary excretion is diminished subsequent to the decrease in parathyroid hormone. In renal failure (choice D), an increase (not decrease) in serum phosphate subsequent to decreased urinary excretion is a primary manifestation. Serum calcium is decreased because the hyperphosphatemia drives the equilibrium between calcium and phosphate toward hydroxyapatite crystals. This, in turn, produces an increase in parathyroid hormone secretion with subsequent bone demineralization (renal osteodystrophy).

20The correct answer is D. During the fourth week of development, the lateral body folds move ventrally and fuse in the midline to form the anterior body wall. Incomplete fusion results in a defect that allows abdominal viscera to protrude from the abdominal cavity, a condition known as gastroschisis. During development, the midgut normally herniates into the umbilical cord and then subsequently retracts into the abdominal cavity. Failure of the intestinal loop to retract from the umbilical cord (choice A) results in omphalocele. Failure of the yolk stalk to degenerate (choice B) results in an ileal (Meckel's) diverticulum or a vitelline fistula or cyst. In the early embryo, the gut tube is connected to the yolk sac by a narrow connection known as the yolk stalk. Normally, this connection degenerates. During development, certain peritoneal organs fuse with the posterior abdominal wall to become secondarily retroperitoneal. Failure of this peritoneal fusion (choice C) will result in certain organs that are normally immobile being mobile (e.g., mobile cecum). Umbilical herniation (choice E) results from abdominal viscera protruding through a weakness in the abdominal wall after development. Such protrusions are covered by subcutaneous fascia and skin, distinguishing them from gastroschisis. 21The correct answer is C. The bladder is supplied by the vesicular branches of the internal iliac arteries. The internal iliacs arise from the common iliac artery. Note that this is a simple fact question (Which artery supplies the urinary bladder?) embedded in a clinical scenario. The external iliac (choice A) also arises from the common iliac artery. It makes no contribution to the blood supply of the bladder. The inferior epigastric (choice B) is a branch of the external iliac artery. It serves as a landmark in the inguinal region. Indirect inguinal hernias lie lateral to the inferior epigastric arteries, whereas direct inguinal hernias lie medial to these vessels. A good mnemonic is MD's don't LIe. (Medial-Direct, Lateral-Indirect). The internal pudendal (choice D) is a branch of the anterior division of the internal iliac artery. It gives rise to the inferior rectal artery, perineal artery, artery of the bulb in men, urethral artery, deep artery of the penis or clitoris, and dorsal artery of the penis or clitoris. The lateral sacral (choice E) is a branch of the posterior division of the internal iliac artery. It supplies sacral structures. 22The correct answer is B. Pituitary apoplexy, which is a life-threatening infarction of the pituitary gland, may result after obstetric hemorrhage (Sheehan's syndrome), with increased intracranial pressure, or during systemic anticoagulation therapy. While the patient may have a generalized hypofunction of the pituitary in these settings, the most important hormones to quickly replace are glucocorticoids (synthesized by the adrenal cortex under pituitary ACTH control) and thyroid hormone (under pituitary TSH control), since deficiency of these hormones produces life-threatening syndromes. Growth hormone, estrogens, and prolactin (choices A, C, D, and E) do not require immediate replacement. Mineralocorticoids (choices D and E) can be replaced if diabetes insipidus develops. 23The correct answer is B. The disease is cretinism, characterized by a profound lack of thyroid hormone in a developing child, leading to mental retardation and the physical findings described in the question stem. Cretinism can be due to dietary deficiency of iodine (now rare in this country because of iodized salt), to developmental failure of thyroid formation, or to a defect in thyroxine synthesis. Calcium deficiency (choice A) in children can cause osteoporosis or osteopenia. Iron deficiency (choice C) can cause a hypochromic, microcytic anemia.

Magnesium deficiency (choice D) is uncommon, but can cause decreased reflexes, and blunts the parathyroid response to hypocalcemia. Selenium deficiency (choice E) is rare, but may cause a reversible form of cardiomyopathy. 24The correct answer is E. Mycobacterium leprae is endemic to parts of Africa, Asia, and South America. Tuberculoid leprosy is an indolent disease, typically affecting cooler parts of the body, such as the nose and ears, producing dermal granulomas with very rare, acid-fast bacilli and damage to peripheral nerves. This is in marked contrast to lepromatous leprosy, which is progressive and invasive and generally characterized by the presence of numerous acid-fast bacteria in a histiocytic, but non-granulomatous tissue response. M. leprae has not been grown in any culture medium. Cutaneous leishmaniasis (choice A) is due to Leishmania species that show a worldwide distribution. The infection is transmitted through a sandfly bite, and the skin lesion is typically ulcerated. Histology shows intracellular parasites within the dermis and epidermis. Granulomas are not formed. Onchocerciasis (choice B), or river blindness, is a roundworm infection transmitted by black flies of Africa and South America. The microfilaria grow at the site of inoculation, and cause an inflamed subcutaneous nodule. The organism is seen on tissue sections. Rhinoscleroma (choice C) is a destructive granulomatous infection of the nasopharynx caused by Klebsiella rhinoscleromatis. Gram-negative rods can be cultured from the lesions. Smallpox (choice D), the infection caused by the variola virus (a DNA poxvirus), produces malaise, headaches, and a macular/pustular rash involving the face and distal extremities. Smallpox has been eradicated through worldwide vaccination 25The correct answer is A. The patient described suffers from myasthenia gravis (MG), a disorder in which autoantibodies to skeletal muscle nicotinic acetylcholine receptors cause a reduction in the receptor number, leading to easy fatigability, weakness of extraocular and facial muscles, and difficulty eating. Symptomatic improvement in these patients can be obtained with acetylcholinesterase inhibitors. Two of the most common drugs given are neostigmine and pyridostigmine, both of which act by carbamylating the acetylcholinesterase enzyme. This temporarily inhibits the enzyme, thus preventing the degradation of acetylcholine and allowing greater stimulation of the nicotinic acetylcholine receptors on skeletal muscle. Edrophonium (Tensilon) is a short-acting competitive inhibitor of acetylcholinesterase (choice B), used in the diagnosis of MG. The physician selects a weak muscle and then administers edrophonium to the patient. It the test is positive, the patient will exhibit increased strength in that muscle for about two minutes. Edrophonium is not useful for the treatment of MG because of its short duration of action. Pralidoxime (2-PAM) is an acetylcholinesterase reactivating agent that dephosphorylates acetylcholinesterase (choice C). It is used if an individual is exposed to a phosphorylating acetylcholinesterase inhibitor (e.g., parathion or nerve gases). 2-PAM has a higher affinity for phosphorus than the enzyme, and thus can bind the acetylcholinesterase inhibitor and release the enzyme if "aging" of the phosphate bond has not occurred. This allows the active enzyme to be regenerated. A direct muscarinic agonist (choice D) such as pilocarpine or bethanechol would cause enhanced parasympathetic effects such as increased activity in the bowel and bladder, pupillary miosis and accommodation for near vision. These agents are used clinically to activate bowel and bladder smooth muscle, and in the treatment of glaucoma. They have no place in the treatment of MG. A direct muscarinic antagonist (choice E) such as atropine could be used as an antidote for an anticholinesterase inhibitor because it blocks the excessive parasympathetic side effects that would occur with elevated acetylcholine.

Direct-acting nicotinic receptor agonists (choice F) do not have therapeutic applications except for succinylcholine, a depolarizing skeletal muscle relaxant used in surgery. Direct nicotinic receptor antagonists (choice G), such as curare and pancuronium, are skeletal muscle relaxants. These drugs block the skeletal muscle nicotinic receptor (NM). Antagonists at the ganglionic nicotinic receptor (NN), such as hexamethonium or trimethaphan, interrupt sympathetic and parasympathetic outflow. Neither type of agent would be used in the treatment of MG. Agents that phosphorylate acetylcholinesterase (choice H), such as echothiophate, cause irreversible inhibition of acetylcholinesterase and are not useful in the treatment of MG. Insecticides (e.g., malathion, parathion) and nerve gases are also phosphorylating agents. 26The correct answer is A. Graves' disease is the most common cause of hyperthyroidism in a young female and is the only one that causes exophthalmos ("bulging of both eyes"). Grave's disease is an autoimmune disorder in which a thyroid-stimulating IgG immunoglobulin (TSI) binds to the TSH receptors causing increased release of thyroid hormone. The exophthalmos is caused by lymphocytic infiltration of the extraocular muscles. Hashimoto's thyroiditis (choice B) results in hypothyroidism and is associated with a diffusely enlarged thyroid gland and antimicrosomal antibodies against the thyroid parenchyma. Multinodular toxic goiter (choice C) causes hyperthyroidism, but does not result in exophthalmos. Papillary carcinoma (choice D) will only very rarely present as a hypersecreting nodule. Most cases will be nonsecreting, cold nodules. There is no exophthalmos. This is the most common thyroid cancer and has the best prognosis of all thyroid cancers. Subacute thyroiditis (choice E) is an uncommon form of thyroiditis that lasts approximately 8 months and is self-limited. Early on, with destruction of thyroid tissue, there may be release of thyroid hormone and symptoms of hyperthyroidism, but exophthalmos is generally absent. 27The correct answer is D. The vagina of prepubertal girls and post-menopausal women is colonized by colonic and skin bacteria, including Staphylococcus epidermidis, which is normally found on the skin. The vagina of women of child-bearing age tends to be colonized by Lactobacillus (choice B) species, yeasts such as Candida (choice A), and Streptococcus species (choice E). The presence of Neisseria (choice C), such as N. gonorrhoeae (the cause of gonorrhea), in the vagina of a 5 year-old strongly suggests sexual abuse. 28The correct answer is E. Sickling crises can be triggered by hypoxia caused by high altitude or pneumonia. The very high osmolarity of the renal medulla particularly favors sickling of erythrocytes in the vasa recta. The resultant ischemia can cause a patchy papillary necrosis, proteinuria, and sometimes, cortical scarring. Larger blood vessels such as the arcuate arteries (choice A), interlobar arteries (choice C), and renal arteries (choice D) are usually not occluded by sickled cells. The glomerular capillaries (choice B) are small enough to be occluded by sickled cells, but they are well oxygenated and the blood within them is not hypertonic, so the glomerular capillaries are significantly less likely to become occluded then the vasa recta.

29The correct answer is C. The patient is presenting with signs and symptoms of cystic fibrosis (CF). CF is an autosomal recessive disorder of the exocrine glands. The pulmonary manifestations include acute and chronic bronchitis, bronchiectasis, chronic bouts of pneumonia, hemoptysis, and cor pulmonale, which can occur late in the disease. Other common findings include chronic cough, exercise intolerance, recurrent respiratory

infections, digital clubbing, increased anteroposterior diameter, and basilar crackles. If the pilocarpine sweat test reveals sodium and chloride levels greater than 80 mEq/L, a diagnosis of CF can be made. The primary goals of treatment include thinning the mucus secretions, keeping the airways open, and treating recurrent infections. Thinning of mucus can be achieved with mucolytics such as N-acetylcysteine. N-Acetylcysteine (Mucomyst) splits the disulfide linkages between these mucoproteins, resulting in a decrease in mucous viscosity. It is indicated as adjuvant therapy in the treatment of abnormal viscid or inspissated mucus secretions in CF, chronic lung disease, post-traumatic chest complications, and atelectasis secondary to mucus obstruction. Inhaled bronchodilators are used to open the airways. Furthermore, prednisone has been shown to increase pulmonary function and increase body weight. The definitive treatment is lung transplantation. Dextromethorphan (choice A), a cough suppressant, is contraindicated in patients with CF since it will prevent the removal of mucus from the lungs. Ipratropium (choice B) is an anticholinergic that will cause a drying and thickening of the mucus in this patient; therefore, it is contraindicated. Pentamidine (aerosolized) (choice D) is an antiprotozoal agent primarily used in the treatment of Pneumocystis carinii pneumonia in HIV-infected patients. Vancomycin (choice E) is an anti-infective agent used in the treatment of life-threatening, gram-positive infections. 30The correct answer is C. Stage 2 has more theta waves than stage 1 and is associated with sleep spindles (short bursts of 12-16 Hz activity) and K-complexes (high amplitude slow waves with superposed sleep spindles) on the electroencephalogram Transient large amplitude potentials in the occipital areas (ponto-geniculo-occipital [PGO] spikes) are associated with REM sleep (choice A). Stage 1 (choice B), or drowsiness, is characterized by the attenuation of alpha rhythm (8-13 Hz) and the appearance of 4-7-Hz theta waves. Stages 3 (choice D) and 4 (choice E), or slow wave sleep, are characterized by high amplitude slow waves, especially in the delta (< 4 Hz) frequency range. 31The correct answer is A. Alpha2-receptor agonists directly inhibit pancreatic insulin secretion. Beta2-adrenergic agonists (choice B) stimulate insulin secretion. Cholecystokinin (choice C) is a hormone that not only causes gallbladder contraction, but also causes insulin secretion from the pancreas. Pancreatic glucagon (choice D) release acts as a paracrine stimulus for insulin secretion. Ingestion of high-sugar meals (choice E) is a stimulus for the secretion of insulin from the pancreas. Muscarinic activity (choice F) in the GI tract enhances secretion of insulin from the pancreas. 32The correct answer is E. The spleen follows the long axes of ribs 9 to 11 and lies mostly posterior to the stomach, above the colon, and partly anterior to the kidney. Therefore, it is the most likely organ of the group to be pierced by a sharp object penetrating just above rib 10 at the posterior axillary line. Note that the pleural cavity, and possibly the lower part of the inferior lobe of the lung, would be pierced before the spleen. The ascending colon (choice A) is on the wrong side (the right) to be penetrated by a sharp instrument piercing the left side. Most of the duodenum (choice B) is positioned too far to the right to be affected by this injury. Even the third part of the duodenum, which runs from right to left, would still be out of harm's way. In addition, the duodenum lies at about levels L1 to L3, placing it too low to be injured in this case.

The superior pole of the left kidney (choice C) is bordered by the lower part of the spleen. However, it is crossed by rib 12 and usually does not extend above rib 11. It would probably be too low and medial to be injured in this case, since this penetration is at the posterior axillary line. The left lobe of the liver (choice D) is positioned just beneath the diaphragm, just over and anterior to the stomach. The anterior positioning of this structure makes it an unlikely candidate for injury in this case. Even with deep penetration at the correct angle it would not be penetrated before the spleen. 33The correct answer is D. The patient has gout, which is due to precipitation of monosodium urate crystals in joint spaces (notably the great toe) and soft tissues (causing tophi, which are often found on the external ears). Bile pigments (choice A) are found in some gallstones. Calcium pyrophosphate (choice B) crystals are deposited in pseudogout, which classically affects the knee or other large joints. Cystine (choice C) and struvite (choice E) can form kidney stones. 34The correct answer is E. This is a typical case description of chancroid, caused by Haemophilus ducreyi, a pleomorphic gram-negative rod that displays a characteristic pattern on Gram's stained slides. Epithelial cells with intranuclear inclusion bodies (choice A) would be found with herpes simplex infections, but these lesions would not have the appearance described in this case history. Iodine-staining intracellular inclusion bodies (choice B) would be found with genital lesions of Chlamydia trachomatis, the causative agent of lymphogranuloma venereum, but this lesion is generally nonpainful. Koilocytotic squamous epithelial cells (choice C) would be found in infections with human papilloma virus (HPV), which is associated with venereal warts. Neutrophils containing gram-negative diplococci (choice D) would be found if this were gonorrhea, but the case symptoms are not consistent with this disease. Spirochetes (choice F) would be found on darkfield microscopy if this were a case of syphilitic chancre, but that chancre would be hard and nontender.

35The correct answer is C. Clues to the correct answer are the underlying disease (AIDS), which predisposes to opportunistic infections, the typical MRI appearance of the lesion (ringenhancing mass), and the histopathologic features (presence of encysted bradyzoites). In short, this patient has cerebral toxoplasmosis, which represents one of the most common opportunistic infections in AIDS. Toxoplasma gondii is a protozoon that infects humans who ingest the oocysts from cat feces or incompletely cooked lamb or pork. Only immunodepressed patients and fetuses are vulnerable to this infection. In the fetus, toxoplasmosis causes extensive damage to brain parenchyma and retina. Toxoplasmosis associated with AIDS manifests with necrotizing lesions surrounded by chronic inflammation. A ring-enhancing lesion is a mass that contains a rim of contrast enhancement (bright signal on MRI) surrounding a dark core corresponding to central necrosis. In AIDS, the most frequent causes of a ring-enhancing lesion are primary brain lymphoma and toxoplasmosis. Anopheles mosquitoes (choice A) transmit malaria parasites. Cerebral malaria is caused by Plasmodium falciparum, which is able to adhere to endothelial cells of small cerebral vessels. Vascular occlusion ensues, resulting in numerous small infarcts. Bird droppings (choice B) represent the vehicle of infection for two of the most common opportunistic fungal infections affecting immunocompromised patients: cryptococcosis and

histoplasmosis. Cryptococcus neoformans causes meningoencephalitis, not intracerebral necrotic lesions. Histoplasma capsulatum rarely affects the brain. These fungi can be visualized in tissue sections by silver stains. Cooling systems (choice D) may harbor Legionella pneumophila, spreading the bacteria in aerosolized form. L. pneumoniae is a gram-negative bacterium that causes Legionnaire's disease, a fatal form of pneumonia that first struck participants at a meeting of the American Legion. It has been reported in immunocompromised patients as well. Washbasins (choice E) frequently contain Pseudomonas aeruginosa, which has also been isolated from respirator devices, cribs, and antiseptic-containing bottles. P. aeruginosa tends to affect patients with cystic fibrosis, severe burns, or immune impairment. It may cause bronchopneumonia, osteomyelitis, endocarditis, external otitis, and keratitis, but not cerebral infection.

36The correct answer is A. During each cardiac cycle, the walls of the ventricle undergo isometric contraction and relaxation as well as isotonic contraction and relaxation. Muscle contraction and relaxation is considered to be isometric when the muscle length does not change, and isotonic when the muscle length does change with a constant tension on the muscle. Phase 3 corresponds to a period of isometric contraction, referred to as the period of isovolumetric or isovolumic contraction. The ventricle is contracting and the pressure is rising, but the volume of the ventricle remains constant, thus muscle length is relatively constant. The aortic valve opens when ventricular pressure exceeds about 80 mm Hg, allowing blood to eject from the heart, which begins a phase of isotonic contraction (phase 2, choice C). This phase is called the period of ejection. Phase 1 begins when the ventricle relaxes and the aortic valve closes (period of isovolumetric or isovolumic relaxation). Phase 1 is a period of isometric relaxation (choice B), referred to as the period of isovolumic or isovolumetric relaxation. The ventricle relaxes and the pressure falls during phase 1, but the volume of the ventricle remains constant, thus muscle length is relatively constant. Phase 4 begins when the mitral valve opens. This is a period of isotonic relaxation (choice D) in which the relaxed ventricle fills with blood; it is called the period of filling.

37The correct answer is B. Rheumatoid arthritis (RA) is a chronic, multisystem inflammatory disorder of unknown etiology. The primary feature of RA is persistent inflammatory synovitis, symmetrically involving the peripheral joints. The synovial inflammation leads to cartilage destruction and bone erosions, which can cause substantial joint deformities. In around 10-20% of patients, the onset of RA is acute, and accompanied by constitutional symptoms, such as fever, lymphadenopathy, splenomegaly, and weight loss. Subcutaneous nodules (Heberden's nodes), pleuritis, pulmonary fibrosis, pericarditis, nerve entrapment syndromes, ocular changes, and vasculitis may also be seen. Morning stiffness > 1 hr is one of the distinguishing factors of inflammatory arthritis as compared to non-inflammatory arthritis. The question is essentially asking for the most appropriate agent for the alleviation of the patient's acute signs and symptoms. Celecoxib is a selective cyclooxygenase-2 (COX2) inhibitor with anti-inflammatory, analgesic, and antipyretic effects. COX-1 is involved in the production of prostaglandins that protect the GI lining, while COX-2 is important for the synthesis of prostaglandins involved in inflammation and pain. Therefore, a selective COX-2 inhibitor can be used for management of RA in a patient with a past history of ulcers. Acetaminophen (choice A) has analgesic and antipyretic effects, but not anti-inflammatory effects. Therefore, this agent would not be indicated for treatment of a patient with RA. Indomethacin (choice C) is a non-steroidal anti-inflammatory drug indicated for the treatment of acute pain caused by inflammation. Although indomethacin can be used in the treatment of RA, it would not be recommended in a patient with a past medical history of ulcers.

Both methotrexate (choice D) and sulfasalazine (choice E) are used in the chronic management of RA as part of disease-modifying antirheumatic drug (DMARD) therapy; however, these agents take several weeks to months to elicit their beneficial effects. Therefore, these agents should not be used in the acute management of rheumatoid arthritis. 38The correct answer is B. Broca aphasia, caused in this case by an embolus to the Broca area (inferior frontal gyrus), is often associated with hemiparesis. The aphasia is characterized by slow, nonfluent speech with deficits in word finding. Because comprehension is normal, patients are typically aware of the problem and appear frustrated. Apraxia (choice A) is a deficit of purposeful movement caused by a central lesion. Dysarthria (choice C) is a deficit in speech articulation with normal grammar and word finding. Global aphasia (choice D) is usually caused by large infarcts in the distribution of the middle cerebral artery. It is characterized by elements of Broca and Wernicke aphasia (i.e., an inability to generate or comprehend fluent speech). Wernicke aphasia (choice E), caused by lesions in Wernicke area, is characterized by fluent speech that has a normal tempo, but is filled with incorrect words and neologisms. The patient is unable to comprehend speech.

39The correct answer is B. The disease is systemic lupus erythematosus; the most useful specific clue to the diagnosis is the presence of autoantibodies to double-stranded DNA (one type of antinuclear antibody or ANA). The characteristic "butterfly" facial rash of lupus is due to deposition of antibodies and complement at the dermal/epidermal junction. Cells similar to fibroblasts growing in a storiform ("pinwheel") pattern (choice A) are characteristic of dermatofibrosarcoma protuberans, a slow-growing type of fibrosarcoma. Horn cysts (choice C) are lamellated collections of keratin that occur in seborrheic keratoses, a type of benign epithelial tumor of the skin. Pautrier microabscesses (choice D) are a feature of mycosis fungoides, a cutaneous T-cell lymphoma. A sawtooth dermal/epidermal junction (choice E) is a feature of lichen planus, an inflammatory skin condition. 40The correct answer is B. The colony forming unit-erythroid (CFU-E) is a unipotential stem cell that develops from a burst forming unit-erythroid (BFU-E), which develops eventually from the multipotential stem cell. The BFU-E is somewhat responsive to erythropoietin, but the CFU-E is completely dependent on erythropoietin. Erythropoietin is normally released from the kidney in response to hypoxic or anemic conditions. Its half life is about 3-6 hours. Clinically it takes 5 days to see reticulocyte formation in the peripheral blood following erythropoietin administration. The basophilic erythroblast (choice A) differentiates from the proerythroblast. It is recognizable by light microscopy and has a dark basophilic staining due to hemoglobin synthesis. It is not directly effected by erythropoietin, but is instead indirectly increased by the increase in precursor cells from the increase in CFU-E earlier in development. The multipotential stem cell (choice C) appears earlier in development than CFU-E and does not increase with erythropoietin. The development of the major components of blood (RBC, WBC, and platelets) all begin with the multipotential stem cell (CFU-S). This cell is noncommitted and can self-renew. It is located in the bone marrow and is not recognizable by light microscopy. The proerythroblast (choice D) is the first recognizable cell in the red cell lineage. It develops from the CFU-E cell. It is not affected directly by erythropoietin, but instead increases in number from the increased CFU-E cells.

The reticulocyte (choice E) is the enucleated cell just before the mature red blood cell. Reticulocytes enter the peripheral circulation, but continue to synthesize hemoglobin. This cell is not directly stimulated by erythropoietin, but increases in number as a result of the increase in precursors.

41The correct answer is D. The patient's initial presentation strongly suggests Type 2 diabetes mellitus (NIDDM), which usually begins in middle or late life. Symptoms often develop gradually, and the diagnosis is frequently made when an asymptomatic or mildly symptomatic patient is found on routine laboratory examination to have an elevated blood glucose level. Therapy with an oral hypoglycemic agent would be appropriate in this case. Since the patient had a documented anaphylactic reaction to trimethoprim-sulfamethoxazole, he should not take any "sulfa" drugs, including the sulfonylurea type oral hypoglycemic agents such as chlorpropamide (choice A) and glipizide (choice B). Metformin is a biguanide oral hypoglycemic agent, chemically distinct from the sulfonylureas. This medication is indicated as monotherapy or in conjunction with other oral hypoglycemic agents in the treatment of NIDDM. Glucagon (choice C) is the drug of choice for the treatment of severe hypoglycemia; this agent would worsen the patient's hyperglycemia. Propranolol (choice E) is a non-selective beta blocking agent used for the treatment of hypertension and cardiac arrhythmias. Beta blockers are contraindicated since they "blunt" the appearance of the premonitory signs and symptoms of hypoglycemia. 42The correct answer is B. An increased number of eosinophils (AKA eosinophilia) occurs in association with several conditions, the most frequent of which are immune-mediated diseases (e.g., asthma, hay fever, and pemphigus vulgaris) and parasitic infestations. This is due to an absolute increase in the number of circulating eosinophils, brought about by IL-5, which stimulates differentiation of eosinophilic precursor cells in the bone marrow. Basophilic leukocytosis (choice A) is a rare event that is sometimes observed in association with chronic myelogenous leukemia. It is not seen in patients with asthma. Lymphocytosis (choice C) may result from a vast array of conditions, but it is not typical of asthma or other allergic diseases. Lymphocytosis may develop in response to a number of infections (e.g., brucellosis, whooping cough, hepatitis, infectious mononucleosis, and tuberculosis) or manifest as part of chronic lymphocytic leukemia. Monocytosis (choice D) refers to an increase in number of monocytes, which are circulating macrophages. Chronic infections (e.g., tuberculosis, rickettsiosis, and malaria) and chronic inflammatory conditions (e.g., collagen vascular diseases and inflammatory bowel disease) are the most common underlying causes. Neutrophilic leukocytosis (choice E) is a typical systemic reaction to acute and chronic infections, especially those due to bacteria. The increase in neutrophil number is mediated by IL-1 and TNF, which induce a rapid release of neutrophils from the bone marrow in acute infections and stimulate proliferation of bone marrow precursors in chronic infections. 43The correct answer is D. The infant has necrotizing enterocolitis, which can affect infants any time in the first few months of life, but is most common around the time an infant is started on oral foods. The functional immaturity of the neonatal gut apparently leaves it particularly vulnerable to a combination of ischemic injury and colonization by pathogenic organisms. Formula-fed infants appear to be more vulnerable than breast-fed infants, possibly due to the absence of maternal antibodies or other immunoprotective features in formula. Premature and low-birth-weight infants are also more likely to develop this condition. Affected infants may have either mild gastrointestinal illness or develop frank, lifethreatening gangrene of the terminal ileum and ascending colon.

Thickening of the pylorus (choice A) is a feature of congenital hypertrophic pyloric stenosis, which typically presents with vomiting and regurgitation in an older infant. A massively dilated colon (choice B) suggests Hirschsprung's disease, which may present in a similar fashion to necrotizing enterocolitis. The two conditions can usually be distinguished by noting that meconium is usually not passed prior to feeding of the neonate in Hirschsprung's disease. Bowel loops in the chest cavity (choice C) are a feature of congenital diaphragmatic hernia, which causes respiratory distress and, often, death in neonates. The gastrointestinal tract would be unlikely to appear normal (choice E) in a case such as this. 44The correct answer is B. The patient described above has Gaucher disease, a hereditary disease that affects bones and other organs. Glucocerebrosides accumulate within macrophages in places such as bone marrow. The failure of proper bone remodeling of the distal femur gives the characteristic "Erlenmeyer flask" shape on x-ray. These patients suffer Gaucher crises from acute ischemia to the bone, usually in the pelvis and femoral head. The pain is sudden, severe, and progressive, lasting 2 or more weeks before fading. The crisis usually follows viral illness. Other findings include osteosclerotic bone and corticomedullary osteonecrosis. Abnormal osteoclasts and mosaic lamellar bone (choice A) describe Paget disease of bone. This is a disease of disordered bone remodeling that affects people older than 60. Although the etiology is unknown, it may be due to viral effect on osteoclasts. The osteoclast activity is excessive, and increased absorption occurs. The osteoclasts appear to have too many nuclei. The lamellar bone slowly acquires a mosaic pattern because of irregular cement lines. Pain is usually due to fractures of the misshapen bone. Benign reactive bone around an osteoid nidus (choice C) describes osteoid osteoma. This is a common lesion that is found in young people aged 5-25 years. It is usually seen radiographically in the cortex of the diaphysis as a small, round lesion, composed of a nidus of osteoid surrounded by woven bone. It is painful, usually at night; the pain is relieved by aspirin. Surgery is curative. Malignant sarcoma (choice D) would probably represent an osteosarcoma in this age and location. Clinically, sarcomas do not present with acute pain, but rather are associated with steadily progressive pain. Radiographs show a destructive tumor with elevated periosteum and reactive new bone formation. Treatment includes amputation. Well-differentiated cartilage (choice E), if located in the marrow space and not just caused by a misguided biopsy attempt, would indicate a solitary chondroma or enchondroma. This is a benign tumor that is probably hamartomatous in nature. It is asymptomatic and forms during development. It is sometimes found incidentally.

45The correct answer is D. The great majority of ectopic pregnancies (90%) occur in the fallopian tubes. The other sites are the ovaries, abdominal cavity, and the intrauterine segment of the fallopian tubes. Any condition that leads to anatomical abnormalities of the uterus and fallopian tubes may predispose to ectopic pregnancy. The most frequent of such conditions is pelvic inflammatory disease (PID), which is usually associated with salpingitis. PID is a common infectious condition most frequently caused by Neisseria gonorrhoeae and Chlamydia trachomatis, both sexually transmitted. Other cases are due to a polymicrobial population, including staphylococci, streptococci, coliform bacteria, and Clostridium perfringens, acquired during abortion or delivery. PID leads to acute purulent salpingitis. If this is untreated or inadequately treated, it progresses to salpingo-oophoritis, tubal abscesses, pyosalpinx, or hydrosalpinx. Even milder cases may cause adhesions within the tube or between the tube and the ovary that interfere with implantation of the ovum and result in

tubal pregnancy. All the remaining conditions listed above may also predispose to ectopic pregnancy. Endometriosis (choice A) refers to the presence of endometrium in abnormal locations, such as the ovary, uterine ligaments, rectovaginal pouch, and pelvic peritoneum. It is an important clinical condition manifesting with pain, dysmenorrhea, and infertility. Scarring at endometriotic sites may cause peritubal adhesions and ectopic pregnancy. An intrauterine device (choice B) may also increase the risk of ectopic pregnancy, but the mechanism of action is not clear. Leiomyomas of the uterus (choice C) are the most frequent benign tumor in women. They develop from the smooth muscle as well-circumscribed nodules within the uterine wall (intramural), in a subserosal or submucosal location. Leiomyomas may cause significant distortion of the uterine wall and interfere with implantation, increasing the risk of ectopic pregnancy. Previous surgery (choice E) of any kind may create scars and peritubal adhesions, thus predisposing to ectopic pregnancy. 46The correct answer is E. In fully compensated aortic coarctation, blood flow is normal in the upper and lower body (choices A and B) despite an increased arterial pressure (about 50% higher) in the upper body (choice C) compared to the pressure in the lower body. Because resistance = pressure/blood flow, it is clear that resistance must be lower in the lower portions of the body. The mechanism of this decrease in resistance below the constriction (and increased resistance above the constriction) is autoregulation of blood flow. The small arteries and arterioles dilate (or constrict) in accordance with the metabolic needs of the tissues ensuring that each tissue receive an adequate amount of blood flow. Thus, the increase in blood pressure in the upper body leads to constriction of the arterioles, which increases vascular resistance (choice D), and the lower pressure below the coarctation leads to dilation of the arterioles, which decreases vascular resistance in the lower body. 47The correct answer is D. Tubular fluid first becomes hypotonic toward the end of the thick ascending limb of the loop of Henle and will therefore be hypotonic by the macula densa (which is the border between the thick ascending limb and the distal convoluted tubule). Tubular fluid is isotonic at the beginning of the proximal tubule (choice A). Tubular fluid is isotonic by the end of the cortical collecting duct (choice B) in the presence of antidiuretic hormone (ADH), since water is reabsorbed until the tubular fluid osmolarity is the same as the peritubular fluid in the cortex (which has the same osmolarity as plasma). A person with a urine flow rate of 1 mL/minute is typically making hypertonic urine, and so has a significant amount of ADH present. The urine is assumed to be hypertonic since osmolar clearance (Cosm) is usually 2 mL/minute, and urine osmolarity must be greater than plasma osmolarity if Cosm > urine flow rate. Tubular fluid at the end of the papillary collecting duct (choice C) will be hypertonic in the presence of ADH. (See explanation of choice B for why ADH is present.) Tubular fluid at the tip of the loop of Henle is always hypertonic; essentially no water or solute is reabsorbed along the thin descending limb (choice E). 48The correct answer is B. The hematologic finding is erythrocytosis, which can be caused by abnormal erythropoietin secretion by renal cell carcinoma (i.e., a paraneoplastic syndrome). Absolute erythrocytosis also occurs in a number of other conditions, such as hypoxia, other types of renal disease, some tumors (e.g., hepatocellular carcinoma, meningioma, pheochromocytoma, cerebellar hemangioblastoma, adrenal adenoma), androgen therapy, Bartter's syndrome, or in polycythemia vera. Cancers of the colon (choice A), prostate (choice D), and thyroid (choice E) do not usually produce inappropriate hormones.

Cancers of the ovary (choice C) can produce male or female sex steroids, but do not produce erythropoietin. 49The correct answer is B. 50.Correct Answer is C.

(15) <1>A patient consults a dermatologist about a skin lesion on her neck. Examination reveals a 1-cm diameter, red, scaly plaque with a rough texture and irregular margins. Biopsy demonstrates epidermal and dermal cells with large, pleomorphic, hyperchromatic nuclei. Which of the following conditions would most likely predispose this patient to the development of this lesion? A. Actinic keratosis B. Compound nevus C. Dermal nevus D. Junctional nevus E. Melanoma Answer

<2>A 15 year-old boy from Mexico presents with chronic renal failure . A careful history obtained from his uncle indicates that he has not been treated with dialysis. Radiography of the hand and forearm demonstrates erosion of the terminal phalanges and marked metaphyseal resorption of the ulna and radius. Excessive secretion of which of the following hormones most likely contributed to these problems? A. Aldosterone B. Calcitonin C. Parathyroid hormone D. Renin E. Vitamin D Answer

<3>Which of the following substances takes part in the nonoxidative killing pathway by which pathogenic bacteria can be killed? A. Hydrogen peroxide B. Hypochlorous acid C. Lysozyme D. Myeloperoxidase E. Superoxide ions Answer

<4>An adolescent male is referred for drug abuse. He confides to the therapist that he has been taking large amounts of "reds" (secobarbital sodium) for some time, and that they make him feel confident and calm. He would like to try to stop and says he would like to "do it on his own," without additional medication. The therapist should advise the patient to detoxify with medical assistance because of the danger of A. insomnia B. rebound anxiety C. recidivism D. respiratory depression E. seizures Answer

<5>A neonate develops bile-stained vomiting and progressive abdominal distention, and does not pass meconium over the first two days of life. The anus is patent, and the bowel loops are palpable. Plain radiograph shows bubbly meconium in the right lower quadrant. No localized areas of constriction or other abnormalities are noted. Which of the following is most likely etiologically related to this infant's condition? A. Cystic fibrosis B. Hirschsprung's disease C. Meckel's diverticulum D. Omphalocele E. Polycystic kidney disease Answer

<6>A 33-year-old newlywed presents to her physician with a sharp, burning epigastric pain. She had recently begun a regimen of non-steroidal antiinflammatory agents to help relieve pain caused by rheumatoid arthritis. Her physician recommends misoprostol to relieve her gastric distress. Before prescribing this drug, the physician should first obtain the results of a(n) A. antinuclear antibody test B. barium swallow C. esophageal manometry D. osmotic fragility test E. pregnancy test Answer

<7>A medical student examining a patient is startled when he cannot "find" the patient's heart during auscultation. The patient laughs and tells him to "try the other side." Auscultation on the right side of the chest does demonstrates an apparently normal heart beat. Further physical examination demonstrates that the liver edge can be palpated on the left but not the right side of the abdomen. Questioning of the patient about his medical history reveals a history of bronchiectasis and sinusitis. Which of the following should be suspected? A. Down syndrome B. Kartagener syndrome C. Kawasaki disease D. Marfan syndrome E. Turner syndrome Answer

<8>An 82-year-old man develops a round, fluid-filled cystic structure on the back of his knee that limits the knee's mobility. This most likely represents an enlargement of which of the following structures? A. Deep infrapatellar bursa B. Prepatellar bursa C. Semimembranous bursa D. Superficial infrapatellar bursa E. Suprapatellar bursa Answer

<9>A 27-year-old male presents to the doctor with complaints of "heartburn" and painful, sour-tasting acid reflux that has not been alleviated by over-the-counter medications. An endoscopic exam is performed and a biopsy of the distal esophagus is taken. Microscopic examination of the tissue shows normal tissue without pathologic changes. What type of mucosa is normal for the distal esophagus? A. Ciliated, columnar epithelium B. Keratinized, stratified, squamous epithelium C. Non-ciliated, columnar epithelium D. Non-keratinized, simple, squamous epithelium E. Non-keratinized, stratified, squamous epithelium F. Pseudostratified, columnar epithelium Answer

<10>A 35-year-old construction worker is complaining of aching pain in his right hand since starting a new project in which he has been

operating a jack hammer for several hours a day. At first the pain was tolerable, but now he awakens at night and has recently noticed numbness and tingling in his hand. He continues to perform his daily work despite his symptoms. On physical exam, there appears to be decreased sensation over the first three-and-a-half digits in the right hand. Which muscles are likely to be affected in addition to the sensory loss? A. Abductor digiti minimi and 1st and 2nd lumbricals B. Abductor digiti minimi and 1st through 4th dorsal interossei C. Abductor pollicis brevis and opponens pollicis D. Wrist extensors E. Wrist supinators Answer

<11>A pediatrician discovers a large mass in the abdomen of a 3-year-old child. Ultrasound examination demonstrates that the mass appears to arise from the right kidney. Which of the following tumors is most likely present? A. Cortical adenoma B. Hemangioma C. Nephroblastoma D. Oncocytoma E. Renal cell carcinoma Answer

<12>A knife wound to the face selectively damages the facial nerve. Salivation from which of the following would be impaired? A. Parotid and sublingual glands B. Parotid and submandibular glands C. Parotid gland only D. Sublingual gland only E. Submandibular and sublingual glands F. Submandibular gland only Answer

<13>Molecular studies on an abdominal lymph node containing lymphoma demonstrate t(2;8)(p12;q24) translocation. This is most compatible with which of the following diseases? A. Burkitt's lymphoma B. Mantle cell lymphoma C. Multiple myeloma D. Small cell lymphoma E. Small cleaved cell lymphoma Answer

<14>A patient with long-standing constipation enters a clinical research study. After a complete physical examination, a small intraluminal balloon is inserted through the anus to the rectum. Transducers are also inserted to measure internal and external anal sphincter pressures. Inflation of the rectal balloon causes the external anal sphincter to contract, but the internal anal sphincter, which exhibits normal tone, fails to relax and the urge to defecate is not sensed. Which of the following structures is most likely damaged? A. Internal anal sphincter B. External anal sphincter C. Pelvic nerve D. Pudendal nerve E. Rectum Answer

<15>A very ill-appearing 64-year-old woman is admitted to the hospital with malaise, fever, and low-back pain. Funduscopic examination on admission was unremarkable, but one day later, multiple small white spots surrounded by hemorrhage are observed on both retinas. The ophthalmologic findings suggest which of the following diagnoses? A. Bacterial endocarditis B. Crohn's disease C. Diabetes mellitus D. Glaucoma E. Urosepsis

<16> A 52-year-old man is admitted to the hospital complaining of chest pain and difficulty breathing. He has a history of rheumatic valvular disease. Physical examination reveals a systolic murmur. Pressure tracings from the aorta, left ventricle, and left atrium are shown in the diagram. This patient is suffering from which of the following? A. Aortic obstruction B. Aortic regurgitation C. Infarction of the left ventricle D. Mitral obstruction E. Rupture of the chordae tendineae

<17>A 79-year-old man complains of pain in the upper portion of his neck on swallowing. He occasionally regurgitates undigested food shortly after eating. Which of the following is the most likely etiology of his problems? A. Mallory-Weiss tears B. Plummer-Vinson syndrome

C. D. E. Answer

Schatzki rings Traction diverticula Zenker's diverticulum

<18> The diagram above shows maximum expiratory flow-volume (MEFV) curves from a typical healthy individual (solid curve) and from a 62-year-old carpenter who complains of shortness of breath (dashed curve). The carpenter most likely suffers from which of the following disorders? A. Asbestosis B. Emphysema C. Pleural effusion D. Pneumothorax E. Silicosis Answer

<19>A newborn baby is noted to have a left unilateral cleft lip. There are no abnormalities of the baby's palate. Which of the following developmental defects accounts for this occurrence?

A. process B. prominence C. D. E. Answer

Failure of the left lateral palatine process to fuse with the median palatine Failure of the left maxillary prominence to unite with the left medial nasal Failure of the primary palate to fuse with the secondary palate Failure of the right and left medial nasal prominences to merge Failure of the right palatine process to fuse with the left palatine process

<20>A 26-year-old pregnant migrant worker sustains a placental abruption, and is admitted to the intensive care unit. While in the unit, she begins bleeding from multiple sites, including her venipuncture sites and oral mucous membranes. Which of the following studies would be most valuable in assessing this patient's condition? A. Partial thromboplastin time, kininogen, and factor VIII levels B. Platelet count, fibrinogen levels, and fibrin degradation products C. Platelet count, thrombin time, and prekallikrein levels D. Prothrombin time and factor VIII levels E. Thrombin time, fibrinogen levels, and factor VIII levels Answer

<21>A 59-year-old woman with advanced, metastatic lung cancer develops profound fatigue and weakness and alternating diarrhea and constipation. Physical examination demonstrates hyperpigmentation of skin, even in areas protected from the sun. Tumor involvement of which endocrine organ is most strongly suggested by this patient's presentation? A. Adrenal gland B. Endocrine pancreas C. Ovaries D. Pituitary gland E. Thyroid gland Answer

<22>A 38-year-old construction worker presents with constant back pain that is exacerbated by movement. After being discharged from the emergency room, the man gets a prescription filled, and takes the recommended dose of the medication. After about 45 minutes, he begins to feel sleepy, has a dry mouth and can feel his heart "racing." Based on this information, which of the following drugs was most likely prescribed? A. Baclofen B. Cyclobenzaprine

C. D. E. Answer

Diclofenac Methocarbamol Rofecoxib

<23>A 54-year-old man develops sustained, severe chest pain. He takes several antacid tablets without significant relief. Finally he tells his wife, who demands that he go to the emergency room. At the hospital, he is diagnosed with a myocardial infarction, and is admitted and stabilized, then released several days later. Three weeks after the myocardial infarction, the man develops steady, burning chest pain. He returns to the emergency room, where a friction rub is heard on auscultation. Which of the following is the most probable underlying cause of this complication? A. Autoimmune phenomenon B. Bacterial infection C. Chlamydial infection D. Fungal infection E. Viral infection Answer

<24>A 43-year-old man presents to a urologist because of a lesion on his penis. Physical examination reveals an 8-mm opaque, gray-white, relatively flat penile plaque. A biopsy is performed on the lesion; the pathology report indicates the presence of clearly dysplastic squamous epithelium. Which of the following is the most likely diagnosis? A. Bowenoid papulosis B. Bowen's disease C. Condyloma acuminatum D. Erythroplasia of Queyrat E. Giant condyloma Answer

<25>A sexually active 25-year-old man develops epididymitis and orchitis . Needle biopsy demonstrates a prominent leukocytic infiltrate with numerous neutrophils. Which of the following organisms is the most likely cause of this man's infection? A. Escherichia coli B. Mycobacterium tuberculosis C. Neisseria gonorrhoeae D. Pseudomonas sp. E. Treponema pallidum Answer

<26> Respiratory rate 15/min Blood pressure 120/80 mm Hg Cardiac output 5 L/min Heart rate 50/min A 25-year-old man is participating in a clinical study to determine the cardiovascular response to physical exercise. Basal measurements are shown above. What is his stroke volume during resting conditions (in mL/min)? A. 50 B. 75 C. 100 D. 125 E. 150 Answer

<27> A couple has four children, three girls and a boy. The girls are healthy, but the boy develops corneal opacities, painful neuropathies , and multiple, violaceous nodules distributed diffusely over his skin. Two of the daughters marry and have a total of seven children. As shown in the pedigree above, two of these children develop the same syndrome as did the affected son in the F1 generation. Which of the following is the likely diagnosis? A. Fabry's disease B. Gaucher's disease C. Krabbe's disease D. Metachromatic leukodystrophy E. Niemann-Pick disease Answer

<28>A 37-year-old man presents to a physician because of a lesion on the shaft of his penis. On physical examination, a solitary, thickened, whitish plaque with a slightly ulcerated, crusted surface is observed. Biopsy reveals markedly dysplastic epithelial cells, many mitoses (some of which are abnormal), disordered epithelial maturation, and an intact basement membrane with no evidence of stromal invasion. Which of the following is the most likely diagnosis? A. Bowenoid papulosis B. Bowen's disease

C. D. E. Answer

Condyloma acuminatum Erythroplasia of Queyrat Squamous cell carcinoma

<29>A 23-year-old woman presents to the emergency room with pelvic pain. A Gram's stain of her cervical discharge reveals multiple polymorphonuclear leukocytes, but none contain gram-negative diplococci. Which of the following statements best describes the two organisms that most commonly cause this disorder? A. Both are unlikely to recur because of acquired cell mediated immunity B. Both are unlikely to recur because of antibody mediated immunity C. Both induce endocytosis by epithelial cells D. Both are obligate intracellular parasites E. Both respond to b-lactam antibiotics Answer

<30>A 64-year-old white female who was diagnosed with rheumatoid arthritis two years ago has been taking salicylates and other NSAIDs for the past 18 months without adequate relief of her symptoms. Her physician decides to institute methotrexate therapy. Over the next seven weeks she receives prednisone as a form of "bridging therapy" to help prevent pain and inflammation while waiting for the pharmacological benefits of methotrexate to begin. Which of the following is she most likely to experience secondary to her glucocorticoid therapy? A. Dehydration B. Hyperkalemia C. Hypocalcemia D. Hypoglycemia E. Hyponatremia Answer

<31>A 32-year-old construction worker arrives in the emergency room after an accident on the job. The tendon of the biceps brachii at the elbow has been severed by a laceration that extends 2 cm medially from the tendon. Which of the following structures is likely to have been injured by medial extension of the laceration? A. Brachial artery B. Musculocutaneous nerve C. Profunda brachii artery D. Radial nerve E. Ulnar nerve

Answer

<32>A patient with essential hypertension is starting diuretic therapy. He has a history of calcium oxalate renal stones. Which of the following diuretics would be most appropriate to give this patient? A. Acetazolamide B. Furosemide C. Hydrochlorothiazide D. Spironolactone E. Triamterene Answer

<33>A 65-year-old man with hyperlucent lung fields develops extreme shortness of breath over a period of about 15 minutes. Chest x-ray shows a shift of the mediastinum to the right, and the lung field on the left appears even more hyperlucent than before, with the exception of a white shadow near the heart border. Which of the following is the most probable cause of the patient's current problem? A. Bronchogenic carcinoma B. Pleural effusion C. Pulmonary embolism D. Rupture of an emphysematous bulla E. Tuberculosis Answer

<34>A patient is brought to the emergency room in a coma due to diabetic ketoacidosis. Insulin therapy is begun immediately. Which of the following therapies should also be begun immediately? A. Calcium supplementation B. Creatinine supplementation C. Magnesium supplementation D. Potassium supplementation E. Sodium supplementation Answer

<35>A 69-year-old man with Alzheimer disease and a 10-year history of type 2 diabetes is brought to a family practice clinic by his daughter. The patient is unable to give a clear account of how carefully he controls his blood glucose. Which of the following laboratory

parameters could be used to assess glycemic control over the past 3-6 months? A. Blood glucose B. Blood insulin levels C. Blood ketones D. Glycosylated hemoglobin E. Urinary glucose Answer

<36>A woman with glucose-6-phosphate dehydrogenase (G6PD) deficiency develops a urinary tract infection. Free radicals generated by responding neutrophils create an oxidant stress, and RBCs are rapidly overwhelmed. As soon as intravascular hemolysis begins, serum levels of which of the following will decrease? A. Bilirubin B. C-reactive protein C. Free iron D. Haptoglobin E. Methemoglobin Answer

<37>An urban health department reports the infant mortality rate of the city in the past year. This value corresponds to which of the following? A. The number of deaths during the past year from all causes divided by the total population B. The number of deaths occurring after the first 4 weeks of life and before the first birthday divided by the total number of live births C. The number of deaths occurring until the first birthday divided by the total number of live births D. The number of deaths occurring within the first 4 weeks of life divided by the total number of births E. The number of deaths occurring within the first 4 weeks of life divided by the total number of live births Answer

<38>A male infant presents with flattened facial features, low set ears , and deformities of the feet. The lungs are underdeveloped. The pregnancy was complicated by severe oligohydramnios. The most likely cause of this condition is a malformation of the A. paramesonephric ducts B. pronephros

C. D. E. Answer

ureteric buds urogenital sinus urorectal septum

<39>A 29-year-old female comes to her physician's office complaining of headaches, fatigue, and weakness over the past several months. Physical exam is significant for pallor, tachycardia, dizziness on standing up, and koilonychia (spooning of the nails). Laboratory studies show: Hemoglobin-10.2 g/dl Hematocrit-30.8 % Serum Fe-24 mg/dl Serum ferritin-30 ng/ml Total Fe binding capacity-713 mg/dl A peripheral blood smear would likely show A. macrocytosis with hypersegmented neutrophils B. microcytosis with basophilic stippling C. microcytosis with hypochromia D. numerous schistocytes Answer

<40>A 3-year-old boy presents with a 1-day history of loose stools, fever, abdominal cramping, headache, and myalgia. He has no blood in the stool. A careful history reveals that he has several pet turtles. Which of the following is most likely the causative agent of his diarrhea? A. Chlamydia psittaci B. Entamoeba histolytica C. Salmonella spp. D. Staphylococcus aureus E. Yersinia enterocolitica Answer

<41>A newborn baby has a large, cystic "mass" of the lumbar region. The mass is found to consist of CSF-filled meningeal tissue that has herniated through a vertebral defect. The child moves all her extremities and responds to external stimulation in a normal fashion. The term best used to describe this child's lesion is which of the following? A. Encephalocele B. Meningocele C. Meningomyelocele D. Spina bifida aperta E. Spina bifida occulta Answer

<42>A medical student, whose baseline alveolar PCO2 level was 40 mm Hg, begins to voluntarily hyperventilate for an experiment during his respiratory physiology laboratory. If his alveolar ventilation quadruples and his CO2 production remains constant, approximately what will be his alveolar PCO2? A. 4 mm Hg B. 10 mm Hg C. 20 mm Hg D. 80 mm Hg E. 160 mm Hg Answer

<43>A 32-year-old woman visits her gynecologist for a Pap smear. On physical examination, her gynecologist palpates a large adnexal mass on the right. After ultrasound confirmation of a large ovarian mass, a laparotomy is scheduled, and the mass is removed. Pathologic examination of the mass demonstrates a cystic cavity filled with hair and keratin debris, and the wall contains skin, adnexal tissue, thyroid tissue, and neural tissue. All of the tissues are similar to those normally found, and no malignant changes are seen. Which of the following is the most likely diagnosis? A. Immature teratoma B. Leiomyoma C. Leiomyosarcoma D. Mature teratoma E. Rhabdomyosarcoma Answer

<44>An 82-year-old woman with congestive heart failure and a creatinine clearance (CrCl) of 17 mL/min needs a diuretic for treatment of peripheral edema. Which of the following diuretics would be most appropriate in this patient? A. Furosemide B. Hydrochlorothiazide C. Indapamide D. Spironolactone E. Triamterene Answer

<45>A hypertensive patient is found to have a partial obstruction of the renal artery due to an atherosclerotic plaque. The resultant decrease in blood flow causes the increased release of an enzyme from which of the following structures? A. Afferent arterioles B. Arcuate arteries C. Juxtaglomerular cells D. Kupffer cells E. Proximal convoluted tubule Answer

<46>A Native American man is brought to a rural hospital in New Mexico. On arrival, he is unconscious with severe bronchopneumonia. Family members state that he suffered the sudden onset of chills, fever, and headache several days ago. One day later, the man complained of chest pain and difficulty breathing, and coughed up blood-tinged sputum. Chest x-ray reveals patchy infiltrates and segmental consolidation. Which of the following organisms is the most likely cause of this man's pneumonia? A. Brucella abortus B. Clostridium perfringens C. Francisella tularensis D. Listeria monocytogenes E. Yersinia pestis Answer

<47>A 34-year-old woman complains of early morning awakenings and loss of interest in everyday activities. She is diagnosed with major depressive disorder and given fluoxetine, but does not improve. Tricyclic antidepressants and MAO inhibitors are subsequently tried without effect, and electroconvulsive therapy (ECT) is recommended.Which of the following represents the most serious side effect of ECT? A. Extrapyramidal symptoms B. Hearing loss C. Mania D. Retrograde amnesia E. Rhabdomyolysis Answer

<48>A 62-year-old man with a 50-year-history of cigarette smoking has a complete work-up in a pulmonary function laboratory. The

table below shows pulmonary volumes and capacities obtained using simple spirometry and helium washout techniques. Lung Volumes Values Functional residual capacity 5.0 L Inspiratory reserve volume 1.5 L Inspiratory reserve capacity 2.0 L Vital capacity 3.5 L What is the total lung capacity of this patient? A. 6.5 L B. 7.0 L C. 7.5 L D. 8.0 L E. 8.5 L Answer

<49>A patient arrives in the emergency room after having been stabbed. He has suffered a penetrating wound in the left fourth intercostal space immediately lateral to the sternal border. Which of the following thoracic structures is most likely to have been injured? A. Left atrium B. Left ventricle C. Right atrium D. Right ventricle E. Upper lobe of the left lung

Answer

<50>A 60-year-old male presents to the dermatologist with a complaint o f tender blisters on his arm and flank. Physical examination reveals blisters and flaccid bullae; a few have ruptured, leaving red, sore, denuded areas. Which of the following findings would suggest the diagnosis of pemphigus vulgaris as opposed to bullous pemphigoid? A. Eosinophils within bullae B. IgA deposits on basement membrane C. IgG autoantibody activity D. Negative Nikolsky sign E. Oral mucosal lesions Answer

Answers

1The correct answer is A. The lesion is a squamous cell carcinoma of the skin. Actinic keratosis, which is a hyperplastic lesion of sun-damaged skin, predisposes for squamous cell carcinoma. Another predisposing condition to remember is xeroderma pigmentosum, which predisposes for both squamous cell and basal cell carcinomas of skin. A nevus is a mole, containing characteristic cells called nevocellular cells. If the nevocellular cells are located at the dermal-epidermal junction (junctional nevus, choice D), in the dermis (dermal nevus, choice C), or both (compound nevus, choice B), they do not predispose for squamous cell carcinomas of the skin. Malignant melanoma (choice E), however, can arise in pre-existing nevi.

2The correct answer is C. In renal failure, the ability of the kidney to secrete phosphate is impaired. The resultant hyperphosphatemia causes hypocalcemia and triggers excretion of large amounts of parathyroid hormone. The released parathyroid hormone is a major contributor to bony changes (e.g., osteitis fibrosa, a form of localized bone resorption) seen in some patients with chronic renal failure. Aldosterone (choice A) is a regulator of serum sodium. Calcitonin (choice B) levels are usually low in chronic renal failure, unless the parathyroids have so hypertrophied as to cause "tertiary hyperparathyroidism" with hypercalcemia. Renin (choice D) is normally secreted by the kidney and may be either decreased or increased in varying stages and forms of kidney disease. Regardless, renin regulates blood pressure and aldosterone secretion, rather than bone metabolism. The active form of Vitamin D (choice E), cholecalciferol, is formed in the kidney from Vitamin D absorbed from the gut and then processed by the liver. Uremia interrupts this pathway and consequently causes a functional Vitamin D

3The correct answer is C. Lysozyme is present in tears, saliva, mucus, vaginal secretions, and several other body fluids. This material lyses the peptidoglycan layer of the cell wall of bacteria without participation of any of the elements of the oxidative killing pathway. Hydrogen peroxide (choice A) is formed in the oxidative killing pathway from the superoxide ions. This material is also very toxic to bacteria pathogens. Hypochlorous acid (choice B) is formed from hydrogen peroxide and halide ions in the presence of myeloperoxidase. Myeloperoxidase (choice D) is an enzyme present in the oxidative killing pathway that breaks down hydrogen peroxide. Superoxide ions (choice E) are formed by NADPH oxidase in the first reaction of the oxidative killing pathway. These superoxide ions are extremely toxic to bacterial organisms.

4The correct answer is E. Secobarbital is a short-acting barbiturate with considerable dependence potential. Withdrawal from short-acting barbiturates can produce anxiety, delirium, and seizures which may be accompanied by life-threatening cardiovascular collapse. Insomnia (choice A) is a complication of barbiturate withdrawal, since barbiturates are sedative/hypnotic agents, but this complication is not serious enough to be a contraindication to abrupt cessation of the drug. Rebound anxiety (choice B) would be quite likely following abrupt cessation of the barbiturate, but would not constitute a sufficient danger to the patient to preclude selfdetoxification. Recidivism (choice C) is quite likely in drug abusers, with or without medical intervention. Respiratory depression (choice D) is common with acute administration of barbiturates, but would not be expected with barbiturate abstinence.

5The correct answer is A. The baby has meconium ileus, which is a manifestation of cystic fibrosis due to the abnormally viscid pancreatic secretions which "get stuck" in the small bowel. Meconium ileus can cause gut perforation with peritonitis and intraperitoneal calcifications (that may be visible on plain film). Meconium ileus complicated by intestinal perforation or formation of fistulas to the bladder or vagina must be treated surgically. Medical treatments for uncomplicated meconium ileus are now available, which use enemas, mucolytic agents, or pancreatic enzymes. Hirschsprung's disease (choice B) is a cause of congenital constipation related to absence of ganglion cells in a segment of bowel. The aganglionic bowel segment is narrowed because the lack of peristalsis keeps stool from moving into the segment. The distal rectum is always involved, and the lesion may extend proximally as far as the small intestine. The bowel proximal to the lesion is usually dilated. A Meckel's diverticulum (choice C) can form due to the persistence of the vitelline duct, which connects the developing gut to the yolk sac. They are classically located in the distal ileum within 30 cm of the ileocecal valve, and may contain ectopic pancreatic tissue or gastric mucosa.

6The correct answer is E. Misoprostol, a methyl analog of prostaglandin E1, is approved for the prevention of ulcers caused by the administration of nonsteroidal anti-inflammatory agents. Because this drug is a potential abortifacient, it should not be given to pregnant women, or to women who are attempting to conceive.

Antinuclear antibodies (choice A) are associated with autoimmune diseases such as systemic lupus erythematosus, scleroderma, Sjögren's syndrome, and inflammatory myopathies. The test would be of no value in this case. A barium swallow (choice B) is not indicated prior to the administration of misoprostol. Esophageal manometry (choice C) is used to evaluate the competency of the lower esophageal sphincter, and to assess esophageal motor activity. The osmotic fragility test (choice D) is performed by placing erythrocytes into a low-salt solution. An increased susceptibility to osmotic lysis is found in hereditary spherocytosis.

7The correct answer is B. Inversion of the heart, so that the morphologic left ventricle is in the right chest, is called dextrocardia. Isolated dextrocardia is almost always associated with cardiac defects that may include transposition of the atria and transposition of the great arteries. However, dextrocardia as part of situs inversus totalis, with reversal of the thoracic and abdominal organs, is usually associated with a physiologically normal heart. The cluster of situs inversus, sinusitis, and bronchiectasis is called Kartagener syndrome, which is caused by defective ciliary function. Since migration of some embryonic cells during development appears to be dependent on ciliary function, this is thought to explain the situs inversus. You should associate Down syndrome (choice A) with an ostium primum type of atrial septal defect. You should associate Kawasaki disease (choice C) with coronary artery aneurysms. You should associate Marfan syndrome (choice D) with aortic dissection. You should associate Turner syndrome (choice E) with coarctation of the aorta.

8The correct answer is C. The lesion is commonly called a Baker's cyst, and anatomically represents an enlarged semimembranous bursa. Baker's cysts are more commonly seen at the extremes of age. The deep infrapatellar bursa (choice A) is on the anterior aspect below the knee. The prepatellar bursa (choice B) is anterior to the patella. The superficial infrapatellar bursa (choice D) is on the anterior aspect of the leg below the knee. The suprapatellar bursa (choice E) is on the anterior aspect of the thigh above the knee.

9The correct answer is E. The esophagus is covered by non-keratinized, stratified, squamous epithelium for its entire length. Heartburn is usually a sign of gastric regurgitation of the acidic contents in the lower esophagus (acid reflux disease). Acid reflux disease is a serious problem that may be associated with a precancerous condition (Barrett's esophagus).

10The correct answer is C. This man has received repetitive trauma to his right arm from operating a jack hammer for long periods of time. The median nerve is affected, as evidenced by decreased sensation in its distribution (first three-and-a-half). Thus, the muscles in the hand innervated by the median nerve will likely also be affected, such as the thenar muscles (abductor pollicis brevis, opponens pollicis, and flexor pollicis brevis) and the first two lumbricals. All other intrinsic muscles of the hand are innervated by the ulnar nerve (abductor digiti minimi, dorsal interossei, choices A and B). The wrist extensors (choice D) are innervated by the radial nerve and the supinators (choice E) are innervated as follows: biceps brachiimusculocutaneous nerve, supinator-radial nerve, brachioradialis-radial nerve.

11The correct answer is C. Nephroblastoma (Wilms tumor) characteristically affects children between 2 and 4 years of age and can form large spherical masses composed of variegated tissues including primitive renal epithelial elements, a sarcomatous-appearing stroma, abortive glomeruli and tubules, and heterologous tissues such as muscle, cartilage, fat, and bone. Cortical adenoma (choice A) is a small (under 2 cm) benign tumor that is usually found incidentally at autopsy. Hemangiomas (choice B) can occur in the kidney, but would not usually produce a large mass. Oncocytomas (choice D) are benign tumors that can be large but do not usually affect young children. Renal cell carcinoma (choice E) is usually a disease of older adults.

12The correct answer is E. The facial nerve (CN VII) is intimately related anatomically to the parotid gland, but controls salivation from both the submandibular and sublingual glands. The parotid gland (choices A, B, and C) is innervated by the glossopharyngeal nerve (CN IX).

13The correct answer is A. Burkitt's lymphoma is actually associated with three translocations. The common variant t(8;14)(q24;q32), involving the oncogene myc on chromosome 8, and the heavy immunoglobulin chain on chromosome 14. The other two variants are: t(8;22)(q24;q11), involving myc and the lambda light chain immunoglobulin site, and t(2;8)(p12;q24), involving the kappa light chain and myc. Mantle cell lymphoma (choice B), multiple myeloma (choice C), and small (not cleaved) cell lymphoma (choice D) are associated with the t(11;14)(q13;q32) translocation involving bcl -1 and the heavy chain site. Small cleaved cell lymphoma (choice E) is associated with t(14;18)(q 32;q21), involving the immunoglobulin chain site and bcl-2.

14The correct answer is C. The defecation reflex that is evoked when the rectum is distended involves three responses: 1) the internal anal sphincter relaxes, 2) the external anal sphincter contracts, and 3) a conscious urge to defecate is perceived. This neural reflex involves the pelvic nerve, which provides the parasympathetic preganglionic innervation to the internal anal sphincter (composed of smooth muscle) and also carries the sensory afferent information from the rectum to the spinal cord, and the pudendal nerve, which carries the somatic efferent inputs to the external anal sphincter (composed of skeletal muscle). In the patient described above, the pelvic nerve is most likely damaged since neither the reflex relaxation of the internal anal sphincter nor the urge to defecate is evoked by rectal distention. Damage to the internal anal sphincter (choice A) would most likely cause resting tone to be low and, if anything, lead to fecal incontinence rather than constipation. Furthermore, damage to the internal anal sphincter could not explain the failure of the appearance of the urge to defecate. The external anal sphincter (choice B) appears to function normally since distention of the rectum evokes the expected contraction. The normal contraction of the external anal sphincter also suggests that the pudendal nerve (choice D) is intact. Since distention of the rectum (choice E) evoked the contraction of the external anal sphincter, it too appears to be functioning normally.

15The correct answer is A. The spots described are called Roth's spots, and specifically suggest bacterial endocarditis. They represent small fibrin clots that form on the vegetations and then break off and lodge in small blood vessels, including those of the retina. Splinter hemorrhages, petechiae, and small, painful nodules on the finger and toe pads (Osler's nodes) may also be seen. Physical examination frequently reveals a heart murmur. Crohn's disease (choice B) can occasionally be associated with uveitis, but not retinal hemorrhages. Diabetes mellitus (choice C) can cause a variety of ocular changes including microaneurysms, flame hemorrhages, and "cotton wool" deposits, but Roth's spots are not produced. Glaucoma (choice D) causes increased pressure in the anterior chamber, but does not produce Roth's spots. Urosepsis (choice E) does not usually cause any obvious eye findings.

16The correct answer is E. The patient is suffering from mitral regurgitation caused by rupture of the chordae tendineae. Mitral regurgitation is characterized by a greatly elevated left atrial pressure toward the end of systole caused by backward flow of blood from the left ventricle into the left atrium through the leaky mitral valve. The left atrial pressure is normal at the end of diastole with mitral regurgitation because blood flows unimpeded from the atrium into the ventricle when the mitral valve is open. The leak occurs during systole, and is characterized by a systolic murmur, which was noted in the patient. The chordae tendineae are tendinous cords that connect each cusp of the mitral valve to the papillary muscles in the left ventricle. When these rupture, the cusps of the mitral valve cannot be approximated during systole, which results in backward flow of blood into the left atrium. The chordae tendineae are often damaged in rheumatic valvular disease, which increases the probability of rupture. The aortic pressure and left ventricular pressure tracings are nearly superimposed during systole in the diagram, which eliminates the possibility of aortic obstruction (choice A) and aortic regurgitation (choice B). The rate of rise of left ventricular pressure appears to be normal, which argues against the possibility of left ventricular infarction (choice C). In mitral obstruction (choice D), the left atrial pressure is greater than the left ventricular pressure toward the end of diastole when blood is flowing from the left atrium into the left ventricle.

17The correct answer is E. This is the classic presentation of Zenker's diverticulum, which is a false diverticulum formed by herniation of the mucosa at a point of weakness at the junction of the pharynx and esophagus in the posterior hypopharyngeal wall. Zenker's diverticulum is also associated with halitosis, and if the diverticulum fills completely with food, it can cause dysphagia or obstruction of the esophagus. Mallory-Weiss tears (choice A) are mucosal tears at the gastroesophageal junction secondary to repeated, forceful vomiting. They are often seen in alcoholics. Plummer-Vinson syndrome (choice B) is the triad of dysphagia (due to esophageal webs in the upper esophagus), atrophic glossitis, and iron-deficiency anemia. Schatzki rings (choice C) are mucosal rings found in the distal esophagus at the squamocolumnar junction. In contrast to a Zenker's diverticulum, the usually asymptomatic traction diverticula (choice D) are true diverticula involving all of the layers of the esophagus. They are typically caused by adherence of the esophagus to a scarred mediastinal structure.

18The correct answer is B. In obstructive lung disease such as emphysema, the MEFV curve begins and ends at abnormally high lung volumes, and the flow rates are lower than normal at any given lung volume. Note on the diagram that the patient's total lung capacity is 7 liters and the residual volume is 3.5 liters (dashed curve). The curve may also have a scooped out appearance as shown on the diagram. Note that absolute lung volumes cannot be determined from a MEFV curve alone. An additional method is used to measure residual volume, then the curves can be placed appropriately on the abscissa. Lung volumes are expected to be lower than normal in asbestosis (choice A), pleural effusion (choice C), pneumothorax (choice D), silicosis (choice E), and other types of restrictive lung diseases.

19The correct answer is B. In the formation of the upper lip, the right and left medial nasal prominences merge to form the philtrum of the upper lip. The lateral maxillary prominence then merges with the merged medial nasal prominences. Failure of this merger to occur results in a unilateral cleft lip. Failure of a lateral palatine process to fuse with the median palatine process (choice A), which is synonymous with a failure of the primary palate to fuse with the secondary palate (choice C), results in a primary cleft palate. Primary clefts of the palate are found anterior to the incisive foramen of the palate. Primary cleft palates may occur along with cleft lips but are the result of a separate developmental defect. Failure of the right and left medial nasal prominences to merge (choice D) results in a median cleft lip. This is a rare anomaly. Normally, the right and left medial nasal prominences merge into a single prominence which forms the philtrum of the lip. Failure of the right and left palatine processes to fuse (choice E) results in a secondary cleft palate. Secondary cleft palates are found posterior to the incisive foramen. Normally, the right and left palatine processes fuse together and fuse to the primary palate.

20The correct answer is B. Disseminated intravascular coagulation (DIC) is characterized by consumption of both platelets and clotting factors. The best tests to order are platelet count (which will be markedly decreased), serum fibrinogen level (which will be low), and fibrin degradation products (which will be high). Prothrombin time (PT) measures factors I (fibrinogen), II, V, VIII, and X. Partial thromboplastin time (PTT) measures VII, prekallikrein, high-molecular weight kininogen, and factors I, II, V, VII, IX, X, and XI. Both PT and PTT are relatively non-specific. Thrombin time (TT) is a more specific measure of fibrinogen and would potentially be a useful test in this setting. However, specific measurement of factor VIII, kininogen, or prekallikrein levels would not be rational in evaluating DIC.

21The correct answer is A. This is Addison disease, in which severe adrenal disease produces adrenocortical insufficiency. Causes include autoimmune destruction, congenital adrenal hyperplasia, hemorrhagic necrosis, and replacement of the glands by either tumor (usually metastatic) or granulomatous disease (usually tuberculosis). The symptoms can be subtle and nonspecific (such as those illustrated), so a high clinical index of suspicion is warranted. Skin hyperpigmentation is a specific clue that may be present on physical examination, suggesting excess pituitary ACTH secretion. (The ACTH precursor has an amino acid sequence similar to MSH, melanocyte stimulating hormone.) Most patients have symptoms (fatigue, gastrointestinal distress) related principally to glucocorticoid deficiency. In some cases,

however, mineralocorticoid replacement may also be needed for symptoms of salt wasting with lower circulating volume. Except in the case of primary pancreatic cancer, complete tumor replacement of the endocrine pancreas (choice B) would be uncommon. In any event, pancreatic involvement would be associated with diabetes mellitus. Involvement of the ovaries (choice C) by metastatic tumor (classically gastric adenocarcinoma) would produce failure of menstruation. Involvement of the pituitary gland (choice D) could produce Addisonian symptoms, but the pigmented skin suggests a primary adrenal problem rather than pituitary involvement. Replacement of the thyroid gland (choice E) by tumor would cause hypothyroidism with lesser degrees of fatigue and cold intolerance; this is an unusual cause of hypothyroidism and is less likely to be tested than Addison disease caused by bilateral adrenal metastasis.

22The correct answer is B. When patients present with either a muscle spasm or a "strained" muscle, a centrally acting skeletal muscle relaxant is typically prescribed. In addition to these agents, a nonsteroidal anti-inflammatory drug is often added for additional pain control. Although somnolence can be seen with any of the agents listed, xerostomia (dry mouth), mydriasis and tachycardia are classic anticholinergic side effects. Cyclobenzaprine is a centrally acting skeletal muscle relaxant that is structurally related to tricyclic antidepressants, which are known for their strong anticholinergic side effects. Additional common anticholinergic side effects seen with this agent include blurred vision, urinary retention, and constipation. Less common side effects include agitation, respiratory depression, disorientation, tachycardia, and widening of the QRS complex. Baclofen (choice A) is a centrally acting skeletal muscle relaxant that produces muscle relaxation by inhibition of both monosynaptic and polysynaptic reflexes at the spinal level. This agent is indicated for the treatment of spasticity resulting from multiple sclerosis or secondary to spinal cord injuries; it has also been used in the treatment of trigeminal neuralgia. The most common side effects include transient drowsiness, fatigue, and hypotension. Diclofenac (choice C) is a non-steroidal anti-inflammatory drug indicated for the treatment of a variety of disorders associated with pain and inflammation. The most common side effects include dyspepsia, nausea, vomiting, abdominal cramps, and dizziness. Methocarbamol (choice D) produces muscle relaxation by general CNS depression; it does not have a direct action on the contractile mechanism of striated muscle or nerve fibers. This agent is indicated as an adjunct to rest, physical therapy, and other measures for relief of discomfort in various musculoskeletal conditions. Reported side-effects include dizziness, vertigo, ataxia, headache, irritability, bradycardia, hypotension, and syncope. Rofecoxib (choice E) is a selective cyclooxygenase-2 (COX-2) inhibitor with antiinflammatory, analgesic, and antipyretic effects. This agent is used in adults for relief of pain and inflammation caused by osteoarthritis and rheumatoid arthritis, as well other inflammatory conditions. The most common side effects are nausea, vomiting, diarrhea, abdominal distress, flatulence, and anorexia.

23The correct answer is A. The patient has Dressler's syndrome, which is thought to be an autoimmune phenomenon resulting in fibrinous pericarditis with fever and pleuropericardial chest pain several weeks after a myocardial infarction. Bacterial (choice B), fungal (choice D), and viral (choice E) infections can cause pericarditis, but would not be suspected in the setting of myocardial infarction. Chlamydia (choice C) are not a usual cause of pericarditis.

24The correct answer is B. The lesion described is the form of in situ penile carcinoma known as Bowen's disease. Bowen's disease is thought to carry a 10% risk of progressing to invasive squamous cell carcinoma, if left untreated. Bowenoid papulosis (choice A) is a form of in situ penile carcinoma that is characterized clinically by multiple, reddish-brown, papular lesions. Condyloma acuminatum (choice C) is a benign lesion that resembles the common wart. Condylomata are associated with papillomavirus infection. Erythroplasia of Queyrat (choice D) is a form of in situ penile carcinoma that produces a soft, red plaque. Giant condyloma (choice E) is an uncommon variant of condyloma acuminatum that is locally aggressive, but does not usually metastasize.

25The correct answer is C. Acute epididymitis and orchitis with prominent neutrophils in a sexually active male are most likely due to infection with Neisseria gonorrhoeae or Chlamydia trachomatis. N. gonorrhoeae can produce a nonspecific pattern of acute inflammation (nonspecific epididymitis and orchitis) or can be sufficiently severe as to cause frank abscesses within the epididymis. Escherichia coli (choice A) is an important cause of nonspecific epididymitis and orchitis in children with congenital genitourinary abnormalities and in older men. Mycobacterium tuberculosis (choice B) can cause tuberculosis of the epididymis and testes, characterized by granuloma formation. Pseudomonas sp.(choice D) has been implicated as an important cause of nonspecific epididymitis and orchitis in older men. Treponema pallidum (choice E), the causative agent of syphilis, can cause testicular involvement with gumma formation, endarteritis, and/or a prominent plasma cell infiltrate.

26The correct answer is C. The cardiac output (CO) is equal to the volume of blood ejected from the heart during each systole (i.e., the stroke volume; SV) multiplied by the number of times the heart beats each minute (heart rate; HR). In other words, CO = SV x HR. Therefore, SV = CO/HR, and since CO = 5000 mL/min, and HR = 50/min, SV = 5000/50 = 100 mL.

27The correct answer is A. Even if you do not remember the features of the individual lipid storage diseases, it is worth remembering that Fabry's disease (described above) is the only one in the group with X-linked genetics. As a general rule, you should associate all of the lipid storage diseases with severe neurologic deterioration. The exception is Gaucher's disease (choice B), which tends to affect the liver and spares the brain. Gaucher's disease (choice B), Niemann-Pick disease (choice E), and Type I Tay-Sachs disease are not X-linked; all occur with greater frequency in Ashkenazi Jews. You should associate Krabbe's disease (choice C) with the presence of "globoid" cells in degenerating white matter in the brain. Metachromatic leukodystrophy (choice D) is caused by a deficiency of the enzyme arylsulfatase A.

28The correct answer is B. This is Bowen's disease, which is one clinical form of penile carcinoma in situ (the other forms are Bowenoid papulosis and erythroplasia of Queyrat). Untreated Bowen's disease will, over a period of years, progress to frank invasive carcinoma

in 10% to 20% of patients. Bowen's disease can affect the genital region of both men and women. Bowenoid papulosis (choice A) is another form of penile carcinoma in situ, characterized clinically by multiple reddish-brown papular lesions. Condyloma acuminatum (choice C) usually produces a papillary lesion. Erythroplasia of Queyrat (choice D) is another form of penile carcinoma in situ, characterized by single or multiple shiny red plaques. Squamous cell carcinoma (choice E) will be frankly invasive on biopsy.

29The correct answer is C. In young women, the most likely causes of cervicitis and pelvic inflammatory disease (PID) are Neisseria gonorrhoeae and Chlamydia trachomatis. Gram's staining alone may not be able to distinguish between the two in women, so culture is warranted. Both organisms induce endocytosis by epithelial cells. Neisseria gonorrhoeae is a gram-negative diplococcus. It is endocytosed by mucus-secreting epithelia, and is exocytosed into subepithelial tissues leading to necrotizing acute inflammation and destruction of ciliated and non-ciliated cells. Through direct extension, it can lead to PID and infertility in women. It can be detected by visualizing the organism in polymorphonuclear leukocytes (PMNs) in Gram's stained clinical material more easily in men than in women. Therefore, culture onto Thayer-Martin agar is usually required for diagnosis in women. Since the organism can be cultured, it is not an obligate intracellular parasite (compare with choice D). The organism can be killed by PMNs, antibody, and complement, however, many of its outer membrane proteins undergo antigenic or phase variation or cause the production of blocking antibody that interferes with bactericidal activity. Immunity to the organism does not develop (compare with choices A and B). Neisseria gonorrhoeae is resistant to penicillin, a b-lactam antibiotic (compare to choice E), because of a plasmid-mediated penicillinase and a chromosomally-mediated mutation that decreases the permeability of the outer membrane and decreases the affinity of penicillin binding proteins. It can be treated with ceftriaxone, a cephalosporin, which resists the penicillinase, or with quinolones and azithromycin. Chlamydia trachomatis is an obligate intracellular parasite (choice D) that induces endocytosis and resides in the phagosome of infected epithelial cells. It possesses a gramnegative envelope but lacks peptidoglycan, and hence is intrinsically resistant to all antibiotics that inhibit peptidoglycan synthesis, such as the b-lactam antibiotics (compare with choice E). Antibodies are ineffective at controlling infection. Cell mediated immunity (choice A) is probably the major means of controlling this infection since a deficiency in cell mediated immunity both increases susceptibility and severity in animal models. Chronic and clinically latent infections cause serious morbidity, including pelvic inflammatory disease, fallopian tube dysfunction and blindness. Chlamydia infection can be treated with macrolides, quinolones and tetracyclines.

30The correct answer is C. Methotrexate is a type of disease-modifying antirheumatic drug (DMARD). DMARDs are a varied group of drugs, including methotrexate, azathioprine, penicillamine, hydroxychloroquine and chloroquine, organic gold compounds, and sulfasalazine, which are thought to slow the progression of rheumatoid arthritis by modifying the disease itself. However, these drugs can take several weeks to several months to produce therapeutic effects. In rheumatoid arthritis, prednisone is used when persistent synovitis is seen in multiple joints despite sufficient dosage of NSAIDs. It is also used for "bridge" therapy when DMARD therapy with methotrexate is first initiated. Because it takes a long time for the therapeutic effect of DMARDs to become evident, agents like prednisone are needed to "bridge the gap" between NSAID therapy and DMARD therapy.

The major disadvantage of using glucocorticoids for an extended period of time is the severe side effect profile. For example, long term use of prednisone is associated with hypocalcemia (choice C), fluid retention (not dehydration, choice A), hypokalemia (not hyperkalemia, choice B), hyperglycemia (not hypoglycemia, choice D), and hypernatremia (not hyponatremia, choice E). Other adverse reactions include adrenal suppression, muscle weakness and atrophy, gastritis, nausea, vomiting, Cushingoid state (moon face, buffalo hump, central obesity), immunosuppression, hypertension, psychosis, osteoporosis, glaucoma, and posterior subcapsular cataracts.

31The correct answer is A. The brachial artery is immediately medial to the tendon of the biceps brachii at the elbow. As the artery enters the forearm, it is covered by the bicipital aponeurosis, a broadening of the biceps tendon. The musculocutaneous nerve (choice B) does not cross the elbow. The musculocutaneous nerve gives off all of its muscular branches to muscles in the arm. The remainder of the nerve is then renamed the lateral cutaneous nerve of the forearm, which passes the elbow lateral to the tendon of the biceps. The profunda brachii artery (choice C) arises from the brachial artery in the proximal part of the arm. It accompanies the radial artery in the musculospiral groove and then divides into the radial collateral artery and middle collateral artery, which cross the elbow lateral to the tendon of the biceps. The radial nerve (choice D) lies within the musculospiral groove along the back of the humerus, then passes between the brachioradialis muscle and the brachialis muscle at the elbow, lateral to the tendon of the biceps. The ulnar nerve (choice E) crosses the elbow posterior to the medial epicondyle of the humerus. It then passes between the two heads of the flexor carpi ulnaris and courses through the forearm deep to this muscle.

32The correct answer is C. A thiazide diuretic would be the drug of choice for this patient because it is the only class of diuretic which decreases urinary secretion of calcium. Thiazide diuretics, like hydrochlorothiazide, inhibit the Na+/Cl- cotransporter in the distal convoluted tubule and promote the reabsorption of calcium. Acetazolamide (choice A), a carbonic anhydrase inhibitor, and furosemide (choice B), a loop diuretic, both induce diuresis at the expense of all three major cationic electrolytes (Na+, K+, and Ca2+) which are secreted in increased amounts. Spironolactone (choice D) and triamterene (choice E), so-called potassium sparing diuretics, block Na+/K+ exchange in the collecting duct. Although they decrease K+ secretion, Na+ and Ca2+ secretion are elevated.

33The correct answer is D. The patient's initial hyperlucent lung fields strongly suggest the presence of emphysema. The radiologic findings after the increase in shortness of breath are consistent with free air in the chest, which has collapsed the left lung and caused a shift in the location of the mediastinum. Such air might have been introduced by rupture of a bulla. Small pneumothoraces are usually well tolerated, but larger ones may require decompression (the needle from a syringe is sometimes used), or even surgical correction if bullae continue to leak air. Bronchogenic carcinoma (choice A) would be expected to produce a mass lesion. Pleural effusion (choice B) usually develops slowly, and causes a whitening of lung fields when fluid is present.

Pulmonary embolism (choice C) can cause a sudden shortness of breath, but would not cause an increase in the lucency of the lung fields. Tuberculosis (choice E) would be expected to produce a mass lesion in the lung

34The correct answer is D. Therapy of diabetic ketoacidosis requires more than insulin. Intravascular volume is often depleted, and initial fluids to restore volume should include isotonic saline or lactated Ringer's solution. If arterial blood pH is less than 7.1 or if severe hyperkalemia is present, bicarbonate supplementation should be used. IV fluids containing 510% dextrose (glucose) should be used when the serum glucose levels fall to 200-300 mg/dL, since high doses of rapidly acting insulin can cause life-threatening hypoglycemia. Additionally, the serum potassium concentration should be watched very carefully, since potassium is cotransported into cells with glucose in the presence of insulin. It is often the case that hyperkalemia is present initially, secondary to decreased cellular uptake of potassium with decreased cellular uptake of glucose. However, this can rapidly change when insulin drives glucose (with potassium) into cells, and a life-threatening hypokalemia can develop. Supplementation with calcium (choice A) is not required with insulin administration. Creatinine (choice B) is a waste product, rather than a nutrient. Supplementation with magnesium (choice C) is not required with insulin administration. Sodium supplementation (choice E) is not required during therapy with insulin.

35The correct answer is D. The amount of glycosylated hemoglobin (HbA1c) is directly related to the level of glucose in the blood. Since HbA1c is a stable product, its concentration reflects glucose levels over the past 3-6 months. HbA1c forms as a result of nonenzymatic glycosylation, a fundamental biochemical abnormality that accounts for most of the histopathologic alterations in diabetes mellitus. At first, glucose forms reversible glycosylation products with proteins by formation of Schiff bases. Rearrangement of Schiff bases leads to more stable, but still reversible, Amadori products and subsequently to irreversible advanced glycosylation end products (AGE), of which HbA1c is an example. Blood ketones, blood glucose, urinary glucose, and blood insulin do not reflect long-standing metabolic abnormalities of diabetes mellitus and cannot be used to assess long-term glycemic control. Blood glucose (choice A) is elevated in both type 1 and type 2 diabetes mellitus. Hyperglycemia is the diagnostic feature of diabetes mellitus and leads to glycosuria (choice E) when blood glucose exceeds 160-180 mg/dL. Blood insulin (choice B) is decreased in untreated type 1 diabetes and normal or even slightly increased in type 2 diabetes. Blood ketones (choice C) (acetoacetic acid and b-hydroxybutyric acid) are synthesized from free fatty acids in response to severe insulin deficiency. Accumulation of ketone bodies in the blood is a crucial pathogenetic factor in ketoacidosis, which occurs exclusively in type 1 diabetics.

36The correct answer is D. Haptoglobin (or alpha-2 globulin) is a serum protein that promptly binds to free hemoglobin in the serum, forming a tight complex. The haptoglobinhemoglobin complex is quickly cleared from the blood by the reticuloendothelial system, which allows the hemoglobin to be salvaged instead of lost into the urine. Intravascular hemolysis from any cause is rapidly followed by a dramatic drop in serum haptoglobin. Bilirubin (choice A) is synthesized in the liver and spleen as an end-product of heme degradation. Serum bilirubin levels would not change until the haptoglobin in the blood was

completely saturated, and free hemoglobin began to circulate. In this circumstance, serum bilirubin would increase, not decrease. C-reactive protein (choice B) is an acute phase reactant produced by the liver in increased quantity in response to inflammation. This patient's urinary tract infection would increase Creactive protein levels, but the hemolysis would not further affect them. Serum free iron (choice C) does not change appreciably in intravascular hemolysis. Ferrous iron in the red blood cell is complexed to hemoglobin, and this complex is not broken in hemolysis. Methemoglobin (an oxidized form of hemoglobin; choice E) increases in the blood along with free hemoglobin in cases of intravascular hemolysis.

37The correct answer is C. This is one of those questions where predicting the correct answer will facilitate your selecting the appropriate answer choice. Make sure to read each choice carefully (for example, choices D and E, though both incorrect in this case, look almost identical and could cost you points if you were not reading actively). Choice A refers to the crude mortality rate. Choice B refers to the postnatal mortality rate. Choice D is an incorrect rendering of the neonatal mortality rate since it considers the total number of births instead of the total number of live births. Choice E refers to the neonatal mortality rate.

38The correct answer is C. This infant suffers from Potter syndrome, caused by an absence of both kidneys. This is often caused by a failure of the ureteric buds to develop. The ureteric buds form the ureters, renal pelvis, calyces, and collecting tubules. The collecting tubules induce the formation of metanephric vesicles, which differentiate into the tubular components of the nephron. The paramesonephric ducts (choice A) form the uterine tubes, uterus, and the upper third of the vagina. The pronephros (choice B) is a transient collection of cells that disappears during the fourth week of development. It does not form the permanent kidney. The urogenital sinus (choice D) forms the urinary bladder (in both sexes). It also forms the prostatic urethra, prostate, membranous urethra, bulbourethral glands, penile urethra (proximal part) and Littre's glands in the male. In the female it forms most of the urethra, urethral glands, paraurethral glands, vestibule of the vagina and greater vestibular glands. The urorectal septum (choice E) partitions the cloaca into the urogenital sinus and rectum (and upper anal canal).

39The correct answer is C. This is a classic description of Fe deficiency anemia (up to 20% of adult women are Fe deficient!). Fe deficiency anemia is very common in menstruating women, and is associated with the signs and symptoms described (fatigue, weakness, pallor). It can also be associated with epithelial changes such as brittle nails and atrophic tongue. The typical laboratory values are those described along with a decreased reticulocyte count. On peripheral blood smear, the RBCs are small (microcytic) and pale in color (hypochromic, due to low Hb levels from inadequate Fe stores). Vitamin B12/folate deficiency would give you macrocytosis with hypersegmented neutrophils (choice A). Lead poisoning would give you microcytosis with basophilic stippling (choice B).

Schistocytes (choice D) are RBC fragments seen when the cells are destroyed by shearing forces in the vascular system, such as those present in prosthetic heart valves and microangiopathic hemolytic anemias.

40The correct answer is C. Salmonella spp., including S. enteritidis and S. typhimurium, produce a gastroenteritis or enterocolitis. Patients with decreased gastric acidity, sickle cell disease, defects in immunity, or children younger than 4 years have a more severe course of disease. Salmonella spp. are carried in nature by animal reservoirs such as poultry, turtles, cattle, pigs, and sheep. The incubation period is 8-48 hours after ingestion of contaminated food or water. Chlamydia psittaci (choice A) produces an interstitial pneumonitis accompanied by headache, backache, and a dry, hacking cough. A pale, macular rash is also found on the trunk (Horder's spots). Patients at risk include pet shop workers, pigeon handlers, and poultry workers. Entamoeba histolytica (choice B) produces a diarrhea (frequently bloody or heme-positive), right lower quadrant crampy abdominal pain, and fever. Patients frequently have weight loss and anorexia. There is usually a history of travel outside the U.S. Most cases are chronic. Complications include liver abscesses. Staphylococcus aureus (choice D) produces a self-limited gastroenteritis due to the production of preformed, heat-stable enterotoxins. The incubation period is 16 hours. The toxins enhance intestinal peristalsis and induce vomiting by a direct effect on the CNS. Yersinia enterocolitica (choice E) usually produces a chronic enteritis in children. These patients have diarrhea, failure to thrive, hypoalbuminemia, and hypokalemia. Other findings include acute right lower quadrant abdominal pain, tenderness, nausea, and vomiting. The infection mimics appendicitis or Crohn's disease.

41The correct answer is B. Meningocele occurs due to a failure of closure of the caudal portion of the neural tube. In contrast to the more serious meningomyelocele, in which the spinal cord also herniates through the vertebral defect, meningocele is typically associated with only minimal neurological damage and is relatively easy to treat surgically. Encephalocele (choice A) implies herniation of the brain through a bony defect in the skull caused by defective closure of the cranial end of the neural tube. Meningomyelocele (choice C) includes herniation of the spinal cord through a vertebral defect. Associated neurological deficits are usually severe. In spina bifida aperta (choice D), there is a complete failure of fusion of the neural plate associated with malformation of the vertebral arches such that the underdeveloped neural plate is covered only with skin. No mass lesion is present, and the patient typically has major neurologic deficits. Spina bifida occulta (choice E) is the mildest of the neural tube defects, typically consisting of a small vertebral defect with a normal spinal cord and meninges. The defect is often associated with a skin dimple that overlies adipose tissue, hair follicles, or a sinus.

42The correct answer is B. When you hyperventilate, CO2 is blown off. The amount of CO2 blown off is inversely proportional to alveolar ventilation. This is shown by the alveolar ventilation equation: VA = VCO2/PACO2, where VA = alveolar ventilation VCO2 = CO2 production PACO2 = alveolar PCO2

So, if VCO2 remains the same, and VA quadruples, PACO2 must decrease by 4 fold; 40 mm Hg decreases to 10 mm Hg.

43The correct answer is D. The lesion is a mature teratoma. Teratomas located in the ovary and containing a hair and keratin filled cyst are sometimes called dermoid cysts. Teratomas contain cells of a variety of types, often including skin, skin adnexal structures (hair follicles, sweat glands, sebaceous glands), connective tissues, neural tissue, muscle, and thyroid tissue. If immature tissues such as primitive neuroepithelial cells or developing skeletal muscle cells are seen, the lesion is considered potentially malignant and classified as an immature teratoma (choice A). Leiomyomas (choice B) are benign tumors of smooth muscle (e.g., uterine "fibroids"), usually in the female genital tract. Leiomyosarcomas (choice C) are rare malignant tumors of smooth muscle, usually in the female genital tract. Rhabdomyosarcomas (choice E) are malignant skeletal muscle tumors with a predilection for the head and neck and urogenital regions in children.

44The correct answer is A. The key to this question is understanding that the effectiveness of each diuretic is dependent on the creatinine clearance (CrCl). For example, the "loop" diuretics are effective down to a CrCl of around 10 mL/min. However, the thiazide and potassium-sparing diuretics are effective only down to a CrCl of around 40 mL/min. Therefore, on the basis of this patient's CrCl of 17 mL/min, only a loop diuretic would be recommended. Furosemide is a loop diuretic that is indicated for the treatment of edema associated with congestive heart failure, hepatic cirrhosis, and renal disease. Hydrochlorothiazide (choice B) and indapamide (choice C) are thiazide diuretics and therefore would not be recommended for patients with such a low CrCl. Spironolactone (choice D) and triamterene (choice E) are potassium-sparing diuretics and therefore would not be recommended for a patient with a CrCl of 17 mL/min.

45The correct answer is C. The juxtaglomerular cells are in the wall of the afferent arteriole, close to the glomerulus. In response to decreased blood pressure, they secrete renin, an enzyme that converts angiotensinogen to angiotensin I. Angiotensin converting enzyme, found in the lungs, converts angiotensin I to angiotensin II. Angiotensin II increases peripheral vascular resistance directly and stimulates aldosterone secretion, resulting in increased reabsorption of sodium and water in the distal convoluted tubules. The afferent arteriole (choice A) carries blood from the interlobular arteries to the glomerulus. Filtration of blood occurs in the glomerulus, with the filtrate entering Bowman's capsule. The arcuate arteries (choice B) are branches of the interlobar arteries of the kidney. The arcuate arteries lie in the corticomedullary junction of the kidney and give rise to interlobular arteries, which enter the cortex of the kidney and supply the glomeruli. Kupffer cells (choice D) are found in the liver, along the sinusoids. They are phagocytic cells that are part of the reticuloendothelial system. The proximal convoluted tubule (choice E) is directly continuous with Bowman's capsule. Most of the resorption of the glomerular filtrate occurs in this part of the nephron.

46The correct answer is E. Any previously healthy person in the Southwestern United States who develops septic shock or severe pulmonary disease should be evaluated for plague.

Plague is not an extinct disease, but is still encountered in sporadic cases in various places in the world, including Asia, Africa, parts of Europe, and the American Southwest. The causative organism is Yersinia pestis, which is endemic in many wild animal populations, and can be transmitted to humans either by direct contact or by arthropod bite. Human plague may take many forms, including pestis minor (mild lymphadenopathy); bubonic plague (prominent lymphadenopathy); pneumonic plague (as in this patient); and septicemic plague. The primary pneumonic form typically presents as described. Antibiotics are most effective if given within the first 24 hours, which can be problematic if medical staff do not suspect the disease. Since plague is rare in the United States, a high degree of clinical suspicion is required to make a rapid diagnosis and to institute timely treatment. If the diagnosis is missed, the mortality rate is quite high. Brucella abortus (choice A) causes brucellosis, characterized by undulating fever, lymphadenopathy, and hepatosplenomegaly. Clostridium perfringens (choice B) causes gas gangrene and gastroenteritis. Francisella tularensis (choice C) causes tularemia, associated with a spectrum of manifestations from an influenza-like syndrome to adenopathy with ulceration at the site of inoculation. Listeria monocytogenes (choice D) causes listeriosis. Infection during pregnancy may result in sepsis, abortion or premature delivery. Infection in the neonate may produce meningitis. In immunocompromised adults, either meningitis or sepsis may occur.

47The correct answer is D. Although electroconvulsive therapy (ECT) is highly efficacious in treating major depressions that are refractory to tricyclic antidepressants and selective serotonin reuptake inhibitors, it produces retrograde amnesia as its major side effect. Extrapyramidal symptoms (choice A) are commonly produced by acute administration of antipsychotic drugs, such as phenothiazines or butyrophenones, not ECT. Hearing loss (choice B) is not a common side effect of ECT. Mania (choice C) is not a recognized side effect of ECT. Rhabdomyolysis (choice E) does not generally occur with ECT when it is performed correctly, with the administration of skeletal muscle relaxants.

48The correct answer is B. The total lung capacity is the sum of the functional residual capacity and inspiratory reserve capacity. The easiest approach to this type of question is to construct a simple spirogram (see below) and fill in the values provided in the table. This approach eliminates the need to memorize formulas. The missing volume or capacity can be easily determined from the spirogram. The total lung capacity, functional residual capacity, and residual volume are often increased in the emphysematous lungs of patients with a longterm history of cigarette smoking. A B C D E F G H inspiratory reserve volume expiratory reserve volume inspiratory reserve capacity vital capacity residual volume functional residual capacity tidal volume total lung capacity

49The correct answer is D. The right ventricle forms most of the anterior wall of the heart and extends from approximately the right border of the sternum to approximately 2 inches to the left of the sternum at the level of the fourth intercostal space. The left atrium (choice A) forms the posterior wall of the heart. The only portion of the left atrium seen on the anterior surface of the heart is the left auricular appendage, which is at the level of the second intercostal space on the left. The left ventricle (choice B) forms most of the left border of the heart and the diaphragmatic surface of the heart. It forms the anterior wall of the heart in a region from approximately 2-3 inches from the left border of the sternum from the third to the fifth intercostal space. The right atrium (choice C) forms the right border of the heart. Its anterior surface is on the right side of the sternum from approximately the third rib to the sixth rib. The left lung (choice E) is displaced away from the sternum on the left side by the presence of the heart.

50The correct answer is E. Pemphigus vulgaris is associated with chronic, severe bullae formation on the skin and oral mucosa. Mucosal lesions are extremely rare in bullous pemphigoid. This can be used clinically to guide therapy, although a skin biopsy should be taken to confirm the diagnosis. Both diseases are characterized by formation of tender bullae that can rupture, leaving red, raw areas. Pemphigus vulgaris patients eventually become febrile and lose weight, and if untreated, most will die within one year. Bullous pemphigoid lesions tend to heal and the patients do very well. This prognostic difference is an important distinction in dermatologic medicine. Eosinophils within blisters (choice A) provide an important clue supporting bullous pemphigoid as the diagnosis which must be ascertained with histologic examination. The vesicles in pemphigus vulgaris mostly contain rounded acantholytic keratinocytes "floating" within. IgA deposits seen with immunofluorescence on the basement membrane (choice B) is characteristic of a third bullae-forming disease known as dermatitis herpetiformis. Vesicles form between the dermal-epidermal junction. The disease is associated with gluten sensitivity and celiac disease. IgG autoantibody activity (choice C) is common to both pemphigus vulgaris and bullous pemphigoid. Nikolsky's sign consists of separation of the epidermis upon manual stroking of the skin. Bullous pemphigoid is characterized by a negative Nikolsky's sign (choice D), but Nikolsky's sign is positive in pemphigus vulgaris due to the IgG-mediated destruction of intercellular bridges between keratinocytes.

(16) <1>A 15-year-old boy presents to his pediatrician complaining of headaches. Physical examination is remarkable for paralysis of upward gaze, bilateral papilledema, and pupils that react to accommodation, but not to light. The physician orders a CT scan of the head, which demonstrates a pineal tumor. Damage to which of the following structures probably accounts for the patient's upward gaze defect? A. Mamillary body B. Optic chiasm C. Pons D. Superior cerebellar peduncle E. Superior colliculus

Answer

<2>A patient presents with a blood pressure of 165/95 mm Hg, and complaints of tiredness and muscle weakness. A blood workup reveals that plasma sodium is slightly increased and plasma potassium is significantly decreased compared to normal. Hematocrit is also low. Plasma renin activity is markedly decreased, and serum aldosterone is increased. Which of the following is the most likely diagnosis? A. Addison's disease B. Conn's syndrome C. Cushing's syndrome D. 21-Hydroxylase deficiency E. Pheochromocytoma Answer

<3>A 52-year-old Caucasian male presents with sinus pain and drainage, bloody nasal discharge, and nasal mucosal ulceration. On laboratory examination, the man is found to have proteinuria, hematuria, and red blood cell casts. A biopsy of the upper airway tissue reveals granulomatous inflammation with necrosis. Renal biopsy confirms the existence of glomerulonephritis. Blood tests show the presence of antineutrophil cytoplasmic antibodies (c-ANCA). What is the most likely diagnosis? A. Allergic angiitis B. Goodpasture's syndrome C. Non-infectious granulomatous disease D. Tumors of the upper airway E. Wegener's granulomatosis Answer

<4>Which of the following events occurs first in the differentiation sequence of human B cells in the bone marrow? A. Cytoplasmic mu chains present in the B cell B. Immunoglobulin heavy chain rearrangement C. Immunoglobulin light chain rearrangement D. Surface IgD and IgM present on the B cell E. Surface IgM present on the B cell Answer

<5>Following an upper respiratory infection, a 7-year-old child develops

multiple petechial hemorrhages over her entire body. Her mother takes her to the physician, who does a complete blood count, revealing marked thrombocytopenia. Which of the following diagnoses is most appropriate for this individual? A. Bernard-Soulier syndrome B. Idiopathic thrombocytopenic purpura C. Thrombasthenia D. Thrombotic thrombocytopenic purpura E. Von Willebrand's disease Answer

<6>A 54-year-old man with a history of glomerulonephritis is diagnosed with renal failure. The man subsequently complains of heartburn and nausea, and states that he has been vomiting each morning for the last few days. Which of the following forms of gastritis would most likely be found in this patient? A. Acute gastritis B. Chronic antral gastritis C. Chronic fundal gastritis D. Hypertrophic gastritis E. Lymphocytic gastritis Answer

<7>A 10-year-old child with new onset of visual field abnormalities and diabetes insipidus undergoes a head CT. The CT scan demonstrates a 3 cm mass lesion with focal calcification involving the area above the sella turcica. Needle biopsy of this mass shows that the tumor is composed of tissue resembling tooth enamel. Which of the following diagnoses is most likely? A. Craniopharyngioma B. Glioblastoma multiforme C. Large pituitary adenoma D. Medulloblastoma E. Pituitary microadenoma Answer

<8>A 28-year-old pregnant woman develops a flu-like illness with fever, headache, myalgia, and back pain. As a complication of the illness, she has a spontaneous abortion. Examination of the abortus demonstrates severe amnionitis. Which of the following organisms would most likely be isolated from the placental membranes? A. Borrelia burgdorferi B. Leptospira interrogans

C. D. E. Answer

Listeria monocytogenes Spirillium minus Streptobacillus moniliformis

<9>A 14-year old girl visits her pediatrician because of primary amenorrhea. Breast development occurred as expected at puberty, but axillary and pubic hair is still fine and unpigmented. She is 5' 5" tall and weighs 105 lb. Pelvic examination reveals a shortened vagina with no discernible cervix or uterus. Serum LH concentration is markedly increased compared to normal. Which of the following is the most likely cause of the amenorrhea? A. 17-alpha-hydroxylase deficiency B. Complete androgen resistance C. Constitutional delay in the onset of menses D. Hyperprolactinemia E. Turner's syndrome Answer

<10>A 50-year-old man undergoes biopsy of a reddish scaly plaque on the skin of his thigh. The biopsy is diagnosed as mycosis fungoides. Which of the following was seen on the biopsy? A. Keratinocytes with cytoplasmic inclusions B. Malignant-appearing lymphocytes C. Nits D. Septate hyphae E. Vascular proliferation Answer

<11>A four-month-old child develops cardiac failure and dies three months later. At autopsy, the heart has no obvious congenital defects, but the cardiac chambers are small and covered with thick, white endocardium. Histological sections of the heart demonstrate regular bands of elastic tissue in the thick fibrous endocardium. Which of the following is the most likely diagnosis? A. Coxsackievirus myocarditis B. Cardiac amyloidosis C. Endocardial fibroelastosis D. Idiopathic subaortic stenosis E. Loeffler's endocarditis Answer

<12>A 45-year-old man presents to his physician with acute onset of muscle spasms in his lower back. The physician prescribes cyclobenzaprine. The side effects of this drug are most similar to those of which of the following drugs? A. Amitriptyline B. Dantrolene C. Doxycycline D. Ibuprofen E. Lorazepam Answer

<13>A gastric biopsy is taken from a 42-year-old man. As the pathologist inspects the specimen, he observes numerous, normal cuboidal-to-columna r cells with apical membrane-bound secretion granules in the gastric glands. From which area of the stomach was the biopsy most likely taken? A. Cardiac region B. Columns of Morgagni C. Fundic region D. Greater omentum E. Pyloric region Answer

<14>A 35-year-old sexually active male presents to his internist with a painless penile vesicle. Physical exam reveals inguinal lymphadenopathy. The infecting organism is definitively diagnosed and is known to exist in distinct extracellular and intracellular forms. Which of the following is the most likely pathogen? A. Calymmatobacterium granulomatis B. Chlamydia trachomatis C. Haemophilus ducreyi D. Neisseria gonorrhoeae E. Treponema pallidum Answer

<15>A patient with a history of pheochromocytoma develops a neck mass . Resection of the neck mass demonstrates a multifocal tumor with hemorrhage, necrosis, and spread outside the thyroid capsule. The tumor is composed of polygonal cells in nests. Amyloid deposits are seen in the intervening fibrovascular stroma. The polygonal cells would most likely secrete which of the following? A. Calcitonin

B. C. D. E. Answer

Parathyroid hormone TSH T3 T4

<16>A cardiovascular physiologist performs an experiment on an animal subject to study heart rate and blood pressure changes with nerve stimulation. He selectively stimulates the afferent portions of the glossopharyngeal and vagus nerves. Which of the following outcomes would most likely occur after this manipulation? A. Bradycardia with hypertension B. Bradycardia with hypotension C. Sinus arrhythmia with hypotension D. Tachycardia with hypertension E. Tachycardia with hypotension Answer

<17>Transcription of a prokaryotic gene by RNA polymerase yields an mRNA corresponding to a single polypeptide chain containing 64 amino acids. The mRNA has a 5' untranslated region of 120 nucleotides and a 3' untranslated region of 240 nucleotides. Approximately how many nucleotides are in the coding region of the mRNA? A. 64 B. 128 C. 192 D. 424 E. 552 Answer

<18>An electrophysiologist is performing intracellular recordings on neuronal cells in culture. He is trying to identify a drug that would reliably increase the firing rate in the cultured cells. Assuming the cells in question express all of the following receptor types, an agonist at which of the following receptors would most likely produce an increase in firing rate? A. Alpha-2 adrenergic B. Beta-1 adrenergic C. Gamma-aminobutyric acid D. Glycine E. N-methyl-D-aspartate Answer

<19>A 16-year-old boy presents to the emergency room after suffering a generalized tonic-clonic seizure. He is presently restless and irritable, and complains of nausea and headache. A careful history reveals that he had been experimenting with cocaine earlier that day. Physical examination is remarkable for a heart rate of 130 and blood pressure of 150/95. Which of the following mechanisms is most likely responsible for the cocaine-induced hypertension? A. Blocking norepinephrine reuptake B. Directly stimulating alpha-1 receptors C. Directly stimulating beta-1 receptors D. Directly stimulating beta-2 receptors E. Inducing norepinephrine release F. Metabolism to a false neurotransmitter Answer

<20>A patient with normal lungs overdoses on a secobarbital, causing hypoventilation. The patient arrives at a hospital where the barometric pressure = 500 mmHg. Alveolar PCO2 rises to 80 mmHg and the respiratory exchange ratio is 1.0. Assuming that the patient's condition remains unchanged, what percentage of inspired O2 will return the patient's alveolar PO2 to normal (100 mmHg)? A. 55 B. 40 C. 36 D. 28 E. 24 Answer

<21>Examination of a skin lesion demonstrates very abnormal squamous cells with a high nuclear/cytoplasmic ratio and clumped chromatin. These cells form nests within the epidermis that extend to the superficial surface of the epithelium. In some places, nests of these cells have central areas of abnormal keratin formation. The basement membrane is intact and no nests of cells are seen in the dermis. Which of the following terms best describes this lesion? A. Carcinoma in situ B. Dysplasia C. Invasive carcinoma D. Metaplasia E. Metastatic carcinoma Answer

<22>A 74-year-old male has been unsuccessful in passing urine today, but was able to pass urine normally for the previous two days. Physical examination is remarkable for a blood pressure of 175/90 mm Hg. Laboratory examination reveals a serum creatinine of 4.5 and a blood urea nitrogen of 115 mg/dL. Urinalysis reveals a specific gravity of 1.01 mg/dL, and an occasional white blood cell per high-powered field. Which of the following could be used to ameliorate the patient's symptoms? A. Benazepril B. Doxazosin C. Furosemide D. Hyoscyamine E. Phenazopyridine Answer

<23>A 45-year-old male complains of gradual weight gain over the past several years. His fingers have enlarged so much that he can no longer wear his wedding ring. He sweats more than usual, and in particular, his hands are constantly sweaty. He has also noticed a gradual coarsening of his facial features. An MRI reveals the presence of a 1.5-cm tumor in the anterior pituitary. Which of the following endocrine abnormalities is likely to be present? A. Decreased plasma growth hormone concentration B. Decreased plasma IGF-1 concentration C. Decreased plasma insulin concentration D. Impaired glucose tolerance E. Increased suppression of growth hormone secretion with oral glucose Answer

<24>A pharmaceutical researcher is examining the ulcerogenic potential of a new nonsteroidal anti-inflammatory drug. He gives 20 rats a single subcutaneous injection of the drug every day for one week, and gives a similarly matched group of 20 animals daily saline injections for one week. 24 hours after the final injection, the investigator sacrifices the rats, removes their stomachs , and examines them to determine if any ulcers were produced. He obtains the following data: Ulcers present Ulcers absent Drug 12 8 No Drug 8 12 Which of the following tests would be most appropriate for determining if administration of the drug increased the incidence of stomach ulcers?

A. B. C. D. E. Answer

Analysis of variance (ANOVA) Chi-squared test Linear regression Paired t-test Pearson correlation coefficient

<25>A 61-year-old man with a long history of cigarette smoking is diagnosed with oral squamous cell carcinoma. Following surgical dissection of lymph nodes in the right side of his neck, the man can no longer raise his right arm above the horizontal position. The patient also cannot shrug the right shoulder. Which of the following nerves was injured? A. Axillary nerve B. Great auricular nerve C. Greater occipital nerve D. Spinal accessory nerve E. Transverse cervical nerve Answer

<26>A 55-year-old hypertensive man develops sudden onset of excruciating pain beginning in the anterior chest, and then radiating to the back. Over the next 2 hours, the pain moves downward toward the abdomen. Which of the following is the most probable diagnosis? A. Aortic dissection B. Aortic valve stenosis C. Atherosclerotic aneurysm D. Myocardial infarction E. Syphilitic aneurysm Answer

<27>A child has been experiencing intermittent, short episodes of hematuria beginning shortly after a transient gastrointestinal infection. Which of the following renal biopsy findings would best establish the diagnosis of Berger's disease? A. Crescent formation B. Foot process effacement C. Mesangial IgA deposits D. Subepithelial humps E. Tram tracking Answer

<28>Over a one month period, a 35-year-old man develops symptoms of hyperthyroidism with tachycardia and heat intolerance. Thyroid biopsy demonstrates a heavy mononuclear cell infiltrate with multinucleated giant cells, follicular disruption, and loss of colloid. About one month later, the patient develops symptoms of hypothyroidism. To which of the following is this patient's condition thought to be most closely related? A. Blocking TSH receptor autoantibodies B. Carcinoma C. Lymphoma D. Stimulating TSH receptor autoantibodies E. Viral infection Answer

<29>Two diabetic patients are seen by a clinician. The first patient is a 16-year-old boy who 2 years previously had presented with polyuria and polydipsia. The second patient is a 65year-old woman whose diabetes was identified by the presence of hyperglycemia on a routine blood glucose screen 10 years previously. Compared to the 65-year-old patient with diabetes, the 16-year-old diabetic is more likely to A. be obese B. become euglycemic with oral hypoglycemic agents C. develop ketoacidosis D. have relatively high endogenous insulin levels E. not have the HLA-DR3 or HLA-DR4 allele Answer

<30>A 22-year-old woman presents with a 1-week history of mild lower abdominal pain and a yellowish vaginal discharge. She describes the pain as dull in nature, relieved slightly by acetaminophen and worsened by intercourse. Pelvic examination reveals a red, swollen cervix without motion tenderness. The mucosa is friable. Potassium hydroxide (KOH) mount is negative, and wet mount does not reveal clue cells. Gram's stain of the exudate reveals gram-negative cocci . Which of the following procedures would most likely lead to the correct diagnosis? A. Culture the blood on Thayer-Martin agar B. Order DNA probe assays of endocervical exudates C. Order serologic tests to identify specific capsular antigens D. Order the germ tube test E. Order the rapid plasma reagin (RPR) test Answer

<31>A patient's abdomen becomes distended with loculated masses of semi-translucent mucinous material produced by a mucinous cystadenoma. Which of the following are the most likely sites for the primary tumor? A. Colon or spleen B. Liver or pancreas C. Lung or bladder D. Ovary or appendix E. Prostate or gall bladder Answer

<32>A 77-year-old black male is recovering in a rehabilitation center 10 days after having sustained a massive anterolateral infarction of the left ventricle. He suddenly develops paralysis of the entire right half of the body, including facial and eye muscles. Which of the following complications of myocardial infarction is most likely to have precipitated this event? A. Calcific coronary atherosclerosis B. Electromechanical dissociation C. Left bundle branch block D. Myocardial rupture E. Ventricular mural thrombus Answer

<33>An infant is born with a large port-wine nevus on the face. If this infant has one of the phacomatoses, which of the following would most likely also be present? A. Acoustic neuromas B. Cerebellar hemangioblastomas C. Leptomeningeal angiomatosis D. Neurofibromas E. Subependymal tubers Answer

<34>A 55-year-old man returns from a vacation to the beach. While on vacation, he and his family consumed several meals consisting primarily of seafood, including lobster and raw oysters. Although the other members of his family did not get sick, he developed a bullous rash over his lower extremities, hypotension, and confusion. His past medical history is significant for liver disease and alcoholism. The most likely cause of this man's signs and symptoms is A. Aspergillus fumigatus

B. C. D. E. Answer

Campylobacter jejuni Candida albicans Streptococcus (Group A) Vibrio vulnificus

<35>Uncontrollable bleeding from the umbilical stump of a neonate specifically suggests deficiency of which of the following coagulation factors? A. Factor VIII B. Factor IX C. Factor XII D. Factor XIII E. Von Willebrand's factor Answer

<36>A 62-year-old man with well-controlled Parkinson's disease and type 2 diabetes presents with akinesia, a festinating gait, rigidity, and loss of postural reflexes. The patient states that his symptoms began shortly after starting a new "stomach" medication. On the basis of this information, the patient is most likely receiving A. cisapride B. metoclopramide C. nizatidine D. omeprazole E. sucralfate Answer

<37>which of the following tissues normally has the highest percentage of mucus-secreting cells? A. Esophageal mucosa B. Oral mucosa C. Parotid gland D. Sublingual gland E. Submandibular gland Answer

<38>A 57-year-old woman has severe arteriosclerosis that decreases the luminal diameter of her right renal artery by about 50%. Which of the following is most likely increased in this patient? A. Afferent arteriolar resistance

B. C. D. E. Answer

Glomerular filtration rate Glomerular hydrostatic pressure Interlobar artery pressure Secretion of renin

<39>Following a fall on a basketball court, a 20-year-old man develops a swollen and painful upper arm. Over the next several weeks, the involved area becomes more circumscribed and firm, and then later evolves to a painless, hard, well-demarcated mass. X-ray of the arm at this point would most likely demonstrate which of the following? A. Benign-appearing bony outgrowths from the humerus B. Dislocation of the shoulder C. Flocculent radiodensities surrounding a radiolucent center D. Healing fracture E. Malignant-appearing bony outgrowths from the humerus Answer

<40>Brunner's glands secrete an alkaline product that helps achieve optimal pH for the activity of pancreatic enzymes. Where are these glands located? A. At the base of villi throughout the small intestine B. In the epithelium of the ampulla of Vater C. In the mucosa and submucosa of the jejunum D. In the submucosa of the duodenum E. In the submucosa of the ileum Answer

<41>Following a fracture of the humerus, an adult patient has a biopsy of the healing area. Which of the following types of bone will the biopsy most likely show? A. Cancellous B. Compact C. Spongy D. Trabecular E. Woven Answer

<42>A 30-year-old female with a 15-year history of asthma presents to the emergency room with left elbow pain. Physical examination reveals tenderness and swelling over the olecranon process. An x-ray of the left arm reveals a fracture. Her medications include oral

prednisone and albuterol aerosol. By which of the following mechanisms might corticosteroids have contributed to her fracture? A. Decreased osteoblastic bone formation only B. Decreased osteoblastic bone formation and osteoclastic bone resorption C. Increased osteoclastic bone resorption only D. Increased osteoclastic bone resorption and decreased osteoblastic bone formation E. Increased osteoclastic bone resorption and osteoblastic bone formation Answer

<43>A medical student volunteers to have his lung volumes and capacities measured for his organ physiology laboratory class. He is connected to a spirometer containing a known concentration of helium. He is instructed to breathe several times until the helium has equilibrated between the spirometer and his lungs. He is then instructed to exhale as much air as he possibly can. Calculations are made to determine the amount of air remaining in his lungs. This quantity is known as the A. expiratory reserve volume B. functional residual capacity C. inspiratory capacity D. inspiratory reserve volume E. residual volume F. tidal volume G. vital capacity Answer

<44>A 42-year-old woman is noted to have mildly elevated creatinine and blood urea nitrogen on routine physical exam. She recalls that her father also had kidney trouble and died in kidney failure. Workup reveals persistent azotemia and microscopic hematuria without evidence of urinary tract infection. An ultrasound of the kidneys identifies bilaterally enlarged and multicystic kidneys. In addition to chronic renal failure, the clinician should also be concerned about her risk of A. liver failure B. pancreatic insufficiency C. portal hypertension D. renal cell carcinoma E. subarachnoid hemorrhage Answer

<45>While rescuing a child from a burning home, a firefighter was burned over 60% of his body . He is rushed to the emergency room and quickly

taken into surgery. During the surgery, the anesthesiologist notices tall, peaked T waves and prolongation of the PR interval, accompanied by progressive widening of the QRS complex so that it appears to merge with the T waves. The patient goes into ventricular fibrillation, then asystole, and cannot be resuscitated. Which of the following agents is most likely responsible for this patient's electrocardiographic changes? A. Atracurium B. Baclofen C. Cyclobenzaprine D. Succinylcholine E. Tubocurarine Answer

<46>A 70-year-old man presents with severe acute abdominal pain . Physical examination reveals tenderness with guarding localized to the left lower quadrant. A complete blood count with differential shows a white count of 18,000/mm3 with increased neutrophil band forms. Paracentesis demonstrates mixed flora bacteria with many neutrophils in the peritoneal fluid. Which of the following is the most probable source of the infection? A. Bladder infection B. Colonic diverticulum C. Prostatic inflammation D. Ruptured appendix E. Ureteral stone Answer

<47>A 78-year-old woman has multiple long-standing lesions on her face and back. These well-circumscribed lesions are tan to brownish, slightly raised with a rough surface, and typically 0.5 to 1.5 cm in diameter. The clinician examining the patient is able to "peel away" parts of the lesion with the dull side of a scalpel blade. Which of the following diagnoses is most likely? A. Eczema B. Melanoma C. Psoriasis D. Seborrheic keratoses E. Verruca vulgaris <48>A patient is referred to a neurologist because of ataxia. The neurologist diagnoses degeneration of the dorsal columns and dorsal roots of the spinal cord, which has caused impaired proprioception and locomotor ataxia. Which of the following organisms most likely caused this pattern of damage? A. Haemophilus influenzae

B. C. D. E. Answer

Herpes simplex I Neisseria gonorrhoeae Neisseria meningitidis Treponema pallidum

<49>A term neonate is born after a long, difficult delivery. The baby has an APGAR score of 3, so arterial blood is drawn for blood gas studies 3 minutes after delivery. Arterial blood gas studies show a PO2 of 10 mm Hg, PCO2 of 27 mm Hg, and pH of 7.09. Which of the following is the best interpretation of these studies? A. Markedly decreased PCO2, suggesting hyperventilation B. Markedly decreased pH, suggesting acidosis C. Markedly decreased PO2, suggesting respiratory failure D. Markedly increased pH, suggesting alkalosis E. Within normal limits Answer

<50>A patient consults a physician because of a small lesion on the lips that, on biopsy, proves to be a mucosal neuroma. The patient's mother had medullary carcinoma of the thyroid. In addition to medullary carcinoma of the thyroid, to which of the following conditions would this patient be particularly vulnerable? A. Gastrinoma B. Insulinoma C. Parathyroid adenoma D. Pheochromocytoma E. Pituitary adenoma Answer

Answers

1The correct answer is E. The clinical syndrome is Parinaud's syndrome, caused in this case by a pineal tumor that is compressing the superior colliculi and pretectal area of the dorsal midbrain, the region that contains the vertical gaze center. Pineal tumors also can cause compression of the cerebral aqueduct, resulting in a noncommunicating hydrocephalus. This has likely already occurred in this patient, as evidenced by the bilateral papilledema. The mamillary bodies (choice A) are located on the ventral surface of the diencephalon. By contrast, the pineal body is a dorsal outpouching of the diencephalon near the midbrain tectum.

Compression of the optic chiasm (choice B) generally results from a pituitary tumor, resulting in a bitemporal hemianopia. The pineal body is at the level of the midbrain. The pons (choice C) is too far caudal to be affected by a pineal tumor. The superior cerebellar peduncle (choice D) primarily contains efferent projections from the cerebellum. Damage to this peduncle would result in cerebellar signs (e.g., intention tremor, dysmetria). 2The correct answer is B. Conn's syndrome, or primary hyperaldosteronism, results from an adrenal tumor that secretes excessive aldosterone. The increased mineralocorticoid effects of aldosterone lead to renal sodium and water retention (which explains the hypertension) and increased renal potassium excretion (hypokalemia). The volume expansion also explains the decrease in hematocrit. The increased blood volume, increased blood pressure, and hypernatremia will all tend to suppress renin secretion in an attempt to compensate for the increased aldosterone. Addison's disease (choice A), or primary adrenal insufficiency, is characterized by low plasma concentration of aldosterone, hyponatremia, hypotension, and hyperkalemia. In Cushing's syndrome (choice C), blood pressure may be increased because of crossover mineralocorticoid activity of the increased plasma cortisol. Furthermore, cortisol makes blood vessels more responsive to catecholamines, which could increase peripheral resistance. The combination of increased blood pressure and hypokalemia would, if anything, tend to suppress secretion of aldosterone. 21-Hydroxylase deficiency (choice D) is likely to produce hypotension. In the salt-wasting variant of this disorder, the plasma concentration of aldosterone is decreased and hyponatremia and hyperkalemia result. Pheochromocytoma (choice E) is another endocrine cause of hypertension. The increased plasma concentration of catecholamines can cause increased cardiac output and increased peripheral resistance. Plasma renin activity may be increased because of increased beta receptor activation on juxtaglomerular cells. This could produce increased aldosterone secretion and subsequent salt retention. 3The correct answer is E. Antineutrophil cytoplasmic antibodies yielding a cytoplasmic immunofluorescence pattern (c-ANCA) are found in over 90% of patients with Wegener's granulomatosis. The classic clinicopathologic complex of Wegener's granulomatosis usually provides ready differentiation from other disorders in which c-ANCA is positive. c-ANCA is not considered pathognomonic, but has a very strong association with Wegener's and is not found in any of the other diseases listed. c-ANCA is generally negative in patients with allergic angiitis (choice A), non-infectious granulomatous disease (choice C), and tumors of the upper airway (choice D). c-ANCA is typically negative in Goodpasture's syndrome (choice B), but p-ANCA have been detected in some patients with Goodpasture's syndrome. 4The correct answer is B. The first event that occurs in the pre-B cell (progenitor) is the gene rearrangement of the heavy chain. The D gene and J gene recombination event occurs first, followed by V recombination with the D-J region. The cytoplasmic mu chains (choice A) are the result of immunoglobulin heavy chain rearrangement, the production of the messenger RNA from this rearrangement, and the ribosomal synthesis of the protein mu chain. This is the second event that occurs in the B-cell maturational sequence. Light chain rearrangement (choice C) occurs when recombination events occur with the V gene and J gene from the light chain germ line. After this recombination has occurred, and

the messenger RNA for this germ line has produced the light chain protein, the light chains and heavy chains form. The complete IgM molecule and IgD molecules (choice D) are present on the surface of only the mature B cells. This event is the last event to occur during the differentiation and development of B cells in the bone marrow. The complete IgM molecule (choice E) is present on the surface of the immature B cell. This event is one of the last events to occur in the differentiation and development of B cells. 5The correct answer is B. The process described is commonly called acute idiopathic thrombocytopenic purpura (ITP), even though the autoimmune basis has been clearly established (some authors use "immune thrombocytopenic purpura," so that the initials still work). The thrombocytopenia in this disorder appears to be secondary to splenic destruction of opsonized platelets, and usually follows a viral upper respiratory tract infection or exanthem. The acute form of ITP is usually explosive, but self-limited; a chronic form in adults may respond to steroid therapy or splenectomy. In Bernard-Soulier syndrome (choice A), platelets are unable to adhere to collagen. Thrombasthenia (choice C), is associated with a functional defect in platelets (they do not aggregate). In thrombotic thrombocytopenic purpura (choice D), platelets are consumed in intravascular platelet microthrombi. In von Willebrand's disease (choice E), deficient von Willebrand factor produces platelet dysfunction, but thrombocytopenia is not prominent. 6The correct answer is A. Acute gastritis, characterized by patches of erythematous mucosa, sometimes with petechiae and ulceration, can be seen as a complication of a variety of other conditions (alcohol use, aspirin and other NSAIDs use, smoking, shock, steroid use, and uremia), which usually have in common disruption of the mucosal barrier of the stomach. Chronic antral (type B) gastritis (choice B) is associated with Helicobacter pylori. Chronic fundal (type A) gastritis (choice C) is the type associated with pernicious anemia. Hypertrophic gastritis (Menetrier's disease; choice D) is an idiopathic condition characterized by markedly enlarged mucosal folds. Lymphocytic gastritis (choice E) is thought to be a gastric manifestation of celiac sprue. 7The correct answer is A. The tumor is a craniopharyngioma, alternatively known as an adamantinoma or ameloblastoma. Craniopharyngiomas may arise in, or more commonly above, the sella turcica. The histological pattern recapitulates the enamel organ of the tooth, with nests or cords of stratified squamous or columnar epithelium embedded in a loose fibrous stroma. Calcification (and even metaplastic bone formation) is common in these benign tumors, which are thought to arise from vestigial remnants of Rathke's pouch. Glioblastoma multiforme (choice B) characteristically shows at least some enlarged cells with bizarre nuclei. Large pituitary adenomas (choice C) contain nests of uniform glandular cells. Medulloblastoma (choice D) is made of small basophilic cells with relatively large nuclei for their size. Pituitary microadenomas (choice E) contain nests of uniform glandular cells.

8The correct answer is C. Spontaneous abortion is a problem associated with Listeriosis, caused by Listeria monocytogenes. The pattern of abortions was first recognized in herd animals, notably sheep and cattle, and then listeriosis was later implicated as a cause of spontaneous abortion in pregnant women. Listeriosis can occur in either epidemic (foodborne or hospital-acquired) forms or may be sporadic (noticed in animal or animal product

handlers). Soft cheeses like Brie are a particularly common source of food-borne listeriosis. The disease may range in severity from asymptomatic carrier cases, to flu-like illness, to spontaneous abortion or neonatal death, to fatal illness in children or adults secondary to septicemia or meningoencephalitis. Other localized infections can also occur, primarily in the immunosuppressed. The treatment of choice is intravenous administration of ampicillin or penicillin, often in combination with an aminoglycoside. Trimethoprim-sulfamethoxazole has been used successfully in patients with penicillin allergy. Borrelia burgdorferi (choice A) causes Lyme disease. Leptospira interrogans (choice B) causes leptospirosis. Spirillium minus (choice D) is a cause of rat-bite fever. Streptobacillus moniliformis (choice E) is a cause of rat-bite fever.

9The correct answer is B. This individual has an XY karyotype and testes (probably abdominal), but because of complete androgen resistance, developed a female phenotype in utero. In the absence of androgen receptors, the indifferent external genital slit will differentiate into a vagina with clitoris and labia. However, the vagina will end as a blind sac because Müllerian regression factor secreted by the testes will prevent the formation of a uterus or uterine tubes. The Wolffian ducts will also degenerate in the absence of androgen receptors. At puberty, the testes will respond to the increased LH by increasing testosterone secretion. Masculinization is not possible because of the absence of androgen receptors, however, significant gonadal or peripheral aromatization of testosterone to estrogen will produce breast enlargement and other female secondary sex characteristics. LH will remain high because of the absence of negative feedback by the testosterone. Pubic and axillary hair development, which is also androgen-driven, will not occur. Females with 17-alpha-hydroxylase deficiency (choice A) are born with normal female internal reproductive tract and external genitalia. This is because the "default" program is for the female phenotype to develop in utero. With 17-alpha-hydroxylase deficiency, sex steroids (estrogen in the case of females) cannot be synthesized and secreted. Affected females will not mature sexually at puberty, but will remain infantile. Since the patient described above exhibited breast development, 17-alpha-hydroxylase deficiency is unlikely. Furthermore, the absence of uterus or uterine tubes is not consistent with 17-alpha-hydroxylase deficiency. Constitutional delay in onset of menses (choice C) may occur in certain families. It is thought to be due to slow maturation of the hypothalamic-pituitary-gonadal axis. However, growth velocity and development of breasts and pubic hair usually occurs normally. A uterus and uterine tubes would be present since there is no disorder in embryologic development. Hyperprolactinemia (choice D) can suppress the hypothalamic-pituitary-gonadal axis and produce amenorrhea, however, it cannot explain the absence of pubic and axillary hair or the absence of a uterus and uterine tubes. Turner's syndrome (choice E) occurs in females with the XO genotype. They are typically short in stature, rarely reaching 5 feet. The germinal tissue in the ovaries is replaced with fibrous streaks. The internal reproductive tract is normal. Estrogen secretion is diminished (primary ovarian disorder) which leads to an increase in LH and FSH. The height of the above patient makes Turner's syndrome unlikely. Furthermore, Turner's syndrome could not explain the absence of a uterus and uterine tubes. 10The correct answer is B. Mycosis fungoides (despite its deceivingly fungal name) is a cutaneous T cell lymphoma in which the malignant lymphocytes show trophism for the epidermis. The malignant T cells densely infiltrate the superficial dermis and epidermis, producing the typical plaques and nodules.

Intracellular inclusions are seen in viral infections, and cytoplasmic inclusions in the epidermal cells (choice A) are pathognomonic for molluscum contagiosum, a poxvirus that produces wart-like skin lesions. Nits (choice C) are the egg cases of lice. Nits, or the lice themselves, can be seen attached to the hair shafts of people with pediculosis. Hyphae and yeasts (choice D) are the hallmarks of superficial fungal infections. The tinea infections are caused by dermatophytic fungi, and can usually be appreciated in PAS stains of skin biopsies. Vascular proliferation (choice E) is the characteristic finding in hemangiomas, Kaposi's sarcoma, and bacillary angiomatosis. 11The correct answer is C. This disease is endocardial fibroelastosis, which is suspected of being related to intrauterine virus infection, possibly with mumps virus. The endocardium thickens secondary to a marked increase in fibrous and elastic tissue, which may extend into the ventricle. The left ventricle is most commonly involved, but other chambers may also be affected. A variety of other findings may also be present, including mural thrombi, flattened trabeculae, and abnormal (usually stenosed) valves. The disease occurs in infantile and adolescent forms. Coxsackie virus myocarditis (choice A) would produce a flabby myocardium, patchy areas of hemorrhage, and four chamber dilatation. In cardiac amyloidosis (choice B), extracellular amyloid deposits would be seen in histological sections. Idiopathic subaortic stenosis (choice D) produces a hypertrophic cardiomyopathy. Loeffler's endocarditis (choice E) is characterized by a prominent eosinophilic infiltrate with no increase in elastic tissue. 12The correct answer is A. Cyclobenzaprine is a centrally acting skeletal muscle relaxant that is structurally and pharmacologically related to tricyclic antidepressants (eg, amitriptyline). It is used short-term as an adjunct to rest and physical therapy for relief of muscle spasm associated with acute musculoskeletal conditions. Like tricyclic antidepressants, the most common side effects are dry mouth, drowsiness, dizziness, weakness, fatigue, tachycardia, urinary retention, and abdominal cramping. Dantrolene (choice B) is also a centrally acting skeletal muscle relaxant; however, it is structurally and pharmacologically related to hydantoin derivatives, such as phenytoin. Although dantrolene produces the same CNS effects as cyclobenzaprine, it does not produce anticholinergic side effects, such as dry mouth and urinary retention. Doxycycline (choice C) is an antibiotic used primarily in the treatment of various sexually transmitted diseases and acne. Its major side effects include diarrhea, gastrointestinal upset, and phototoxicity. Ibuprofen (choice D) is a nonsteroidal anti-inflammatory drug used in the treatment of mildto-moderate pain caused by inflammation; its most common side effects are intestinal discomfort and dizziness. Lorazepam (choice E) is a benzodiazepine used in the management of anxiety disorders and for the short-term relief of anxiety. Side effects include drowsiness, sedation, dizziness, and weakness. 13The correct answer is C. The pathologist saw normal chief cells, which are abundant in the body and fundus of the stomach. Chief cells secrete pepsinogen, which is stored in apical membrane-bound granules. The body and fundus of the stomach contain high concentrations of four other types of cells in the epithelium. The parietal (oxyntic) cells are large, pyramidal, and acidophilic with central nuclei (look like a "fried egg"). They make and secrete HCl. The mucous neck cells secrete mucus and appear clear. The enteroendocrine cells have affinity for

silver stains and exhibit a positive chromaffin reaction; these cells synthesize amines, polypeptides, or proteins. The cardiac region (choice A) is a narrow, circular band at the transition between the esophagus and stomach, consisting of shallow gastric pits and mucous glands. It does not normally contain an abundance of chief cells. The columns of Morgagni (choice B) are found in the rectum, not in the stomach. These are mucous membrane infoldings in the submucosa of the proximal anal canal. They would not contain chief cells. The greater omentum (choice D) is a four-layered fold of peritoneum that hangs from the greater curvature of the stomach and attaches to the transverse colon. It would not contain chief cells. The pyloric region (choice E) has deep gastric pits into which tubular glands open. The predominant secretion is mucus. It does not normally contain an abundance of chief cells. Note that in this question you could have automatically eliminated choices B and D, since they are not gastric structures. If nothing else, you would have improved your guessing odds to 33%. 14The correct answer is B. This patient has lymphogranuloma venereum caused by Chlamydia trachomatis (type L1, 2, or 3). Chlamydia exhibit distinct infectious and reproductive forms. The extracellular infectious form is known as the elementary body (EB), which is incapable of reproduction. It attaches to the host cell and enters through endocytosis. Once inside the cell, the EB is transformed into the reticulate body (RB) within the endosome. The RB is capable of binary fission and divides within the endosome; fusion with other endosomes occurs to form a single large inclusion. Eventually, the RBs undergo DNA condensation and disulfide bond bridgings of the major outer membrane protein, forming EBs. The EBs are then released. Note that C. trachomatis is responsible for several sexually or perinatally transmitted diseases, including ocular trachoma (types A, B, and C), neonatal conjunctivitis, nongonococcal urethritis, cervicitis, and pelvic inflammatory disease (types DK). Calymmatobacterium granulomatis (choice A) is a gram-negative rod that causes superficially ulcerated genital or inguinal papules that coalesce to form substantial lesions. The appearance of Donovan bodies in histiocytes is diagnostic of this infection. Haemophilus ducreyi (choice C) is a gram-negative rod that causes a soft, painful penile chancre, unlike that of a chlamydial or syphilitic lesion. This infection is common in the tropics. Neisseria gonorrhoeae (choice D) is a gram-negative diplococcus responsible for gonorrhea. Patients typically present with purulent penile discharge, not genital lesions. Treponema pallidum (choice E) is the spirochete responsible for syphilis. It may cause a firm, painless ulcer as a manifestation of primary syphilis, but the organism does not exist in distinct extracellular and intracellular forms as does Chlamydia. Secondary syphilis is associated with the appearance of condyloma lata-flat, gray, wart-like lesions. 15The correct answer is A. The tumor is medullary carcinoma of the thyroid, which can occur sporadically or as part of multiple endocrine neoplasia (MEN), types IIa and IIb. The history of pheochromocytoma and the multifocality of this tumor suggest that this is one of the MEN-type tumors. Other facts to know about medullary carcinoma of the thyroid include the local production of amyloid (formed in this case from precipitated calcitonin), the secretion of calcitonin (and also other biologically active substances), and the link to a genetic defect on chromosome 10. Parathyroid hormone (choice B) can be produced by parathyroid tumors or can be a paraneoplastic product of a variety of tumors, including lung cancer. TSH (choice C) can be produced by pituitary adenomas.

T3 (choice D), or triiodothyronine, and T4 (choice E), or thyroxine, can be produced by thyroid tumors composed of follicular cells. 16The correct answer is B. The glossopharyngeal nerve (CN IX) and the vagus nerve (CN X) carry afferent information to the medulla from the carotid sinus and aortic arch baroreceptors, respectively. The firing rate of these neurons increases with increasing blood pressure. Therefore, by artificially increasing the firing rate of these nerves, the medulla receives a false signal that indicates that the blood pressure is too high. This elicits a baroreceptor reflex, resulting in a decrease in sympathetic outflow and an increase in parasympathetic outflow, which leads to bradycardia and hypotension. 17The correct answer is C. Regardless of how long the untranslated regions are, the number of nucleotides in the coding region of an mRNA is three times the number of amino acids, since three nucleotides are required to code for each amino acid, and 3 X 64 = 192. In reality, three nucleotides code for the first amino acid (formyl-methionine in prokaryotes, methionine in eukaryotes), which may be removed in posttranslational steps, and three nucleotides at the 3' end (are needed to terminate the process (i.e., a STOP codon), so the actual number would likely be slightly higher. 18The correct answer is E. The answer options contain a mix of ligand-gated ion channel receptors and G protein coupled receptors. A receptor that would reliably produce excitation, thus increasing in firing rate, would be an excitatory amino acid receptor. The N-methyl-Daspartate (NMDA) receptor is an example of this type of receptor. The NMDA receptor is a ligand-gated ion channel that would permit the influx of cations (sodium and calcium). The rule of thumb is that cations entering the cell through ion channels produce depolarization, and anions entering the cell cause hyperpolarization. The alpha-2 adrenergic receptor (choice A) is coupled to Gi, and would lead to a decrease in cAMP levels. The beta-1 adrenergic receptor (choice B) is coupled to Gs, and would lead to an increase in cAMP levels. The gamma-aminobutyric acid (GABA) (choice C) and glycine (choice D) receptors are inhibitory amino acid receptors. They are ligand-gated ion channel receptors that allow chloride influx. This could cause hyperpolarization, or at least membrane potential stabilization, thus preventing excitation of the cell. 19The correct answer is A. Cocaine is a stimulant that causes hypertension and tachycardia by blocking norepinephrine uptake. This leads to an accumulation of norepinephrine in the synapse, causing greater stimulation of postsynaptic receptors. The receptors that mediate the systemic vasoconstriction are alpha-1 adrenergic receptors, and the receptors that mediate the increases in heart rate and inotropic state are beta-1 adrenergic receptors. Direct stimulation of alpha-1 receptors (choice B) would increase blood pressure, but this is not cocaine's mechanism of action. Direct stimulation of beta-1 receptors (choice C) could increase blood pressure by increasing inotropic state, but this is not cocaine's mechanism of action. Direct stimulation of beta-2 receptor