Human Genetics Basics

Reviews
Shared by: pptfiles
Stats
views:
5
rating:
not rated
reviews:
0
posted:
11/8/2009
language:
pages:
0
Human Genetics Basics Kate Garber Director of Education Department of Human Genetics kgarber@genetics.emory.edu Medical Genetics  Syndrome named after an old guy  Gene name, which is some meaningless abbreviation  Pathway  Genetic test Variable Human Traits Qualitative Traits: Discrete traits Receding hairline Bushy eyebrows Gray hair Quantitative Traits: Measurable traits IQ Blood pressure Height Genes versus Environment Rare Simple genetics High recurrence risk Common Complex genetics Low recurrence risk genetic Sickle cell disease environmental Hypertension Heart disease Diabetes Asthma Behavioral disorders Scurvy; Infectious diseases; Gunshot wound Why might someone want to seek genetic services?  Get information about their family history and any        genetic risk factors The diagnosis of a genetic disorder by physical examination and/or genetic laboratory testing How/why a disorder occurred (in most cases) The chance for the disorder to reoccur in the family The chance for other family members to have the disorder or pass it on The management and treatment of the disorder Support groups for the disorder Connections to other families who have a child with a similar/same disorder Types of genetic testing 1. Diagnostic testing - establish or confirm a diagnosis 2. Carrier testing - screen adults to determine if they are carriers of mutations so that their risk of having a child with a genetic defect can be calculated 3. Prenatal testing - determine if a fetus is affected with a genetic disorder (also includes PGD testing). 4. Presymptomatic testing - determine if a currently asymptomatic individual will become affected with a genetic disease in the future. 5. Population screening - screening of the entire population for a genetic disorder so that these individuals can be identified and treated before the onset of symptoms Chromosome Variation  Karyotype  23 pairs autosomes, 2 sex chromosomes  Each chromosome has a characteristic banding pattern  What is the most common genetic variation you see in karyotypes from a normal population? 46, XX versus 46, XY Variation in Chromosome Number  Trisomies 13, 18, and 21 are the only non- mosaic trisomies for an entire autosome that are compatible with postnatal survival  Monosomy X is the only monosomy that is viable Trisomy 13 Trisomy 18 Turnpenny & Ellard, 2007 Variation in chromosome structure  Translocations  Inversions  Duplications  Deletions Chromosome abnormalities microscopically visible changes in the number or structure of chromosomes occur in: Approximately 1% of all live births 23% of congenital anomalies with MR 13% of congenital heart defects 60% of spontaneous first trimester abortions Examples: 1. Down syndrome - caused by an additional copy of chromosome 21 2. Unbalanced translocations - partial monosomy for one region of the genome and partial trisomy for another region of the genome 3. 22q11.2 deletion –interstitial deletion of 3Mb removing several genes When to order cytogenetic testing (i.e. standard of care) Multiple congenital anomalies Mental retardation of unknown origin or associated with minor or major malformations Multiple unexplained spontaneous abortions Ambiguous genitalia Prenatal testing Abnormal prenatal screen Ultrasound abnormalities Fluorescence In Situ Hybridization (FISH) G A T T Metaphase cell Denatured target DNA ds ssDNA Denatured probe DNA FISH probes Unique sequence probes - single copy probes (1 kb feasible). Useful for microdeletions/dups, specific telomeres. A shows a normal chromosome 15 B shows a deletion at the end of the other chromosome 15 Copy Number Polymorphism  Large chunks of DNA (1000s-1 Mb) that are present in a variable number of copies in different people  Can affect the number of copies of a gene that are present in a person  Even if they don’t contain a complete gene, they can affect the level of gene expression Comparative Genome Hybridization      Fragments of sample and reference DNA labeled with different fluorescent dyes Labeled DNAs are denatured and incubated with metaphase chromosomes or on DNA arrays The DNAs compete for binding to the target DNA Resulting relative fluorescence is measured If there’s an equal sequence between sample and reference,you get a yellow signal. If not you get red or green. Indications for array CGH  Patients with normal chromosome analysis and:  Unexplained developmental delay or mental retardation  Dysmorphic features or congenital anomalies  Autism spectrum disorders, seizures, or a clinical presentation suggestive of a chromosomal syndrome  Patients with a previously identified chromosome abnormality:   To size deletions or duplications and identify genes involved For apparently balanced rearrangements and an abnormal clinical phenotype, oligo array analysis can be used to test for cryptic deletions/duplications at the breakpoints Changes to DNA sequence CTCGAGGGGCCTAGACATTGCCCTCCAGAGAGAGCACCCAACACCCTCCAGGCTTGACCGGCCAGGGTGTCCCCTTCCTACCTTGGAGAG AGCAGCCCCAGGGCATCCTGCAGGGGGTGCTGGGACACCAGCTGGCCTTCAAGGTCTCTGCCTCCCTCCAGCCACCCCACTACACGCTGC TGGGATCCTGGATCTCAGCTCCCTGGCCGACAACACTGGCAAACTCCTACTCATCCACGAAGGCCCTCCTGGGCATGGTGGTCCTTCCCA GCCTGGCAGTCTGTTCCTCACACACCTTGTTAGTGCCCAGCCCCTGAGGTTGCAGCTGGGGGTGTCTCTGAAGGGCTGTGAGCCCCCAGG AAGCCCTGGGGAAGTGCCTGCCTTGCCTCCCCCCGGCCCTGCCAGCGCCTGGCTCTGCCCTCCTACCTGGGCTCCCCCCATCCAGCCTCC CTCCCTACACACTCCTCTCAAGGAGGCACCCATGTCCTCTCCAGCTGCCGGGCCTCAGAGCACTGTGGCGTCCTGGGGCAGCCACCGCAT GTCCTGCTGTGGCATGGCTCAGGGTGGAAAGGGCGGAAGGGAGGGGTCCTGCAGATAGCTGGTGCCCACTACCAAACCCGCTCGGGGCAG GAGAGCCAAAGGCTGGGTGTGTGCAGAGCGGCCCCGAGAGGTTCCGAGGCTGAGGCCAGGGTGGGACATAGGGATGCGAGGGGCCGGGGC ACAGGATACTCCAACCTGCCTGCCCCCATGGTCTCATCCTCCTGCTTCTGGGACCTCCTGATCCTGCCCCTGGTGCTAAGAGGCAGGTAA GGGGCTGCAGGCAGCAGGGCTCGGAGCCCATGCCCCCTCACCATGGGTCAGGCTGGACCTCCAGGTGCCTGTTCTGGGGAGCTGGGAGGG CCGGAGGGGTGTACCCCAGGGGCTCAGCCCAGATGACACTATGGGGGTGATGGTGTCATGGGACCTGGCCAGGAGAGGGGAGATGGGCTC CCAGAAGAGGAGTGGGGGCTGAGAGGGTGCCTGGGGGGCCAGGACGGAGCTGGGCCAGTGCACAGCTTCCCACACCTGCCCACCCCCAGA GTCCTGCCGCCACCCCCAGATCACACGGAAGATGAGGTCCGAGTGGCCTGCTGAGGACTTGCTGCTTGTCCCCAGGTCCCCAGGTCATGC CCTCCTTCTGCCACCCTGGGGAGCTGAGGGCCTCAGCTGGGGCTGCTGTCCTAAGGCAGGGTGGGAACTAGGCAGCCAGCAGGGAGGGGA CCCCTCCCTCACTCCCACTCTCCCACCCCCACCACCTTGGCCCATCCATGGCGGCATCTTGGGCCATCCGGGACTGGGGACAGGGGTCCT GGGGACAGGGGTCCGGGGACAGGGTCCTGGGGACAGGGGTGTGGGGACAGGGGTCTGGGGACAGGGGTGTGGGGACAGGGGTGTGGGGAC AGGGGTCTGGGGACAGGGGTGTGGGGACAGGGGTCCGGGGACAGGGGTGTG ~ 1 change every 1,000 bases = 99.9% identical from person to person What is the effect of a DNA change? ½ White Lily chocolate DNA change can lead to different results No change Neutral variation ??? polymorphisms height, weight response to certain drugs, hair, skin, eye color Deleterious mutation Inborn errors of metabolism, cystic fibrosis, sickle cell anemia, cancer Mutation can occur in different places across a gene promoter X 1 X 2 X 3 X 4 5 Clinicians often don’t use pedigrees  “Although there are several obstacles, ... a common underestimation by clinicians of the value of Blue – 57% - no significant family hx the family history, …” Red – 33% - one chronic condition 57% 33% 2% 8% Yellow – 8% - two Pink – 2% - three or more (3) Scheuner, et al. Am J Med Genet 1997, 71:315-324. Pedigree vs. Questionnaire  Focus on individuals by asking about each person in       family Trigger patient memory Easier to see patterns Use to explain patterns Demonstrates biological relationships “Amount of genetic information shared” Reveals social relationships Family history can provide the basis for:  Making a diagnosis  Determining who is at risk and level of risk  Assessing needs for education and psychosocial support Rules  Squares for males  Circles for females  Relationship line (horizontal) – connects partners – double slash equals separation  Line of descent (vertical)  Sib-ship line (horizontal) Information to collect       Initials or first name – particularly affected Ages or dates (year) of birth Decades for adult onset concerns okay Unaffected just as important as affected If affected, note age of onset Deceased – slash – age and cause – include lost pregnancies d. 58 Colon CA More information to collect  Physical and mental health of each individual  Birth defects, developmental delay, mental retardation, inherited disorders, chronic conditions?  Build key – shading, patterns, etc.  Watch abbreviations – add to key as you go  Date pedigree, Where and who collected  Who reported information - Historian What to look for:  Mental retardation/  Early age of onset  Multiple affecteds  Individuals who are developmental delay  Birth Defects  Obvious genetic conditions  Infertility/miscarriage affected multiple times  Particular constellations of features  Pattern of inheritance 90 Dx 48 d. 50 82 82 60 Dx 42 58 63 62 61 Type 2 diabetes Dx. 45 28 35 33 30 Breast cancer 90 Dx 75 d. 77 82 Dx 76 80 Dx 68 d. 75 MI 60 58 63 62 28 35 33 30 Breast cancer 90 d. 35 Car accident d. 86 Prostate ca Dx 54 d. 78 60 58 63 d. 40 MI 70 Dx 51 51 28 35 33 30 Breast cancer Autosomal Dominant • • • Responsible gene on autosome Only 1 copy of mutation needed - normal allele not sufficient to compensate for mutant allele Heterozygotes and homozygotes are both affected Characteristics of Autosomal Dominant Disorders • appears in every generation • each affected person has an affected parent (exceptions!) • each child of an affected parent has 50% risk to inherit trait. • unaffected family members don’t transmit phenotype to children (exceptions again). • males and females equally likely to transmit the trait, to children of either sex. • male-to-male transmission • new mutations relatively common Autosomal Recessive • • • • Responsible gene on autosome Both alleles of the gene must be defective. Frequently due to loss of function (gene is inactivated) Heterozygotes are unaffected carriers Aa Aa Medium chain acyl CoA dehydrogenase (MCAD) aa Characteristics of Autosomal Recessive Disorders • If disorder appears >1 family member, typically found within a sibship, not across generations. • The recurrence risk for each sib of the proband is 25%. • More common with consanguinity, especially for rare diseases. • Males and females are equally likely to be affected. • New mutation is almost never a consideration. Sex-Linked • • • Responsible gene on X chromosome (also called “X-linked”) Usually for females, both copies of the X chromosome must be affected Males, hemizygous for the X chromosome, much more likely to be affected X-linked mental retardation Genetics and Prenatal Care Diagnostic Tests  Chorionic Villus Screens  Combined first trimester Sampling (CVS)  Amniocentesis  Testing for single gene defects screen  Triple screen/Quad screen Genetics and Prenatal Care Diagnostic Tests  Chorionic Villus Screens  Combined first trimester Sampling (CVS)  Amniocentesis screen  Triple screen/Quad screen Is 35 a “magic” age cut-off for screening versus testing? From Thompson & Thompson Genetics in Medicine For an autosomal recessive disorder, what is the family history likely to be? Carrier Testing The frequency of Tay-Sachs (prior to the onset of widespread carrier screening among Ashkenazim ) was about: 1/360,000 live births for non-Ashkenazi North Americans, and 1/3,600 for North American Ashkenazi Jews Carrier frequencies are therefore about: 1/300 for most North Americans, and 1/30 for North American Ashkenazi Jews And within a certain population, particular mutations tend to predominate Carrier Testing  African Americans:  Sickle cell disease  1 in 10  Ashkenazi Jewish:  Tay-Sachs  Canavan Disease  1 in 40 1 in 13 1 in 30 1 in 25 1 in 90 1 in 90 1 in 100       Gaucher Disease  Familial Dysautonomia   Caucasians:  Cystic fibrosis  1 in 25 Cystic fibrosis  Fanconi anemia  Niemann-Pick Disease  Bloom syndrome  What does a negative result tell you? For an autosomal recessive disorder, what is the family history likely to be? Newborn Screening Newborn Screening: WHY ?  Detect an affected infant before before symptoms to prevent or reduce morbidity and mortality  Provide parents and family reproductive options for future pregnancies  Avoid diagnostic odyssey http://genes-r-us.uthscsa.edu www.acmg.net/resources Look under “reference materials” Algorithm for MCAD positive newborn screen MCAD ACT Sheet Adults who might seek genetic services:  Those with reproductive problems  Those with a known genetic disorder in the family  Those with symptoms of a genetic disorder  Those with family history of cancer Case Study  At the time of her annual physical, your patient, a 30-year old woman, asks about the “breast cancer gene”. She is Jewish and has been reading in the paper that Jewish women may be more likely to have this “gene”. She has two older sisters, aged 33 and 35, who are also worried about their risks. Cancer risk assessment Sporadic cancer Familial cancer Red Flags: Hereditary cancer *Early onset cases *Individuals affected with multiple tumors *Particular patterns of tumors Breast and ovarian 90 Dx 48 d. 50 82 82 60 Dx 42 58 63 62 61 Type 2 diabetes Dx. 45 28 35 33 30 Breast cancer Genetic testing for BRCA1/2  All testing in North America performed by a single lab, Myriad  Exons and adjacent regions sequenced. Also look for large duplications and deletions. Mutation-specific testing is also available.  Possible results:  Mutation positive  Mutation negative (known mutation in family)  Variant of unknown significance (This happens ~10% of the time)  No mutation found  Preferable procedure is to do test on an affected family member first If our patient tests negative for a BRCA1/2 mutation, what are the possible explanations?  No BRCA1/2 mutation in the family Increased risk  She didn’t inherit the mutation in the family  Population risk (1 in 8)  There is a mutation in our patient but we can’t detect it using our testing method.  High risk  How can we avoid some of this confusion?  Identify a familial mutation  Try to test aunt first or test archived tissue sample from grandmother, if available.  What if the test is positive?  Provide psychosocial support  Review cancer risks and management options  Identify at-risk relatives  Plan for follow-up Cancer risks with BRCA mutations www.myriad.com  Increased surveillance Personal risk reduction following BRCA1/2 mutation detection  Selective estrogen receptor modulators (tamoxifen)  Prophylactic mastectomy  Prophylactic oophorectomy (usually recommended) Finch et al. (2006) JAMA 286:185-192 ASCO Guidelines for Hereditary Cancer Testing  Cancer predisposition testing should be offered only when…    There is a personal or family history suggesting a genetic susceptibility to cancer The test can be adequately interpreted The test result will aid in diagnosis or influence medical management of the patient or family members Why might somebody who has already had cancer want genetic testing?    They would be at increased risk of other additional primary tumors Could influence patient management Could help family members Genetic counseling/risk assessment  When a patient is not interested in or is not a good candidate for cancer genetic testing, genetic counseling and risk assessment are still valuable when there is:    A suggestive pattern of cancers in the family or individual High anxiety A mixture of cancers in the family (suggestive of a cancer syndrome) Mendelian versus complex traits  Mendelian traits    Are determined by the independent action of a single major gene Mutation in this gene is necessary and sufficient for phenotype Have predictable inheritance patterns Cystic fibrosis Risk to each sib is 25% and we can do prenatal testing Mendelian versus complex traits  Complex traits  Exhibit familial clustering but not predictable inheritance patterns Cleft palate Recurrence risk is 3% (compared to population risk of 0.1%) Benefits to determining genetic factors that influence a complex trait      Provide a molecular definition of the trait Improve understanding of disease etiology and mechanism Can offer early risk assessment Aids in discovery of new, targeted drugs Can be utilized for disease prevention How do we find genes for complex traits? Association studies  Search for the occurrence of specific genetic variation at a higher frequency among affected individuals compared to unaffected individuals  Strength of association is measured by an odds ratio  “we identified a variant in the CDKAL1 gene that was associated with T2D in individuals of European ancestry (odds ratio (OR) = 1.20)” Steintorsdottir et al. (2007)  In contrast to studies of Mendelian traits in which you look for mutations throughout a gene that that are inherited with a trait, association studies look for one specific allele that is overrepresented in the case population  An allele is the specific genetic variation in a gene  The sickle cell mutation is an allele of the beta globin gene We reserve the term “mutation” for alleles that cause disease and are very rare  Association and allele frequency in populations Control Population Affected Population Allele 1 Allele 2 Allele 3 Allele 4 Association with allele 1 Note: the disease-associated allele is found in the control population! Case Study  A 53-year old African American male has an annual check-up. He is 5’10” and 220 lbs. He reports feeling well. Family history indicates a history of diabetes in his mother that was diagnosed at age 45. She died at age 58 from complications of diabetes after 3 years on dialysis. “An immediate practical consequence of the discovery, said Decode’s chief executive, Kari Stefansson, would be to develop a diagnostic test to identify people who carry the variant gene. If people knew of their extra risk, they would have an incentive to stay thin and exercise, he said.” TCF7L2 and Type 2 Diabetes  ~38% of people examined are heterozygous for the TCF7L2 risk allele  Relative risk if you are heterozygous for the TCF7L2 risk allele is ~1.4.   26% of people in the group without the risk allele had T2D 38% of people in the group heterozygous for the risk allele had T2D  General population risk for T2D is ~33% Grant et al. (2006) Nature Genetics 38: 320-323 Why is this study important?  There was no prior evidence that TCF7L2 was involved in diabetes. This gives us a new way to look at the process by which diabetes develops.  Could ultimately lead to new treatments  We may find other genes that, in combination with TCF7L2, help us fully understand genetic contributions to diabetes. Evaluating Association Studies  Has the result been replicated in an independent population?  How predictive is the genetic variation of disease?  How do environmental risk factors interact with this genetic risk factor? Does the environmental risk have a much bigger role?  Would a genetic test for this variation give us more accurate risk assessment than one based on general family history and lifestyle factors? Unique Aspects of Genetic Medicine  You’re really treating a family, not an individual  Testing individuals can reveal information about other family members  Testing can be predictive  Especially as we move toward genomic tests, we may find things we’re not looking for Genetic Resources  National Society of Genetic Counselors  http://www.nsgc.org/  Genetics Home Reference  http://ghr.nlm.nih.gov/  NIH website with consumer-oriented information on genetic variation and genetic disease  Gene Tests/Gene Reviews  http://www.geneclinics.org/  Current reviews of genetic disorders  Labs that offer testing for each, if available  Genetic clinics by geographic location  Emory Genetics  http://www.genetics.emory.edu/egl/index.php

Related docs
DEPARTMENT OF HUMAN GENETICS
Views: 79  |  Downloads: 1
human genetics commission
Views: 2  |  Downloads: 0
Genetics Tutorial
Views: 76  |  Downloads: 3
MOLECULAR _ HUMAN GENETICS_ Semester System
Views: 14  |  Downloads: 1
Introduction to Genetics
Views: 86  |  Downloads: 8
Genetic Fundamentals
Views: 413  |  Downloads: 37
Human Genetics
Views: 5  |  Downloads: 1
Schedule for Genetics
Views: 253  |  Downloads: 1
Genetics and Heredity
Views: 12  |  Downloads: 3
genetics problems
Views: 21  |  Downloads: 2
Genetics
Views: 17  |  Downloads: 0
Human Genetics (PDF)
Views: 3  |  Downloads: 0
Introduction_to_genetics
Views: 5  |  Downloads: 2
premium docs
Other docs by pptfiles