Dataset S1_ Table S2 by langkunxg

VIEWS: 3 PAGES: 54

									Table S1 Flowering time of vernalized and mutant lines
                                                                                                   Rosette leaf
                                                                                                   Leaf number n
Non vernalized and wild type controls
Col (fri/fri , FLC/FLC )                                                                            11.8±0.4   8
C24 (FRI/FRI , FLC*/FLC* )                                                                          14.1±0.3   14
F1-Col×C24 (fri/FRI , FLC/FLC* )                                                                      >30
F1-C24×Col (fri/FRI , FLC/FLC* )                                                                      >30
6 weeks vernalization
Col (fri/fri , FLC / FLC )                                                                          9.9±0.2    28
C24 (FRI/FRI , FLC* / FLC* )                                                                        7.8±0.2    29
F1-Col×C24 (fri/FRI , FLC / FLC* )                                                                  11.6±0.2   28
F1-C24×Col (FRI/fri , FLC* / FLC )                                                                  11.3±0.3   27
flc mutants-unvernalized
F1-flc-20 (C24) ×flc-a (Col) (fri/FRI, flc/flc)                                                     12.4±0.3   37
F1-flc-20 (C24)×flc-b (Col) (fri/FRI, flc/flc)                                                      12.6±0.1   39
F1-flc-20 (C24)×flc-3 (Col) (fri/FRI, flc/flc)                                                      12.0±0.2   34

n, number of plants.
Underline shows decreased activity of FLC following vernalization.
* shows the FLC allele from C24
flc-a (SALK-092716), flc-b (SALK-003346), and flc-3 mutants are in Col. flc-20 mutant is in C24.
Table S2 Size and dry weight of parental and hybrid seeds

                                                                                    Cola        C24a       F1-Col×C24   F1-C24×Col
Length (mm)                                                                      0.58±0.004   0.56±0.003   0.55±0.002   0.61±0.002
Width (mm)                                                                       0.34±0.002   0.33±0.002   0.34±0.001   0.36±0.001
         2
Area (mm )                                                                       0.15±0.002   0.14±0.001   0.14±0.001   0.17±0.001
50 seed weight (mg)                                                              1.50±0.071   1.49±0.050   1.61±0.064   2.04±0.036
                            b
Cotyledon area of embryos                                                        1.00±0.020   0.82±0.016   1.03±0.022   1.23±0.014
                          b
Cell number per unit area                                                        1.00±0.026   1.13±0.028   1.00±0.026   1.03±0.027

a. Self-pollination of a restricted number of flowers (five to six) per plant.
b. The ratio compared to Col.
Table S3 Genes differentially expressed between F1 (C24 x Col) and MPV at 3 DAS using the tiling array


                              Fold change
                                            No. of Affy          Gene Start   Gene End
Gene Name         Strand       (F1/MPV)                   Chr.                            Gene Description
                                             Probes                Point        Point
                                 (log2)

1.5-fold up-regulated genes (F1/MPV)

AT1G54040            -           2.63           35        chr1    20174433     20175672   ESP (EPITHIOSPECIFIER PROTEIN)
AT4G29200            -           2.57           32        chr4    14398177     14399382   beta-galactosidase
AT5G44440            -           2.15           46        chr5    17927817     17929493   FAD-binding domain-containing protein
AT5G15360            -           1.88           35        chr5      4987463     4988691   unknown protein
AT5G19100            -           1.81           34        chr5      6408246     6409415   extracellular dermal glycoprotein-related / EDGP-related
AT3G14210           +             1.8           38        chr3      4729854     4731478   ESM1 (EPITHIOSPECIFIER MODIFIER 1); carboxylesterase
AT1G29090            -           1.76           34        chr1    10162969     10164366   peptidase C1A papain family protein
AT1G07320           +            1.64           25        chr1      2249138     2249990   RPL4 (ribosomal protein L4)binding
AT1G18080           +            1.61           21        chr1      6222277     6223111   ATARCA (Arabidopsis thaliana Homolog of the Tobacco ArcA)
AT4G03060            -           1.56           41        chr4      1351792     1353829   AOP2 (ALKENYL HYDROXALKYL PRODUCING 2)
AT4G20360           +            1.52           43        chr4    10989989     10991502   AtRABE1b/AtRab8D (Arabidopsis Rab GTPase homolog E1b)
AT2G43030           +            1.49           23        chr2    17901940     17902752   ribosomal protein L3 family protein
AT4G27440           +            1.39           38        chr4    13725581     13727214   PORB (PROTOCHLOROPHYLLIDE OXIDOREDUCTASE B)
AT5G45390           +            1.37           26        chr5    18413549     18414814   CLPP4 (Clp protease proteolytic subunit 4); endopeptidase Clp
AT4G17560           +            1.37           20        chr4      9780297     9781529   ribosomal protein L19 family protein
AT5G66570           +            1.37           29        chr5    26585952     26587273   OE33/OEE1/OEE33/PSBO-1/PSBO1 (OXYGEN-EVOLVING ENHANCER 33)
AT5G20720           +            1.36           28        chr5      7014721     7016441   CPN20 (CHAPERONIN 20)
AT1G61520           +            1.35           28        chr1    22703768     22704828   LHCA3 (Photosystem I light harvesting complex gene)
AT3G46780           +            1.32           44        chr3    17239674     17241953   PTAC16 (PLASTID TRANSCRIPTIONALLY ACTIVE18)
AT1G20620           +            1.31           40        chr1      7144220     7146182   CAT3 (CATALASE 3); catalase|CAT3 (CATALASE 3)
AT1G06680           +            1.31           21        chr1      2047887     2049152   PSBP-1 (OXYGEN-EVOLVING ENHANCER PROTEIN 2)
AT1G61500            -            1.3           70        chr1    22693411     22696461   S-locus protein kinase, putative
AT2G18020           +             1.3           23        chr2      7844211     7845217   EMB2296 (EMBRYO DEFECTIVE 2296)
AT5G01530           +            1.27           29        chr5       208962      210399   chlorophyll A-B binding protein CP29 (LHCB4)
AT3G26650           +            1.27           31        chr3      9796414     9797997   GAPA (GLYCERALDEHYDE 3-PHOSPHATE DEHYDROGENASE A SUBUNIT)
AT3G26060           +            1.24           20        chr3      9525971     9527425   ATPRX Q; antioxidant/ peroxiredoxin
AT2G05642            -           1.24           42        chr2      2098365     2100811   similar to replication protein-related [Arabidopsis thaliana] (TAIR:AT1G52950 )
AT4G25080           +            1.24           26        chr4    12876970     12878065   CHLM (MAGNESIUM-PROTOPORPHYRIN IX METHYLTRANSFERASE)
AT1G32060           +            1.24           33        chr1    11532550     11534261   PRK (PHOSPHORIBULOKINASE)
AT1G01390   -   1.23   38   chr1     148260     149734   UDP-glucoronosyl/UDP-glucosyl transferase family protein
AT3G16400   +   1.22   43   chr3    5566421    5568467   ATMLP-470 (MYROSINASE-BINDING PROTEIN-LIKE PROTEIN-470)
AT2G20890   +   1.22   27   chr2    8994757    8996410   PSB29 (THYLAKOID FORMATION1)
AT5G54270   +   1.21   21   chr5   22055596   22056618   LHCB3 (LIGHT-HARVESTING CHLOROPHYLL BINDING PROTEIN 3)
AT4G36130   +   1.91   23   chr4   17097599   17098650   60S ribosomal protein L8 (RPL8C)
AT5G49910   +   1.87   56   chr5   20320693   20323597   cpHSC70-2 (HEAT SHOCK PROTEIN 70-7)
AT5G40950   +   1.81   20   chr5   16428050   16429183   RPL27; structural constituent of ribosome
AT5G07090   +   1.8    24   chr5    2202754    2203964   40S ribosomal protein S4 (RPS4B)
AT3G61470   +   1.8    27   chr3   22756658   22758204   LHCA2 (Photosystem I light harvesting complex gene 2)
AT5G54160   +   1.79   26   chr5   21999225   22001214   ATOMT1 (O-METHYLTRANSFERASE 1)
AT3G51240   +   1.77   25   chr3   19036332   19037518   F3H (TRANSPARENT TESTA 6)
AT5G25980   +   1.74   52   chr5    9072734    9075416   TGG2 (GLUCOSIDE GLUCOHYDROLASE 2)
AT3G21200   +   1.71   29   chr3    7436044    7437802   similar to hypothetical protein [Vitis vinifera] (GB:CAN79599 )
AT3G54050   +   1.67   27   chr3   20027908   20029220   fructose-1,6-bisphosphatase, putative
AT3G14930   +   1.63   36   chr3    5020617    5022799   HEME1; uroporphyrinogen decarboxylase
AT2G28000   +   1.58   56   chr2   11933582   11936351   CPN60A (chloroplast / 60 kDa chaperonin alpha subunit)
AT3G53870   +   1.55   23   chr3   19962492   19963796   40S ribosomal protein S3 (RPS3B)
AT5G26000   -   1.54   47   chr5    9079555    9082296   TGG1 (THIOGLUCOSIDE GLUCOHYDROLASE 1)
AT5G63570   +   1.49   38   chr5   25469227   25470854   GSA1 (GLUTAMATE-1-SEMIALDEHYDE-2,1-AMINOMUTASE)
AT4G29060   +   1.49   73   chr4   14317313   14321260   EMB2726 (EMBRYO DEFECTIVE 2726)
AT3G56940   +   1.47   41   chr3   21087558   21089257   AT103 (DICARBOXYLATE DIIRON 1)
AT2G33430   +   1.46   21   chr2   14169749   14171858   plastid developmental protein DAG, putative
AT3G61430   +   1.43   20   chr3   22744602   22745868   PIP1A (PLASMA MEMBRANE INTRINSIC PROTEIN 1A)
AT3G04550   +   1.38   36   chr3    1225951    1227246   similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G28500 )
AT3G04840   +   1.38   30   chr3    1330054    1331602   40S ribosomal protein S3A (RPS3aA)
AT4G36880   -   1.37   29   chr4   17374628   17376063   CP1 (CYSTEINE PROTEINASE1)
AT4G10340   +   1.35   27   chr4    6408138    6409507   LHCB5 (LIGHT HARVESTING COMPLEX OF PHOTOSYSTEM II 5)
AT2G45960   +   1.33   29   chr2   18917431   18918696   PIP1B (plasma membrane intrinsic protein 1;2)
AT3G09630   +   1.32   31   chr3    2953804    2955455   60S ribosomal protein L4/L1 (RPL4A)
AT1G35680   +   1.3    26   chr1   13209973   13211403   50S ribosomal protein L21, chloroplast
AT4G13940   +   1.26   44   chr4    8054887    8056952   HOG1 (HOMOLOGY-DEPENDENT GENE SILENCING 1)
AT5G01590   +   1.25   31   chr5     224174     226626   similar to unnamed protein product [Vitis vinifera] (GB:CAO63840 )
AT4G01150   +   1.24   20   chr4     493557     494769   Identical to Uncharacterized protein At4g01150
AT1G11860   +   1.21   35   chr1    4001362    4003344   aminomethyltransferase, putative|aminomethyltransferase, putative
AT5G48300   +   1.2    29   chr5   19587498   19589706   ADG1 (ADP GLUCOSE PYROPHOSPHORYLASE SMALL SUBUNIT 1)
AT5G20630   -   1.18   22   chr5    6975118    6975942   GLP3 (GERMIN-LIKE PROTEIN 3)
AT1G44575   +   1.16   22   chr1   16874163   16875812   NPQ4 (NONPHOTOCHEMICAL QUENCHING)
AT3G45140   +   1.14   71   chr3   16536431   16539989   LOX2 (LIPOXYGENASE 2)
AT3G51140   +   1.09   23   chr3   19009091   19010157   heat shock protein binding
AT1G15930   +   1.07   21   chr1    5471630    5472911   40S ribosomal protein S12 (RPS12A)
AT3G16240   +   1.02   23   chr3    5505505    5506775   DELTA-TIP (delta tonoplast integral protein)
AT5G56030   +   1.1    36   chr5   22704105   22706460   HSP81-2 (EARLY-RESPONSIVE TO DEHYDRATION 8)
AT3G62030   +   1.1    23   chr3   22984616   22986121   ROC4 (ROTAMASE CYP 4)
AT4G09650   +   1.09   22   chr4    6100743    6101568   ATP synthase delta chain, chloroplast, putative
AT5G62690   +   1.09   37   chr5   25198747   25200627   TUB2 (Tubulin beta-2)
AT3G55800   +   1.09   27   chr3   20720598   20722317   SBPASE (SEDOHEPTULOSE-BISPHOSPHATASE)
AT1G74470   +   1.09   40   chr1   27994873   27996660   geranylgeranyl reductase
AT5G63050   +   1.09   29   chr5   25309704   25311859   EMB2759 (EMBRYO DEFECTIVE 2759)
AT3G60750   +   1.08   69   chr3   22464813   22467877   transketolase, putative
AT1G45201   +   1.08   32   chr1   17126324   17129879   similar to triacylglycerol lipase [Arabidopsis thaliana] (TAIR:AT5G42930 )
AT1G15690   +   1.08   61   chr1    5399027    5402294   AVP1 (vacuolar-type H+-pumping pyrophosphatase 1)
AT3G08940   +   1.07   21   chr3    2717709    2718624   LHCB4.2 (LIGHT HARVESTING COMPLEX PSII)
AT5G42800   -   1.07   32   chr5   17181414   17183051   DFR (DIHYDROFLAVONOL 4-REDUCTASE)
AT3G48730   +   1.07   36   chr3   18060664   18062532   GSA2 (GLUTAMATE-1-SEMIALDEHYDE 2,1-AMINOMUTASE 2)
AT5G08610   +   1.06   46   chr5    2790329    2793951   DEAD box RNA helicase (RH26)
AT5G17920   +   1.06   66   chr5    5935752    5939234   ATCIMS (COBALAMIN-INDEPENDENT METHIONINE SYNTHASE)
AT1G26630   +   1.06   22   chr1    9205889    9207110   FBR12 (FUMONISIN B1-RESISTANT12)
AT3G18780   +   1.06   34   chr3    6474925    6476982   ACT2 (ACTIN 2)
AT1G78630   +   1.05   23   chr1   29580869   29582328   EMB1473 (EMBRYO DEFECTIVE 1473)
AT3G63490   +   1.05   37   chr3   23455198   23457178   ribosomal protein L1 family protein
AT1G09640   +   1.05   31   chr1    3119929    3122132   elongation factor 1B-gamma, putative
AT4G33520   +   1.05   23   chr4   16118946   16120802   PAA1 (metal-transporting P-type ATPase 1)
AT3G58610   +   1.04   44   chr3   21682465   21685725   ketol-acid reductoisomerase
AT5G15650   +   1.04   21   chr5    5092193    5094172   RGP2 (REVERSIBLY GLYCOSYLATED POLYPEPTIDE 2)
AT5G57180   +   1.04   35   chr5   23185263   23186922   CIA2 (CHLOROPLAST IMPORT APPARATUS 2)
AT5G13510   +   1.04   21   chr5    4341282    4341992   ribosomal protein L10 family protein
AT2G40490   +   1.04   33   chr2   16919956   16921965   HEME2; uroporphyrinogen decarboxylase
AT1G56190   +   1.04   36   chr1   21031922   21033982   phosphoglycerate kinase, putative
AT5G35630   +   1.04   32   chr5   13848399   13850394   GS2 (GLUTAMINE SYNTHETASE 2)
AT5G20010   +   1.04   20   chr5    6760299    6761645   RAN-1 (RAS RELATED NUCLEAR PROTEIN)
AT3G26570   +   1.03   41   chr3    9757588    9759547   PHT2;1 (phosphate transporter 2;1)
AT1G66430   +   1.03   27   chr1   24781964   24784049   pfkB-type carbohydrate kinase family protein
AT5G05580   +   1.03   28   chr5    1664171    1666261   FAD8 (FATTY ACID DESATURASE 8)
AT3G48420   +   1.03   21   chr3   17940636   17942682   haloacid dehalogenase-like hydrolase family protein
AT3G59780   +   1.03   38   chr3   22098101   22101355   similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G23060 )
AT1G07920   +   1.03   39   chr1    2454855    2457227   elongation factor 1-alpha / EF-1-alpha
AT1G80080   -   1.03   36   chr1   30133010   30134460   TMM (TOO MANY MOUTHS)
AT1G15500   +   1.03   46   chr1    5326342    5328642   ATNTT2; ATP:ADP antiporter
AT4G23560   -   1.02   39   chr4   12293558   12295744   ATGH9B15 (ARABIDOPSIS THALIANA GLYCOSYL HYDROLASE 9B15)
AT3G16420   +   1.02   25   chr3    5579510    5580550   PBP1 (PYK10-BINDING PROTEIN 1)
AT4G36250   +   1.02   28   chr4   17150984   17152851   ALDH3F1 (ALDEHYDE DEHYDROGENASE 3F1)
AT1G20020   +   1.02   26   chr1    6942842    6944860   ATLFNR2 (LEAF FNR 2)
AT4G34050   +   1.02   20   chr4   16310896   16311884   caffeoyl-CoA 3-O-methyltransferase, putative
AT1G02560   +   1.02   29   chr1     537914     540008   CLPP5 (NUCLEAR ENCODED CLP PROTEASE 1)
AT2G30950   +   1.02   41   chr2   13181416   13184023   VAR2 (VARIEGATED 2)
AT5G28500   +   1.02   35   chr5   10477795   10479278   similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G04550 )
AT1G08360   +   1.01   21   chr1    2636033    2637573   60S ribosomal protein L10A (RPL10aA)
AT4G24280   +   1.01   53   chr4   12590027   12593507   CPHSC70-1 (chloroplast heat shock protein 70-1)
AT4G02990   +   1.01   39   chr4    1322203    1323975   mitochondrial transcription termination factor family protein
AT3G17998   +   1.01   24   chr3    6154402    6156915   CPuORF30 (Conserved peptide upstream open reading frame 30)
AT1G61190   +   1.01   36   chr1   22561327   22563288   disease resistance protein (CC-NBS-LRR class), putative
AT4G35100   +   1.01   22   chr4   16708624   16709877   PIP3 (PLASMA MEMBRANE INTRINSIC PROTEIN 3)
AT1G71695   +    1     27   chr1   26968016   26970118   peroxidase 12 (PER12) (P12) (PRXR6)
AT1G04940   +    1     27   chr1    1399212    1400669   TIC20; P-P-bond-hydrolysis-driven protein transmembrane transporter
AT3G47520   +    1     37   chr3   17524281   17525815   MDH (MALATE DEHYDROGENASE)
AT5G63510   +    1     23   chr5   25441225   25442920   GAMMA CAL1 (GAMMA CARBONIC ANHYDRASE LIKE 1)
AT3G44215   -    1     75   chr3   15930392   15934607   transposable element gene
AT5G56010   +    1     28   chr5   22698585   22701294   HSP81-3 (Heat shock protein 81-3)
AT1G11430   +    1     23   chr1    3847274    3849016   plastid developmental protein DAG, putative
AT2G23350   +    1     46   chr2    9950250    9952967   PAB4 (POLY(A) BINDING PROTEIN 4)
AT1G32990   +    1     22   chr1   11955778   11957120   PRPL11 (PLASTID RIBOSOMAL PROTEIN L11)
AT2G47590   +    1     30   chr2   19528947   19530817   PHR2 (PHOTOLYASE/BLUE-LIGHT RECEPTOR 2)
AT5G04590   +   0.99   44   chr5    1319382    1322507   SIR (sulfite reductase); sulfite reductase (ferredoxin)
AT3G04120   +   0.99   31   chr3    1080987    1083057   GAPC (GLYCERALDEHYDE-3-PHOSPHATE DEHYDROGENASE C SUBUNIT)
AT3G13470   +   0.99   26   chr3    4389724    4392232   chaperonin, putative
AT5G60390   +   0.99   33   chr5   24306625   24308023   elongation factor 1-alpha
AT4G33510   +   0.99   30   chr4   16116467   16118199   DHS2 (3-DEOXY-D-ARABINO-HEPTULOSONATE 7-PHOSPHATE SYNTHASE)
AT4G39980   +   0.98   31   chr4   18539668   18541807   DHS1 (3-DEOXY-D-ARABINO-HEPTULOSONATE 7-PHOSPHATE SYNTHASE 1)
AT5G45930    +   0.98   21    chr5   18645336   18646818   CHLI2; magnesium chelatase
AT2G44060    +   0.98   21    chr2   18233465   18234841   late embryogenesis abundant family protein
AT4G39330    +   0.98   24    chr4   18291255   18292702   mannitol dehydrogenase
AT5G10920    +   0.97   20    chr5    3441785    3443815   argininosuccinate lyase, putative
AT1G79560    +   0.97   40    chr1   29931740   29936641   EMB1047/FTSH12 (EMBRYO DEFECTIVE 1047)
AT4G14090    -   0.97   33    chr4    8122419    8123726   UDP-glucosyl transferase family protein
AT3G02468    +   0.97   45    chr3     509126     511329   CPuORF9 (Conserved peptide upstream open reading frame 9)
AT5G54770    +   0.96   30    chr5   22263824   22265172   THI1 (THIAZOLE REQUIRING)
AT4G16390    +   0.96   38    chr4    9258010    9259838   chloroplastic RNA-binding protein P67, putative
AT1G71500    +   0.96   20    chr1   26939777   26940934   Rieske (2Fe-2S) domain-containing protein
AT3G15850    +   0.96   21    chr3    5359060    5360871   FAD5 (FATTY ACID DESATURASE 5); oxidoreductase
AT5G25920    -   0.96   29    chr5    9044239    9045722   similar to ATP binding
AT4G11320    +   0.96   27    chr4    6887317    6888893   cysteine proteinase, putative
AT4TE23125   -   0.96   24    chr4    5520703    5535898   Transposon - VANDAL3
AT2G46820    +   0.96   22    chr2   19250666   19252145   PSAP/PSI-P/PTAC8/TMP14 (THYLAKOID MEMBRANE PHOSPHOPROTEIN OF 14 KDA)
AT3G61580    +   0.96   22    chr3   22797072   22798250   delta-8 sphingolipid desaturase (SLD1)
AT5G46110    +   0.96   30    chr5   18714795   18717255   APE2 (ACCLIMATION OF PHOTOSYNTHESIS TO ENVIRONMENT)
AT5G14260    +   0.96   33    chr5    4601208    4604027   SET domain-containing protein
AT3G01480    +   0.96   25    chr3     188408     190493   CYP38 (CYCLOPHILIN 38)
AT5G13930    +   0.96   33    chr5    4488698    4489975   ATCHS/CHS/TT4 (CHALCONE SYNTHASE)
AT4G15110    -   0.96   55    chr4    8629851    8632956   CYP97B3 (cytochrome P450, family 97, subfamily B, polypeptide 3); oxygen binding
AT3G17790    +   0.96   28    chr3    6089676    6091121   ATACP5 (acid phosphatase 5); acid phosphatase
AT3G15356    -   0.96   21    chr3    5174434    5175389   legume lectin family protein
AT4G01690    +   0.95   32    chr4     729893     732313   PPOX (PROTOPORPHYRINOGEN OXIDASE); protoporphyrinogen oxidase
AT3G52380    +   0.95   30    chr3   19432569   19433873   CP33 (PIGMENT DEFECTIVE 322); RNA binding
AT3G18080    +   0.95   33    chr3    6191567    6194163   glycosyl hydrolase family 1 protein
AT1G68010    +   0.95   31    chr1   25497042   25499145   HPR (HYDROXYPYRUVATE REDUCTASE); glycerate dehydrogenase
AT5G04140    +   0.95   121   chr5    1130036    1138182   GLS1/GLU1/GLUS (FERREDOXIN-DEPENDENT GLUTAMATE SYNTHASE 1)
AT5G36230    +   0.95   26    chr5   14290649   14293795   eIF4-gamma/eIF5/eIF2-epsilon domain-containing protein
AT2G05710    +   0.95   65    chr2    2141638    2146407   aconitate hydratase, cytoplasmic, putative
AT1G35720    +   0.95   22    chr1   13226505   13228005   ANNAT1 (ANNEXIN ARABIDOPSIS 1); calcium ion binding
AT1G57720    +   0.95   29    chr1   21381818   21383721   elongation factor 1B-gamma, putative
AT5G22640    +   0.95   58    chr5    7529384    7533525   EMB1211 (EMBRYO DEFECTIVE 1211)
AT4G33030    +   0.95   41    chr4   15935453   15937693   SQD1 (sulfoquinovosyldiacylglycerol 1); UDPsulfoquinovose synthase
AT1G50010    +   0.95   31    chr1   18521386   18523342   TUA2 (tubulin alpha-2 chain)
AT1G62180    -   0.95   20    chr1   22979252   22981217   APR2 (5'ADENYLYLPHOSPHOSULFATE REDUCTASE 2)
AT4G02510   +   0.95   101   chr4    1104801    1109354   TOC159 (PLASMID PROTEIN IMPORT 2)
AT5G19940   +   0.95   22    chr5    6739648    6740694   plastid-lipid associated protein PAP-related
AT1G11840   +   0.95   22    chr1    3996005    3997486   ATGLX1 (GLYOXALASE I HOMOLOG); lactoylglutathione lyase
AT3G55440   +   0.95   25    chr3   20564669   20567223   ATCTIMC (CYTOSOLIC TRIOSE PHOSPHATE ISOMERASE)
AT5G53210   -   0.95   25    chr5   21604234   21605934   SPCH (SPEECHLESS); DNA binding / transcription factor
AT3G11630   +   0.94   29    chr3    3672161    3674035   2-cys peroxiredoxin, chloroplast (BAS1)
AT1G69740   +   0.94   36    chr1   26235590   26238285   HEMB1; porphobilinogen synthase|HEMB1
AT1G48920   +   0.94   30    chr1   18101799   18104827   ATNUC-L1/PARL1 (PARALLEL 1); nucleic acid binding
AT2G27420   -   0.94   23    chr2   11733377   11734562   cysteine proteinase, putative
AT3G54090   +   0.94   26    chr3   20039149   20040643   pfkB-type carbohydrate kinase family protein
AT1G11650   +   0.94   27    chr1    3914938    3917993   ATRBP45B; RNA binding|ATRBP45B; RNA binding
AT2G21790   +   0.94   39    chr2    9300465    9304456   R1/RNR1 (RIBONUCLEOTIDE REDUCTASE 1); ribonucleoside-diphosphate reductase
AT4G01050   +   0.94   34    chr4     455800     458423   hydroxyproline-rich glycoprotein family protein
AT4G04350   +   0.94   31    chr4    2128110    2133142   EMB2369 (EMBRYO DEFECTIVE 2369); ATP binding / aminoacyl-tRNA ligase
AT5G10140   -   0.94   55    chr5    3173716    3179361   FLC (FLOWERING LOCUS C)|
AT1G61180   +   0.93   35    chr1   22555265   22556973   disease resistance protein (CC-NBS-LRR class), putative
AT5G25754   +   0.93   42    chr5    8953574    8955545   similar to unknown protein
AT5G47030   +   0.93   20    chr5   19107526   19109409   ATP synthase delta' chain, mitochondrial
AT1G03310   +   0.93   30    chr1     813505     816627   ATISA2/BE2/DBE1/ISA2 (DEBRANCHING ENZYME 1)
AT4G16190   +   0.93   20    chr4    9171535    9172821   cysteine proteinase, putative
AT2G43710   +   0.93   31    chr2   18127064   18129812   SSI2 (fatty acid biosynthesis 2); acyl-[acyl-carrier-protein] desaturase
AT3G59970   +   0.93   41    chr3   22162223   22165447   MTHFR1 (METHYLENETETRAHYDROFOLATE REDUCTASE 1)
AT5G02480   +   0.93   29    chr5     548031     549541   similar to SLT1 (SODIUM- AND LITHIUM-TOLERANT 1)
AT2G47450   +   0.93   25    chr2   19479903   19481163   CAO (CHAOS); chromatin binding
AT5G26290   +   0.93   20    chr5    9226086    9227874   meprin and TRAF homology domain-containing protein
AT1G78820   -   0.93   40    chr1   29639065   29640565   curculin-like (mannose-binding) lectin family protein
AT3G11170   +   0.92   32    chr3    3499991    3502234   FAD7 (FATTY ACID DESATURASE 7); omega-3 fatty acid desaturase
AT1G08540   +   0.92   30    chr1    2703357    2706617   SIGB (SIGMA FACTOR B); DNA binding
AT3G08010   +   0.92   22    chr3    2556091    2557368   ATAB2; RNA binding
AT5G19540   +   0.92   25    chr5    6595730    6597681   similar to unknown
AT3G29320   +   0.92   60    chr3   11254073   11258809   glucan phosphorylase, putative
AT1G78570   +   0.92   45    chr1   29554582   29556806   RHM1/ROL1 (RHAMNOSE BIOSYNTHESIS1)
AT2G21390   +   0.91   63    chr2    9159521    9163775   coatomer protein complex, subunit alpha, putative
AT5G13650   +   0.91   52    chr5    4397751    4402108   elongation factor family protein|elongation factor family protein
AT1G03630   +   0.91   24    chr1     907683     909156   POR C (PROTOCHLOROPHYLLIDE OXIDOREDUCTASE)
AT1G54780   +   0.91   22    chr1   20443118   20444641   thylakoid lumen 18.3 kDa protein
AT3G02090    +   0.91   35   chr3     365609     368769   MPPBETA; metalloendopeptidase|MPPBETA; metalloendopeptidase
AT1G42970    +   0.91   37   chr1   16129951   16131964   GAPB (GLYCERALDEHYDE-3-PHOSPHATE DEHYDROGENASE B SUBUNIT)
AT2G20860    +   0.91   26   chr2    8986663    8988011   LIP1 (LIPOIC ACID SYNTHASE 1); lipoic acid synthase
AT4G03280    +   0.91   22   chr4    1440215    1441665   PETC (PHOTOSYNTHETIC ELECTRON TRANSFER C)
AT2G17360    +   0.91   22   chr2    7553628    7555109   40S ribosomal protein S4 (RPS4A)
AT1G27752    +   0.91   21   chr1    9662163    9666938   similar to unnamed protein
AT4G26870    +   0.91   26   chr4   13505426   13507601   aspartyl-tRNA synthetase, putative / aspartate--tRNA ligase, putative
AT3G51870    +   0.9    21   chr3   19255014   19257795   mitochondrial substrate carrier family protein
AT2G34250    +   0.9    32   chr2   14469263   14471556   protein transport protein sec61, putative|protein transport protein sec61, putative
AT5G23310    +   0.9    21   chr5    7850609    7852361   FSD3 (FE SUPEROXIDE DISMUTASE 3); iron superoxide dismutase
AT3G02040    -   0.9    29   chr3     348401     349887   SRG3 (SENESCENCE-RELATED GENE 3); glycerophosphodiester phosphodiesterase
AT1G43170    +   0.9    23   chr1   16269245   16271229   ARP1 (ARABIDOPSIS RIBOSOMAL PROTEIN 1)
AT1G72970    +   0.9    27   chr1   27456498   27459188   HTH (HOTHEAD); aldehyde-lyase
AT1G02150    +   0.9    33   chr1     409015     410423   pentatricopeptide (PPR) repeat-containing protein
AT2G39770    +   0.9    21   chr2   16596470   16597720   CYT1 (CYTOKINESIS DEFECTIVE 1); nucleotidyltransferase
AT5G60600    +   0.9    53   chr5   24376220   24380629   GcpE (CHLOROPLAST BIOGENESIS 4)
AT5G16290    +   0.9    22   chr5    5333860    5336345   acetolactate synthase small subunit
AT4G05320    +   0.89   28   chr4    2718214    2719951   UBQ10 (POLYUBIQUITIN 10)
AT1G20630    +   0.89   27   chr1    7146640    7148986   CAT1 (CATALASE 1); catalase
AT3G23940    +   0.89   39   chr3    8648715    8652449   dehydratase family
AT4G02580    +   0.89   22   chr4    1134502    1137068   NADH-ubiquinone oxidoreductase 24 kDa subunit, putative
AT5TE45920   +   0.89   21   chr5   12916262   12930551   Transposon - HELITRON4
AT4G16920    -   0.89   49   chr4    9519804    9525699   disease resistance protein (TIR-NBS-LRR class), putative
AT5G18660    -   0.89   25   chr5    6220836    6222201   DVR (PALE-GREEN AND CHLOROPHYLL B REDUCED 2)
AT4G30960    +   0.89   20   chr4   15067267   15068932   CIPK6 (CBL-INTERACTING PROTEIN KINASE 6); kinase
AT4G20890    +   0.89   25   chr4   11182243   11183763   TUB9 (tubulin beta-9 chain); structural molecule
AT1G61800    +   0.89   26   chr1   22828124   22830269   GPT2 (glucose-6-phosphate/phosphate translocator 2)
AT3G09840    +   0.89   57   chr3    3019383    3022684   CDC48 (CELL DIVISION CYCLE 48); ATPase
AT1G76140    +   0.89   27   chr1   28576245   28579334   prolyl oligopeptidase|similar to prolyl oligopeptidase, putative
AT5G55220    +   0.89   35   chr5   22414918   22418009   trigger factor type chaperone family protein
AT1G53910    +   0.89   25   chr1   20138939   20140532   RAP2 2; DNA binding
AT4G34110    +   0.89   46   chr4   16336430   16339955   PAB2 (POLY(A) BINDING PROTEIN 2); RNA binding
AT2G30970    +   0.89   31   chr2   13185960   13188778   ASP1 (ASPARTATE AMINOTRANSFERASE 1)
AT3G05600    -   0.89   20   chr3    1623366    1624605   epoxide hydrolase, putative
AT5G08690    +   0.88   28   chr5    2825867    2828243   ATP synthase beta chain 2, mitochondrial
AT5G06290    +   0.88   25   chr5    1919277    1921203   2-cys peroxiredoxin, chloroplast, putative
AT1G60590   -   0.88   26   chr1   22317899   22320502   polygalacturonase, putative / pectinase, putative
AT2G28840   +   0.88   28   chr2   12385841   12387461   ankyrin repeat family protein|ankyrin repeat family protein
AT5G42270   +   0.88   39   chr5   16919728   16922248   VAR1 (VARIEGATED 1); ATP-dependent peptidase/ ATPase/ metallopeptidase
AT1G09340   +   0.88   34   chr1    3015442    3018104   CRB; binding / catalytic/ coenzyme binding
AT3G61130   +   0.88   44   chr3   22633093   22636505   GAUT1/LGT1 (Galacturonosyltransferase 1)
AT1G37130   +   0.88   56   chr1   14161081   14164002   NIA2 (NITRATE REDUCTASE 2)
AT4G28780   +   0.88   25   chr4   14215590   14217100   GDSL-motif lipase/hydrolase family protein
AT2G26910   +   0.88   41   chr2   11488721   11494591   ATPDR4/PDR4 (PLEIOTROPIC DRUG RESISTANCE 4)
AT3G14390   +   0.88   23   chr3    4806741    4808525   diaminopimelate decarboxylase, putative / DAP carboxylase, putative
AT5G17880   -   0.88   51   chr5    5909617    5913040   CSA1 (CONSTITUTIVE SHADE-AVOIDANCE1)
AT2G32230   -   0.88   31   chr2   13686682   13688807   pentatricopeptide (PPR) repeat-containing protein
AT1G30230   +   0.88   22   chr1   10638898   10640343   elongation factor 1-beta
AT2G42220   +   0.88   20   chr2   17599118   17600169   rhodanese-like domain-containing protein
AT5G65720   +   0.88   21   chr5   26313569   26314902   ATNFS1/ATNIFS1/NFS1/NIFS1 (ARABIOPSIS THALIANA NITROGEN FIXATION S HOMOLOG 1)
AT1G10640   -   0.88   21   chr1    3515525    3516729   polygalacturonase, putative / pectinase, putative
AT1G54270   +   0.87   32   chr1   20263471   20265704   EIF4A-2 (eukaryotic translation initiation factor 4A-2); ATP-dependent helicase
AT5G61140   +   0.87   31   chr5   24607325   24619533   DEAD box RNA helicase, putative
AT5G16620   +   0.87   25   chr5    5450728    5454122   PDE120 (PIGMENT DEFECTIVE EMBRYO)
AT3G23530   +   0.87   26   chr3    8436831    8442547   cyclopropane fatty acid synthase, putative / CPA-FA synthase, putative
AT3G48500   +   0.87   20   chr3   17973195   17976131   PDE312/PTAC10 (PIGMENT DEFECTIVE 312); RNA binding
AT2G29630   +   0.87   36   chr2   12674117   12676627   thiamine biosynthesis family protein
AT2G20990   +   0.87   26   chr2    9021721    9024896   ATSYTA/NTMC2T1 /NTMC2TYPE1 /SYTA
AT1G31420   +   0.87   27   chr1   11249646   11253484   leucine-rich repeat transmembrane protein kinase, putative
AT1G12840   +   0.87   21   chr1    4375786    4378291   DET3 (DE-ETIOLATED 3)
AT1G69200   +   0.87   22   chr1   26019580   26021736   kinase
AT1G14670   +   0.87   27   chr1    5037630    5040104   endomembrane protein 70, putative
AT1G02930   -   0.87   24   chr1     661227     662344   ATGSTF6 (EARLY RESPONSIVE TO DEHYDRATION 11); glutathione transferase
AT4G15560   +   0.87   46   chr4    8883983    8887321   CLA1 (CLOROPLASTOS ALTERADOS 1)
AT3G09820   +   0.87   35   chr3    3012107    3014596   ADK1 (ADENOSINE KINASE 1)|ADK1 (ADENOSINE KINASE 1)
AT3G01345   +   0.86   23   chr3     129335     130401   Expressed protein
AT5G10960   +   0.86   20   chr5    3464253    3465216   CCR4-NOT transcription complex protein, putative
AT1G17220   +   0.86   57   chr1    5885361    5890271   FUG1 (FU-GAERI1); translation initiation factor
AT5G67385   +   0.86   40   chr5   26901922   26904114   signal transducer
AT1G11680   +   0.86   22   chr1    3938549    3940360   CYP51G1 (CYTOCHROME P450 51); oxygen binding
AT5G17160   -   0.86   41   chr5    5639731    5642089   similar to unknown protein
AT5G62670   +   0.86   57   chr5   25176698   25182429   AHA11 (ARABIDOPSIS H(+)-ATPASE 11); ATPase
AT1G29900   +   0.86   48   chr1   10468340   10472162   CARB (CARBAMOYL PHOSPHATE SYNTHETASE B)
AT5G23120   +   0.86   24   chr5    7778153    7780251   HCF136 (High chlorophyll fluorescence 136)
AT2G35410   +   0.86   20   chr2   14905520   14906547   33 kDa ribonucleoprotein, chloroplast, putative / RNA-binding protein cp33, putative
AT3G17840   +   0.86   26   chr3    6106086    6108287   RLK902 (receptor-like kinase 902); ATP binding / kinase/ protein serine/threonine kinase
AT5G57020   +   0.86   24   chr5   23092196   23093605   NMT1 (N-MYRISTOYLTRANSFERASE 1)
AT5G17020   +   0.86   20   chr5    5594856    5602352   XPO1A (exportin 1A); protein transporter
AT1G54580   +   0.86   20   chr1   20393146   20394666   ACP2 (ACYL CARRIER PROTEIN 2)
AT5G13490   +   0.86   24   chr5    4335882    4337617   AAC2 (ADP/ATP CARRIER 2); ATP:ADP antiporter
AT5G02760   +   0.85   22   chr5     625379     626721   protein phosphatase 2C family protein
AT3G16460   +   0.85   40   chr3    5593073    5595433   jacalin lectin family protein|jacalin lectin family protein
AT5G09810   +   0.85   24   chr5    3052176    3054533   ACT7 (actin 7)
AT4G34220   -   0.85   57   chr4   16381623   16384125   leucine-rich repeat transmembrane protein kinase, putative
AT2G04030   +   0.85   59   chr2    1281915    1285963   CR88 (EMBRYO DEFECTIVE 1956)
AT5G26280   +   0.85   24   chr5    9208731    9210412   meprin and TRAF homology domain-containing protein
AT1G36320   +   0.85   20   chr1   13673038   13675076   similar to unknown protein
AT5G24240   -   0.85   33   chr5    8231724    8233349   phosphatidylinositol 3- and 4-kinase family protein / ubiquitin family protein
AT1G50920   +   0.85   31   chr1   18873840   18875991   GTP-binding protein-related
AT2G40840   +   0.85   39   chr2   17052707   17057742   DPE2 (DISPROPORTIONATING ENZYME 2); 4-alpha-glucanotransferase
AT5G65010   +   0.85   36   chr5   25986431   25989641   ASN2 (ASPARAGINE SYNTHETASE 2)
AT1G73010   -   0.85   21   chr1   27468471   27469872   phosphoric monoester hydrolase
AT2G20360   +   0.85   26   chr2    8793203    8796339   binding / catalytic/ coenzyme binding
AT5G38530   +   0.84   25   chr5   15441285   15443298   tryptophan synthase-related
AT1G64760   -   0.84   21   chr1   24057968   24059023   glycosyl hydrolase family 17 protein|-
AT5G02240   +   0.84   23   chr5     451493     452906   binding / catalytic/ coenzyme binding
AT1G26830   +   0.84   32   chr1    9295734    9298190   ATCUL3/ATCUL3A/CUL3/CUL3A (Cullin 3A); protein binding
AT5G27150   +   0.84   23   chr5    9553668    9557301   NHX1 (NA+/H+ EXCHANGER); sodium ion transmembrane transporter
AT1G14440   -   0.84   26   chr1    4938934    4939970   ATHB31 (ARABIDOPSIS THALIANA HOMEOBOX PROTEIN 31)
AT2G20580   +   0.84   40   chr2    8866113    8871945   AtRPN1a/RPN1A (26S proteasome regulatory subunit S2 1A); binding
AT2G35500   +   0.84   25   chr2   14921111   14922951   shikimate kinase-related
AT1G65010   +   0.84   27   chr1   24153587   24157010   hydrogen ion transmembrane transporter/ protein binding
AT1G11600   +   0.84   24   chr1    3902043    3903337   CYP77B1 (cytochrome P450, family 77, subfamily B, polypeptide 1); oxygen binding
AT1G27760   +   0.84   26   chr1    9668703    9670172   interferon-related developmental regulator family protein
AT3G29590   -   0.84   30   chr3   11401455   11402706   AT5MAT; O-malonyltransferase/ transferase
AT1G06290   +   0.84   25   chr1    1922367    1924991   ACX3 (ACYL-COA OXIDASE 3); acyl-CoA oxidase
AT3G20370   +   0.84   24   chr3    7105393    7107061   meprin and TRAF homology domain-containing protein / MATH domain-containing protein
AT1G33790   +   0.84   23   chr1   12256682   12260099   jacalin lectin family protein
AT1G49760   +   0.84   41   chr1   18420205   18423702   PAB8 (POLY(A) BINDING PROTEIN 8); RNA binding / translation initiation factor
AT1G70940   +   0.84   30   chr1   26746755   26749489   PIN3 (PIN-FORMED 3); auxin:hydrogen symporter/ transporter
AT2G05990   +   0.84   27   chr2    2322303    2324918   MOD1 (MOSAIC DEATH 1); enoyl-[acyl-carrier-protein] reductase (NADH)
AT1G08520   +   0.84   39   chr1    2696545    2700356   CHLD/PDE166 (PIGMENT DEFECTIVE 166); magnesium chelatase
AT5G11170   +   0.84   30   chr5    3554248    3556726   DEAD/DEAH box helicase, putative (RH15)|DEAD/DEAH box helicase, putative (RH15)
AT2G39190   +   0.84   44   chr2   16357176   16362798   ATATH8 (ABC2 homolog 8)|ATATH8 (ABC2 homolog 8)
AT5G03300   +   0.83   20   chr5     796523     798877   ADK2 (ADENOSINE KINASE 2); kinase
AT5G09870   +   0.83   31   chr5    3073832    3077445   CESA5 (CELLULOSE SYNTHASE 5); transferase, transferring glycosyl groups
AT5G14740   +   0.83   33   chr5    4759032    4762380   CA2 (BETA CARBONIC ANHYDRASE 2); carbonate dehydratase
AT5G64740   +   0.83   43   chr5   25898399   25903102   CESA6 (CELLULOSE SYNTHASE 6); transferase, transferring glycosyl groups
AT3G23820   +   0.83   22   chr3    8603518    8605046   GAE6 (UDP-D-GLUCURONATE 4-EPIMERASE 6); catalytic
AT5G20020   +   0.83   20   chr5    6762758    6764316   RAN2 (Ras-related GTP-binding nuclear protein 2); GTP binding
AT4G25100   -   0.83   32   chr4   12884487   12886442   FSD1 (FE SUPEROXIDE DISMUTASE 1); iron superoxide dismutase
AT1G07705   +   0.83   21   chr1    2382189    2385661   transcription regulator|similar to VIP2 (VIRE2 INTERACTING PROTEIN2)
AT4G21150   +   0.83   22   chr4   11279063   11283546   ribophorin II (RPN2) family protein
AT2G39670   +   0.83   32   chr2   16541438   16544371   radical SAM domain-containing protein|radical SAM domain-containing protein
AT5G02870   +   0.83   29   chr5     657849     659504   60S ribosomal protein L4/L1 (RPL4D)|60S ribosomal protein L4/L1 (RPL4D)
AT4G02350   +   0.83   24   chr4    1038247    1040390   exocyst complex subunit Sec15-like family protein
AT2G32700   +   0.83   21   chr2   13874487   13877801   WD-40 repeat family protein|WD-40 repeat family protein
AT5G37510   +   0.83   44   chr5   14914653   14917491   EMB1467 (EMBRYO DEFECTIVE 1467); NADH dehydrogenase
AT3G44035   +   0.83   21   chr3   15819440   15821117   transposable element gene
AT3G28040   +   0.83   31   chr3   10436328   10439067   leucine-rich repeat transmembrane protein kinase, putative
AT5G52520   +   0.83   28   chr5   21328307   21330800   OVA6/PRORS1 (OVULE ABORTION 6); ATP binding / aminoacyl-tRNA ligase
AT3G21690   +   0.83   23   chr3    7638971    7641668   MATE efflux family protein
AT4G23740   +   0.83   20   chr4   12366504   12369053   leucine-rich repeat transmembrane protein kinase, putative
AT3G11560   +   0.83   30   chr3    3639447    3643376   similar to unknown protein
AT4G24770   -   0.83   22   chr4   12766075   12767979   RBP31 (31-KDA RNA BINDING PROTEIN); RNA binding / poly(U) binding
AT3G04870   +   0.82   25   chr3    1342878    1345862   ZDS (ZETA-CAROTENE DESATURASE); carotene 7,8-desaturase
AT3G48870   -   0.82   40   chr3   18133204   18137382   ATCLPC (CASEINOLYTIC PROTEASE C); ATP binding / ATPase
AT3G06980   +   0.82   33   chr3    2201567    2204694   DEAD/DEAH box helicase, putative
AT3G49670   +   0.82   34   chr3   18428751   18431562   BAM2 (big apical meristem 2); ATP binding / protein serine/threonine kinase
AT3G49260   +   0.82   23   chr3   18273507   18276523   IQD21 (IQ-DOMAIN 21, IQ-domain 21
AT2G39250   -   0.82   23   chr2   16395971   16398076   SNZ (SCHNARCHZAPFEN); DNA binding / transcription factor
AT1G48520   +   0.82   27   chr1   17943845   17945977   GATB (GLU-ADT SUBUNIT B); glutaminyl-tRNA synthase (glutamine-hydrolyzing)
AT1G48660   -   0.82   25   chr1   18000006   18001537   auxin-responsive GH3 family protein
AT1G25490   +   0.82   27   chr1    8951376    8955075   RCN1 (ROOTS CURL IN NPA); protein phosphatase type 2A regulator
AT1G16350   +   0.82   20   chr1    5590969    5592633   inosine-5'-monophosphate dehydrogenase, putative
AT1G80300   +   0.82   23   chr1   30196853   30198773   ATNTT1; ATP:ADP antiporter
AT3G18190   +   0.82   23   chr3    6232161    6233674   chaperonin, putative
AT5G20350   +   0.82   20   chr5    6876598    6881007   TIP1 (TIP GROWTH DEFECTIVE 1)
AT5G54060   -   0.82   20   chr5   21954403   21955528   UF3GT (UDP-GLUCOSE:FLAVONOID 3-O-GLUCOSYLTRANSFERASE)
AT2G02560   +   0.82   22   chr2     689853     696776   CAND1 (CULLIN-ASSOCIATED AND NEDDYLATION DISSOCIATED)
AT2G23000   +   0.82   24   chr2    9799358    9802789   SCPL10 (serine carboxypeptidase-like 10); serine carboxypeptidase
AT5G44400   -   0.82   22   chr5   17903527   17905607   FAD-binding domain-containing protein
AT4G17520   +   0.82   25   chr4    9771331    9773573   nuclear RNA-binding protein, putative
AT5G03650   +   0.82   34   chr5     931927     937454   SBE2.2 (STARCH BRANCHING ENZYME 2.2); 1,4-alpha-glucan branching enzyme
AT4G31490   +   0.81   30   chr4   15268565   15272205   coatomer beta subunit, putative / beta-coat protein, putative / beta-COP, putative
AT5G23940   -   0.81   27   chr5    8076966    8079642   EMB3009 (EMBRYO DEFECTIVE 3009); transferase
AT4G17470   -   0.81   22   chr4    9742902    9744411   palmitoyl protein thioesterase family protein
AT3G03780   +   0.81   32   chr3     957603     960455   AtMS2 (Arabidopsis thaliana methionine synthase 2)
AT3G06880   -   0.81   78   chr3    2169883    2175572   transducin family protein / WD-40 repeat family protein
AT4G34450   +   0.81   42   chr4   16471858   16476362   coatomer gamma-2 subunit, putative / gamma-2 coat protein, putative
AT2G15620   +   0.81   27   chr2    6817610    6819641   NIR1 (NITRITE REDUCTASE); ferredoxin-nitrate reductase
AT3G15730   +   0.81   34   chr3    5330793    5332785   PLDALPHA1 (PHOSPHOLIPASE D ALPHA 1); phospholipase D
AT4G27720   +   0.81   23   chr4   13831187   13833751   similar to unknown protein
AT3G17970   +   0.81   30   chr3    6147991    6151984   ATTOC64-III
AT4G13810   -   0.81   23   chr4    8005313    8006966   disease resistance family protein / LRR family protein
AT3G04910   +   0.81   20   chr3    1355489    1357342   WNK1 (WITH NO LYSINE (K) 1
AT2G32530   +   0.81   21   chr2   13816418   13820616   ATCSLB03 (Cellulose synthase-like B3); transferase
AT5G61780   +   0.81   31   chr5   24838501   24843490   tudor domain-containing protein / nuclease family protein
AT3G06530   +   0.81   40   chr3    2022622    2032585   BAP28-related
AT5G51750   +   0.81   47   chr5   21037459   21039837   ATSBT1.3; subtilase
AT1G42550   +   0.81   29   chr1   15979981   15981856   PMI1 (PLASTID MOVEMENT IMPAIRED1)
AT3G43300   -   0.81   20   chr3   15244933   15255674   ATMIN7 (ARABIDOPSIS THALIANA HOPM INTERACTOR 7)
AT3G02050   +   0.81   25   chr3     350708     354098   KUP3 (K+ uptake permease 3); potassium ion transmembrane transporter
AT5G13840   -   0.81   20   chr5    4468559    4470716   WD-40 repeat family protein
AT2G17390   +   0.81   24   chr2    7562935    7564884   AKR2B; protein binding / transcription regulator
AT3G45780   +   0.81   38   chr3   16829498   16834668   PHOT1 (phototropin 1); kinase|PHOT1 (phototropin 1); kinase
AT4G34260   +   0.81   27   chr4   16398192   16400882   catalytic
AT1G67040   -   0.81   21   chr1   25022840   25025595   similar to unknown protein
AT4G31480   +   0.81   37   chr4   15264392   15267345   coatomer beta subunit, putative / beta-coat protein, putative / beta-COP, putative
AT1G63540   +   0.81   21   chr1   23571228   23572862   hydroxyproline-rich glycoprotein family protein
AT3G13690   +   0.8    28   chr3    4486488    4490146   protein kinase family protein
AT3G11700   +   0.8    24   chr3    3699052    3701008   FLA18 (FASCICLIN-LIKE ARABINOGALACTAN PROTEIN 18 PRECURSOR)
AT3G12080   +   0.8    28   chr3    3847811    3851521   EMB2738 (EMBRYO DEFECTIVE 2738); GTP binding|EMB2738 (EMBRYO DEFECTIVE 2738)
AT5G63810   +   0.8    42   chr5   25554418   25558589   BGAL10 (beta-galactosidase 10); beta-galactosidase
AT1G01790   +   0.8    21   chr1     284799     290162   KEA1 (K EFFLUX ANTIPORTER 1); potassium:hydrogen antiporter
AT5G08280   -   0.8    31   chr5    2663506    2665669   HEMC (HYDROXYMETHYLBILANE SYNTHASE); hydroxymethylbilane synthase
AT5G16715   +   0.8    52   chr5    5485390    5493499   EMB2247 (EMBRYO DEFECTIVE 2247); ATP binding / aminoacyl-tRNA ligase
AT2G47070   +   0.8    22   chr2   19343856   19347236   SPL1 (SQUAMOSA PROMOTER BINDING PROTEIN-LIKE 1); DNA binding
AT4G02060   +   0.8    21   chr4     901587     905279   PRL (PROLIFERA); ATP binding / DNA binding / DNA-dependent ATPase
AT4G22880   -   0.8    26   chr4   12004780   12006092   LDOX (TANNIN DEFICIENT SEED 4)|-
AT2G34660   +   0.8    55   chr2   14610312   14619048   ATMRP2 (MULTIDRUG RESISTANCE-ASSOCIATED PROTEIN 2)
AT4G16890   -   0.8    26   chr4    9501153    9505366   SNC1 (SUPPRESSOR OF NPR1-1, CONSTITUTIVE 1)
AT5G43810   +   0.8    23   chr5   17628759   17631646   ZLL (ZWILLE)
AT1G75820   -   0.8    40   chr1   28467246   28469984   CLV1 (CLAVATA 1); ATP binding / kinase/ protein serine/threonine kinase
AT4G39400   +   0.8    30   chr4   18324727   18328446   BRI1 (BRASSINOSTEROID INSENSITIVE 1); kinase
AT1G12800   -   0.8    31   chr1    4361744    4365251   S1 RNA-binding domain-containing protein
AT2G38040   +   0.8    31   chr2   15924344   15927909   CAC3 (acetyl co-enzyme A carboxylase carboxyltransferase alpha subunit)
AT1G50480   +   0.8    34   chr1   18705656   18708579   THFS (10-FORMYLTETRAHYDROFOLATE SYNTHETASE); ATP binding
AT5G35360   +   0.8    25   chr5   13601450   13605202   CAC2 (acetyl co-enzyme A carboxylase biotin carboxylase subunit
AT1G03780   -   0.8    47   chr1     947731     951678   targeting protein-related|-
AT5G26570   +   0.8    42   chr5    9261603    9267611   PWD (PHOSPHOGLUCAN WATER DIKINASE); catalytic
AT5G19000   +   0.8    23   chr5    6342436    6344607   ATBPM1 (BTB-POZ AND MATH DOMAIN 1); protein binding
AT5G05010   +   0.8    28   chr5    1477141    1479234   clathrin adaptor complexes medium subunit-related
AT3G07770   +   0.8    22   chr3    2479591    2484158   ATP binding
AT5G26710   +   0.8    22   chr5    9305598    9307980   glutamate-tRNA ligase, putative / glutamyl-tRNA synthetase, putatuve / GluRS, putative
AT5G13980   +   0.79   35   chr5    4508623    4514132   glycosyl hydrolase family 38 protein
AT3G23640   +   0.79   20   chr3    8502260    8509380   HGL1 (HETEROGLYCAN GLUCOSIDASE 1)
AT5G52560   +   0.79   21   chr5   21348003   21351724   ATUSP (ARABIDOPSIS THALIANA UDP-SUGAR PYROPHOSPHORYLASE)
AT1G47950   -   0.79   38   chr1   17680826   17684640   transposable element gene|Transposon - ATCOPIA51
AT4G19530   +   0.79   20   chr4   10652458   10657273   disease resistance protein (TIR-NBS-LRR class), putative
AT5G01920   +   0.79   23   chr5     359120     361906   STN8 (state transition 8); kinase
AT3G55410   +   0.79   52   chr3   20552451   20556528   2-oxoglutarate dehydrogenase E1 component, putative
AT5G47690   +   0.79   24   chr5   19335027   19344372   binding|binding|binding
AT2G31660   +   0.79   36   chr2   13471468   13478760   SAD2 (SUPER SENSITIVE TO ABA AND DROUGHT2); protein transporter
AT2G31960   +   0.79   37   chr2   13597185   13606645   ATGSL03 (GLUCAN SYNTHASE-LIKE 3); 1,3-beta-glucan synthase
AT1G12770   +   0.79   24   chr1    4351881    4353249   EMB1586 (EMBRYO DEFECTIVE 1586)
AT3G55200   +   0.79   30   chr3   20471523   20475307   splicing factor, putative
AT5G52920   +   0.79   24   chr5   21480803   21483890   PKP-BETA1/PKP1/PKP2 (PLASTIDIC PYRUVATE KINASE 1); pyruvate kinase
AT3G18890   +   0.79   35   chr3    6511222    6514774   binding / catalytic/ coenzyme binding
AT3G01370   +   0.79   32   chr3     139047     142467   ATCFM2/CFM2 (CRM FAMILY MEMBER 2)
AT3G22790   -   0.79   26   chr3    8052725    8058726   kinase interacting family protein
AT4G09730   +   0.79   37   chr4    6136248    6139549   DEAD/DEAH box helicase, putative
AT3G14420   +   0.79   27   chr3    4821770    4824045   (S)-2-hydroxy-acid oxidase, peroxisomal, putative
AT1G55020   +   0.79   28   chr1   20529390   20533712   LOX1 (Lipoxygenase 1); lipoxygenase
AT1G04810   +   0.79   22   chr1    1350337    1355021   26S proteasome regulatory subunit, putative
AT1G28660   -   0.79   31   chr1   10071703   10073244   lipase, putative|-
AT1G17850   -   0.79   25   chr1    6146073    6148500   similar to rhodanese-like domain-containing protein
AT4G19710   +   0.79   34   chr4   10725257   10729596   AK-HSDH/AK-HSDH II; aspartate kinase
AT1G45191   +   0.79   27   chr1   17118521   17121474   glycosyl hydrolase family 1 protein
AT4G16860   -   0.79   33   chr4    9488653    9495362   RPP4 (RECOGNITION OF PERONOSPORA PARASITICA 4)
AT1G08260   +   0.79   20   chr1    2590996    2605592   EMB2284/EMB529/POL2A/TIL1 (EMBRYO DEFECTIVE 2284)
AT1G18370   -   0.79   29   chr1    6319665    6323745   HIK (HINKEL); microtubule motor
AT3G54540   +   0.79   21   chr3   20201386   20203525   ATGCN4 (Arabidopsis thaliana general control non-repressible 4)
AT3G48110   +   0.79   28   chr3   17774041   17782124   EDD1 (EMBRYO-DEFECTIVE-DEVELOPMENT 1)
AT5G64940   +   0.79   43   chr5   25966200   25970777   ATATH13 (ABC2 homolog 13)|ATATH13 (ABC2 homolog 13)
AT2G18960   +   0.79   41   chr2    8228899    8234320   AHA1 (ARABIDOPSIS H+ ATPASE 1); ATPase
AT1G10760   -   0.79   31   chr1    3581397    3589789   SEX1 (STARCH EXCESS 1)
AT3G25660   -   0.78   25   chr3    9340684    9343312   glutamyl-tRNA(Gln) amidotransferase, putative
AT5G15780   -   0.78   24   chr5    5144837    5145815   pollen Ole e 1 allergen and extensin family protein
AT1G32230   +   0.78   30   chr1   11612166   11615553   RCD1 (RADICAL-INDUCED CELL DEATH1)|RCD1 (RADICAL-INDUCED CELL DEATH1)
AT4G14770   -   0.78   23   chr4    8481897    8484776   tesmin/TSO1-like CXC domain-containing protein
AT2G18790   +   0.78   34   chr2    8147013    8151318   PHYB (PHYTOCHROME B); G-protein coupled photoreceptor/ signal transducer
AT4G21770   -   0.78   25   chr4   11563657   11565319   pseudouridine synthase family protein
AT4G14760   +   0.78   23   chr4    8476135    8480906   M protein repeat-containing protein
AT4G39080   +   0.78   39   chr4   18209421   18214980   VHA-A3 (VACUOLAR PROTON ATPASE A3); ATPase
AT4G25960   +   0.78   24   chr4   13179011   13182979   PGP2 (P-GLYCOPROTEIN 2); ATPase, coupled to transmembrane movement of substances
AT5G58140   +   0.78   41   chr5   23541984   23546580   PHOT2 (NON PHOTOTROPIC HYPOCOTYL 1-LIKE); kinase
AT1G23190   +   0.78   31   chr1    8219863    8224060   phosphoglucomutase, cytoplasmic, putative / glucose phosphomutase, putative
AT1G09750   +   0.78   26   chr1    3157554    3159014   chloroplast nucleoid DNA-binding protein-related
AT1G80680   +   0.78   22   chr1   30328938   30332375   MOS3/PRE/SAR3 (SUPPRESSOR OF AUXIN RESISTANCE3); porin
AT2G34357   +   0.78   20   chr2   14506329   14512567   binding
AT3G61690   +   0.78   45   chr3   22838885   22844546   nucleotidyltransferase
AT3G05370   -   0.78   22   chr3    1536071    1538410   disease resistance family protein
AT5G51600   -   0.78   27   chr5   20978156   20981015   PLE (PLEIADE)
AT4G38440   +   0.78   24   chr4   17989099   17993521   similar to hypothetical protein
AT3G07520   -   0.78   21   chr3    2395186    2398126   ATGLR1.4 (Arabidopsis thaliana glutamate receptor 1.4)
AT5G67280   -   0.78   27   chr5   26860029   26862040   RLK (RECEPTOR-LIKE KINASE); ATP binding / kinase/ protein serine/threonine kinase
AT4G24690   +   0.78   21   chr4   12741138   12744467   ubiquitin-associated (UBA)/TS-N domain-containing protein
AT1G02500   +   0.78   23   chr1     519093     520155   SAM1 (S-adenosylmethionine synthetase 1
AT3G03380   +   0.78   23   chr3     799906     807573   DEGP7 (DEGP PROTEASE 7); serine-type peptidase/ trypsin
AT4G34240   +   0.78   21   chr4   16389751   16391998   ALDH3I1 (Aldehyde dehydrogenase 3I1)
AT3G14720   +   0.78   27   chr3    4945877    4948922   ATMPK19 (Arabidopsis thaliana MAP kinase 19); MAP kinase
AT4G19210   +   0.78   30   chr4   10501885   10504971   ATRLI2 (Arabidopsis thaliana RNase L inhibitor protein 2)
AT1G63680   +   0.78   26   chr1   23618111   23619907   ATMURE/PDE316 (PIGMENT DEFECTIVE EMBRYO); ATP binding / ligase
AT3G18390   +   0.78   23   chr3    6313506    6317401   EMB1865 (EMBRYO DEFECTIVE 1865)
AT5G16590   +   0.78   24   chr5    5431863    5433765   leucine-rich repeat transmembrane protein kinase, putative
AT3G04260   -   0.78   31   chr3    1123199    1127487   PTAC3 (PLASTID TRANSCRIPTIONALLY ACTIVE3); DNA binding
AT1G31730   +   0.77   24   chr1   11359650   11364066   epsilon-adaptin, putative
AT1G49970   -   0.77   20   chr1   18505311   18507308   CLPR1 (Clp protease proteolytic subunit 5); endopeptidase Clp
AT2G23740   +   0.77   21   chr2   10106528   10109873   nucleic acid binding / transcription factor/ zinc ion binding
AT4G30720   -   0.77   54   chr4   14971999   14975442   oxidoreductase
AT1G54030   +   0.77   22   chr1   20171429   20173119   GDSL-motif lipase, putative
AT1G23090   -   0.77   30   chr1    8186029    8188835   AST91 (SULFATE TRANSPORTER 91); sulfate transmembrane transporter
AT4G31850   +   0.77   32   chr4   15403175   15406312   PGR3 (PROTON GRADIENT REGULATION 3)
AT4G30160   +   0.77   21   chr4   14755226   14760081   VLN4 (ARABIDOPSIS THALIANA VILLIN 4); actin binding
AT1G80070   +   0.77   92   chr1   30122970   30132426   SUS2 (ABNORMAL SUSPENSOR 2)
AT1G33980   +   0.77   22   chr1   12351593   12354427   ATUPF3/UPF3; nucleotide binding|ATUPF3/UPF3; nucleotide binding
AT3G63070   +   0.77   29   chr3   23313484   23320497   PWWP domain-containing protein
AT1G02730   -   0.77   48   chr1     594617     598018   ATCSLD5 (CELLULOSE SYNTHASE-LIKE D5); 1,4-beta-D-xylan synthase
AT5G12850   +   0.77   23   chr5    4056335    4059308   zinc finger (CCCH-type) family protein
AT3G02030   +   0.77   21   chr3     345470     348833   hydrolase, alpha/beta fold family protein
AT1G78900   +   0.77   38   chr1   29665109   29669592   VHA-A; ATP binding / hydrogen ion transporting ATP synthase, rotational mechanism
AT3G03710   +   0.77   20   chr3     919577     924930   RIF10 (RESISTANT TO INHIBITION WITH FSM 10); 3'-5'-exoribonuclease
AT1G02080   +   0.77   49   chr1     373951     386419   transcriptional regulator-related
AT1G04510   +   0.77   25   chr1    1226637    1230096   transducin family protein / WD-40 repeat family protein|transducin family protein
AT3G22890   +   0.77   24   chr3    8112749    8114273   APS1 (ATP sulfurylase 3)
AT2G28290   +   0.77   75   chr2   12064398   12079537   SYD (SPLAYED)|SYD (SPLAYED)|SYD (SPLAYED)
AT3G52140   +   0.77   32   chr3   19344257   19352154   tetratricopeptide repeat (TPR)-containing protein
AT5G49460   +   0.77   22   chr5   20072231   20075328   ACLB-2 (ATP-citrate lyase B-2)
AT5G06460   +   0.77   21   chr5    1970331    1974044   ATUBA2 (Arabidopsis thaliana ubiquitin activating enzyme 2); ubiquitin activating enzyme
AT2G14880   -   0.77   20   chr2    6400586    6401938   SWIB complex BAF60b domain-containing protein
AT1G04080   +   0.77   22   chr1    1051581    1056180   PRP39; binding
AT3G01780   +   0.77   22   chr3     279139     282673   TPLATE; binding
AT5G14430   +   0.77   23   chr5    4653014    4655916   dehydration-responsive protein-related|dehydration-responsive protein-related
AT1G01320   -   0.76   84   chr1     121250     129285   tetratricopeptide repeat (TPR)-containing protein
AT5G11480   -   0.76   20   chr5    3669239    3671555   GTP binding
AT4G31210   +   0.76   33   chr4   15165290   15171193   DNA topoisomerase family protein
AT3G14415   +   0.76   29   chr3    4818480    4820767   (S)-2-hydroxy-acid oxidase, peroxisomal, putative
AT3G61150   +   0.76   24   chr3   22641783   22645564   HDG1 (HOMEODOMAIN GLABROUS1); DNA binding / transcription factor
AT5G62000   +   0.76   35   chr5   24927684   24931914   ARF2 (AUXIN RESPONSE FACTOR 2); transcription factor
AT3G16000   -   0.76   36   chr3    5430965    5433710   MFP1 (MAR BINDING FILAMENT-LIKE PROTEIN 1)
AT1G64390   +   0.76   23   chr1   23915171   23918742   ATGH9C2 (ARABIDOPSIS THALIANA GLYCOSYL HYDROLASE 9C2)
AT4G33110   -   0.76   20   chr4   15972542   15974609   coclaurine N-methyltransferase, putative
AT4G23940   +   0.76   26   chr4   12437131   12441527   FtsH protease, putative
AT5G46420   +   0.76   23   chr5   18847204   18849979   16S rRNA processing protein RimM family
AT4G22010   +   0.76   23   chr4   11663347   11666429   SKS4 (SKU5 Similar 4); copper ion binding / oxidoreductase
AT1G36160   +   0.76   66   chr1   13535399   13544672   ACC1 (ACETYL-COENZYME A CARBOXYLASE 1); acetyl-CoA carboxylase
AT4G36810   +   0.76   24   chr4   17343538   17344705   GGPS1 (GERANYLGERANYL PYROPHOSPHATE SYNTHASE 1)
AT5G04560   +   0.76   33   chr5    1309683    1316486   DME (DEMETER)|DME (DEMETER)
AT1G31710   +   0.76   20   chr1   11349853   11355177   copper amine oxidase, putative
AT5G64580   -   0.76   34   chr5   25834408   25838681   AAA-type ATPase family protein
AT4G09040   -   0.76   22   chr4    5794615    5797187   RNA recognition motif (RRM)-containing protein
AT1G24706   +   0.76   32   chr1    8741938    8754447   similar to putative THO complex 2 [Oryza sativa (japonica cultivar-group)]
AT2G25430   +   0.76   29   chr2   10829508   10831942   epsin N-terminal homology (ENTH) domain-containing protein
AT2G20570   +   0.76   22   chr2    8862564    8863911   GPRI1 (GOLDEN2-LIKE 1); transcription factor
AT3G25860   +   0.76   25   chr3    9461841    9463827   LTA2 (PLASTID E2 SUBUNIT OF PYRUVATE DECARBOXYLASE)
AT5G47010   +   0.76   25   chr5   19089618   19096043   LBA1/UPF1 (LOW-LEVEL BETA-AMYLASE 1); RNA helicase
AT5G19400   +   0.76   32   chr5    6540220    6544359   similar to unknown protein
AT2G16950   +   0.76   24   chr2    7360937    7367845   protein transporter|protein transporter
AT1G03370   +   0.76   20   chr1     826648     833056   C2 domain-containing protein / GRAM domain-containing protein
AT3G57470   -   0.76   20   chr3   21280503   21286889   peptidase M16 family protein / insulinase family protein|-
AT3G25690   +   0.75   25   chr3    9355200    9358283   CHUP1 (CHLOROPLAST UNUSUAL POSITIONING 1)
AT5G28320   +   0.75   31   chr5   10302158   10305712   similar to EMB1703 (EMBRYO DEFECTIVE 1703)
AT4G20980   +   0.75   24   chr4   11216994   11218496   eukaryotic translation initiation factor 3 subunit 7, putative
AT3G06860    +   0.75   28   chr3    2161976    2166108   MFP2 (MULTIFUNCTIONAL PROTEIN); enoyl-CoA hydratase
AT1G06670    +   0.75   52   chr1    2040648    2047161   NIH (NUCLEAR DEIH-BOXHELICASE)
AT2G47980    +   0.75   23   chr2   19638449   19643741   SCC3 (sister-chromatide cohesion protein 3); binding
AT4TE14520   -   0.75   25   chr4    3159714    3168495   Transposon - VANDAL3
AT4G27430    +   0.75   41   chr4   13718699   13722777   CIP7 (COP1-INTERACTING PROTEIN 7)|CIP7 (COP1-INTERACTING PROTEIN 7)
AT5G65950    +   0.75   23   chr5   26397468   26401882   binding
AT4G14150    -   0.75   25   chr4    8159543    8162990   PAKRP1 (PHRAGMOPLAST-ASSOCIATED KINESIN-RELATED PROTEIN 1)
AT1G30360    +   0.75   36   chr1   10715655   10718731   ERD4 (EARLY-RESPONSIVE TO DEHYDRATION 4)
AT2G47410    +   0.75   20   chr2   19455653   19463892   nucleotide binding
AT1G17840    +   0.75   44   chr1    6142591    6146472   ABCG11/COF1/DSO/WBC11 (DESPERADO)
AT1G80410    -   0.75   33   chr1   30232420   30238462   EMB2753 (EMBRYO DEFECTIVE 2753); binding
AT2G36390    +   0.75   22   chr2   15271518   15276530   SBE2 (STARCH BRANCHING ENZYME 2 ); 1,4-alpha-glucan branching enzyme
AT5G06120    +   0.75   20   chr5    1845620    1852099   Ran-binding protein, putative
AT5G53460    +   0.75   88   chr5   21718022   21726949   GLT1 (NADH-dependent glutamate synthase 1 gene)
AT4G34830    -   0.75   41   chr4   16599711   16605280   binding
AT5G64270    +   0.75   26   chr5   25723907   25727777   splicing factor, putative
AT1G04420    +   0.75   21   chr1    1191611    1193655   aldo/keto reductase family protein
AT4G31570    +   0.75   21   chr4   15297356   15305544   similar to myosin-related [Arabidopsis thaliana] (TAIR:AT1G24460 )
AT4G15090    +   0.75   21   chr4    8614116    8617052   FAR1 (FAR-RED IMPAIRED RESPONSE 1)
AT2G22125    +   0.75   50   chr2    9414571    9420852   binding
AT1G03160    +   0.75   24   chr1     761462     765174   FZL (FZO-LIKE); GTP binding
AT4G21750    +   0.75   25   chr4   11556250   11560678   ATML1 (MERISTEM LAYER 1); DNA binding
AT5G42390    +   0.74   30   chr5   16962510   16969933   metalloendopeptidase
AT5G49630    -   0.74   20   chr5   20159982   20163635   AAP6 (AMINO ACID PERMEASE 6); amino acid transmembrane transporter
AT1G17580    +   0.74   28   chr1    6041619    6049525   MYA1 (ARABIDOPSIS MYOSIN); motor/ protein binding
AT5G08570    +   0.74   29   chr5    2778053    2780190   pyruvate kinase, putative
AT5G18700    -   0.74   40   chr5    6235721    6239334   EMB3013 (EMBRYO DEFECTIVE 3013); kinase
AT2G42600    -   0.74   29   chr2   17741616   17746043   ATPPC2 (PHOSPHOENOLPYRUVATE CARBOXYLASE 2)
AT1G52360    +   0.74   24   chr1   19502891   19508215   coatomer protein complex, subunit beta 2 (beta prime), putative
AT1G66980    -   0.74   23   chr1   25001160   25004853   protein kinase family protein / glycerophosphoryl diester phosphodiesterase family protein
AT5G27970    +   0.74   23   chr5   10004738   10015298   binding
AT5G51200    +   0.74   28   chr5   20822413   20836200   similar to unnamed protein product
AT4G39850    +   0.74   21   chr4   18489167   18495889   PXA1 (PEROXISOMAL ABC TRANSPORTER 1)
AT3G62010    +   0.74   27   chr3   22976045   22981507   metal ion binding / oxidoreductase
AT5G67100    +   0.74   26   chr5   26794259   26802235   ICU2 (INCURVATA2); DNA-directed DNA polymerase
AT1G55325    +   0.74   27   chr1   20641986   20650317   similar to hypothetical protein
AT1G10290   +   0.74   24   chr1    3370579    3376960   ADL6 (DYNAMIN-LIKE PROTEIN 6)
AT3G23890   +   0.74   20   chr3    8624903    8629966   TOPII (TOPOISOMERASE II); ATP binding
AT1G64550   +   0.74   21   chr1   23972537   23976928   ATGCN3 (Arabidopsis thaliana general control non-repressible 3)
AT2G05170   +   0.74   23   chr2    1869935    1873568   ATVPS11 (Arabidopsis thaliana vacuolar protein sorting 11); transporter
AT1G22770   +   0.74   26   chr1    8063058    8067382   GI (GIGANTEA); binding
AT5G65670   +   0.74   20   chr5   26271036   26273578   IAA9 (indoleacetic acid-induced protein 9); transcription factor
AT1G22610   +   0.74   24   chr1    7994328    7997424   C2 domain-containing protein
AT3G13180   -   0.74   21   chr3    4236041    4239384   NOL1/NOP2/sun family protein / antitermination NusB domain-containing protein
AT4G16660   +   0.74   29   chr4    9377478    9380560   heat shock protein 70, putative / HSP70, putative
AT3G55110   -   0.74   33   chr3   20435667   20438329   ABC transporter family protein
AT3G18110   -   0.74   35   chr3    6205133    6209375   EMB1270 (EMBRYO DEFECTIVE 1270)
AT3G57300   +   0.74   28   chr3   21210498   21218475   transcriptional activator, putative
AT1G31800   +   0.74   20   chr1   11396464   11398857   CYP97A3/LUT5 (CYTOCHROME P450-TYPE MONOOXYGENASE 97A3)
AT4G02400   +   0.74   21   chr4    1054377    1056541   similar to U3 ribonucleoprotein (Utp) family protein
AT1G72710   +   0.74   21   chr1   27375978   27380024   CKL2; casein kinase I/ kinase
AT4G31160   +   0.74   32   chr4   15145990   15153026   transducin family protein / WD-40 repeat family protein
AT5G16150   +   0.73   22   chr5    5272758    5275695   GLT1/PGLCT (GLUCOSE TRANSPORTER 1); carbohydrate transmembrane transporter
AT5G26820   +   0.73   27   chr5    9433766    9436649   ferroportin-related
AT1G04210   +   0.73   22   chr1    1114466    1118098   leucine-rich repeat family protein / protein kinase family protein
AT2G15420   -   0.73   20   chr2    6731032    6734711   myosin heavy chain-related
AT5G11530   +   0.73   21   chr5    3695997    3700400   EMF1 (EMBRYONIC FLOWER 1)
AT1G10510   +   0.73   22   chr1    3461669    3465546   EMB2004 (EMBRYO DEFECTIVE 2004); protein binding
AT3G04740   +   0.73   24   chr3    1294362    1300426   SWP (STRUWWELPETER)
AT1G22430   +   0.73   20   chr1    7919190    7921678   alcohol dehydrogenase, putative|alcohol dehydrogenase, putative
AT1G69440   -   0.73   23   chr1   26105013   26107418   AGO7 (ARGONAUTE7); nucleic acid binding
AT3G04290   -   0.73   24   chr3    1133379    1136220   ATLTL1/LTL1 (LI-TOLERANT LIPASE 1); carboxylesterase
AT3G48610   -   0.73   29   chr3   18022593   18024888   phosphoesterase family protein
AT5G62550   -   0.73   22   chr5   25123207   25124587   similar to unknown protein
AT3G13300   +   0.73   30   chr3    4304576    4309538   VCS (VARICOSE); nucleotide binding|VCS (VARICOSE); nucleotide binding
AT3G50590   +   0.73   33   chr3   18782025   18789919   transducin family protein / WD-40 repeat family protein
AT5G49160   +   0.73   28   chr5   19949757   19955381   MET1 (DECREASED METHYLATION 2DNA)
AT3G21560   +   0.73   25   chr3    7595836    7597560   UGT84A2; UDP-glycosyltransferase/ sinapate 1-glucosyltransferase
AT5G63840   +   0.73   25   chr5   25562337   25565998   RSW3 (RADIAL SWELLING 3); hydrolase, hydrolyzing O-glycosyl compounds
AT5G23110   +   0.73   42   chr5    7758853    7774476   zinc finger (C3HC4-type RING finger) family protein
AT2G33770   -   0.73   42   chr2   14284675   14289223   ATUBC24/PHO2/UBC24 (PHOSPHATE 2); ubiquitin-protein ligase
AT4G20140   +   0.73   21   chr4   10884490   10888109   leucine-rich repeat transmembrane protein kinase, putative
AT5G64813   +   0.73   20   chr5   25927534   25929968   LIP1 (LIGHT INSENSITIVE PERIOD1); GTPase
AT4G39350   +   0.73   22   chr4   18297127   18301500   CESA2 (CELLULOSE SYNTHASE 2); cellulose synthase
AT5G64420   +   0.73   28   chr5   25773943   25778248   DNA polymerase V family
AT2G03140   +   0.73   26   chr2     943028     948651   CAAX amino terminal protease family protein
AT5G48310   -   0.73   28   chr5   19592208   19597330   similar to unknown protein
AT3G12700   +   0.73   20   chr3    4037366    4038750   aspartyl protease family protein
AT1G70200   -   0.73   20   chr1   26435986   26437913   RNA recognition motif (RRM)-containing protein
AT5G55520   -   0.73   21   chr5   22505475   22507433   similar to unknown protein
AT4G22930   +   0.73   22   chr4   12018904   12021465   PYR4 (PYRIMIDIN 4); dihydroorotase
AT4G15180   +   0.73   23   chr4    8651625    8661808   SET domain-containing protein
AT2G47750   -   0.73   33   chr2   19567467   19570236   GH3.9 (PUTATIVE INDOLE-3-ACETIC ACID-AMIDO SYNTHETASE GH3.9)
AT4G14160   +   0.73   25   chr4    8167477    8172318   transport protein, putative|transport protein, putative|transport protein, putative
AT1G62390   -   0.73   23   chr1   23088072   23090691   octicosapeptide/Phox/Bem1p (PB1) domain-containing protein
AT3G55130   -   0.73   25   chr3   20445352   20447007   ATWBC19 (WHITE-BROWN COMPLEX HOMOLOG 19)
AT5G37020   +   0.73   21   chr5   14647348   14650489   ARF8 (AUXIN RESPONSE FACTOR 8)
AT4G38950   -   0.73   26   chr4   18154680   18159591   kinesin motor family protein|-
AT3G14270   +   0.73   23   chr3    4754547    4760640   phosphatidylinositol-4-phosphate 5-kinase family protein
AT2G25170   +   0.73   23   chr2   10721577   10730711   PKL (PICKLE)
AT1G10130   +   0.72   24   chr1    3312849    3322011   ECA3 (ENDOPLASMIC RETICULUM-TYPE CALCIUM-TRANSPORTING ATPASE 3)
AT5G49030   -   0.72   41   chr5   19893668   19899596   OVA2 (OVULE ABORTION 2); ATP binding
AT5G14270   +   0.72   23   chr5    4604809    4608624   ATBET9
AT4G03550   +   0.72   22   chr4    1573619    1578318   ATGSL05 (GLUCAN SYNTHASE-LIKE 5)
AT3G04760   -   0.72   25   chr3    1303648    1305684   pentatricopeptide (PPR) repeat-containing protein
AT3G59290   +   0.72   20   chr3   21922606   21928676   (EPSIN3); binding
AT4G04340   +   0.72   25   chr4    2123115    2126571   early-responsive to dehydration protein-related
AT4G17040   -   0.72   25   chr4    9585757    9589354   ATP-dependent Clp protease proteolytic subunit, putative
AT5G08470   +   0.72   20   chr5    2735934    2742648   PEX1 (PEROXISOME 1); ATPase
AT3G15000   +   0.72   25   chr3    5050349    5052129   Identical to Uncharacterized mitochondrial protein
AT3G03050   +   0.72   23   chr3     687399     691353   CSLD3 (CELLULOSE SYNTHASE-LIKE 3); cellulose synthase
AT1G28440   +   0.72   20   chr1    9996927   10000426   HSL1 (HAESA-LIKE 1); ATP binding / kinase/ protein serine/threonine kinase
AT3G54280   +   0.72   36   chr3   20105091   20114917   ATP binding / DNA binding / helicase
AT1G15290   -   0.72   78   chr1    5257049    5264736   binding
AT5G13630   -   0.72   28   chr5    4387377    4392012   GUN5 (GENOMES UNCOUPLED 5)
AT1G55490   -   0.72   23   chr1   20719290   20722616   CPN60B (CHAPERONIN 60 BETA); ATP binding
AT4G00450   +   0.72   21   chr4     204001     210758   CRP (CRYPTIC PRECOCIOUS)
AT3G18860   +   0.72   21   chr3    6504571    6508541   transducin family protein / WD-40 repeat family protein
AT5G64030   +   0.72   29   chr5   25641391   25645620   dehydration-responsive protein-related
AT3G48190   +   0.72   36   chr3   17808475   17835126   ATM (ATAXIA-TELANGIECTASIA MUTATED)
AT5G01220   -   0.72   27   chr5      86868      89681   SQD2 (SULFOQUINOVOSYLDIACYLGLYCEROL 2)
AT1G72390   +   0.72   23   chr1   27251037   27254160   similar to unnamed protein product [Vitis vinifera] (GB:CAO45587 )
AT2G44160   +   0.72   23   chr2   18269535   18272224   MTHFR2 (METHYLENETETRAHYDROFOLATE REDUCTASE 2)
AT4G28760   +   0.71   25   chr4   14207607   14211581   similar to unknown protein
AT3G15030   +   0.71   20   chr3    5062437    5063839   TCP4 (TCP FAMILY TRANSCRIPTION FACTOR 4)
AT5G19690   +   0.71   20   chr5    6652519    6657209   STT3A (STAUROSPORIN AND TEMPERATURE SENSITIVE 3-LIKE A)
AT3G44330   +   0.71   21   chr3   16017760   16021296   similar to hypothetical protein OsJ_024705
AT3G16760   +   0.71   20   chr3    5703146    5705123   tetratricopeptide repeat (TPR)-containing protein
AT3G02060   +   0.71   32   chr3     354427     358542   DEAD/DEAH box helicase, putative|DEAD/DEAH box helicase, putative
AT3G22380   +   0.71   24   chr3    7913221    7918574   TIC (TIME FOR COFFEE)|TIC (TIME FOR COFFEE)
AT3G26720   +   0.71   30   chr3    9817948    9824410   glycosyl hydrolase family 38 protein|glycosyl hydrolase family 38 protein
AT5G39770   -   0.71   25   chr5   15937164   15944439   repair endonuclease family protein
AT2G04842   -   0.71   25   chr2    1698832    1701255   EMB2761 (EMBRYO DEFECTIVE 2761); threonine-tRNA ligase
AT4G11380   +   0.71   23   chr4    6921282    6925623   beta-adaptin, putative
AT5G39980   -   0.71   28   chr5   16017943   16020219   pentatricopeptide (PPR) repeat-containing protein
AT5G40480   +   0.71   37   chr5   16230619   16240767   EMB3012 (EMBRYO DEFECTIVE 3012)
AT1G30400   +   0.71   29   chr1   10727964   10736412   ATMRP1 (Arabidopsis thaliana multidrug resistance-associated protein 1)
AT3G53180   +   0.71   24   chr3   19718048   19721886   glutamate-ammonia ligase
AT1G06190   -   0.71   27   chr1    1892306    1894077   ATP binding / ATPase, coupled to transmembrane movement of ions
AT1G04430   +   0.71   20   chr1    1198855    1201058   dehydration-responsive protein-related|dehydration-responsive protein-related
AT1G20970   +   0.71   22   chr1    7314129    7319555   adhesin-related
AT4G12420   -   0.7    22   chr4    7349798    7352937   SKU5 (skewed 5); copper ion binding
AT4G30200   -   0.7    22   chr4   14786782   14790421   similar to VIN3 (VERNALIZATION INSENSITIVE 3), protein binding
AT3G45850   -   0.7    20   chr3   16867126   16871878   kinesin motor protein-related
AT3G54400   -   0.7    21   chr3   20151090   20153521   aspartyl protease family protein
AT5G57800   +   0.7    23   chr5   23437581   23441086   CER3/FLP1/WAX2/YRE (ECERIFERUM 3); catalytic
AT1G68890   +   0.7    24   chr1   25900633   25909287   2-oxoglutarate decarboxylase
AT1G19835   -   0.7    20   chr1    6856029    6857508   similar to unknown protein
AT5G08650   -   0.7    21   chr5    2807020    2812446   GTP-binding protein LepA, putative
AT5G39500   +   0.7    20   chr5   15832603   15836811   pattern formation protein, putative
AT3G49220   +   0.7    20   chr3   18260883   18264331   pectinesterase family protein
AT4G28080   -   0.7    52   chr4   13948749   13957093   binding
AT5G21105   +   0.7    24   chr5    7172968    7177259   L-ascorbate oxidase/ copper ion binding
AT3G51640   +   0.7    20   chr3   19165329   19167285   similar to unknown protein
AT3G06810   +   0.7     23     chr3    2146514    2150131   IBR3 (IBA-RESPONSE 3); acyl-CoA dehydrogenase/ oxidoreductase
AT2G46020   +   0.7     20     chr2   18931464   18938597   ATBRM/BRM/CHR2 (ARABIDOPSIS THALIANA BRAHMA)
AT1G30210   -   0.7     25     chr1   10627364   10630453   TCP24; transcription factor
AT4G02260   +   0.7     22     chr4     985356     991118   RSH1 (RELA-SPOT HOMOLOG)
AT2G35630   +   0.69    42     chr2   14973891   14986970   MOR1 (MICROTUBULE ORGANIZATION 1)
AT2G47940   -   0.69    20     chr2   19625174   19628787   DEGP2 (DEGP PROTEASE 2)
AT5G23890   +   0.69    21     chr5    8058738    8062383   similar to unknown protein
AT5G55540   -   0.69    42     chr5   22513565   22517554   TRN1 (TORNADO 1)
AT1G27850   +   0.69    25     chr1    9699154    9703577   similar to unknown protein
AT5G64050   -   0.69    23     chr5   25647409   25650372   ATERS/ERS/OVA3 (OVULE ABORTION 3); glutamate-tRNA ligase
AT2G26330   -   0.69    37     chr2   11215347   11220954   ER (ERECTA)
AT5G60930   -   0.69    20     chr5   24533183   24539214   chromosome-associated kinesin, putative
AT3G56040   -   0.69    45     chr3   20803699   20808328   similar to hypothetical protein OsJ_018104
AT4G04890   -   0.69    20     chr4    2476613    2481011   PDF2 (PROTODERMAL FACTOR2); DNA binding / transcription factor
AT3G22200   +   0.69    20     chr3    7835229    7839029   POP2 (POLLEN-PISTIL INCOMPATIBILITY 2); 4-aminobutyrate transaminase
AT2G31890   -   0.69    33     chr2   13564056   13566759   similar to hypothetical protein [Vitis vinifera] (GB:CAN78554 )
AT1G71220   +   0.69    26     chr1   26845737   26855068   EBS1 (EMS-MUTAGENIZED BRI1 SUPPRESSOR 1)
AT5G03860   -   0.69    31     chr5    1032400    1034537   MLS (MALATE SYNTHASE); malate synthase
AT5G40820   -   0.69    23     chr5   16360386   16371070   ATRAD3 (ATAXIA TELANGIECTASIA-MUTATED AND RAD3-RELATED)
AT4G16940   -   0.68    21     chr4    9533931    9537486   disease resistance protein (TIR-NBS-LRR class), putative
AT5G47480   +   0.68    21     chr5   19274876   19279508   similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G47490)
AT5G05560   +   0.68    24     chr5    1642221    1652379   APC1 (EMBRYO DEFECTIVE 2771); ubiquitin-protein ligase
AT1G06950   -   0.68    25     chr1    2130176    2135487   ATTIC110/TIC110
AT5G07940   +   0.68    23     chr5    2534729    2540016   similar to dentin sialophosphoprotein-related [Arabidopsis thaliana]
AT5G19220   -   0.68    22     chr5    6463938    6466660   ADG2 (ADPG PYROPHOSPHORYLASE 2); glucose-1-phosphate adenylyltransferase
AT2G17820   -   0.68    37     chr2    7750192    7754989   ATHK1 (HISTIDINE KINASE 1)
AT3G50380   -   0.68    24     chr3   18699037   18711449   similar to hypothetical protein OsI_037699
AT2G32730   +   0.68    26     chr2   13887639   13892284   26S proteasome regulatory subunit, putative
AT1G01030   -   0.68   73555   chr1      11906      13446   NGA3 (NGATHA3); transcription factor
AT5G66470   -   0.68    20     chr5   26559009   26561392   GTP binding / RNA binding
AT2G13560   +   0.68    23     chr2    5657117    5662244   malate oxidoreductase, putative
AT4G27595   -   0.68    30     chr4   13772939   13776463   protein transport protein-related
AT5G11710   +   0.68    20     chr5    3772843    3776203   (EPSIN1); binding
AT4G24680   +   0.67    22     chr4   12734243   12739548   similar to unnamed protein product [Vitis vinifera] (GB:CAO64289 )
AT5G10470   -   0.67    23     chr5    3290132    3295913   kinesin motor protein-related|-
AT5G51820   -   0.67    23     chr5   21080725   21085167   PGM (PHOSPHOGLUCOMUTASE)
AT3G12810       +           0.66           20        chr3    4065280    4073272   PIE1 (PHOTOPERIOD-INDEPENDENT EARLY FLOWERING 1)
AT1G20720       -           0.66           28        chr1    7186228    7192673   helicase-related
AT1G58602       +           0.66           31        chr1   21750534   21767025   disease resistance protein (CC-NBS-LRR class)
AT1G64790       -           0.66           41        chr1   24068803   24085283   binding
AT2G39800       -           0.66           23        chr2   16605554   16609551   P5CS1 (DELTA1-PYRROLINE-5-CARBOXYLATE SYNTHASE 1)
AT5G42950       +           0.65           23        chr5   17241942   17247445   GYF domain-containing protein
AT5G66150       -           0.65           21        chr5   26456544   26461574   glycosyl hydrolase family 38 protein
AT1G67120       -           0.64           21        chr1   25074326   25096414   midasin-related
AT5G19390       +           0.64           25        chr5    6531672    6537080   pleckstrin homology (PH) domain-containing protein
AT1G79280       -           0.63           20        chr1   29824696   29837864   NUA (NUCLEAR PORE ANCHOR)
AT2G07698       +           0.63           29        chr2    3361719    3363781   ATP synthase alpha chain, mitochondrial, putative
            1.5-fold down-regulated genes (F1/MPV)
AT4G36700       -           -1.88          41        chr4   17298233   17300277   cupin family protein
AT3G17520       -           -1.76          28        chr3    5999396    6000375   late embryogenesis abundant domain-containing protein
AT2G16005       -           -1.68          22        chr2    6966251    6967190   MD-2-related lipid recognition domain-containing protein
AT4G11650       -           -1.63          25        chr4    7024982    7026056   ATOSM34 (OSMOTIN 34)
AT5G40420       -           -1.56          22        chr5   16190661   16191932   OLEO2 (OLEOSIN 2)
AT2G42560       -           -1.51          53        chr2   17721920   17723899   late embryogenesis abundant domain-containing protein
AT4G16260       -           -1.42          30        chr4    9200114    9201448   glycosyl hydrolase family 17 protein
AT2G33790       -            -1.4          20        chr2   14300921   14302236   pollen Ole e 1 allergen and extensin family protein
AT5G48430       -            -1.4          33        chr5   19645115   19646310   aspartic-type endopeptidase/ pepsin A
AT5G37990       -           -1.29          39        chr5   15150999   15152682   S-adenosylmethionine-dependent methyltransferase
AT2G18193       -           -1.29          26        chr2    7924763    7926003   AAA-type ATPase family protein
AT2G41240       -           -1.28          22        chr2   17205418   17206372   BHLH100; DNA binding
AT3G01290       -           -1.25          31        chr3      88089      89366   band 7 family protein
AT5G44120       -           -1.23          35        chr5   17773593   17775447   CRA1 (CRUCIFERINA)
AT3G53040       -           -1.23          29        chr3   19676186   19677332   late embryogenesis abundant protein, putative
AT3G56980       -           -1.22          26        chr3   21097533   21098432   BHLH039/ORG3 (OBP3-RESPONSIVE GENE 3)
AT3G50740       -           -1.22          41        chr3   18866203   18867766   UGT72E1 (UDP-glucosyl transferase 72E1)
AT1G30370       -           -1.21          27        chr1   10719192   10720306   lipase class 3 family protein
AT3G22640       -           -1.21          27        chr3    8011924    8013843   cupin family protein
AT5G63600       -           -1.92          34        chr5   25478059   25479622   flavonol synthase, putative
AT3G24300       -           -1.81          28        chr3    8806116    8807222   AMT1;3/ATAMT1;3 (AMMONIUM TRANSPORTER 1;3)
AT5G44310       -           -1.44          26        chr5   17865227   17866244   late embryogenesis abundant domain-containing protein
AT2G28490       -            -1.1          24        chr2   12185978   12187760   cupin family protein
AT5G43350       -           -1.09          48        chr5   17417100   17418860   ATPT1 (PHOSPHATE TRANSPORTER 1)
AT3G56970   -   -1.09   27   chr3   21095107   21096100   BHLH038/ORG2 (OBP3-RESPONSIVE GENE 2)
AT5G56080   -   -1.09   25   chr5   22728651   22729563   nicotianamine synthase, putative
AT2G27660   -   -1.08   46   chr2   11805632   11807767   DC1 domain-containing protein
AT4G08770   -   -1.07   20   chr4    5598565    5600244   peroxidase, putative
AT2G46750   -   -1.04   48   chr2   19215414   19217883   FAD-binding domain-containing protein
AT5G24780   -   -1.04   25   chr5    8507640    8508960   VSP1 (VEGETATIVE STORAGE PROTEIN 1)
AT5G59520   -   -1.03   34   chr5   24008494   24009856   ZIP2 (ZINC TRANSPORTER 2 PRECURSOR)
AT1G70850   -   -1.03   34   chr1   26718896   26720393   MLP34 (MLP-LIKE PROTEIN 34)
AT4G19810   -   -1.03   30   chr4   10764115   10765737   glycosyl hydrolase family 18 protein
AT1G12030   -   -1.02   24   chr1    4064691    4066319   similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G62420 )
AT3G45410   -   -1.01   52   chr3   16665011   16666990   lectin protein kinase family protein
AT5G64120   -   -1.01   28   chr5   25676566   25678186   peroxidase, putative
AT5G58390   -   -1.01   28   chr5   23616964   23618393   peroxidase, putative
AT1G73330   -   -1.01   23   chr1   27572454   27573297   ATDR4 (Arabidopsis thaliana drought-repressed 4)
AT5G38030   -    -1     52   chr5   15188555   15192548   MATE efflux family protein
AT3G04720   -    -1     28   chr3    1285553    1286555   PR4 (PATHOGENESIS-RELATED 4)
AT4G02410   -   -0.99   27   chr4    1060126    1062101   lectin protein kinase family protein
AT3G08860   -   -0.99   41   chr3    2696593    2698968   alanine--glyoxylate aminotransferase, putative
AT4G36430   -   -0.98   27   chr4   17204503   17205834   peroxidase, putative
AT1G01580   +   -0.97   31   chr1     209409     212857   FRO2 (FERRIC REDUCTION OXIDASE 2); ferric-chelate reductase
AT3G54040   -   -0.96   26   chr3   20024802   20026230   photoassimilate-responsive protein-related
AT3G20250   -   -0.96   59   chr3    7059278    7063131   APUM5 (ARABIDOPSIS PUMILIO 5); RNA binding
AT5G59090   -   -0.96   43   chr5   23869422   23872159   ATSBT4 2; subtilase|-|-
AT4G37160   -   -0.96   22   chr4   17495108   17497106   SKS15 (SKU5 Similar 15); copper ion binding
AT2G35930   -   -0.96   29   chr2   15089960   15091105   U-box domain-containing protein
AT1G69810   -   -0.96   24   chr1   26280979   26282765   WRKY36 (WRKY DNA-binding protein 36); transcription factor
AT1G66280   -   -0.95   29   chr1   24710529   24713342   glycosyl hydrolase family 1 protein
AT1G74460   -   -0.95   27   chr1   27991636   27993422   GDSL-motif lipase/hydrolase family protein
AT5G48000   -   -0.95   34   chr5   19461570   19464216   CYP708A2 (cytochrome P450, family 708, subfamily A, polypeptide 2)
AT4G28530   -   -0.95   21   chr4   14090571   14094521   ANAC074 (Arabidopsis NAC domain containing protein 74)
AT1G32450   -   -0.94   32   chr1   11715306   11719807   proton-dependent oligopeptide transport (POT) family protein
AT5G36140   -   -0.94   24   chr5   14229481   14230465   CYP716A2 (cytochrome P450, family 716, subfamily A, polypeptide 2)
AT3G30775   -   -0.94   40   chr3   12451353   12453592   ERD5 (EARLY RESPONSIVE TO DEHYDRATION 5); proline dehydrogenase
AT2G30840   -   -0.94   27   chr2   13142553   13143615   2-oxoglutarate-dependent dioxygenase, putative
AT5G27920   -   -0.94   27   chr5    9942524    9944485   F-box family protein
AT3G26590   -   -0.93   40   chr3    9763070    9766528   MATE efflux family protein
AT5G61140   +   -0.92   20   chr5   24610830   24620573   DEAD box RNA helicase, putative
AT1G61560   -   -0.92   34   chr1   22712438   22715633   MLO6 (MILDEW RESISTANCE LOCUS O 6); calmodulin binding
AT2G48080   -   -0.92   31   chr2   19672263   19674013   oxidoreductase, 2OG-Fe(II) oxygenase family protein
AT4G32650   -   -0.91   35   chr4   15751534   15754288   ATKC1 (ARABIDOPSIS THALIANA K+ RECTIFYING CHANNEL 1)
AT5G49360   -   -0.91   69   chr5   20029132   20033858   BXL1 (BETA-XYLOSIDASE 1); hydrolase, hydrolyzing O-glycosyl compounds
AT5G39580   -   -0.91   26   chr5   15864442   15866225   peroxidase, putative|-
AT1G64780   -   -0.9    36   chr1   24064561   24066164   ATAMT1;2 (AMMONIUM TRANSPORTER 1;2); ammonium transmembrane transporter
AT1G07550   -   -0.9    21   chr1    2322653    2325921   leucine-rich repeat protein kinase, putative
AT5G06750   -   -0.9    33   chr5    2086323    2088075   protein phosphatase 2C family protein / PP2C family protein
AT5G61250   -   -0.9    22   chr5   24649723   24651376   ATGUS1 (ARABIDOPSIS THALIANA GLUCURONIDASE 1); beta-glucuronidase
AT2G41800   -   -0.9    20   chr2   17443654   17444813   similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G41810 )
AT2G28960   -   -0.9    49   chr2   12445150   12449394   leucine-rich repeat protein kinase, putative
AT1G23020   -   -0.89   59   chr1    8150109    8153313   ATFRO3/FRO3 (FERRIC REDUCTION OXIDASE 3); ferric-chelate reductase
AT5G05400   -   -0.89   27   chr5    1597903    1600361   disease resistance protein (CC-NBS-LRR class), putative
AT3G46330   -   -0.89   32   chr3   17032592   17035990   MEE39 (maternal effect embryo arrest 39); kinase
AT3G22800   -   -0.89   22   chr3    8063327    8064504   leucine-rich repeat family protein / extensin family protein
AT2G38020   -   -0.89   29   chr2   15917745   15921185   VCL1 (VACUOLELESS 1)|-
AT5G23240   -   -0.89   27   chr5    7826906    7828705   DNAJ heat shock N-terminal domain-containing protein
AT4G25090   -   -0.88   43   chr4   12879147   12883569   respiratory burst oxidase, putative / NADPH oxidase, putative
AT2G04090   -   -0.88   23   chr2    1362730    1364548   MATE efflux family protein
AT5G27100   -   -0.88   55   chr5    9535146    9538332   ATGLR2 (Arabidopsis thaliana glutamate receptor 2 )
AT1G69450   -   -0.87   33   chr1   26110802   26113681   similar to HYP1 (HYPOTHETICAL PROTEIN 1)
AT4G17280   -   -0.87   25   chr4    9678917    9680279   auxin-responsive family protein
AT3G53510   -   -0.87   25   chr3   19848264   19850412   ABC transporter family protein
AT1G51790   -   -0.87   50   chr1   19210545   19214990   kinase
AT1G51860   -   -0.87   50   chr1   19261307   19265080   leucine-rich repeat protein kinase, putative
AT1G80830   -   -0.87   36   chr1   30377817   30380540   NRAMP1 (NRAMP metal ion transporter 1)
AT3G13900   +   -0.87   20   chr3    4586827    4590499   haloacid dehalogenase-like hydrolase family protein
AT2G37035   -   -0.87   24   chr2   15562328   15563696   similar to unnamed protein product [Vitis vinifera] (GB:CAO18172 )
AT1G23720   +   -0.86   56   chr1    8388744    8391214   proline-rich extensin-like family protein
AT5G45070   -   -0.86   31   chr5   18205163   18206550   ATPP2-A8 (Phloem protein 2-A8); transmembrane receptor
AT2G27000   -   -0.86   26   chr2   11530614   11532089   CYP705A8 (cytochrome P450, family 705, subfamily A, polypeptide 8)
AT4G11850   -   -0.86   32   chr4    7129415    7132554   PLDGAMMA1 (maternal effect embryo arrest 54); phospholipase D
AT4G17230   -   -0.86   33   chr4    9661051    9663748   SCL13 (SCARECROW-LIKE 13); transcription factor
AT1G21110   -   -0.86   23   chr1    7390155    7391458   O-methyltransferase, putative
AT1G26440   -   -0.85   23   chr1    9143968    9145895   ATUPS5 (ARABIDOPSIS THALIANA UREIDE PERMEASE 5)
AT2G18540   -   -0.85   26   chr2    8050155    8052084   cupin family protein
AT3G11960   +   -0.85   20   chr3    3786613    3792953   cleavage and polyadenylation specificity factor (CPSF)
AT5G64100   -   -0.85   29   chr5   25668050   25669105   peroxidase, putative
AT4G28900   +   -0.85   21   chr4   14259767   14263318   transposable element gene|Transposon - ATCOPIA46
AT5G40240   -   -0.85   23   chr5   16099561   16101585   nodulin MtN21 family protein
AT3G59660   -   -0.85   27   chr3   22045983   22049262   C2 domain-containing protein / GRAM domain-containing protein
AT3G09940   -   -0.84   29   chr3    3056528    3059069   ATMDAR3/MDHAR (MONODEHYDROASCORBATE REDUCTASE)
AT2G23770   -   -0.84   25   chr2   10127386   10129145   protein kinase family protein / peptidoglycan-binding LysM domain-containing protein
AT2G21840   -   -0.84   31   chr2    9314439    9316745   protein binding / zinc ion binding
AT1G51890   -   -0.84   33   chr1   19279141   19282169   leucine-rich repeat protein kinase, putative
AT2G04620   -   -0.84   22   chr2    1611002    1612350   cation efflux family protein
AT1G51870   -   -0.84   31   chr1   19266644   19270371   protein kinase family protein
AT4G12330   -   -0.84   20   chr4    7317852    7319377   CYP706A7 (cytochrome P450, family 706, subfamily A, polypeptide 7); oxygen binding
AT4G26080   -   -0.84   21   chr4   13220441   13222177   ABI1 (ABA INSENSITIVE 1); calcium ion binding / protein serine/threonine phosphatase
AT1G57590   -   -0.83   24   chr1   21331427   21333251   carboxylesterase
AT2G19900   -   -0.83   35   chr2    8599217    8602360   ATNADP-ME1 (NADP-MALIC ENZYME 1)
AT4G30080   -   -0.83   22   chr4   14703743   14706322   ARF16 (AUXIN RESPONSE FACTOR 16); miRNA binding / transcription factor
AT5G44390   -   -0.83   27   chr5   17899753   17902029   FAD-binding domain-containing protein
AT4G27300   -   -0.83   36   chr4   13669406   13672283   S-locus protein kinase, putative
AT2G39200   -   -0.83   26   chr2   16363399   16366823   MLO12 (MILDEW RESISTANCE LOCUS O 12); calmodulin binding
AT3G60961   +   -0.83   33   chr3   22552551   22561773   ATP binding / nucleobase, nucleoside, nucleotide kinase
AT5G45410   -   -0.83   21   chr5   18419232   18420314   similar to unknown protein
AT1G51820   -   -0.83   27   chr1   19241351   19245541   leucine-rich repeat protein kinase, putative
AT3G55150   -   -0.83   25   chr3   20451658   20453250   ATEXO70H1 (exocyst subunit EXO70 family protein H1); protein binding
AT5G43400   -   -0.82   27   chr5   17443309   17444997   similar to unknown protein
AT5G49270   -   -0.82   26   chr5   19989299   19991334   COBL9/MRH4/SHV2 (COBRA-LIKE 9, SHAVEN 2); carbohydrate binding
AT3G51350   -   -0.82   20   chr3   19071444   19074210   aspartyl protease family protein
AT5G01550   -   -0.82   25   chr5     214628     216567   lectin protein kinase, putative
AT4G21903   -   -0.82   28   chr4   11621356   11623628   antiporter/ drug transporter
AT4G36140   -   -0.82   25   chr4   17099054   17102778   disease resistance protein (TIR-NBS-LRR class), putative
AT5G54040   -   -0.82   31   chr5   21946203   21947532   DC1 domain-containing protein
AT4G11610   -   -0.82   20   chr4    7014360    7017787   C2 domain-containing protein
AT5G13990   -   -0.82   21   chr5    4514851    4516865   ATEXO70C2 (exocyst subunit EXO70 family protein C2); protein binding
AT2G31390   -   -0.82   20   chr2   13391042   13392888   pfkB-type carbohydrate kinase family protein
AT3G13790   -   -0.82   25   chr3    4533001    4535266   ATBFRUCT1/ATCWINV1 (ARABIDOPSIS THALIANA CELL WALL INVERTASE 1)
AT2G28671   +   -0.82   30   chr2   12307349   12308717   contains domain PRICHEXTENSN (PR01217)
AT2G28670    -   -0.82   30   chr2   12307349   12308717   disease resistance-responsive family protein / fibroin-related
AT1G51830    -   -0.82   42   chr1   19246754   19249508   ATP binding / kinase/ protein serine/threonine kinase
AT5G17380    -   -0.82   24   chr5    5724854    5726450   pyruvate decarboxylase family protein
AT5G42580    -   -0.81   27   chr5   17040938   17042370   CYP705A12 (cytochrome P450, family 705, subfamily A, polypeptide 12)
AT2G28110    -   -0.81   32   chr2   11985110   11986900   FRA8 (FRAGILE FIBER8); transferase
AT2G11450    -   -0.81   30   chr2    4581750    4588275   transposable element gene|Transposon - ATHILA0_I
AT1G08050    -   -0.81   20   chr1    2499231    2500877   zinc finger (C3HC4-type RING finger) family protein
AT3G32980    -   -0.81   32   chr3   13529966   13533629   peroxidase 32 (PER32) (P32) (PRXR3)
AT2G28860    -   -0.81   24   chr2   12395320   12396798   CYP710A4 (cytochrome P450, family 710, subfamily A, polypeptide 4); oxygen binding
AT3G04010    -   -0.81   21   chr3    1037177    1039485   glycosyl hydrolase family 17 protein
AT5G40480    +   -0.81   24   chr5   16230726   16238776   EMB3012 (EMBRYO DEFECTIVE 3012)
AT4TE14520   -   -0.81   20   chr4    3160978    3168057   Transposon - VANDAL3
AT2TE02465   +   -0.81   20   chr2     567528     581690   Transposon - ARNOLD1
AT5G04020    -   -0.81   23   chr5    1081935    1085570   calmodulin-binding protein-related (PICBP)
AT5G49850    -   -0.8    23   chr5   20277697   20279108   jacalin lectin family protein
AT1G56280    -   -0.8    21   chr1   21076653   21078284   ATDI19 (Arabidopsis thaliana drought-induced 19)
AT4G10380    -   -0.8    24   chr4    6431777    6434773   NIP5;1/NLM6/NLM8 (NOD26-like intrinsic protein 5;1); boron transporter/ water channel
AT4G01920    -   -0.8    40   chr4     829051     831028   DC1 domain-containing protein
AT4G25620    -   -0.8    21   chr4   13068097   13069301   hydroxyproline-rich glycoprotein family protein
AT5G38020    -   -0.8    27   chr5   15182943   15184757   S-adenosyl-L-methionine:carboxyl methyltransferase family protein
AT1G18910    -   -0.8    26   chr1    6532757    6537208   protein binding / zinc ion binding
AT4G36380    -   -0.8    22   chr4   17187761   17192136   ROT3 (ROTUNDIFOLIA 3); oxygen binding / steroid hydroxylase
AT3G16690    -   -0.8    22   chr3    5684414    5686242   nodulin MtN3 family protein
AT2G26650    -   -0.8    40   chr2   11339090   11343412   AKT1 (ARABIDOPSIS K TRANSPORTER 1); cyclic nucleotide binding
AT3G51330    -   -0.8    31   chr3   19064384   19067108   aspartyl protease family protein
AT3G28345    -   -0.8    70   chr3   10595090   10599984   ABC transporter family protein
AT3G27510    -   -0.8    26   chr3   10189657   10191137   protein binding / zinc ion binding
AT2G14100    -   -0.8    20   chr2    5942070    5942961   CYP705A13 (cytochrome P450, family 705, subfamily A, polypeptide 13); oxygen binding
AT3G12500    -   -0.79   21   chr3    3962636    3963868   ATHCHIB (BASIC CHITINASE); chitinase
AT4G01540    -   -0.79   24   chr4     670499     672373   ANAC068/NTM1 (NAC WITH TRANSMEMBRANE MOTIF1); transcription activator
AT3G01720    -   -0.79   23   chr3     262284     265550   similar to unknown protein
AT3G24670    -   -0.79   20   chr3    9005972    9007783   pectate lyase family protein
AT2G47000    -   -0.79   70   chr2   19316937   19321632   MDR4/PGP4 (P-GLYCOPROTEIN4)
AT3G29250    -   -0.79   26   chr3   11195020   11196039   similar to short-chain dehydrogenase
AT4G32920    -   -0.79   26   chr4   15887584   15896008   glycine-rich protein
AT1G74770    -   -0.79   62   chr1   28093237   28098381   protein binding / zinc ion binding
AT2G39380    -   -0.79   25   chr2   16454130   16455885   ATEXO70H2 (EXOCYST SUBUNIT EXO70 FAMILY PROTEIN H2); protein binding
AT5G03380    -   -0.79   30   chr5     832255     833824   heavy-metal-associated domain-containing protein
AT2G15390    -   -0.79   21   chr2    6716641    6717835   FUT4 (fucosyltransferase 4); fucosyltransferase
AT3G46700    -   -0.79   21   chr3   17211325   17212722   UDP-glycosyltransferase/ transferase, transferring glycosyl groups
AT1G20390    +   -0.79   37   chr1    7066605    7071246   transposable element gene|Transposon - ATLANTYS2
AT1G13970    -   -0.78   22   chr1    4779776    4781998   similar to unknown protein
AT1G51850    -   -0.78   39   chr1   19256732   19260406   leucine-rich repeat protein kinase, putative
AT1G11100    -   -0.78   38   chr1    3704243    3709129   SNF2 domain-containing protein
AT3G14050    -   -0.78   51   chr3    4650813    4653766   RSH2 (RELA-SPOT HOMOLOG); catalytic
AT5G42590    -   -0.78   26   chr5   17048399   17050930   CYP71A16 (cytochrome P450, family 71, subfamily A, polypeptide 16); oxygen binding
AT1TE38530   +   -0.78   20   chr1   11887656   11899952   Transposon - ARNOLD2
AT4G06744    -   -0.78   26   chr4    4070827    4072251   leucine-rich repeat family protein / extensin family protein
AT5G51060    -   -0.78   60   chr5   20774719   20779548   RHD2 (ROOT HAIR DEFECTIVE 2)
AT4G29700    -   -0.78   28   chr4   14543684   14545021   type I phosphodiesterase/nucleotide pyrophosphatase family protein
AT2G01830    -   -0.78   25   chr2     363353     367127   WOL (WOODEN LEG)
AT3G04240    -   -0.78   23   chr3    1115762    1120773   SEC (SECRET AGENT); transferase, transferring glycosyl groups
AT5G63760    -   -0.78   22   chr5   25533400   25534921   IBR domain-containing protein|-
AT1G62800    -   -0.78   36   chr1   23257606   23261057   ASP4 (ASPARTATE AMINOTRANSFERASE 4)
AT2G23620    -   -0.77   21   chr2   10054472   10056272   esterase, putative
AT1G10090    -   -0.77   25   chr1    3290772    3296124   similar to RXW8 [Arabidopsis thaliana] (TAIR:AT1G58520 )
AT2G41830    -   -0.77   28   chr2   17457830   17463276   cyclin-related
AT2G33980    -   -0.77   21   chr2   14356872   14366343   ATNUDT22 (Arabidopsis thaliana Nudix hydrolase homolog 22); hydrolase
AT1G66270    -   -0.77   21   chr1   24704021   24706578   beta-glucosidase (PSR3.2)|-
AT3G47340    -   -0.77   21   chr3   17449644   17451667   ASN1 (DARK INDUCIBLE 6)
AT1G61360    -   -0.77   20   chr1   22641773   22644605   S-locus lectin protein kinase family protein
AT5G38550    -   -0.77   20   chr5   15450217   15452474   jacalin lectin family protein
AT5G13170    -   -0.77   21   chr5    4181364    4182629   nodulin MtN3 family protein
AT1G64170    -   -0.77   35   chr1   23818968   23821643   ATCHX16 (CATION/H+ EXCHANGER 16); monovalent cation:proton antiporter
AT1G06840    -   -0.76   21   chr1    2098486    2103381   leucine-rich repeat transmembrane protein kinase, putative
AT5G37600    -   -0.76   21   chr5   14950657   14953006   ATGSR1 (Arabidopsis thaliana glutamine synthase clone R1)
AT4G03460    -   -0.76   22   chr4    1537245    1540081   ankyrin repeat family protein
AT1G21920    -   -0.76   20   chr1    7704701    7705912   MORN (Membrane Occupation and Recognition Nexus) repeat-containing protein
AT3G27220    -   -0.76   22   chr3   10052879   10054913   kelch repeat-containing protein
AT1TE41350   -   -0.76   20   chr1   12674870   12679066   Transposon - VANDAL16
AT4G22485    -   -0.76   26   chr4   11844559   11846405   Encodes a Protease inhibitor/seed storage/LTP family protein
AT1G64400    -   -0.76   34   chr1   23919936   23923345   long-chain-fatty-acid--CoA ligase, putative / long-chain acyl-CoA synthetase, putative
AT5G48110    -   -0.76   25   chr5   19518773   19521186   terpene synthase/cyclase family protein
AT1G64110    -   -0.75   44   chr1   23800734   23804769   AAA-type ATPase family protein
AT3G21070    -   -0.75   28   chr3    7380350    7383982   NADK1 (NAD kinase 1); NAD+ kinase/ NADH kinase/ calmodulin binding|-
AT5G23190    -   -0.75   33   chr5    7803255    7805659   CYP86B1 (cytochrome P450, family 86, subfamily B, polypeptide 1); oxygen binding
AT2TE23965   -   -0.75   32   chr2    5893489    5907146   Transposon - VANDAL13
AT5G49990    -   -0.75   24   chr5   20355017   20359004   xanthine/uracil permease family protein
AT5G49730    -   -0.75   39   chr5   20218613   20221520   ATFRO6/FRO6 (FERRIC REDUCTION OXIDASE 6); ferric-chelate reductase
AT5G24740    -   -0.75   30   chr5    8470945    8489599   similar to unknown protein
AT4G02760    -   -0.75   22   chr4    1225126    1228663   F-box family protein
AT5G25350    -   -0.75   23   chr5    8794515    8796414   EBF2 (EIN3-BINDING F BOX PROTEIN 2)
AT2G33630    -   -0.75   25   chr2   14244155   14245401   3-beta hydroxysteroid dehydrogenase/isomerase family protein
AT4G01870    -   -0.75   23   chr4     808763     810231   tolB protein-related
AT1G60140    -   -0.75   38   chr1   22180773   22184488   ATTPS10 (TREHALOSE PHOSPHATE SYNTHASE)
AT3G22750    -   -0.75   23   chr3    8037365    8039617   protein kinase, putative
AT1G02660    -   -0.75   22   chr1     572633     574376   lipase class 3 family protein
AT3G54100    -   -0.75   33   chr3   20045193   20048885   similar to unknown protein
AT1G21310    -   -0.75   27   chr1    7453363    7454807   ATEXT3 (EXTENSIN 3); structural constituent of cell wall
AT1G45616    -   -0.75   21   chr1   17186251   17188905   leucine-rich repeat family protein
AT3G13330    -   -0.75   33   chr3    4320199    4329903   binding
AT3G62455    -   -0.74   23   chr3   23111723   23115184   transposable element gene|Transposon - ATCOPIA23
AT5G07360    -   -0.74   21   chr5    2326740    2329829   amidase family protein
AT5G42870    -   -0.74   20   chr5   17204708   17206683   lipin family protein
AT5G51200    +   -0.74   24   chr5   20823248   20836021   similar to unnamed protein product
AT3G57330    -   -0.74   30   chr3   21223706   21227139   ACA11 (AUTOINHIBITED CA2+-ATPASE 11)
AT2G34830    -   -0.74   20   chr2   14701357   14703424   WRKY35 (WRKY DNA-BINDING PROTEIN 35); transcription factor
AT4G33300    -   -0.74   45   chr4   16051210   16056263   ADR1-L1 (ADR1-LIKE 1); ATP binding / protein binding
AT2G37130    -   -0.74   27   chr2   15605430   15606812   peroxidase 21 (PER21) (P21) (PRXR5)
AT5G36870    +   -0.74   20   chr5   14536465   14549736   ATGSL09 (GLUCAN SYNTHASE-LIKE 9); 1,3-beta-glucan synthase
AT4G22590    -   -0.74   21   chr4   11894049   11896438   trehalose-6-phosphate phosphatase, putative
AT1G20840    -   -0.74   32   chr1    7246030    7248122   TMT1 (TONOPLAST MONOSACCHARIDE TRANSPORTER1)
AT2G20630    -   -0.74   24   chr2    8905015    8906846   protein phosphatase 2C, putative / PP2C, putative
AT4G01910    -   -0.74   25   chr4     824786     826341   DC1 domain-containing protein
AT1G10170    -   -0.73   25   chr1    3334058    3336242   ATNFXL1; transcription factor
AT2G28890    -   -0.73   28   chr2   12413125   12415261   PLL4 (POLTERGEIST LIKE 4); protein serine/threonine phosphatase
AT4G02290    -   -0.73   27   chr4    1002705    1004999   ATGH9B13 (ARABIDOPSIS THALIANA GLYCOSYL HYDROLASE 9B13)
AT2G39210    -   -0.73   20   chr2   16373375   16375178   nodulin family protein
AT1G04220    -   -0.73   24   chr1    1119727    1122413   beta-ketoacyl-CoA synthase, putative
AT3G30842    -   -0.73   22   chr3   12597230   12602910   ATPDR10/PDR10 (PLEIOTROPIC DRUG RESISTANCE 10)
AT1G29020    -   -0.73   23   chr1   10120530   10126718   calcium-binding EF hand family protein
AT4G15210    -   -0.73   22   chr4    8667062    8669331   ATBETA-AMY (BETA-AMYLASE); beta-amylase
AT5G11850    -   -0.73   21   chr5    3816755    3820666   protein kinase family protein
AT3G14590    -   -0.73   34   chr3    4904429    4907768   NTMC2T6.2/NTMC2TYPE6.2
AT5G11250    -   -0.73   20   chr5    3588253    3591663   disease resistance protein (TIR-NBS-LRR class), putative
AT5G45140    -   -0.73   32   chr5   18265767   18275128   NRPC2 (nuclear RNA polymerase C 2); DNA binding
AT1G15210    -   -0.73   70   chr1    5231523    5236422   ATPDR7/PDR7 (PLEIOTROPIC DRUG RESISTANCE 7)
AT4G33430    -   -0.73   21   chr4   16086463   16090293   BAK1 (BRI1-ASSOCIATED RECEPTOR KINASE); kinase
AT1G09170    -   -0.73   25   chr1    2956681    2961075   kinesin motor protein-related
AT2G18450    -   -0.73   23   chr2    8004642    8007602   SDH1-2 (Succinate dehydrogenase 1-2)
AT5TE38675   -   -0.73   21   chr5   10597797   10604693   Transposon - VANDAL9
AT5G40450    -   -0.73   20   chr5   16201886   16209693   similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G28770 )
AT2TE16930   -   -0.73   29   chr2    3994360    4008626   Transposon - VANDAL4
AT3G01100    -   -0.72   23   chr3      35279      38073   HYP1 (HYPOTHETICAL PROTEIN 1)
AT3TE58960   -   -0.72   22   chr3   14377758   14385319   Transposon - VANDAL10
AT2TE12225   -   -0.72   20   chr2    2766509    2779354   Transposon - VANDAL9
AT5TE41250   -   -0.72   25   chr5   11410309   11423509   Transposon - ATLANTYS3
AT1G56145    -   -0.72   25   chr1   21012375   21017572   leucine-rich repeat family protein / protein kinase family protein
AT2TE21295   -   -0.72   32   chr2    5199349    5216797   Transposon - VANDAL3
AT4G23850    -   -0.72   20   chr4   12403581   12406970   long-chain-fatty-acid--CoA ligase / long-chain acyl-CoA synthetase
AT2G41250    -   -0.72   23   chr2   17207964   17209552   haloacid dehalogenase-like hydrolase family protein
AT4G16870    -   -0.72   25   chr4    9484157    9488277   transposable element gene|Transposon - ATCOPIA4
AT3G47810    -   -0.72   20   chr3   17648513   17650585   MAG1 (MAIGO 1); protein serine/threonine phosphatase
AT3G48190    +   -0.72   53   chr3   17808588   17836922   ATM (ATAXIA-TELANGIECTASIA MUTATED)
AT1G13210    -   -0.72   28   chr1    4509491    4513798   ACA.L (AUTOINHIBITED CA2+/ATPASE II); ATPase
AT1G56140    -   -0.72   38   chr1   21005364   21011456   leucine-rich repeat family protein / protein kinase family protein
AT2G20010    -   -0.72   25   chr2    8645071    8648475   similar to unknown protein
AT3G45300    -   -0.72   24   chr3   16631662   16635681   IVD (ISOVALERYL-COA-DEHYDROGENASE)
AT3G57520    -   -0.72   35   chr3   21300255   21303975   ATSIP2 (ARABIDOPSIS THALIANA SEED IMBIBITION 2)
AT1G48930    -   -0.71   28   chr1   18105358   18108106   ATGH9C1 (ARABIDOPSIS THALIANA GLYCOSYL HYDROLASE 9C1)
AT4G03190    -   -0.71   23   chr4    1404984    1407059   GRH1 (GRR1-LIKE PROTEIN 1); ubiquitin-protein ligase
AT3G23430    -   -0.71   25   chr3    8387649    8392925   PHO1 (PHOSPHATE 1)
AT5G41990    -   -0.71   28   chr5   16812426   16815199   WNK8 (Arabidopsis WNK kinase 8); kinase
AT1G70300    -   -0.71   44   chr1   26481559   26485277   KUP6 (K+ uptake permease 6); potassium ion transmembrane transporter
AT3G01420    -   -0.71   24   chr3     159764     162624   ALPHA-DOX1 (ALPHA-DIOXYGENASE 1)
AT5G24120    -   -0.71   24   chr5    8157836    8159708   SIGE (RNA polymerase sigma subunit E); DNA binding
AT4G29900    -   -0.71   20   chr4   14611223   14618161   ACA10 (autoinhibited Ca2+ -ATPase 10)
AT5G54780    -   -0.71   22   chr5   22266038   22268901   RAB GTPase activator
AT1G18270    -   -0.71   36   chr1    6283712    6293758   ketose-bisphosphate aldolase class-II family protein
AT2TE16800   -   -0.71   30   chr2    3950044    3968849   Transposon - ATLANTYS3
AT5G50900    -   -0.71   27   chr5   20722408   20723513   armadillo/beta-catenin repeat family protein
AT4G33150    -   -0.71   57   chr4   15985227   15991047   LKR (SACCHAROPINE DEHYDROGENASE)
AT1G66880    +   -0.71   24   chr1   24951436   24959245   serine/threonine protein kinase family protein
AT4G14370    -   -0.71   21   chr4    8276312    8283015   disease resistance protein (TIR-NBS-LRR class), putative
AT1TE41745   +   -0.71   23   chr1   12818404   12836898   Transposon - VANDAL5
AT1G11910    -   -0.71   23   chr1    4017275    4020952   aspartyl protease family protein
AT5G33428    +   -0.7    20   chr5   12738289   12744216   transposable element gene|Transposon - ATENSPM7
AT3G02020    -   -0.7    23   chr3     340562     343350   aspartate kinase, lysine-sensitive, putative
AT1G35580    -   -0.7    25   chr1   13123316   13124593   CINV1 (CYTOSOLIC INVERTASE 1); beta-fructofuranosidase
AT3G57410    -   -0.7    27   chr3   21254144   21261764   VLN3 (VILLIN 3); actin binding
AT3G21250    -   -0.7    25   chr3    7458384    7462692   ATMRP6 (Arabidopsis thaliana multidrug resistance-associated protein 6)
AT5G06970    -   -0.7    21   chr5    2158592    2165757   similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G20010.2)
AT4G30190    -   -0.7    32   chr4   14770701   14776022   AHA2 (Arabidopsis H(+)-ATPase 2); ATPase
AT4G26270    -   -0.7    27   chr4   13300838   13304180   phosphofructokinase family protein
AT2G25140    -   -0.7    30   chr2   10705330   10709056   CLPB-M/CLPB4/HSP98.7 (HEAT SHOCK PROTEIN 98.7); ATP binding / ATPase
AT1G68940    -   -0.7    20   chr1   25925681   25928265   armadillo/beta-catenin repeat protein-related / U-box domain-containing protein
AT4G12010    -   -0.7    30   chr4    7197220    7201114   disease resistance protein (TIR-NBS-LRR class), putative
AT4G21680    -   -0.7    23   chr4   11517792   11519332   proton-dependent oligopeptide transport (POT) family protein
AT5G01050    -   -0.7    20   chr5      18307      20693   laccase family protein / diphenol oxidase family protein
AT1G45150    -   -0.69   20   chr1   17080183   17084779   similar to predicted protein [Physcomitrella patens subsp. patens]
AT1G72300    -   -0.69   32   chr1   27221461   27224239   leucine-rich repeat transmembrane protein kinase, putative
AT1G50030    -   -0.69   36   chr1   18527186   18543179   TOR (TARGET OF RAPAMYCIN)
AT1G05570    -   -0.69   28   chr1    1648414    1658439   CALS1 (CALLOSE SYNTHASE 1); transferase, transferring glycosyl groups
AT5G20840    -   -0.69   21   chr5    7061170    7069080   phosphoinositide phosphatase family protein
AT4G27320    -   -0.69   26   chr4   13678526   13680431   universal stress protein (USP) family protein
AT5G38280    -   -0.69   20   chr5   15310388   15314517   PR5K (PR5-like receptor kinase); kinase/ transmembrane receptor protein serine
AT1G62810    -   -0.69   22   chr1   23261578   23265189   copper amine oxidase, putative
AT3G25510    -   -0.69   27   chr3    9262087    9269729   disease resistance protein (TIR-NBS-LRR class), putative
AT2G07682    -   -0.69   22   chr2    3292601    3296875   transposable element gene
AT3G15880    -   -0.69   23   chr3    5365238    5371929   TPR4/WSIP2 (TOPLESS-RELATED 4); protein binding
AT1G22550    -   -0.68    26     chr1    7966524    7968238   proton-dependent oligopeptide transport (POT) family protein
AT3G25610    -   -0.68    22     chr3    9310769    9313744   haloacid dehalogenase-like hydrolase family protein
AT1G60490    -   -0.68    21     chr1   22289586   22293647   ATVPS34 (Arabidopsis thaliana vacuolar protein sorting 34)
AT5G24470    -   -0.68    20     chr5    8356218    8358436   APRR5 (PSEUDO-RESPONSE REGULATOR 5); transcription regulator
AT5G20990    -   -0.68    20     chr5    7129176    7133299   B73 (CHLORATE RESISTANT 6); molybdenum ion binding
AT5G07920    -   -0.68    21     chr5    2524937    2529149   DGK1 (DIACYLGLYCEROL KINASE 1, DIACYLGLYCEROL KINASE1)
AT4G27010    +   -0.68    26     chr4   13558598   13567126   binding
AT2G02220    -   -0.68    21     chr2     584328     587066   ATPSKR1/PSKR1 (PHYTOSULFOKIN RECEPTOR 1); ATP binding
AT3G12580    -   -0.68    29     chr3    3991666    3993572   HSP70 (heat shock protein 70); ATP binding
AT1G67500    -   -0.67    26     chr1   25292200   25299686   ATREV3 (Arabidopsis thaliana recovery protein 3); DNA binding
AT5G15890    -   -0.67    22     chr5    5187713    5189215   similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G15900 )
AT4G19040    -   -0.67    21     chr4   10432169   10437041   EDR2 (enhanced disease resistance 2)
AT1G48090    -   -0.67    33     chr1   17740871   17761246   C2 domain-containing protein
AT2G42490    -   -0.67    23     chr2   17700413   17702614   copper amine oxidase, putative
AT3TE60130   -   -0.67    22     chr3   14702292   14712768   Transposon - VANDAL1
AT1G01020    -   -0.67   45426   chr1       7048       8393   ARV1
AT4G36670    -   -0.65    20     chr4   17287766   17289575   mannitol transporter, putative
Table S4 Verification by quantitative real-time PCR of differentially expressed genes at 3 DAS detected in the tiling array analysis

                                                         Quantitative real time PCR                          Tiling array
                                                        Fold change divided by MPV                           Fold change
                    Locus        Symbol      MPV          F1 vs. MPV                SE
 Up-regulated     At5g54190       PORA        1             2.10**                  0.17                         2.1
                  At4g27440       PORB        1              1.39*                  0.06                         2.63
                  AT1G03630       PORC        1             1.59***                 0.06                         1.88
                  At5g45930      CHLI2        1             1.68***                 0.07                         1.97
                  AT3G56940      CHL27        1              1.16*                  0.04                         2.21
                  AT5G18660        DVR        1             1.55***                 0.02                         1.86
                  AT5G13630       GUN5        1             1.58***                 0.02                         1.65
                  AT1G03475      HEMF         1              1.16*                  0.04                         1.77
                  AT4G25080      CHLM         1             1.41***                 0.04                         2.36
                  AT3G29320       PHS1        1              1.22                   0.09                         1.89
                  AT1G03310       ISA2        1              1.14                   0.07                         1.91
                  AT5G26570      GWD3         1              1.20*                  0.04                         1.74
                  AT2G40840       DPE2        1             1.27**                  0.02                         1.8
                  AT1G80300       NTT1        1              1.26*                  0.11                         1.77
                  AT1G15500       NTT2        1              1.29*                  0.05                         2.04
                  AT1G09340       CRB1        1               1.1                   0.04                         1.84
                  At4g02510       PPI2        1             1.32**                  0.04                         1.93
                  At4g13940      SAHH1        1              1.18*                  0.04                         2.18
                  At4g09650       APTD        1              1.17*                  0.06                         2.13
                  At4g10340      LHCB5        1              1.21*                  0.03                         2.2
                  At4g03210       XTH9        1             1.69***                 0.13                         2.24
                  At5g06290       2CPB        1             1.49***                 0.02                         1.85
                  At4g25050       ACP4        1             1.61***                 0.04                         2.24
                  At4g28660      PSB28        1             1.57***                 0.04                         2.1
                  At5g28750                   1             1.60**                  0.06                         1.81
                  At3g61470      LHCA2        1             1.43***                 0.02                         2.26
                    At1g61520      LHCA3   1   1.55***   0.05   2.31
                    At5g54270 LHCB3        1   1.42***   0.04   2.31
                    At5g01530 LHCB4        1   1.40***   0.04   2.41
                    At3g08940 LHCB4.2      1   1.21**    0.03   2.1
                    At5g66570       PsbO   1   1.34**    0.05   2.58
                    At1g06680       PsbP   1   1.48***   0.03   2.48
                    At1g44575       PsbS   1   1.41**    0.01   2.17
                    At3g54050       CEF1   1   1.57***   0.01   2.25
                    At3g26650 GAPA-1       1   1.40***   0.02   2.41
                    At4g33520       PAA1   1   1.74***   0.02   2.07
                    At1g56190       PGK    1   1.49***   0.04   2.06
                    At1g32060       PRK    1    1.29*    0.07   2.36
                    At2g20890       THF1   1   1.47***   0.02   2.33
                    At2g30950       VAR2   1   1.48***   0.01   2.03
                    At2g20570       GLK1   1   1.31***   0.04   1.69
                    At5g44190       GLK2   1   1.30***   0.01   1.77
Down-regulated At3g01290                   1   0.60**    0.02   0.42
                    At5g44120       CRA1   1   0.35***   0.07   0.43
                    At5g48430 MJE7.6       1   0.51**    0.03   0.38
                    At2g16005              1   0.21***   0.01   0.31
                    At1g23020       FRO3   1   0.62**    0.02   0.54
                    At2g41240 BHLH100      1   0.22***   0.02   0.41
                    At3g56970       ORG2   1   0.23***   0.01   0.47
                    At3g56980       ORG3   1   0.26***   0.03   0.43
*, p<0.05; **. p<0.01; ***, p<0.001
Table S5 Functional classification of genes differentially expressed between F1 and MPV

                                                                    3/4 DAS                                         10 DAS
                                                        1.5 fold up      1.5 fold down                 1.5 fold up         1.5 fold down
Term ID          Term                               No.        p value      No.     p value          No.      p value     No.      p value
                 Cellular Component
GO:0005618       Cell wall                             20       4.70E-04         0        N.D.          0      N.D.          0      N.D.
GO:0009507       Chloroplast                          187       8.50E-49         6               1     13         0.54       0      N.D.
GO:0005829       Cytosol                               37       1.90E-07         6           0.18       6        0.057       0      N.D.
GO:0005783       ER                                    10            0.29        0        N.D.          0      N.D.          0      N.D.
GO:0005576       Extracellular                         15         0.0012         0        N.D.          0      N.D.          0      N.D.
GO:0044431       Golgi apparatus                        5            0.11        0        N.D.          0      N.D.          0      N.D.
GO:0044429       Mitochondria                           9          0.075         0        N.D.          0      N.D.          0      N.D.
GO:0005634       Nucleus                               83       6.70E-07         9             0.9     11           0.4      0      N.D.
GO:0044444       Cytoplasmic part                     323       1.90E-71        30           0.64      24         0.56       0      N.D.
GO:0044424       Intracellular part                   401       8.50E-75        39           0.91      36         0.37       0      N.D.
GO:0044425       Membrane part                         43         0.0019        10             0.2      5         0.63       0      N.D.
GO:0044459       Plasma membrane                        8            0.12        0        N.D.          0      N.D.          0      N.D.
GO:0009536       Plastid                              201       1.40E-53         6               1     14         0.46       0      N.D.
GO:0005840       Ribosome                              25       1.10E-05         0        N.D.          0      N.D.          0      N.D.
                 Molecular Function
GO:0003677       DNA binding                           39           0.99        12        0.82          8         0.64       0      N.D.
GO:0003723       RNA binding                           25       8.10E-04         0     N.D.             0      N.D.          0      N.D.
GO:0016787       Hydrolase activity                   119       1.40E-10        35   8.50E-05          13           0.2      5        0.074
GO:0016301       Kinase activity                       43          0.028        22   7.50E-05           0      N.D.          0      N.D.
GO:0003676       Nucleic acid binding                  89          0.079        14        0.97          9         0.91       0      N.D.
GO:0000166       Nucleotide binding                    87       2.10E-09        14        0.31          7         0.79       0      N.D.
GO:0005515       Protein binding                       64          0.089        27      0.002          14           0.1      0      N.D.
GO:0005198       Structural molecule activity          32       2.00E-06         0     N.D.             0      N.D.          0      N.D.
GO:0003700       Transcription factor activity         22              1        10        0.72          8           0.2      0      N.D.
GO:0016740       Transferase activity                 106       1.30E-07        32   5.30E-04           8         0.88       0      N.D.
                 Biological Process
GO:0032502       Developmental processes              111       1.30E-20        17         0.056         7        0.57       0      N.D.
GO:0006259       DNA metabolic process                 12           0.11         0        N.D.           0     N.D.          0      N.D.
GO:0016070   RNA metabolic process           40      0.017     5       0.88    0    N.D.      0   N.D.
GO:0009987   Cellular process               388   4.20E-48    70      0.012   37       0.57   0   N.D.
GO:0008152   Metabolic process              347   3.00E-39    61      0.044   33       0.63   5       0.94
GO:0019538   Protein metabolic process      109   5.50E-09    24      0.049    8       0.95   0   N.D.
GO:0009628   Response to abiotic stimulus    94   1.40E-25    14      0.011    7       0.24   0   N.D.
GO:0009607   Response to biotic stimulus     27   9.00E-05    16   2.40E-07   11   1.70E-05   0   N.D.
GO:0006950   Response to stress             104   1.10E-16    30   1.80E-06   30   5.30E-11   6    0.0068
GO:0007165   Signal transduction             27         0.1   11       0.03    5       0.27   0   N.D.
GO:0006350   Transcription                   28       0.95    10       0.58    0    N.D.      0   N.D.
GO:0006810   Transport                       70   3.20E-07    18      0.012    0    N.D.      0   N.D.
Table S6 Functional enrichment of genes differentially expressed between F1 and MPV

                                                                                           3/4 DAS                                       10 DAS
                                                                       1.5 up              2.0 up             1.5 down            1.5 up        1.5 down
Term ID        Term                                                N     p-value      N       p-value     N       p-value    N       p-value   N
               Cellular Component
GO:0009579     Thylakoid                                            38   4.80E-14     18      1.20E-14        0    N.D.      0        N.D.     0
GO:0009570     Chloroplast stroma                                   46   8.90E-25     20      9.10E-20        0    N.D.      0        N.D.     0
GO:0009941     Chloroplast envelope                                 39   6.90E-18     14      1.10E-11        0    N.D.      0        N.D.     0
GO:0034357     Photosynthetic membrane                              28   9.70E-11     15      4.00E-13        0    N.D.      0        N.D.     0
GO:0005840     Ribosome                                             25   1.10E-05     18      9.90E-14        0    N.D.      0        N.D.     0
               Molecular Function
GO:0017111     Nucleoside-triphosphatase activity                   57   3.70E-15      5           0.16   10         0.014   0        N.D.     0
GO:0016887     ATPase activity                                      36   3.20E-10      0       N.D.        7         0.022   0        N.D.     0
GO:0016491     oxidoreductase activity                              72   5.10E-12     18      3.60E-06    18      1.00E-03   0        N.D.     0
GO:0016791     phosphatase activity                                  5       0.71      0       N.D.        9      6.50E-05   0        N.D.     0
GO:0005524     ATP binding                                          61   1.20E-08      6           0.35   13         0.038   6          0.49   0
GO:0003735     Structural constituent of ribosome                   20   6.10E-04     17      5.10E-13     0       N.D.      0        N.D.     0
GO:0016168     Chlorophyll binding                                   6   1.50E-04      6      8.40E-09     0       N.D.      0        N.D.     0
               Biological Process
GO:0044237     Cellular metabolic process                         291    4.50E-34     66      4.10E-15    48         0.096   27         0.63   0
GO:0005975     Carbohydrate metabolic process                      53    4.60E-13     13      7.00E-06     7          0.15    6         0.12   0
GO:0034641     Cellular nitrogen compound metabolic process        57    1.90E-19      9      4.40E-04     5          0.26    6        0.041   0
GO:0019752     Earboxylic acid metabolic process                   62    8.30E-19      5           0.14    9         0.027    0       N.D.     0
GO:0033014     Tetrapyrrole biosynthetic process                   16    2.70E-11      5      7.00E-06     0       N.D.       0       N.D.     0
GO:0015995     Chlorophyll biosynthetic process                    12    2.00E-09      0       N.D.        0       N.D.       0       N.D.     0
GO:0046148     Pigment biosynthetic process                        20    2.00E-12      5      4.80E-05     0       N.D.       0       N.D.     0
GO:0006091     Generation of precursor metabolites and energy      25    4.60E-10      9      4.00E-07     0       N.D.       0       N.D.     0
GO:0019762     Glucosinolate catabolic process                      5    2.80E-04      5      7.80E-08     0       N.D.       0       N.D.     0
GO:0015979     Photosynthesis                                      22    7.50E-12     13      3.10E-14     0       N.D.       0       N.D.     0
GO:0019684     Photosynthesis, light reaction                      13    1.20E-07      7      4.90E-08     0       N.D.       0       N.D.     0
GO:0042548      Regulation of photosynthesis, light reaction     5   1.90E-04    0    N.D.       0    N.D.       0     N.D.     0
GO:0006412      Translation                                     40   2.40E-09   19   3.80E-12    0    N.D.       0     N.D.     0
GO:0009790      Embryonic development                           38   9.00E-12    6   7.70E-03   10   4.00E-04    0     N.D.     0
GO:0009791      Post-embryonic development                      71   6.10E-18    8      0.032   14   2.00E-03    0     N.D.     0
GO:0048316      Seed development                                37   5.60E-11    5      0.031   10   4.60E-04    0     N.D.     0
GO:0009793      Embryonic development ending in seed dormancy   33   2.10E-10    5      0.017    9   6.00E-04    0     N.D.     0
GO:0009658      Chloroplast organization                        14   2.40E-08    0    N.D.       0    N.D.       0     N.D.     0
GO:0042221      Response to chemical stimulus                   85   3.10E-11   20   1.60E-05   27   9.00E-06   14      0.014   6
GO:0009266      Response to temperature stimulus                36   3.10E-12   15   4.60E-11    0    N.D.       6   5.60E-03   0
GO:0009416      Response to light stimulus                      39   3.60E-11   14   1.00E-08    6      0.074    0     N.D.     0
GO:0006952      Defense response                                29   1.50E-03    0    N.D.      14   1.40E-04   18   9.90E-11   0
GO:0009409      Response to cold                                28   1.40E-11   11   4.90E-09    5   5.00E-03    0     N.D.     0
GO:0015031      Protein transport                               27   9.50E-08    0    N.D.       0    N.D.       0     N.D.     0

N.D - not differential
1.5 down
     p-value

      N.D.
      N.D.
      N.D.
      N.D.
      N.D.

      N.D.
      N.D.
      N.D.
      N.D.
      N.D.
      N.D.
      N.D.

      N.D.
      N.D.
      N.D.
      N.D.
      N.D.
      N.D.
      N.D.
      N.D.
      N.D.
      N.D.
      N.D.
  N.D.
  N.D.
  N.D.
  N.D.
  N.D.
  N.D.
  N.D.
5.20E-03
  N.D.
  N.D.
  N.D.
  N.D.
  N.D.
Table S7 Genes differentially expressed between F1 and MPV at 10 DAS

       ID        Fold change       P Value      Description
1.5 fold upregulated genes (F1/MPV)
253707_at            7.89         8.10E-09      hypothetical protein
256497_at            5.85         5.25E-08      ORF1, putative similar to ORF1
250476_at            5.76         3.94E-07      MADS box protein FLOWERING LOCUS F (FLF)
267389_at            3.53         1.87E-03      putative beta-glucosidase
255257_at            3.46         1.35E-07      unknown protein
263174_at            3.36         3.34E-07      jasmonate inducible protein
261648_at            2.98         9.03E-03      salt-tolerance zinc finger protein identical to salt-tolerance zinc finger protein
255437_at            2.98         1.35E-03      putative oxidoreductase similar to P. vulgaris gibberellin 20-oxidase
264958_at            2.94         1.90E-05      unknown protein
254120_at            2.88         7.83E-03      putative mitochondrial uncoupling protein
262319_s_at          2.86         1.94E-07      unknown protein similar to unknown protein GB:AAC63676
249216_at            2.76         2.88E-07      serine carboxypeptidase II-like
248944_at            2.72         8.02E-06      putative protein similar to unknown protein (pir||T08416)
256617_at            2.65         9.06E-03      unknown protein
257008_at            2.52         4.12E-06      myrosinase-associated protein
263023_at            2.52         1.14E-05      unknown protein
261453_at            2.51         6.63E-04      O-methyltransferase
256940_at            2.37         4.46E-04      unknown protein
245253_at            2.34         1.57E-03      hydroperoxide lyase (HPOL) like protein
263182_at            2.34         9.85E-03      Expressed protein
252679_at            2.29         7.66E-03      CCR4-associated factor 1-like protein
267459_at            2.28         2.29E-05      unknown protein
245638_s_at          2.27         7.09E-04      unknown protein
264758_at            2.24         3.60E-03      late embryogenesis abundant protein
245041_at            2.24         1.04E-05      AR781, similar to yeast pheromone receptor identical to GB:D88743
246888_at             2.2         1.39E-04      putative protein
265063_at            2.17         3.10E-05      receptor kinase
245219_at            2.16         1.89E-05      viral resistance protein
254481_at            2.12         7.98E-07      hypothetical protein
257365_x_at          2.11         3.15E-03      putative antifungal protein
245448_at     2.09   9.18E-04   disease resistance RPP5 like protein
255065_s_at   2.08   2.08E-04   putative arginase similar to arginases
256526_at     2.05   6.76E-04   disease resistance protein
267028_at     2.04   9.41E-04   putative WRKY-type DNA binding protein
246194_at     2.01   3.38E-04   putative protein
250135_at     1.99   1.66E-05   putative protein
247351_at     1.97   1.17E-05   putative protein contains similarity to NAC-domain protein
246777_at     1.95   9.16E-04   RING-H2 zinc finger protein-like RING-H2 zinc finger protein ATL6
245736_at     1.95   6.90E-03   Dr4(protease inhibitor) identical to Dr4 GI:469114 from [Arabidopsis thaliana]
249645_at     1.93   2.40E-03   thionin Thi2.2
266800_at     1.92   7.43E-03   hypothetical protein
247177_at     1.92   2.67E-03   unknown protein
245169_at     1.91   1.51E-06   unknown protein
254585_at      1.9   4.35E-05   resistance protein - like downy mildew resistance protein RPP5, Arabidopsis thaliana
262421_at     1.88   1.88E-05   hypothetical protein
249265_at     1.86   5.11E-06   E2, ubiquitin-conjugating enzyme 8 (UBC8) identical to gi:297882
257053_at     1.86   9.41E-03   ethylene responsive element binding factor 4 (AtERF4)
264824_at     1.85   8.56E-05   unknown protein
261470_at     1.84   1.15E-03   ethylene-responsive element binding factor
260549_at     1.83   4.50E-05   Expressed protein ; supported by full-length cDNA: Ceres: 91704.
246821_at     1.82   1.61E-03
                                calmodulin-binding - like protein calmodulin-binding protein TCB60, Nicotiana tabacum
261919_at     1.81   4.06E-05   type 2 peroxiredoxin
250942_at     1.79   1.65E-04   putative protein
248686_at     1.78   4.07E-03   33 kDa secretory protein-like
245928_s_at   1.78   2.26E-04   vegetative storage protein Vsp1
262719_at     1.77   5.83E-03   hypothetical protein
267569_at     1.77   2.10E-03   putative photosystem II oxygen-evolving complex 23K protein
263153_s_at   1.73   9.36E-03   myrosinase-associated protein
252485_at     1.72   5.52E-05   disease resistance protein RPP13-like protein disease resistance protein RPP8 - Arabidopsis
                                thaliana
261942_at      1.7   1.11E-03   unknown protein
255578_at      1.7   6.19E-04   predicted protein
264214_s_at   1.68   1.84E-03   MADS-box transcription factor
265670_s_at   1.68   6.79E-03   unknown protein
265831_at     1.67   6.06E-04   unknown protein
248522_at     1.67   2.21E-05   predicted protein
263083_at     1.66   1.36E-04   purple acid phosphatase precursor identical to SP:Q38924
248045_at     1.66   1.31E-04   HEAT SHOCK PROTEIN 81-2 (HSP81-2)
258792_at     1.66   8.92E-03   hypothetical protein
249918_at     1.65   2.53E-03   putative protein
264655_at     1.65   5.33E-04   unknown protein
248330_at     1.64   1.55E-03   putative protein contains similarity to ornithine cyclodeaminase
248079_at     1.63   3.92E-04   unknown protein
265974_at     1.63   1.31E-05   unknown protein
246870_at     1.62   9.86E-03   ferrochelatase-I
258983_at     1.61   8.03E-03   putative aminotransferase similar to beta-alanine-pyruvate aminotransferase GB:BAA19549
                                [Rattus norvegicus]
248914_at     1.61   8.09E-03   Rab-type small GTP-binding protein-like
256384_at      1.6   1.89E-04   hypothetical protein
266275_at     1.59   3.95E-03   putative tropinone reductase
246642_s_at   1.59   1.97E-03   putative protein
249158_at     1.58   1.09E-04   electron transfer flavoprotein beta-subunit-like
250515_at     1.58   9.45E-03   putative protein
252677_at     1.57   4.31E-04   nitrilase 3
256017_at     1.57   5.15E-03   unknown protein
252724_at     1.57   7.69E-04   putative protein
247047_at     1.56   8.91E-04   putative protein
250676_at     1.56   2.90E-04   harpin-induced protein-like
260602_at     1.56   1.11E-03   serine acetyltransferase identical to GB:CAA84371 from [Arabidopsis thaliana]
249780_at     1.56   2.97E-03   ubiquitin
264986_at     1.56   4.53E-03   glutathione transferase
244969_at     1.54   2.39E-03   ribosomal protein S18
260560_at     1.53   6.94E-03   putative endochitinase
257756_at     1.51   1.54E-03   uridylate kinase
253455_at     1.51   1.80E-03   putative protein
257673_at      1.5   1.54E-03   unknown protein
264232_at      1.5   6.18E-03   putative protein kinase
1.5-fold down-regulated genes (F1/MPV)
266385_at           0.26          5.67E-07   pathogenesis-related PR-1-like protein identical to GB:M90508
267509_at           0.36          1.64E-05   MADS-box protein (AGL20)
252549_at           0.39          1.02E-03   protein kinase - like receptor-like protein kinase RLK3, Arabidopsis thaliana
260568_at           0.42          4.70E-06   endochitinase isolog
248169_at           0.42          2.60E-06   ankyrin-repeat-containing protein-like
250445_at           0.43          2.52E-05   nucleoid DNA-binding protein cnd41
251625_at           0.45          2.24E-03   beta-1,3-glucanase 2 (BG2) (PR-2)
251400_at           0.47          3.38E-03   putative protein prib5, Ribes nigrum
259573_at           0.48          3.20E-06   hypothetical protein
263852_at           0.55          2.63E-05   putative mutT domain protein
252136_at           0.55          9.66E-06   calmodulin-like protein flagellar calmodulin
267385_at           0.56          1.48E-04   unknown protein
256382_at           0.58          1.45E-03   unknown protein
249004_at           0.58          6.76E-06   unknown protein
260943_at            0.6          1.54E-04   thioredoxin, putative similar to thioredoxin GI:992966 from [Arabidopsis thaliana]
254975_at           0.61          1.76E-04   putative Fe(II)/ascorbate oxidase SRG1 protein
250435_at           0.62          1.79E-03   putative protein various predicted proteins, Arabidopsis thaliana
266901_at           0.62          8.48E-03   hypothetical protein
253829_at           0.62          4.53E-04   Medicago nodulin N21-like protein MtN21 gene
                                             vacuolar sorting receptor-like protein BP-80 vacuolar sorting receptor, Pisum sativum,
254500_at          0.64          8.43E-04    PATCHX:G1737222
263539_at          0.65          1.16E-04    putative tyrosine aminotransferase
259417_at          0.65          7.63E-03    unknown protein contains similarity to phytochrome interacting factor 3 GI:3929586 from
                                             [Arabidopsis thaliana]
267139_s_at        0.66          1.39E-04    hypothetical protein
Table S8 Verification of microarray detected differentially expressed genes at 10 DAS by quantitative real-time PCR

                                                        Quantitative real time RT-PCR                    Microarray data
                                                         Fold change divided with Col              Fold change divided with Col
                          Locus         Symbol        Col           C24           C24Col         Col           C24         C24Col
    Up-regulated        At1g27730         STZ      1.00±0.07     1.89±0.20       3.17±0.57    1.00±0.23     2.74±0.87     5.05±1.67
                        At1g54040         ESP      1.00±0.07 27.16±1.24         15.36±1.23    1.00±0.11    16.83±0.41    13.72±0.18
                        At4g03060        AOP2      1.00±0.22 28.32±1.00         10.85±1.18    1.00±0.37    18.84±0.27    12.03±1.43
                        At4g29200                  1.00±0.17 53.55±1.55         35.38±0.90    1.00±0.08 140.54±5.02 93.24±2.97
                        At1g61500                  1.00±0.09     9.75±0.36       5.12±0.42    1.00±0.11    19.99±2.43     9.61±0.61
                        At3g14210       ESM1       1.00±0.09     0.09±0.01       0.80±0.06    1.00±0.14     0.18±0.02     1.05±0.01
                        At5g10140        FLC       1.00±0.09 24.23±1.03         25.76±1.34    1.00±0.10    45.20±2.48    38.76±3.19
                        At2g30790      PSBP-2      1.00±0.05     2.68±0.13       2.40±0.18    1.00±0.09     4.31±0.26     3.71±0.47
   Down-regulated       At2g43570        CHI       1.00±0.08     5.95±0.83       1.31±0.11    1.00±0.09     8.15±1.87     1.16±0.05
                        At3g57260        BG2       1.00±0.12 22.61±2.74          2.83±0.38    1.00±0.06    14.69±2.90     1.74±0.32
                        At5g10760      MAJ23.1     1.00±0.17 15.70±3.38          1.65±0.16    1.00±0.15    18.59±7.56     1.66±0.09
                        At5g54610       ANK        1.00±0.13 11.34±1.05          1.57±0.16    1.00±0.09    12.59±2.44     1.48±0.05
                        At4g20110                  1.00±0.12     2.41±0.35       0.83±0.10    1.00±0.08     3.14±0.35     1.13±0.09
                        At1g02340       HFR1       1.00±0.08     2.93±0.41       1.06±0.08    1.00±0.11     2.68±0.64     1.05±0.12
                        At2g45660        SOC1      1.00±0.07     0.14±0.01       0.10±0.01    1.00±0.19     0.31±0.04     0.20±0.00
    No difference       AT2G40840       DPE2       1.00±0.07     1.00±0.04       1.12±0.05    1.00±0.12     0.93±0.06     0.91±0.03
      (=MPV)            AT5G26570       GWD3       1.00±0.05     1.00±0.03       0.91±0.03    1.00±0.03     1.05±0.17     1.06±0.06
                        At4g27440       PORB       1.00±0.12     1.08±0.12       1.09±0.08    1.00±0.04     0.92±0.06     0.94±0.09
                        At1g69830       AMY3       1.00±0.05     1.09±0.06       1.10±0.03    1.00±0.08     1.12±0.11     1.17±0.08
                        AT3G56940       CHL27      1.00±0.05     0.96±0.03       1.10±0.08    1.00±0.02     0.98±0.03     0.98±0.02
                        AT5G18660        DVR       1.00±0.07     1.12±0.05       1.23±0.08    1.00±0.05     1.15±0.07     1.09±0.05
                        AT1G03630       PORC       1.00±0.07     0.94±0.06       1.13±0.06    1.00±0.06     1.02±0.06     1.06±0.06
Table S9 Genes differentially expressed between F1 and MPV at both 3/4 and 10 DAS



                    Fold
Locus              change                Description
                 (F1/MPV)
                     3 DAS    10 DAS
Up-regulated genes
At4g29200              5.92      7.89    beta-galactosidase
At5g10140              1.91      5.76    FLC (FLOWERING LOCUS C)
At1g54040              6.18      3.36    ESP (EPITHIOSPECIFIER PROTEIN)
At4g03060              2.95      2.98    AOP2 (ALKENYL HYDROXALKYL PRODUCING 2)
At3g14210              3.48      2.52    ESM1 (EPITHIOSPECIFIER MODIFIER 1)
At1g61500              2.45      2.17    S-locus protein kinase, putative
At4g16860              1.72      2.09    RPP4 (RECOGNITION OF PERONOSPORA PARASITICA 4)
At5g15360              3.69      1.99    unknown protein
At5g56030              2.14      1.66    HSP81-2 (EARLY-RESPONSIVE TO DEHYDRATION 8)
At5g24240               1.8      1.56    phosphatidylinositol 3- and 4-kinase family protein
At3g20370              1.79       1.5    meprin and TRAF homology domain-containing protein
Down-regulated genes
AT1G20390            0.51        0.48    transposable element gene
Table S10 Transcription of genes involved in chlorophyll biosynthesis and photosynthesis at different times after sowing

                                                          Quantitative real time PCR
                                                        Fold change divided with MPV
                                                                    6DAS
                                               Cotyledon                    1st and 2nd rosette leaves
   Locus        Symbol               MPV         SE      F1     SE     MPV          SE        F1       SE
 At4g27440       PORB        CB       1          0.03 0.95     0.06      1          0.03     1.13*     0.05
 At1g03630       PORC        CB       1          0.04 0.94     0.07      1          0.06      1.14     0.13
 At5g45930      CHLI2        CB       1          0.03    0.9   0.05      1          0.03       1.1     0.07
 At3g56940      CHL27        CB       1          0.04    0.8   0.05      1          0.03      0.93     0.04
 At5g18660        DVR        CB       1          0.06 0.93     0.04      1          0.02    1.18**     0.07
 Ag5g13630       GUN5        CB       1          0.03 0.89     0.02      1          0.02      1.06     0.03
 At1g03475      HEMF         CB       1          0.03 1.05     0.05      1          0.04     1.16*     0.07
 At4g25080      CHLM         CB       1          0.03 0.96     0.06      1          0.03      1.09     0.06
 At1g09340       CRB1                 1          0.03    1.1   0.05      1          0.03    1.31**      0.1
 At4g02510       PPI2                 1          0.06 0.89     0.06      1          0.04      1.12     0.06
 At4g09650       APTD        P        1          0.03 0.97     0.04      1          0.03     1.12*     0.04
 At4g10340      LHCB5        P        1          0.02 1.05     0.06      1          0.02     1.15*     0.09
 At3g61470      LHCA2        P        1          0.06 1.11     0.08      1          0.04    1.23**     0.07
 At1g61520      LHCA3        P        1          0.07 1.03      0.1      1          0.05      1.18     0.09
 At5g54270      LHCB3        P        1          0.05 1.03     0.08      1          0.04     1.19*     0.09
 At5g01530      LHCB4        P        1          0.04 1.04     0.08      1          0.04      1.11     0.08
 At5g66570       PsbO        P        1          0.04 1.07     0.06      1          0.03     1.25*     0.11
 At1g06680       PsbP        P        1          0.03 1.02     0.04      1          0.05    1.29**     0.07
 At1g44575       PsbS        P        1          0.05 0.96     0.04      1          0.06      1.13     0.09
 At3g54050       CEF1                 1          0.05 1.09     0.09      1          0.04     1.19*     0.04
 At1g56190        PGK                 1          0.05 1.02     0.06      1          0.03    1.36**      0.1
 At1g32060        PRK                 1          0.06 1.01     0.05      1          0.04    1.29**     0.06
 At2g20890       THF1                 1             0      1      0      1          0.04     1.14*     0.03

                                                                      7DAS
                                Cotyledon                 1st and 2nd rosette leaves
  Locus     Symbol        MPV     SE      F1     SE    MPV        SE        F1         SE
At4g27440    PORB    CB    1      0.03 0.95     0.06    1         0.03     1.24*        0.1
At1g03630    PORC    CB    1      0.03 0.93     0.06    1         0.06     1.24*       0.07
At5g45930   CHLI2    CB    1      0.05 0.93     0.04    1         0.03      1.11       0.08
At3g56940   CHL27    CB    1      0.05 0.87     0.05    1         0.03      1.08       0.06
At5g18660     DVR    CB    1      0.07 0.91     0.04    1         0.04     1.17*       0.06
Ag5g13630    GUN5    CB    1      0.05 0.98     0.07    1         0.03      1.11       0.06
At1g03475   HEMF     CB    1      0.07    0.8   0.05    1         0.04    1.34**       0.12
Ag4g25080   CHLM     CB    1      0.04 1.13     0.05    1         0.03     1.16*       0.06
At1g09340    CRB1          1      0.04 0.84     0.04    1         0.03    1.20**       0.07
At4g02510    PPI2          1      0.05 0.98     0.09    1         0.04      1.03       0.07
At4g09650    APTD    P     1      0.03 0.82     0.06    1         0.02    1.19**       0.06
At4g10340   LHCB5    P     1      0.04 0.96     0.05    1         0.04    1.28**       0.08
At3g61470   LHCA2    P     1      0.04 0.93     0.04    1         0.04     1.25*       0.14
At1g61520   LHCA3    P     1      0.06 0.97     0.06    1         0.07     1.29*       0.08
At5g54270   LHCB3    P     1      0.04 0.91     0.07    1         0.04    1.29**       0.07
At5g01530   LHCB4    P     1      0.04 0.73     0.04    1         0.03    1.36**       0.17
At5g66570    PsbO    P     1      0.03 0.91     0.05    1         0.04    1.29**        0.1
At1g06680    PsbP    P     1      0.02 0.83     0.04    1         0.04    1.26**        0.1
At1g44575    PsbS    P     1      0.06 0.94     0.07    1         0.05      1.17       0.06
At3g54050    CEF1          1      0.05 0.85     0.06    1         0.03    1.42**       0.05
At1g56190     PGK          1      0.05 0.84     0.05    1         0.02    1.38**       0.05
At1g32060     PRK          1      0.05 0.88     0.05    1         0.03    1.30**       0.11
At2g20890    THF1          1      0.04 0.86     0.03    1         0.03     1.19*       0.09
                                                          9DAS
                              1st and 2nd leaves               3rd and 4th rosette leaves
  Locus     Symbol        MPV       SE       F1     SE      MPV       SE         F1         SE
At4g27440    PORB    CB    1         0.02 1.01     0.03      1         0.03      1.09       0.03
At1g03630    PORC    CB    1         0.03 0.96     0.06      1         0.03      0.96       0.07
At5g45930   CHLI2    CB    1         0.03 0.87     0.06      1         0.03      0.97       0.03
At3g56940   CHL27    CB    1         0.04    0.9   0.05      1         0.03      1.05       0.06
At5g18660     DVR    CB    1         0.04 0.92     0.04      1         0.02      1.08       0.03
At5g13630    GUN5    CB    1         0.04 0.99     0.04      1         0.03      0.99       0.07
At1g03475   HEMF     CB    1         0.02 0.96     0.05      1         0.05      1.03       0.06
At4g25080   CHLM     CB    1         0.02      1   0.07      1         0.03      1.06       0.03
At1g09340    CRB1          1         0.04      1   0.05      1         0.03      0.95       0.04
At4g02510    PPI2          1         0.03 0.95     0.05      1         0.03      0.95       0.03
At4g09650    APTD    P     1         0.02 0.94     0.04      1         0.02      1.09       0.07
At4g10340   LHCB5    P     1         0.03      1   0.05      1         0.03      1.05       0.09
At3g61470   LHCA2    P     1         0.02 0.98     0.04      1         0.03      1.05       0.04
At1g61520   LHCA3    P     1         0.06 0.93     0.01      1         0.06      0.96       0.07
At5g54270   LHCB3    P     1         0.06 0.97     0.05      1         0.03      1.11       0.04
At5g01530   LHCB4    P     1         0.05 1.02     0.03      1         0.03      1.13       0.02
At5g66570    PsbO    P     1         0.04 0.99     0.04      1         0.04      1.12       0.05
At1g06680    PsbP    P     1         0.02 0.96     0.03      1         0.03      1.06       0.08
At1g44575    PsbS    P     1         0.03 1.01     0.04      1         0.03      1.05       0.04
At3g54050    CEF1          1         0.02 0.95     0.05      1         0.03      1.07       0.04
At1g56190     PGK          1         0.03 0.98     0.04      1         0.02      1.06       0.03
At1g32060     PRK          1         0.03 1.03     0.08      1         0.03       1.1       0.08
At2g20890    THF1          1         0.03 0.97     0.05      1         0.03      1.01       0.04
                                                                    10DAS
                                            1st and 2nd leaves             3rd and 4th rosette leaves
     Locus        Symbol               MPV        SE       F1     SE    MPV       SE         F1         SE
  At4g27440        PORB      CB          1         0.04 0.96     0.06    1         0.05      1.04       0.03
  At1g03630        PORC      CB          1         0.02 0.76     0.02    1         0.03      0.89       0.02
  At5g45930       CHLI2      CB          1         0.03 0.73     0.03    1         0.03      1.06       0.06
  At3g56940       CHL27      CB          1         0.02 0.89     0.06    1         0.04      1.07       0.05
  At5g18660         DVR      CB          1         0.03 0.94     0.02    1         0.03      1.02       0.03
  At5g13630        GUN5      CB          1         0.02 1.02     0.07    1         0.04      0.93       0.03
  At1g03475       HEMF       CB          1         0.02 0.83     0.02    1         0.04      0.96       0.05
  At4g25080       CHLM       CB          1         0.04 0.97     0.04    1         0.04      1.14       0.05
  At1g09340        CRB1                  1         0.03 0.87     0.03    1         0.05      1.02       0.02
  At4g02510        PPI2                  1         0.03 0.92     0.05    1         0.04      1.02       0.08
  At4g09650        APTD       P          1         0.03 0.81     0.05    1         0.04      0.92       0.05
  At4g10340       LHCB5       P          1         0.04 0.95     0.06    1         0.07      1.13       0.04
  At3g61470       LHCA2       P          1         0.04 0.86     0.06    1         0.04      1.07       0.05
  At1g61520       LHCA3       P          1         0.03    0.9   0.04    1         0.06      1.15       0.07
  At5g54270       LHCB3       P          1         0.05 0.89     0.05    1         0.06       1.1       0.07
  At5g01530       LHCB4       P          1         0.04 0.89     0.06    1         0.06       1.1       0.09
  At5g66570        PsbO       P          1         0.04 0.95     0.05    1         0.03      1.07       0.03
  At1g06680        PsbP       P          1         0.03 0.91     0.04    1         0.03      1.11       0.03
  At1g44575        PsbS       P          1         0.03 0.83     0.05    1         0.05      1.02       0.05
  At3g54050        CEF1                  1         0.04 0.86     0.02    1         0.03      1.06       0.03
  At1g56190         PGK                  1         0.06 0.79     0.03    1         0.05       0.9       0.05
  At1g32060         PRK                  1         0.04 0.86     0.04    1         0.06      0.94       0.05
  At2g20890        THF1                  1         0.03 0.91     0.04    1         1.01      0.03       0.03
CB, chlorophyll biosynthetic process, P; photosynthesis
*, p<0.05; **. p<0.01
      Table S11 CO2 fixation rate per unit area in a heterotic F1 hybrid between C24 and Col

                                                Col          C24        F1-C24×Col
                                    d
(A)   CO2 fixation rate per unit area
      +sucrose, 1,000μmol photons m-2 s-1
      7 DAS a                                1.00±0.02    0.71±0.02     0.78±0.02
                b
      10 DAS                                 1.00±0.01    0.98±0.02     1.00±0.02
                b
      14 DAS                            1.00±0.02         0.92±0.03     0.88±0.02
      +sucrose, 200μmol photons m-2 s-1
      14 DAS b, c                       0.62±0.05         0.65±0.02     0.62±0.03
      -sucrose, 200μmol photons m-2 s-1
                b, c
      14 DAS                                 0.57±0.03    0.73±0.02     0.59±0.04

                                         d
(B)   Leaf area with and without sucrose
      +sucrose, 1,000μmol photons m-2 s-1
      14 DAS b                           1.00±0.05        0.82±0.02     1.54±0.06
      -sucrose, 1,000μmol photons m-2 s-1
      14 DAS b, c                            0.86±0.03    0.85±0.03     1.20±0.05

(C)   Chlorophyll content per fresh weight (μg/ml)
      7 DAS a
      Chlorophyll a                        0.11±0.003    0.087±0.002 0.092±0.004
      Chlorophyll b                       0.034±0.002    0.022±0.001 0.029±0.001
      10 DAS b
      Chlorophyll a                        0.15±0.005     0.15±0.007 0.15±0.008
      Chlorophyll b                       0.049±0.002    0.040±0.002 0.051±0.003
      14 DAS b
      Chlorophyll a                        0.14±0.002     0.15±0.005 0.14±0.004
      Chlorophyll b                       0.048±0.003    0.045±0.002 0.053±0.003

(D)   Fresh weight of cotyledons and leaves d
      7 DAS a                                1.00±0.05    1.17±0.07     1.71±0.10
                b
      10 DAS                                 1.00±0.03    0.70±0.03     1.25±0.06
      14 DAS b                               1.00±0.04    0.83±0.04     1.48±0.07

      a. Cotyledon.
      b. Leaf.
      c. divided by the Col at 14 DAS (exposed to light at 1000 µmol, +sucrose)
      d. Measurements are relative to Col.
Table S12 CO2 fixation rate per unit area in a weak-heterotic F1 hybrid between Col and Ler

                         Col             Ler          F1-Col×Ler
                                  a
CO2 fixation rate per unit area
        a
7 DAS                1.00±0.02        0.79±0.02        0.90±0.02
14 DAS b             1.00±0.02        0.76±0.04        0.89±0.04

Cotyledon and Leaf area
      a
7 DAS               1.00±0.04         1.01±0.07        1.29±0.07
        b
14 DAS              1.00±0.04         0.85±0.03        1.05±0.07

a. Cotyledon.
b. Leaf.
All measurements are relative to Col.
Table S13 Primer sequences

                                                       Primer sequences (5'-3')
     Locus           Symbol    Forward                            Reverse
   At5g54190          PORA     AAACCATTTGGGCCACTTTCTT             CAAGTCTTTTCCCAGCCTCTGA
   At4g27440          PORB     ACCAAATCAAATCCGAACATGG             GGCTCTTTAGCTGTCGGGAAAT
   At1g03630          PORC     GGCTTAGCGTCAGGATTGAATGGGC          TTTGCCAGCTTCCTCTTCAGATACG
   At5g45930         CHLI2     CAAGTAGGGACGGTTAGAGACGCCG          ATAACAATACCAACATCTTCAGCTG
   At3g56940         CHL27     GACTTACTTATCCGAGAAAATCGGG          GATGATGACATGCATATCGAACTCC
   At5g18660           DVR     AGCGAAACTGAAGTTCGAAGCAGAG          CAGAATCTCTCCTTGCTCTAATGGC
   At5g13630          GUN5     GCGGAGCTAGATGAGCCTGTAGAGC          GGTGACTTCTGCAGTGCTAAGAGCC
   At1g03475         HEMF      TCAAGCACCGTGATGAGAGACGAGG          GCGGAAGAGAGACGAGAATGCTCTC
   At4g25080         CHLM      AACTCAGAATCACTCTCTTCTCTGC          ACGGTGGAGAACACGATGCTTATGC
   At3g29320          PHS1     ATTATCCGGCTTGGGGTTATGG             TCGGAAGGAGCTTTTGTTGACC
   At1g03310          ISA2     TCCCAAGACTCACAAACCCACA             TGAAGCATGCCAAACATCACCT
   At5g26570         GWD3      GCCATTGTTGCAGCTCTCCTTT             TTCCAACTCACAAACCCATCCA
   At2g40840          DPE2     GCAGCAGCAGAATATGCAAGGA             CGCCACCAGGCATAGTTGTC
   At1g80300          NTT1     ACTAGCGAATTCAACGCCGTATCTA          CCAAGGGAACCGTTTCCGCTTTCG
   At1g15500          NTT2     ACTCGCCAATTCCACACCTTACCTT          CGTAGTTTCTCCTGATGGCGCATCC
   At1g09340          CRB1     TTGATGGGTTAGCAAAAGCTTGCGC          GAATGTTCCGCGACCGAAATCAAGG
   At4g02510          PPI2     ATGGACTCAAAGTCGGTTACTCCAG          CGGAGTCAGATAAATCATCAGCTCC
   At4g13940         SAHH1     GCTACTCTTTTGATTCATGAGGGTG          AGGGAACAAAAGAGTTCCATTTTGC
   At4g09650          APTD     CATCGACGACATAGTGAAATCGTCG          TTAACCCGAACATTCTTAGCTCCGG
   At4g10340         LHCB5     GTCTCTGAGACTAGCGATGAGCTCG          CTGCTCCTAACATAGCCCATCTCGC
   At4g03210          XTH9     TCCATTTGGAATGCAGATGATTGGG          GAACCCAAATAAGCTGATGATTCTG
   At5g06290          2CPB     CTCTAGGGTTCTTCTTCCCTCCAAG          AAAATCAGGCGCCTTATTACCGACC
   At4g25050          ACP4     AATGTTTTGAGCATCAGATTCCTCC          GTGACATTGTAAAAGAACAATTGGC
   At4g28660         PSB28     CGGTTTCCCATTCACGAATCTCGCG          TGGCTTGTGTTCGGTCGATTGGTTC
   At5g28750                   TAAGCTCAGACTCGAACTCTTTTGC          ATTGCTTCACAGTCACGACCCGACC
   At3g61470          LHCA2    TTTGTGCTTCTTCTGCCATCGCTGC          TTCCATTTTAGACTGTCCGGGTCCG
   At1g61520          LHCA3    CACTTGTGTCTTCTTCACTTACCTC          AATCCTCCAGTACCTTCTGGGTCTG
   At5g54270          LHCB3    GCATCAACATTCACGAGCTCAAGCA          CCATAATCGCCAGGGAATTCTCCGG
   At5g01530          LHCB4    GCCGCAACATCCGCCGCTGCTGCAG          ATACTCGGCCGGTTTGCCTAAACCG
   At3g08940         LHCB4.2   GCCGCCACTTCAACCGCCGCTGCTG          CCCGTAGTCCCCGACAAGTGAACCG
   At5g66570           PsbO    CCAATCCACCGCTACATTCCTCCAG          CACTTGCTCCCGAGACGACGAGAGC
   At1g06680           PsbP    AGTGCGTGTTTCCTACACCAGAGCG          CGTTTGCAGCTTCACCGTAGGCGGC
At1g44575    PsbS     TCAAACCATGCTGCTTACTTCAGGC   TCCCACCAGACGTTCCAAAGATGCC
At3g54050    CEF1     CAGCAACCGCCGCAACAACGACGTC   TGTCTCAGCAACCAGCCCGTCAACG
At3g26650   GAPA-1    CCAAGGGTTTCACTGAATTCTCAGG   CCAACATCTCAGGAAGTTCCTCCCG
At4g33520    PAA1     TCTCAGCTTTCTCAACCGTCAAGGC   CGACAAACACTCTAAACGGTGTCGG
At1g56190    PGK      GGCTTCCACCGCCGCAACTGCAGCT   TCTCCAACACTCTTCTTCGCCATCG
At1g32060    PRK      CAACTATCTACTCAACACAAGCTCT   ATCAGGGTTCCCGCCTTTTGGTGGC
At2g20890    THF1     CAATCTCTTCTCTTTCCTTCCCAGC   GTAGATACTCGGGATGGGTCGCTTG
At2g30950    VAR2     CATCAGCTTGTCTTGTGGGAAATGG   AACCTAGAATACGACATCCTCGACG
At2g20570    GLK1     GAACGCTTCTTCAACGATTACTACG   AGCTCCAGAATTCGAGAAGGAACAG
At5g44190    GLK2     TTTTACGACGGAAGACTTGCCGGAC   CCACCGCTTGTACAAATTTCCGGTG
At3g01290             AGCGAGCGAAAAAGCAGAGGCTGAG   TCTCTCATTGTGTCAAAGTACTGAG
At5g44120   CRA1      GCAGGGTCAGCAGTTTCCGAACGAG   CACTTTTCCCATAAGACCTCGTCCC
At5g48430   MJE7.6    ACATCGGCGGTCCCTATCTTGTCCG   ACGTTGTTGATCGTGACCGAAGGAG
At2g16005             AATGGAGAGATTACGATAACCGGTG   GCACATCATTGACTCTTTCAGAGGC
At1g23020    FRO3     GATGTGGGCCACCACATTCCCGGCG   AGGTTGAGCATTGAGAGGTCGGAAG
At2g41240   BHLH100   TGAAACCGACGACGTATCCAACACG   CTTACTGTTTTGGTCGGTGTAAACG
At3g56970    ORG2     AACTTCGGTTGGCCGTCAACGAATC   GCTGCTTATCGTAAAGCTCAAAGTC
At3g56980    ORG3     GTACCGGAGGAGACTTATGGAGCTG   TTGACCTGAAATTTGCACCAAGAGC
At1g27730     STZ     TTCTCGCTCGCGACAACCGTCAGCC   CCCGCACCTTCGGAGTTGGACACGC
At1g54040     ESP     AACTGTATCCTGCTTAGGCGTGCGC   ATTGCACAGCATTAGACTCATAGTC
At4g03060    AOP2     TGAATCATAATAATCTCTCCGAGAG   ATTATCATTAACACCGGTATCAGCG
At4g29200             GCTCTTTGGACAGATTCGTGCTCGG   TCTCTATCAAATGGTGTCCATGGCC
At1g61500             CTCGTATTTATCGTTCATAATCGTG   ATGACCTTAAGATTTCCGCTATCTG
At3g14210    ESM1     ATGACCTTAAGATTTCCGCTATCTG   GGTATTAACCATCTTCCATAATCCG
At2g30790   PSBP-2    GAGAAGGATTCAAAATCCAGATCCC   CCTAGCTCCTTTGAACCACCTCTTG
At2g43570     CHI     CGCCTCTCAAAACTGTGGCTGCGCC   CCCTGTTTCTTGGGCTACGTGAGCG
At3g57260     BG2     ACGGGATGCTAGGCGATACCTTGCC   ACCTTGACTTCAAGCCCTGCTCCAG
At5g10760   MAJ23.1   CCATTCAAGTCAGCTCTCTGTTCCC   TCACTTCCGGTGTCGAAGACCAGCG
At5g54610    ANK      TATTCTCTTATTCAAGCGGCTCCCG   CTCGTATTTATCGTTCATAATCGTG
At4g20110             GTCGAAGCACGACGGCTCGATAGCC   CCAAATGATTTATCGATTAACACCG
At1g02340    HFR1     CCAAATGATTTATCGATTAACACCG   ACTTGCTGTGAAAGATCAGGGCATG
At2g45660    SOC1     AGAATGCAACAAGCAGACAAGTGAC   TTGCTCAATCTGTTGCAGCTCCTCG
At5g14780    FDH      CAAGGCCAACGAATACGCTACCAAG   TTGCTTCCCGTGACTTCAGCAACCG

								
To top