Docstoc

Table S1 - BioMed Central

Document Sample
Table S1 - BioMed Central Powered By Docstoc
					Plant cell wall (PCW) synthesis stages of known PCW related genes in co-expression module

           Do modules contain
           genes in only one
Module IDs                       # of seed genes    1. Substrate generation
           PCW synthesis
           stage?
2_1                              8                  0
2_2                              6                  AT3G10340
3_1                              4                  AT4G34230
4_1                              8                  AT5G59290,AT2G28760,AT5G15490
14_1                             2                  0
15_1                             3                  0
16_1                             6                  AT2G28760,AT3G21240
18_1                             5                  AT1G76790
19_1                             2                  0
20_1                             8                  0
40_1                             7                  AT1G65060,AT4G05160
40_2                             2                  0
40_3       yes                   4                  0
40_4       yes                   3                  0
40_5       yes                   1                  0
40_6                             4                  0
40_7       yes                   1                  0
40_8       yes                   2                  0
40_9       yes                   2                  0
41_1                             5                  0
42_1       yes                   3                  0
42_2                             4                  0
42_3       yes                   2                  0
44_1       yes                   1                  0
44_2                             3                  AT2G30490
44_3       yes                   1                  0
44_4       yes                   1                  0
46_1       yes                   1                  0
52_1                             6                  AT4G36220
52_2       yes                   1                  0
52_3       yes                   1                  0
61_1                             14                 0
64_1                             2                  0
64_2                             2                  0
64_3                             4                  AT3G51160
65_1          4    AT1G24735
67_1          3    0
67_2    yes   1    0
68_1          5    0
74_1          5    AT3G61990
77_1          7    0
81_1          6    0
81_2          3    0
81_3          8    AT5G59290,AT2G28760,AT1G76790
81_4          3    AT5G15490
81_5          6    0
81_6    yes   1    0
81_7    yes   1    0
81_8          2    0
81_9          5    AT5G28840
81_11         3    0
85_1          2    0
86_1    yes   4    AT1G78570,AT1G51680,AT3G53260,AT4G3
87_1          6    0
92_1          4    AT1G62940
92_2    yes   1    AT1G67990
96_1          19   0
99_1          6    0
99_2          3    0
101_1   yes   1    0
102_2   yes   1    0
102_3   yes   2    0
102_4   yes   1    0
102_5   yes   1    0
108_1   yes   1    0
108_2         2    0
109_1         5    AT1G51680,AT3G53260,AT3G19450,AT5G4
111_1         6    0
119_1         10   AT2G28760
121_1         6    0
124_1         5    AT1G63180,AT1G72680
125_1         3    AT3G19450
125_2         2    AT1G12780
125_3         2    AT5G39320
125_5   yes   2    0
128_1         7    AT3G19450
128_2   yes   3    0
131_1         5    0
140_1         8    0
141_1         26   0
144_1   yes   2    0
147_1         25   AT3G19450
149_1   yes   2    0
153_1   yes   1    0
153_2   yes   1    0
154_1         9    0
154_2         6    0
154_3   yes   1    AT3G53260
155_1   yes   2    0
155_2   yes   1    0
155_3         2    0
156_1   yes   5    0
166_1         2    0
167_1   yes   1    0
173_1   yes   6    AT1G51680,AT3G53260,AT4G34230,AT2G4
176_1         4    0
177_1         10   0
178_1         5    0
181_1   yes   3    0
181_2         4    0
181_3         4    AT3G53260
183_2   yes   1    AT4G34050
184_1         3    0
184_2         2    0
184_3         5    AT1G80820
184_4         6    AT4G20460
184_5   yes   1    AT5G28840
185_2   yes   1    0
186_1         17   0
186_2         2    0
186_3   yes   1    0
192_1   yes   2    0
192_2   yes   1    0
192_3         2    AT1G33030
192_4   yes   1    0
200_1         6    AT1G17890
207_1   yes   1    0
207_2         3    0
207_3   yes   1    0
208_1         4    AT5G59290,AT2G28760,AT5G15490
209_1         3    0
211_1         6    AT3G10340
218_1         11   0
219_1   yes   1    0
225_1         9    0
225_2   yes   3    0
225_3         4    0
228_1         5    0
229_1         7    AT5G39320,AT5G15490
229_2         3    0
230_1   yes   1    0
230_2   yes   1    AT1G72680
231_1   yes   3    0
236_1   yes   1    0
238_1   yes   1    0
238_2   yes   1    0
244_1         23   0
248_1         10   0
249_1   yes   1    0
251_1         4    0
254_1         5    0
261_1         14   AT3G10340
265_1         5    0
265_2         3    0
265_4         2    0
265_5   yes   1    0
271_1         2    AT1G12780
275_1         9    0
278_1   yes   1    AT1G12780
279_1         12   AT5G15490
279_2         6    AT5G39320
286_1         4    0
286_2         9    AT5G39320,AT5G15490
286_3         4    0
286_4   yes   2    0
286_5         3    AT3G21230,AT1G15950
293_1         7    0
294_1         5    AT1G51680,AT3G53260,AT4G34230,AT1G1
295_1         19   0
303_1         4    0
308_1         5    0
309_1         14   0
312_1         7    AT1G63180,AT1G72680
312_2   yes   1    0
312_4         2    AT5G39320
312_5   yes   2    AT1G24735,AT2G33590
318_1   yes   1    0
323_1   yes   1    0
323_2   yes   2    0
323_3   yes   1    0
323_4         2    0
323_5         3    0
323_6         2    0
334_1         8    0
335_1         3    AT3G21230
335_2         2    0
335_4         2    0
335_5   yes   1    0
337_1         3    0
337_2         4    AT2G37040,AT1G80820
337_3         2    AT4G20460
337_4   yes   1    0
337_5   yes   1    0
337_6   yes   1    AT2G28760
338_1   yes   1    0
339_1   yes   1    0
342_1         5    AT3G21230
343_1         18   0
345_1         6    AT5G59290,AT2G28760,AT1G76790
348_1         7    0
349_1         4    0
362_1         9    0
364_1         8    0
365_1         3    0
368_1         3    0
368_2         2    0
377_1         10   0
379_1         3    0
380_1         5    0
383_1         7    0
384_1         10   0
385_1         2    0
387_1         7    0
388_1   yes   1   0
393_1         2   0
395_1         7   AT1G26570
397_1         6   AT2G28760
398_1         2   0
399_1         2   0
401_1         2   0
401_2         5   0
401_3   yes   1   AT2G37040
405_1         8   0
405_2   yes   3   0
407_1         7   0
411_1         8   AT2G30490
415_1         6   0
-expression modules


        2. Polysaccharide synthases and
                                             3. Secretion and targeting
        glycosyl transferases

                                             0
        AT5G17420,AT5G17420,AT5G03760,AT1G19300
        AT5G44030,AT4G18780,AT5G44030,AT4G18780,AT5G54690
                                             0
        0                                    0
        AT5G44030,AT4G18780,AT5G44030,AT4G18780,AT2G37090
                                             0
        AT2G22900                            0
        AT5G62620                            0
        0                                    0
        0                                    0
        0                                    0
        0                                    0
        AT5G16190                            0
        AT1G02730                            0
        0                                    0
        0                                    0
        0                                    0
        AT4G23990,AT2G38650                  0
        0                                    0
        0                                    0
        0                                    0
        0                                    0
        0                                    0
        AT2G28110                            0
        0                                    0
        0                                    0
        0                                    0
        0                                    0
        0                                    0
        0                                    0
        0                                    0
        0                                    0
        0                                    0
        0                                    0
        0                                    0
        0                                    0
        0                                    0
0                                    0
AT2G35650                            0
0                                    0
0                                    0
0                                    0
AT1G32930                            0
AT5G61840                            0
AT2G37090                            0
AT1G77130                            0
0                                    0
AT3G02350,AT3G11420                  0
0                                    0
0                                    0
0                                    0
AT1G24170,AT2G32430                  0
AT4G18780,AT4G18780,AT2G32610        0
AT5G30500                            0
0                                    0
AT1G02730                            0
AT1G33430                            0
0                                    0
0                                    0
AT1G13250                            0
AT1G23480                            0
0                                    0
0                                    0
0                                    0
0                                    0
0                                    0
0                                    0
0                                    0
0                                    0
0                                    0
AT5G44030,AT4G18780,AT5G44030,AT4G18780,AT2G28110,AT2G37090
                                     0
0                                    0
AT5G62620                            0
0                                    0
0                                    0
0                                    0
0                                    0
AT3G25140,AT2G03220                  0
0                                    0
0                     0
0                     0
AT1G55850             0
0                     0
AT4G07960,AT2G33100   0
0                     0
0                     0
0                     0
0                     0
0                     0
0                     0
0                     0
0                     0
0                     0
0                     0
0                     0
0                     0
0                     0
0                     0
0                     0
0                     0
0                     0
AT1G23480             0
0                     0
0                     0
0                     0
AT2G47180             0
0                     0
AT1G77130,AT1G32930   0
0                     0
0                     0
AT2G29040             0
AT4G23490             0
0                     0
0                     0
0                     0
0                     0
0                     0
0                     0
0                     0
0                     0
AT5G41460             0
0                                    0
0                                    0
0                                    0
0                                    0
0                                    0
0                                    0
0                                    0
0                                    0
AT1G55850,AT1G77130                  0
0                                    0
AT5G25820                            0
0                                    0
0                                    0
0                                    0
0                                    0
0                                    0
0                                    0
AT4G07960,AT2G33100,AT1G55850        0
0                                    0
0                                    0
0                                    0
0                                    0
AT5G44030,AT5G17420,AT4G18780,AT5G44030,AT5G17420,AT4G18780,AT5G03760,AT1G19300,AT2G3
                                     0
AT1G24170                            0
AT4G32410,AT4G32410,AT3G56000        0
AT3G02350                            0
0                                    0
0                                    0
0                                    0
0                                    0
0                                    0
AT2G20370                            0
AT1G24170                            0
0                                    0
0                                    0
0                                    0
0                                    0
0                                    0
AT4G26940                            0
0                                    0
0                                    0
AT1G02730                            0
AT5G25820,AT1G14080                  0
AT5G62620                            0
0                                    0
0                                    0
0                                    0
0                                    0
0                                    0
0                                    0
AT4G23990                            0
AT5G41460                            0
AT4G39350,AT4G39350                  0
0                                    0
AT1G13250                            0
0                                    0
AT3G62720                            0
AT2G21770,AT2G21770                  0
0                                    0
0                                    0
0                                    0
0                                    0
AT1G77130                            0
0                                    0
0                                    0
0                                    0
0                                    0
AT3G50760,AT2G20370                  0
AT4G07960,AT3G06260                  0
AT5G44030,AT5G44030                  0
AT1G23480                            0
0                                    0
0                                    0
0                                    0
AT4G38040                            0
AT5G30500                            0
0                                    0
0                                    0
AT1G27120                            0
0                                    0
AT1G02730,AT4G23490                  0
AT5G44030,AT5G17420,AT4G18780,AT5G44030,AT5G17420,AT4G18780,AT1G19300,AT2G37090
                                     0
AT1G21480                            0
0                                    0
0                               0
AT3G50760                       0
AT1G23480                       0
AT5G44030,AT5G44030,AT1G19300   0
0                               0
0                               0
0                               0
AT2G47180                       0
0                               0
0                               0
0                               0
AT5G22740                       0
AT1G14080                       0
0                               0
                                        5. Differentiation and secondary wall
4. Assembly, architecture, and growth
                                        formation

AT1G72990,AT4G19420,AT5G03170        AT5G60020
AT1G19940,AT1G80170                  0
AT5G65730,AT5G48900                  0
AT5G03170                            AT2G38080
0                                    0
0                                    0
AT2G32990,AT2G22470                  AT2G37130
AT1G70710,AT2G32990,AT4G37450        0
AT5G64640                            0
                                     0
AT5G58480,AT1G66250,AT3G13560,AT3G07320,AT1G10640
0                                    0
AT2G03090                            0
                                     0
AT2G01850,AT3G46570,AT2G45220,AT4G28300
AT1G26770,AT3G03220,AT5G56590        0
AT4G03210                            0
AT4G13080,AT3G53190                  0
AT2G28950                            0
AT4G28250,AT1G04680                  0
0                                    0
AT5G40730,AT5G53250                  AT1G05260,AT5G17820
AT1G65310,AT5G10430,AT4G12730        0
AT1G20190,AT1G03870                  0
AT5G02260,AT5G56870                  0
0                                    AT5G42180
AT2G17720,AT3G06300                  0
0                                    0
0                                    0
AT1G48100                            0
                                     0
AT5G20710,AT4G26830,AT1G02790,AT5G63180
AT4G30270                            0
AT3G52840                            0
AT5G40730,AT5G53250                  AT2G30210,AT1G05260,AT3G01190,AT3G21770,AT4G1129
AT2G47550                            AT4G08770
AT2G22470                            0
AT4G16260,AT3G06300                  AT5G19890
AT4G03210,AT2G28240                  0
0                                    0
AT1G70710                            0
                                     0
AT4G25810,AT3G07010,AT5G48900,AT2G04780
0                                    AT2G30210,AT4G11290,AT5G17820
AT1G66250,AT3G13560,AT3G07320        0
AT5G13870,AT3G04010,AT2G17720        AT5G42180
AT4G16260,AT2G22470                  0
AT3G03220,AT3G06300                  AT5G60020,AT2G37130
AT2G32990                            0
AT2G39700,AT4G30280,AT5G60490        0
0                                    0
0                                    0
AT3G44990                            AT2G38080
AT3G62110,AT2G43080                  0
AT5G03170                            0
0                                    AT4G31760
0                                    0
AT1G70710,AT3G53190                  AT5G40150
AT3G07320,AT4G14080                  0
0                                    0
                                     AT5G47000
AT4G35010,AT2G16730,AT1G02790,AT3G07820,AT5G48140,AT1G14420,AT3G01270,AT5G15110,AT5G0
                                     0
AT2G28950,AT3G10720,AT2G14890,AT5G55730
0                                    0
AT5G58480                            0
AT5G65730                            0
AT5G63800,AT3G07010                  0
0                                    0
AT3G10720                            0
AT4G30380                            0
AT1G80140                            0
AT1G14720                            0
AT5G40730                            AT1G05260,AT3G01190,AT3G21770,AT5G66390
AT1G72990,AT3G42950                  AT2G29130,AT5G42180
AT3G45970,AT2G45220,AT2G22470        AT2G37130
AT4G17180,AT3G29090                  0
AT5G56870,AT1G75680                  0
AT3G45970                            0
0                                    0
AT3G06770,AT4G02320                  0
AT3G15720,AT5G63180                  0
AT3G52840,AT2G46930,AT5G64310        0
                                     0
AT2G28950,AT5G42100,AT3G54920,AT5G55730
                                     0
AT2G28950,AT4G03210,AT5G42100,AT3G54920,AT5G55730
                                     AT5G47000
AT4G35010,AT2G16730,AT2G23900,AT1G02790,AT3G07820,AT5G48140,AT1G14420,AT2G02720,AT3G0
AT2G17720,AT3G06300                  0
                                     0
AT2G16730,AT2G44560,AT3G43860,AT5G20390,AT5G64790,AT2G23900,AT2G02720,AT5G15110,AT3G1
0                                    AT2G30210,AT1G05260
0                                    0
AT3G03220                            0
                                     0
AT2G28950,AT5G65730,AT4G24780,AT1G11580,AT3G10720,AT4G33220
                                     0
AT2G06850,AT2G14890,AT3G13520,AT1G03870,AT2G04780
0                                    0
AT1G02790,AT5G40730                  0
AT3G57690                            0
AT4G26830                            0
                                     0
AT2G28950,AT4G03210,AT5G42100,AT3G54920,AT5G55730
AT4G03210                            0
AT2G45220                            0
0                                    0
AT5G56870,AT1G03870,AT5G44130        AT5G51890
AT5G40730,AT5G53250,AT5G56540        AT2G30210,AT3G01190,AT4G11290,AT5G17820,AT5G6639
0                                    AT5G03260,AT5G42180,AT4G35970
AT5G65730,AT4G24780,AT5G48900        0
AT2G28950,AT2G36870                  0
AT2G04780                            0
0                                    0
0                                    AT5G42180
AT3G44990                            0
AT4G25810,AT4G17180                  AT5G06730
AT5G13870,AT1G66250                  0
0                                    0
AT3G03220                            0
                                     0
AT2G16730,AT5G64790,AT2G23900,AT5G48140,AT1G14420,AT2G02720,AT5G15110,AT3G05610,AT3G0
AT3G07830                            0
0                                    AT4G17690
AT5G44130,AT2G43080                  0
0                                    AT5G17820
AT3G45970                            0
0                                    AT5G06720
AT3G24670                            AT5G17820,AT2G18980,AT1G30870
AT3G49220                            0
AT5G42100,AT1G04680                  0
0                                    0
0                                    AT5G01190
AT2G01850,AT3G29090                  0
AT5G56540                            AT1G68850,AT5G14130,AT5G14130
                                     AT2G30210,AT3G01190,AT5G17820,AT5G64100,AT4G3017
AT5G40730,AT5G53250,AT5G56540,AT5G65390
0                                    0
AT5G56540                            AT2G30210,AT1G05260,AT3G21770,AT4G11290,AT5G6639
AT5G40730,AT5G53250,AT5G65390        0
AT4G14130,AT4G30290                  AT5G03260
AT5G58090,AT3G22440,AT4G09030        0
AT2G17720,AT3G06300                  AT2G39040
AT2G22470                            AT5G42180
AT3G48580                            0
0                                    0
AT1G69530,AT2G06850,AT4G03210        0
AT4G14130                            0
AT2G28950                            0
0                                    0
                                     0
AT2G16730,AT3G43860,AT5G64790,AT2G23900,AT2G02720,AT5G15110,AT3G17060,AT2G26450,AT3G0
AT5G40730,AT5G56540                  AT2G30210,AT1G05260,AT5G17820,AT5G64100,AT5G6639
0                                    0
AT2G32990,AT5G10430                  AT2G37130
                                     AT3G49960
AT1G12560,AT3G10710,AT5G04960,AT4G40090
AT1G72990,AT5G03170                  AT2G38080,AT5G60020,AT5G42180
AT3G04010,AT3G29090                  0
AT3G03220                            0
0                                    AT3G28200
AT2G22470                            0
AT3G59010                            0
AT4G25820,AT3G54590,AT5G53250        AT1G05260,AT4G11290,AT4G26010,AT5G17820,AT1G3087
0                                    0
                                     AT2G39040,AT5G42180,AT3G49960
AT1G12560,AT5G57530,AT4G14130,AT1G48930,AT3G10710,AT5G04960,AT2G17720
AT1G65610,AT2G22470,AT3G06300        0
AT2G17720,AT3G06300                  AT5G42180
AT3G03220,AT1G48930,AT2G22470        AT2G39040,AT3G49960
AT1G65310,AT4G16260,AT3G10710        0
AT1G12560,AT5G13870                  0
AT5G04960                            0
                                     0
AT2G06850,AT3G13750,AT4G24780,AT5G48900,AT4G33220,AT2G14890
0                                    0
                                     AT5G47000
AT4G35010,AT2G16730,AT1G02790,AT3G07820,AT5G48140,AT1G14420,AT3G01270,AT5G15110,AT5G0
AT1G12560,AT1G48930,AT4G40090        AT5G67400
AT3G53190                            AT5G40150
AT3G24670,AT3G47400                  AT2G30210,AT5G03260,AT1G05260,AT3G01190,AT3G2177
AT4G03210,AT5G57550,AT2G14890        0
0                                    0
AT4G23820                            0
0                                    0
AT4G03210                            0
AT2G03090                            0
AT4G03210,AT1G48100                  0
0                                    0
0                                    0
AT4G02320,AT2G22470                  0
AT4G28300                            AT5G64120
                                     0
AT2G28950,AT4G03210,AT1G45130,AT1G04680,AT5G55730
0                                    0
AT3G07320                            0
0                                    0
AT5G64640                            0
AT2G17720                            AT5G06730,AT5G42180
AT4G25810                            0
AT4G13080                            0
0                                    0
0                                    AT1G71695,AT1G71695
0                                    0
0                                    0
AT4G13080                            0
AT4G22470                            0
                                     0
AT2G16730,AT2G23900,AT2G02720,AT5G15110,AT3G17060,AT2G26450,AT3G05610,AT3G62170,AT4G1
AT2G32990,AT2G17720                  0
                                     0
AT3G10720,AT2G14890,AT2G04780,AT5G55730
AT2G17720,AT3G06300                  AT5G42180
AT5G40730,AT5G56540                  AT2G30210,AT1G05260,AT4G11290,AT5G66390,AT4G3017
                                     0
AT1G75680,AT4G29360,AT4G23820,AT2G14890,AT2G04780
AT5G56590                            0
AT4G32375,AT5G18990                  0
AT1G80140                            0
                                     0
AT3G23730,AT5G58480,AT1G66250,AT3G13560,AT3G07320,AT1G10640
0                                    0
                                     0
AT3G45960,AT3G45970,AT4G30280,AT4G25810
AT1G70710,AT3G53190,AT2G46930        AT5G40150
AT5G03170,AT5G60490                  AT2G38080,AT5G60020
0                                    AT2G37130
0                                    AT3G21770,AT4G11290,AT5G17820,AT5G64100,AT4G0878
0                                    AT5G42180
0                                    0
                                     0
AT2G28950,AT3G10720,AT2G14890,AT2G04780,AT5G55730
0                                    AT5G03260,AT4G35970
AT2G37640                            0
AT1G11580                            0
AT4G17180                            AT5G06730
AT4G25810,AT2G17720                  AT5G42180
0                                    0
                                     AT5G42180,AT3G49960
AT1G12560,AT1G48930,AT3G10710,AT5G04960
AT2G22470,AT2G17720,AT3G06300        0
                                     0
AT2G28950,AT2G39700,AT4G03210,AT3G54920,AT3G61640,AT5G55730
AT3G24670                            AT2G30210,AT5G66390,AT4G30170
0                                    AT2G30210,AT3G21770,AT4G11290,AT5G66390,AT4G3017
6. Signaling and response


AT1G22480
0
AT4G27520
0
AT3G22600
AT1G54860,AT3G61980
AT1G77630
AT3G52370,AT3G52370
AT1G65240
AT2G25060,AT1G21880,AT5G08000
AT1G29980,AT3G27200,AT1G77630,AT4G38660
0
0
0
0
0
0
0
AT1G21090,AT5G08210
AT3G22600
0
AT1G08500
0
0
0
AT3G43960
AT4G26690
0
AT1G18280
0
0
AT2G48130
0
AT2G32300
0
AT1G23050
AT5G39970,AT3G52370,AT3G52370
0
AT1G62790
AT2G48130
AT2G25060,AT5G25090,AT1G21880
AT4G26690
0
0
AT3G52370,AT3G52370
AT1G70990
AT3G27200
AT4G28085
0
0
0
0
0
AT1G21090,AT1G77630
0
0
AT3G26110,AT1G24520,AT2G20700
AT1G55260
AT3G18050,AT4G12420
0
0
0
AT1G55260
0
0
AT2G23990
0
AT2G44790
AT1G72230
AT1G59970,AT3G29810
0
0
0
AT3G02210,AT3G02210
0
AT2G27130,AT5G64080
0
AT1G21090
AT1G21090,AT1G77630,AT4G35880
AT3G26110,AT1G24520,AT5G58170,AT3G20580,AT3G20580,AT5G58170
0
AT4G28280,AT5G58050,AT5G58170,AT3G20580,AT3G20580,AT4G28280,AT5G58170
0
AT1G08500
0
AT4G27520,AT3G18050,AT5G19250
AT1G55260
0
0
0
AT1G18280
0
AT3G61980
0
0
0
AT3G22600
AT3G20570,AT1G72230
0
AT5G19250
AT3G18050,AT1G55260
0
AT1G72230,AT5G60950
0
AT3G27200
AT4G30590
0
0
AT3G26110,AT1G24520,AT4G28280,AT2G20700,AT5G36260,AT5G58050,AT4G28280
0
0
0
0
0
0
AT2G48130
0
AT1G65380
0
0
AT3G44100
AT1G56320,AT2G48140
AT1G62790,AT2G48130
AT3G18050
AT2G44790,AT3G22600
0
AT1G64640
0
AT1G72230,AT2G32300
0
0
0
0
0
0
AT2G17760
AT4G28280,AT2G20700,AT5G58050,AT5G58170,AT3G20580,AT3G20580,AT4G28280,AT5G58170
AT1G62790,AT3G22600
AT5G22430
AT3G52370,AT3G52370
0
AT1G22480,AT1G72230
AT4G28085,AT5G60920
0
0
0
0
AT2G48130
0
AT5G49270
AT3G43960
0
AT1G08500,AT3G52370,AT3G52370
AT5G49270
0
0
AT1G55260
0
AT3G26110,AT1G24520,AT2G20700
0
AT1G21090,AT1G77630
AT5G14150
AT1G54860
AT5G64080
0
0
0
0
0
0
AT5G08210
0
0
AT4G16140,AT4G38660
AT3G20570,AT1G09790
0
AT2G28410,AT2G28410
0
0
AT3G27200
0
0
0
0
AT5G55480
0
AT3G07390
AT4G28280,AT1G29980,AT5G58050,AT5G58170,AT4G28280,AT5G58170
0
AT4G38660,AT4G12420
AT1G72230
AT2G44790,AT3G22600
AT4G31840,AT4G38660,AT5G55480
AT4G16120,AT4G16120
0
AT2G23990
AT2G25060,AT5G25090,AT1G21880,AT5G08000
AT2G25060,AT1G21880
AT3G16860
AT1G21090
AT1G72230
0
AT2G44790,AT3G22600
0
AT3G02210,AT3G02210
0
AT3G20570
AT4G27520
AT4G16640
0
AT3G27200
0
AT2G32300,AT5G60950
0
0
AT5G14150,AT1G62790
AT2G44790
G28280,AT5G58170
Co-expressed genes in each module and their motifs in the promoters

              Modules containing seed genes from
                                                   Modules including
Module IDs    over four major PCW synthesis
                                                   transcription factor?
              stages?
2_1           yes                                  yes
2_2           yes
3_1           yes
4_1           yes
14_1          yes
15_1          yes                                  yes
16_1          yes
18_1          yes
19_1                                               yes
20_1
40_1          yes
40_2          yes
40_3                                               yes
40_4
40_5
40_6          yes
40_7
40_8
40_9
41_1
42_1
42_2          yes
42_3
44_1                                               yes
44_2          yes
44_3
44_4
46_1                                               yes
52_1          yes
52_2
52_3                                               yes
61_1
64_1
64_2                                               yes
64_3          yes
65_1          yes
67_1    yes   yes
67_2
68_1
74_1    yes
77_1    yes
81_1    yes
81_2    yes
81_3    yes
81_4    yes   yes
81_5    yes
81_6
81_7
81_8
81_9    yes
81_11   yes
85_1    yes   yes
86_1    yes
87_1    yes
92_1    yes
92_2    yes   yes
96_1
99_1    yes
99_2    yes
101_1         yes
102_2
102_3
102_4
102_5
108_1         yes
108_2
109_1   yes
111_1
119_1   yes   yes
121_1         yes
124_1   yes
125_1   yes   yes
125_2   yes
125_3   yes
125_5
128_1   yes   yes
128_2
131_1
140_1
141_1   yes   yes
144_1
147_1   yes   yes
149_1
153_1         yes
153_2
154_1         yes
154_2
154_3   yes
155_1         yes
155_2
155_3
156_1
166_1
167_1
173_1   yes
176_1         yes
177_1         yes
178_1
181_1
181_2   yes
181_3   yes   yes
183_2   yes   yes
184_1
184_2   yes
184_3   yes
184_4   yes   yes
184_5   yes
185_2
186_1   yes   yes
186_2   yes
186_3
192_1
192_2
192_3   yes
192_4         yes
200_1   yes
207_1
207_2
207_3   yes
208_1   yes   yes
209_1         yes
211_1   yes
218_1
219_1
225_1         yes
225_2
225_3
228_1   yes   yes
229_1   yes
229_2   yes
230_1
230_2   yes
231_1
236_1         yes
238_1
238_2         yes
244_1   yes   yes
248_1
249_1         yes
251_1
254_1
261_1   yes   yes
265_1   yes
265_2   yes
265_4   yes
265_5         yes
271_1   yes   yes
275_1
278_1   yes
279_1   yes   yes
279_2   yes
286_1   yes
286_2   yes
286_3
286_4
286_5   yes   yes
293_1
294_1   yes
295_1
303_1
308_1   yes
309_1   yes
312_1   yes   yes
312_2
312_4   yes
312_5   yes
318_1         yes
323_1
323_2         yes
323_3   yes
323_4   yes
323_5   yes
323_6
334_1   yes
335_1   yes   yes
335_2   yes
335_4   yes
335_5
337_1
337_2   yes   yes
337_3   yes
337_4   yes
337_5
337_6   yes
338_1
339_1
342_1   yes
343_1   yes
345_1   yes   yes
348_1   yes
349_1
362_1         yes
364_1
365_1   yes
368_1   yes   yes
368_2
377_1         yes
379_1   yes
380_1
383_1   yes
384_1   yes   yes
385_1   yes   yes
387_1
388_1
393_1   yes   yes
395_1   yes
397_1   yes
398_1         yes
399_1
401_1
401_2   yes   yes
401_3   yes
405_1
405_2         yes
407_1   yes
411_1   yes
415_1
                       * indicates # of genes expressed in the tissue/organ
                                            # of genes that is
Total # of genes (size) # of new candidates conserved between          Gene IDs
                                            Arabidopsis and
                                            Populus
31                      23                  21                         AT5G03760,AT1G14380,AT
14                      8                   9                          AT1G17620,AT1G19940,AT
6                       2                   1                          AT5G48900,AT1G19050,AT
9                       1                   5                          AT5G15490,AT5G59290,AT
6                       4                   3                          AT5G43260,AT2G22900,AT
15                      12                  7                          AT1G54860,AT5G53490,AT
16                      10                  7                          AT2G27140,AT4G34640,AT
6                       1                   2                          AT2G32990,AT3G52370,AT
40                      38                  16                         AT5G18310,AT1G12370,AT
8                       0                   4                          AT3G07320,AT5G58480,AT
173                     166                 106                        AT4G35570,AT4G14770,AT
87                      85                  50                         AT5G51940,AT5G17620,AT
97                      93                  62                         AT3G54220,AT4G24560,AT
57                      54                  35                         AT3G07170,AT1G08660,AT
30                      29                  20                         AT3G60690,AT3G58800,AT
38                      34                  20                         AT5G02100,AT2G38650,AT
23                      22                  9                          AT4G33300,AT2G20500,AT
21                      19                  13                         AT3G02660,AT3G13230,AT
34                      32                  16                         AT1G21090,AT5G08210,AT
17                      12                  6                          AT4G23690,AT5G08640,AT
14                      11                  8                          AT1G16370,AT3G54860,AT
13                      9                   9                          AT1G03870,AT3G10740,AT
13                      11                  9                          AT4G01950,AT3G52480,AT
8                       7                   5                          AT1G08320,AT1G67730,AT
6                       3                   4                          AT5G20400,AT2G30490,AT
6                       5                   2                          AT5G65020,AT1G12310,AT
5                       4                   4                          AT4G14750,AT2G36400,AT
7                       6                   4                          AT3G50070,AT3G07540,AT
29                      23                  14                         AT1G02790,AT4G36220,AT
17                      16                  8                          AT4G00330,AT2G15890,AT
8                       7                   3                          AT3G61890,AT4G31800,AT
27                      13                  12                         AT2G18980,AT1G05260,AT
10                      8                   2                          AT2G47550,AT4G09990,AT
6                       4                   5                          AT2G39430,AT2G28670,AT
7                       3                   5                          AT3G27240,AT1G67330,AT
18                      14                  8                          AT4G03210,AT1G23050,AT
12   9    3    AT5G09330,AT5G27550,AT
23   22   9    AT5G42400,AT2G17560,AT
9    4    3    AT1G62790,AT4G25810,AT
5    0    1    AT4G11290,AT2G30210,AT
7    0    4    AT1G21880,AT1G32930,AT
70   64   45   AT5G54500,AT2G27290,AT
99   96   65   AT3G02880,AT1G20900,AT
91   83   53   AT3G14610,AT3G29185,AT
58   55   36   AT1G10480,AT4G20110,AT
51   45   22   AT3G11420,AT1G70990,AT
11   10   7    AT5G66920,AT3G27200,AT
14   13   11   AT2G43950,AT3G57180,AT
32   30   21   AT2G38080,AT2G01260,AT
41   36   27   AT2G45820,AT5G07100,AT
20   17   9    AT3G18710,AT4G00700,AT
8    6    0    AT5G21120,AT5G27100,AT
7    3    3    AT3G23000,AT3G53260,AT
6    0    4    AT1G21090,AT3G53190,AT
16   12   10   AT3G57620,AT3G57920,AT
16   15   6    AT1G13140,AT3G43920,AT
40   21   10   AT1G14420,AT5G15110,AT
13   7    8    AT5G15230,AT5G57700,AT
7    4    4    AT1G23480,AT1G75780,AT
11   10   3    AT5G58480,AT5G10030,AT
10   9    7    AT4G27710,AT1G76450,AT
10   8    5    AT5G08650,AT5G13490,AT
9    8    7    AT1G75690,AT3G01660,AT
5    4    4    AT4G02070,AT5G45680,AT
14   13   2    AT5G48770,AT2G15410,AT
12   10   3    AT5G15730,AT5G53740,AT
11   6    7    AT1G14720,AT3G19450,AT
6    0    3    AT3G21770,AT1G05260,AT
21   11   12   AT1G20850,AT5G46340,AT
25   19   8    AT3G29810,AT1G59970,AT
11   6    8    AT1G63180,AT4G17180,AT
16   13   6    AT4G38360,AT3G17810,AT
15   13   8    AT1G49670,AT5G63905,AT
7    5    4    AT2G29450,AT3G59280,AT
5    3    1    AT3G06770,AT1G09390,AT
19   12   13   AT1G13080,AT3G47250,AT
7    4    2    AT3G52840,AT2G46930,AT
7    2    3    AT1G21090,AT3G54920,AT
15    7     7    AT1G21090,AT2G05790,AT
69    43    26   AT2G16730,AT3G57690,AT
5     3     2    AT2G17720,AT1G47740,AT
146   121   62   AT1G47270,AT2G45800,AT
7     5     5    AT1G26230,AT1G09340,AT
14    13    9    AT2G30200,AT4G25260,AT
12    11    8    AT1G17560,AT5G53400,AT
45    36    21   AT2G25510,AT5G25610,AT
40    34    22   AT1G03870,AT3G13520,AT
32    31    24   AT1G66200,AT5G11670,AT
22    20    10   AT2G30290,AT5G09550,AT
23    22    14   AT5G65090,AT4G02860,AT
12    10    6    AT5G57610,AT3G47250,AT
7     2     3    AT4G35950,AT5G55730,AT
6     4     4    AT4G27450,AT3G45900,AT
18    17    9    AT3G07590,AT1G16520,AT
8     2     5    AT2G31880,AT1G51680,AT
5     1     1    AT3G23050,AT5G51890,AT
27    17    13   AT2G31390,AT5G66390,AT
6     1     4    AT4G35970,AT1G72230,AT
16    13    6    AT3G56240,AT5G40890,AT
20    16    9    AT3G27890,AT1G49750,AT
13    9     8    AT2G26340,AT5G35630,AT
9     8     4    AT4G34050,AT3G59060,AT
32    29    15   AT5G11060,AT1G14780,AT
20    18    12   AT5G01610,AT2G47180,AT
24    19    18   AT4G17180,AT1G80820,AT
44    38    25   AT1G78170,AT1G74370,AT
22    21    13   AT5G28840,AT2G36250,AT
12    11    7    AT2G04700,AT5G23530,AT
123   106   52   AT3G17980,AT5G58050,AT
10    8     6    AT4G23490,AT2G33670,AT
6     5     2    AT4G17690,AT3G46750,AT
27    25    20   AT5G63410,AT2G02760,AT
13    12    8    AT3G22420,AT1G49820,AT
27    25    14   AT5G04140,AT5G20270,AT
11    10    8    AT4G19840,AT1G70230,AT
6     0     2    AT3G24670,AT2G18980,AT
14    13    11   AT3G06150,AT5G23080,AT
20    17    12   AT1G48240,AT2G13690,AT
18    17    14   AT4G27690,AT2G39450,AT
20    16    8    AT5G13090,AT5G37500,AT
13   10   6    AT2G21290,AT2G36720,AT
7    1    4    AT5G56540,AT3G10340,AT
18   7    6    AT4G15093,AT5G65390,AT
15   14   13   AT3G18050,AT5G66190,AT
21   12   9    AT2G36100,AT2G47000,AT
7    4    1    AT5G65390,AT3G21710,AT
5    1    3    AT4G14130,AT2G37750,AT
19   14   9    AT4G09030,AT1G78550,AT
16   9    5    AT2G39040,AT3G10660,AT
11   8    8    AT5G42180,AT3G05490,AT
7    6    5    AT1G27300,AT5G04040,AT
5    4    3    AT4G02280,AT1G68140,AT
37   34   24   AT5G60360,AT2G45180,AT
6    5    2    AT5G14340,AT4G14130,AT
24   23   12   AT3G27060,AT5G16130,AT
19   18   6    AT1G77580,AT3G07590,AT
93   70   44   AT3G20190,AT3G43120,AT
25   15   9    AT4G13660,AT5G17820,AT
6    5    2    AT5G07560,AT5G22430,AT
5    1    2    AT4G20110,AT5G10430,AT
11   6    4    AT3G05490,AT5G05500,AT
22   8    17   AT3G10340,AT5G12870,AT
30   25   16   AT5G60920,AT3G57420,AT
44   41   24   AT4G24120,AT4G31470,AT
22   20   9    AT3G28200,AT3G55640,AT
12   11   7    AT5G10750,AT2G22470,AT
9    7    7    AT3G59010,AT5G03530,AT
9    0    3    AT1G30870,AT4G11290,AT
6    5    3    AT3G15880,AT1G35190,AT
46   34   19   AT2G41970,AT1G05810,AT
16   10   5    AT5G05880,AT4G01700,AT
30   26   14   AT3G24450,AT1G01070,AT
53   44   28   AT2G38480,AT4G26790,AT
34   30   17   AT1G25260,AT5G37790,AT
7    5    3    AT1G27400,AT1G05210,AT
19   16   9    AT1G59850,AT1G67730,AT
7    0    2    AT5G48900,AT4G24780,AT
9    4    4    AT3G53260,AT1G15950,AT
39   20   10   AT3G26110,AT5G07430,AT
8    4    4    AT1G12560,AT5G67400,AT
5    0    3    AT1G02730,AT1G21090,AT
26   12   13   AT1G02900,AT3G62280,AT
113   106   61   AT1G72680,AT1G01140,AT
17    16    5    AT1G14950,AT1G03890,AT
14    12    7    AT3G25870,AT3G05260,AT
8     6     4    AT5G09650,AT1G04920,AT
16    15    10   AT5G08580,AT2G19170,AT
40    39    18   AT5G59740,AT3G03980,AT
41    39    23   AT3G24150,AT4G23800,AT
24    23    18   AT1G76360,AT4G23990,AT
31    29    15   AT5G41460,AT1G60810,AT
26    23    12   AT4G30390,AT3G51850,AT
20    18    7    AT3G07590,AT1G17380,AT
11    3     7    AT4G16140,AT1G04680,AT
48    45    29   AT4G29140,AT5G07320,AT
35    33    22   AT1G69430,AT2G44940,AT
23    21    11   AT2G28390,AT4G20110,AT
7     6     4    AT1G53770,AT1G06520,AT
24    21    16   AT2G20875,AT2G17720,AT
46    42    22   AT1G47410,AT5G20960,AT
39    37    20   AT1G67920,AT5G12290,AT
22    21    12   AT1G77130,AT5G02790,AT
14    13    9    AT1G71695,AT1G14030,AT
19    18    9    AT2G28760,AT2G01720,AT
9     8     6    AT3G49670,AT1G66180,AT
5     4     0    AT1G52810,AT4G13080,AT
12    7     3    AT3G21230,AT3G09920,AT
19    1     9    AT3G06260,AT1G29980,AT
14    8     3    AT2G28760,AT1G49240,AT
8     1     5    AT2G14890,AT1G23480,AT
7     3     5    AT3G06300,AT1G72230,AT
23    14    11   AT4G13660,AT3G22600,AT
8     0     2    AT2G04780,AT2G14890,AT
8     5     6    AT4G18460,AT1G77860,AT
23    20    1    AT5G04400,AT1G28160,AT
16    14    3    AT2G07230,AT3G48830,AT
28    18    15   AT3G08770,AT3G54560,AT
13    10    9    AT5G55540,AT1G27120,AT
5     0     1    AT4G30280,AT4G25810,AT
7     0     5    AT1G70710,AT4G23490,AT
13    3     11   AT1G19300,AT1G72230,AT
12    10    7    AT1G76360,AT1G08320,AT
18    11    8    AT5G12880,AT3G22600,AT
5     4     2    AT2G17370,AT1G35190,AT
19   17   13   AT3G50760,AT1G56700,AT
9    2    3    AT2G14890,AT2G28950,AT
7    1    3    AT3G20570,AT1G19300,AT
12   10   5    AT4G27520,AT2G37640,AT
6    4    3    AT3G07760,AT4G16640,AT
24   22   10   AT1G09970,AT3G62030,AT
26   21   18   AT2G18360,AT4G36990,AT
14   13   11   AT4G00660,AT1G25380,AT
21   13   11   AT2G05920,AT5G04960,AT
11   8    5    AT3G06300,AT4G00680,AT
7    0    5    AT5G22740,AT2G39700,AT
8    0    4    AT5G14150,AT1G62790,AT
6    0    3    AT5G66390,AT3G21770,AT
** indicates # of conditions contained the corresponding tissue/organ

                                                     # of genes
                 % of new
Seed IDs                           # of found motifs covered by the best
                 candidates
                                                     motif
              74%            15                30
AT5G03760,AT1G22480,AT5G03170,AT4G19420,AT1G19300,AT5G17420,AT1G72990,AT5G60020
              57%            9                 13
AT1G19940,AT1G80170,AT3G10340,AT4G18780,AT5G44030,AT5G54690
              33%            9
AT5G48900,AT4G27520,AT4G34230,AT5G65730        5
              11%            12                9
AT5G15490,AT5G59290,AT5G44030,AT2G28760,AT4G18780,AT2G37090,AT5G03170,AT2G38080
              67%
AT2G22900,AT3G22600          15                5
              80%
AT1G54860,AT5G62620,AT3G6198014                14
              63%            11                15
AT3G21240,AT1G77630,AT2G28760,AT2G32990,AT2G37130,AT2G22470
              17%            16                5
AT2G32990,AT3G52370,AT1G70710,AT1G76790,AT4G37450
              95%
AT1G65240,AT5G64640          8                 37
              0%             11                7
AT3G07320,AT5G58480,AT3G13560,AT1G21880,AT5G08000,AT2G25060,AT1G10640,AT1G66250
              96%            14                125
AT1G65060,AT1G29980,AT4G05160,AT1G77630,AT4G38660,AT5G16190,AT3G27200
              98%
AT1G02730,AT2G03090          8                 85
              96%            12
AT3G46570,AT2G45220,AT4G28300,AT2G01850        96
              95%
AT5G56590,AT1G26770,AT3G032209                 56
AT4G03210     97%            8                 29
              89%            9
AT2G38650,AT4G23990,AT3G53190,AT4G13080        36
AT2G28950     96%            8                 22
              90%
AT4G28250,AT1G04680          15                20
              94%
AT1G21090,AT5G08210          8                 32
              71%            18                16
AT3G22600,AT5G40730,AT5G53250,AT1G05260,AT5G17820
              79%
AT5G10430,AT4G12730,AT1G6531014                13
              69%            14
AT1G03870,AT1G20190,AT1G08500,AT2G28110        12
              85%
AT5G02260,AT5G56870          11                12
AT5G42180     88%            13                8
              50%
AT2G30490,AT3G06300,AT2G1772015                5
AT3G43960     83%            9                 5
AT4G26690     80%            14                4
AT1G48100     86%            12                6
              79%            15                27
AT1G02790,AT4G36220,AT5G20710,AT5G63180,AT1G18280,AT4G26830
AT4G30270     94%            11                16
AT3G52840     88%            7                 7
              48%            11                26
AT2G18980,AT1G05260,AT5G53250,AT5G66390,AT4G30170,AT2G48130,AT4G26010,AT3G21770,AT5G4
              80%
AT2G47550,AT4G08770          12                9
              67%
AT2G32300,AT2G22470          12                5
              43%            12
AT3G51160,AT3G06300,AT4G16260,AT5G19890        6
              78%            8
AT4G03210,AT1G23050,AT2G28240,AT1G24735        17
              75%
AT2G35650,AT3G52370,AT5G3997012                11
AT1G70710     96%            8                 21
              44%            10                8
AT1G62790,AT4G25810,AT3G07010,AT2G04780,AT5G48900
              0%             12                4
AT4G11290,AT2G30210,AT3G61990,AT2G48130,AT5G17820
              0%             4                 7
AT1G21880,AT1G32930,AT3G13560,AT2G25060,AT1G66250,AT3G07320,AT5G25090
              91%            8                 69
AT4G26690,AT5G42180,AT2G17720,AT5G13870,AT5G61840,AT3G04010
              97%
AT4G16260,AT2G22470,AT2G370909                 88
              91%            10                90
AT1G76790,AT3G06300,AT5G59290,AT3G03220,AT5G60020,AT2G37130,AT2G28760,AT1G77130
              95%
AT2G32990,AT3G52370,AT5G1549011                57
              88%            9                 45
AT3G11420,AT1G70990,AT3G02350,AT2G39700,AT4G30280,AT5G60490
AT3G27200     91%            12                10
AT4G28085     93%            13                13
              94%
AT2G38080,AT3G44990          11                31
              88%            12                40
AT1G24170,AT3G62110,AT5G28840,AT2G32430,AT2G43080
              85%
AT4G18780,AT2G32610,AT5G0317013                19
              75%
AT5G30500,AT4G31760          13                6
              43%            11
AT3G53260,AT1G51680,AT4G34230,AT1G78570        7
              0%             18                6
AT1G21090,AT3G53190,AT1G77630,AT1G02730,AT1G70710,AT5G40150
              75%            9
AT4G14080,AT3G07320,AT1G33430,AT1G62940        15
AT1G67990     94%            13                15
              53%            9                 40
AT1G14420,AT5G15110,AT3G26110,AT5G47000,AT3G57690,AT3G01270,AT5G40730,AT3G07820,AT4G3
              54%            19                12
AT3G10720,AT2G28950,AT2G14890,AT1G13250,AT1G55260,AT5G55730
              57%
AT1G23480,AT3G18050,AT4G1242012                6
AT5G58480     91%            9                 3
AT5G65730     90%            15                9
              80%
AT3G07010,AT5G63800          10                9
AT1G55260     89%            11                8
AT3G10720     80%            16                4
AT4G30380     93%            13                9
              83%
AT2G23990,AT1G80140          17                11
              55%            15                10
AT1G14720,AT3G19450,AT1G51680,AT5G48930,AT3G53260
              0%             14                5
AT3G21770,AT1G05260,AT5G66390,AT2G44790,AT5G40730,AT3G01190
              52%            10                20
AT2G28760,AT1G72990,AT2G28110,AT4G18780,AT2G29130,AT5G44030,AT1G72230,AT5G42180,AT2G3
              76%            14                4
AT3G29810,AT1G59970,AT2G37130,AT2G22470,AT2G45220,AT3G45970
              55%            15                10
AT1G63180,AT4G17180,AT5G62620,AT3G29090,AT1G72680
              81%
AT5G56870,AT3G19450,AT1G7568013                14
              87%
AT3G45970,AT1G12780          13                14
              71%
AT5G39320,AT3G02210          10                6
              60%
AT3G06770,AT4G02320          14                4
              63%            12                18
AT3G15720,AT5G63180,AT2G27130,AT3G19450,AT5G64080,AT3G25140,AT2G03220
              57%
AT3G52840,AT2G46930,AT5G643108                 6
              29%            8                 7
AT1G21090,AT3G54920,AT5G55730,AT2G28950,AT5G42100
              47%            7                 14
AT1G21090,AT3G54920,AT4G35880,AT5G42100,AT5G55730,AT1G77630,AT2G28950,AT4G03210
              62%            9                 68
AT2G16730,AT3G57690,AT5G15110,AT3G05610,AT5G07430,AT5G14380,AT2G24450,AT1G02790,AT3G0
              60%
AT2G17720,AT3G06300          14                5
              83%            11                121
AT4G28280,AT2G44560,AT5G64790,AT4G07960,AT3G43860,AT5G58050,AT5G58170,AT3G01700,AT2G2
              71%
AT1G05260,AT2G30210          12                6
AT1G08500     93%            14                12
AT3G03220     92%            11                11
              80%            16                44
AT4G33220,AT2G28950,AT4G27520,AT3G10720,AT4G24780,AT5G19250,AT5G65730,AT1G11580,AT3G1
              85%            9                 39
AT1G03870,AT3G13520,AT2G04780,AT2G14890,AT2G06850,AT1G55260
AT3G53260     97%            7                 31
              91%
AT5G40730,AT1G02790          12                21
AT3G57690     96%            15                22
              83%
AT4G26830,AT1G18280          10                10
              29%            13                7
AT5G55730,AT4G03210,AT5G42100,AT2G28950,AT3G54920
              67%
AT4G03210,AT3G61980          14                5
AT2G45220     94%            12                17
              25%            11                7
AT1G51680,AT4G34230,AT2G40890,AT1G15950,AT5G48930,AT3G53260
              20%            9
AT5G51890,AT5G44130,AT5G56870,AT1G03870        4
              63%            10                26
AT5G66390,AT5G17820,AT4G30170,AT5G40730,AT2G30210,AT3G22600,AT5G56540,AT5G53250,AT3G0
              17%            11                5
AT4G35970,AT1G72230,AT5G03260,AT3G20570,AT5G42180
              81%
AT4G24780,AT5G65730,AT5G4890012                15
              80%            10
AT5G19250,AT2G28950,AT1G23480,AT2G36870        19
              69%            15
AT3G18050,AT2G04780,AT1G55260,AT3G53260        12
AT4G34050     89%            11                8
              91%
AT5G42180,AT1G72230,AT5G609506                 31
              90%
AT2G47180,AT3G44990          15                19
              79%            8                 21
AT4G17180,AT1G80820,AT4G25810,AT3G27200,AT5G06730
              86%            9                 42
AT4G20460,AT4G30590,AT5G13870,AT1G32930,AT1G66250,AT1G77130
AT5G28840     95%            17                21
AT3G03220     92%            12                12
              86%            8                 99
AT5G58050,AT5G48140,AT3G05610,AT2G02720,AT5G15110,AT3G26110,AT2G16730,AT1G24520,AT1G1
              80%
AT4G23490,AT3G07830          14                9
AT4G17690     83%            11                5
              93%
AT5G44130,AT2G43080          10                26
AT5G17820     92%            14                12
              93%
AT1G33030,AT3G45970          9                 25
AT5G06720     91%            10                10
              0%             7                 5
AT3G24670,AT2G18980,AT1G17890,AT5G17820,AT2G48130,AT1G30870
AT3G49220     93%            16                13
              85%
AT5G42100,AT1G04680,AT1G653809                 19
AT5G41460     94%            16                17
              80%            15
AT5G01190,AT5G59290,AT2G28760,AT5G15490        19
              77%
AT3G44100,AT2G01850,AT3G2909010                12
              14%            13                6
AT5G56540,AT3G10340,AT2G48140,AT1G56320,AT5G14130,AT1G68850
              39%            9                 17
AT5G65390,AT5G40730,AT5G56540,AT4G30170,AT1G62790,AT3G01190,AT5G17820,AT2G30210,AT5G5
AT3G18050     93%            9                 14
              57%            8                 20
AT5G56540,AT1G05260,AT2G30210,AT4G30170,AT5G66390,AT4G11290,AT2G44790,AT3G21770,AT3G2
              57%
AT5G65390,AT5G40730,AT5G532507                 6
              20%            18
AT4G14130,AT5G03260,AT1G64640,AT4G30290        4
              74%            9                 18
AT4G09030,AT5G58090,AT3G22440,AT1G55850,AT1G77130
              56%            15                15
AT2G39040,AT2G17720,AT2G32300,AT1G72230,AT5G39320,AT5G15490,AT3G06300
              73%
AT5G42180,AT5G25820,AT2G2247014                10
AT3G48580     86%            9                 6
AT1G72680     80%            13                4
              92%
AT1G69530,AT2G06850,AT4G032109                 36
AT4G14130     83%            8                 5
AT2G28950     96%            12                22
AT2G17760     95%            11                18
              75%            13                92
AT5G15110,AT3G05610,AT4G28280,AT4G15980,AT1G55850,AT2G02720,AT5G58050,AT2G16730,AT3G2
              60%            14                24
AT5G17820,AT5G64100,AT3G22600,AT5G66390,AT2G30210,AT5G56540,AT1G30870,AT5G40730,AT1G0
AT5G22430     83%            13                5
              20%            8
AT5G10430,AT2G37130,AT2G32990,AT3G52370        5
              55%            13                10
AT3G49960,AT4G40090,AT1G12560,AT3G10710,AT5G04960
              36%            11                21
AT3G10340,AT2G37090,AT1G19300,AT4G18780,AT5G17420,AT5G44030,AT2G38080,AT5G03760,AT5G0
              83%            9                 29
AT5G60920,AT3G04010,AT4G28085,AT3G29090,AT1G24170
              93%
AT3G56000,AT4G32410,AT3G0322011                43
              91%
AT3G28200,AT3G02350          9                 21
AT2G22470     92%            9                 11
              78%
AT3G59010,AT1G12780          13                8
              0%             17                8
AT1G30870,AT4G11290,AT4G26010,AT4G25820,AT3G54590,AT5G53250,AT1G05260,AT5G17820,AT2G4
AT1G12780     83%            9                 5
              74%            9                 45
AT5G42180,AT4G14130,AT5G15490,AT1G48930,AT5G04960,AT3G10710,AT5G57530,AT2G17720,AT5G4
              63%            15                15
AT1G65610,AT3G43960,AT3G06300,AT2G22470,AT2G20370,AT5G39320
              87%            12
AT3G06300,AT5G42180,AT1G24170,AT2G17720        29
              83%            13                52
AT2G22470,AT3G52370,AT5G39320,AT5G15490,AT1G48930,AT3G03220,AT1G08500,AT3G49960,AT2G3
              88%            9
AT1G65310,AT3G10710,AT4G16260,AT5G49270        33
              71%
AT5G13870,AT1G12560          10                6
              84%
AT1G15950,AT5G04960,AT3G2123010                18
              0%             10                7
AT5G48900,AT4G24780,AT2G06850,AT4G33220,AT1G55260,AT2G14890,AT3G13750
              44%            12                8
AT3G53260,AT1G15950,AT1G51680,AT4G26940,AT4G34230
              51%            12                39
AT3G26110,AT5G07430,AT3G57690,AT1G14420,AT2G20700,AT3G62170,AT5G15110,AT2G16730,AT3G2
              50%            15
AT1G12560,AT5G67400,AT4G40090,AT1G48930        8
              0%             5                 5
AT1G02730,AT1G21090,AT5G40150,AT3G53190,AT1G77630
              46%            10                25
AT1G05260,AT3G47400,AT3G21770,AT5G03260,AT1G14080,AT3G01190,AT5G14150,AT4G30170,AT2G3
              94%            10                83
AT1G72680,AT2G14890,AT1G54860,AT4G03210,AT5G62620,AT1G63180,AT5G57550
AT5G64080     94%            11                16
              86%
AT4G23820,AT5G39320          13                13
              75%
AT2G33590,AT1G24735          12                7
AT4G03210     94%            10                15
AT2G03090     98%            10                39
              95%
AT1G48100,AT4G03210          10                37
AT4G23990     96%            14                23
              94%
AT5G41460,AT5G08210          9                 29
              88%
AT2G22470,AT4G39350,AT4G0232010                25
              90%
AT4G28300,AT5G64120          15                19
              27%            12                11
AT4G16140,AT1G04680,AT1G45130,AT5G55730,AT2G28950,AT4G38660,AT4G03210,AT1G13250
              94%
AT3G20570,AT3G21230,AT1G0979011                47
              94%
AT3G07320,AT3G62720          8                 34
              91%
AT2G28410,AT2G21770          10                22
AT5G64640     86%            12                6
              88%
AT2G17720,AT5G06730,AT5G4218011                23
              91%            10
AT4G25810,AT3G27200,AT1G80820,AT2G37040        45
              95%
AT4G13080,AT4G20460          10                39
AT1G77130     95%            10                19
AT1G71695     93%            14                13
AT2G28760     95%            13                18
AT5G55480     89%            10                9
AT4G13080     80%            15                4
              58%            10                8
AT3G21230,AT2G20370,AT3G50760,AT4G22470,AT3G07390
              5%             12                19
AT3G06260,AT1G29980,AT2G23900,AT3G01700,AT5G58170,AT3G17060,AT4G07960,AT2G24450,AT3G6
              57%            5                 14
AT2G28760,AT2G17720,AT1G76790,AT2G32990,AT5G44030,AT5G59290
              13%            12                7
AT2G14890,AT1G23480,AT4G38660,AT5G55730,AT4G12420,AT2G04780,AT3G10720
              43%            11
AT3G06300,AT1G72230,AT2G17720,AT5G42180        7
              61%            14                22
AT3G22600,AT2G30210,AT1G05260,AT5G66390,AT5G40730,AT4G11290,AT5G56540,AT4G30170,AT2G4
              0%             9                 7
AT2G04780,AT2G14890,AT4G23820,AT5G55480,AT4G29360,AT4G38660,AT4G31840,AT1G75680
              63%
AT5G56590,AT4G38040,AT4G1612011                7
              87%
AT5G30500,AT5G18990,AT4G3237519                16
              88%
AT2G23990,AT1G80140          9                 12
              64%            9                 27
AT5G58480,AT5G25090,AT5G08000,AT3G13560,AT3G23730,AT2G25060,AT1G10640,AT3G07320,AT1G2
              77%
AT1G27120,AT2G25060,AT1G2188011                12
              0%             16                4
AT4G30280,AT4G25810,AT3G16860,AT3G45970,AT3G45960
              0%             10                6
AT1G70710,AT4G23490,AT1G02730,AT1G21090,AT5G40150,AT3G53190,AT2G46930
              23%            5                 13
AT1G19300,AT1G72230,AT2G38080,AT4G18780,AT2G37090,AT5G44030,AT5G60490,AT5G17420,AT5G0
              83%
AT2G37130,AT1G21480          14                11
              61%            13                17
AT3G22600,AT4G11290,AT5G17820,AT5G64100,AT4G08780,AT3G21770,AT2G44790
AT5G42180     80%            10                4
              89%
AT3G50760,AT3G02210          9                 18
              22%            14                8
AT2G14890,AT2G28950,AT1G26570,AT5G55730,AT3G10720,AT2G04780,AT1G23480
              14%            11                6
AT3G20570,AT1G19300,AT5G03260,AT5G44030,AT4G35970,AT2G28760
              83%
AT4G27520,AT2G37640          9                 11
              67%
AT4G16640,AT1G11580          17                5
              92%
AT4G17180,AT5G06730          13                23
              81%            14                25
AT2G17720,AT3G27200,AT5G42180,AT2G47180,AT4G25810
AT2G37040     93%            15                13
              62%            14                21
AT5G04960,AT2G32300,AT5G42180,AT3G49960,AT1G48930,AT1G12560,AT3G10710,AT5G60950
              73%
AT3G06300,AT2G17720,AT2G2247016                11
              0%             10                7
AT5G22740,AT2G39700,AT3G54920,AT5G55730,AT2G28950,AT3G61640,AT4G03210
              0%             12                8
AT5G14150,AT1G62790,AT2G30490,AT4G30170,AT5G66390,AT3G24670,AT1G14080,AT2G30210
              0%             17                5
AT5G66390,AT3G21770,AT4G30170,AT4G11290,AT2G30210,AT2G44790
                                         Best motif ID (conserved
Motif IDs(p-values sorting by szie) between Arabidopsis and
                                         Populus, and covered the
                                         most genes)
                                         cluster_74
cluster_0(p-value:6.39e-57),cluster_1037(p-value:9.59e-17),cluster_1038(p-value:5.63e-05),cluster_1089
                                         cluster_71
cluster_0(p-value:1.12e-64),cluster_1(p-value:8.71e-52),cluster_479(p-value:7.69e-02),cluster_552(p-va
                                         cluster_0
cluster_0(p-value:1.27e-22),cluster_1121(p-value:3.58e-01),cluster_163(p-value:1.90e-32),cluster_219(p
                                         cluster_110
cluster_0(p-value:1.76e-35),cluster_107(p-value:3.06e-04),cluster_110(p-value:6.17e-02),cluster_1(p-va
                                         cluster_190
cluster_1231(p-value:3.49e-02),cluster_170(p-value:4.64e-06),cluster_190(p-value:1.03e-03),cluster_2(p
                                         cluster_803
cluster_104(p-value:2.12e-01),cluster_1132(p-value:1.02e-01),cluster_1146(p-value:1.02e-01),cluster_11
                                         cluster_766
cluster_0(p-value:2.75e-33),cluster_1273(p-value:4.42e-02),cluster_266(p-value:1.43e-01),cluster_3(p-v
                                         cluster_49
cluster_0(p-value:1.12e-23),cluster_1200(p-value:1.24e-01),cluster_129(p-value:4.44e-04),cluster_1(p-v
                                         cluster_6
cluster_0(p-value:5.40e-68),cluster_100(p-value:2.92e-02),cluster_1019(p-value:5.43e-02),cluster_1222(
                                         cluster_1
cluster_0(p-value:1.18e-24),cluster_1062(p-value:4.01e-02),cluster_180(p-value:1.54e-09),cluster_1(p-v
                                         cluster_4
cluster_0(p-value:7.90e-222),cluster_1316(p-value:4.99e-01),cluster_1(p-value:1.28e-164),cluster_231(p
                                         cluster_18
cluster_0(p-value:2.51e-219),cluster_183(p-value:6.61e-11),cluster_18(p-value:5.80e-43),cluster_1(p-va
                                         cluster_869
cluster_0(p-value:2.31e-86),cluster_183(p-value:5.15e-09),cluster_199(p-value:6.33e-58),cluster_1(p-va
                                         cluster_570
cluster_0(p-value:7.37e-115),cluster_1214(p-value:2.65e-13),cluster_147(p-value:1.00e+00),cluster_22(
                                         cluster_141
cluster_0(p-value:1.68e-114),cluster_1094(p-value:2.93e-01),cluster_141(p-value:1.81e-01),cluster_1(p-
                                         cluster_1016
cluster_0(p-value:5.12e-69),cluster_1016(p-value:1.00e+00),cluster_1045(p-value:2.04e-01),cluster_113
                                         cluster_326
cluster_16(p-value:1.66e-22),cluster_1(p-value:6.27e-32),cluster_22(p-value:5.71e-15),cluster_326(p-va
                                         cluster_38
cluster_0(p-value:2.88e-41),cluster_1004(p-value:3.19e-01),cluster_122(p-value:2.02e-07),cluster_1230(
                                         cluster_4
cluster_0(p-value:1.28e-51),cluster_1022(p-value:2.36e-89),cluster_1115(p-value:4.83e-03),cluster_1(p-
                                         cluster_633
cluster_1105(p-value:4.69e-03),cluster_1248(p-value:8.82e-02),cluster_24(p-value:1.41e-14),cluster_295
                                         cluster_311
cluster_1023(p-value:1.00e+00),cluster_1024(p-value:1.00e+00),cluster_1229(p-value:6.24e-02),cluster
                                         cluster_881
cluster_102(p-value:9.31e-03),cluster_1095(p-value:1.68e-01),cluster_139(p-value:1.48e-01),cluster_187
                                         cluster_208
cluster_0(p-value:6.12e-26),cluster_1116(p-value:3.88e-01),cluster_1224(p-value:3.88e-01),cluster_1318
                                         cluster_383
cluster_0(p-value:5.91e-19),cluster_1136(p-value:2.66e-01),cluster_1137(p-value:2.66e-01),cluster_145(
                                         cluster_9
cluster_1025(p-value:1.08e-01),cluster_1066(p-value:1.08e-01),cluster_118(p-value:5.31e-07),cluster_13
                                         cluster_8
cluster_146(p-value:4.24e-01),cluster_25(p-value:3.21e-01),cluster_32(p-value:9.25e-03),cluster_449(p-
                                         cluster_981
cluster_0(p-value:2.12e-44),cluster_1097(p-value:6.27e-04),cluster_1100(p-value:6.27e-04),cluster_165(
                                         cluster_58
cluster_1302(p-value:4.54e-05),cluster_1328(p-value:4.54e-05),cluster_18(p-value:8.23e-08),cluster_1(p
                                         cluster_9
cluster_1014(p-value:8.57e-21),cluster_101(p-value:3.94e-01),cluster_15(p-value:1.03e-01),cluster_2(p-
                                         cluster_153
cluster_0(p-value:1.27e-33),cluster_1056(p-value:1.79e-01),cluster_12(p-value:1.96e-04),cluster_153(p-
                                         cluster_573
cluster_145(p-value:3.41e-03),cluster_191(p-value:1.07e-13),cluster_372(p-value:1.63e-04),cluster_4(p-
                                         cluster_22
cluster_1005(p-value:1.30e-03),cluster_10(p-value:1.67e-09),cluster_1158(p-value:9.16e-02),cluster_11(
                                         cluster_3
cluster_1185(p-value:3.05e-01),cluster_126(p-value:4.54e-16),cluster_168(p-value:8.51e-02),cluster_238
                                         cluster_65
cluster_0(p-value:1.85e-30),cluster_1047(p-value:4.30e-02),cluster_1048(p-value:4.30e-02),cluster_1138
                                         cluster_38
cluster_1026(p-value:5.25e-10),cluster_1027(p-value:5.25e-10),cluster_10(p-value:3.39e-02),cluster_132
                                         cluster_781
cluster_0(p-value:3.92e-39),cluster_184(p-value:6.96e-17),cluster_1(p-value:1.03e-29),cluster_363(p-va
                                         cluster_34
cluster_0(p-value:3.00e-41),cluster_115(p-value:8.70e-04),cluster_1166(p-value:5.37e-03),cluster_1292(
                                         cluster_857
cluster_0(p-value:2.11e-56),cluster_1075(p-value:2.01e-04),cluster_10(p-value:5.41e-02),cluster_1186(p
                                         cluster_268
cluster_105(p-value:4.69e-02),cluster_1(p-value:5.06e-24),cluster_268(p-value:6.49e-01),cluster_415(p-
                                         cluster_858
cluster_1171(p-value:9.82e-07),cluster_1327(p-value:9.82e-07),cluster_141(p-value:6.45e-03),cluster_17
                                         cluster_0
cluster_0(p-value:3.94e-42),cluster_17(p-value:1.21e-01),cluster_21(p-value:1.91e-04),cluster_62(p-valu
                                         cluster_966
cluster_0(p-value:2.48e-129),cluster_1106(p-value:3.47e-14),cluster_1107(p-value:2.46e-03),cluster_125
                                         cluster_749
cluster_0(p-value:3.97e-186),cluster_1267(p-value:1.47e-02),cluster_1274(p-value:3.51e-99),cluster_1(p
                                         cluster_864
cluster_0(p-value:2.26e-110),cluster_12(p-value:1.83e-17),cluster_15(p-value:3.10e-19),cluster_18(p-va
                                         cluster_134
cluster_0(p-value:3.23e-101),cluster_1235(p-value:1.44e-04),cluster_134(p-value:5.31e-03),cluster_164(
                                         cluster_3
cluster_0(p-value:2.02e-64),cluster_1(p-value:6.63e-56),cluster_237(p-value:2.01e-03),cluster_2(p-value
                                         cluster_110
cluster_110(p-value:1.26e-04),cluster_1122(p-value:2.94e-01),cluster_1189(p-value:2.94e-01),cluster_15
                                         cluster_750
cluster_0(p-value:1.14e-38),cluster_1216(p-value:1.03e-01),cluster_21(p-value:9.86e-12),cluster_22(p-v
                                         cluster_375
cluster_0(p-value:1.96e-76),cluster_1067(p-value:3.65e-02),cluster_1176(p-value:1.04e-29),cluster_1187
                                         cluster_513
cluster_0(p-value:1.24e-58),cluster_1139(p-value:3.84e-02),cluster_122(p-value:1.31e-03),cluster_123(p
                                         cluster_43
cluster_149(p-value:2.52e-02),cluster_15(p-value:2.12e-09),cluster_197(p-value:5.36e-19),cluster_1(p-v
                                         cluster_3
cluster_1028(p-value:5.12e-03),cluster_1270(p-value:5.12e-03),cluster_139(p-value:2.16e-02),cluster_1(
                                         cluster_56
cluster_11(p-value:4.73e-11),cluster_1276(p-value:5.91e-01),cluster_1308(p-value:5.91e-01),cluster_140
                                         cluster_212
cluster_1057(p-value:6.39e-02),cluster_1070(p-value:6.39e-02),cluster_1289(p-value:6.39e-02),cluster_1
                                         cluster_661
cluster_0(p-value:4.80e-18),cluster_120(p-value:3.46e-01),cluster_121(p-value:6.71e-16),cluster_32(p-v
                                         cluster_51
cluster_0(p-value:7.09e-29),cluster_1008(p-value:1.09e-15),cluster_1144(p-value:6.95e-02),cluster_1294
                                         cluster_80
cluster_0(p-value:2.02e-55),cluster_1(p-value:1.58e-63),cluster_275(p-value:1.23e-01),cluster_303(p-va
                                         cluster_99
cluster_0(p-value:3.56e-39),cluster_1096(p-value:1.21e-01),cluster_1113(p-value:1.21e-01),cluster_1225
                                         cluster_175
cluster_1140(p-value:1.25e-03),cluster_13(p-value:8.30e-10),cluster_175(p-value:6.00e-05),cluster_19(p
                                         cluster_1
cluster_176(p-value:2.35e-03),cluster_1(p-value:5.63e-18),cluster_3(p-value:4.00e-21),cluster_499(p-va
                                         cluster_605
cluster_0(p-value:7.57e-19),cluster_14(p-value:6.65e-18),cluster_188(p-value:1.92e-10),cluster_1(p-valu
                                         cluster_4
cluster_0(p-value:2.30e-31),cluster_105(p-value:9.83e-03),cluster_1(p-value:4.38e-11),cluster_369(p-va
                                         cluster_0
cluster_0(p-value:4.99e-14),cluster_148(p-value:2.22e-03),cluster_298(p-value:5.81e-02),cluster_382(p-
                                         cluster_104
cluster_104(p-value:1.87e-01),cluster_10(p-value:2.12e-11),cluster_1300(p-value:4.83e-01),cluster_151(
                                         cluster_501
cluster_137(p-value:2.70e-02),cluster_142(p-value:2.16e-02),cluster_365(p-value:1.67e-01),cluster_3(p-
                                         cluster_551
cluster_109(p-value:2.74e-02),cluster_1172(p-value:5.82e-02),cluster_125(p-value:9.65e-06),cluster_1(p
                                         cluster_93
cluster_0(p-value:3.37e-36),cluster_1030(p-value:1.60e-01),cluster_1032(p-value:1.60e-01),cluster_1033
                                         cluster_399
cluster_1072(p-value:1.30e-02),cluster_1079(p-value:1.30e-02),cluster_2(p-value:6.43e-10),cluster_307(
                                         cluster_149
cluster_145(p-value:3.83e-03),cluster_149(p-value:7.56e-03),cluster_1(p-value:5.24e-25),cluster_215(p-
                                         cluster_562
cluster_1145(p-value:1.74e-04),cluster_128(p-value:5.28e-06),cluster_271(p-value:5.92e-01),cluster_304
                                         cluster_582
cluster_1035(p-value:1.73e-02),cluster_16(p-value:2.67e-10),cluster_196(p-value:4.54e-02),cluster_24(p
                                         cluster_1
cluster_0(p-value:3.63e-20),cluster_1190(p-value:2.40e-01),cluster_1192(p-value:2.40e-01),cluster_1226
                                         cluster_141
cluster_0(p-value:3.82e-50),cluster_100(p-value:4.91e-02),cluster_1201(p-value:2.52e-02),cluster_141(p
                                         cluster_4
cluster_1074(p-value:3.98e-02),cluster_131(p-value:1.29e-03),cluster_13(p-value:1.38e-12),cluster_164(
                                         cluster_998
cluster_1324(p-value:2.61e-02),cluster_148(p-value:1.12e-09),cluster_199(p-value:2.00e-01),cluster_224
                                         cluster_807
cluster_1131(p-value:1.35e-02),cluster_1242(p-value:1.96e-02),cluster_223(p-value:1.49e-01),cluster_23
                                         cluster_35
cluster_0(p-value:3.41e-27),cluster_205(p-value:4.20e-02),cluster_35(p-value:3.59e-10),cluster_3(p-valu
                                         cluster_1
cluster_0(p-value:2.02e-54),cluster_1(p-value:2.88e-36),cluster_405(p-value:1.38e-11),cluster_718(p-va
                                         cluster_55
cluster_0(p-value:7.77e-69),cluster_1227(p-value:4.97e-02),cluster_1(p-value:1.41e-46),cluster_260(p-v
                                         cluster_533
cluster_0(p-value:1.66e-71),cluster_1275(p-value:4.24e-01),cluster_198(p-value:2.07e-09),cluster_1(p-v
                                         cluster_0
cluster_0(p-value:2.55e-16),cluster_1123(p-value:1.61e-01),cluster_1278(p-value:1.61e-01),cluster_206(
                                         cluster_64
cluster_0(p-value:1.65e-126),cluster_2(p-value:6.91e-110),cluster_3(p-value:1.91e-135),cluster_4(p-valu
                                         cluster_990
cluster_1049(p-value:2.96e-04),cluster_1127(p-value:2.96e-04),cluster_203(p-value:2.16e-01),cluster_26
                                         cluster_264
cluster_0(p-value:1.24e-35),cluster_108(p-value:6.19e-36),cluster_1117(p-value:8.59e-03),cluster_1118(
                                         cluster_211
cluster_1243(p-value:5.31e-03),cluster_1262(p-value:5.31e-03),cluster_147(p-value:1.05e-01),cluster_21
                                         cluster_940
cluster_0(p-value:3.95e-59),cluster_1018(p-value:1.79e-07),cluster_1083(p-value:4.59e-11),cluster_1098
                                         cluster_121
cluster_0(p-value:2.40e-30),cluster_116(p-value:3.96e-13),cluster_121(p-value:1.92e-01),cluster_1293(p
                                         cluster_0
cluster_0(p-value:9.24e-60),cluster_192(p-value:1.62e-02),cluster_296(p-value:9.87e-44),cluster_3(p-va
                                         cluster_92
cluster_0(p-value:5.41e-36),cluster_1059(p-value:7.60e-02),cluster_1060(p-value:3.63e-01),cluster_10(p
                                         cluster_773
cluster_10(p-value:1.10e-01),cluster_1101(p-value:2.60e-09),cluster_1296(p-value:1.18e-01),cluster_12(
                                         cluster_1211
cluster_0(p-value:1.95e-20),cluster_1009(p-value:1.60e-07),cluster_1211(p-value:8.50e-04),cluster_1(p-
                                         cluster_79
cluster_0(p-value:2.89e-60),cluster_108(p-value:1.15e-02),cluster_125(p-value:2.94e-01),cluster_173(p-
                                         cluster_93
cluster_0(p-value:1.19e-12),cluster_10(p-value:6.41e-02),cluster_1129(p-value:6.42e-02),cluster_112(p-
                                         cluster_737
cluster_1209(p-value:1.55e-01),cluster_1232(p-value:1.55e-01),cluster_134(p-value:1.14e-38),cluster_1(
                                         cluster_9
cluster_1010(p-value:4.34e-02),cluster_11(p-value:2.75e-18),cluster_12(p-value:2.20e-07),cluster_14(p-
                                         cluster_738
cluster_0(p-value:6.15e-20),cluster_1119(p-value:7.09e-01),cluster_1124(p-value:7.09e-01),cluster_1147
                                         cluster_113
cluster_113(p-value:1.51e-04),cluster_1(p-value:2.13e-27),cluster_232(p-value:1.30e-02),cluster_33(p-v
                                         cluster_43
cluster_0(p-value:1.56e-14),cluster_1071(p-value:1.53e-03),cluster_10(p-value:1.94e-02),cluster_1125(p
                                         cluster_845
cluster_10(p-value:1.01e-04),cluster_113(p-value:7.50e-06),cluster_116(p-value:7.49e-02),cluster_134(p
                                         cluster_185
cluster_0(p-value:3.91e-27),cluster_1036(p-value:2.14e-01),cluster_185(p-value:1.02e-05),cluster_1(p-v
                                         cluster_9
cluster_0(p-value:1.09e-30),cluster_1051(p-value:5.14e-01),cluster_1220(p-value:3.47e-01),cluster_122(
                                         cluster_9
cluster_162(p-value:9.25e-07),cluster_273(p-value:2.16e-02),cluster_2(p-value:2.95e-20),cluster_337(p-
                                         cluster_93
cluster_0(p-value:1.02e-73),cluster_100(p-value:5.38e-01),cluster_111(p-value:6.45e-52),cluster_2(p-va
                                         cluster_815
cluster_0(p-value:8.22e-19),cluster_12(p-value:2.73e-08),cluster_153(p-value:5.13e-02),cluster_15(p-va
                                         cluster_0
cluster_0(p-value:3.18e-37),cluster_1011(p-value:1.56e-05),cluster_1218(p-value:2.08e-01),cluster_1(p-
                                         cluster_1006
cluster_1006(p-value:3.67e-36),cluster_1061(p-value:6.69e-11),cluster_1178(p-value:1.55e-03),cluster_1
                                         cluster_586
cluster_1126(p-value:4.98e-01),cluster_1254(p-value:1.44e-01),cluster_135(p-value:1.94e-05),cluster_13
                                         cluster_77
cluster_0(p-value:5.11e-25),cluster_1(p-value:2.66e-17),cluster_239(p-value:8.93e-08),cluster_2(p-value
                                         cluster_18
cluster_0(p-value:5.30e-213),cluster_131(p-value:1.92e-17),cluster_18(p-value:5.27e-62),cluster_1(p-va
                                         cluster_896
cluster_0(p-value:8.29e-26),cluster_112(p-value:4.00e-03),cluster_1179(p-value:2.61e-01),cluster_13(p-
                                         cluster_8
cluster_1058(p-value:1.15e-01),cluster_1180(p-value:1.15e-01),cluster_1221(p-value:1.15e-01),cluster_1
                                         cluster_797
cluster_1155(p-value:5.54e-01),cluster_139(p-value:1.02e-01),cluster_251(p-value:1.13e-25),cluster_3(p
                                         cluster_285
cluster_0(p-value:3.47e-15),cluster_1054(p-value:3.03e-01),cluster_1068(p-value:8.98e-02),cluster_1084
                                         cluster_3
cluster_1173(p-value:2.75e-01),cluster_147(p-value:6.81e-02),cluster_1(p-value:1.17e-113),cluster_338(
                                         cluster_55
cluster_0(p-value:7.46e-26),cluster_1076(p-value:5.14e-02),cluster_114(p-value:3.76e-03),cluster_1151(
                                         cluster_132
cluster_10(p-value:1.94e-06),cluster_12(p-value:1.85e-17),cluster_132(p-value:5.38e-05),cluster_257(p-
                                         cluster_669
cluster_0(p-value:1.88e-28),cluster_1(p-value:1.07e-22),cluster_233(p-value:3.23e-01),cluster_26(p-valu
                                         cluster_43
cluster_0(p-value:1.37e-62),cluster_1087(p-value:9.28e-04),cluster_1088(p-value:5.90e-03),cluster_1212
                                         cluster_816
cluster_0(p-value:2.17e-19),cluster_1120(p-value:9.54e-37),cluster_13(p-value:9.66e-14),cluster_155(p-
                                         cluster_739
cluster_0(p-value:2.12e-15),cluster_1168(p-value:5.66e-02),cluster_1194(p-value:5.66e-02),cluster_12(p
                                         cluster_4
cluster_1052(p-value:8.98e-10),cluster_1128(p-value:3.17e-01),cluster_1193(p-value:3.17e-01),cluster_1
                                         cluster_827
cluster_1181(p-value:3.74e-03),cluster_1322(p-value:3.74e-03),cluster_157(p-value:2.59e-02),cluster_16
                                         cluster_649
cluster_0(p-value:2.85e-24),cluster_1319(p-value:7.06e-05),cluster_1(p-value:2.41e-95),cluster_202(p-v
                                         cluster_27
cluster_0(p-value:4.47e-14),cluster_1279(p-value:4.63e-01),cluster_12(p-value:5.64e-17),cluster_211(p-
                                         cluster_98
cluster_261(p-value:2.52e-04),cluster_2(p-value:7.19e-06),cluster_393(p-value:4.59e-21),cluster_44(p-v
                                         cluster_6
cluster_1040(p-value:8.54e-02),cluster_418(p-value:2.74e-09),cluster_4(p-value:3.77e-09),cluster_553(p
                                         cluster_6
cluster_1041(p-value:1.27e-01),cluster_1108(p-value:1.27e-01),cluster_1114(p-value:1.27e-01),cluster_1
                                         cluster_4
cluster_1295(p-value:4.16e-01),cluster_18(p-value:1.46e-34),cluster_1(p-value:5.70e-39),cluster_3(p-va
                                         cluster_601
cluster_1000(p-value:2.68e-01),cluster_1085(p-value:3.11e-01),cluster_1159(p-value:2.58e-03),cluster_1
                                         cluster_503
cluster_1069(p-value:8.83e-02),cluster_1169(p-value:8.83e-02),cluster_1269(p-value:8.83e-02),cluster_1
                                         cluster_59
cluster_0(p-value:2.96e-26),cluster_1(p-value:2.78e-25),cluster_20(p-value:4.46e-01),cluster_235(p-valu
                                         cluster_4
cluster_1077(p-value:7.18e-01),cluster_126(p-value:2.30e-02),cluster_190(p-value:3.45e-01),cluster_1(p
                                         cluster_707
cluster_0(p-value:4.55e-74),cluster_116(p-value:3.77e-13),cluster_1(p-value:1.72e-41),cluster_280(p-va
                                         cluster_74
cluster_0(p-value:5.88e-59),cluster_109(p-value:1.21e-04),cluster_1249(p-value:2.83e-03),cluster_2(p-v
                                         cluster_9
cluster_0(p-value:1.33e-55),cluster_1152(p-value:1.22e-01),cluster_1(p-value:2.46e-35),cluster_24(p-va
                                         cluster_53
cluster_1202(p-value:6.25e-02),cluster_1(p-value:4.91e-71),cluster_220(p-value:3.17e-06),cluster_246(p
                                         cluster_64
cluster_0(p-value:1.48e-96),cluster_1109(p-value:6.27e-02),cluster_1195(p-value:9.03e-05),cluster_1(p-
                                         cluster_1001
cluster_1001(p-value:6.85e-07),cluster_1207(p-value:4.26e-08),cluster_1304(p-value:9.77e-04),cluster_1
                                         cluster_80
cluster_1078(p-value:1.46e-01),cluster_1153(p-value:1.46e-01),cluster_1205(p-value:1.46e-01),cluster_1
                                         cluster_2
cluster_0(p-value:1.23e-19),cluster_10(p-value:2.94e-02),cluster_164(p-value:4.20e-09),cluster_250(p-v
                                         cluster_56
cluster_1080(p-value:1.32e-01),cluster_1233(p-value:1.32e-01),cluster_135(p-value:6.15e-12),cluster_15
                                         cluster_537
cluster_0(p-value:3.48e-18),cluster_1149(p-value:2.27e-01),cluster_1313(p-value:2.27e-01),cluster_149(
                                         cluster_0
cluster_0(p-value:1.65e-79),cluster_1020(p-value:5.10e-13),cluster_125(p-value:6.67e-29),cluster_185(p
                                         cluster_522
cluster_0(p-value:2.75e-47),cluster_1208(p-value:2.89e-01),cluster_1210(p-value:9.31e-02),cluster_1280
                                         cluster_58
cluster_12(p-value:2.16e-10),cluster_1(p-value:4.35e-26),cluster_202(p-value:2.18e-13),cluster_24(p-va
                                         cluster_567
cluster_0(p-value:5.37e-56),cluster_1042(p-value:4.06e-19),cluster_1102(p-value:6.83e-02),cluster_2(p-
                                         cluster_179
cluster_0(p-value:5.17e-16),cluster_10(p-value:2.86e-03),cluster_112(p-value:5.09e-02),cluster_1134(p-
                                         cluster_26
cluster_0(p-value:1.35e-13),cluster_10(p-value:5.47e-05),cluster_178(p-value:2.79e-03),cluster_186(p-v
                                         cluster_3
cluster_129(p-value:1.22e-01),cluster_217(p-value:2.76e-03),cluster_227(p-value:1.41e-05),cluster_27(p
                                         cluster_99
cluster_0(p-value:1.47e-73),cluster_124(p-value:3.51e-02),cluster_1301(p-value:8.73e-05),cluster_37(p-
                                         cluster_73
cluster_0(p-value:1.49e-44),cluster_163(p-value:2.42e-01),cluster_167(p-value:9.63e-21),cluster_1(p-va
                                         cluster_373
cluster_0(p-value:6.72e-22),cluster_1081(p-value:1.28e-16),cluster_13(p-value:1.79e-13),cluster_199(p-
                                         cluster_761
cluster_0(p-value:1.41e-72),cluster_10(p-value:2.18e-12),cluster_1282(p-value:4.05e-01),cluster_12(p-v
                                         cluster_172
cluster_0(p-value:1.03e-51),cluster_1170(p-value:7.57e-02),cluster_1240(p-value:2.93e-01),cluster_15(p
                                         cluster_8
cluster_0(p-value:1.81e-25),cluster_1177(p-value:1.30e-02),cluster_2(p-value:8.11e-19),cluster_492(p-v
                                         cluster_828
cluster_0(p-value:1.13e-21),cluster_1021(p-value:8.84e-02),cluster_1082(p-value:3.99e-01),cluster_1(p-
                                         cluster_246
cluster_1110(p-value:3.70e-02),cluster_121(p-value:3.30e-03),cluster_142(p-value:5.46e-06),cluster_148
                                         cluster_713
cluster_11(p-value:6.64e-06),cluster_14(p-value:3.18e-06),cluster_15(p-value:1.14e-01),cluster_176(p-v
                                         cluster_80
cluster_0(p-value:3.23e-54),cluster_1039(p-value:6.64e-10),cluster_1175(p-value:8.96e-05),cluster_1(p-
                                         cluster_6
cluster_103(p-value:2.51e-26),cluster_1111(p-value:8.79e-02),cluster_1112(p-value:8.79e-02),cluster_11
                                         cluster_212
cluster_0(p-value:4.76e-26),cluster_212(p-value:2.79e-02),cluster_23(p-value:9.69e-11),cluster_40(p-va
                                         cluster_113
cluster_0(p-value:2.19e-32),cluster_113(p-value:5.44e-01),cluster_12(p-value:2.48e-13),cluster_1303(p-
                                         cluster_868
cluster_0(p-value:1.54e-216),cluster_1073(p-value:1.00e+00),cluster_1(p-value:1.19e-199),cluster_20(p
                                         cluster_762
cluster_1055(p-value:2.72e-02),cluster_1283(p-value:1.14e-01),cluster_173(p-value:3.40e-01),cluster_20
                                         cluster_723
cluster_1002(p-value:1.63e-01),cluster_1182(p-value:2.95e-01),cluster_12(p-value:1.05e-07),cluster_15(
                                         cluster_805
cluster_101(p-value:7.39e-02),cluster_1264(p-value:1.40e-01),cluster_133(p-value:3.72e-03),cluster_158
                                         cluster_314
cluster_0(p-value:1.71e-67),cluster_1183(p-value:3.94e-02),cluster_1(p-value:2.22e-56),cluster_20(p-va
                                         cluster_3
cluster_12(p-value:9.90e-18),cluster_13(p-value:5.75e-26),cluster_1(p-value:4.49e-48),cluster_2(p-value
                                         cluster_1043
cluster_0(p-value:4.95e-72),cluster_1043(p-value:7.87e-02),cluster_1103(p-value:8.49e-02),cluster_1162
                                         cluster_53
cluster_1154(p-value:2.38e-02),cluster_1(p-value:1.88e-35),cluster_205(p-value:3.37e-10),cluster_219(p
                                         cluster_1090
cluster_1090(p-value:1.45e-03),cluster_1290(p-value:3.83e-01),cluster_1(p-value:1.88e-28),cluster_243(
                                         cluster_462
cluster_140(p-value:7.79e-22),cluster_1(p-value:4.69e-29),cluster_2(p-value:3.63e-44),cluster_358(p-va
                                         cluster_556
cluster_0(p-value:6.29e-90),cluster_1142(p-value:4.36e-01),cluster_1260(p-value:4.36e-01),cluster_1(p-
                                         cluster_1
cluster_0(p-value:4.52e-45),cluster_1086(p-value:3.61e-02),cluster_1256(p-value:3.61e-02),cluster_156(
                                         cluster_488
cluster_0(p-value:1.11e-81),cluster_1284(p-value:2.36e-04),cluster_21(p-value:4.74e-54),cluster_2(p-va
                                         cluster_654
cluster_0(p-value:1.55e-47),cluster_1287(p-value:9.59e-06),cluster_1(p-value:7.99e-28),cluster_218(p-v
                                         cluster_378
cluster_0(p-value:1.46e-49),cluster_1234(p-value:2.65e-02),cluster_123(p-value:1.56e-04),cluster_1(p-v
                                         cluster_65
cluster_0(p-value:2.08e-27),cluster_1031(p-value:1.29e-01),cluster_104(p-value:9.73e-05),cluster_1196(
                                         cluster_49
cluster_1012(p-value:3.73e-07),cluster_1099(p-value:2.31e-02),cluster_124(p-value:5.41e-28),cluster_12
                                         cluster_59
cluster_0(p-value:2.34e-54),cluster_1(p-value:2.92e-42),cluster_239(p-value:2.31e-01),cluster_292(p-va
                                         cluster_397
cluster_150(p-value:1.52e-01),cluster_179(p-value:8.95e-05),cluster_1(p-value:6.09e-46),cluster_2(p-va
                                         cluster_3
cluster_0(p-value:9.80e-45),cluster_1091(p-value:4.35e-01),cluster_197(p-value:8.15e-03),cluster_20(p-
                                         cluster_206
cluster_0(p-value:4.98e-12),cluster_1044(p-value:7.97e-02),cluster_10(p-value:5.55e-06),cluster_13(p-v
                                         cluster_656
cluster_0(p-value:2.57e-47),cluster_1252(p-value:2.72e-02),cluster_19(p-value:9.52e-03),cluster_1(p-va
                                         cluster_1
cluster_1092(p-value:5.24e-02),cluster_1219(p-value:5.24e-02),cluster_1320(p-value:5.24e-02),cluster_1
                                         cluster_37
cluster_1163(p-value:6.63e-02),cluster_1188(p-value:6.63e-02),cluster_172(p-value:1.46e-01),cluster_18
                                         cluster_99
cluster_1017(p-value:5.71e-03),cluster_1029(p-value:5.71e-03),cluster_20(p-value:1.18e-02),cluster_413
                                         cluster_64
cluster_1148(p-value:4.44e-01),cluster_123(p-value:5.22e-03),cluster_1(p-value:1.12e-19),cluster_240(p
                                         cluster_0
cluster_0(p-value:1.95e-60),cluster_115(p-value:1.18e-05),cluster_1(p-value:1.08e-61),cluster_226(p-va
                                         cluster_856
cluster_0(p-value:1.43e-18),cluster_1265(p-value:8.63e-02),cluster_1291(p-value:8.63e-02),cluster_142(
                                         cluster_728
cluster_119(p-value:2.85e-13),cluster_1271(p-value:3.17e-01),cluster_1272(p-value:3.17e-01),cluster_15
                                         cluster_113
cluster_1007(p-value:8.49e-30),cluster_113(p-value:4.18e-14),cluster_1156(p-value:1.66e-01),cluster_11
                                         cluster_108
cluster_0(p-value:3.17e-43),cluster_108(p-value:2.65e-03),cluster_2(p-value:2.53e-13),cluster_340(p-va
                                         cluster_1013
cluster_0(p-value:5.46e-17),cluster_1013(p-value:5.75e-02),cluster_1015(p-value:5.75e-02),cluster_1053
                                         cluster_0
cluster_0(p-value:8.94e-47),cluster_1003(p-value:1.20e-03),cluster_1050(p-value:4.83e-01),cluster_1063
                                         cluster_784
cluster_0(p-value:5.45e-64),cluster_100(p-value:1.12e-01),cluster_1191(p-value:4.71e-02),cluster_1(p-v
                                         cluster_67
cluster_0(p-value:2.61e-59),cluster_108(p-value:1.28e-63),cluster_117(p-value:2.92e-02),cluster_1(p-va
                                         cluster_42
cluster_0(p-value:3.26e-31),cluster_1246(p-value:2.23e-01),cluster_13(p-value:8.29e-18),cluster_181(p-
                                         cluster_187
cluster_0(p-value:4.65e-18),cluster_106(p-value:1.66e-05),cluster_1184(p-value:5.70e-04),cluster_148(p
                                         cluster_48
cluster_0(p-value:5.01e-29),cluster_1165(p-value:2.46e-02),cluster_136(p-value:1.98e-04),cluster_14(p-
                                         cluster_74
cluster_0(p-value:8.57e-16),cluster_161(p-value:2.78e-02),cluster_1(p-value:4.26e-36),cluster_322(p-va
                                         cluster_539
cluster_1104(p-value:2.75e-01),cluster_1203(p-value:2.75e-01),cluster_1206(p-value:2.75e-01),cluster_1
                                         cluster_98
cluster_0(p-value:2.38e-28),cluster_1236(p-value:6.93e-04),cluster_12(p-value:2.56e-16),cluster_1306(p
                                         cluster_53
cluster_111(p-value:6.41e-02),cluster_1323(p-value:1.79e-01),cluster_33(p-value:1.83e-02),cluster_359(
                                         cluster_778
cluster_1238(p-value:1.17e-02),cluster_149(p-value:2.20e-02),cluster_173(p-value:1.40e-12),cluster_182
                                         cluster_744
cluster_1247(p-value:1.67e-01),cluster_1266(p-value:1.67e-01),cluster_189(p-value:4.69e-11),cluster_20
                                         cluster_547
cluster_110(p-value:1.60e-07),cluster_1281(p-value:5.93e-01),cluster_25(p-value:5.30e-02),cluster_315(
                                         cluster_93
cluster_0(p-value:1.14e-30),cluster_1257(p-value:5.31e-02),cluster_1(p-value:2.24e-19),cluster_298(p-v
                                         cluster_79
cluster_0(p-value:5.77e-19),cluster_1064(p-value:1.87e-01),cluster_1065(p-value:1.87e-01),cluster_1093
                                         cluster_829
cluster_0(p-value:1.50e-69),cluster_10(p-value:2.20e-07),cluster_124(p-value:4.45e-26),cluster_125(p-v
                                         cluster_878
cluster_1157(p-value:1.14e-01),cluster_1199(p-value:2.15e-02),cluster_1237(p-value:5.46e-03),cluster_1
                                         cluster_30
cluster_1213(p-value:7.91e-03),cluster_1239(p-value:7.91e-03),cluster_1288(p-value:7.91e-03),cluster_1
                                         cluster_37
cluster_1130(p-value:2.59e-03),cluster_195(p-value:2.08e-05),cluster_1(p-value:5.83e-17),cluster_2(p-v
                                         cluster_99
cluster_0(p-value:7.77e-29),cluster_122(p-value:8.71e-03),cluster_1298(p-value:1.43e-01),cluster_1312(
                                         cluster_79
cluster_1(p-value:2.48e-27),cluster_286(p-value:1.93e-01),cluster_30(p-value:1.69e-01),cluster_387(p-v
                                         cluster_113
cluster_113(p-value:3.65e-09),cluster_1315(p-value:4.94e-04),cluster_167(p-value:1.15e-08),cluster_255
                                         cluster_59
cluster_0(p-value:1.77e-11),cluster_1046(p-value:9.61e-06),cluster_1160(p-value:9.61e-06),cluster_123(
                                                MYB or lignin-
Top three motif IDs (followed by covered gene
                                                synthesis related
number)
                                                motifs
cluster_292,cluster_136,cluster_74
cluster_552,cluster_71,cluster_83
cluster_555,cluster_589,cluster_627             cluster_627
cluster_893,cluster_0,cluster_110
cluster_645,cluster_734,cluster_957
cluster_466,cluster_678,cluster_803             cluster_678
cluster_540,cluster_541,cluster_766
cluster_543,cluster_648,cluster_97
cluster_1222,cluster_6,cluster_390
cluster_906,cluster_90,cluster_907
cluster_1,cluster_3,cluster_4
cluster_183,cluster_18,cluster_391
cluster_353,cluster_199,cluster_869
cluster_147,cluster_22,cluster_570              cluster_570
cluster_1,cluster_59,cluster_141
cluster_2,cluster_880,cluster_1016
cluster_1,cluster_16,cluster_326                cluster_326
cluster_25,cluster_122,cluster_38
cluster_1115,cluster_1022,cluster_690           cluster_1115
cluster_295,cluster_571,cluster_633
cluster_277,cluster_311,cluster_72
cluster_745,cluster_763,cluster_881
cluster_208,cluster_46,cluster_994
cluster_82,cluster_1,cluster_383                cluster_383
cluster_785,cluster_9,cluster_995               cluster_9
cluster_711,cluster_836,cluster_8
cluster_636,cluster_8,cluster_981               cluster_981
cluster_18,cluster_58,cluster_800
cluster_101,cluster_730,cluster_870             cluster_9
cluster_153,cluster_178,cluster_473             cluster_153
cluster_55,cluster_573,cluster_89               cluster_89
cluster_2,cluster_1005,cluster_22
cluster_659,cluster_756,cluster_757
cluster_574,cluster_65,cluster_937
cluster_278,cluster_35,cluster_38
cluster_184,cluster_363,cluster_781
cluster_220,cluster_34,cluster_96
cluster_1075,cluster_471,cluster_857   cluster_857
cluster_60,cluster_638,cluster_748
cluster_361,cluster_822,cluster_858
cluster_21,cluster_62,cluster_0
cluster_364,cluster_1107,cluster_966
cluster_3,cluster_0,cluster_749
cluster_73,cluster_77,cluster_864
cluster_164,cluster_39,cluster_361
cluster_3,cluster_435,cluster_823
cluster_155,cluster_921,cluster_110
cluster_380,cluster_603,cluster_750
cluster_1187,cluster_169,cluster_375
cluster_18,cluster_229,cluster_513
cluster_226,cluster_256,cluster_43
cluster_575,cluster_660,cluster_758
cluster_527,cluster_11,cluster_284     cluster_56
cluster_1,cluster_212,cluster_70       cluster_212
cluster_121,cluster_49,cluster_661     cluster_661
cluster_1294,cluster_365,cluster_51
cluster_64,cluster_303,cluster_80      cluster_64
cluster_549,cluster_949,cluster_99     cluster_99
cluster_19,cluster_61,cluster_751
cluster_8,cluster_5,cluster_1          cluster_8
cluster_605,cluster_606,cluster_644
cluster_369,cluster_4,cluster_802
cluster_382,cluster_843,cluster_847
cluster_607,cluster_754,cluster_873
cluster_365,cluster_501,cluster_581
cluster_561,cluster_771,cluster_772    cluster_551
cluster_716,cluster_764,cluster_93
cluster_517,cluster_897,cluster_978
cluster_215,cluster_216,cluster_47     cluster_149
cluster_609,cluster_610,cluster_675
cluster_377,cluster_582,cluster_886
cluster_296,cluster_299,cluster_979
cluster_1201,cluster_141,cluster_518
cluster_189,cluster_4,cluster_62
cluster_760,cluster_925,cluster_998    cluster_760
cluster_235,cluster_304,cluster_807
cluster_425,cluster_426,cluster_583
cluster_95,cluster_0,cluster_1
cluster_260,cluster_396,cluster_55
cluster_198,cluster_409,cluster_533   cluster_533
cluster_930,cluster_96,cluster_0
cluster_3,cluster_57,cluster_64       cluster_64
cluster_597,cluster_980,cluster_990
cluster_235,cluster_264,cluster_598
cluster_211,cluster_679,cluster_97
cluster_246,cluster_735,cluster_940   cluster_940
cluster_27,cluster_116,cluster_121
cluster_599,cluster_736,cluster_0
cluster_385,cluster_454,cluster_92
cluster_154,cluster_233,cluster_773   cluster_154
cluster_1211,cluster_272,cluster_84
cluster_1,cluster_396,cluster_79
cluster_668,cluster_887,cluster_93
cluster_600,cluster_134,cluster_737   cluster_737
cluster_50,cluster_814,cluster_9      cluster_9
cluster_434,cluster_542,cluster_738   cluster_542
cluster_4,cluster_113,cluster_418
cluster_614,cluster_647,cluster_901
cluster_116,cluster_565,cluster_845
cluster_0,cluster_1036,cluster_185    cluster_185
cluster_712,cluster_719,cluster_9     cluster_9
cluster_720,cluster_7,cluster_9       cluster_9
cluster_93,cluster_111,cluster_312    cluster_111
cluster_153,cluster_197,cluster_815   cluster_153
cluster_1011,cluster_0,cluster_319
cluster_3,cluster_923,cluster_1006
cluster_30,cluster_397,cluster_586
cluster_8,cluster_3,cluster_77
cluster_617,cluster_1,cluster_18      cluster_617
cluster_65,cluster_6,cluster_896      cluster_896
cluster_301,cluster_804,cluster_8
cluster_251,cluster_544,cluster_797   cluster_544
cluster_233,cluster_285,cluster_313   cluster_233
cluster_444,cluster_841,cluster_366   cluster_366
cluster_1223,cluster_351,cluster_55
cluster_258,cluster_47,cluster_521
cluster_290,cluster_31,cluster_669
cluster_1,cluster_43,cluster_429
cluster_155,cluster_230,cluster_816
cluster_739,cluster_740,cluster_357   cluster_740
cluster_4,cluster_306,cluster_908
cluster_29,cluster_620,cluster_827     cluster_827
cluster_587,cluster_6,cluster_649
cluster_2,cluster_27,cluster_86
cluster_261,cluster_393,cluster_98     cluster_261
cluster_6,cluster_683,cluster_684
cluster_685,cluster_958,cluster_991
cluster_18,cluster_4,cluster_650
cluster_155,cluster_441,cluster_601
cluster_278,cluster_279,cluster_503    cluster_503
cluster_300,cluster_59,cluster_66
cluster_4,cluster_602,cluster_621
cluster_362,cluster_280,cluster_707
cluster_420,cluster_74,cluster_83
cluster_566,cluster_9,cluster_932      cluster_9
cluster_1,cluster_354,cluster_53
cluster_3,cluster_57,cluster_64        cluster_64
cluster_171,cluster_622,cluster_775
cluster_40,cluster_456,cluster_80
cluster_874,cluster_875,cluster_164
cluster_481,cluster_623,cluster_686    cluster_56
cluster_177,cluster_537,cluster_652    cluster_537
cluster_297,cluster_420,cluster_0      cluster_297
cluster_1208,cluster_3,cluster_522
cluster_302,cluster_268,cluster_58
cluster_545,cluster_567,cluster_87
cluster_179,cluster_291,cluster_445
cluster_265,cluster_26,cluster_457
cluster_3,cluster_491,cluster_889
cluster_37,cluster_383,cluster_99      cluster_99
cluster_910,cluster_73,cluster_992
cluster_741,cluster_1081,cluster_373
cluster_191,cluster_229,cluster_761
cluster_3,cluster_172,cluster_279
cluster_8,cluster_867,cluster_945
cluster_625,cluster_742,cluster_828
cluster_653,cluster_9,cluster_246      cluster_9
cluster_224,cluster_554,cluster_713    cluster_713
cluster_352,cluster_221,cluster_80
cluster_626,cluster_6,cluster_195
cluster_40,cluster_48,cluster_212      cluster_212
cluster_339,cluster_113,cluster_46
cluster_3,cluster_868,cluster_346
cluster_1283,cluster_1055,cluster_762   cluster_762
cluster_67,cluster_687,cluster_723      cluster_67
cluster_411,cluster_688,cluster_805
cluster_213,cluster_314,cluster_505
cluster_324,cluster_832,cluster_3
cluster_911,cluster_833,cluster_1043
cluster_225,cluster_363,cluster_53
cluster_276,cluster_724,cluster_1090
cluster_35,cluster_358,cluster_462
cluster_1142,cluster_254,cluster_556
cluster_714,cluster_818,cluster_1       cluster_818
cluster_933,cluster_57,cluster_488      cluster_488
cluster_58,cluster_568,cluster_654
cluster_92,cluster_378,cluster_863
cluster_432,cluster_65,cluster_725      cluster_725
cluster_3,cluster_569,cluster_49
cluster_776,cluster_59,cluster_292
cluster_179,cluster_2,cluster_397
cluster_3,cluster_416,cluster_855
cluster_180,cluster_379,cluster_628
cluster_293,cluster_55,cluster_656
cluster_71,cluster_799,cluster_1
cluster_36,cluster_37,cluster_743
cluster_590,cluster_726,cluster_99      cluster_99
cluster_240,cluster_974,cluster_64      cluster_64
cluster_1,cluster_115,cluster_0
cluster_629,cluster_856,cluster_885     cluster_856
cluster_1272,cluster_728,cluster_63
cluster_113,cluster_127,cluster_450     cluster_127
cluster_341,cluster_414,cluster_708
cluster_1255,cluster_45,cluster_81
cluster_143,cluster_159,cluster_524
cluster_1,cluster_69,cluster_784        cluster_784
cluster_427,cluster_525,cluster_67      cluster_67
cluster_42,cluster_777,cluster_88       cluster_42
cluster_472,cluster_91,cluster_968      cluster_968
cluster_48,cluster_70,cluster_934       cluster_70
cluster_0,cluster_161,cluster_74
cluster_371,cluster_539,cluster_75      cluster_371
cluster_50,cluster_42,cluster_98        cluster_42
cluster_630,cluster_935,cluster_936
cluster_1238,cluster_182,cluster_778
cluster_744,cluster_913,cluster_955
cluster_547,cluster_689,cluster_709
cluster_428,cluster_821,cluster_93     cluster_428
cluster_79,cluster_947,cluster_956
cluster_526,cluster_658,cluster_829
cluster_3,cluster_510,cluster_878
cluster_423,cluster_152,cluster_30
cluster_195,cluster_512,cluster_37
cluster_592,cluster_80,cluster_99
cluster_408,cluster_1,cluster_79
cluster_634,cluster_113,cluster_339
cluster_59,cluster_692,cluster_919
Plant Ontology anatomy enrichment analysis of total
genes in each module*

hypocotyl(28),petal(28),root(29),flower(31),inflorescence(31)
shoot(13),flower(14),inflorescence(14),petal(14),vascular(14)
shoot(6),shoot(6),stamen(6),stem(6),vascular(6)
root(9),sepal(9),stamen(9),stem(9),vascular(9)
petal(6),sepal(6),stamen(6),stem(6),vascular(6)
vascular(9),collective(10),sepal(10),root(11),flower(12)
leaf(15),sepal(15),hypocotyl(16),root(16),vascular(16)
root(6),seed(6),sepal(6),shoot(6),vascular(6)
carpel(37),collective(37),pollen(38),sepal(39),flower(40)
seed(8),sepal(8),shoot(8),shoot(8),vascular(8)
seed(171),sepal(171),shoot(171),collective(172),vascular(172)
shoot(82),collective(83),flower(83),sepal(83),vascular(83)
shoot(88),flower(89),plant(89),sepal(90),vascular(90)
pedicel(57),plant(57),root(57),seed(57),shoot(57)
collective(30),flower(30),sepal(30),shoot(30),vascular(30)
plant(36),seed(36),stem(36),sepal(37),flower(38)
shoot(23),shoot(23),stamen(23),stem(23),vascular(23)
sepal(20),shoot(20),shoot(20),stamen(20),vascular(20)
collective(26),flower(26),hypocotyl(26),sepal(26),root(28)
vascular(13),sepal(14),flower(15),hypocotyl(15),root(17)
collective(14),hypocotyl(14),root(14),shoot(14),vascular(14)
stamen(11),vascular(11),collective(12),flower(12),root(13)
hypocotyl(11),sepal(11),flower(12),vascular(12),root(13)
plant(7),pollen(7),sepal(7),flower(8),root(8)
sepal(5),stem(5),vascular(5),collective(6),root(6)
sepal(6),shoot(6),shoot(6),stamen(6),vascular(6)
seed(5),sepal(5),shoot(5),stem(5),vascular(5)
petal(7),plant(7),seed(7),sepal(7),shoot(7)
stamen(25),petal(28),sepal(28),collective(29),flower(29)
pollen(17),root(17),seed(17),sepal(17),shoot(17)
seed(8),sepal(8),shoot(8),stamen(8),vascular(8)
sepal(11),vascular(12),flower(14),hypocotyl(24),root(27)
collective(8),flower(8),petal(8),hypocotyl(9),root(10)
shoot(4),vascular(4),sepal(5),hypocotyl(6),root(6)
collective(7),hypocotyl(7),root(7),stem(7),vascular(7)
collective(11),vascular(11),root(12),stem(12),flower(14)
seed(11),sepal(11),shoot(11),shoot(11),vascular(11)
root(21),sepal(21),shoot(21),shoot(21),vascular(21)
inflorescence(9),leaf(9),root(9),shoot(9),vascular(9)
shoot(2),flower(3),vascular(3),hypocotyl(4),root(5)
root(7),seed(7),sepal(7),shoot(7),vascular(7)
collective(65),stem(65),sepal(66),vascular(67),flower(68)
flower(93),sepal(93),collective(94),hypocotyl(94),vascular(94)
stamen(86),flower(88),root(88),sepal(88),collective(89)
sepal(51),vascular(51),flower(52),hypocotyl(55),root(56)
vascular(45),hypocotyl(46),inflorescence(46),flower(47),root(47)
shoot(10),stamen(10),stem(10),vascular(10),root(11)
flower(14),leaf(14),sepal(14),stamen(14),vascular(14)
vascular(29),collective(30),hypocotyl(30),inflorescence(30),flower(31)
plant(39),root(39),collective(40),hypocotyl(40),sepal(40)
sepal(18),vascular(18),collective(19),hypocotyl(19),root(20)
flower(2),pollen(2),shoot(2),plant(3),pollen(3)
sepal(7),shoot(7),stamen(7),stem(7),vascular(7)
sepal(6),shoot(6),shoot(6),stamen(6),vascular(6)
petal(9),seed(13),collective(16),flower(16),sepal(16)
petal(15),seed(15),collective(16),flower(16),sepal(16)
plant(40),pollen(40),pollen(40),sepal(40),stamen(40)
sepal(13),shoot(13),shoot(13),stamen(13),vascular(13)
sepal(7),shoot(7),shoot(7),stamen(7),vascular(7)
collective(10),flower(10),petal(10),plant(10),sepal(11)
shoot(10),shoot(10),stamen(10),stem(10),vascular(10)
stamen(9),stem(9),cotyledon(10),flower(10),vascular(10)
sepal(9),shoot(9),shoot(9),stamen(9),vascular(9)
seed(5),sepal(5),shoot(5),shoot(5),vascular(5)
shoot(1),stamen(1),stem(1),vascular(2),plant(3)
flower(3),petal(3),seed(3),plant(4),vascular(4)
shoot(11),shoot(11),stamen(11),stem(11),vascular(11)
seed(4),sepal(4),flower(5),hypocotyl(6),root(6)
sepal(19),hypocotyl(20),flower(21),inflorescence(21),root(21)
sepal(24),stamen(24),root(25),stem(25),vascular(25)
sepal(11),shoot(11),stamen(11),stem(11),vascular(11)
root(15),sepal(15),stamen(15),stem(15),vascular(15)
pollen(15),sepal(15),stamen(15),stem(15),vascular(15)
seed(7),sepal(7),shoot(7),shoot(7),vascular(7)
sepal(4),shoot(4),stamen(4),stem(4),flower(5)
shoot(19),shoot(19),stamen(19),stem(19),vascular(19)
seed(7),sepal(7),shoot(7),shoot(7),vascular(7)
sepal(7),shoot(7),shoot(7),stamen(7),vascular(7)
sepal(15),shoot(15),shoot(15),stamen(15),vascular(15)
petal(69),plant(69),pollen(69),sepal(69),stamen(69)
leaf(5),root(5),shoot(5),stem(5),vascular(5)
petal(142),pollen(145),flower(146),pollen(146),sepal(146)
petal(6),seed(6),sepal(6),stamen(6),hypocotyl(7)
sepal(12),vascular(12),collective(13),flower(13),root(13)
hypocotyl(12),petal(12),root(12),sepal(12),vascular(12)
sepal(45),shoot(45),stamen(45),stem(45),vascular(45)
sepal(40),shoot(40),shoot(40),stamen(40),vascular(40)
seed(32),shoot(32),shoot(32),stem(32),vascular(32)
pollen(19),collective(21),flower(21),petal(21),pollen(22)
sepal(20),pollen(21),collective(23),flower(23),petal(23)
stamen(9),petal(10),sepal(10),collective(11),flower(11)
sepal(7),shoot(7),shoot(7),stamen(7),vascular(7)
root(6),sepal(6),stamen(6),stem(6),vascular(6)
flower(18),plant(18),root(18),sepal(18),vascular(18)
shoot(8),shoot(8),stamen(8),stem(8),vascular(8)
sepal(5),shoot(5),stamen(5),stem(5),vascular(5)
sepal(17),vascular(17),flower(18),hypocotyl(26),root(27)
inflorescence(6),petal(6),pollen(6),root(6),sepal(6)
shoot(16),shoot(16),stamen(16),stem(16),vascular(16)
sepal(20),shoot(20),shoot(20),stem(20),vascular(20)
sepal(13),shoot(13),shoot(13),stamen(13),vascular(13)
sepal(9),shoot(9),stamen(9),stem(9),vascular(9)
collective(31),hypocotyl(31),root(31),sepal(31),petal(32)
flower(18),shoot(18),hypocotyl(19),root(19),vascular(19)
flower(19),shoot(19),hypocotyl(20),root(20),vascular(21)
shoot(40),flower(41),root(41),vascular(41),sepal(43)
sepal(21),shoot(21),shoot(21),stamen(21),hypocotyl(22)
seed(12),sepal(12),shoot(12),stamen(12),vascular(12)
collective(120),petal(120),pollen(120),flower(123),pollen(123)
carpel(10),collective(10),flower(10),petal(10),pollen(10)
collective(6),flower(6),petal(6),pollen(6),pollen(6)
collective(27),flower(27),hypocotyl(27),stem(27),vascular(27)
plant(12),sepal(12),stamen(12),stem(12),vascular(13)
flower(26),shoot(26),stamen(26),stem(27),vascular(27)
petal(11),root(11),sepal(11),shoot(11),stem(11)
shoot(3),shoot(3),hypocotyl(4),vascular(4),root(6)
plant(14),seed(14),sepal(14),shoot(14),vascular(14)
seed(19),sepal(19),shoot(19),stamen(19),vascular(19)
sepal(18),shoot(18),shoot(18),stamen(18),vascular(18)
vascular(19),collective(20),flower(20),hypocotyl(20),inflorescence(20)
shoot(13),shoot(13),stamen(13),stem(13),vascular(13)
stamen(3),flower(5),plant(6),hypocotyl(7),root(7)
inflorescence(9),sepal(9),flower(10),hypocotyl(17),root(18)
shoot(15),shoot(15),stamen(15),stem(15),vascular(15)
sepal(13),vascular(13),flower(14),hypocotyl(21),root(21)
inflorescence(5),plant(5),sepal(5),hypocotyl(6),root(7)
collective(5),flower(5),hypocotyl(5),root(5),sepal(5)
shoot(19),shoot(19),stamen(19),stem(19),vascular(19)
shoot(11),carpel(12),flower(13),sepal(13),root(16)
plant(8),stamen(8),hypocotyl(9),sepal(9),root(11)
stamen(6),carpel(7),flower(7),pedicel(7),plant(7)
flower(5),pollen(5),root(5),stem(5),vascular(5)
seed(37),sepal(37),shoot(37),shoot(37),vascular(37)
vascular(3),collective(4),flower(4),inflorescence(4),root(6)
plant(23),root(23),sepal(23),stamen(23),vascular(23)
seed(19),sepal(19),shoot(19),shoot(19),vascular(19)
petal(92),pollen(92),flower(93),pollen(93),sepal(93)
sepal(14),flower(16),vascular(16),hypocotyl(23),root(25)
stamen(4),collective(6),flower(6),petal(6),sepal(6)
inflorescence(5),leaf(5),root(5),sepal(5),vascular(5)
shoot(2),flower(3),root(8),trichoblast(8),root(9)
petal(19),root(19),sepal(19),flower(22),inflorescence(22)
flower(28),inflorescence(28),sepal(28),stamen(28),vascular(28)
stamen(39),sepal(41),vascular(41),collective(42),stem(42)
stem(18),collective(19),hypocotyl(19),flower(20),root(22)
sepal(11),stamen(11),stem(11),vascular(11),root(12)
sepal(9),shoot(9),shoot(9),stem(9),vascular(9)
vascular(3),sepal(4),flower(5),hypocotyl(5),root(9)
root(6),sepal(6),stamen(6),stem(6),vascular(6)
petal(26),pollen(28),sepal(28),flower(32),root(44)
hypocotyl(13),sepal(14),stamen(14),vascular(14),root(15)
shoot(21),vascular(22),hypocotyl(23),flower(24),root(28)
hypocotyl(42),petal(42),vascular(42),flower(43),root(52)
vascular(26),sepal(27),flower(28),collective(29),root(32)
seed(6),sepal(6),shoot(6),vascular(6),root(7)
sepal(15),stamen(15),vascular(15),flower(16),root(18)
shoot(7),shoot(7),stamen(7),stem(7),vascular(7)
shoot(9),shoot(9),stamen(9),stem(9),vascular(9)
plant(39),pollen(39),pollen(39),sepal(39),stamen(39)
shoot(2),stem(2),root(7),trichoblast(7),root(8)
sepal(5),shoot(5),shoot(5),stamen(5),vascular(5)
collective(10),sepal(10),flower(19),hypocotyl(19),root(26)
root(83),sepal(84),stem(84),collective(87),flower(91)
pollen(9),root(9),seed(9),flower(10),vascular(10)
stem(11),vascular(11),plant(12),stamen(12),seed(13)
collective(7),plant(7),root(7),sepal(7),flower(8)
shoot(15),shoot(15),flower(16),sepal(16),vascular(16)
root(40),sepal(40),shoot(40),shoot(40),vascular(40)
shoot(39),collective(40),flower(40),petal(40),sepal(40)
vascular(23),collective(24),flower(24),sepal(24),shoot(24)
flower(31),petal(31),sepal(31),shoot(31),vascular(31)
stamen(24),stem(24),vascular(24),flower(25),sepal(25)
flower(20),petal(20),plant(20),sepal(20),vascular(20)
sepal(11),shoot(11),shoot(11),stamen(11),vascular(11)
vascular(44),stem(45),flower(46),root(46),collective(47)
sepal(33),stamen(33),stem(33),vascular(33),flower(35)
vascular(22),collective(23),flower(23),petal(23),sepal(23)
petal(7),plant(7),pollen(7),seed(7),sepal(7)
sepal(20),collective(21),hypocotyl(21),vascular(21),root(22)
root(41),sepal(42),shoot(42),vascular(42),flower(43)
collective(37),sepal(37),stem(37),vascular(37),flower(38)
stem(20),collective(21),root(21),hypocotyl(22),vascular(22)
hypocotyl(13),leaf(13),sepal(13),stamen(13),vascular(13)
flower(18),petal(18),sepal(18),vascular(18),hypocotyl(19)
sepal(9),shoot(9),shoot(9),stamen(9),vascular(9)
flower(3),petal(3),sepal(3),root(4),vascular(4)
root(11),sepal(11),stamen(11),stem(11),vascular(11)
collective(19),flower(19),petal(19),pollen(19),sepal(19)
root(14),seed(14),sepal(14),shoot(14),vascular(14)
sepal(8),shoot(8),shoot(8),stamen(8),vascular(8)
plant(6),pollen(6),flower(7),root(7),sepal(7)
vascular(12),flower(15),sepal(15),hypocotyl(21),root(23)
seed(8),sepal(8),shoot(8),shoot(8),vascular(8)
sepal(7),shoot(7),shoot(7),vascular(7),flower(8)
stem(1),synergid(1),plant(2),vascular(2),flower(3)
root(4),seed(4),shoot(4),vascular(4),plant(5)
plant(28),seed(28),sepal(28),shoot(28),vascular(28)
seed(13),sepal(13),shoot(13),shoot(13),vascular(13)
flower(5),hypocotyl(5),leaf(5),root(5),vascular(5)
sepal(7),shoot(7),shoot(7),stamen(7),vascular(7)
vascular(12),collective(13),flower(13),inflorescence(13),root(13)
leaf(11),root(11),stem(11),vascular(11),collective(12)
sepal(13),flower(14),vascular(15),hypocotyl(17),root(18)
petal(5),plant(5),pollen(5),root(5),sepal(5)
cotyledon(19),flower(19),root(19),sepal(19),vascular(19)
sepal(9),shoot(9),shoot(9),stamen(9),vascular(9)
shoot(7),shoot(7),stamen(7),stem(7),vascular(7)
flower(11),seed(11),sepal(11),shoot(11),plant(12)
vascular(5),flower(6),plant(6),pollen(6),stem(6)
plant(22),sepal(22),shoot(22),vascular(22),root(24)
sepal(23),vascular(23),flower(24),hypocotyl(24),root(25)
shoot(14),shoot(14),stamen(14),stem(14),vascular(14)
root(10),sepal(11),trichoblast(11),flower(13),root(19)
pollen(9),sepal(9),stamen(9),stem(9),root(11)
sepal(7),shoot(7),shoot(7),stamen(7),vascular(7)
seed(4),stem(4),flower(6),hypocotyl(6),root(8)
vascular(3),flower(4),leaf(4),hypocotyl(6),root(6)
                                                   # of co-expression
Plant Ontology anatomy enrichment analysis of seed
                                                   conditions in each
genes in each module*
                                                   module
stem(7),vascular(7),flower(8),inflorescence(8),plant(8)   10
plant(6),root(6),sepal(6),shoot(6),vascular(6)            10
shoot(4),shoot(4),stamen(4),stem(4),vascular(4)           23
root(8),sepal(8),stamen(8),stem(8),vascular(8)            26
root(2),sepal(2),stamen(2),stem(2),vascular(2)            21
vascular(2),collective(3),flower(3),petal(3),sepal(3)     18
stem(5),hypocotyl(6),root(6),sepal(6),vascular(6)         22
root(5),seed(5),sepal(5),shoot(5),vascular(5)             26
plant(2),plant(2),pollen(2),pollen(2),sepal(2)            13
seed(8),sepal(8),shoot(8),shoot(8),vascular(8)            27
sepal(7),shoot(7),shoot(7),stamen(7),vascular(7)          13
sepal(2),shoot(2),shoot(2),stamen(2),vascular(2)          13
root(3),sepal(3),stamen(3),stem(3),vascular(3)            13
shoot(3),shoot(3),stamen(3),stem(3),vascular(3)           13
shoot(1),shoot(1),stamen(1),stem(1),vascular(1)           13
vascular(3),flower(4),petal(4),plant(4),seed(4)           13
shoot(1),shoot(1),stamen(1),stem(1),vascular(1)           13
shoot(2),shoot(2),stamen(2),stem(2),vascular(2)           13
seed(2),sepal(2),shoot(2),stamen(2),vascular(2)           13
vascular(3),flower(4),hypocotyl(4),sepal(4),root(5)       12
inflorescence(3),leaf(3),root(3),shoot(3),vascular(3)     14
pollen(4),root(4),sepal(4),stamen(4),vascular(4)          14
sepal(2),shoot(2),stamen(2),stem(2),vascular(2)           14
plant(1),pollen(1),portion(1),root(1),sepal(1)            18
shoot(3),shoot(3),stamen(3),stem(3),vascular(3)           18
sepal(1),shoot(1),shoot(1),stamen(1),vascular(1)          18
shoot(1),stamen(1),stem(1),trichome(1),vascular(1)        18
sepal(1),shoot(1),shoot(1),stamen(1),vascular(1)          20
petal(5),stamen(5),collective(6),flower(6),sepal(6)       15
shoot(1),stamen(1),stem(1),vascular(1),vascular(1)        15
shoot(1),shoot(1),stamen(1),stem(1),vascular(1)           15
sepal(5),vascular(5),flower(7),hypocotyl(11),root(14)     28
stem(1),vascular(1),vascular(1),hypocotyl(2),root(2)      14
stem(1),vascular(1),hypocotyl(2),root(2),sepal(2)         14
pollen(4),root(4),sepal(4),stem(4),vascular(4)            14
leaf(2),root(2),seed(2),stem(3),flower(4)                 18
shoot(2),shoot(2),stamen(2),vascular(2),root(3)              15
sepal(1),shoot(1),shoot(1),stamen(1),vascular(1)             15
root(5),sepal(5),shoot(5),stamen(5),vascular(5)              21
shoot(2),flower(3),vascular(3),hypocotyl(4),root(5)          29
root(7),seed(7),sepal(7),shoot(7),vascular(7)                35
stem(5),vascular(5),flower(6),root(6),sepal(6)               11
root(3),sepal(3),stamen(3),stem(3),vascular(3)               11
plant(8),root(8),sepal(8),stamen(8),vascular(8)              11
root(3),seed(3),sepal(3),shoot(3),vascular(3)                11
flower(6),inflorescence(6),root(6),shoot(6),vascular(6)      11
shoot(1),shoot(1),stamen(1),stem(1),vascular(1)              11
sepal(1),shoot(1),stamen(1),stem(1),vascular(1)              11
root(2),shoot(2),shoot(2),stem(2),vascular(2)                11
shoot(5),shoot(5),stamen(5),stem(5),vascular(5)              11
shoot(2),stamen(2),stem(2),vascular(2),root(3)               11
flower(1),plant(1),pollen(1),seed(1),shoot(1)                23
shoot(4),shoot(4),stamen(4),stem(4),vascular(4)              20
sepal(6),shoot(6),shoot(6),stamen(6),vascular(6)             39
vascular(2),collective(4),flower(4),seed(4),sepal(4)         12
petal(1),seed(1),sepal(1),stamen(1),vascular(1)              12
plant(19),pollen(19),pollen(19),sepal(19),stamen(19)         32
sepal(6),shoot(6),shoot(6),stamen(6),vascular(6)             17
shoot(3),shoot(3),stamen(3),stem(3),vascular(3)              17
shoot(1),shoot(1),stamen(1),stem(1),vascular(1)              14
shoot(1),shoot(1),stamen(1),stem(1),vascular(1)              19
shoot(2),shoot(2),stamen(2),stem(2),vascular(2)              19
shoot(1),shoot(1),stamen(1),stem(1),vascular(1)              19
shoot(1),shoot(1),stamen(1),stem(1),vascular(1)              19
none                                                         11
central(1),plant(1),plant(1),vascular(1)                     11
shoot(5),shoot(5),stamen(5),stem(5),vascular(5)              19
seed(4),sepal(4),flower(5),hypocotyl(6),root(6)              26
sepal(9),vascular(9),flower(10),inflorescence(10),root(10)   13
root(6),sepal(6),stamen(6),stem(6),vascular(6)               14
shoot(5),shoot(5),stamen(5),stem(5),vascular(5)              21
sepal(3),shoot(3),stamen(3),stem(3),vascular(3)              16
sepal(2),shoot(2),stamen(2),stem(2),vascular(2)              16
seed(2),sepal(2),shoot(2),shoot(2),vascular(2)               16
shoot(1),stamen(1),stem(1),vascular(1),flower(2)             16
shoot(7),shoot(7),stamen(7),stem(7),vascular(7)              21
shoot(3),shoot(3),stamen(3),stem(3),vascular(3)              21
sepal(5),shoot(5),shoot(5),stamen(5),vascular(5)             32
sepal(8),shoot(8),shoot(8),stamen(8),vascular(8)        25
petal(26),plant(26),pollen(26),sepal(26),stamen(26)     27
shoot(2),stamen(2),stem(2),trichoblast(2),vascular(2)   18
petal(24),pollen(24),flower(25),pollen(25),sepal(25)    15
sepal(1),stamen(1),hypocotyl(2),root(2),seed(2)         15
seed(1),sepal(1),shoot(1),stamen(1),vascular(1)         12
shoot(1),shoot(1),stamen(1),stem(1),vascular(1)         12
shoot(9),shoot(9),stamen(9),stem(9),vascular(9)         17
sepal(6),shoot(6),shoot(6),stamen(6),vascular(6)        17
shoot(1),shoot(1),stamen(1),stem(1),vascular(1)         17
pollen(2),pollen(2),sepal(2),stamen(2),stem(2)          14
shoot(1),shoot(1),stamen(1),stem(1),vascular(1)         14
flower(2),petal(2),pollen(2),sepal(2),stamen(2)         14
sepal(5),shoot(5),shoot(5),stamen(5),vascular(5)        34
shoot(2),shoot(2),stamen(2),stem(2),vascular(2)         21
root(1),sepal(1),stamen(1),stem(1),vascular(1)          20
shoot(6),shoot(6),stamen(6),stem(6),vascular(6)         19
sepal(4),shoot(4),stamen(4),stem(4),vascular(4)         20
sepal(5),vascular(5),flower(6),hypocotyl(9),root(10)    22
petal(5),plant(5),pollen(5),root(5),sepal(5)            20
shoot(3),shoot(3),stamen(3),stem(3),vascular(3)         20
sepal(4),shoot(4),shoot(4),stem(4),vascular(4)          20
sepal(4),shoot(4),shoot(4),stamen(4),vascular(4)        20
shoot(1),shoot(1),stamen(1),stem(1),vascular(1)         18
inflorescence(3),petal(3),plant(3),root(3),sepal(3)     17
leaf(2),root(2),shoot(2),stem(2),vascular(2)            17
stamen(3),vascular(3),flower(4),hypocotyl(4),root(5)    17
root(6),seed(6),sepal(6),shoot(6),vascular(6)           17
shoot(1),shoot(1),stamen(1),stem(1),vascular(1)         17
shoot(1),shoot(1),stamen(1),stem(1),vascular(1)         13
petal(16),sepal(16),flower(17),pollen(17),pollen(17)    14
collective(2),flower(2),petal(2),pollen(2),pollen(2)    14
sepal(1),shoot(1),stamen(1),stem(1),vascular(1)         14
shoot(2),shoot(2),stamen(2),stem(2),vascular(2)         13
root(1),vascular(1)                                     13
sepal(1),shoot(1),stamen(2),stem(2),vascular(2)         13
shoot(1),shoot(1),stamen(1),stem(1),vascular(1)         13
shoot(3),shoot(3),hypocotyl(4),vascular(4),root(6)      21
shoot(1),shoot(1),stamen(1),stem(1),vascular(1)         19
shoot(3),shoot(3),stamen(3),stem(3),vascular(3)         19
sepal(1),shoot(1),shoot(1),stamen(1),vascular(1)        19
inflorescence(4),leaf(4),root(4),stem(4),vascular(4)    12
shoot(3),shoot(3),stamen(3),stem(3),vascular(3)             15
stamen(3),flower(4),plant(5),hypocotyl(6),root(6)           22
sepal(5),vascular(5),flower(6),hypocotyl(10),root(11)       27
shoot(1),shoot(1),stamen(1),stem(1),vascular(1)             24
petal(6),sepal(6),flower(7),hypocotyl(9),root(9)            22
inflorescence(3),leaf(3),plant(3),root(3),sepal(3)          22
plant(4),root(4),sepal(4),shoot(4),vascular(4)              22
shoot(5),shoot(5),stamen(5),stem(5),vascular(5)             14
plant(6),seed(6),sepal(6),shoot(6),root(7)                  14
pollen(2),sepal(2),stamen(2),stem(2),root(3)                14
carpel(1),flower(1),pedicel(1),plant(1)                     22
shoot(1),shoot(1),stamen(1),stem(1),vascular(1)             22
shoot(3),shoot(3),stamen(3),stem(3),vascular(3)             14
shoot(1),shoot(1),stamen(1),stem(1),vascular(1)             15
shoot(1),shoot(1),stamen(1),stem(1),vascular(1)             24
shoot(1),shoot(1),stamen(1),stem(1),vascular(1)             24
collective(23),flower(23),petal(23),pollen(23),sepal(23)    22
stamen(5),vascular(5),flower(6),hypocotyl(8),root(10)       19
seed(1),sepal(1),shoot(1),stamen(1),vascular(1)             19
leaf(4),plant(4),root(4),sepal(4),vascular(4)               18
shoot(1),flower(2),root(3),root(5),trichoblast(5)           19
plant(13),root(13),sepal(13),flower(14),inflorescence(14)   18
root(5),sepal(5),stamen(5),stem(5),vascular(5)              12
leaf(3),petiole(3),root(3),stem(3),vascular(3)              12
shoot(2),shoot(2),stamen(2),stem(2),vascular(2)             12
root(1),sepal(1),stamen(1),stem(1),vascular(1)              12
shoot(2),shoot(2),stamen(2),stem(2),vascular(2)             13
vascular(3),sepal(4),flower(5),hypocotyl(5),root(9)         33
shoot(1),shoot(1),stamen(1),stem(1),vascular(1)             14
sepal(5),flower(7),root(7),trichoblast(8),root(10)          13
stem(5),root(6),sepal(6),stamen(6),vascular(6)              13
petal(4),plant(4),pollen(4),root(4),sepal(4)                11
pollen(6),sepal(6),stamen(6),vascular(6),root(8)            11
stem(2),trichoblast(2),collective(3),root(3),vascular(3)    11
shoot(1),stem(1),trichoblast(1),vascular(1),root(2)         11
stamen(2),stem(2),vascular(2),flower(3),root(3)             11
shoot(7),shoot(7),stamen(7),stem(7),vascular(7)             18
shoot(5),shoot(5),stamen(5),stem(5),vascular(5)             23
plant(19),pollen(19),pollen(19),sepal(19),stamen(19)        33
plant(1),shoot(1),root(4),root(4),trichoblast(4)            21
sepal(5),shoot(5),shoot(5),stamen(5),vascular(5)            36
collective(6),petal(6),flower(10),hypocotyl(10),root(14)    18
pollen(6),stem(6),vascular(6),collective(7),sepal(7)       14
shoot(1),shoot(1),stamen(1),stem(1),vascular(1)            14
shoot(2),shoot(2),stamen(2),stem(2),vascular(2)            14
vascular(1),flower(2),leaf(2),root(2),stem(2)              14
shoot(1),shoot(1),stamen(1),stem(1),vascular(1)            19
shoot(1),shoot(1),stamen(1),stem(1),vascular(1)            16
sepal(2),shoot(2),shoot(2),stamen(2),vascular(2)           16
shoot(1),shoot(1),stamen(1),stem(1),vascular(1)            16
seed(2),sepal(2),shoot(2),stamen(2),vascular(2)            16
root(2),sepal(2),stamen(2),stem(2),vascular(2)             16
root(2),sepal(2),stamen(2),stem(2),vascular(2)             16
sepal(8),shoot(8),shoot(8),stamen(8),vascular(8)           33
root(3),sepal(3),stamen(3),stem(3),vascular(3)             12
shoot(2),shoot(2),stamen(2),stem(2),vascular(2)            12
seed(2),sepal(2),shoot(2),shoot(2),vascular(2)             12
shoot(1),shoot(1),stamen(1),stem(1),vascular(1)            12
petal(2),plant(2),pollen(2),sepal(2),root(3)               16
stamen(3),vascular(3),flower(4),hypocotyl(4),root(4)       16
carpel(2),flower(2),petal(2),plant(2),seed(2)              16
shoot(1),shoot(1),stamen(1),stem(1),vascular(1)            16
shoot(1),shoot(1),stamen(1),stem(1),vascular(1)            16
shoot(1),shoot(1),stamen(1),stem(1),vascular(1)            16
shoot(1),shoot(1),stamen(1),stem(1),vascular(1)            13
petal(1),plant(1),radicle(1),root(1),seed(1)               25
vascular(4),hypocotyl(5),plant(5),sepal(5),stamen(5)       17
collective(18),flower(18),petal(18),pollen(18),sepal(18)   22
root(6),seed(6),sepal(6),shoot(6),vascular(6)              23
sepal(7),shoot(7),shoot(7),stamen(7),vascular(7)           29
petal(4),plant(4),pollen(4),root(4),sepal(4)               22
petal(6),sepal(6),flower(7),hypocotyl(9),root(9)           26
seed(8),sepal(8),shoot(8),shoot(8),vascular(8)             26
shoot(3),shoot(3),stamen(3),stem(3),vascular(3)            18
1(1),central(1),flower(1),pollen(1)                        14
central(1),plant(1),plant(1),vascular(1)                   14
seed(10),sepal(10),shoot(10),shoot(10),vascular(10)        24
seed(3),sepal(3),shoot(3),shoot(3),vascular(3)             21
flower(5),hypocotyl(5),leaf(5),root(5),vascular(5)         19
sepal(7),shoot(7),shoot(7),stamen(7),vascular(7)           30
petal(10),petiole(10),root(10),sepal(10),vascular(10)      25
root(2),sepal(2),stamen(2),stem(2),vascular(2)             15
flower(5),plant(5),vascular(5),hypocotyl(6),root(7)        17
plant(1),pollen(1),portion(1),root(1),sepal(1)             18
root(2),sepal(2),shoot(2),shoot(2),vascular(2)             14
sepal(7),shoot(7),shoot(7),stamen(7),vascular(7)           25
shoot(6),shoot(6),stamen(6),stem(6),vascular(6)            26
sepal(2),shoot(2),shoot(2),stamen(2),vascular(2)           13
plant(2),pollen(2),sepal(2),stamen(2),stem(2)              19
shoot(1),stamen(1),stem(1),vascular(1),root(2)             18
flower(5),hypocotyl(5),inflorescence(5),root(5),sepal(5)   18
shoot(1),shoot(1),stamen(1),stem(1),vascular(1)            18
sepal(3),flower(4),root(5),trichoblast(5),root(6)          16
root(3),sepal(3),stamen(3),stem(3),vascular(3)             16
sepal(7),shoot(7),shoot(7),stamen(7),vascular(7)           25
seed(4),stem(4),flower(6),hypocotyl(6),root(8)             33
vascular(3),flower(4),leaf(4),hypocotyl(6),root(6)         27
Tissue/organ information of co-expression conditions in each module**

nodeshoot(1),inflorescence_stem_base(2),internodeshoot(3),stem(4)
nodeshoot(1),inflorescence_stem_base(2),internodeshoot(3),stem(4)
leaf(1),cauline_leaf(2),seed_germination(2),whole_plant(3),seed(6),pollen(9)
cell_culture(1),lateral_roots(1),nodeshoot(1),total_roots(1),Small_excised_segments_of_primary_root_tis
fully_expanded_leaves(1),lateral_roots(1),seedlings(1),whole_leaves(1),Rosette_leaves(2),vascular_leaf_
early_green_cotyledon(1),triangle_embryo(1),heart_embryo(2),early_curled_cotyledon(3),seed_germinat
Inflorescence_stalk(1),total_roots(1),cotyledon_hypocotyl(4),seed_germination(4),seed(5),root(7)
early_green_cotyledon(1),fully_expanded_leaves(1),leaf(1),shoot(1),cauline_leaf(2),cell_culture(2),hypoc
ms1ttg-old_flower(1),flower_stamen(3),globular_embryo(3),pollen(3),stamen(3)
All_aerial_tissue(1),carpel(1),nodeshoot(1),petiole(1),seedlings(1),shoot(1),shoot_apex_rosette(1),total_t
carpel(1),leafshoot_apex(1),shoot_apex_rosette(1),shoot_apex_rosette_stage(2),flower(8)
carpel(1),leafshoot_apex(1),shoot_apex_rosette(1),shoot_apex_rosette_stage(2),flower(8)
carpel(1),leafshoot_apex(1),shoot_apex_rosette(1),shoot_apex_rosette_stage(2),flower(8)
carpel(1),leafshoot_apex(1),shoot_apex_rosette(1),shoot_apex_rosette_stage(2),flower(8)
carpel(1),leafshoot_apex(1),shoot_apex_rosette(1),shoot_apex_rosette_stage(2),flower(8)
carpel(1),leafshoot_apex(1),shoot_apex_rosette(1),shoot_apex_rosette_stage(2),flower(8)
carpel(1),leafshoot_apex(1),shoot_apex_rosette(1),shoot_apex_rosette_stage(2),flower(8)
carpel(1),leafshoot_apex(1),shoot_apex_rosette(1),shoot_apex_rosette_stage(2),flower(8)
carpel(1),leafshoot_apex(1),shoot_apex_rosette(1),shoot_apex_rosette_stage(2),flower(8)
root(3),seedlings(3),Small_excised_segments_of_primary_root_tissue_corresponding_to_root-hair_elonga
Small_excised_segments_of_primary_root_tissue_corresponding_to_root-hair_elongation(1),total_roots(1
Small_excised_segments_of_primary_root_tissue_corresponding_to_root-hair_elongation(1),total_roots(1
Small_excised_segments_of_primary_root_tissue_corresponding_to_root-hair_elongation(1),total_roots(1
total_roots(1),seedlings(2),whole_plant(2),whole_seedlings(2),cotyledon_hypocotyl(4),root(7)
total_roots(1),seedlings(2),whole_plant(2),whole_seedlings(2),cotyledon_hypocotyl(4),root(7)
total_roots(1),seedlings(2),whole_plant(2),whole_seedlings(2),cotyledon_hypocotyl(4),root(7)
total_roots(1),seedlings(2),whole_plant(2),whole_seedlings(2),cotyledon_hypocotyl(4),root(7)
ms1ttg-old_flower(1),Young_Flower_Buds(1),Old_Flower_Buds(2),shoot_apex_rosette_stage(2),infloresc
flower(3),stamen(3),pollen(9)
flower(3),stamen(3),pollen(9)
flower(3),stamen(3),pollen(9)
the_entire_seedlings(1),total_roots(1),seedlings(2),total_tissue(2),whole_plants_seedling(2),Small_excise
whole_plant(2),seedlings(3),Small_excised_segments_of_primary_root_tissue_corresponding_to_root-ha
whole_plant(2),seedlings(3),Small_excised_segments_of_primary_root_tissue_corresponding_to_root-ha
whole_plant(2),seedlings(3),Small_excised_segments_of_primary_root_tissue_corresponding_to_root-ha
early_green_cotyledon(1),lateral_roots(1),walking-stick_seed(1),seed_germination(2),whole_plant(2),ear
leaf(1),shoot(1),cauline_leaf(2),flower(3),senescence_leaf(3),seed(5)
leaf(1),shoot(1),cauline_leaf(2),flower(3),senescence_leaf(3),seed(5)
whole_leaves(1),All_aerial_tissue(2),vascular_leaf_late_rosette(2),whole_plant(2),Cell(3),cell_culture(5),P
hypocotyl(1),seedlings(1),total_roots(1),whole_plants_seedling(1),the_entire_seedlings(2),total_tissue(2)
carpel(1),ms1ttg-old_flower(1),nodeshoot(1),Old_Flower_Buds(1),petiole(1),shoot(1),shoot_apex_rosette
total_roots(1),cotyledon_hypocotyl(4),root(6)
total_roots(1),cotyledon_hypocotyl(4),root(6)
total_roots(1),cotyledon_hypocotyl(4),root(6)
total_roots(1),cotyledon_hypocotyl(4),root(6)
total_roots(1),cotyledon_hypocotyl(4),root(6)
total_roots(1),cotyledon_hypocotyl(4),root(6)
total_roots(1),cotyledon_hypocotyl(4),root(6)
total_roots(1),cotyledon_hypocotyl(4),root(6)
total_roots(1),cotyledon_hypocotyl(4),root(6)
total_roots(1),cotyledon_hypocotyl(4),root(6)
fully_expanded_leaves(1),hypocotyls_cotyledons_meristems(1),root(1),Rosette_leaves(1),Small_excised_
axillary_buds(1),Guard_Cell_enriched_leaves(1),hypocotyls_cotyledons_meristems(1),seed(1),whole_plan
shoot(1),shoot_apex_rosette(1),Cell(2),Rosette_leaves(2),hypocotyl(3),shoot_apex_rosette_stage(3),vasc
inflorescence_stem_tip(1),axillary_buds(2),inflorescence(2),flower(7)
inflorescence_stem_tip(1),axillary_buds(2),inflorescence(2),flower(7)
ms1ttg-old_flower(1),inflorescence(2),flower_stamen(3),petal(3),sepal(3),stamen(3),pollen(7),flower(10)
All_aerial_tissue(1),fully_expanded_leaves(1),Programmed_Cell(1),shoot(2),flower(3),senescence_leaf(3)
All_aerial_tissue(1),fully_expanded_leaves(1),Programmed_Cell(1),shoot(2),flower(3),senescence_leaf(3)
carpel(1),triangle_embryo(1),flower(3),globular_embryo(3),heart_embryo(3),torpedo_embryo(3)
Programmed_Cell(4),cell_culture(15)
Programmed_Cell(4),cell_culture(15)
Programmed_Cell(4),cell_culture(15)
Programmed_Cell(4),cell_culture(15)
Guard_Cell_enriched_leaves(1),inflorescence(1),lateral_roots(1),stem(1),whole_seedlings(1),flower(2),po
Guard_Cell_enriched_leaves(1),inflorescence(1),lateral_roots(1),stem(1),whole_seedlings(1),flower(2),po
ms1ttg-old_flower(1),Old_Flower_Buds(1),flower(2),sepal(3),whole_plant(3),pollen(9)
total_roots(1),whole_plants_seedling(1),seedlings(2),Small_excised_segments_of_primary_root_tissue_c
Inflorescence_stalk(1),lateral_roots(1),nodeshoot(1),root(1),total_roots(1),stem(2),inflorescence_stem_b
root(1),seed(2),pollen(3),flower(4),shoot(4)
Guard_Cell_enriched_leaves(1),seedlings(1),whole_leaves(1),whole_plants_seedling(1),seed_germination
flower_stamen(3),sepal(3),whole_plant(4),flower(6)
flower_stamen(3),sepal(3),whole_plant(4),flower(6)
flower_stamen(3),sepal(3),whole_plant(4),flower(6)
flower_stamen(3),sepal(3),whole_plant(4),flower(6)
shoot_apex_rosette(1),inflorescence_stem_tip(2),Programmed_Cell(2),shoot_apex_rosette_stage(2),Cell(
shoot_apex_rosette(1),inflorescence_stem_tip(2),Programmed_Cell(2),shoot_apex_rosette_stage(2),Cell(
carpel(1),nodeshoot(1),shoot_apex_rosette(1),shoot_apex_rosette_stage(1),vascular_leaf_rosette(1),glob
carpel(1),shoot_apex_rosette(1),shoot(2),hypocotyl(3),shoot_apex_rosette_stage(3),vascular_leaf_late_r
inflorescence(2),flower_stamen(3),stamen(3),pollen(7),flower(12)
Small_excised_segments_of_primary_root_tissue_corresponding_to_root-hair_elongation(2),whole_seedl
flower(3),flower_stamen(3),globular_embryo(3),pollen(6)
seed(1),total_roots(1),root(3),torpedo_embryo(3),whole_plant(3),cotyledon_hypocotyl(4)
Small_excised_segments_of_primary_root_tissue_corresponding_to_root-hair_elongation(1),total_roots(1
Small_excised_segments_of_primary_root_tissue_corresponding_to_root-hair_elongation(1),total_roots(1
seed(6),pollen(11)
seed(6),pollen(11)
seed(6),pollen(11)
flower(1),stamen(3),pollen(10)
flower(1),stamen(3),pollen(10)
flower(1),stamen(3),pollen(10)
carpel(1),inflorescence(1),shoot_apex_rosette(1),globular_embryo(3),hypocotyl(3),petal(3),shoot(3),shoo
inflorescence_stem_base(1),Programmed_Cell(1),triangle_embryo(1),walking-stick_seed(1),early_curled_
carpel(1),nodeshoot(1),shoot_apex_rosette(1),inflorescence_stem_tip(2),hypocotyl(3),shoot_apex_rosett
axillary_buds(1),inflorescence_stem_base(1),Tumour(1),flower(2),Whole_leaf_Age(3),vascular_leaf_late_
flower(1),fully_expanded_leaves(1),Small_excised_segments_of_primary_root_tissue_corresponding_to_
total_roots(1),whole_plants_seedling(1),whole_seedlings(3),Small_excised_segments_of_primary_root_ti
nodeshoot(1),Small_excised_segments_of_primary_root_tissue_corresponding_to_root-hair_elongation(1
seed_germination(4),pollen(8),seed(8)
seed_germination(4),pollen(8),seed(8)
seed_germination(4),pollen(8),seed(8)
pollen(1),seed_germination(4),seed(6),cell_culture(7)
total_roots(1),root(16)
total_roots(1),root(16)
total_roots(1),root(16)
total_roots(1),root(16)
total_roots(1),root(16)
hypocotyl(1),shoot_apex_rosette(1),total_roots(1),flower(3),root(3),cotyledon_hypocotyl(4)
flower(1),ms1ttg-old_flower(1),stamen(3),pollen(9)
flower(1),ms1ttg-old_flower(1),stamen(3),pollen(9)
flower(1),ms1ttg-old_flower(1),stamen(3),pollen(9)
cell_culture(1),Programmed_Cell(3),whole_plant(3),Cell(6)
cell_culture(1),Programmed_Cell(3),whole_plant(3),Cell(6)
cell_culture(1),Programmed_Cell(3),whole_plant(3),Cell(6)
cell_culture(1),Programmed_Cell(3),whole_plant(3),Cell(6)
total_roots(1),whole_plants_seedling(1),whole_plant(3),Small_excised_segments_of_primary_root_tissue
carpel(1),seedlings(1),globular_embryo(2),flower(3),hypocotyl(3),leafshoot_apex(3),petal(3),petiole(3)
carpel(1),seedlings(1),globular_embryo(2),flower(3),hypocotyl(3),leafshoot_apex(3),petal(3),petiole(3)
carpel(1),seedlings(1),globular_embryo(2),flower(3),hypocotyl(3),leafshoot_apex(3),petal(3),petiole(3)
nodeshoot(1),Small_excised_segments_of_primary_root_tissue_corresponding_to_root-hair_elongation(1
seedlings(1),Guard_Cell_enriched_leaves(2),vascular_leaf_late_rosette(2),whole_plant(2),stamen(3),polle
early_green_cotyledon(1),lateral_roots(1),the_entire_seedlings(1),walking-stick_seed(1),whole_plant(1),s
total_roots(1),whole_plants_seedling(1),total_tissue(2),whole_plant(2),cotyledon_hypocotyl(4),Small_exc
pollen(1),seed_germination(4),cell_culture(8),seed(11)
seedlings(1),the_entire_seedlings(1),total_roots(1),total_tissue(1),whole_plants_seedling(1),whole_seedl
seedlings(1),the_entire_seedlings(1),total_roots(1),total_tissue(1),whole_plants_seedling(1),whole_seedl
seedlings(1),the_entire_seedlings(1),total_roots(1),total_tissue(1),whole_plants_seedling(1),whole_seedl
seed(2),vascular_leaf_late_rosette(4),pollen(8)
total_roots(1),Small_excised_segments_of_primary_root_tissue_corresponding_to_root-hair_elongation(2
total_roots(1),Small_excised_segments_of_primary_root_tissue_corresponding_to_root-hair_elongation(2
early_curled_cotyledon(1),early_green_cotyledon(1),Tumour(1),root(2),vascular_leaf_rosette(2),flower(6
early_curled_cotyledon(1),early_green_cotyledon(1),Tumour(1),root(2),vascular_leaf_rosette(2),flower(6
fully_expanded_leaves(1),seed_germination(3),seed(4),pollen(6)
pollen(1),total_roots(1),whole_seedlings(2),seedlings(3),root(4),Small_excised_segments_of_primary_roo
carpel(1),inflorescence(1),ms1ttg-old_flower(1),Old_Flower_Buds(1),inflorescence_stem_tip(2),shoot_ape
carpel(1),inflorescence(1),ms1ttg-old_flower(1),Old_Flower_Buds(1),inflorescence_stem_tip(2),shoot_ape
flower_stamen(3),globular_embryo(3),stamen(3),flower(6),pollen(7)
total_roots(1),total_tissue(1),whole_plants_seedling(1),whole_seedlings(1),Small_excised_segments_of_
Young_Flower_Buds(1),inflorescence_stem_tip(3),stamen(3),inflorescence(4),flower(8)
axillary_buds(1),shoot(1),total_roots(1),Young_Flower_Buds(1),seed(4),pollen(5),root(5)
total_roots(1),whole_plant(2),Small_excised_segments_of_primary_root_tissue_corresponding_to_root-h
nodeshoot(1),Tumour(1),inflorescence_stem_tip(2),Guard_Cell_enriched_leaves(3),internodeshoot(3),inf
total_roots(1),seedlings(2),cotyledon_hypocotyl(4),root(5)
total_roots(1),seedlings(2),cotyledon_hypocotyl(4),root(5)
total_roots(1),seedlings(2),cotyledon_hypocotyl(4),root(5)
total_roots(1),seedlings(2),cotyledon_hypocotyl(4),root(5)
Guard_Cell_enriched_leaves(1),nodeshoot(1),triangle_embryo(1),heart_embryo(2),stem(2),torpedo_emb
total_roots(1),the_entire_seedlings(2),total_tissue(2),whole_plants_seedling(3),Small_excised_segments_
early_green_cotyledon(1),stem(1),early_curled_cotyledon(3),inflorescence_stem_base(3),stamen(3),torp
total_roots(1),seedlings(2),Small_excised_segments_of_primary_root_tissue_corresponding_to_root-hair_
total_roots(1),seedlings(2),Small_excised_segments_of_primary_root_tissue_corresponding_to_root-hair_
seedlings(1),total_roots(1),whole_plant(2),whole_seedlings(2),root(5)
seedlings(1),total_roots(1),whole_plant(2),whole_seedlings(2),root(5)
seedlings(1),total_roots(1),whole_plant(2),whole_seedlings(2),root(5)
seedlings(1),total_roots(1),whole_plant(2),whole_seedlings(2),root(5)
seedlings(1),total_roots(1),whole_plant(2),whole_seedlings(2),root(5)
shoot(1),vascular_leaf_late_rosette(1),whole_plant(1),root(2),seed(6),pollen(7)
axillary_buds(1),internodeshoot(1),ms1ttg-young_flower(1),flower(2),inflorescence(2),root(2),shoot(2),W
ms1ttg-old_flower(1),inflorescence(2),flower_stamen(3),petal(3),sepal(3),stamen(3),pollen(7),flower(11)
total_roots(1),Small_excised_segments_of_primary_root_tissue_corresponding_to_root-hair_elongation(2
carpel(1),Cell(2),Rosette_leaves(2),vascular_leaf_rosette(2),hypocotyl(3),shoot(3),Whole_leaf_Age(4),va
total_roots(1),whole_plant(3),whole_seedlings(3),Small_excised_segments_of_primary_root_tissue_corre
early_green_cotyledon(1),early_curled_cotyledon(3),seed_germination(4),seed(6)
early_green_cotyledon(1),early_curled_cotyledon(3),seed_germination(4),seed(6)
early_green_cotyledon(1),early_curled_cotyledon(3),seed_germination(4),seed(6)
early_green_cotyledon(1),early_curled_cotyledon(3),seed_germination(4),seed(6)
carpel(1),axillary_buds(2),Guard_Cell_enriched_leaves(3),inflorescence(3),flower(10)
ms1ttg-old_flower(1),Young_Flower_Buds(1),Old_Flower_Buds(2),flower(12)
ms1ttg-old_flower(1),Young_Flower_Buds(1),Old_Flower_Buds(2),flower(12)
ms1ttg-old_flower(1),Young_Flower_Buds(1),Old_Flower_Buds(2),flower(12)
ms1ttg-old_flower(1),Young_Flower_Buds(1),Old_Flower_Buds(2),flower(12)
ms1ttg-old_flower(1),Young_Flower_Buds(1),Old_Flower_Buds(2),flower(12)
ms1ttg-old_flower(1),Young_Flower_Buds(1),Old_Flower_Buds(2),flower(12)
carpel(1),cell_culture(1),fully_expanded_leaves(1),Programmed_Cell(1),shoot(1),vascular_leaf_rosette(1)
early_green_cotyledon(1),pollen(1),triangle_embryo(1),early_curled_cotyledon(3),stamen(3),torpedo_em
early_green_cotyledon(1),pollen(1),triangle_embryo(1),early_curled_cotyledon(3),stamen(3),torpedo_em
early_green_cotyledon(1),pollen(1),triangle_embryo(1),early_curled_cotyledon(3),stamen(3),torpedo_em
early_green_cotyledon(1),pollen(1),triangle_embryo(1),early_curled_cotyledon(3),stamen(3),torpedo_em
total_roots(1),root(15)
total_roots(1),root(15)
total_roots(1),root(15)
total_roots(1),root(15)
total_roots(1),root(15)
total_roots(1),root(15)
fully_expanded_leaves(1),pollen(1),Whole_leaf_Age(1),Programmed_Cell(2),vascular_leaf_rosette(2),sen
carpel(1),shoot_apex_rosette(1),petal(2),seed(2),seed_germination(2),leafshoot_apex(3),shoot_apex_ros
All_aerial_tissue(1),seedlings(1),whole_plant(1),vascular_leaf(2),Whole_leaf_Age(2),vascular_leaf_late_ro
flower_stamen(3),globular_embryo(3),stamen(3),flower(6),pollen(7)
total_roots(1),hypocotyl(3),cotyledon_hypocotyl(4),seed(7),root(8)
fully_expanded_leaves(1),Whole_leaf_Age(1),All_aerial_tissue(2),Programmed_Cell(2),shoot(2),vascular_
seed(1),total_roots(1),seedlings(2),Small_excised_segments_of_primary_root_tissue_corresponding_to_r
hypocotyl(1),total_roots(1),seedlings(2),the_entire_seedlings(2),whole_plants_seedling(2),whole_seedlin
All_aerial_tissue(1),fully_expanded_leaves(1),leaves(1),Programmed_Cell(1),root(1),unshaded_mature_r
vascular_leaf_rosette(1),Programmed_Cell(2),root(2),shoot(2),Cell(3),senescence_leaf(3),cell_culture(5)
fully_expanded_leaves(1),lateral_roots(1),petiole(1),Small_excised_segments_of_primary_root_tissue_co
fully_expanded_leaves(1),lateral_roots(1),petiole(1),Small_excised_segments_of_primary_root_tissue_co
carpel(1),nodeshoot(1),seedlings(1),shoot(1),shoot_apex_rosette(1),whole_plants_seedling(1),whole_see
carpel(1),Guard_Cell_enriched_leaves(1),inflorescence(1),shoot_apex_rosette(1),globular_embryo(2),sho
Cell(1),stem(1),root(2),hypocotyl(3),Programmed_Cell(4),cell_culture(8)
carpel(1),shoot(1),shoot_apex_rosette(1),vascular_leaf_late_rosette(2),hypocotyl(3),seed(3),shoot_apex_
cell_culture(1),lateral_roots(1),nodeshoot(1),petiole(1),root(1),Small_excised_segments_of_primary_root
flower(1),ms1ttg-young_flower(1),Young_Flower_Buds(1),inflorescence_stem_tip(3),stamen(3),pollen(6)
total_roots(1),total_tissue(1),Small_excised_segments_of_primary_root_tissue_corresponding_to_root-ha
total_roots(1),cotyledon_hypocotyl(4),root(13)
inflorescence_stem_base(1),root(1),flower(3),internodeshoot(3),senescence_leaf(3),Small_excised_segm
cell_culture(1),fully_expanded_leaves(1),vascular_leaf_rosette(1),whole_above_ground_rosettes(1),Prog
early_curled_cotyledon(1),flower(1),inflorescence_stem_base(1),nodeshoot(1),Old_Flower_Buds(1),seed
whole_seedlings(2),seed(4),whole_plant(7)
early_green_cotyledon(1),walking-stick_seed(1),root(2),early_curled_cotyledon(3),flower_stamen(3),torp
total_roots(1),root(17)
total_roots(1),root(17)
total_roots(1),root(17)
total_roots(1),seedlings(2),Small_excised_segments_of_primary_root_tissue_corresponding_to_root-hair_
total_roots(1),seedlings(2),Small_excised_segments_of_primary_root_tissue_corresponding_to_root-hair_
carpel(1),fully_expanded_leaves(1),shoot_apex_rosette_stage(1),shoot(2),globular_embryo(3),seed(6),fl
total_roots(1),the_entire_seedlings(2),seedlings(3),whole_plant(3),whole_plants_seedling(3),Small_excis
seedlings(2),cotyledon_hypocotyl(4),Small_excised_segments_of_primary_root_tissue_corresponding_to_
egments_of_primary_root_tissue_corresponding_to_root-hair_elongation(2),Tumour(2),internodeshoot(3),petiole(3),
ette_leaves(2),vascular_leaf_late_rosette(2),Whole_leaf_Age(2),whole_plant(2),flower(3),senescence_leaf(3),vascula
_cotyledon(3),seed_germination(3),seed(8)
 on(4),seed(5),root(7)
_leaf(2),cell_culture(2),hypocotyl(2),flower(3),root(3),seed(3),senescence_leaf(3),cotyledon_hypocotyl(4)

 hoot_apex_rosette(1),total_tissue(1),whole_plants_seedling(1),whole_seedlings(1),root(2),shoot_system_seedling(2
 e(2),flower(8)
 e(2),flower(8)
 e(2),flower(8)
 e(2),flower(8)
 e(2),flower(8)
 e(2),flower(8)
 e(2),flower(8)
 e(2),flower(8)
 e(2),flower(8)
sponding_to_root-hair_elongation(3),whole_seedlings(3)
 r_elongation(1),total_roots(1),whole_plant(3),cotyledon_hypocotyl(4),root(5)
 r_elongation(1),total_roots(1),whole_plant(3),cotyledon_hypocotyl(4),root(5)
 r_elongation(1),total_roots(1),whole_plant(3),cotyledon_hypocotyl(4),root(5)
pocotyl(4),root(7)
pocotyl(4),root(7)
pocotyl(4),root(7)
pocotyl(4),root(7)
ex_rosette_stage(2),inflorescence(3),inflorescence_stem_tip(3),flower(8)




nts_seedling(2),Small_excised_segments_of_primary_root_tissue_corresponding_to_root-hair_elongation(4),whole_
e_corresponding_to_root-hair_elongation(3),root(6)
e_corresponding_to_root-hair_elongation(3),root(6)
e_corresponding_to_root-hair_elongation(3),root(6)
nation(2),whole_plant(2),early_curled_cotyledon(3),torpedo_embryo(3),seed(5)
nt(2),Cell(3),cell_culture(5),Programmed_Cell(6)
_seedlings(2),total_tissue(2),whole_seedlings(2),Small_excised_segments_of_primary_root_tissue_corresponding_t
shoot(1),shoot_apex_rosette(1),total_roots(1),total_tissue(1),whole_plant(1),whole_plants_seedling(1),whole_seed




tte_leaves(1),Small_excised_segments_of_primary_root_tissue_corresponding_to_root-hair_elongation(1),vascular_
stems(1),seed(1),whole_plant(1),shoot_apex_rosette_stage(2),pollen(4),seed_germination(4),whole_seedlings(5)
t_apex_rosette_stage(3),vascular_leaf_rosette(3),Whole_leaf_Age(4),vascular_leaf_late_rosette(9),flower(11)


amen(3),pollen(7),flower(10)
flower(3),senescence_leaf(3),seed(6)
flower(3),senescence_leaf(3),seed(6)
 ,torpedo_embryo(3)




ole_seedlings(1),flower(2),pollen(2),whole_plant(2)
ole_seedlings(1),flower(2),pollen(2),whole_plant(2)

ts_of_primary_root_tissue_corresponding_to_root-hair_elongation(2),whole_plant(2),whole_seedlings(2),root(16)
em(2),inflorescence_stem_base(3),internodeshoot(3)

seedling(1),seed_germination(3),Small_excised_segments_of_primary_root_tissue_corresponding_to_root-hair_elon




_apex_rosette_stage(2),Cell(3),flower(4),cell_culture(7)
_apex_rosette_stage(2),Cell(3),flower(4),cell_culture(7)
,vascular_leaf_rosette(1),globular_embryo(2),hypocotyl(2),petal(3),vascular_leaf_late_rosette(4),shoot(5),flower(11
 stage(3),vascular_leaf_late_rosette(7),flower(8)

 r_elongation(2),whole_seedlings(2),hypocotyl(3),seedlings(3),whole_plant(3),root(5)

_hypocotyl(4)
 r_elongation(1),total_roots(1),whole_plants_seedling(2),whole_seedlings(2),root(6)
 r_elongation(1),total_roots(1),whole_plants_seedling(2),whole_seedlings(2),root(6)




otyl(3),petal(3),shoot(3),shoot_apex_rosette_stage(3),vascular_leaf_late_rosette(6),flower(10)
g-stick_seed(1),early_curled_cotyledon(2),cell_culture(3),torpedo_embryo(3),seed_germination(4),seed(5)
pocotyl(3),shoot_apex_rosette_stage(3),seed(4),flower(5)
af_Age(3),vascular_leaf_late_rosette(5),pollen(6)
ot_tissue_corresponding_to_root-hair_elongation(1),whole_plant(1),shoot_apex_rosette_stage(2),cotyledon_hypoco
 egments_of_primary_root_tissue_corresponding_to_root-hair_elongation(4),root(13)
ng_to_root-hair_elongation(1),whole_seedlings(1),internodeshoot(3),inflorescence_stem_base(4),root(10)




 n_hypocotyl(4)




ments_of_primary_root_tissue_corresponding_to_root-hair_elongation(4),pollen(5),root(7)
 apex(3),petal(3),petiole(3)
 apex(3),petal(3),petiole(3)
 apex(3),petal(3),petiole(3)
 ng_to_root-hair_elongation(1),inflorescence_stem_base(2),petiole(2),hypocotyl(3),internodeshoot(3)
hole_plant(2),stamen(3),pollen(5)
tick_seed(1),whole_plant(1),seedlings(2),early_curled_cotyledon(3),hypocotyl(3),root(3),torpedo_embryo(3),whole_
edon_hypocotyl(4),Small_excised_segments_of_primary_root_tissue_corresponding_to_root-hair_elongation(4),root(

nts_seedling(1),whole_seedlings(2),cotyledon_hypocotyl(4),Small_excised_segments_of_primary_root_tissue_corre
nts_seedling(1),whole_seedlings(2),cotyledon_hypocotyl(4),Small_excised_segments_of_primary_root_tissue_corre
nts_seedling(1),whole_seedlings(2),cotyledon_hypocotyl(4),Small_excised_segments_of_primary_root_tissue_corre

ng_to_root-hair_elongation(2),whole_seedlings(3),root(4),whole_plant(4)
ng_to_root-hair_elongation(2),whole_seedlings(3),root(4),whole_plant(4)
ular_leaf_rosette(2),flower(6),seed(9)
ular_leaf_rosette(2),flower(6),seed(9)

ed_segments_of_primary_root_tissue_corresponding_to_root-hair_elongation(4)
cence_stem_tip(2),shoot_apex_rosette_stage(2),globular_embryo(3),flower(13)
cence_stem_tip(2),shoot_apex_rosette_stage(2),globular_embryo(3),flower(13)

Small_excised_segments_of_primary_root_tissue_corresponding_to_root-hair_elongation(4),root(11)
 ),flower(8)
en(5),root(5)
 ue_corresponding_to_root-hair_elongation(3),root(4),seedlings(4),whole_seedlings(5)
aves(3),internodeshoot(3),inflorescence_stem_base(4),stem(4)




ryo(2),stem(2),torpedo_embryo(2),cotyledon_hypocotyl(4)
(3),Small_excised_segments_of_primary_root_tissue_corresponding_to_root-hair_elongation(4),whole_plant(4),root
 tem_base(3),stamen(3),torpedo_embryo(3)
_corresponding_to_root-hair_elongation(2),whole_plant(2),whole_seedlings(2),root(4)
_corresponding_to_root-hair_elongation(2),whole_plant(2),whole_seedlings(2),root(4)




scence(2),root(2),shoot(2),Whole_leaf_Age(3),vascular_leaf_late_rosette(4),pollen(5)
amen(3),pollen(7),flower(11)
ng_to_root-hair_elongation(2),whole_plant(2),root(5),seedlings(5),whole_seedlings(6)
oot(3),Whole_leaf_Age(4),vascular_leaf_late_rosette(8),flower(11)
of_primary_root_tissue_corresponding_to_root-hair_elongation(4),root(7)
ot(1),vascular_leaf_rosette(1),whole_above_ground_rosettes(1),Cell(3),senescence_leaf(3),seed(6),flower(14)
 on(3),stamen(3),torpedo_embryo(3)
 on(3),stamen(3),torpedo_embryo(3)
 on(3),stamen(3),torpedo_embryo(3)
 on(3),stamen(3),torpedo_embryo(3)




,vascular_leaf_rosette(2),senescence_leaf(3),vascular_leaf_late_rosette(3)
hoot_apex(3),shoot_apex_rosette_stage(3),stamen(3),flower(8)
_Age(2),vascular_leaf_late_rosette(10)


ed_Cell(2),shoot(2),vascular_leaf_rosette(2),flower(3),pollen(3),senescence_leaf(3),vascular_leaf_late_rosette(4),se
ot_tissue_corresponding_to_root-hair_elongation(2),whole_seedlings(3),whole_plant(5),root(8)
  s_seedling(2),whole_seedlings(2),cotyledon_hypocotyl(4),Small_excised_segments_of_primary_root_tissue_corresp
 ,root(1),unshaded_mature_rosette_leaves(1),Whole_leaf_Age(1),seedlings(2),vascular_leaf_rosette(2),whole_seedli
cence_leaf(3),cell_culture(5)
 s_of_primary_root_tissue_corresponding_to_root-hair_elongation(1),whole_leaves(1),whole_plant(2),Programmed_C
 s_of_primary_root_tissue_corresponding_to_root-hair_elongation(1),whole_leaves(1),whole_plant(2),Programmed_C
plants_seedling(1),whole_seedlings(1),shoot_system_seedling(2),total_tissue(2),leafshoot_apex(3),shoot_apex_rose
 e(1),globular_embryo(2),shoot_apex_rosette_stage(3),flower(12)

 cotyl(3),seed(3),shoot_apex_rosette_stage(3),vascular_leaf_rosette(3),Whole_leaf_Age(3),flower(10)
d_segments_of_primary_root_tissue_corresponding_to_root-hair_elongation(1),total_roots(1),inflorescence_stem_tip
m_tip(3),stamen(3),pollen(6)
ue_corresponding_to_root-hair_elongation(2),whole_plant(6),root(7)
_leaf(3),Small_excised_segments_of_primary_root_tissue_corresponding_to_root-hair_elongation(3)
ove_ground_rosettes(1),Programmed_Cell(2),flower(3),senescence_leaf(3),vascular_leaf_late_rosette(6),seed(7)
 1),Old_Flower_Buds(1),seed_germination(1),walking-stick_seed(1),cell_culture(2),internodeshoot(3),sepal(3),torped

don(3),flower_stamen(3),torpedo_embryo(3),flower(6)




_corresponding_to_root-hair_elongation(2),whole_plant(2),whole_seedlings(3),root(6)
_corresponding_to_root-hair_elongation(2),whole_plant(2),whole_seedlings(3),root(6)
 obular_embryo(3),seed(6),flower(11)
ants_seedling(3),Small_excised_segments_of_primary_root_tissue_corresponding_to_root-hair_elongation(4),whole_
oot_tissue_corresponding_to_root-hair_elongation(4),whole_plant(4),whole_seedlings(4),root(9)
nodeshoot(3),petiole(3),stem(3),cotyledon_hypocotyl(4),root(5)
nescence_leaf(3),vascular_leaf_rosette(3)


_hypocotyl(4)

shoot_system_seedling(2),leafshoot_apex(3),shoot_apex_rosette_stage(3),flower(7)




air_elongation(4),whole_plant(4),whole_seedlings(4),root(8)
 _tissue_corresponding_to_root-hair_elongation(4),whole_plant(4),root(11)
_seedling(1),whole_seedlings(1),seedlings(2),leafshoot_apex(3),shoot_apex_rosette_stage(3),root(7),flower(8)




_elongation(1),vascular_leaf_late_rosette(1),whole_above_ground_rosettes(1),Whole_leaf_Age(1),inflorescence_ste
4),whole_seedlings(5)
ette(9),flower(11)




_seedlings(2),root(16)


nding_to_root-hair_elongation(3),vascular_leaf_late_rosette(4),seed(7)




te(4),shoot(5),flower(11)
tion(4),seed(5)


ge(2),cotyledon_hypocotyl(4),seed_germination(4),seed(6)

se(4),root(10)
pedo_embryo(3),whole_plants_seedling(3)
-hair_elongation(4),root(13)

imary_root_tissue_corresponding_to_root-hair_elongation(4),root(7)
imary_root_tissue_corresponding_to_root-hair_elongation(4),root(7)
imary_root_tissue_corresponding_to_root-hair_elongation(4),root(7)




n(4),whole_plant(4),root(5),seedlings(6),whole_seedlings(6)
seed(6),flower(14)




 _leaf_late_rosette(4),seed(6)

mary_root_tissue_corresponding_to_root-hair_elongation(4),root(8)
 _rosette(2),whole_seedlings(2),flower(3),senescence_leaf(3),vascular_leaf_late_rosette(3),shoot(4)

 _plant(2),Programmed_Cell(3),pollen(4)
 _plant(2),Programmed_Cell(3),pollen(4)
apex(3),shoot_apex_rosette_stage(3),flower(7)




1),inflorescence_stem_tip(2),Tumour(2),Guard_Cell_enriched_leaves(3),internodeshoot(3),inflorescence_stem_base(
e_rosette(6),seed(7)
shoot(3),sepal(3),torpedo_embryo(3),seed(8)




air_elongation(4),whole_seedlings(6),root(11)
3),root(7),flower(8)




Age(1),inflorescence_stem_base(2),stem(2),Cell(3),pollen(4),whole_seedlings(4)
nflorescence_stem_base(4),stem(4)
Experimental conditions of co-expression modules

Column # in the data matrix
Co-expression module ID starting with 2
COL64
COL65
COL66
COL67
COL320
COL321
COL322
COL323
COL324
COL325
Co-expression module ID starting with 3
COL61
COL62
COL63
COL108
COL109
COL110
COL187

COL188

COL189

COL190

COL191

COL192
COL256
COL259
COL261

COL262

COL263
COL293
COL294
COL297
COL298
COL346
COL347
Co-expression module ID starting with 4
COL55
COL56
COL57
COL64
COL65
COL66
COL67
COL127
COL128
COL129
COL156

COL157
COL158
COL159
COL184

COL221


COL281


COL282
COL299
COL305
COL307


COL312


COL322
COL323
COL325
COL343
Co-expression module ID starting with 14
COL58
COL59
COL60
COL93
COL94
COL95
COL135

COL138

COL165

COL166

COL167
COL216
COL230

COL231
COL242
COL243
COL252

COL273

COL275
COL299
COL335
Co-expression module ID starting with 15
COL115
COL116
COL117
COL122
COL123
COL124
COL125
COL257
COL258
COL259
COL294
COL295
COL296
COL301
COL302
COL304
COL344
COL346
Co-expression module ID starting with 16
COL11
COL126
COL127
COL128
COL129
COL156

COL157
COL158
COL159
COL221
COL256
COL257
COL258
COL259
COL293
COL294
COL297
COL306


COL312




COL313


COL346
COL347
Co-expression module ID starting with 18
COL4
COL10
COL11
COL27
COL58
COL59
COL60
COL61
COL62
COL63
COL71
COL73
COL93
COL94
COL95
COL125
COL156

COL157
COL158
COL159
COL172
COL303
COL304
COL332
COL335
COL346
Co-expression module ID starting with 19
COL85
COL86
COL87
COL99
COL100
COL101
COL108
COL109
COL110
COL111
COL112
COL113
COL349
Co-expression module ID starting with 20
COL13
COL14
COL31
COL32
COL35
COL41
COL55
COL67
COL68
COL69
COL70
COL74
COL75
COL76
COL77
COL88
COL105
COL106
COL107
COL178
COL202
COL213
COL223
COL253
COL254
COL255
COL292
Co-expression module ID starting with 40
COL74
COL75
COL76
COL77
COL78
COL88
COL102
COL103
COL104
COL105
COL178
COL253
COL255
Co-expression module ID starting with 41
COL126
COL127
COL209
COL210
COL212
COL276
COL277
COL278
COL279

COL280
COL282


COL313


Co-expression module ID starting with 42
COL126
COL127
COL128
COL129
COL156

COL157
COL158
COL159
COL221

COL262

COL263

COL267


COL281


COL343
Co-expression module ID starting with 44
COL4
COL11
COL126
COL127
COL128
COL129
COL156

COL157
COL158
COL159
COL211
COL212
COL218


COL220


COL221
COL276
COL278
COL343
Co-expression module ID starting with 46
COL74
COL75
COL76
COL77
COL78
COL102
COL104
COL161
COL162

COL163
COL197
COL253
COL254
COL315
COL316
COL319
COL349

COL350

COL351

COL352
Co-expression module ID starting with 52
COL75
COL76
COL77
COL85
COL86
COL87
COL108
COL109
COL110
COL187

COL188

COL189

COL190

COL191

COL192
Co-expression module ID starting with 61
COL3
COL4
COL11
COL38
COL40
COL126
COL127
COL195

COL221

COL223

COL224
COL242
COL243
COL244
COL267

COL279

COL280


COL281
COL282
COL285
COL286
COL287

COL289

COL291

COL292


COL312




COL313


COL343
Co-expression module ID starting with 64
COL4
COL11
COL50
COL51
COL128
COL129
COL211
COL212
COL213

COL218


COL220


COL279

COL280

COL282
Co-expression module ID starting with 65
COL118
COL119
COL120
COL121
COL122
COL123
COL124
COL125
COL257
COL258
COL262

COL263
COL296
COL300
COL301
COL302
COL303
COL344
Co-expression module ID starting with 67
COL27
COL58
COL59
COL60
COL61
COL62
COL63
COL93
COL94
COL95
COL296
COL301
COL302
COL303
COL304
Co-expression module ID starting with 68
COL136

COL137
COL182
COL203
COL204
COL233
COL234

COL235

COL236

COL237

COL238
COL242
COL243
COL252
COL268
COL269
COL270
COL271
COL337
COL339
COL340
Co-expression module ID starting with 74
COL3
COL4
COL10
COL11
COL38
COL73
COL126
COL127
COL128
COL129
COL195

COL196
COL216
COL221

COL223

COL224
COL244
COL261

COL262

COL267

COL279

COL280


COL281


COL282

COL291

COL292


COL312




COL313


COL343
Co-expression module ID starting with 77
COL3
COL4
COL10
COL11
COL32
COL41
COL55
COL67
COL68
COL69
COL70
COL74
COL75
COL76
COL77
COL88
COL89
COL105
COL106
COL107
COL128
COL129
COL178
COL212
COL213

COL220


COL221

COL223
COL253
COL254
COL255
COL292
COL343
COL349

COL351
Co-expression module ID starting with 81
COL11
COL127
COL128
COL129
COL156

COL157
COL158
COL159
COL221


COL312


COL343
Co-expression module ID starting with 85
COL109
COL134

COL164

COL189

COL193
COL194
COL223

COL226

COL229

COL232

COL275
COL276
COL277
COL280


COL312


COL320
COL321
COL322
COL324
COL335
COL339
COL341
COL342
Co-expression module ID starting with 86
COL164

COL187

COL188
COL190

COL191

COL227

COL228

COL229

COL247
COL254
COL255
COL256
COL257
COL258
COL259
COL266
COL283
COL284
COL327
COL346
Co-expression module ID starting with 87
COL27
COL71
COL72
COL73
COL74
COL75
COL76
COL77
COL78
COL93
COL94
COL95
COL102
COL103
COL104
COL130

COL135
COL136

COL137

COL139

COL140

COL149

COL153

COL154

COL165

COL166

COL167
COL178
COL230

COL231
COL253
COL254
COL255
COL272

COL273

COL274

COL275
COL339
COL340
Co-expression module ID starting with 92
COL74
COL75
COL76
COL77
COL161
COL163
COL197
COL198
COL200
COL316
COL326

COL327
Co-expression module ID starting with 96
COL79
COL80
COL81
COL82
COL83
COL84
COL85
COL86
COL87
COL93
COL94
COL95
COL96
COL97
COL98
COL99
COL100
COL101
COL102
COL103
COL104
COL108
COL109
COL110

COL160

COL161
COL189

COL192

COL193
COL194
COL200
COL349
Co-expression module ID starting with 99
COL46
COL47
COL58
COL59
COL60
COL93
COL94
COL95
COL203
COL238
COL295
COL296
COL301
COL302
COL303
COL304
COL335
Co-expression module ID starting with 101
COL88
COL102
COL103
COL104
COL111
COL112
COL113
COL114
COL115
COL116
COL117
COL118
COL119
COL120
Co-expression module ID starting with 102
COL170
COL171
COL179
COL180
COL181
COL182
COL233

COL234

COL236

COL237
COL268
COL269
COL270
COL271
COL328
COL330
COL331
COL333
COL334
Co-expression module ID starting with 108

COL160


COL193
COL194
COL198
COL200
COL228

COL249

COL261

COL267
COL300
COL323
Co-expression module ID starting with 109
COL79
COL80
COL81
COL109
COL110
COL187
COL188

COL189

COL190

COL191

COL192

COL193
COL197
COL198
COL262

COL263

COL266

COL349

COL350
Co-expression module ID starting with 111
COL3
COL4
COL10
COL11
COL17
COL20
COL23
COL26
COL37
COL38
COL126
COL127
COL128
COL129
COL221

COL223

COL224
COL242
COL243
COL279

COL280

COL287

COL289


COL312




COL313


COL343
Co-expression module ID starting with 119
COL64
COL65
COL66
COL67
COL221
COL299
COL306
COL318
COL320
COL321
COL322
COL323
COL343
Co-expression module ID starting with 121
COL44
COL45
COL46
COL47
COL68
COL69
COL70
COL74
COL109
COL110
COL194


COL313


COL346
COL347
Co-expression module ID starting with 124
COL41
COL137

COL139

COL148
COL150
COL212
COL247

COL251
COL257
COL258
COL259
COL279


COL281


COL282
COL295
COL296
COL301
COL302
COL303
COL304
COL346
Co-expression module ID starting with 125
COL79
COL80
COL81
COL89
COL90
COL91
COL96
COL97
COL98
COL99
COL100
COL101
COL177
COL239
COL240
COL241
Co-expression module ID starting with 128
COL102
COL103
COL104
COL178
COL180
COL181
COL182
COL197
COL236

COL237
COL253
COL255
COL315
COL316
COL330
COL331
COL333
COL334
COL338
COL341
COL342
Co-expression module ID starting with 131
COL21
COL22
COL24
COL46
COL47
COL67
COL68
COL69
COL70
COL72
COL73
COL74
COL75
COL76
COL77
COL78
COL82
COL83
COL84
COL88
COL102
COL103
COL104
COL111
COL113
COL130

COL140

COL149

COL153

COL165
COL178
COL255
Co-expression module ID starting with 140
COL21
COL22
COL71
COL72
COL73
COL74
COL75
COL76
COL77
COL78
COL88
COL102
COL103
COL104
COL135

COL136

COL137

COL139

COL140

COL149

COL153
COL178
COL253
COL254
COL255
Co-expression module ID starting with 141
COL85
COL86
COL87
COL93
COL94
COL95
COL96
COL97
COL98
COL99
COL100
COL101
COL102
COL103
COL104
COL108
COL109
COL110

COL160

COL161
COL189

COL192
COL193
COL194
COL197
COL199
COL200
Co-expression module ID starting with 144
COL4
COL11
COL71
COL72
COL73
COL127
COL128
COL129
COL211
COL212
COL213

COL218


COL220


COL260
COL276
COL278
COL279

COL280
Co-expression module ID starting with 147
COL89
COL90
COL91
COL99
COL100
COL101
COL108
COL109
COL110
COL111
COL112
COL113
COL192

COL193
COL194
Co-expression module ID starting with 149
COL118
COL119
COL120
COL126
COL127
COL156

COL157
COL158
COL159
COL221

COL261

COL262

COL263
COL343
COL345
Co-expression module ID starting with 153
COL4
COL40
COL42
COL126
COL127
COL128
COL129
COL221
COL276
COL278
COL282
COL343
Co-expression module ID starting with 154
COL108
COL109
COL110
COL187

COL188

COL189

COL190

COL191

COL192

COL193
COL194
COL295
COL296
COL301
COL302
COL303
COL304
Co-expression module ID starting with 155
COL77
COL85
COL86
COL87
COL108
COL109
COL110
COL187

COL188

COL189

COL190

COL191

COL192

COL193
Co-expression module ID starting with 156
COL21
COL46
COL47
COL68
COL69
COL70
COL71
COL72
COL73
COL74
COL75
COL76
COL77
COL82
COL83
COL84
COL88
COL102
COL103
COL104
COL111
COL112
COL113
COL135

COL136

COL137

COL139

COL140

COL149


COL160

COL178
COL253
COL254
COL255
Co-expression module ID starting with 166
COL117
COL118
COL119
COL120
COL121
COL122
COL124
COL180
COL181
COL182
COL236
COL256
COL257
COL258
COL259
COL296
COL301
COL302
COL304
COL320
COL346
Co-expression module ID starting with 167
COL67
COL71
COL72
COL73
COL74
COL75
COL76
COL77
COL88
COL178
COL199
COL253
COL254
COL255
COL293
COL294
COL297
COL298
COL315
COL316
Co-expression module ID starting with 173
COL103
COL108
COL110
COL136

COL137

COL139

COL140

COL145

COL187

COL188

COL190

COL191
COL199
COL272

COL273

COL274
COL305
COL318
COL326
Co-expression module ID starting with 176
COL69
COL156

COL157
COL158
COL159
COL176
COL254
COL255
COL256
COL257
COL258
COL259
COL281


COL295
COL296
COL301
COL302
COL335
COL346
COL347
Co-expression module ID starting with 177
COL3
COL4
COL10
COL11
COL17
COL38
COL50
COL126
COL127
COL128
COL129
COL221

COL223

COL224

COL279

COL280


COL281


COL282
COL286


COL312
COL313


COL343
Co-expression module ID starting with 178
COL3
COL10
COL17
COL23
COL25
COL29
COL30
COL37
COL50
COL51
COL64
COL65
COL66
COL67
COL277
COL280
COL317
COL318
COL320
COL321
Co-expression module ID starting with 181
COL108
COL187

COL188

COL189

COL190

COL191

COL192

COL193
COL256
COL257
COL258
COL259
COL295
COL296
COL301
COL302
COL303
COL304
COL346
COL347
Co-expression module ID starting with 183
COL168
COL169
COL170
COL171
COL172
COL173
COL179
COL187
COL256
COL257
COL258
COL259
COL293
COL294
COL297
COL298
COL346
COL347
Co-expression module ID starting with 184
COL3
COL4
COL10
COL11
COL20
COL23
COL25
COL26
COL29
COL30
COL37
COL126
COL127
COL128
COL221


COL312


COL343
Co-expression module ID starting with 185
COL68
COL69
COL70
COL71
COL127
COL156

COL157
COL158
COL159
COL178
COL221


COL312


COL343
Co-expression module ID starting with 186
COL78
COL85
COL86
COL87
COL108
COL109
COL110
COL188

COL189

COL191

COL192

COL193
COL194
COL349
Co-expression module ID starting with 192
COL182
COL235

COL236

COL238
COL239
COL240
COL241
COL337
COL338
COL339
COL340
COL341
COL342
Co-expression module ID starting with 200
COL37
COL40
COL109
COL126
COL127
COL128
COL129
COL189

COL192

COL193
COL194
COL221
COL242
COL243
COL265

COL279

COL280
COL281


COL282


COL312


COL343
Co-expression module ID starting with 207
COL55
COL56
COL57
COL71
COL72
COL73
COL82
COL83
COL84
COL88
COL102
COL103
COL104
COL105
COL106
COL107
COL111
COL112
COL211
Co-expression module ID starting with 208
COL55
COL57
COL64
COL65
COL66
COL67
COL71
COL72
COL73


COL281
COL317
COL321
Co-expression module ID starting with 209
COL85
COL86
COL87
COL108
COL109
COL136

COL137

COL189

COL192
COL194
COL210
COL247

COL250

COL263

COL265
Co-expression module ID starting with 211
COL39
COL41
COL42
COL71
COL72
COL73
COL118
COL119
COL120
COL121
COL122
COL123
COL124
COL125
COL126
COL127
COL195
COL214

COL218


COL289
COL299


COL312


Co-expression module ID starting with 218
COL3
COL4
COL10
COL11
COL17
COL18
COL38
COL126
COL127
COL128
COL129
COL156

COL157
COL158
COL159
COL221
COL242
COL243
COL279

COL280


COL281


COL282

COL291
COL292


COL312




COL313


COL343
Co-expression module ID starting with 219
COL168
COL169
COL170
COL171
COL172
COL173
COL188
COL256
COL257
COL258
COL259
COL293
COL294
COL295
COL296
COL297
COL301
COL302
COL303
COL304
COL328
COL332
COL346
COL347
Co-expression module ID starting with 225
COL4
COL11
COL38
COL126
COL127
COL128
COL129
COL156

COL157
COL158
COL159
COL196

COL221

COL223

COL224

COL279

COL280


COL281


COL282

COL289

COL291
COL343
Co-expression module ID starting with 228
COL108
COL109
COL110
COL136

COL137

COL139

COL140

COL188

COL189
COL190

COL191
COL194
COL295
COL296
Co-expression module ID starting with 229
COL11
COL128
COL129

COL218


COL220


COL221

COL260

COL265
COL276
COL277
COL278
COL279

COL280
COL343
Co-expression module ID starting with 230
COL25
COL26
COL93
COL94
COL95
COL96
COL97
COL98
COL123
COL125
COL165
COL166
COL293
COL294
COL295
COL296
COL297
COL298
COL301
COL302
COL307
COL347
Co-expression module ID starting with 231
COL108
COL109
COL110
COL192

COL193
COL194
COL256
COL258
COL259
COL295
COL296
COL301
COL302
COL335
Co-expression module ID starting with 236
COL126
COL127
COL193
COL211
COL212
COL216
COL221
COL276
COL278
COL279

COL280
COL281


COL282


COL312




COL313


Co-expression module ID starting with 238
COL68
COL69
COL70
COL74
COL75
COL76
COL77
COL78
COL88
COL102
COL103
COL104
COL111
COL112
COL113
COL161
COL197
COL199
COL253
COL254
COL315
COL319
COL349

COL351
Co-expression module ID starting with 244
COL85
COL86
COL87
COL89
COL90
COL91
COL99
COL100
COL101
COL108
COL109
COL110
COL111
COL112
COL113
COL189

COL192

COL193
COL194
COL197
COL198
COL199
Co-expression module ID starting with 248
COL3
COL4
COL10
COL11
COL38
COL126
COL127
COL128
COL129
COL221

COL223

COL279

COL280


COL281
COL282

COL292


COL312




COL313


COL343
Co-expression module ID starting with 249
COL75
COL76
COL77
COL78
COL85
COL86
COL87

COL160

COL161
COL162

COL163
COL197
COL198
COL199
COL200
COL315
COL316
COL319
COL352
Co-expression module ID starting with 251
COL11
COL27
COL126
COL127
COL128
COL129
COL188

COL190

COL191

COL192
COL194
COL221
COL295
COL303
COL304
COL327
COL346
COL352
Co-expression module ID starting with 254
COL126
COL127
COL211
COL212
COL213
COL216

COL218


COL220


COL221

COL228

COL229
COL276
COL277
COL278
COL279

COL280
COL281




COL312


COL343
Co-expression module ID starting with 261
COL64
COL65
COL66
COL67
COL248

COL249

COL250
COL305
COL315
COL316
COL317
COL318
COL320
COL321
COL322
COL323
COL324
COL325
Co-expression module ID starting with 265
COL126
COL127
COL128
COL129
COL156

COL157
COL158
COL159
COL221
COL287

COL289
COL343
Co-expression module ID starting with 271
COL67
COL114
COL115
COL117
COL118
COL119
COL156

COL157
COL158
COL159
COL248
COL324
COL325
Co-expression module ID starting with 275
COL38
COL40
COL41
COL126
COL127
COL195

COL196
COL212
COL213
COL214
COL216
COL221

COL223

COL224
COL242
COL243
COL244
COL266
COL276
COL278
COL279

COL280


COL281


COL282
COL285
COL286
COL287

COL289

COL291

COL292


COL312




COL313


COL343
Co-expression module ID starting with 278
COL85
COL86
COL87
COL118
COL119
COL120
COL122
COL123
COL124
COL125
COL317
COL320
COL321
COL324
Co-expression module ID starting with 279
COL126
COL127
COL211
COL212

COL218


COL220


COL221
COL276
COL278
COL279

COL280


COL312


COL343
Co-expression module ID starting with 286
COL126
COL127
COL213

COL218


COL220


COL221
COL276
COL278


COL312
COL313


COL343
Co-expression module ID starting with 293
COL23
COL25
COL27
COL108
COL109
COL110
COL149

COL177

COL189

COL192

COL193
COL194
COL295
COL296
COL301
COL302
COL303
COL304
Co-expression module ID starting with 294
COL23
COL37
COL48
COL49
COL65
COL70
COL136

COL137

COL139

COL140
COL160

COL161
COL187

COL188

COL189

COL190

COL191
COL199
COL272

COL273

COL274

COL326

COL348
Co-expression module ID starting with 295
COL79
COL80
COL81
COL82
COL83
COL84
COL85
COL86
COL87
COL93
COL94
COL95
COL96
COL97
COL98
COL99
COL100
COL101
COL102
COL103
COL104
COL108
COL109
COL110

COL160

COL161
COL189

COL192

COL193
COL194
COL199
COL200
COL349
Co-expression module ID starting with 303
COL11
COL37
COL126
COL127
COL209
COL210
COL211
COL212
COL213

COL218


COL220


COL221

COL227

COL228

COL229
COL276
COL277
COL278
COL279

COL280
COL343
Co-expression module ID starting with 308
COL21
COL22
COL27
COL71
COL72
COL73
COL74
COL75
COL76
COL77
COL78
COL88
COL93
COL94
COL95
COL102
COL103
COL104
COL130

COL135

COL136

COL137

COL139

COL140

COL149

COL153

COL165
COL167

COL230

COL231

COL272

COL273

COL274

COL275
COL339
COL340
Co-expression module ID starting with 309
COL11
COL33
COL126
COL127
COL129

COL219


COL221

COL261

COL266
COL276
COL277
COL278
COL279

COL280


COL281


COL282
COL312


COL343
Co-expression module ID starting with 312
COL122
COL123
COL124
COL125
COL256
COL257
COL258
COL259
COL295
COL296
COL301
COL302
COL304
COL346
Co-expression module ID starting with 318
COL68
COL69
COL70
COL74
COL75
COL76
COL77
COL88
COL102
COL103
COL104

COL160

COL161
COL162

COL247

COL248

COL250
COL326

COL327
Co-expression module ID starting with 323
COL68
COL69
COL70
COL74
COL75
COL76
COL77
COL78
COL102
COL103
COL104
COL197
COL349

COL350

COL351

COL352
Co-expression module ID starting with 334
COL22
COL58
COL59
COL60
COL68
COL69
COL70
COL74
COL75
COL76
COL77
COL78
COL88
COL93
COL94
COL95
COL102
COL103
COL104
COL167


COL225


COL238
COL295
COL296
COL301
COL302
COL303
COL304
COL329
COL335
COL337
COL339
COL340
Co-expression module ID starting with 335
COL85
COL86
COL87
COL117
COL118
COL119
COL120
COL122
COL123
COL124
COL125
COL192
Co-expression module ID starting with 337
COL3
COL4
COL10
COL11
COL17
COL18
COL20
COL23
COL25
COL26
COL126
COL127
COL221


COL312




COL313


COL343
Co-expression module ID starting with 338
COL58
COL59
COL60
COL132

COL133

COL134

COL166

COL167
COL194
COL235

COL238

COL275
COL335
Co-expression module ID starting with 339
COL68
COL69
COL70
COL74
COL75
COL76
COL77
COL78
COL82
COL83
COL85
COL86
COL87
COL88
COL105
COL106
COL107
COL178
COL253
COL254
COL255
COL256
COL257
COL293
COL297
Co-expression module ID starting with 342
COL6

COL8

COL136

COL137

COL139

COL140
COL147
COL148
COL150
COL151

COL153

COL154
COL202
COL208

COL219


COL273
COL274
Co-expression module ID starting with 343
COL85
COL86
COL87
COL89
COL90
COL91
COL99
COL100
COL101
COL108
COL109
COL110
COL111
COL112
COL113
COL189

COL192

COL193
COL194
COL197
COL198
COL199
Co-expression module ID starting with 345
COL4
COL10
COL11
COL18
COL71
COL72
COL73
COL126
COL128
COL129
COL156

COL157
COL158
COL159
COL221
COL295
COL296
COL301
COL302
COL303
COL304


COL312


COL346
Co-expression module ID starting with 348
COL46
COL47
COL58
COL59
COL60
COL93
COL94
COL95
COL108
COL131

COL132

COL133

COL134

COL166

COL167

COL189

COL192
COL203
COL204
COL235

COL238
COL275
COL295
COL296
COL301
COL302
COL303
COL304
COL335
Co-expression module ID starting with 349
COL3
COL4
COL10
COL11
COL37
COL128
COL129
COL214
COL216

COL218


COL220


COL221

COL260

COL264

COL265
COL276
COL277
COL278
COL279

COL280
COL343
COL345
Co-expression module ID starting with 362
COL4
COL11
COL38
COL41
COL71
COL126
COL127
COL128
COL129
COL156

COL157
COL158
COL159
COL195

COL196

COL221

COL223

COL224

COL279

COL280


COL281


COL282

COL287

COL289


COL312


COL343
Co-expression module ID starting with 364
COL14
COL15
COL16
COL46
COL47
COL58
COL59
COL60
COL93
COL94
COL95
COL132

COL133

COL134

COL166

COL167
COL203
COL238

COL275
COL283
COL284
COL288

COL290

COL311
COL314
COL335
Co-expression module ID starting with 365
COL27
COL29
COL30
COL46
COL58
COL59
COL60
COL165
COL179
COL180
COL234

COL236
COL330
COL331
COL334
COL338
COL341
COL342
Co-expression module ID starting with 368
COL110
COL192

COL193
COL194
COL201

COL234

COL235

COL237

COL251

COL260

COL267

COL280
COL299
COL335
Co-expression module ID starting with 377
COL31
COL32
COL35
COL41
COL67
COL68
COL69
COL70
COL74
COL75
COL76
COL77
COL88
COL105
COL106
COL107
COL178
COL213
COL223
COL253
COL254
COL255
COL291

COL292
Co-expression module ID starting with 379
COL68
COL69
COL70
COL74
COL75
COL76
COL77
COL78
COL88
COL102
COL103
COL104
COL111
COL112
COL161
COL178
COL199
COL249
COL253
COL254
COL255
Co-expression module ID starting with 380
COL71
COL72
COL73
COL128
COL129
COL179
COL182
COL233

COL235

COL236

COL237
COL268
COL269
COL270
COL271
COL325
COL333
COL334
COL339
Co-expression module ID starting with 383
COL27
COL71
COL72
COL73
COL75
COL76
COL77
COL78
COL88
COL93
COL94
COL95
COL102
COL103
COL104
COL133

COL153

COL165

COL166
COL167
COL178
COL253
COL254
COL255
COL272

COL273

COL275
COL296
COL301
COL304
Co-expression module ID starting with 384
COL57
COL64
COL65
COL66
COL67
COL184

COL221

COL248

COL249

COL250


COL281


COL299
COL305
COL307
COL315
COL316
COL317
COL318
COL320
COL321
COL322
COL323
COL324
COL325
COL343
Co-expression module ID starting with 385
COL76
COL85
COL86
COL87
COL108
COL109
COL110
COL189

COL192
COL194
COL315
COL316
COL319
COL348

COL352
Co-expression module ID starting with 387
COL3
COL4
COL10
COL11
COL17
COL126
COL177

COL221
COL239
COL240
COL241
COL242
COL243


COL281
COL282

COL291
COL343
Co-expression module ID starting with 388
COL3
COL4
COL10
COL11
COL17
COL20
COL23
COL25
COL26
COL37
COL50
COL156

COL157
COL158
COL159
COL221


COL312


COL343
Co-expression module ID starting with 393
COL58
COL59
COL60
COL64
COL65
COL66
COL89
COL90
COL91
COL126
COL279

COL280
COL282
COL318
Co-expression module ID starting with 395
COL58
COL59
COL60
COL93
COL94
COL95
COL130

COL131

COL133

COL135

COL152

COL154

COL166
COL173

COL225


COL235

COL238
COL295
COL296
COL301
COL302
COL303
COL304
COL335
COL346
Co-expression module ID starting with 397
COL64
COL65
COL66
COL67
COL79
COL80
COL81
COL92
COL118
COL119
COL120
COL121
COL124
COL168
COL169
COL258
COL293
COL294
COL295
COL296
COL297
COL298
COL303
COL304
COL320
COL351
Co-expression module ID starting with 398
COL227

COL228

COL260

COL261

COL262

COL263

COL265

COL266

COL267
COL293
COL297
COL298
COL347
Co-expression module ID starting with 399
COL20
COL23
COL93
COL94
COL95
COL96
COL97
COL98
COL99
COL100
COL101
COL118
COL119
COL120
COL121
COL122
COL123
COL124
COL125
Co-expression module ID starting with 401
COL3
COL4
COL10
COL11
COL17
COL20
COL23
COL25
COL26
COL29
COL30
COL37
COL126
COL127
COL221


COL312
COL313


COL343
Co-expression module ID starting with 405
COL4
COL11
COL126
COL127
COL211
COL212

COL218


COL220


COL221
COL276
COL277
COL278
COL279

COL280


COL312


COL343
Co-expression module ID starting with 407
COL22
COL46
COL68
COL69
COL70
COL74
COL75
COL76
COL77
COL78
COL88
COL102
COL103
COL104
COL111
COL112
COL113
COL255
COL295
COL296
COL301
COL302
COL303
COL304
COL335
Co-expression module ID starting with 411
COL3
COL10
COL11
COL33
COL38
COL39
COL40
COL126
COL127
COL128
COL129
COL195

COL196
COL211
COL212
COL216

COL217


COL219


COL221

COL227

COL228
COL229

COL265
COL276
COL277
COL278
COL279

COL280


COL281


COL282


COL312




COL313


COL343
Co-expression module ID starting with 415
COL3
COL4
COL10
COL11
COL126
COL127
COL128
COL129
COL156

COL157
COL158
COL159
COL214
COL215
COL219


COL223

COL224

COL261

COL266

COL267
COL276
COL278
COL279

COL280


COL281


COL282


COL312
CEL files


ATGE_27_A.CEL
ATGE_27_B.CEL
ATGE_27_C.CEL
ATGE_28_A2.CEL
ST001_ATH1_A7.WT.Base1.CEL
ST001_ATH1_A8.WT.Base2.CEL
STEM_GC7.cel
STEM_GC8.cel
STEM_GH7.cel
STEM_GH8.cel

ATGE_26_A.CEL
ATGE_26_B.CEL
ATGE_26_C.CEL
ATGE_73_A.CEL
ATGE_73_B.CEL
ATGE_73_C.CEL
DH001_ATH1_A1.UNM1.CEL

DH001_ATH1_A2.BCP1.CEL

DH001_ATH1_A3.TCP1.CEL

DH001_ATH1_A4.UNM2.CEL

DH001_ATH1_A5.BCP2.CEL

DH001_ATH1_A6.TCP2.CEL
Li_Control_3.1.cel
Li_Control_6.2.cel
MC001_ATH1_A10.Campb.326.CEL

MC001_ATH1_A11.Campb.327.CEL

MC001_ATH1_A12.Campb.328.new..CEL
Nakabayashi_ABA3.1.cel
Nakabayashi_ABA3.2.cel
Nakabayashi_Imb24.1.cel
Nakabayashi_Imb24.2.cel
Yamauchi_WT4CA.cel
Yamauchi_WT4CB.cel

ATGE_19_A.CEL
ATGE_19_B.CEL
ATGE_19_C.CEL
ATGE_27_A.CEL
ATGE_27_B.CEL
ATGE_27_C.CEL
ATGE_28_A2.CEL
ATGE_93_B.CEL
ATGE_9_A.CEL
ATGE_9_B.CEL
AtGen_D.10_1.FS_REP1_ATH1.CEL

AtGen_D.11_1.PS_REP1_ATH1.CEL
AtGen_D.12_1.RS_REP1_ATH1.CEL
AtGen_D.13_1.BS_REP1_ATH1.CEL
DB001_ATH1_A2.Brown.cal.CEL

HY001_ATH1_A1.Yap.AMF.CEL


MJ001_ATH1_A3.jones.rh1.CEL


MJ001_ATH1_A4.jones.rh2.CEL
PU001_ATH1_A1.Urwin.Con.CEL
RD001_ATH1_A1.deeke.tum.CEL
RD001_ATH1_A3.deeke.tum.CEL


SF001_ATH1_A4.Fille.ANGR4.12.dex.CEL


STEM_GC7.cel
STEM_GC8.cel
STEM_GH8.cel
YH001_ATH1_A2.Yap.AMF.CEL

ATGE_25_A.CEL
ATGE_25_B.CEL
ATGE_25_C.CEL
ATGE_41_A.CEL
ATGE_41_B.CEL
ATGE_41_C.CEL
AtGen_A.17_24.1_REP1_ATH1.CEL

AtGen_A.24_25.4_REP3_ATH1.CEL

Bc181.1.CEL

Bc482.1.CEL

Bc482.2.CEL
Goda_I_MJ3.2.CEL
JL001_ATH1_A1.LLOYD.POH.CEL

JL001_ATH1_A2.LLOYD.POH.CEL
Kiba2_28.CEL
Kiba2_29.CEL
LH001_ATH1_A8.Heggi.HEW.CEL

MG001_ATH1_A12.Torres.5N6.CEL

MG001_ATH1_A25.Torres.8N1.CEL
PU001_ATH1_A1.Urwin.Con.CEL
VB001_ATH1_A10.Bwoll.Col2.CEL

ATGE_77_E.CEL
ATGE_77_F.CEL
ATGE_78_D.CEL
ATGE_82_A.CEL
ATGE_82_B.CEL
ATGE_82_C.CEL
ATGE_83_A.CEL
Li_Control_3.2.cel
Li_Control_6.1.cel
Li_Control_6.2.cel
Nakabayashi_ABA3.2.cel
Nakabayashi_DS1.cel
Nakabayashi_DS2.cel
Preston_chip.1.dry.seed.CEL
Preston_chip.2.dry.seed.CEL
Preston_chip.6.3hr.imbibed.seed.CEL
Yamauchi_WT22CA.cel
Yamauchi_WT4CA.cel

X0122.CEL
ATGE_93_A.CEL
ATGE_93_B.CEL
ATGE_9_A.CEL
ATGE_9_B.CEL
AtGen_D.10_1.FS_REP1_ATH1.CEL

AtGen_D.11_1.PS_REP1_ATH1.CEL
AtGen_D.12_1.RS_REP1_ATH1.CEL
AtGen_D.13_1.BS_REP1_ATH1.CEL
HY001_ATH1_A1.Yap.AMF.CEL
Li_Control_3.1.cel
Li_Control_3.2.cel
Li_Control_6.1.cel
Li_Control_6.2.cel
Nakabayashi_ABA3.1.cel
Nakabayashi_ABA3.2.cel
Nakabayashi_Imb24.1.cel
RD001_ATH1_A2.deeke.Inf.CEL


SF001_ATH1_A4.Fille.ANGR4.12.dex.CEL




SF002_ATH1_A6.Fille.WT.dex.CEL


Yamauchi_WT4CA.cel
Yamauchi_WT4CB.cel

X0022.CEL
X0121.CEL
X0122.CEL
X2611.CEL
ATGE_25_A.CEL
ATGE_25_B.CEL
ATGE_25_C.CEL
ATGE_26_A.CEL
ATGE_26_B.CEL
ATGE_26_C.CEL
ATGE_2_A.CEL
ATGE_2_C.CEL
ATGE_41_A.CEL
ATGE_41_B.CEL
ATGE_41_C.CEL
ATGE_83_A.CEL
AtGen_D.10_1.FS_REP1_ATH1.CEL

AtGen_D.11_1.PS_REP1_ATH1.CEL
AtGen_D.12_1.RS_REP1_ATH1.CEL
AtGen_D.13_1.BS_REP1_ATH1.CEL
C7_1.CEL
Preston_chip.5.3hr.imbibed.seed.CEL
Preston_chip.6.3hr.imbibed.seed.CEL
T2.aph..MM2d...CEL
VB001_ATH1_A10.Bwoll.Col2.CEL
Yamauchi_WT4CA.cel

ATGE_36_A.CEL
ATGE_36_B.CEL
ATGE_36_C.CEL
ATGE_43_A.CEL
ATGE_43_B.CEL
ATGE_43_C.CEL
ATGE_73_A.CEL
ATGE_73_B.CEL
ATGE_73_C.CEL
ATGE_76_A.CEL
ATGE_76_B.CEL
ATGE_76_C.CEL
ZW001_ATH1_A2.Wilson.mlb.CEL


X1511.CEL
X1512.CEL
X337.MT.CEL
X3412.CEL
X343.MT.CEL
X498r.MT.CEL
ATGE_19_A.CEL
ATGE_28_A2.CEL
ATGE_29_A2.CEL
ATGE_29_B2.CEL
ATGE_29_C2.CEL
ATGE_31_A2.CEL
ATGE_32_A2.CEL
ATGE_32_B2.CEL
ATGE_32_C2.CEL
ATGE_37_A.CEL
ATGE_4_A.CEL
ATGE_4_B.CEL
ATGE_4_C.CEL
Col_0_1.cel
GW001_ATH1_A21.Warre.00f.CEL
Goda_I_ABA1.2.CEL
JB001_ATH1_A1.1.Boyce.Kan.1.CEL
Ler.0.1.CEL
Ler.0.2.CEL
Ler.3.2.CEL
NJ001_ATH1_A7.Jor.15B.2.3.CEL


ATGE_31_A2.CEL
ATGE_32_A2.CEL
ATGE_32_B2.CEL
ATGE_32_C2.CEL
ATGE_33_A.CEL
ATGE_37_A.CEL
ATGE_45_A.CEL
ATGE_45_B.CEL
ATGE_45_C.CEL
ATGE_4_A.CEL
Col_0_1.cel
Ler.0.1.CEL
Ler.3.2.CEL

ATGE_93_A.CEL
ATGE_93_B.CEL
Goda_III_CHX.3h.1.CEL
Goda_III_CHX.3h.2.CEL
Goda_II_3DT3h.2.CEL
MH001_ATH1_A12.grevi.AT3.CEL
MH001_ATH1_A6.grevi.AC3.CEL
MH001_ATH1_A9.grevi.CT3.CEL
MJ001_ATH1_A1.jones.WT1.CEL

MJ001_ATH1_A2.jones.WT2.CEL
MJ001_ATH1_A4.jones.rh2.CEL


SF002_ATH1_A6.Fille.WT.dex.CEL



ATGE_93_A.CEL
ATGE_93_B.CEL
ATGE_9_A.CEL
ATGE_9_B.CEL
AtGen_D.10_1.FS_REP1_ATH1.CEL

AtGen_D.11_1.PS_REP1_ATH1.CEL
AtGen_D.12_1.RS_REP1_ATH1.CEL
AtGen_D.13_1.BS_REP1_ATH1.CEL
HY001_ATH1_A1.Yap.AMF.CEL

MC001_ATH1_A11.Campb.327.CEL

MC001_ATH1_A12.Campb.328.new..CEL

MC001_ATH1_A17.Campb.333.CEL


MJ001_ATH1_A3.jones.rh1.CEL


YH001_ATH1_A2.Yap.AMF.CEL

X0022.CEL
X0122.CEL
ATGE_93_A.CEL
ATGE_93_B.CEL
ATGE_9_A.CEL
ATGE_9_B.CEL
AtGen_D.10_1.FS_REP1_ATH1.CEL

AtGen_D.11_1.PS_REP1_ATH1.CEL
AtGen_D.12_1.RS_REP1_ATH1.CEL
AtGen_D.13_1.BS_REP1_ATH1.CEL
Goda_II_3DT3h.1.CEL
Goda_II_3DT3h.2.CEL
HO001_ATH1_A2.Okamo.gpal.control.CEL


HO001_ATH1_A4.Okamo.WS.control.CEL


HY001_ATH1_A1.Yap.AMF.CEL
MH001_ATH1_A12.grevi.AT3.CEL
MH001_ATH1_A9.grevi.CT3.CEL
YH001_ATH1_A2.Yap.AMF.CEL

ATGE_31_A2.CEL
ATGE_32_A2.CEL
ATGE_32_B2.CEL
ATGE_32_C2.CEL
ATGE_33_A.CEL
ATGE_45_A.CEL
ATGE_45_C.CEL
BD001_ATH1_A2.DAVIE.CON.CEL
BD001_ATH1_A3.DAVIE.T13.CEL

BD001_ATH1_A4.DAVIE.T13.CEL
FLOWER_GC5.cel
Ler.0.1.CEL
Ler.0.2.CEL
ST001_ATH1_A1.MUT.Top1.CEL
ST001_ATH1_A2.MUT.Top2.CEL
ST001_ATH1_A6.WT.Top2.CEL
ZW001_ATH1_A2.Wilson.mlb.CEL

ZW001_ATH1_A4.Wilson.Ler.CEL

ZW002_ATH1_A2.GVB.Rep1.CEL

ZW002_ATH1_A3.GVB.Rep1.CEL


ATGE_32_A2.CEL
ATGE_32_B2.CEL
ATGE_32_C2.CEL
ATGE_36_A.CEL
ATGE_36_B.CEL
ATGE_36_C.CEL
ATGE_73_A.CEL
ATGE_73_B.CEL
ATGE_73_C.CEL
DH001_ATH1_A1.UNM1.CEL

DH001_ATH1_A2.BCP1.CEL

DH001_ATH1_A3.TCP1.CEL

DH001_ATH1_A4.UNM2.CEL

DH001_ATH1_A5.BCP2.CEL

DH001_ATH1_A6.TCP2.CEL


X0021.CEL
X0022.CEL
X0122.CEL
X445.MT.CEL
X456.MT.CEL
ATGE_93_A.CEL
ATGE_93_B.CEL
DV001_ATH1_A1.villa.zer.CEL

HY001_ATH1_A1.Yap.AMF.CEL

JB001_ATH1_A1.1.Boyce.Kan.1.CEL

JB001_ATH1_A1.2.Boyce.Kan.2.CEL
Kiba2_28.CEL
Kiba2_29.CEL
Kiba2_30.CEL
MC001_ATH1_A17.Campb.333.CEL

MJ001_ATH1_A1.jones.WT1.CEL

MJ001_ATH1_A2.jones.WT2.CEL


MJ001_ATH1_A3.jones.rh1.CEL
MJ001_ATH1_A4.jones.rh2.CEL
MR001_ATH1_A3.Rente.WS2.Control.CEL
MR001_ATH1_A4.Rente.KKO.Control.CEL
NE001_ATH1_A2.Evans.w30.CEL

NE001_ATH1_A5.Evans.m30.CEL

NJ001_ATH1_A6.Jor.15B.2.2.CEL

NJ001_ATH1_A7.Jor.15B.2.3.CEL


SF001_ATH1_A4.Fille.ANGR4.12.dex.CEL




SF002_ATH1_A6.Fille.WT.dex.CEL


YH001_ATH1_A2.Yap.AMF.CEL

X0022.CEL
X0122.CEL
X9321.CEL
X9322.CEL
ATGE_9_A.CEL
ATGE_9_B.CEL
Goda_II_3DT3h.1.CEL
Goda_II_3DT3h.2.CEL
Goda_I_ABA1.2.CEL

HO001_ATH1_A2.Okamo.gpal.control.CEL


HO001_ATH1_A4.Okamo.WS.control.CEL


MJ001_ATH1_A1.jones.WT1.CEL

MJ001_ATH1_A2.jones.WT2.CEL

MJ001_ATH1_A4.jones.rh2.CEL


ATGE_79_A.CEL
ATGE_79_B.CEL
ATGE_79_C.CEL
ATGE_81_B.CEL
ATGE_82_A.CEL
ATGE_82_B.CEL
ATGE_82_C.CEL
ATGE_83_A.CEL
Li_Control_3.2.cel
Li_Control_6.1.cel
MC001_ATH1_A11.Campb.327.CEL

MC001_ATH1_A12.Campb.328.new..CEL
Nakabayashi_DS2.cel
PU001_ATH1_A2.Urwin.Inf.CEL
Preston_chip.1.dry.seed.CEL
Preston_chip.2.dry.seed.CEL
Preston_chip.5.3hr.imbibed.seed.CEL
Yamauchi_WT22CA.cel

X2611.CEL
ATGE_25_A.CEL
ATGE_25_B.CEL
ATGE_25_C.CEL
ATGE_26_A.CEL
ATGE_26_B.CEL
ATGE_26_C.CEL
ATGE_41_A.CEL
ATGE_41_B.CEL
ATGE_41_C.CEL
Nakabayashi_DS2.cel
Preston_chip.1.dry.seed.CEL
Preston_chip.2.dry.seed.CEL
Preston_chip.5.3hr.imbibed.seed.CEL
Preston_chip.6.3hr.imbibed.seed.CEL


AtGen_A.18_24.2_REP2_ATH1.CEL

AtGen_A.19_24.3_REP3_ATH1.CEL
D7.growth..MM2d...CEL
GW001_ATH1_A23.Warre.03f.CEL
GW001_ATH1_A24.Warre.03f.CEL
JS001_ATH1.Control.4..CEL
JS001_ATH1.Heat.4..CEL

JS001_ATH1.Sen.4..CEL

JS001_ATH1_Control.3.new.CEL

JS001_ATH1_Heat.3.new.CEL

JS001_ATH1_Sen.3.new.CEL
Kiba2_28.CEL
Kiba2_29.CEL
LH001_ATH1_A8.Heggi.HEW.CEL
MD001_ATH1_A1.Diamo.Fum.CEL
MD001_ATH1_A1.Diamo.met.CEL
MD001_ATH1_A2.Diamo.Fum.CEL
MD001_ATH1_A2.Diamo.met.CEL
WW001_ATH1_A1.WILLA.CON.CEL
WW002_ATH1_A1.willa.CON.REP2.CEL
WW002_ATH1_A1.willa.CON.REP3.CEL

X0021.CEL
X0022.CEL
X0121.CEL
X0122.CEL
X445.MT.CEL
ATGE_2_C.CEL
ATGE_93_A.CEL
ATGE_93_B.CEL
ATGE_9_A.CEL
ATGE_9_B.CEL
DV001_ATH1_A1.villa.zer.CEL

DV001_ATH1_A3.villa.glc.CEL
Goda_I_MJ3.2.CEL
HY001_ATH1_A1.Yap.AMF.CEL

JB001_ATH1_A1.1.Boyce.Kan.1.CEL

JB001_ATH1_A1.2.Boyce.Kan.2.CEL
Kiba2_30.CEL
MC001_ATH1_A10.Campb.326.CEL

MC001_ATH1_A11.Campb.327.CEL

MC001_ATH1_A17.Campb.333.CEL

MJ001_ATH1_A1.jones.WT1.CEL

MJ001_ATH1_A2.jones.WT2.CEL


MJ001_ATH1_A3.jones.rh1.CEL


MJ001_ATH1_A4.jones.rh2.CEL

NJ001_ATH1_A6.Jor.15B.2.2.CEL

NJ001_ATH1_A7.Jor.15B.2.3.CEL


SF001_ATH1_A4.Fille.ANGR4.12.dex.CEL




SF002_ATH1_A6.Fille.WT.dex.CEL


YH001_ATH1_A2.Yap.AMF.CEL

X0021.CEL
X0022.CEL
X0121.CEL
X0122.CEL
X3412.CEL
X498r.MT.CEL
ATGE_19_A.CEL
ATGE_28_A2.CEL
ATGE_29_A2.CEL
ATGE_29_B2.CEL
ATGE_29_C2.CEL
ATGE_31_A2.CEL
ATGE_32_A2.CEL
ATGE_32_B2.CEL
ATGE_32_C2.CEL
ATGE_37_A.CEL
ATGE_39_A.CEL
ATGE_4_A.CEL
ATGE_4_B.CEL
ATGE_4_C.CEL
ATGE_9_A.CEL
ATGE_9_B.CEL
Col_0_1.cel
Goda_II_3DT3h.2.CEL
Goda_I_ABA1.2.CEL

HO001_ATH1_A4.Okamo.WS.control.CEL


HY001_ATH1_A1.Yap.AMF.CEL

JB001_ATH1_A1.1.Boyce.Kan.1.CEL
Ler.0.1.CEL
Ler.0.2.CEL
Ler.3.2.CEL
NJ001_ATH1_A7.Jor.15B.2.3.CEL
YH001_ATH1_A2.Yap.AMF.CEL
ZW001_ATH1_A2.Wilson.mlb.CEL

ZW002_ATH1_A2.GVB.Rep1.CEL


X0122.CEL
ATGE_93_B.CEL
ATGE_9_A.CEL
ATGE_9_B.CEL
AtGen_D.10_1.FS_REP1_ATH1.CEL

AtGen_D.11_1.PS_REP1_ATH1.CEL
AtGen_D.12_1.RS_REP1_ATH1.CEL
AtGen_D.13_1.BS_REP1_ATH1.CEL
HY001_ATH1_A1.Yap.AMF.CEL


SF001_ATH1_A4.Fille.ANGR4.12.dex.CEL


YH001_ATH1_A2.Yap.AMF.CEL
ATGE_73_B.CEL
AtGen_A.16_23.4_REP3_ATH1.CEL

BP001_ATH1_A3.Pickett.a1.CEL

DH001_ATH1_A3.TCP1.CEL

DH001_ATH1_A7.MPG1.CEL
DT002_ATH1_Pollen.CEL
JB001_ATH1_A1.1.Boyce.Kan.1.CEL

JB001_ATH1_A5.Brueg.Mck.CEL

JC001_ATH1_A1.3.cornah.icl.CEL

JL001_ATH1_A5.LLOYD.CON.CEL

MG001_ATH1_A25.Torres.8N1.CEL
MH001_ATH1_A12.grevi.AT3.CEL
MH001_ATH1_A6.grevi.AC3.CEL
MJ001_ATH1_A2.jones.WT2.CEL


SF001_ATH1_A4.Fille.ANGR4.12.dex.CEL


ST001_ATH1_A7.WT.Base1.CEL
ST001_ATH1_A8.WT.Base2.CEL
STEM_GC7.cel
STEM_GH7.cel
VB001_ATH1_A10.Bwoll.Col2.CEL
WW002_ATH1_A1.willa.CON.REP2.CEL
WW002_ATH1_A2.willa.ISOX.REP2.CEL
WW002_ATH1_A2.willa.ISOX.REP3.CEL


BP001_ATH1_A3.Pickett.a1.CEL

DH001_ATH1_A1.UNM1.CEL

DH001_ATH1_A2.BCP1.CEL
DH001_ATH1_A4.UNM2.CEL

DH001_ATH1_A5.BCP2.CEL

JC001_ATH1_A1.1.cornah.icl.CEL

JC001_ATH1_A1.2.cornah.icl.CEL

JC001_ATH1_A1.3.cornah.icl.CEL

LH001_ATH1_A1.Heggi.CAG.CEL
Ler.0.2.CEL
Ler.3.2.CEL
Li_Control_3.1.cel
Li_Control_3.2.cel
Li_Control_6.1.cel
Li_Control_6.2.cel
MC001_ATH1_A15.Campb.331.CEL
MR001_ATH1_A1.Rente.WS2.HO.CEL
MR001_ATH1_A2.Rente.KKO.HO.CEL
SW001_ATH1_A2.Ward.ax1.CEL
Yamauchi_WT4CA.cel

X2611.CEL
ATGE_2_A.CEL
ATGE_2_B.CEL
ATGE_2_C.CEL
ATGE_31_A2.CEL
ATGE_32_A2.CEL
ATGE_32_B2.CEL
ATGE_32_C2.CEL
ATGE_33_A.CEL
ATGE_41_A.CEL
ATGE_41_B.CEL
ATGE_41_C.CEL
ATGE_45_A.CEL
ATGE_45_B.CEL
ATGE_45_C.CEL
AtGen_A.10_22.2_REP2_ATH1.CEL

AtGen_A.17_24.1_REP1_ATH1.CEL
AtGen_A.18_24.2_REP2_ATH1.CEL

AtGen_A.19_24.3_REP3_ATH1.CEL

AtGen_A.30_27.2_REP2_ATH1.CEL

AtGen_A.31_27.3_REP3_ATH1.CEL

AtGen_B.26_2.5.4_REP2_ATH1.CEL

AtGen_C.11_2.Pi.6_REP2_ATH1.CEL

AtGen_C.12_3.Pi.6_REP3_ATH1.CEL

Bc181.1.CEL

Bc482.1.CEL

Bc482.2.CEL
Col_0_1.cel
JL001_ATH1_A1.LLOYD.POH.CEL

JL001_ATH1_A2.LLOYD.POH.CEL
Ler.0.1.CEL
Ler.0.2.CEL
Ler.3.2.CEL
MG001_ATH1_A10.Torres.5N1.CEL

MG001_ATH1_A12.Torres.5N6.CEL

MG001_ATH1_A14.Torres.4N3.CEL

MG001_ATH1_A25.Torres.8N1.CEL
WW002_ATH1_A1.willa.CON.REP2.CEL
WW002_ATH1_A1.willa.CON.REP3.CEL

ATGE_31_A2.CEL
ATGE_32_A2.CEL
ATGE_32_B2.CEL
ATGE_32_C2.CEL
BD001_ATH1_A2.DAVIE.CON.CEL
BD001_ATH1_A4.DAVIE.T13.CEL
FLOWER_GC5.cel
FLOWER_GC6.cel
FLOWER_GH6.cel
ST001_ATH1_A2.MUT.Top2.CEL
SW001_ATH1_A1.Ward.ax3.CEL

SW001_ATH1_A2.Ward.ax1.CEL


ATGE_34_A.CEL
ATGE_34_B.CEL
ATGE_34_C.CEL
ATGE_35_A.CEL
ATGE_35_B.CEL
ATGE_35_C.CEL
ATGE_36_A.CEL
ATGE_36_B.CEL
ATGE_36_C.CEL
ATGE_41_A.CEL
ATGE_41_B.CEL
ATGE_41_C.CEL
ATGE_42_B.CEL
ATGE_42_C.CEL
ATGE_42_D.CEL
ATGE_43_A.CEL
ATGE_43_B.CEL
ATGE_43_C.CEL
ATGE_45_A.CEL
ATGE_45_B.CEL
ATGE_45_C.CEL
ATGE_73_A.CEL
ATGE_73_B.CEL
ATGE_73_C.CEL

BD001_ATH1_A1.DAVIE.CON.CEL

BD001_ATH1_A2.DAVIE.CON.CEL
DH001_ATH1_A3.TCP1.CEL

DH001_ATH1_A6.TCP2.CEL

DH001_ATH1_A7.MPG1.CEL
DT002_ATH1_Pollen.CEL
FLOWER_GH6.cel
ZW001_ATH1_A2.Wilson.mlb.CEL


X7411.CEL
X7412.CEL
ATGE_25_A.CEL
ATGE_25_B.CEL
ATGE_25_C.CEL
ATGE_41_A.CEL
ATGE_41_B.CEL
ATGE_41_C.CEL
GW001_ATH1_A23.Warre.03f.CEL
JS001_ATH1_Sen.3.new.CEL
Nakabayashi_DS1.cel
Nakabayashi_DS2.cel
Preston_chip.1.dry.seed.CEL
Preston_chip.2.dry.seed.CEL
Preston_chip.5.3hr.imbibed.seed.CEL
Preston_chip.6.3hr.imbibed.seed.CEL
VB001_ATH1_A10.Bwoll.Col2.CEL

ATGE_37_A.CEL
ATGE_45_A.CEL
ATGE_45_B.CEL
ATGE_45_C.CEL
ATGE_76_A.CEL
ATGE_76_B.CEL
ATGE_76_C.CEL
ATGE_77_D.CEL
ATGE_77_E.CEL
ATGE_77_F.CEL
ATGE_78_D.CEL
ATGE_79_A.CEL
ATGE_79_B.CEL
ATGE_79_C.CEL

C10_1.CEL
C10_2.CEL
D1.growth..MM2d...CEL
D3.growth..MM2d...CEL
D5.growth..MM2d...CEL
D7.growth..MM2d...CEL
JS001_ATH1.Control.4..CEL

JS001_ATH1.Heat.4..CEL

JS001_ATH1_Control.3.new.CEL

JS001_ATH1_Heat.3.new.CEL
MD001_ATH1_A1.Diamo.Fum.CEL
MD001_ATH1_A1.Diamo.met.CEL
MD001_ATH1_A2.Diamo.Fum.CEL
MD001_ATH1_A2.Diamo.met.CEL
T0.aph..MM2d...CEL
T10.suc..MM2d...CEL
T12.suc..MM2d...CEL
T2.suc..MM2d...CEL
T4.suc..MM2d...CEL


BD001_ATH1_A1.DAVIE.CON.CEL


DH001_ATH1_A7.MPG1.CEL
DT002_ATH1_Pollen.CEL
FLOWER_GC6.cel
FLOWER_GH6.cel
JC001_ATH1_A1.2.cornah.icl.CEL

LH001_ATH1_A3.Heggi.HAG.CEL

MC001_ATH1_A10.Campb.326.CEL

MC001_ATH1_A17.Campb.333.CEL
PU001_ATH1_A2.Urwin.Inf.CEL
STEM_GC8.cel

ATGE_34_A.CEL
ATGE_34_B.CEL
ATGE_34_C.CEL
ATGE_73_B.CEL
ATGE_73_C.CEL
DH001_ATH1_A1.UNM1.CEL
DH001_ATH1_A2.BCP1.CEL

DH001_ATH1_A3.TCP1.CEL

DH001_ATH1_A4.UNM2.CEL

DH001_ATH1_A5.BCP2.CEL

DH001_ATH1_A6.TCP2.CEL

DH001_ATH1_A7.MPG1.CEL
FLOWER_GC5.cel
FLOWER_GC6.cel
MC001_ATH1_A11.Campb.327.CEL

MC001_ATH1_A12.Campb.328.new..CEL

MC001_ATH1_A15.Campb.331.CEL

ZW001_ATH1_A2.Wilson.mlb.CEL

ZW001_ATH1_A4.Wilson.Ler.CEL


X0021.CEL
X0022.CEL
X0121.CEL
X0122.CEL
X1621.CEL
X2321.CEL
X2421.CEL
X2522.CEL
X3621.CEL
X445.MT.CEL
ATGE_93_A.CEL
ATGE_93_B.CEL
ATGE_9_A.CEL
ATGE_9_B.CEL
HY001_ATH1_A1.Yap.AMF.CEL

JB001_ATH1_A1.1.Boyce.Kan.1.CEL

JB001_ATH1_A1.2.Boyce.Kan.2.CEL
Kiba2_28.CEL
Kiba2_29.CEL
MJ001_ATH1_A1.jones.WT1.CEL

MJ001_ATH1_A2.jones.WT2.CEL

NE001_ATH1_A2.Evans.w30.CEL

NE001_ATH1_A5.Evans.m30.CEL


SF001_ATH1_A4.Fille.ANGR4.12.dex.CEL




SF002_ATH1_A6.Fille.WT.dex.CEL


YH001_ATH1_A2.Yap.AMF.CEL

ATGE_27_A.CEL
ATGE_27_B.CEL
ATGE_27_C.CEL
ATGE_28_A2.CEL
HY001_ATH1_A1.Yap.AMF.CEL
PU001_ATH1_A1.Urwin.Con.CEL
RD001_ATH1_A2.deeke.Inf.CEL
ST001_ATH1_A4.MUT.Base2.CEL
ST001_ATH1_A7.WT.Base1.CEL
ST001_ATH1_A8.WT.Base2.CEL
STEM_GC7.cel
STEM_GC8.cel
YH001_ATH1_A2.Yap.AMF.CEL

X7311.CEL
X7312.CEL
X7411.CEL
X7412.CEL
ATGE_29_A2.CEL
ATGE_29_B2.CEL
ATGE_29_C2.CEL
ATGE_31_A2.CEL
ATGE_73_B.CEL
ATGE_73_C.CEL
DT002_ATH1_Pollen.CEL


SF002_ATH1_A6.Fille.WT.dex.CEL


Yamauchi_WT4CA.cel
Yamauchi_WT4CB.cel

X498r.MT.CEL
AtGen_A.19_24.3_REP3_ATH1.CEL

AtGen_A.30_27.2_REP2_ATH1.CEL

AtGen_B.16_2.2.1_REP2_ATH1.CEL
AtGen_B.29_3.1.1_REP3_ATH1.CEL
Goda_II_3DT3h.2.CEL
LH001_ATH1_A1.Heggi.CAG.CEL

LH001_ATH1_A7.Heggi.HAW.CEL
Li_Control_3.2.cel
Li_Control_6.1.cel
Li_Control_6.2.cel
MJ001_ATH1_A1.jones.WT1.CEL


MJ001_ATH1_A3.jones.rh1.CEL


MJ001_ATH1_A4.jones.rh2.CEL
Nakabayashi_DS1.cel
Nakabayashi_DS2.cel
Preston_chip.1.dry.seed.CEL
Preston_chip.2.dry.seed.CEL
Preston_chip.5.3hr.imbibed.seed.CEL
Preston_chip.6.3hr.imbibed.seed.CEL
Yamauchi_WT4CA.cel

ATGE_34_A.CEL
ATGE_34_B.CEL
ATGE_34_C.CEL
ATGE_39_A.CEL
ATGE_39_B.CEL
ATGE_39_C.CEL
ATGE_42_B.CEL
ATGE_42_C.CEL
ATGE_42_D.CEL
ATGE_43_A.CEL
ATGE_43_B.CEL
ATGE_43_C.CEL
CW001_ATH1_A1.4.WestC.kub.CEL
Kiba2_25.CEL
Kiba2_26.CEL
Kiba2_27.CEL

ATGE_45_A.CEL
ATGE_45_B.CEL
ATGE_45_C.CEL
Col_0_1.cel
D3.growth..MM2d...CEL
D5.growth..MM2d...CEL
D7.growth..MM2d...CEL
FLOWER_GC5.cel
JS001_ATH1_Control.3.new.CEL

JS001_ATH1_Heat.3.new.CEL
Ler.0.1.CEL
Ler.3.2.CEL
ST001_ATH1_A1.MUT.Top1.CEL
ST001_ATH1_A2.MUT.Top2.CEL
T10.suc..MM2d...CEL
T12.suc..MM2d...CEL
T2.suc..MM2d...CEL
T4.suc..MM2d...CEL
WW001_ATH1_A2.WILLA.ISOX.CEL
WW002_ATH1_A2.willa.ISOX.REP2.CEL
WW002_ATH1_A2.willa.ISOX.REP3.CEL

X2411.CEL
X2412.CEL
X2511.CEL
X7411.CEL
X7412.CEL
ATGE_28_A2.CEL
ATGE_29_A2.CEL
ATGE_29_B2.CEL
ATGE_29_C2.CEL
ATGE_2_B.CEL
ATGE_2_C.CEL
ATGE_31_A2.CEL
ATGE_32_A2.CEL
ATGE_32_B2.CEL
ATGE_32_C2.CEL
ATGE_33_A.CEL
ATGE_35_A.CEL
ATGE_35_B.CEL
ATGE_35_C.CEL
ATGE_37_A.CEL
ATGE_45_A.CEL
ATGE_45_B.CEL
ATGE_45_C.CEL
ATGE_76_A.CEL
ATGE_76_C.CEL
AtGen_A.10_22.2_REP2_ATH1.CEL

AtGen_A.31_27.3_REP3_ATH1.CEL

AtGen_B.26_2.5.4_REP2_ATH1.CEL

AtGen_C.11_2.Pi.6_REP2_ATH1.CEL

Bc181.1.CEL
Col_0_1.cel
Ler.3.2.CEL

X2411.CEL
X2412.CEL
ATGE_2_A.CEL
ATGE_2_B.CEL
ATGE_2_C.CEL
ATGE_31_A2.CEL
ATGE_32_A2.CEL
ATGE_32_B2.CEL
ATGE_32_C2.CEL
ATGE_33_A.CEL
ATGE_37_A.CEL
ATGE_45_A.CEL
ATGE_45_B.CEL
ATGE_45_C.CEL
AtGen_A.17_24.1_REP1_ATH1.CEL

AtGen_A.18_24.2_REP2_ATH1.CEL

AtGen_A.19_24.3_REP3_ATH1.CEL

AtGen_A.30_27.2_REP2_ATH1.CEL

AtGen_A.31_27.3_REP3_ATH1.CEL

AtGen_B.26_2.5.4_REP2_ATH1.CEL

AtGen_C.11_2.Pi.6_REP2_ATH1.CEL
Col_0_1.cel
Ler.0.1.CEL
Ler.0.2.CEL
Ler.3.2.CEL

ATGE_36_A.CEL
ATGE_36_B.CEL
ATGE_36_C.CEL
ATGE_41_A.CEL
ATGE_41_B.CEL
ATGE_41_C.CEL
ATGE_42_B.CEL
ATGE_42_C.CEL
ATGE_42_D.CEL
ATGE_43_A.CEL
ATGE_43_B.CEL
ATGE_43_C.CEL
ATGE_45_A.CEL
ATGE_45_B.CEL
ATGE_45_C.CEL
ATGE_73_A.CEL
ATGE_73_B.CEL
ATGE_73_C.CEL

BD001_ATH1_A1.DAVIE.CON.CEL

BD001_ATH1_A2.DAVIE.CON.CEL
DH001_ATH1_A3.TCP1.CEL

DH001_ATH1_A6.TCP2.CEL
DH001_ATH1_A7.MPG1.CEL
DT002_ATH1_Pollen.CEL
FLOWER_GC5.cel
FLOWER_GH5.cel
FLOWER_GH6.cel

X0022.CEL
X0122.CEL
ATGE_2_A.CEL
ATGE_2_B.CEL
ATGE_2_C.CEL
ATGE_93_B.CEL
ATGE_9_A.CEL
ATGE_9_B.CEL
Goda_II_3DT3h.1.CEL
Goda_II_3DT3h.2.CEL
Goda_I_ABA1.2.CEL

HO001_ATH1_A2.Okamo.gpal.control.CEL


HO001_ATH1_A4.Okamo.WS.control.CEL


MC001_ATH1_A1.Campb.317.CEL
MH001_ATH1_A12.grevi.AT3.CEL
MH001_ATH1_A9.grevi.CT3.CEL
MJ001_ATH1_A1.jones.WT1.CEL

MJ001_ATH1_A2.jones.WT2.CEL


ATGE_39_A.CEL
ATGE_39_B.CEL
ATGE_39_C.CEL
ATGE_43_A.CEL
ATGE_43_B.CEL
ATGE_43_C.CEL
ATGE_73_A.CEL
ATGE_73_B.CEL
ATGE_73_C.CEL
ATGE_76_A.CEL
ATGE_76_B.CEL
ATGE_76_C.CEL
DH001_ATH1_A6.TCP2.CEL

DH001_ATH1_A7.MPG1.CEL
DT002_ATH1_Pollen.CEL

ATGE_79_A.CEL
ATGE_79_B.CEL
ATGE_79_C.CEL
ATGE_93_A.CEL
ATGE_93_B.CEL
AtGen_D.10_1.FS_REP1_ATH1.CEL

AtGen_D.11_1.PS_REP1_ATH1.CEL
AtGen_D.12_1.RS_REP1_ATH1.CEL
AtGen_D.13_1.BS_REP1_ATH1.CEL
HY001_ATH1_A1.Yap.AMF.CEL

MC001_ATH1_A10.Campb.326.CEL

MC001_ATH1_A11.Campb.327.CEL

MC001_ATH1_A12.Campb.328.new..CEL
YH001_ATH1_A2.Yap.AMF.CEL
Yamauchi_WT22CB.cel

X0022.CEL
X456.MT.CEL
X499.MT.CEL
ATGE_93_A.CEL
ATGE_93_B.CEL
ATGE_9_A.CEL
ATGE_9_B.CEL
HY001_ATH1_A1.Yap.AMF.CEL
MH001_ATH1_A12.grevi.AT3.CEL
MH001_ATH1_A9.grevi.CT3.CEL
MJ001_ATH1_A4.jones.rh2.CEL
YH001_ATH1_A2.Yap.AMF.CEL

ATGE_73_A.CEL
ATGE_73_B.CEL
ATGE_73_C.CEL
DH001_ATH1_A1.UNM1.CEL

DH001_ATH1_A2.BCP1.CEL

DH001_ATH1_A3.TCP1.CEL

DH001_ATH1_A4.UNM2.CEL

DH001_ATH1_A5.BCP2.CEL

DH001_ATH1_A6.TCP2.CEL

DH001_ATH1_A7.MPG1.CEL
DT002_ATH1_Pollen.CEL
Nakabayashi_DS1.cel
Nakabayashi_DS2.cel
Preston_chip.1.dry.seed.CEL
Preston_chip.2.dry.seed.CEL
Preston_chip.5.3hr.imbibed.seed.CEL
Preston_chip.6.3hr.imbibed.seed.CEL

ATGE_32_C2.CEL
ATGE_36_A.CEL
ATGE_36_B.CEL
ATGE_36_C.CEL
ATGE_73_A.CEL
ATGE_73_B.CEL
ATGE_73_C.CEL
DH001_ATH1_A1.UNM1.CEL

DH001_ATH1_A2.BCP1.CEL

DH001_ATH1_A3.TCP1.CEL

DH001_ATH1_A4.UNM2.CEL

DH001_ATH1_A5.BCP2.CEL

DH001_ATH1_A6.TCP2.CEL

DH001_ATH1_A7.MPG1.CEL
X2411.CEL
X7411.CEL
X7412.CEL
ATGE_29_A2.CEL
ATGE_29_B2.CEL
ATGE_29_C2.CEL
ATGE_2_A.CEL
ATGE_2_B.CEL
ATGE_2_C.CEL
ATGE_31_A2.CEL
ATGE_32_A2.CEL
ATGE_32_B2.CEL
ATGE_32_C2.CEL
ATGE_35_A.CEL
ATGE_35_B.CEL
ATGE_35_C.CEL
ATGE_37_A.CEL
ATGE_45_A.CEL
ATGE_45_B.CEL
ATGE_45_C.CEL
ATGE_76_A.CEL
ATGE_76_B.CEL
ATGE_76_C.CEL
AtGen_A.17_24.1_REP1_ATH1.CEL

AtGen_A.18_24.2_REP2_ATH1.CEL

AtGen_A.19_24.3_REP3_ATH1.CEL

AtGen_A.30_27.2_REP2_ATH1.CEL

AtGen_A.31_27.3_REP3_ATH1.CEL

AtGen_B.26_2.5.4_REP2_ATH1.CEL


BD001_ATH1_A1.DAVIE.CON.CEL

Col_0_1.cel
Ler.0.1.CEL
Ler.0.2.CEL
Ler.3.2.CEL

ATGE_78_D.CEL
ATGE_79_A.CEL
ATGE_79_B.CEL
ATGE_79_C.CEL
ATGE_81_B.CEL
ATGE_82_A.CEL
ATGE_82_C.CEL
D3.growth..MM2d...CEL
D5.growth..MM2d...CEL
D7.growth..MM2d...CEL
JS001_ATH1_Control.3.new.CEL
Li_Control_3.1.cel
Li_Control_3.2.cel
Li_Control_6.1.cel
Li_Control_6.2.cel
Nakabayashi_DS2.cel
Preston_chip.1.dry.seed.CEL
Preston_chip.2.dry.seed.CEL
Preston_chip.6.3hr.imbibed.seed.CEL
ST001_ATH1_A7.WT.Base1.CEL
Yamauchi_WT4CA.cel

ATGE_28_A2.CEL
ATGE_2_A.CEL
ATGE_2_B.CEL
ATGE_2_C.CEL
ATGE_31_A2.CEL
ATGE_32_A2.CEL
ATGE_32_B2.CEL
ATGE_32_C2.CEL
ATGE_37_A.CEL
Col_0_1.cel
FLOWER_GH5.cel
Ler.0.1.CEL
Ler.0.2.CEL
Ler.3.2.CEL
Nakabayashi_ABA3.1.cel
Nakabayashi_ABA3.2.cel
Nakabayashi_Imb24.1.cel
Nakabayashi_Imb24.2.cel
ST001_ATH1_A1.MUT.Top1.CEL
ST001_ATH1_A2.MUT.Top2.CEL

ATGE_45_B.CEL
ATGE_73_A.CEL
ATGE_73_C.CEL
AtGen_A.18_24.2_REP2_ATH1.CEL

AtGen_A.19_24.3_REP3_ATH1.CEL

AtGen_A.30_27.2_REP2_ATH1.CEL

AtGen_A.31_27.3_REP3_ATH1.CEL

AtGen_A.52_32.4_REP3_ATH1.CEL

DH001_ATH1_A1.UNM1.CEL

DH001_ATH1_A2.BCP1.CEL

DH001_ATH1_A4.UNM2.CEL

DH001_ATH1_A5.BCP2.CEL
FLOWER_GH5.cel
MG001_ATH1_A10.Torres.5N1.CEL

MG001_ATH1_A12.Torres.5N6.CEL

MG001_ATH1_A14.Torres.4N3.CEL
RD001_ATH1_A1.deeke.tum.CEL
ST001_ATH1_A4.MUT.Base2.CEL
SW001_ATH1_A1.Ward.ax3.CEL


ATGE_29_B2.CEL
AtGen_D.10_1.FS_REP1_ATH1.CEL

AtGen_D.11_1.PS_REP1_ATH1.CEL
AtGen_D.12_1.RS_REP1_ATH1.CEL
AtGen_D.13_1.BS_REP1_ATH1.CEL
CW001_ATH1_A1.3.WestC.kuu.CEL
Ler.0.2.CEL
Ler.3.2.CEL
Li_Control_3.1.cel
Li_Control_3.2.cel
Li_Control_6.1.cel
Li_Control_6.2.cel
MJ001_ATH1_A3.jones.rh1.CEL


Nakabayashi_DS1.cel
Nakabayashi_DS2.cel
Preston_chip.1.dry.seed.CEL
Preston_chip.2.dry.seed.CEL
VB001_ATH1_A10.Bwoll.Col2.CEL
Yamauchi_WT4CA.cel
Yamauchi_WT4CB.cel

X0021.CEL
X0022.CEL
X0121.CEL
X0122.CEL
X1621.CEL
X445.MT.CEL
X9321.CEL
ATGE_93_A.CEL
ATGE_93_B.CEL
ATGE_9_A.CEL
ATGE_9_B.CEL
HY001_ATH1_A1.Yap.AMF.CEL

JB001_ATH1_A1.1.Boyce.Kan.1.CEL

JB001_ATH1_A1.2.Boyce.Kan.2.CEL

MJ001_ATH1_A1.jones.WT1.CEL

MJ001_ATH1_A2.jones.WT2.CEL


MJ001_ATH1_A3.jones.rh1.CEL


MJ001_ATH1_A4.jones.rh2.CEL
MR001_ATH1_A4.Rente.KKO.Control.CEL


SF001_ATH1_A4.Fille.ANGR4.12.dex.CEL
SF002_ATH1_A6.Fille.WT.dex.CEL


YH001_ATH1_A2.Yap.AMF.CEL

X0021.CEL
X0121.CEL
X1621.CEL
X2421.CEL
X2521.CEL
X3321.CEL
X3322.CEL
X3621.CEL
X9321.CEL
X9322.CEL
ATGE_27_A.CEL
ATGE_27_B.CEL
ATGE_27_C.CEL
ATGE_28_A2.CEL
MH001_ATH1_A6.grevi.AC3.CEL
MJ001_ATH1_A2.jones.WT2.CEL
ST001_ATH1_A3.MUT.Base1.CEL
ST001_ATH1_A4.MUT.Base2.CEL
ST001_ATH1_A7.WT.Base1.CEL
ST001_ATH1_A8.WT.Base2.CEL

ATGE_73_A.CEL
DH001_ATH1_A1.UNM1.CEL

DH001_ATH1_A2.BCP1.CEL

DH001_ATH1_A3.TCP1.CEL

DH001_ATH1_A4.UNM2.CEL

DH001_ATH1_A5.BCP2.CEL

DH001_ATH1_A6.TCP2.CEL

DH001_ATH1_A7.MPG1.CEL
Li_Control_3.1.cel
Li_Control_3.2.cel
Li_Control_6.1.cel
Li_Control_6.2.cel
Nakabayashi_DS1.cel
Nakabayashi_DS2.cel
Preston_chip.1.dry.seed.CEL
Preston_chip.2.dry.seed.CEL
Preston_chip.5.3hr.imbibed.seed.CEL
Preston_chip.6.3hr.imbibed.seed.CEL
Yamauchi_WT4CA.cel
Yamauchi_WT4CB.cel

C0_1.CEL
C0_2.CEL
C10_1.CEL
C10_2.CEL
C7_1.CEL
C8_1.CEL
D1.growth..MM2d...CEL
DH001_ATH1_A1.UNM1.CEL
Li_Control_3.1.cel
Li_Control_3.2.cel
Li_Control_6.1.cel
Li_Control_6.2.cel
Nakabayashi_ABA3.1.cel
Nakabayashi_ABA3.2.cel
Nakabayashi_Imb24.1.cel
Nakabayashi_Imb24.2.cel
Yamauchi_WT4CA.cel
Yamauchi_WT4CB.cel

X0021.CEL
X0022.CEL
X0121.CEL
X0122.CEL
X2321.CEL
X2421.CEL
X2521.CEL
X2522.CEL
X3321.CEL
X3322.CEL
X3621.CEL
ATGE_93_A.CEL
ATGE_93_B.CEL
ATGE_9_A.CEL
HY001_ATH1_A1.Yap.AMF.CEL


SF001_ATH1_A4.Fille.ANGR4.12.dex.CEL


YH001_ATH1_A2.Yap.AMF.CEL

ATGE_29_A2.CEL
ATGE_29_B2.CEL
ATGE_29_C2.CEL
ATGE_2_A.CEL
ATGE_93_B.CEL
AtGen_D.10_1.FS_REP1_ATH1.CEL

AtGen_D.11_1.PS_REP1_ATH1.CEL
AtGen_D.12_1.RS_REP1_ATH1.CEL
AtGen_D.13_1.BS_REP1_ATH1.CEL
Col_0_1.cel
HY001_ATH1_A1.Yap.AMF.CEL


SF001_ATH1_A4.Fille.ANGR4.12.dex.CEL


YH001_ATH1_A2.Yap.AMF.CEL

ATGE_33_A.CEL
ATGE_36_A.CEL
ATGE_36_B.CEL
ATGE_36_C.CEL
ATGE_73_A.CEL
ATGE_73_B.CEL
ATGE_73_C.CEL
DH001_ATH1_A2.BCP1.CEL

DH001_ATH1_A3.TCP1.CEL

DH001_ATH1_A5.BCP2.CEL

DH001_ATH1_A6.TCP2.CEL

DH001_ATH1_A7.MPG1.CEL
DT002_ATH1_Pollen.CEL
ZW001_ATH1_A2.Wilson.mlb.CEL


D7.growth..MM2d...CEL
JS001_ATH1.Sen.4..CEL

JS001_ATH1_Control.3.new.CEL

JS001_ATH1_Sen.3.new.CEL
Kiba2_25.CEL
Kiba2_26.CEL
Kiba2_27.CEL
WW001_ATH1_A1.WILLA.CON.CEL
WW001_ATH1_A2.WILLA.ISOX.CEL
WW002_ATH1_A1.willa.CON.REP2.CEL
WW002_ATH1_A1.willa.CON.REP3.CEL
WW002_ATH1_A2.willa.ISOX.REP2.CEL
WW002_ATH1_A2.willa.ISOX.REP3.CEL

X3621.CEL
X456.MT.CEL
ATGE_73_B.CEL
ATGE_93_A.CEL
ATGE_93_B.CEL
ATGE_9_A.CEL
ATGE_9_B.CEL
DH001_ATH1_A3.TCP1.CEL

DH001_ATH1_A6.TCP2.CEL

DH001_ATH1_A7.MPG1.CEL
DT002_ATH1_Pollen.CEL
HY001_ATH1_A1.Yap.AMF.CEL
Kiba2_28.CEL
Kiba2_29.CEL
MC001_ATH1_A14.Campb.330.new..CEL

MJ001_ATH1_A1.jones.WT1.CEL

MJ001_ATH1_A2.jones.WT2.CEL
MJ001_ATH1_A3.jones.rh1.CEL


MJ001_ATH1_A4.jones.rh2.CEL


SF001_ATH1_A4.Fille.ANGR4.12.dex.CEL


YH001_ATH1_A2.Yap.AMF.CEL

ATGE_19_A.CEL
ATGE_19_B.CEL
ATGE_19_C.CEL
ATGE_2_A.CEL
ATGE_2_B.CEL
ATGE_2_C.CEL
ATGE_35_A.CEL
ATGE_35_B.CEL
ATGE_35_C.CEL
ATGE_37_A.CEL
ATGE_45_A.CEL
ATGE_45_B.CEL
ATGE_45_C.CEL
ATGE_4_A.CEL
ATGE_4_B.CEL
ATGE_4_C.CEL
ATGE_76_A.CEL
ATGE_76_B.CEL
Goda_II_3DT3h.1.CEL

ATGE_19_A.CEL
ATGE_19_C.CEL
ATGE_27_A.CEL
ATGE_27_B.CEL
ATGE_27_C.CEL
ATGE_28_A2.CEL
ATGE_2_A.CEL
ATGE_2_B.CEL
ATGE_2_C.CEL


MJ001_ATH1_A3.jones.rh1.CEL
ST001_ATH1_A3.MUT.Base1.CEL
ST001_ATH1_A8.WT.Base2.CEL

ATGE_36_A.CEL
ATGE_36_B.CEL
ATGE_36_C.CEL
ATGE_73_A.CEL
ATGE_73_B.CEL
AtGen_A.18_24.2_REP2_ATH1.CEL

AtGen_A.19_24.3_REP3_ATH1.CEL

DH001_ATH1_A3.TCP1.CEL

DH001_ATH1_A6.TCP2.CEL
DT002_ATH1_Pollen.CEL
Goda_III_CHX.3h.2.CEL
LH001_ATH1_A1.Heggi.CAG.CEL

LH001_ATH1_A4.Heggi.HEG.CEL

MC001_ATH1_A12.Campb.328.new..CEL

MC001_ATH1_A14.Campb.330.new..CEL


X452.MT.CEL
X498r.MT.CEL
X499.MT.CEL
ATGE_2_A.CEL
ATGE_2_B.CEL
ATGE_2_C.CEL
ATGE_79_A.CEL
ATGE_79_B.CEL
ATGE_79_C.CEL
ATGE_81_B.CEL
ATGE_82_A.CEL
ATGE_82_B.CEL
ATGE_82_C.CEL
ATGE_83_A.CEL
ATGE_93_A.CEL
ATGE_93_B.CEL
DV001_ATH1_A1.villa.zer.CEL
Goda_I_ABA3.2.CEL

HO001_ATH1_A2.Okamo.gpal.control.CEL


NE001_ATH1_A5.Evans.m30.CEL
PU001_ATH1_A1.Urwin.Con.CEL


SF001_ATH1_A4.Fille.ANGR4.12.dex.CEL



X0021.CEL
X0022.CEL
X0121.CEL
X0122.CEL
X1621.CEL
X1622.CEL
X445.MT.CEL
ATGE_93_A.CEL
ATGE_93_B.CEL
ATGE_9_A.CEL
ATGE_9_B.CEL
AtGen_D.10_1.FS_REP1_ATH1.CEL

AtGen_D.11_1.PS_REP1_ATH1.CEL
AtGen_D.12_1.RS_REP1_ATH1.CEL
AtGen_D.13_1.BS_REP1_ATH1.CEL
HY001_ATH1_A1.Yap.AMF.CEL
Kiba2_28.CEL
Kiba2_29.CEL
MJ001_ATH1_A1.jones.WT1.CEL

MJ001_ATH1_A2.jones.WT2.CEL


MJ001_ATH1_A3.jones.rh1.CEL


MJ001_ATH1_A4.jones.rh2.CEL

NJ001_ATH1_A6.Jor.15B.2.2.CEL
NJ001_ATH1_A7.Jor.15B.2.3.CEL


SF001_ATH1_A4.Fille.ANGR4.12.dex.CEL




SF002_ATH1_A6.Fille.WT.dex.CEL


YH001_ATH1_A2.Yap.AMF.CEL

C0_1.CEL
C0_2.CEL
C10_1.CEL
C10_2.CEL
C7_1.CEL
C8_1.CEL
DH001_ATH1_A2.BCP1.CEL
Li_Control_3.1.cel
Li_Control_3.2.cel
Li_Control_6.1.cel
Li_Control_6.2.cel
Nakabayashi_ABA3.1.cel
Nakabayashi_ABA3.2.cel
Nakabayashi_DS1.cel
Nakabayashi_DS2.cel
Nakabayashi_Imb24.1.cel
Preston_chip.1.dry.seed.CEL
Preston_chip.2.dry.seed.CEL
Preston_chip.5.3hr.imbibed.seed.CEL
Preston_chip.6.3hr.imbibed.seed.CEL
T0.aph..MM2d...CEL
T2.aph..MM2d...CEL
Yamauchi_WT4CA.cel
Yamauchi_WT4CB.cel

X0022.CEL
X0122.CEL
X445.MT.CEL
ATGE_93_A.CEL
ATGE_93_B.CEL
ATGE_9_A.CEL
ATGE_9_B.CEL
AtGen_D.10_1.FS_REP1_ATH1.CEL

AtGen_D.11_1.PS_REP1_ATH1.CEL
AtGen_D.12_1.RS_REP1_ATH1.CEL
AtGen_D.13_1.BS_REP1_ATH1.CEL
DV001_ATH1_A3.villa.glc.CEL

HY001_ATH1_A1.Yap.AMF.CEL

JB001_ATH1_A1.1.Boyce.Kan.1.CEL

JB001_ATH1_A1.2.Boyce.Kan.2.CEL

MJ001_ATH1_A1.jones.WT1.CEL

MJ001_ATH1_A2.jones.WT2.CEL


MJ001_ATH1_A3.jones.rh1.CEL


MJ001_ATH1_A4.jones.rh2.CEL

NE001_ATH1_A5.Evans.m30.CEL

NJ001_ATH1_A6.Jor.15B.2.2.CEL
YH001_ATH1_A2.Yap.AMF.CEL

ATGE_73_A.CEL
ATGE_73_B.CEL
ATGE_73_C.CEL
AtGen_A.18_24.2_REP2_ATH1.CEL

AtGen_A.19_24.3_REP3_ATH1.CEL

AtGen_A.30_27.2_REP2_ATH1.CEL

AtGen_A.31_27.3_REP3_ATH1.CEL

DH001_ATH1_A2.BCP1.CEL

DH001_ATH1_A3.TCP1.CEL
DH001_ATH1_A4.UNM2.CEL

DH001_ATH1_A5.BCP2.CEL
DT002_ATH1_Pollen.CEL
Nakabayashi_DS1.cel
Nakabayashi_DS2.cel

X0122.CEL
ATGE_9_A.CEL
ATGE_9_B.CEL

HO001_ATH1_A2.Okamo.gpal.control.CEL


HO001_ATH1_A4.Okamo.WS.control.CEL


HY001_ATH1_A1.Yap.AMF.CEL

MC001_ATH1_A1.Campb.317.CEL

MC001_ATH1_A14.Campb.330.new..CEL
MH001_ATH1_A12.grevi.AT3.CEL
MH001_ATH1_A6.grevi.AC3.CEL
MH001_ATH1_A9.grevi.CT3.CEL
MJ001_ATH1_A1.jones.WT1.CEL

MJ001_ATH1_A2.jones.WT2.CEL
YH001_ATH1_A2.Yap.AMF.CEL

X2521.CEL
X2522.CEL
ATGE_41_A.CEL
ATGE_41_B.CEL
ATGE_41_C.CEL
ATGE_42_B.CEL
ATGE_42_C.CEL
ATGE_42_D.CEL
ATGE_82_B.CEL
ATGE_83_A.CEL
Bc181.1.CEL
Bc482.1.CEL
Nakabayashi_ABA3.1.cel
Nakabayashi_ABA3.2.cel
Nakabayashi_DS1.cel
Nakabayashi_DS2.cel
Nakabayashi_Imb24.1.cel
Nakabayashi_Imb24.2.cel
Preston_chip.1.dry.seed.CEL
Preston_chip.2.dry.seed.CEL
RD001_ATH1_A3.deeke.tum.CEL
Yamauchi_WT4CB.cel

ATGE_73_A.CEL
ATGE_73_B.CEL
ATGE_73_C.CEL
DH001_ATH1_A6.TCP2.CEL

DH001_ATH1_A7.MPG1.CEL
DT002_ATH1_Pollen.CEL
Li_Control_3.1.cel
Li_Control_6.1.cel
Li_Control_6.2.cel
Nakabayashi_DS1.cel
Nakabayashi_DS2.cel
Preston_chip.1.dry.seed.CEL
Preston_chip.2.dry.seed.CEL
VB001_ATH1_A10.Bwoll.Col2.CEL

ATGE_93_A.CEL
ATGE_93_B.CEL
DH001_ATH1_A7.MPG1.CEL
Goda_II_3DT3h.1.CEL
Goda_II_3DT3h.2.CEL
Goda_I_MJ3.2.CEL
HY001_ATH1_A1.Yap.AMF.CEL
MH001_ATH1_A12.grevi.AT3.CEL
MH001_ATH1_A9.grevi.CT3.CEL
MJ001_ATH1_A1.jones.WT1.CEL

MJ001_ATH1_A2.jones.WT2.CEL
MJ001_ATH1_A3.jones.rh1.CEL


MJ001_ATH1_A4.jones.rh2.CEL


SF001_ATH1_A4.Fille.ANGR4.12.dex.CEL




SF002_ATH1_A6.Fille.WT.dex.CEL



ATGE_29_A2.CEL
ATGE_29_B2.CEL
ATGE_29_C2.CEL
ATGE_31_A2.CEL
ATGE_32_A2.CEL
ATGE_32_B2.CEL
ATGE_32_C2.CEL
ATGE_33_A.CEL
ATGE_37_A.CEL
ATGE_45_A.CEL
ATGE_45_B.CEL
ATGE_45_C.CEL
ATGE_76_A.CEL
ATGE_76_B.CEL
ATGE_76_C.CEL
BD001_ATH1_A2.DAVIE.CON.CEL
FLOWER_GC5.cel
FLOWER_GH5.cel
Ler.0.1.CEL
Ler.0.2.CEL
ST001_ATH1_A1.MUT.Top1.CEL
ST001_ATH1_A6.WT.Top2.CEL
ZW001_ATH1_A2.Wilson.mlb.CEL

ZW002_ATH1_A2.GVB.Rep1.CEL


ATGE_36_A.CEL
ATGE_36_B.CEL
ATGE_36_C.CEL
ATGE_39_A.CEL
ATGE_39_B.CEL
ATGE_39_C.CEL
ATGE_43_A.CEL
ATGE_43_B.CEL
ATGE_43_C.CEL
ATGE_73_A.CEL
ATGE_73_B.CEL
ATGE_73_C.CEL
ATGE_76_A.CEL
ATGE_76_B.CEL
ATGE_76_C.CEL
DH001_ATH1_A3.TCP1.CEL

DH001_ATH1_A6.TCP2.CEL

DH001_ATH1_A7.MPG1.CEL
DT002_ATH1_Pollen.CEL
FLOWER_GC5.cel
FLOWER_GC6.cel
FLOWER_GH5.cel

X0021.CEL
X0022.CEL
X0121.CEL
X0122.CEL
X445.MT.CEL
ATGE_93_A.CEL
ATGE_93_B.CEL
ATGE_9_A.CEL
ATGE_9_B.CEL
HY001_ATH1_A1.Yap.AMF.CEL

JB001_ATH1_A1.1.Boyce.Kan.1.CEL

MJ001_ATH1_A1.jones.WT1.CEL

MJ001_ATH1_A2.jones.WT2.CEL


MJ001_ATH1_A3.jones.rh1.CEL
MJ001_ATH1_A4.jones.rh2.CEL

NJ001_ATH1_A7.Jor.15B.2.3.CEL


SF001_ATH1_A4.Fille.ANGR4.12.dex.CEL




SF002_ATH1_A6.Fille.WT.dex.CEL


YH001_ATH1_A2.Yap.AMF.CEL

ATGE_32_A2.CEL
ATGE_32_B2.CEL
ATGE_32_C2.CEL
ATGE_33_A.CEL
ATGE_36_A.CEL
ATGE_36_B.CEL
ATGE_36_C.CEL

BD001_ATH1_A1.DAVIE.CON.CEL

BD001_ATH1_A2.DAVIE.CON.CEL
BD001_ATH1_A3.DAVIE.T13.CEL

BD001_ATH1_A4.DAVIE.T13.CEL
FLOWER_GC5.cel
FLOWER_GC6.cel
FLOWER_GH5.cel
FLOWER_GH6.cel
ST001_ATH1_A1.MUT.Top1.CEL
ST001_ATH1_A2.MUT.Top2.CEL
ST001_ATH1_A6.WT.Top2.CEL
ZW002_ATH1_A3.GVB.Rep1.CEL


X0122.CEL
X2611.CEL
ATGE_93_A.CEL
ATGE_93_B.CEL
ATGE_9_A.CEL
ATGE_9_B.CEL
DH001_ATH1_A2.BCP1.CEL

DH001_ATH1_A4.UNM2.CEL

DH001_ATH1_A5.BCP2.CEL

DH001_ATH1_A6.TCP2.CEL
DT002_ATH1_Pollen.CEL
HY001_ATH1_A1.Yap.AMF.CEL
Nakabayashi_DS1.cel
Preston_chip.5.3hr.imbibed.seed.CEL
Preston_chip.6.3hr.imbibed.seed.CEL
SW001_ATH1_A2.Ward.ax1.CEL
Yamauchi_WT4CA.cel
ZW002_ATH1_A3.GVB.Rep1.CEL


ATGE_93_A.CEL
ATGE_93_B.CEL
Goda_II_3DT3h.1.CEL
Goda_II_3DT3h.2.CEL
Goda_I_ABA1.2.CEL
Goda_I_MJ3.2.CEL

HO001_ATH1_A2.Okamo.gpal.control.CEL


HO001_ATH1_A4.Okamo.WS.control.CEL


HY001_ATH1_A1.Yap.AMF.CEL

JC001_ATH1_A1.2.cornah.icl.CEL

JC001_ATH1_A1.3.cornah.icl.CEL
MH001_ATH1_A12.grevi.AT3.CEL
MH001_ATH1_A6.grevi.AC3.CEL
MH001_ATH1_A9.grevi.CT3.CEL
MJ001_ATH1_A1.jones.WT1.CEL

MJ001_ATH1_A2.jones.WT2.CEL
MJ001_ATH1_A3.jones.rh1.CEL




SF001_ATH1_A4.Fille.ANGR4.12.dex.CEL


YH001_ATH1_A2.Yap.AMF.CEL

ATGE_27_A.CEL
ATGE_27_B.CEL
ATGE_27_C.CEL
ATGE_28_A2.CEL
LH001_ATH1_A2.Heggi.CEG.CEL

LH001_ATH1_A3.Heggi.HAG.CEL

LH001_ATH1_A4.Heggi.HEG.CEL
RD001_ATH1_A1.deeke.tum.CEL
ST001_ATH1_A1.MUT.Top1.CEL
ST001_ATH1_A2.MUT.Top2.CEL
ST001_ATH1_A3.MUT.Base1.CEL
ST001_ATH1_A4.MUT.Base2.CEL
ST001_ATH1_A7.WT.Base1.CEL
ST001_ATH1_A8.WT.Base2.CEL
STEM_GC7.cel
STEM_GC8.cel
STEM_GH7.cel
STEM_GH8.cel

ATGE_93_A.CEL
ATGE_93_B.CEL
ATGE_9_A.CEL
ATGE_9_B.CEL
AtGen_D.10_1.FS_REP1_ATH1.CEL

AtGen_D.11_1.PS_REP1_ATH1.CEL
AtGen_D.12_1.RS_REP1_ATH1.CEL
AtGen_D.13_1.BS_REP1_ATH1.CEL
HY001_ATH1_A1.Yap.AMF.CEL
NE001_ATH1_A2.Evans.w30.CEL

NE001_ATH1_A5.Evans.m30.CEL
YH001_ATH1_A2.Yap.AMF.CEL

ATGE_28_A2.CEL
ATGE_77_D.CEL
ATGE_77_E.CEL
ATGE_78_D.CEL
ATGE_79_A.CEL
ATGE_79_B.CEL
AtGen_D.10_1.FS_REP1_ATH1.CEL

AtGen_D.11_1.PS_REP1_ATH1.CEL
AtGen_D.12_1.RS_REP1_ATH1.CEL
AtGen_D.13_1.BS_REP1_ATH1.CEL
LH001_ATH1_A2.Heggi.CEG.CEL
STEM_GH7.cel
STEM_GH8.cel

X445.MT.CEL
X456.MT.CEL
X498r.MT.CEL
ATGE_93_A.CEL
ATGE_93_B.CEL
DV001_ATH1_A1.villa.zer.CEL

DV001_ATH1_A3.villa.glc.CEL
Goda_II_3DT3h.2.CEL
Goda_I_ABA1.2.CEL
Goda_I_ABA3.2.CEL
Goda_I_MJ3.2.CEL
HY001_ATH1_A1.Yap.AMF.CEL

JB001_ATH1_A1.1.Boyce.Kan.1.CEL

JB001_ATH1_A1.2.Boyce.Kan.2.CEL
Kiba2_28.CEL
Kiba2_29.CEL
Kiba2_30.CEL
MC001_ATH1_A15.Campb.331.CEL
MH001_ATH1_A12.grevi.AT3.CEL
MH001_ATH1_A9.grevi.CT3.CEL
MJ001_ATH1_A1.jones.WT1.CEL

MJ001_ATH1_A2.jones.WT2.CEL


MJ001_ATH1_A3.jones.rh1.CEL


MJ001_ATH1_A4.jones.rh2.CEL
MR001_ATH1_A3.Rente.WS2.Control.CEL
MR001_ATH1_A4.Rente.KKO.Control.CEL
NE001_ATH1_A2.Evans.w30.CEL

NE001_ATH1_A5.Evans.m30.CEL

NJ001_ATH1_A6.Jor.15B.2.2.CEL

NJ001_ATH1_A7.Jor.15B.2.3.CEL


SF001_ATH1_A4.Fille.ANGR4.12.dex.CEL




SF002_ATH1_A6.Fille.WT.dex.CEL


YH001_ATH1_A2.Yap.AMF.CEL

ATGE_36_A.CEL
ATGE_36_B.CEL
ATGE_36_C.CEL
ATGE_79_A.CEL
ATGE_79_B.CEL
ATGE_79_C.CEL
ATGE_82_A.CEL
ATGE_82_B.CEL
ATGE_82_C.CEL
ATGE_83_A.CEL
ST001_ATH1_A3.MUT.Base1.CEL
ST001_ATH1_A7.WT.Base1.CEL
ST001_ATH1_A8.WT.Base2.CEL
STEM_GH7.cel

ATGE_93_A.CEL
ATGE_93_B.CEL
Goda_II_3DT3h.1.CEL
Goda_II_3DT3h.2.CEL

HO001_ATH1_A2.Okamo.gpal.control.CEL


HO001_ATH1_A4.Okamo.WS.control.CEL


HY001_ATH1_A1.Yap.AMF.CEL
MH001_ATH1_A12.grevi.AT3.CEL
MH001_ATH1_A9.grevi.CT3.CEL
MJ001_ATH1_A1.jones.WT1.CEL

MJ001_ATH1_A2.jones.WT2.CEL


SF001_ATH1_A4.Fille.ANGR4.12.dex.CEL


YH001_ATH1_A2.Yap.AMF.CEL

ATGE_93_A.CEL
ATGE_93_B.CEL
Goda_I_ABA1.2.CEL

HO001_ATH1_A2.Okamo.gpal.control.CEL


HO001_ATH1_A4.Okamo.WS.control.CEL


HY001_ATH1_A1.Yap.AMF.CEL
MH001_ATH1_A12.grevi.AT3.CEL
MH001_ATH1_A9.grevi.CT3.CEL


SF001_ATH1_A4.Fille.ANGR4.12.dex.CEL
SF002_ATH1_A6.Fille.WT.dex.CEL


YH001_ATH1_A2.Yap.AMF.CEL

X2421.CEL
X2521.CEL
X2611.CEL
ATGE_73_A.CEL
ATGE_73_B.CEL
ATGE_73_C.CEL
AtGen_B.26_2.5.4_REP2_ATH1.CEL

CW001_ATH1_A1.4.WestC.kub.CEL

DH001_ATH1_A3.TCP1.CEL

DH001_ATH1_A6.TCP2.CEL

DH001_ATH1_A7.MPG1.CEL
DT002_ATH1_Pollen.CEL
Nakabayashi_DS1.cel
Nakabayashi_DS2.cel
Preston_chip.1.dry.seed.CEL
Preston_chip.2.dry.seed.CEL
Preston_chip.5.3hr.imbibed.seed.CEL
Preston_chip.6.3hr.imbibed.seed.CEL

X2421.CEL
X3621.CEL
X9311.CEL
X9312.CEL
ATGE_27_B.CEL
ATGE_29_C2.CEL
AtGen_A.18_24.2_REP2_ATH1.CEL

AtGen_A.19_24.3_REP3_ATH1.CEL

AtGen_A.30_27.2_REP2_ATH1.CEL

AtGen_A.31_27.3_REP3_ATH1.CEL
BD001_ATH1_A1.DAVIE.CON.CEL

BD001_ATH1_A2.DAVIE.CON.CEL
DH001_ATH1_A1.UNM1.CEL

DH001_ATH1_A2.BCP1.CEL

DH001_ATH1_A3.TCP1.CEL

DH001_ATH1_A4.UNM2.CEL

DH001_ATH1_A5.BCP2.CEL
FLOWER_GH5.cel
MG001_ATH1_A10.Torres.5N1.CEL

MG001_ATH1_A12.Torres.5N6.CEL

MG001_ATH1_A14.Torres.4N3.CEL

SW001_ATH1_A1.Ward.ax3.CEL

ZW001_ATH1_A1.Wilson.mla.CEL


ATGE_34_A.CEL
ATGE_34_B.CEL
ATGE_34_C.CEL
ATGE_35_A.CEL
ATGE_35_B.CEL
ATGE_35_C.CEL
ATGE_36_A.CEL
ATGE_36_B.CEL
ATGE_36_C.CEL
ATGE_41_A.CEL
ATGE_41_B.CEL
ATGE_41_C.CEL
ATGE_42_B.CEL
ATGE_42_C.CEL
ATGE_42_D.CEL
ATGE_43_A.CEL
ATGE_43_B.CEL
ATGE_43_C.CEL
ATGE_45_A.CEL
ATGE_45_B.CEL
ATGE_45_C.CEL
ATGE_73_A.CEL
ATGE_73_B.CEL
ATGE_73_C.CEL

BD001_ATH1_A1.DAVIE.CON.CEL

BD001_ATH1_A2.DAVIE.CON.CEL
DH001_ATH1_A3.TCP1.CEL

DH001_ATH1_A6.TCP2.CEL

DH001_ATH1_A7.MPG1.CEL
DT002_ATH1_Pollen.CEL
FLOWER_GH5.cel
FLOWER_GH6.cel
ZW001_ATH1_A2.Wilson.mlb.CEL


X0122.CEL
X3621.CEL
ATGE_93_A.CEL
ATGE_93_B.CEL
Goda_III_CHX.3h.1.CEL
Goda_III_CHX.3h.2.CEL
Goda_II_3DT3h.1.CEL
Goda_II_3DT3h.2.CEL
Goda_I_ABA1.2.CEL

HO001_ATH1_A2.Okamo.gpal.control.CEL


HO001_ATH1_A4.Okamo.WS.control.CEL


HY001_ATH1_A1.Yap.AMF.CEL

JC001_ATH1_A1.1.cornah.icl.CEL

JC001_ATH1_A1.2.cornah.icl.CEL

JC001_ATH1_A1.3.cornah.icl.CEL
MH001_ATH1_A12.grevi.AT3.CEL
MH001_ATH1_A6.grevi.AC3.CEL
MH001_ATH1_A9.grevi.CT3.CEL
MJ001_ATH1_A1.jones.WT1.CEL

MJ001_ATH1_A2.jones.WT2.CEL
YH001_ATH1_A2.Yap.AMF.CEL

X2411.CEL
X2412.CEL
X2611.CEL
ATGE_2_A.CEL
ATGE_2_B.CEL
ATGE_2_C.CEL
ATGE_31_A2.CEL
ATGE_32_A2.CEL
ATGE_32_B2.CEL
ATGE_32_C2.CEL
ATGE_33_A.CEL
ATGE_37_A.CEL
ATGE_41_A.CEL
ATGE_41_B.CEL
ATGE_41_C.CEL
ATGE_45_A.CEL
ATGE_45_B.CEL
ATGE_45_C.CEL
AtGen_A.10_22.2_REP2_ATH1.CEL

AtGen_A.17_24.1_REP1_ATH1.CEL

AtGen_A.18_24.2_REP2_ATH1.CEL

AtGen_A.19_24.3_REP3_ATH1.CEL

AtGen_A.30_27.2_REP2_ATH1.CEL

AtGen_A.31_27.3_REP3_ATH1.CEL

AtGen_B.26_2.5.4_REP2_ATH1.CEL

AtGen_C.11_2.Pi.6_REP2_ATH1.CEL

Bc181.1.CEL
Bc482.2.CEL

JL001_ATH1_A1.LLOYD.POH.CEL

JL001_ATH1_A2.LLOYD.POH.CEL

MG001_ATH1_A10.Torres.5N1.CEL

MG001_ATH1_A12.Torres.5N6.CEL

MG001_ATH1_A14.Torres.4N3.CEL

MG001_ATH1_A25.Torres.8N1.CEL
WW002_ATH1_A1.willa.CON.REP2.CEL
WW002_ATH1_A1.willa.CON.REP3.CEL

X0122.CEL
X3421.CEL
ATGE_93_A.CEL
ATGE_93_B.CEL
ATGE_9_B.CEL

HO001_ATH1_A3.Okamo.WS.ABA.CEL


HY001_ATH1_A1.Yap.AMF.CEL

MC001_ATH1_A10.Campb.326.CEL

MC001_ATH1_A15.Campb.331.CEL
MH001_ATH1_A12.grevi.AT3.CEL
MH001_ATH1_A6.grevi.AC3.CEL
MH001_ATH1_A9.grevi.CT3.CEL
MJ001_ATH1_A1.jones.WT1.CEL

MJ001_ATH1_A2.jones.WT2.CEL


MJ001_ATH1_A3.jones.rh1.CEL


MJ001_ATH1_A4.jones.rh2.CEL
SF001_ATH1_A4.Fille.ANGR4.12.dex.CEL


YH001_ATH1_A2.Yap.AMF.CEL

ATGE_82_A.CEL
ATGE_82_B.CEL
ATGE_82_C.CEL
ATGE_83_A.CEL
Li_Control_3.1.cel
Li_Control_3.2.cel
Li_Control_6.1.cel
Li_Control_6.2.cel
Nakabayashi_DS1.cel
Nakabayashi_DS2.cel
Preston_chip.1.dry.seed.CEL
Preston_chip.2.dry.seed.CEL
Preston_chip.6.3hr.imbibed.seed.CEL
Yamauchi_WT4CA.cel

ATGE_29_A2.CEL
ATGE_29_B2.CEL
ATGE_29_C2.CEL
ATGE_31_A2.CEL
ATGE_32_A2.CEL
ATGE_32_B2.CEL
ATGE_32_C2.CEL
ATGE_37_A.CEL
ATGE_45_A.CEL
ATGE_45_B.CEL
ATGE_45_C.CEL

BD001_ATH1_A1.DAVIE.CON.CEL

BD001_ATH1_A2.DAVIE.CON.CEL
BD001_ATH1_A3.DAVIE.T13.CEL

LH001_ATH1_A1.Heggi.CAG.CEL

LH001_ATH1_A2.Heggi.CEG.CEL

LH001_ATH1_A4.Heggi.HEG.CEL
SW001_ATH1_A1.Ward.ax3.CEL

SW001_ATH1_A2.Ward.ax1.CEL


ATGE_29_A2.CEL
ATGE_29_B2.CEL
ATGE_29_C2.CEL
ATGE_31_A2.CEL
ATGE_32_A2.CEL
ATGE_32_B2.CEL
ATGE_32_C2.CEL
ATGE_33_A.CEL
ATGE_45_A.CEL
ATGE_45_B.CEL
ATGE_45_C.CEL
FLOWER_GC5.cel
ZW001_ATH1_A2.Wilson.mlb.CEL

ZW001_ATH1_A4.Wilson.Ler.CEL

ZW002_ATH1_A2.GVB.Rep1.CEL

ZW002_ATH1_A3.GVB.Rep1.CEL


X2412.CEL
ATGE_25_A.CEL
ATGE_25_B.CEL
ATGE_25_C.CEL
ATGE_29_A2.CEL
ATGE_29_B2.CEL
ATGE_29_C2.CEL
ATGE_31_A2.CEL
ATGE_32_A2.CEL
ATGE_32_B2.CEL
ATGE_32_C2.CEL
ATGE_33_A.CEL
ATGE_37_A.CEL
ATGE_41_A.CEL
ATGE_41_B.CEL
ATGE_41_C.CEL
ATGE_45_A.CEL
ATGE_45_B.CEL
ATGE_45_C.CEL
Bc482.2.CEL


JB001_ATH1_A1.Brueg.UVB.CEL


JS001_ATH1_Sen.3.new.CEL
Nakabayashi_DS1.cel
Nakabayashi_DS2.cel
Preston_chip.1.dry.seed.CEL
Preston_chip.2.dry.seed.CEL
Preston_chip.5.3hr.imbibed.seed.CEL
Preston_chip.6.3hr.imbibed.seed.CEL
T0.suc..MM2d...CEL
VB001_ATH1_A10.Bwoll.Col2.CEL
WW001_ATH1_A1.WILLA.CON.CEL
WW002_ATH1_A1.willa.CON.REP2.CEL
WW002_ATH1_A1.willa.CON.REP3.CEL

ATGE_36_A.CEL
ATGE_36_B.CEL
ATGE_36_C.CEL
ATGE_78_D.CEL
ATGE_79_A.CEL
ATGE_79_B.CEL
ATGE_79_C.CEL
ATGE_82_A.CEL
ATGE_82_B.CEL
ATGE_82_C.CEL
ATGE_83_A.CEL
DH001_ATH1_A6.TCP2.CEL


X0021.CEL
X0022.CEL
X0121.CEL
X0122.CEL
X1621.CEL
X1622.CEL
X2321.CEL
X2421.CEL
X2521.CEL
X2522.CEL
ATGE_93_A.CEL
ATGE_93_B.CEL
HY001_ATH1_A1.Yap.AMF.CEL


SF001_ATH1_A4.Fille.ANGR4.12.dex.CEL




SF002_ATH1_A6.Fille.WT.dex.CEL


YH001_ATH1_A2.Yap.AMF.CEL

ATGE_25_A.CEL
ATGE_25_B.CEL
ATGE_25_C.CEL
AtGen_A.13_23.1_REP1_ATH1.CEL

AtGen_A.14_23.2_REP2_ATH1.CEL

AtGen_A.16_23.4_REP3_ATH1.CEL

Bc482.1.CEL

Bc482.2.CEL
DT002_ATH1_Pollen.CEL
JS001_ATH1.Sen.4..CEL

JS001_ATH1_Sen.3.new.CEL

MG001_ATH1_A25.Torres.8N1.CEL
VB001_ATH1_A10.Bwoll.Col2.CEL

ATGE_29_A2.CEL
ATGE_29_B2.CEL
ATGE_29_C2.CEL
ATGE_31_A2.CEL
ATGE_32_A2.CEL
ATGE_32_B2.CEL
ATGE_32_C2.CEL
ATGE_33_A.CEL
ATGE_35_A.CEL
ATGE_35_B.CEL
ATGE_36_A.CEL
ATGE_36_B.CEL
ATGE_36_C.CEL
ATGE_37_A.CEL
ATGE_4_A.CEL
ATGE_4_B.CEL
ATGE_4_C.CEL
Col_0_1.cel
Ler.0.1.CEL
Ler.0.2.CEL
Ler.3.2.CEL
Li_Control_3.1.cel
Li_Control_3.2.cel
Nakabayashi_ABA3.1.cel
Nakabayashi_Imb24.1.cel


X0050_2504_ARTH1_204.CEL

X0050_2506_ARTH1_201.CEL

AtGen_A.18_24.2_REP2_ATH1.CEL

AtGen_A.19_24.3_REP3_ATH1.CEL

AtGen_A.30_27.2_REP2_ATH1.CEL

AtGen_A.31_27.3_REP3_ATH1.CEL
AtGen_B.15_2.1.1_REP2_ATH1.CEL
AtGen_B.16_2.2.1_REP2_ATH1.CEL
AtGen_B.29_3.1.1_REP3_ATH1.CEL
AtGen_B.37_3.2.4_REP3_ATH1.CEL

AtGen_C.11_2.Pi.6_REP2_ATH1.CEL

AtGen_C.12_3.Pi.6_REP3_ATH1.CEL
GW001_ATH1_A21.Warre.00f.CEL
Goda_III_AgNO3.3h.2.CEL

HO001_ATH1_A3.Okamo.WS.ABA.CEL


MG001_ATH1_A12.Torres.5N6.CEL
MG001_ATH1_A14.Torres.4N3.CEL


ATGE_36_A.CEL
ATGE_36_B.CEL
ATGE_36_C.CEL
ATGE_39_A.CEL
ATGE_39_B.CEL
ATGE_39_C.CEL
ATGE_43_A.CEL
ATGE_43_B.CEL
ATGE_43_C.CEL
ATGE_73_A.CEL
ATGE_73_B.CEL
ATGE_73_C.CEL
ATGE_76_A.CEL
ATGE_76_B.CEL
ATGE_76_C.CEL
DH001_ATH1_A3.TCP1.CEL

DH001_ATH1_A6.TCP2.CEL

DH001_ATH1_A7.MPG1.CEL
DT002_ATH1_Pollen.CEL
FLOWER_GC5.cel
FLOWER_GC6.cel
FLOWER_GH5.cel

X0022.CEL
X0121.CEL
X0122.CEL
X1622.CEL
ATGE_2_A.CEL
ATGE_2_B.CEL
ATGE_2_C.CEL
ATGE_93_A.CEL
ATGE_9_A.CEL
ATGE_9_B.CEL
AtGen_D.10_1.FS_REP1_ATH1.CEL

AtGen_D.11_1.PS_REP1_ATH1.CEL
AtGen_D.12_1.RS_REP1_ATH1.CEL
AtGen_D.13_1.BS_REP1_ATH1.CEL
HY001_ATH1_A1.Yap.AMF.CEL
Nakabayashi_DS1.cel
Nakabayashi_DS2.cel
Preston_chip.1.dry.seed.CEL
Preston_chip.2.dry.seed.CEL
Preston_chip.5.3hr.imbibed.seed.CEL
Preston_chip.6.3hr.imbibed.seed.CEL


SF001_ATH1_A4.Fille.ANGR4.12.dex.CEL


Yamauchi_WT4CA.cel

X7411.CEL
X7412.CEL
ATGE_25_A.CEL
ATGE_25_B.CEL
ATGE_25_C.CEL
ATGE_41_A.CEL
ATGE_41_B.CEL
ATGE_41_C.CEL
ATGE_73_A.CEL
AtGen_A.11_22.3_REP3_ATH1.CEL

AtGen_A.13_23.1_REP1_ATH1.CEL

AtGen_A.14_23.2_REP2_ATH1.CEL

AtGen_A.16_23.4_REP3_ATH1.CEL

Bc482.1.CEL

Bc482.2.CEL

DH001_ATH1_A3.TCP1.CEL

DH001_ATH1_A6.TCP2.CEL
GW001_ATH1_A23.Warre.03f.CEL
GW001_ATH1_A24.Warre.03f.CEL
JS001_ATH1.Sen.4..CEL

JS001_ATH1_Sen.3.new.CEL
MG001_ATH1_A25.Torres.8N1.CEL
Nakabayashi_DS1.cel
Nakabayashi_DS2.cel
Preston_chip.1.dry.seed.CEL
Preston_chip.2.dry.seed.CEL
Preston_chip.5.3hr.imbibed.seed.CEL
Preston_chip.6.3hr.imbibed.seed.CEL
VB001_ATH1_A10.Bwoll.Col2.CEL

X0021.CEL
X0022.CEL
X0121.CEL
X0122.CEL
X3621.CEL
ATGE_9_A.CEL
ATGE_9_B.CEL
Goda_I_ABA3.2.CEL
Goda_I_MJ3.2.CEL

HO001_ATH1_A2.Okamo.gpal.control.CEL


HO001_ATH1_A4.Okamo.WS.control.CEL


HY001_ATH1_A1.Yap.AMF.CEL

MC001_ATH1_A1.Campb.317.CEL

MC001_ATH1_A13.Campb.329.new..CEL

MC001_ATH1_A14.Campb.330.new..CEL
MH001_ATH1_A12.grevi.AT3.CEL
MH001_ATH1_A6.grevi.AC3.CEL
MH001_ATH1_A9.grevi.CT3.CEL
MJ001_ATH1_A1.jones.WT1.CEL

MJ001_ATH1_A2.jones.WT2.CEL
YH001_ATH1_A2.Yap.AMF.CEL
Yamauchi_WT22CB.cel

X0022.CEL
X0122.CEL
X445.MT.CEL
X498r.MT.CEL
ATGE_2_A.CEL
ATGE_93_A.CEL
ATGE_93_B.CEL
ATGE_9_A.CEL
ATGE_9_B.CEL
AtGen_D.10_1.FS_REP1_ATH1.CEL

AtGen_D.11_1.PS_REP1_ATH1.CEL
AtGen_D.12_1.RS_REP1_ATH1.CEL
AtGen_D.13_1.BS_REP1_ATH1.CEL
DV001_ATH1_A1.villa.zer.CEL

DV001_ATH1_A3.villa.glc.CEL

HY001_ATH1_A1.Yap.AMF.CEL

JB001_ATH1_A1.1.Boyce.Kan.1.CEL

JB001_ATH1_A1.2.Boyce.Kan.2.CEL

MJ001_ATH1_A1.jones.WT1.CEL

MJ001_ATH1_A2.jones.WT2.CEL


MJ001_ATH1_A3.jones.rh1.CEL


MJ001_ATH1_A4.jones.rh2.CEL

NE001_ATH1_A2.Evans.w30.CEL

NE001_ATH1_A5.Evans.m30.CEL


SF001_ATH1_A4.Fille.ANGR4.12.dex.CEL


YH001_ATH1_A2.Yap.AMF.CEL

X1512.CEL
X1611.CEL
X1612.CEL
X7411.CEL
X7412.CEL
ATGE_25_A.CEL
ATGE_25_B.CEL
ATGE_25_C.CEL
ATGE_41_A.CEL
ATGE_41_B.CEL
ATGE_41_C.CEL
AtGen_A.13_23.1_REP1_ATH1.CEL

AtGen_A.14_23.2_REP2_ATH1.CEL

AtGen_A.16_23.4_REP3_ATH1.CEL

Bc482.1.CEL

Bc482.2.CEL
GW001_ATH1_A23.Warre.03f.CEL
JS001_ATH1_Sen.3.new.CEL

MG001_ATH1_A25.Torres.8N1.CEL
MR001_ATH1_A1.Rente.WS2.HO.CEL
MR001_ATH1_A2.Rente.KKO.HO.CEL
NE001_ATH1_A3.Evans.w40.CEL

NE001_ATH1_A6.Evans.m40.CEL

RW001_ATH1_A.04.Kruger.WH1.CEL
SS002_ATH1_A7.smith.13h.CEL
VB001_ATH1_A10.Bwoll.Col2.CEL

X2611.CEL
X3321.CEL
X3322.CEL
X7411.CEL
ATGE_25_A.CEL
ATGE_25_B.CEL
ATGE_25_C.CEL
Bc181.1.CEL
D1.growth..MM2d...CEL
D3.growth..MM2d...CEL
JS001_ATH1.Heat.4..CEL

JS001_ATH1_Control.3.new.CEL
T10.suc..MM2d...CEL
T12.suc..MM2d...CEL
T4.suc..MM2d...CEL
WW001_ATH1_A2.WILLA.ISOX.CEL
WW002_ATH1_A2.willa.ISOX.REP2.CEL
WW002_ATH1_A2.willa.ISOX.REP3.CEL

ATGE_73_C.CEL
DH001_ATH1_A6.TCP2.CEL

DH001_ATH1_A7.MPG1.CEL
DT002_ATH1_Pollen.CEL
FM001_ATH1_A2.MILL.ETH.REP2.CEL

JS001_ATH1.Heat.4..CEL

JS001_ATH1.Sen.4..CEL

JS001_ATH1_Heat.3.new.CEL

LH001_ATH1_A7.Heggi.HAW.CEL

MC001_ATH1_A1.Campb.317.CEL

MC001_ATH1_A17.Campb.333.CEL

MJ001_ATH1_A2.jones.WT2.CEL
PU001_ATH1_A1.Urwin.Con.CEL
VB001_ATH1_A10.Bwoll.Col2.CEL

X337.MT.CEL
X3412.CEL
X343.MT.CEL
X498r.MT.CEL
ATGE_28_A2.CEL
ATGE_29_A2.CEL
ATGE_29_B2.CEL
ATGE_29_C2.CEL
ATGE_31_A2.CEL
ATGE_32_A2.CEL
ATGE_32_B2.CEL
ATGE_32_C2.CEL
ATGE_37_A.CEL
ATGE_4_A.CEL
ATGE_4_B.CEL
ATGE_4_C.CEL
Col_0_1.cel
Goda_I_ABA1.2.CEL
JB001_ATH1_A1.1.Boyce.Kan.1.CEL
Ler.0.1.CEL
Ler.0.2.CEL
Ler.3.2.CEL
NJ001_ATH1_A6.Jor.15B.2.2.CEL

NJ001_ATH1_A7.Jor.15B.2.3.CEL


ATGE_29_A2.CEL
ATGE_29_B2.CEL
ATGE_29_C2.CEL
ATGE_31_A2.CEL
ATGE_32_A2.CEL
ATGE_32_B2.CEL
ATGE_32_C2.CEL
ATGE_33_A.CEL
ATGE_37_A.CEL
ATGE_45_A.CEL
ATGE_45_B.CEL
ATGE_45_C.CEL
ATGE_76_A.CEL
ATGE_76_B.CEL
BD001_ATH1_A2.DAVIE.CON.CEL
Col_0_1.cel
FLOWER_GH5.cel
LH001_ATH1_A3.Heggi.HAG.CEL
Ler.0.1.CEL
Ler.0.2.CEL
Ler.3.2.CEL

ATGE_2_A.CEL
ATGE_2_B.CEL
ATGE_2_C.CEL
ATGE_9_A.CEL
ATGE_9_B.CEL
D1.growth..MM2d...CEL
D7.growth..MM2d...CEL
JS001_ATH1.Control.4..CEL

JS001_ATH1.Sen.4..CEL

JS001_ATH1_Control.3.new.CEL

JS001_ATH1_Heat.3.new.CEL
MD001_ATH1_A1.Diamo.Fum.CEL
MD001_ATH1_A1.Diamo.met.CEL
MD001_ATH1_A2.Diamo.Fum.CEL
MD001_ATH1_A2.Diamo.met.CEL
STEM_GH8.cel
T2.suc..MM2d...CEL
T4.suc..MM2d...CEL
WW002_ATH1_A1.willa.CON.REP2.CEL

X2611.CEL
ATGE_2_A.CEL
ATGE_2_B.CEL
ATGE_2_C.CEL
ATGE_32_A2.CEL
ATGE_32_B2.CEL
ATGE_32_C2.CEL
ATGE_33_A.CEL
ATGE_37_A.CEL
ATGE_41_A.CEL
ATGE_41_B.CEL
ATGE_41_C.CEL
ATGE_45_A.CEL
ATGE_45_B.CEL
ATGE_45_C.CEL
AtGen_A.14_23.2_REP2_ATH1.CEL

AtGen_C.11_2.Pi.6_REP2_ATH1.CEL

Bc181.1.CEL

Bc482.1.CEL
Bc482.2.CEL
Col_0_1.cel
Ler.0.1.CEL
Ler.0.2.CEL
Ler.3.2.CEL
MG001_ATH1_A10.Torres.5N1.CEL

MG001_ATH1_A12.Torres.5N6.CEL

MG001_ATH1_A25.Torres.8N1.CEL
Nakabayashi_DS2.cel
Preston_chip.1.dry.seed.CEL
Preston_chip.6.3hr.imbibed.seed.CEL

ATGE_19_C.CEL
ATGE_27_A.CEL
ATGE_27_B.CEL
ATGE_27_C.CEL
ATGE_28_A2.CEL
DB001_ATH1_A2.Brown.cal.CEL

HY001_ATH1_A1.Yap.AMF.CEL

LH001_ATH1_A2.Heggi.CEG.CEL

LH001_ATH1_A3.Heggi.HAG.CEL

LH001_ATH1_A4.Heggi.HEG.CEL


MJ001_ATH1_A3.jones.rh1.CEL


PU001_ATH1_A1.Urwin.Con.CEL
RD001_ATH1_A1.deeke.tum.CEL
RD001_ATH1_A3.deeke.tum.CEL
ST001_ATH1_A1.MUT.Top1.CEL
ST001_ATH1_A2.MUT.Top2.CEL
ST001_ATH1_A3.MUT.Base1.CEL
ST001_ATH1_A4.MUT.Base2.CEL
ST001_ATH1_A7.WT.Base1.CEL
ST001_ATH1_A8.WT.Base2.CEL
STEM_GC7.cel
STEM_GC8.cel
STEM_GH7.cel
STEM_GH8.cel
YH001_ATH1_A2.Yap.AMF.CEL

ATGE_32_B2.CEL
ATGE_36_A.CEL
ATGE_36_B.CEL
ATGE_36_C.CEL
ATGE_73_A.CEL
ATGE_73_B.CEL
ATGE_73_C.CEL
DH001_ATH1_A3.TCP1.CEL

DH001_ATH1_A6.TCP2.CEL
DT002_ATH1_Pollen.CEL
ST001_ATH1_A1.MUT.Top1.CEL
ST001_ATH1_A2.MUT.Top2.CEL
ST001_ATH1_A6.WT.Top2.CEL
ZW001_ATH1_A1.Wilson.mla.CEL

ZW002_ATH1_A3.GVB.Rep1.CEL


X0021.CEL
X0022.CEL
X0121.CEL
X0122.CEL
X1621.CEL
ATGE_93_A.CEL
CW001_ATH1_A1.4.WestC.kub.CEL

HY001_ATH1_A1.Yap.AMF.CEL
Kiba2_25.CEL
Kiba2_26.CEL
Kiba2_27.CEL
Kiba2_28.CEL
Kiba2_29.CEL


MJ001_ATH1_A3.jones.rh1.CEL
MJ001_ATH1_A4.jones.rh2.CEL

NJ001_ATH1_A6.Jor.15B.2.2.CEL
YH001_ATH1_A2.Yap.AMF.CEL

X0021.CEL
X0022.CEL
X0121.CEL
X0122.CEL
X1621.CEL
X2321.CEL
X2421.CEL
X2521.CEL
X2522.CEL
X3621.CEL
X9321.CEL
AtGen_D.10_1.FS_REP1_ATH1.CEL

AtGen_D.11_1.PS_REP1_ATH1.CEL
AtGen_D.12_1.RS_REP1_ATH1.CEL
AtGen_D.13_1.BS_REP1_ATH1.CEL
HY001_ATH1_A1.Yap.AMF.CEL


SF001_ATH1_A4.Fille.ANGR4.12.dex.CEL


YH001_ATH1_A2.Yap.AMF.CEL

ATGE_25_A.CEL
ATGE_25_B.CEL
ATGE_25_C.CEL
ATGE_27_A.CEL
ATGE_27_B.CEL
ATGE_27_C.CEL
ATGE_39_A.CEL
ATGE_39_B.CEL
ATGE_39_C.CEL
ATGE_93_A.CEL
MJ001_ATH1_A1.jones.WT1.CEL

MJ001_ATH1_A2.jones.WT2.CEL
MJ001_ATH1_A4.jones.rh2.CEL
ST001_ATH1_A4.MUT.Base2.CEL

ATGE_25_A.CEL
ATGE_25_B.CEL
ATGE_25_C.CEL
ATGE_41_A.CEL
ATGE_41_B.CEL
ATGE_41_C.CEL
AtGen_A.10_22.2_REP2_ATH1.CEL

AtGen_A.11_22.3_REP3_ATH1.CEL

AtGen_A.14_23.2_REP2_ATH1.CEL

AtGen_A.17_24.1_REP1_ATH1.CEL

AtGen_C.10_1.Pi.6_REP1_ATH1.CEL

AtGen_C.12_3.Pi.6_REP3_ATH1.CEL

Bc482.1.CEL
C8_1.CEL

JB001_ATH1_A1.Brueg.UVB.CEL


JS001_ATH1.Sen.4..CEL

JS001_ATH1_Sen.3.new.CEL
Nakabayashi_DS1.cel
Nakabayashi_DS2.cel
Preston_chip.1.dry.seed.CEL
Preston_chip.2.dry.seed.CEL
Preston_chip.5.3hr.imbibed.seed.CEL
Preston_chip.6.3hr.imbibed.seed.CEL
VB001_ATH1_A10.Bwoll.Col2.CEL
Yamauchi_WT4CA.cel

ATGE_27_A.CEL
ATGE_27_B.CEL
ATGE_27_C.CEL
ATGE_28_A2.CEL
ATGE_34_A.CEL
ATGE_34_B.CEL
ATGE_34_C.CEL
ATGE_40_A.CEL
ATGE_79_A.CEL
ATGE_79_B.CEL
ATGE_79_C.CEL
ATGE_81_B.CEL
ATGE_82_C.CEL
C0_1.CEL
C0_2.CEL
Li_Control_6.1.cel
Nakabayashi_ABA3.1.cel
Nakabayashi_ABA3.2.cel
Nakabayashi_DS1.cel
Nakabayashi_DS2.cel
Nakabayashi_Imb24.1.cel
Nakabayashi_Imb24.2.cel
Preston_chip.5.3hr.imbibed.seed.CEL
Preston_chip.6.3hr.imbibed.seed.CEL
ST001_ATH1_A7.WT.Base1.CEL
ZW002_ATH1_A2.GVB.Rep1.CEL


JC001_ATH1_A1.1.cornah.icl.CEL

JC001_ATH1_A1.2.cornah.icl.CEL

MC001_ATH1_A1.Campb.317.CEL

MC001_ATH1_A10.Campb.326.CEL

MC001_ATH1_A11.Campb.327.CEL

MC001_ATH1_A12.Campb.328.new..CEL

MC001_ATH1_A14.Campb.330.new..CEL

MC001_ATH1_A15.Campb.331.CEL

MC001_ATH1_A17.Campb.333.CEL
Nakabayashi_ABA3.1.cel
Nakabayashi_Imb24.1.cel
Nakabayashi_Imb24.2.cel
Yamauchi_WT4CB.cel

X2321.CEL
X2421.CEL
ATGE_41_A.CEL
ATGE_41_B.CEL
ATGE_41_C.CEL
ATGE_42_B.CEL
ATGE_42_C.CEL
ATGE_42_D.CEL
ATGE_43_A.CEL
ATGE_43_B.CEL
ATGE_43_C.CEL
ATGE_79_A.CEL
ATGE_79_B.CEL
ATGE_79_C.CEL
ATGE_81_B.CEL
ATGE_82_A.CEL
ATGE_82_B.CEL
ATGE_82_C.CEL
ATGE_83_A.CEL

X0021.CEL
X0022.CEL
X0121.CEL
X0122.CEL
X1621.CEL
X2321.CEL
X2421.CEL
X2521.CEL
X2522.CEL
X3321.CEL
X3322.CEL
X3621.CEL
ATGE_93_A.CEL
ATGE_93_B.CEL
HY001_ATH1_A1.Yap.AMF.CEL


SF001_ATH1_A4.Fille.ANGR4.12.dex.CEL
SF002_ATH1_A6.Fille.WT.dex.CEL


YH001_ATH1_A2.Yap.AMF.CEL

X0022.CEL
X0122.CEL
ATGE_93_A.CEL
ATGE_93_B.CEL
Goda_II_3DT3h.1.CEL
Goda_II_3DT3h.2.CEL

HO001_ATH1_A2.Okamo.gpal.control.CEL


HO001_ATH1_A4.Okamo.WS.control.CEL


HY001_ATH1_A1.Yap.AMF.CEL
MH001_ATH1_A12.grevi.AT3.CEL
MH001_ATH1_A6.grevi.AC3.CEL
MH001_ATH1_A9.grevi.CT3.CEL
MJ001_ATH1_A1.jones.WT1.CEL

MJ001_ATH1_A2.jones.WT2.CEL


SF001_ATH1_A4.Fille.ANGR4.12.dex.CEL


YH001_ATH1_A2.Yap.AMF.CEL

X2412.CEL
X7411.CEL
ATGE_29_A2.CEL
ATGE_29_B2.CEL
ATGE_29_C2.CEL
ATGE_31_A2.CEL
ATGE_32_A2.CEL
ATGE_32_B2.CEL
ATGE_32_C2.CEL
ATGE_33_A.CEL
ATGE_37_A.CEL
ATGE_45_A.CEL
ATGE_45_B.CEL
ATGE_45_C.CEL
ATGE_76_A.CEL
ATGE_76_B.CEL
ATGE_76_C.CEL
Ler.3.2.CEL
Nakabayashi_DS1.cel
Nakabayashi_DS2.cel
Preston_chip.1.dry.seed.CEL
Preston_chip.2.dry.seed.CEL
Preston_chip.5.3hr.imbibed.seed.CEL
Preston_chip.6.3hr.imbibed.seed.CEL
VB001_ATH1_A10.Bwoll.Col2.CEL

X0021.CEL
X0121.CEL
X0122.CEL
X3421.CEL
X445.MT.CEL
X452.MT.CEL
X456.MT.CEL
ATGE_93_A.CEL
ATGE_93_B.CEL
ATGE_9_A.CEL
ATGE_9_B.CEL
DV001_ATH1_A1.villa.zer.CEL

DV001_ATH1_A3.villa.glc.CEL
Goda_II_3DT3h.1.CEL
Goda_II_3DT3h.2.CEL
Goda_I_MJ3.2.CEL

HO001_ATH1_A1.Okamo.gpal.ABA.CEL


HO001_ATH1_A3.Okamo.WS.ABA.CEL


HY001_ATH1_A1.Yap.AMF.CEL

JC001_ATH1_A1.1.cornah.icl.CEL

JC001_ATH1_A1.2.cornah.icl.CEL
JC001_ATH1_A1.3.cornah.icl.CEL

MC001_ATH1_A14.Campb.330.new..CEL
MH001_ATH1_A12.grevi.AT3.CEL
MH001_ATH1_A6.grevi.AC3.CEL
MH001_ATH1_A9.grevi.CT3.CEL
MJ001_ATH1_A1.jones.WT1.CEL

MJ001_ATH1_A2.jones.WT2.CEL


MJ001_ATH1_A3.jones.rh1.CEL


MJ001_ATH1_A4.jones.rh2.CEL


SF001_ATH1_A4.Fille.ANGR4.12.dex.CEL




SF002_ATH1_A6.Fille.WT.dex.CEL


YH001_ATH1_A2.Yap.AMF.CEL

X0021.CEL
X0022.CEL
X0121.CEL
X0122.CEL
ATGE_93_A.CEL
ATGE_93_B.CEL
ATGE_9_A.CEL
ATGE_9_B.CEL
AtGen_D.10_1.FS_REP1_ATH1.CEL

AtGen_D.11_1.PS_REP1_ATH1.CEL
AtGen_D.12_1.RS_REP1_ATH1.CEL
AtGen_D.13_1.BS_REP1_ATH1.CEL
Goda_I_ABA3.2.CEL
Goda_I_ABA3.3.CEL
HO001_ATH1_A3.Okamo.WS.ABA.CEL


JB001_ATH1_A1.1.Boyce.Kan.1.CEL

JB001_ATH1_A1.2.Boyce.Kan.2.CEL

MC001_ATH1_A10.Campb.326.CEL

MC001_ATH1_A15.Campb.331.CEL

MC001_ATH1_A17.Campb.333.CEL
MH001_ATH1_A12.grevi.AT3.CEL
MH001_ATH1_A9.grevi.CT3.CEL
MJ001_ATH1_A1.jones.WT1.CEL

MJ001_ATH1_A2.jones.WT2.CEL


MJ001_ATH1_A3.jones.rh1.CEL


MJ001_ATH1_A4.jones.rh2.CEL


SF001_ATH1_A4.Fille.ANGR4.12.dex.CEL
Conditional descriptions


col-0age(21+_days)internodeshoot_
col-0age(21+_days)internodeshoot_
col-0age(21+_days)internodeshoot_
col-0age(21+_days)nodeshoot_
inflorescence stem base
inflorescence stem base
controlled system (29 days); age (29 days ); stem
controlled system (29 days); age (29 days ); stem
greenhouse (29 days); age (29 days ); stem
greenhouse (29 days); age (29 days ); stem

col-0age(21+_days)cauline_leaf_
col-0age(21+_days)cauline_leaf_
col-0age(21+_days)cauline_leaf_
col-0age(6_weeks)pollen_
col-0age(6_weeks)pollen_
col-0age(6_weeks)pollen_
OrganismPart: Pollen Ecotype: Ler-0 GeneticModification: None NASC:Growth Stage:
5.10 NASC:StockCode: NW20
OrganismPart: Pollen Ecotype: Ler-0 GeneticModification: None NASC:Growth Stage:
5.10 NASC:StockCode: NW20
OrganismPart: Pollen Ecotype: Ler-0 GeneticModification: None NASC:Growth Stage:
5.10 NASC:StockCode: NW20
OrganismPart: Pollen Ecotype: Ler-0 GeneticModification: None NASC:Growth Stage:
5.10 NASC:StockCode: NW20
OrganismPart: Pollen Ecotype: Ler-0 GeneticModification: None NASC:Growth Stage:
5.10 NASC:StockCode: NW20
OrganismPart: Pollen Ecotype: Ler-0 GeneticModification: None NASC:Growth Stage:
5.10 NASC:StockCode: NW20
seed germination water (3 hours)
seed germination water (6 hours)
MYB761 Knockout, Plant Cell 13, 2777-2791 Overexpressor GROWTHCONDITIONS
Dark DEVELOPMENTSTAGE 0.7 Whole Plant
MYB761 Knockout, Plant Cell 13, 2777-2791 Overexpressor GROWTHCONDITIONS
Dark DEVELOPMENTSTAGE 0.7 Whole Plant
MYB61 Overexpressor GROWTHCONDITIONS Dark DEVELOPMENTSTAGE 0.7 Whole
Plant
seed imbibition ABA (3 uM, 24 hours)
seed imbibition ABA (3 uM, 24 hours)
24 h imbibed in water imbibed seeds water (48 hours)
24 h imbibed in water imbibed seeds water (48 hours)
seeds dry seed stage cold (4 C, 96 hr )
seeds dry seed stage cold (4 C, 96 hr )

col-0age(17_days)petiole_
col-0age(17_days)petiole_
col-0age(17_days)petiole_
col-0age(21+_days)internodeshoot_
col-0age(21+_days)internodeshoot_
col-0age(21+_days)internodeshoot_
col-0age(21+_days)nodeshoot_
col-0age(15_days)root_
col-0age(17_days)root_
col-0age(17_days)root_
cotyledon ; hypocotyl seedling growth light wavelength (far-red light, 45 minutes)
cotyledon ; hypocotyl seedling growth light regime (continuous darkness, 44
minutes) light wavelength (red light, 1 minutes)
cotyledon ; hypocotyl seedling growth light wavelength (red light, 45 minutes)
cotyledon ; hypocotyl seedling growth light wavelength (blue light, 45 minutes)
OrganismPart: Cell culture Age time point: 9 day timepoint Ecotype: Ler
NASC:StockCode: NW20
total roots (primary and all lateral )
OrganismPart: Small excised segments of primary root tissue corresponding to root-
hair elongation zone Ecotype: Columbia GeneticModification: EMS mutant, Plant Cell
(1990) 2:235-243 NASC:Growth Stage: 1.02 NASC:StockCode: N2259 StrainOrLine:
rhd2-1
Small excised segments of primary root tissue corresponding to root-hair elongation
Stock Code: N1093 Developmental stage: 6.1 Tissue: lateral roots
Tumour
Tumour
OrganismPart: root Ecotype: C24 GeneticModification: Transgenic plant carrying
ANR1::rGR fusion under the 35S promoter control. The ANR1::rGR fusion is stongly
expressed in this line. NASC:Growth Stage: 1.02 NASC:StockCode: StrainOrLine:
Working overexpressor
controlled system (29 days); age (29 days ); stem
controlled system (29 days); age (29 days ); stem
greenhouse (29 days); age (29 days ); stem
col-0age(7_days)root_

col-0age(35_days)senescence_leaf_
col-0age(35_days)senescence_leaf_
col-0age(35_days)senescence_leaf_
col-0age(21+_days)sepalstage_15_flower_
col-0age(21+_days)sepalstage_15_flower_
col-0age(21+_days)sepalstage_15_flower_
vascular leaf late rosette growth Pseudomonas syringae pv. tomato avrRpm1 (10e8
cfu/ml ) time after treatment (2 hours)
vascular leaf late rosette growth Pseudomonas syringae pv. tomato avrRpm1 (10e8
cfu/ml ) time after treatment (6 hours)
vascular leaf rosette growth Botrytis cinerea (5X10^5 spores/ml ) time after
treatment (18 hours)
vascular leaf rosette growth Botrytis cinerea (5X10^5 spores/ml ) time after
treatment (48 hours)
vascular leaf rosette growth Botrytis cinerea (5X10^5 spores/ml ) time after
treatment (48 hours)
whole plant 7-day-old seedlings Methyl Jasmonate (10 uM, 3 hours)
Stock Code: N2614 Developmental stage: 6.0 Tissue: Rosette leaves Genetic
background: ws-2 Genetic variation: T-DNA insert
Stock Code: N2614 Developmental stage: 6.0 Tissue: Rosette leaves Genetic
background: ws-2 Genetic variation: T-DNA insert
whole plant 21-day-old plants, vegetative stage no treatment
whole plant 21-day-old plants, vegetative stage no treatment
whole leaves
OrganismPart: Whole leaf Age time point: 4 hours Ecotype: col-5 NASC:Growth
Stage: 3.90 NASC:StockCode: N1688
OrganismPart: Whole leaf Age time point: 4 hours Ecotype: col-5 NASC:Growth
Stage: 3.90 NASC:StockCode: N1688
Stock Code: N1093 Developmental stage: 6.1 Tissue: lateral roots
fully expanded leaves

col-0age(8_weeks)heart_embryo_
col-0age(8_weeks)heart_embryo_
col-0age(8_weeks)triangle_embryo_
col-0age(8_weeks)early_curled_cotyledon_
col-0age(8_weeks)early_curled_cotyledon_
col-0age(8_weeks)early_curled_cotyledon_
col-0age(8_weeks)early_green_cotyledon_
seed germination water (3 hours)
seed germination water (6 hours)
seed germination water (6 hours)
seed imbibition ABA (3 uM, 24 hours)
no treatment dry seeds
no treatment dry seeds
seed dry seed stage no treatment
seed dry seed stage no treatment
seed imbibition water (3 hours)
seeds dry seed stage average daily temperature (22 C, 96 hr )
seeds dry seed stage cold (4 C, 96 hr )

cold_control_30min_root no treatment root
col-0age(15_days)root_
col-0age(15_days)root_
col-0age(17_days)root_
col-0age(17_days)root_
cotyledon ; hypocotyl seedling growth light wavelength (far-red light, 45 minutes)
cotyledon ; hypocotyl seedling growth light regime (continuous darkness, 44
minutes) light wavelength (red light, 1 minutes)
cotyledon ; hypocotyl seedling growth light wavelength (red light, 45 minutes)
cotyledon ; hypocotyl seedling growth light wavelength (blue light, 45 minutes)
total roots (primary and all lateral )
seed germination water (3 hours)
seed germination water (3 hours)
seed germination water (6 hours)
seed germination water (6 hours)
seed imbibition ABA (3 uM, 24 hours)
seed imbibition ABA (3 uM, 24 hours)
24 h imbibed in water imbibed seeds water (48 hours)
Inflorescence stalk
OrganismPart: root Ecotype: C24 GeneticModification: Transgenic plant carrying
ANR1::rGR fusion under the 35S promoter control. The ANR1::rGR fusion is stongly
expressed in this line. NASC:Growth Stage: 1.02 NASC:StockCode: StrainOrLine:
Working overexpressor
OrganismPart: root Ecotype: C24 GeneticModification: Transgenic plant carrying
ANR1::rGR fusion under the 35S promoter control. The ANR1::rGR fusion is stongly
expressed in this line. NASC:Growth Stage: 1.02 NASC:StockCode: StrainOrLine:
Working overexpressor
seeds dry seed stage cold (4 C, 96 hr )
seeds dry seed stage cold (4 C, 96 hr )

cold_control_0min_root no treatment root
cold_control_30min_root no treatment root
cold_control_30min_root no treatment root
osmotic_24h_shoot mannitol (300 mM, 24 hours) shoot
col-0age(35_days)senescence_leaf_
col-0age(35_days)senescence_leaf_
col-0age(35_days)senescence_leaf_
col-0age(21+_days)cauline_leaf_
col-0age(21+_days)cauline_leaf_
col-0age(21+_days)cauline_leaf_
col-0age(7_days)hypocotyl_
col-0age(7_days)hypocotyl_
col-0age(21+_days)sepalstage_15_flower_
col-0age(21+_days)sepalstage_15_flower_
col-0age(21+_days)sepalstage_15_flower_
col-0age(8_weeks)early_green_cotyledon_
cotyledon ; hypocotyl seedling growth light wavelength (far-red light, 45 minutes)
cotyledon ; hypocotyl seedling growth light regime (continuous darkness, 44
minutes) light wavelength (red light, 1 minutes)
cotyledon ; hypocotyl seedling growth light wavelength (red light, 45 minutes)
cotyledon ; hypocotyl seedling growth light wavelength (blue light, 45 minutes)
heat_1h_38C_cell_culture
seed imbibition water (3 hours)
seed imbibition water (3 hours)
cultured cell early stationary phase time after drug removal (2 hours)
fully expanded leaves
seeds dry seed stage cold (4 C, 96 hr )

col-0age(21+_days)stamen_
col-0age(21+_days)stamen_
col-0age(21+_days)stamen_
col-0age(21+_days)stage_15_flowerstamen_
col-0age(21+_days)stage_15_flowerstamen_
col-0age(21+_days)stage_15_flowerstamen_
col-0age(6_weeks)pollen_
col-0age(6_weeks)pollen_
col-0age(6_weeks)pollen_
col-0age(8_weeks)globular_embryo_
col-0age(8_weeks)globular_embryo_
col-0age(8_weeks)globular_embryo_
ms1ttg-old Flower


cold (4 C, 12 hours) root
cold (4 C, 12 hours) root
shoot system seedling growth MT-7dC(soil) cold (4C, 7 days)
salt_6h_shoot NaCl (150 mM, 6 hours) shoot
shoot system seedling growth MT-7dC(soil) cold (4C, 7 days)
whole plants seedling growth MT-WT(zat12) gl1
col-0age(17_days)petiole_
col-0age(21+_days)nodeshoot_
col-0age(21_days)inflorescencestage_1-6_flower_
col-0age(21_days)inflorescencestage_1-6_flower_
col-0age(21_days)inflorescencestage_1-6_flower_
col-0age(21+_days)stage_9_flower_
col-0age(21+_days)stage_10-11_flower_
col-0age(21+_days)stage_10-11_flower_
col-0age(21+_days)stage_10-11_flower_
col-0age(21+_days)carpel_
col-0age(7_days)leafshoot_apex_
col-0age(7_days)leafshoot_apex_
col-0age(7_days)leafshoot_apex_
shoot apex rosette stage KB9 line
All aerial tissue
whole plant 7-day-old seedlings ABA (10 uM, 1 hours)
OrganismPart: whole seedling Ecotype: Col-0 GeneticModification: Aequorin
transgene NASC:StockCode: StrainOrLine: aeq+
shoot apex rosette stage
shoot apex rosette stage
shoot apex rosette stage KB31 line photoperiod (16 hr, 3 days)
OrganismPart: total tissue Ecotype: Ler GeneticModification: EMS Mutant of N1695
NASC:Growth Stage: 1.04 NASC:StockCode: StrainOrLine: 15B

col-0age(21+_days)stage_9_flower_
col-0age(21+_days)stage_10-11_flower_
col-0age(21+_days)stage_10-11_flower_
col-0age(21+_days)stage_10-11_flower_
col-0age(21+_days)stage_12_flower_
col-0age(21+_days)carpel_
col-0age(21+_days)carpelstage_15_flower_
col-0age(21+_days)carpelstage_15_flower_
col-0age(21+_days)carpelstage_15_flower_
col-0age(7_days)leafshoot_apex_
shoot apex rosette stage KB9 line
shoot apex rosette stage
shoot apex rosette stage KB31 line photoperiod (16 hr, 3 days)

col-0age(15_days)root_
col-0age(15_days)root_
whole plant 7-day-old seedlings cycloheximide (10 uM, 3 hours)
whole plant 7-day-old seedlings cycloheximide (10 uM, 3 hours)
whole plant 7-day-old seedlings 3-dehydroteasterone (1 uM, 3 hours)
OrganismPart: whole seedling Ecotype: col-7 NASC:StockCode: N3731
OrganismPart: whole seedling Ecotype: col-7 NASC:StockCode: N3731
OrganismPart: whole seedling Ecotype: col-7 NASC:StockCode: N3731
Small excised segments of primary root tissue corresponding to root-hair elongation
zone
Small excised segments of primary root tissue corresponding to root-hair elongation
zone
Small excised segments of primary root tissue corresponding to root-hair elongation
OrganismPart: root Ecotype: C24 GeneticModification: Transgenic plant carrying
ANR1::rGR fusion under the 35S promoter control. The ANR1::rGR fusion is stongly
expressed in this line. NASC:Growth Stage: 1.02 NASC:StockCode: StrainOrLine:
Working overexpressor

col-0age(15_days)root_
col-0age(15_days)root_
col-0age(17_days)root_
col-0age(17_days)root_
cotyledon ; hypocotyl seedling growth light wavelength (far-red light, 45 minutes)
cotyledon ; hypocotyl seedling growth light regime (continuous darkness, 44
minutes) light wavelength (red light, 1 minutes)
cotyledon ; hypocotyl seedling growth light wavelength (red light, 45 minutes)
cotyledon ; hypocotyl seedling growth light wavelength (blue light, 45 minutes)
total roots (primary and all lateral )
MYB761 Knockout, Plant Cell 13, 2777-2791 Overexpressor GROWTHCONDITIONS
Dark DEVELOPMENTSTAGE 0.7 Whole Plant
MYB61 Overexpressor GROWTHCONDITIONS Dark DEVELOPMENTSTAGE 0.7 Whole
Plant
MYB61 Overexpressor GROWTHCONDITIONS Dark DEVELOPMENTSTAGE 0.7 Whole
Plant
OrganismPart: Small excised segments of primary root tissue corresponding to root-
hair elongation zone Ecotype: Columbia GeneticModification: EMS mutant, Plant Cell
(1990) 2:235-243 NASC:Growth Stage: 1.02 NASC:StockCode: N2259 StrainOrLine:
rhd2-1
col-0age(7_days)root_

cold_control_0min_root no treatment root
cold_control_30min_root no treatment root
col-0age(15_days)root_
col-0age(15_days)root_
col-0age(17_days)root_
col-0age(17_days)root_
cotyledon ; hypocotyl seedling growth light wavelength (far-red light, 45 minutes)
cotyledon ; hypocotyl seedling growth light regime (continuous darkness, 44
minutes) light wavelength (red light, 1 minutes)
cotyledon ; hypocotyl seedling growth light wavelength (red light, 45 minutes)
cotyledon ; hypocotyl seedling growth light wavelength (blue light, 45 minutes)
whole plant 7-day-old seedlings 3-dehydroteasterone (1 uM, 3 hours)
whole plant 7-day-old seedlings 3-dehydroteasterone (1 uM, 3 hours)
OrganismPart: whole plant Ecotype: ws-2 NASC:Growth Stage: 10-day-old whole
plant NASC:StockCode: N1601 Experiment: Comparative transcriptome analysis
between wild-type and gpa1 mutant in response to ABA
OrganismPart: whole plant Ecotype: ws-2 NASC:Growth Stage: 10-day-old whole
plant NASC:StockCode: N1601 Experiment: Comparative transcriptome analysis
between wild-type and gpa1 mutant in response to ABA
total roots (primary and all lateral )
OrganismPart: whole seedling Ecotype: col-7 NASC:StockCode: N3731
OrganismPart: whole seedling Ecotype: col-7 NASC:StockCode: N3731
col-0age(7_days)root_

col-0age(21+_days)stage_9_flower_
col-0age(21+_days)stage_10-11_flower_
col-0age(21+_days)stage_10-11_flower_
col-0age(21+_days)stage_10-11_flower_
col-0age(21+_days)stage_12_flower_
col-0age(21+_days)carpelstage_15_flower_
col-0age(21+_days)carpelstage_15_flower_
OrganismPart: inflorescence Ecotype: ws NASC:Growth Stage: 6.0
OrganismPart: inflorescence Ecotype: ws NASC:Growth Stage: 6.0

OrganismPart: inflorescence Ecotype: ws NASC:Growth Stage: 6.0
controlled system (29 days); age (29 days ); flower
shoot apex rosette stage
shoot apex rosette stage
inflorescence stem tip
inflorescence stem tip
inflorescence stem tip
ms1ttg-old Flower

Old Flower Buds

Old Flower Buds

Young Flower Buds


col-0age(21+_days)stage_10-11_flower_
col-0age(21+_days)stage_10-11_flower_
col-0age(21+_days)stage_10-11_flower_
col-0age(21+_days)stamen_
col-0age(21+_days)stamen_
col-0age(21+_days)stamen_
col-0age(6_weeks)pollen_
col-0age(6_weeks)pollen_
col-0age(6_weeks)pollen_
OrganismPart: Pollen Ecotype:    Ler-0 GeneticModification: None NASC:Growth Stage:
5.10 NASC:StockCode: NW20
OrganismPart: Pollen Ecotype:    Ler-0 GeneticModification: None NASC:Growth Stage:
5.10 NASC:StockCode: NW20
OrganismPart: Pollen Ecotype:    Ler-0 GeneticModification: None NASC:Growth Stage:
5.10 NASC:StockCode: NW20
OrganismPart: Pollen Ecotype:    Ler-0 GeneticModification: None NASC:Growth Stage:
5.10 NASC:StockCode: NW20
OrganismPart: Pollen Ecotype:    Ler-0 GeneticModification: None NASC:Growth Stage:
5.10 NASC:StockCode: NW20
OrganismPart: Pollen Ecotype:    Ler-0 GeneticModification: None NASC:Growth Stage:
5.10 NASC:StockCode: NW20

cold_control_0min_root no treatment root
cold_control_0min_root no treatment root
cold_control_30min_root no treatment root
whole plants seedling growth MT-p15-8 35S::ZAP12
whole plants seedling growth MT-WT24h(plate) cold (4C, 24 hours)
col-0age(15_days)root_
col-0age(15_days)root_
the entire seedlings;Identification of genes responsive to non-metabolised glucose
analoges as an approach to hexokinase-independent glucose sensing in plants
total roots (primary and all lateral )
OrganismPart: whole seedling Ecotype: Col-0 GeneticModification: Aequorin
transgene NASC:StockCode: StrainOrLine: aeq+
OrganismPart: whole seedling Ecotype: Col-0 GeneticModification: Aequorin
transgene NASC:StockCode: StrainOrLine: aeq+
whole plant 21-day-old plants, vegetative stage no treatment
whole plant 21-day-old plants, vegetative stage no treatment
whole plant 21-day-old plants, vegetative stage no treatment
MYB61 Overexpressor GROWTHCONDITIONS Dark DEVELOPMENTSTAGE 0.7 Whole
Plant
Small excised segments of primary root tissue corresponding to root-hair elongation
zone
Small excised segments of primary root tissue corresponding to root-hair elongation
zone
OrganismPart: Small excised segments of primary root tissue corresponding to root-
hair elongation zone Ecotype: Columbia GeneticModification: EMS mutant, Plant Cell
(1990) 2:235-243 NASC:Growth Stage: 1.02 NASC:StockCode: N2259 StrainOrLine:
rhd2-1
Small excised segments of primary root tissue corresponding to root-hair elongation
Whole seedlings
Whole seedlings
Growth Room 16 hour days Seedlings were floated on distilled water at 30 degrees
centigrade, then blotted on tissue and frozen in liquid nitrogen
Growth Room 16 hour days Seedlings were floated on distilled water at 30 degrees
centigrade, then blotted on tissue and frozen in liquid nitrogen
OrganismPart: total tissue Ecotype: Ler GeneticModification: EMS Mutant of N1695
NASC:Growth Stage: 1.04 NASC:StockCode: StrainOrLine: 15B
OrganismPart: total tissue Ecotype: Ler GeneticModification: EMS Mutant of N1695
NASC:Growth Stage: 1.04 NASC:StockCode: StrainOrLine: 15B
OrganismPart: root Ecotype: C24 GeneticModification: Transgenic plant carrying
ANR1::rGR fusion under the 35S promoter control. The ANR1::rGR fusion is stongly
expressed in this line. NASC:Growth Stage: 1.02 NASC:StockCode: StrainOrLine:
Working overexpressor
OrganismPart: root Ecotype: C24 GeneticModification: Transgenic plant carrying
ANR1::rGR fusion under the 35S promoter control. The ANR1::rGR fusion is stongly
expressed in this line. NASC:Growth Stage: 1.02 NASC:StockCode: StrainOrLine:
Working overexpressor
col-0age(7_days)root_

cold_control_0min_root no treatment root
cold_control_30min_root no treatment root
heat_3h_root
heat_3h_root
col-0age(17_days)root_
col-0age(17_days)root_
whole plant 7-day-old seedlings 3-dehydroteasterone (1 uM, 3 hours)
whole plant 7-day-old seedlings 3-dehydroteasterone (1 uM, 3 hours)
whole plant 7-day-old seedlings ABA (10 uM, 1 hours)
OrganismPart: whole plant Ecotype: ws-2 NASC:Growth Stage: 10-day-old whole
plant NASC:StockCode: N1601 Experiment: Comparative transcriptome analysis
between wild-type and gpa1 mutant in response to ABA
OrganismPart: whole plant Ecotype: ws-2 NASC:Growth Stage: 10-day-old whole
plant NASC:StockCode: N1601 Experiment: Comparative transcriptome analysis
between wild-type and gpa1 mutant in response to ABA
Small excised segments of primary root tissue corresponding to root-hair elongation
zone
Small excised segments of primary root tissue corresponding to root-hair elongation
zone
Small excised segments of primary root tissue corresponding to root-hair elongation


col-0age(8_weeks)torpedo_embryo_
col-0age(8_weeks)torpedo_embryo_
col-0age(8_weeks)torpedo_embryo_
col-0age(8_weeks)walking-stick_seed_
col-0age(8_weeks)early_curled_cotyledon_
col-0age(8_weeks)early_curled_cotyledon_
col-0age(8_weeks)early_curled_cotyledon_
col-0age(8_weeks)early_green_cotyledon_
seed germination water (3 hours)
seed germination water (6 hours)
MYB761 Knockout, Plant Cell 13, 2777-2791 Overexpressor GROWTHCONDITIONS
Dark DEVELOPMENTSTAGE 0.7 Whole Plant
MYB61 Overexpressor GROWTHCONDITIONS Dark DEVELOPMENTSTAGE 0.7 Whole
Plant
no treatment dry seeds
Stock Code: N1093 Developmental stage: 6.1 Tissue: lateral roots
seed dry seed stage no treatment
seed dry seed stage no treatment
seed imbibition water (3 hours)
seeds dry seed stage average daily temperature (22 C, 96 hr )

osmotic_24h_shoot mannitol (300 mM, 24 hours) shoot
col-0age(35_days)senescence_leaf_
col-0age(35_days)senescence_leaf_
col-0age(35_days)senescence_leaf_
col-0age(21+_days)cauline_leaf_
col-0age(21+_days)cauline_leaf_
col-0age(21+_days)cauline_leaf_
col-0age(21+_days)sepalstage_15_flower_
col-0age(21+_days)sepalstage_15_flower_
col-0age(21+_days)sepalstage_15_flower_
no treatment dry seeds
seed dry seed stage no treatment
seed dry seed stage no treatment
seed imbibition water (3 hours)
seed imbibition water (3 hours)

vascular leaf late rosette growth Pseudomonas syringae pv. tomato avrRpm1 (10e8
cfu/ml ) time after treatment (2 hours)
vascular leaf late rosette growth Pseudomonas syringae pv. tomato avrRpm1 (10e8
cfu/ml ) time after treatment (2 hours)
cultured cell time after subculture (7 days)
All aerial tissue
All aerial tissue
Programmed Cell Death Control
Programmed Cell Death Heat

Programmed Cell Death Senescence

Programmed Cell Death Control

Programmed Cell Death Heat

Programmed Cell Death Senescence
whole plant 21-day-old plants, vegetative stage no treatment
whole plant 21-day-old plants, vegetative stage no treatment
whole leaves
Stock Code: NW20     Tissue: Cell   culture
Stock Code: NW20     Tissue: Cell   culture
Stock Code: NW20     Tissue: Cell   culture
Stock Code: NW20     Tissue: Cell   culture
OrganismPart: Cell   suspension
OrganismPart: Cell   suspension
OrganismPart: Cell   suspension

cold_control_0min_root no treatment root
cold_control_0min_root no treatment root
cold_control_30min_root no treatment root
cold_control_30min_root no treatment root
whole plants seedling growth MT-p15-8 35S::ZAP12
col-0age(7_days)hypocotyl_
col-0age(15_days)root_
col-0age(15_days)root_
col-0age(17_days)root_
col-0age(17_days)root_
the entire seedlings;Identification of genes responsive to non-metabolised glucose
analoges as an approach to hexokinase-independent glucose sensing in plants
the entire seedlings;Identification of genes responsive to non-metabolised glucose
analoges as an approach to hexokinase-independent glucose sensing in plants
whole plant 7-day-old seedlings Methyl Jasmonate (10 uM, 3 hours)
total roots (primary and all lateral )
OrganismPart: whole seedling Ecotype: Col-0 GeneticModification:         Aequorin
transgene NASC:StockCode: StrainOrLine: aeq+
OrganismPart: whole seedling Ecotype: Col-0 GeneticModification:         Aequorin
transgene NASC:StockCode: StrainOrLine: aeq+
whole plant 21-day-old plants, vegetative stage no treatment
MYB761 Knockout, Plant Cell 13, 2777-2791 Overexpressor GROWTHCONDITIONS
Dark DEVELOPMENTSTAGE 0.7 Whole Plant
MYB761 Knockout, Plant Cell 13, 2777-2791 Overexpressor GROWTHCONDITIONS
Dark DEVELOPMENTSTAGE 0.7 Whole Plant
MYB61 Overexpressor GROWTHCONDITIONS Dark DEVELOPMENTSTAGE 0.7 Whole
Plant
Small excised segments of primary root tissue corresponding to root-hair elongation
zone
Small excised segments of primary root tissue corresponding to root-hair elongation
zone
OrganismPart: Small excised segments of primary root tissue corresponding to root-
hair elongation zone Ecotype: Columbia GeneticModification: EMS mutant, Plant Cell
(1990) 2:235-243 NASC:Growth Stage: 1.02 NASC:StockCode: N2259 StrainOrLine:
rhd2-1
Small excised segments of primary root tissue corresponding to root-hair elongation
OrganismPart: total tissue Ecotype: Ler GeneticModification: EMS Mutant of N1695
NASC:Growth Stage: 1.04 NASC:StockCode: StrainOrLine: 15B
OrganismPart: total tissue Ecotype: Ler GeneticModification: EMS Mutant of N1695
NASC:Growth Stage: 1.04 NASC:StockCode: StrainOrLine: 15B
OrganismPart: root Ecotype: C24 GeneticModification: Transgenic plant carrying
ANR1::rGR fusion under the 35S promoter control. The ANR1::rGR fusion is stongly
expressed in this line. NASC:Growth Stage: 1.02 NASC:StockCode: StrainOrLine:
Working overexpressor
OrganismPart: root Ecotype: C24 GeneticModification: Transgenic plant carrying
ANR1::rGR fusion under the 35S promoter control. The ANR1::rGR fusion is stongly
expressed in this line. NASC:Growth Stage: 1.02 NASC:StockCode: StrainOrLine:
Working overexpressor
col-0age(7_days)root_

cold_control_0min_root no treatment root
cold_control_0min_root no treatment root
cold_control_30min_root no treatment root
cold_control_30min_root no treatment root
salt_6h_shoot NaCl (150 mM, 6 hours) shoot
whole plants seedling growth MT-WT(zat12) gl1
col-0age(17_days)petiole_
col-0age(21+_days)nodeshoot_
col-0age(21_days)inflorescencestage_1-6_flower_
col-0age(21_days)inflorescencestage_1-6_flower_
col-0age(21_days)inflorescencestage_1-6_flower_
col-0age(21+_days)stage_9_flower_
col-0age(21+_days)stage_10-11_flower_
col-0age(21+_days)stage_10-11_flower_
col-0age(21+_days)stage_10-11_flower_
col-0age(21+_days)carpel_
col-0age(21+_days)stage_15_flower_
col-0age(7_days)leafshoot_apex_
col-0age(7_days)leafshoot_apex_
col-0age(7_days)leafshoot_apex_
col-0age(17_days)root_
col-0age(17_days)root_
shoot apex rosette stage KB9 line
whole plant 7-day-old seedlings 3-dehydroteasterone (1 uM, 3 hours)
whole plant 7-day-old seedlings ABA (10 uM, 1 hours)
OrganismPart: whole plant Ecotype: ws-2 NASC:Growth Stage: 10-day-old whole
plant NASC:StockCode: N1601 Experiment: Comparative transcriptome analysis
between wild-type and gpa1 mutant in response to ABA
total roots (primary and all lateral )
OrganismPart: whole seedling Ecotype: Col-0 GeneticModification: Aequorin
transgene NASC:StockCode: StrainOrLine: aeq+
shoot apex rosette stage
shoot apex rosette stage
shoot apex rosette stage KB31 line photoperiod (16 hr, 3 days)
OrganismPart: total tissue Ecotype: Ler GeneticModification: EMS Mutant of N1695
NASC:Growth Stage: 1.04 NASC:StockCode: StrainOrLine: 15B
col-0age(7_days)root_
ms1ttg-old Flower

Old Flower Buds


cold_control_30min_root no treatment root
col-0age(15_days)root_
col-0age(17_days)root_
col-0age(17_days)root_
cotyledon ; hypocotyl seedling growth light wavelength (far-red light, 45 minutes)
cotyledon ; hypocotyl seedling growth light regime (continuous darkness, 44
minutes) light wavelength (red light, 1 minutes)
cotyledon ; hypocotyl seedling growth light wavelength (red light, 45 minutes)
cotyledon ; hypocotyl seedling growth light wavelength (blue light, 45 minutes)
total roots (primary and all lateral )
OrganismPart: root Ecotype: C24 GeneticModification: Transgenic plant carrying
ANR1::rGR fusion under the 35S promoter control. The ANR1::rGR fusion is stongly
expressed in this line. NASC:Growth Stage: 1.02 NASC:StockCode: StrainOrLine:
Working overexpressor
col-0age(7_days)root_
col-0age(6_weeks)pollen_
vascular leaf late rosette growth Pseudomonas syringae pv. tomato DC3000 (10e8
cfu/ml ) time after treatment (24 hours)
Developmental stage: 1.02 Tissue: hypocotyls; cotyledons;meristems; true leaves 1
and 2; true leaves primordial initals Genetic background: wild-type
OrganismPart: Pollen Ecotype: Ler-0 GeneticModification: None NASC:Growth Stage:
5.10 NASC:StockCode: NW20
OrganismPart: Pollen Ecotype: Ler-0 GeneticModification: None NASC:Growth Stage:
5.10 NASC:StockCode: NW20
col-0age(6_weeks) pollen_
OrganismPart: whole seedling Ecotype: Col-0 GeneticModification: Aequorin
transgene NASC:StockCode: StrainOrLine: aeq+
Stock Code: N1688 Developmental stage: 3.90: Rosette Growth Complete Tissue:
whole above ground rosettes
whole seedlings
Stock Code: N2614 Developmental stage: 6.0 Tissue: Rosette leaves Genetic
background: ws-2 Genetic variation: T-DNA insert
OrganismPart: Whole leaf Age time point: 4 hours Ecotype: col-5 NASC:Growth
Stage: 3.90 NASC:StockCode: N1688
OrganismPart: whole seedling Ecotype: col-7 NASC:StockCode: N3731
OrganismPart: whole seedling Ecotype: col-7 NASC:StockCode: N3731
Small excised segments of primary root tissue corresponding to root-hair elongation
zone
OrganismPart: root Ecotype: C24 GeneticModification: Transgenic plant carrying
ANR1::rGR fusion under the 35S promoter control. The ANR1::rGR fusion is stongly
expressed in this line. NASC:Growth Stage: 1.02 NASC:StockCode: StrainOrLine:
Working overexpressor
inflorescence stem base
inflorescence stem base
controlled system (29 days); age (29 days ); stem
greenhouse (29 days); age (29 days ); stem
fully expanded leaves
OrganismPart: Cell suspension
OrganismPart: Cell suspension
OrganismPart: Cell suspension

Developmental stage: 1.02 Tissue: hypocotyls; cotyledons;meristems; true leaves 1
and 2; true leaves primordial initals Genetic background: wild-type
OrganismPart: Pollen Ecotype: Ler-0 GeneticModification: None NASC:Growth Stage:
5.10 NASC:StockCode: NW20
OrganismPart: Pollen Ecotype: Ler-0 GeneticModification: None NASC:Growth Stage:
5.10 NASC:StockCode: NW20
OrganismPart: Pollen Ecotype: Ler-0 GeneticModification: None NASC:Growth Stage:
5.10 NASC:StockCode: NW20
OrganismPart: Pollen Ecotype: Ler-0 GeneticModification: None NASC:Growth Stage:
5.10 NASC:StockCode: NW20
whole seedlings

whole seedlings

whole seedlings

Guard Cell enriched leaves
shoot apex rosette stage
shoot apex rosette stage KB31 line photoperiod (16 hr, 3 days)
seed germination water (3 hours)
seed germination water (3 hours)
seed germination water (6 hours)
seed germination water (6 hours)
MYB61 Overexpressor GROWTHCONDITIONS Dark DEVELOPMENTSTAGE 0.7 Whole
Plant
Whole seedlings
Whole seedlings
Stock Code: N3076 Tissue: axillary buds approx. 2 mm elongated Genetic
background: col-0 Genetic variation: EMS
seeds dry seed stage cold (4 C, 96 hr )

osmotic_24h_shoot mannitol (300 mM, 24 hours) shoot
col-0age(7_days)hypocotyl_
col-0age(7_days)hypocotyl_
col-0age(7_days)hypocotyl_
col-0age(21+_days)stage_9_flower_
col-0age(21+_days)stage_10-11_flower_
col-0age(21+_days)stage_10-11_flower_
col-0age(21+_days)stage_10-11_flower_
col-0age(21+_days)stage_12_flower_
col-0age(21+_days)sepalstage_15_flower_
col-0age(21+_days)sepalstage_15_flower_
col-0age(21+_days)sepalstage_15_flower_
col-0age(21+_days)carpelstage_15_flower_
col-0age(21+_days)carpelstage_15_flower_
col-0age(21+_days)carpelstage_15_flower_
vascular leaf late rosette growth Pseudomonas syringae pv. tomato DC3000 (10e8
cfu/ml ); time after treatment (6 hours)
vascular leaf late rosette growth Pseudomonas syringae pv. tomato avrRpm1 (10e8
cfu/ml ) time after treatment (2 hours)
vascular leaf late rosette growth Pseudomonas syringae pv. tomato avrRpm1 (10e8
cfu/ml ) time after treatment (2 hours)
vascular leaf late rosette growth Pseudomonas syringae pv. tomato avrRpm1 (10e8
cfu/ml ) time after treatment (2 hours)
vascular leaf late rosette growth Pseudomonas syringae pv. tomato DC3000 hrcC-
(10e8 cfu/ml ) time after treatment (2 hours)
vascular leaf late rosette growth Pseudomonas syringae pv. tomato DC3000 hrcC-
(10e8 cfu/ml ) time after treatment (2 hours)
vascular leaf late rosette growth GST-Necrosis-inducing Phytophthora Protein 1 (1
uM ) time after treatment (4 hours)
vascular leaf late rosette growth Phytophthora infestans (10^6 spores/ml ) time
after treatment (6 hours)
vascular leaf late rosette growth Phytophthora infestans (10^6 spores/ml ) time
after treatment (6 hours)
vascular leaf rosette growth Botrytis cinerea (5X10^5 spores/ml ) time after
treatment (18 hours)
vascular leaf rosette growth Botrytis cinerea (5X10^5 spores/ml ) time after
treatment (48 hours)
vascular leaf rosette growth Botrytis cinerea (5X10^5 spores/ml ) time after
treatment (48 hours)
shoot apex rosette stage KB9 line
Stock Code: N2614 Developmental stage: 6.0 Tissue: Rosette leaves Genetic
background: ws-2 Genetic variation: T-DNA insert
Stock Code: N2614 Developmental stage: 6.0 Tissue: Rosette leaves Genetic
background: ws-2 Genetic variation: T-DNA insert
shoot apex rosette stage
shoot apex rosette stage
shoot apex rosette stage KB31 line photoperiod (16 hr, 3 days)
OrganismPart: Whole leaf Age time point: 4 hours Ecotype: col-5 NASC:Growth
Stage: 3.90 NASC:StockCode: N1688
OrganismPart: Whole leaf Age time point: 4 hours Ecotype: col-5 NASC:Growth
Stage: 3.90 NASC:StockCode: N1688
OrganismPart: Whole leaf Age time point: 4 hours Ecotype: col-5 NASC:Growth
Stage: 3.90 NASC:StockCode: N1688
OrganismPart: Whole leaf Age time point: 4 hours Ecotype: col-5 NASC:Growth
Stage: 3.90 NASC:StockCode: N1688
OrganismPart: Cell suspension
OrganismPart: Cell suspension

col-0age(21+_days)stage_9_flower_
col-0age(21+_days)stage_10-11_flower_
col-0age(21+_days)stage_10-11_flower_
col-0age(21+_days)stage_10-11_flower_
OrganismPart: inflorescence Ecotype: ws NASC:Growth Stage: 6.0
OrganismPart: inflorescence Ecotype: ws NASC:Growth Stage: 6.0
controlled system (29 days); age (29 days ); flower
controlled system (29 days); age (29 days ); flower
greenhouse (29 days);age (29 days ); flower
inflorescence stem tip
Stock Code: N3076 Tissue: axillary buds approx. 2 mm elongated Genetic
background: col-0 Genetic variation: EMS
Stock Code: N3076 Tissue: axillary buds approx. 2 mm elongated Genetic
background: col-0 Genetic variation: EMS

col-0age(21+_days)sepal_
col-0age(21+_days)sepal_
col-0age(21+_days)sepal_
col-0age(21+_days)petal_
col-0age(21+_days)petal_
col-0age(21+_days)petal_
col-0age(21+_days)stamen_
col-0age(21+_days)stamen_
col-0age(21+_days)stamen_
col-0age(21+_days)sepalstage_15_flower_
col-0age(21+_days)sepalstage_15_flower_
col-0age(21+_days)sepalstage_15_flower_
col-0age(21+_days)petalstage_15_flower_
col-0age(21+_days)petalstage_15_flower_
col-0age(21+_days)petalstage_15_flower_
col-0age(21+_days)stage_15_flowerstamen_
col-0age(21+_days)stage_15_flowerstamen_
col-0age(21+_days)stage_15_flowerstamen_
col-0age(21+_days)carpelstage_15_flower_
col-0age(21+_days)carpelstage_15_flower_
col-0age(21+_days)carpelstage_15_flower_
col-0age(6_weeks)pollen_
col-0age(6_weeks)pollen_
col-0age(6_weeks)pollen_

OrganismPart: inflorescence Ecotype: ws NASC:Growth Stage: 6.0

OrganismPart: inflorescence Ecotype: ws NASC:Growth Stage: 6.0
OrganismPart: Pollen Ecotype: Ler-0 GeneticModification: None NASC:Growth Stage:
5.10 NASC:StockCode: NW20
OrganismPart: Pollen Ecotype: Ler-0 GeneticModification: None NASC:Growth Stage:
5.10 NASC:StockCode: NW20
OrganismPart: Pollen Ecotype: Ler-0 GeneticModification: None NASC:Growth Stage:
5.10 NASC:StockCode: NW20
col-0age(6_weeks) pollen_
greenhouse (29 days);age (29 days ); flower
ms1ttg-old Flower


time after treatment (6 hours) light wavelength (UV-B light, 6 hours) shoot
time after treatment (6 hours) light wavelength (UV-B light, 6 hours) shoot
col-0age(35_days)senescence_leaf_
col-0age(35_days)senescence_leaf_
col-0age(35_days)senescence_leaf_
col-0age(21+_days)sepalstage_15_flower_
col-0age(21+_days)sepalstage_15_flower_
col-0age(21+_days)sepalstage_15_flower_
All aerial tissue
Programmed Cell Death Senescence
no treatment dry seeds
no treatment dry seeds
seed dry seed stage no treatment
seed dry seed stage no treatment
seed imbibition water (3 hours)
seed imbibition water (3 hours)
fully expanded leaves

col-0age(21+_days)carpel_
col-0age(21+_days)carpelstage_15_flower_
col-0age(21+_days)carpelstage_15_flower_
col-0age(21+_days)carpelstage_15_flower_
col-0age(8_weeks)globular_embryo_
col-0age(8_weeks)globular_embryo_
col-0age(8_weeks)globular_embryo_
col-0age(8_weeks)heart_embryo_
col-0age(8_weeks)heart_embryo_
col-0age(8_weeks)heart_embryo_
col-0age(8_weeks)triangle_embryo_
col-0age(8_weeks)torpedo_embryo_
col-0age(8_weeks)torpedo_embryo_
col-0age(8_weeks)torpedo_embryo_

heat_3h_38C_3h_recover_cell_culture
heat_3h_38C_3h_recover_cell_culture
cultured cell time after subculture (1 days)
cultured cell time after subculture (3 days)
cultured cell time after subculture (5 days)
cultured cell time after subculture (7 days)
Programmed Cell Death Control

Programmed Cell Death Heat

Programmed Cell Death Control

Programmed Cell Death Heat
Stock Code: NW20 Tissue: Cell culture
Stock Code: NW20 Tissue: Cell culture
Stock Code: NW20 Tissue: Cell culture
Stock Code: NW20 Tissue: Cell culture
cultured cell early stationary phase time after drug removal (0 hours)
cultured cell mid-exponential phase sucrose (3%, 10 hours)
cultured cell mid-exponential phase sucrose (3%, 12 hours)
cultured cell early stationary phase sucrose (3%, 2 hours)
cultured cell early stationary phase sucrose (3%, 4 hours)


OrganismPart: inflorescence Ecotype: ws NASC:Growth Stage: 6.0

OrganismPart: Pollen Ecotype: Ler-0 GeneticModification: None NASC:Growth Stage:
5.10 NASC:StockCode: NW20
col-0age(6_weeks) pollen_
controlled system (29 days); age (29 days ); flower
greenhouse (29 days);age (29 days ); flower
whole seedlings

Guard Cell enriched leaves
MYB761 Knockout, Plant Cell 13, 2777-2791 Overexpressor GROWTHCONDITIONS
Dark DEVELOPMENTSTAGE 0.7 Whole Plant
MYB61 Overexpressor GROWTHCONDITIONS Dark DEVELOPMENTSTAGE 0.7 Whole
Plant
Stock Code: N1093 Developmental stage: 6.1 Tissue: lateral roots
controlled system (29 days); age (29 days ); stem

col-0age(21+_days)sepal_
col-0age(21+_days)sepal_
col-0age(21+_days)sepal_
col-0age(6_weeks)pollen_
col-0age(6_weeks)pollen_
OrganismPart: Pollen Ecotype: Ler-0 GeneticModification: None NASC:Growth Stage:
5.10 NASC:StockCode: NW20
OrganismPart: Pollen Ecotype: Ler-0 GeneticModification: None NASC:Growth Stage:
5.10 NASC:StockCode: NW20
OrganismPart: Pollen Ecotype: Ler-0 GeneticModification: None NASC:Growth Stage:
5.10 NASC:StockCode: NW20
OrganismPart: Pollen Ecotype: Ler-0 GeneticModification: None NASC:Growth Stage:
5.10 NASC:StockCode: NW20
OrganismPart: Pollen Ecotype: Ler-0 GeneticModification: None NASC:Growth Stage:
5.10 NASC:StockCode: NW20
OrganismPart: Pollen Ecotype: Ler-0 GeneticModification: None NASC:Growth Stage:
5.10 NASC:StockCode: NW20
OrganismPart: Pollen Ecotype: Ler-0 GeneticModification: None NASC:Growth Stage:
5.10 NASC:StockCode: NW20
controlled system (29 days); age (29 days ); flower
controlled system (29 days); age (29 days ); flower
MYB761 Knockout, Plant Cell 13, 2777-2791 Overexpressor GROWTHCONDITIONS
Dark DEVELOPMENTSTAGE 0.7 Whole Plant
MYB61 Overexpressor GROWTHCONDITIONS Dark DEVELOPMENTSTAGE 0.7 Whole
Plant
MYB61 Overexpressor GROWTHCONDITIONS Dark DEVELOPMENTSTAGE 0.7 Whole
Plant
ms1ttg-old Flower

Old Flower Buds


cold_control_0min_root no treatment root
cold_control_0min_root no treatment root
cold_control_30min_root no treatment root
cold_control_30min_root no treatment root
cold (4 C, 24 hours) root
osmotic_3h_root mannitol (300 mM, 3 hours) root
osmotic_6h_root mannitol (300 mM, 6 hours) root
osmotic_12h_root mannitol (300 mM, 12 hours) root
salt_24h_root NaCl (150 mM, 24 hours) root
whole plants seedling growth MT-p15-8 35S::ZAP12
col-0age(15_days)root_
col-0age(15_days)root_
col-0age(17_days)root_
col-0age(17_days)root_
total roots (primary and all lateral )
OrganismPart: whole seedling Ecotype: Col-0         GeneticModification:   Aequorin
transgene NASC:StockCode: StrainOrLine: aeq+
OrganismPart: whole seedling Ecotype: Col-0         GeneticModification:   Aequorin
transgene NASC:StockCode: StrainOrLine: aeq+
whole plant 21-day-old plants, vegetative stage no treatment
whole plant 21-day-old plants, vegetative stage no treatment
Small excised segments of primary root tissue corresponding to root-hair elongation
zone
Small excised segments of primary root tissue corresponding to root-hair elongation
zone
Growth Room 16 hour days Seedlings were floated on distilled water at 30 degrees
centigrade, then blotted on tissue and frozen in liquid nitrogen
Growth Room 16 hour days Seedlings were floated on distilled water at 30 degrees
centigrade, then blotted on tissue and frozen in liquid nitrogen
OrganismPart: root Ecotype: C24 GeneticModification: Transgenic plant carrying
ANR1::rGR fusion under the 35S promoter control. The ANR1::rGR fusion is stongly
expressed in this line. NASC:Growth Stage: 1.02 NASC:StockCode: StrainOrLine:
Working overexpressor
OrganismPart: root Ecotype: C24 GeneticModification: Transgenic plant carrying
ANR1::rGR fusion under the 35S promoter control. The ANR1::rGR fusion is stongly
expressed in this line. NASC:Growth Stage: 1.02 NASC:StockCode: StrainOrLine:
Working overexpressor
col-0age(7_days)root_

col-0age(21+_days)internodeshoot_
col-0age(21+_days)internodeshoot_
col-0age(21+_days)internodeshoot_
col-0age(21+_days)nodeshoot_
total roots (primary and all lateral )
Stock Code: N1093 Developmental stage: 6.1 Tissue: lateral roots
Inflorescence stalk
inflorescence stem base
inflorescence stem base
inflorescence stem base
controlled system (29 days); age (29 days ); stem
controlled system (29 days); age (29 days ); stem
col-0age(7_days)root_

time after treatment (3 hours) light wavelength (UV-B   light,   3   hours)   shoot
time after treatment (3 hours) light wavelength (UV-B   light,   3   hours)   shoot
time after treatment (6 hours) light wavelength (UV-B   light,   6   hours)   shoot
time after treatment (6 hours) light wavelength (UV-B   light,   6   hours)   shoot
col-0age(21_days)inflorescencestage_1-6_flower_
col-0age(21_days)inflorescencestage_1-6_flower_
col-0age(21_days)inflorescencestage_1-6_flower_
col-0age(21+_days)stage_9_flower_
col-0age(6_weeks)pollen_
col-0age(6_weeks)pollen_
col-0age(6_weeks) pollen_
OrganismPart: root Ecotype: C24 GeneticModification: Transgenic plant carrying
ANR1::rGR fusion under the 35S promoter control. The ANR1::rGR fusion is stongly
expressed in this line. NASC:Growth Stage: 1.02 NASC:StockCode: StrainOrLine:
Working overexpressor
seeds dry seed stage cold (4 C, 96 hr )
seeds dry seed stage cold (4 C, 96 hr )

whole plants seedling growth MT-WT(zat12) gl1
vascular leaf late rosette growth Pseudomonas syringae pv. tomato avrRpm1 (10e8
cfu/ml ) time after treatment (2 hours)
vascular leaf late rosette growth Pseudomonas syringae pv. tomato DC3000 hrcC-
(10e8 cfu/ml ) time after treatment (2 hours)
vascular leaf late rosette growth CaCl2 + MgCl2 (1mM CaCl2 + 2.5 mM MgCl2 ) time
after treatment (1 hours)
vascular leaf late rosette growth water time after treatment (1 hours)
whole plant 7-day-old seedlings 3-dehydroteasterone (1 uM, 3 hours)
Guard Cell enriched leaves

whole leaves
seed germination water (3 hours)
seed germination water (6 hours)
seed germination water (6 hours)
Small excised segments of primary root tissue corresponding to root-hair elongation
zone
OrganismPart: Small excised segments of primary root tissue corresponding to root-
hair elongation zone Ecotype: Columbia GeneticModification: EMS mutant, Plant Cell
(1990) 2:235-243 NASC:Growth Stage: 1.02 NASC:StockCode: N2259 StrainOrLine:
rhd2-1
Small excised segments of primary root tissue corresponding to root-hair elongation
no treatment dry seeds
no treatment dry seeds
seed dry seed stage no treatment
seed dry seed stage no treatment
seed imbibition water (3 hours)
seed imbibition water (3 hours)
seeds dry seed stage cold (4 C, 96 hr )

col-0age(21+_days)sepal_
col-0age(21+_days)sepal_
col-0age(21+_days)sepal_
col-0age(21+_days)stage_15_flower_
col-0age(21+_days)stage_15_flower_
col-0age(21+_days)stage_15_flower_
col-0age(21+_days)petalstage_15_flower_
col-0age(21+_days)petalstage_15_flower_
col-0age(21+_days)petalstage_15_flower_
col-0age(21+_days)stage_15_flowerstamen_
col-0age(21+_days)stage_15_flowerstamen_
col-0age(21+_days)stage_15_flowerstamen_
OrganismPart: whole plant Ecotype: ws-2 NASC:Growth                    Stage:   1.06
NASC:StockCode: N1601
whole plant 21-day-old plants, vegetative stage Arr21c-ox
whole plant 21-day-old plants, vegetative stage Arr21c-ox
whole plant 21-day-old plants, vegetative stage Arr21c-ox

col-0age(21+_days)carpelstage_15_flower_
col-0age(21+_days)carpelstage_15_flower_
col-0age(21+_days)carpelstage_15_flower_
shoot apex rosette stage KB9 line
cultured cell time after subculture (3 days)
cultured cell time after subculture (5 days)
cultured cell time after subculture (7 days)
controlled system (29 days); age (29 days ); flower
Programmed Cell Death Control

Programmed Cell Death Heat
shoot apex rosette stage
shoot apex rosette stage KB31 line photoperiod (16 hr, 3 days)
inflorescence stem tip
inflorescence stem tip
cultured cell mid-exponential phase sucrose (3%, 10 hours)
cultured cell mid-exponential phase sucrose (3%, 12 hours)
cultured cell early stationary phase sucrose (3%, 2 hours)
cultured cell early stationary phase sucrose (3%, 4 hours)
OrganismPart: Cell suspension
OrganismPart: Cell suspension
OrganismPart: Cell suspension

osmotic_6h_shoot mannitol (300 mM, 6 hours) shoot
osmotic_6h_shoot mannitol (300 mM, 6 hours) shoot
osmotic_12h_shoot mannitol (300 mM, 12 hours) shoot
time after treatment (6 hours) light wavelength (UV-B light, 6 hours) shoot
time after treatment (6 hours) light wavelength (UV-B light, 6 hours) shoot
col-0age(21+_days)nodeshoot_
col-0age(21_days)inflorescencestage_1-6_flower_
col-0age(21_days)inflorescencestage_1-6_flower_
col-0age(21_days)inflorescencestage_1-6_flower_
col-0age(7_days)hypocotyl_
col-0age(7_days)hypocotyl_
col-0age(21+_days)stage_9_flower_
col-0age(21+_days)stage_10-11_flower_
col-0age(21+_days)stage_10-11_flower_
col-0age(21+_days)stage_10-11_flower_
col-0age(21+_days)stage_12_flower_
col-0age(21+_days)petal_
col-0age(21+_days)petal_
col-0age(21+_days)petal_
col-0age(21+_days)carpel_
col-0age(21+_days)carpelstage_15_flower_
col-0age(21+_days)carpelstage_15_flower_
col-0age(21+_days)carpelstage_15_flower_
col-0age(8_weeks)globular_embryo_
col-0age(8_weeks)globular_embryo_
vascular leaf late rosette growth Pseudomonas syringae pv. tomato DC3000 (10e8
cfu/ml ); time after treatment (6 hours)
vascular leaf late rosette growth Pseudomonas syringae pv. tomato DC3000 hrcC-
(10e8 cfu/ml ) time after treatment (2 hours)
vascular leaf late rosette growth GST-Necrosis-inducing Phytophthora Protein 1 (1
uM ) time after treatment (4 hours)
vascular leaf late rosette growth Phytophthora infestans (10^6 spores/ml ) time
after treatment (6 hours)
vascular leaf rosette growth Botrytis cinerea (5X10^5 spores/ml ) time after
treatment (18 hours)
shoot apex rosette stage KB9 line
shoot apex rosette stage KB31 line photoperiod (16 hr, 3 days)

osmotic_6h_shoot mannitol (300 mM, 6 hours) shoot
osmotic_6h_shoot mannitol (300 mM, 6 hours) shoot
col-0age(7_days)hypocotyl_
col-0age(7_days)hypocotyl_
col-0age(7_days)hypocotyl_
col-0age(21+_days)stage_9_flower_
col-0age(21+_days)stage_10-11_flower_
col-0age(21+_days)stage_10-11_flower_
col-0age(21+_days)stage_10-11_flower_
col-0age(21+_days)stage_12_flower_
col-0age(21+_days)carpel_
col-0age(21+_days)carpelstage_15_flower_
col-0age(21+_days)carpelstage_15_flower_
col-0age(21+_days)carpelstage_15_flower_
vascular leaf late rosette growth Pseudomonas syringae pv. tomato avrRpm1 (10e8
cfu/ml ) time after treatment (2 hours)
vascular leaf late rosette growth Pseudomonas syringae pv. tomato avrRpm1 (10e8
cfu/ml ) time after treatment (2 hours)
vascular leaf late rosette growth Pseudomonas syringae pv. tomato avrRpm1 (10e8
cfu/ml ) time after treatment (2 hours)
vascular leaf late rosette growth Pseudomonas syringae pv. tomato DC3000 hrcC-
(10e8 cfu/ml ) time after treatment (2 hours)
vascular leaf late rosette growth Pseudomonas syringae pv. tomato DC3000 hrcC-
(10e8 cfu/ml ) time after treatment (2 hours)
vascular leaf late rosette growth GST-Necrosis-inducing Phytophthora Protein 1 (1
uM ) time after treatment (4 hours)
vascular leaf late rosette growth Phytophthora infestans (10^6 spores/ml ) time
after treatment (6 hours)
shoot apex rosette stage KB9 line
shoot apex rosette stage
shoot apex rosette stage
shoot apex rosette stage KB31 line photoperiod (16 hr, 3 days)

col-0age(21+_days)stamen_
col-0age(21+_days)stamen_
col-0age(21+_days)stamen_
col-0age(21+_days)sepalstage_15_flower_
col-0age(21+_days)sepalstage_15_flower_
col-0age(21+_days)sepalstage_15_flower_
col-0age(21+_days)petalstage_15_flower_
col-0age(21+_days)petalstage_15_flower_
col-0age(21+_days)petalstage_15_flower_
col-0age(21+_days)stage_15_flowerstamen_
col-0age(21+_days)stage_15_flowerstamen_
col-0age(21+_days)stage_15_flowerstamen_
col-0age(21+_days)carpelstage_15_flower_
col-0age(21+_days)carpelstage_15_flower_
col-0age(21+_days)carpelstage_15_flower_
col-0age(6_weeks)pollen_
col-0age(6_weeks)pollen_
col-0age(6_weeks)pollen_

OrganismPart: inflorescence Ecotype: ws NASC:Growth Stage: 6.0

OrganismPart: inflorescence Ecotype: ws NASC:Growth Stage: 6.0
OrganismPart: Pollen Ecotype: Ler-0 GeneticModification: None NASC:Growth Stage:
5.10 NASC:StockCode: NW20
OrganismPart: Pollen Ecotype: Ler-0 GeneticModification: None NASC:Growth Stage:
5.10 NASC:StockCode: NW20
OrganismPart: Pollen Ecotype: Ler-0 GeneticModification: None NASC:Growth Stage:
5.10 NASC:StockCode: NW20
col-0age(6_weeks) pollen_
controlled system (29 days); age (29 days ); flower
greenhouse (29 days);age (29 days ); flower
greenhouse (29 days);age (29 days ); flower

cold_control_0min_root no treatment root
cold_control_30min_root no treatment root
col-0age(7_days)hypocotyl_
col-0age(7_days)hypocotyl_
col-0age(7_days)hypocotyl_
col-0age(15_days)root_
col-0age(17_days)root_
col-0age(17_days)root_
whole plant 7-day-old seedlings 3-dehydroteasterone (1 uM, 3 hours)
whole plant 7-day-old seedlings 3-dehydroteasterone (1 uM, 3 hours)
whole plant 7-day-old seedlings ABA (10 uM, 1 hours)
OrganismPart: whole plant Ecotype: ws-2 NASC:Growth Stage: 10-day-old whole
plant NASC:StockCode: N1601 Experiment: Comparative transcriptome analysis
between wild-type and gpa1 mutant in response to ABA
OrganismPart: whole plant Ecotype: ws-2 NASC:Growth Stage: 10-day-old whole
plant NASC:StockCode: N1601 Experiment: Comparative transcriptome analysis
between wild-type and gpa1 mutant in response to ABA
Col-0 Whole Plant
OrganismPart: whole seedling Ecotype: col-7 NASC:StockCode: N3731
OrganismPart: whole seedling Ecotype: col-7 NASC:StockCode: N3731
Small excised segments of primary root tissue corresponding to root-hair elongation
zone
Small excised segments of primary root tissue corresponding to root-hair elongation
zone

col-0age(21+_days)stage_15_flower_
col-0age(21+_days)stage_15_flower_
col-0age(21+_days)stage_15_flower_
col-0age(21+_days)stage_15_flowerstamen_
col-0age(21+_days)stage_15_flowerstamen_
col-0age(21+_days)stage_15_flowerstamen_
col-0age(6_weeks)pollen_
col-0age(6_weeks)pollen_
col-0age(6_weeks)pollen_
col-0age(8_weeks)globular_embryo_
col-0age(8_weeks)globular_embryo_
col-0age(8_weeks)globular_embryo_
OrganismPart: Pollen Ecotype: Ler-0 GeneticModification: None NASC:Growth Stage:
5.10 NASC:StockCode: NW20
OrganismPart: Pollen Ecotype: Ler-0 GeneticModification: None NASC:Growth Stage:
5.10 NASC:StockCode: NW20
col-0age(6_weeks) pollen_

col-0age(8_weeks)torpedo_embryo_
col-0age(8_weeks)torpedo_embryo_
col-0age(8_weeks)torpedo_embryo_
col-0age(15_days)root_
col-0age(15_days)root_
cotyledon ; hypocotyl seedling growth light wavelength (far-red light, 45 minutes)
cotyledon ; hypocotyl seedling growth light regime (continuous darkness, 44
minutes) light wavelength (red light, 1 minutes)
cotyledon ; hypocotyl seedling growth light wavelength (red light, 45 minutes)
cotyledon ; hypocotyl seedling growth light wavelength (blue light, 45 minutes)
total roots (primary and all lateral )
MYB761 Knockout, Plant Cell 13, 2777-2791 Overexpressor GROWTHCONDITIONS
Dark DEVELOPMENTSTAGE 0.7 Whole Plant
MYB761 Knockout, Plant Cell 13, 2777-2791 Overexpressor GROWTHCONDITIONS
Dark DEVELOPMENTSTAGE 0.7 Whole Plant
MYB61 Overexpressor GROWTHCONDITIONS Dark DEVELOPMENTSTAGE 0.7 Whole
Plant
col-0age(7_days)root_
seeds dry seed stage average daily temperature (22 C, 96 hr )

cold_control_0min_root no treatment root
whole plants seedling growth MT-WT24h(plate) cold (4C, 24 hours)
whole plants seedling growth MT-E2 35S::CBF2
col-0age(15_days)root_
col-0age(15_days)root_
col-0age(17_days)root_
col-0age(17_days)root_
total roots (primary and all lateral )
OrganismPart: whole seedling Ecotype: col-7 NASC:StockCode: N3731
OrganismPart: whole seedling Ecotype: col-7 NASC:StockCode: N3731
Small excised segments of primary root tissue corresponding to root-hair elongation
col-0age(7_days)root_

col-0age(6_weeks)pollen_
col-0age(6_weeks)pollen_
col-0age(6_weeks)pollen_
OrganismPart: Pollen Ecotype: Ler-0   GeneticModification: None NASC:Growth Stage:
5.10 NASC:StockCode: NW20
OrganismPart: Pollen Ecotype: Ler-0   GeneticModification: None NASC:Growth Stage:
5.10 NASC:StockCode: NW20
OrganismPart: Pollen Ecotype: Ler-0   GeneticModification: None NASC:Growth Stage:
5.10 NASC:StockCode: NW20
OrganismPart: Pollen Ecotype: Ler-0   GeneticModification: None NASC:Growth Stage:
5.10 NASC:StockCode: NW20
OrganismPart: Pollen Ecotype: Ler-0   GeneticModification: None NASC:Growth Stage:
5.10 NASC:StockCode: NW20
OrganismPart: Pollen Ecotype: Ler-0   GeneticModification: None NASC:Growth Stage:
5.10 NASC:StockCode: NW20
OrganismPart: Pollen Ecotype: Ler-0   GeneticModification: None NASC:Growth Stage:
5.10 NASC:StockCode: NW20
col-0age(6_weeks) pollen_
no treatment dry seeds
no treatment dry seeds
seed dry seed stage no treatment
seed dry seed stage no treatment
seed imbibition water (3 hours)
seed imbibition water (3 hours)

col-0age(21+_days)stage_10-11_flower_
col-0age(21+_days)stamen_
col-0age(21+_days)stamen_
col-0age(21+_days)stamen_
col-0age(6_weeks)pollen_
col-0age(6_weeks)pollen_
col-0age(6_weeks)pollen_
OrganismPart: Pollen Ecotype: Ler-0 GeneticModification:   None NASC:Growth Stage:
5.10 NASC:StockCode: NW20
OrganismPart: Pollen Ecotype: Ler-0 GeneticModification:   None NASC:Growth Stage:
5.10 NASC:StockCode: NW20
OrganismPart: Pollen Ecotype: Ler-0 GeneticModification:   None NASC:Growth Stage:
5.10 NASC:StockCode: NW20
OrganismPart: Pollen Ecotype: Ler-0 GeneticModification:   None NASC:Growth Stage:
5.10 NASC:StockCode: NW20
OrganismPart: Pollen Ecotype: Ler-0 GeneticModification:   None NASC:Growth Stage:
5.10 NASC:StockCode: NW20
OrganismPart: Pollen Ecotype: Ler-0 GeneticModification:   None NASC:Growth Stage:
5.10 NASC:StockCode: NW20
OrganismPart: Pollen Ecotype: Ler-0 GeneticModification:   None NASC:Growth Stage:
5.10 NASC:StockCode: NW20
osmotic_6h_shoot mannitol (300 mM, 6 hours) shoot
time after treatment (6 hours) light wavelength (UV-B light, 6 hours) shoot
time after treatment (6 hours) light wavelength (UV-B light, 6 hours) shoot
col-0age(21_days)inflorescencestage_1-6_flower_
col-0age(21_days)inflorescencestage_1-6_flower_
col-0age(21_days)inflorescencestage_1-6_flower_
col-0age(7_days)hypocotyl_
col-0age(7_days)hypocotyl_
col-0age(7_days)hypocotyl_
col-0age(21+_days)stage_9_flower_
col-0age(21+_days)stage_10-11_flower_
col-0age(21+_days)stage_10-11_flower_
col-0age(21+_days)stage_10-11_flower_
col-0age(21+_days)petal_
col-0age(21+_days)petal_
col-0age(21+_days)petal_
col-0age(21+_days)carpel_
col-0age(21+_days)carpelstage_15_flower_
col-0age(21+_days)carpelstage_15_flower_
col-0age(21+_days)carpelstage_15_flower_
col-0age(8_weeks)globular_embryo_
col-0age(8_weeks)globular_embryo_
col-0age(8_weeks)globular_embryo_
vascular leaf late rosette growth Pseudomonas syringae pv. tomato avrRpm1 (10e8
cfu/ml ) time after treatment (2 hours)
vascular leaf late rosette growth Pseudomonas syringae pv. tomato avrRpm1 (10e8
cfu/ml ) time after treatment (2 hours)
vascular leaf late rosette growth Pseudomonas syringae pv. tomato avrRpm1 (10e8
cfu/ml ) time after treatment (2 hours)
vascular leaf late rosette growth Pseudomonas syringae pv. tomato DC3000 hrcC-
(10e8 cfu/ml ) time after treatment (2 hours)
vascular leaf late rosette growth Pseudomonas syringae pv. tomato DC3000 hrcC-
(10e8 cfu/ml ) time after treatment (2 hours)
vascular leaf late rosette growth GST-Necrosis-inducing Phytophthora Protein 1 (1
uM ) time after treatment (4 hours)

OrganismPart: inflorescence Ecotype: ws NASC:Growth Stage: 6.0

shoot   apex   rosette   stage KB9 line
shoot   apex   rosette   stage
shoot   apex   rosette   stage
shoot   apex   rosette   stage KB31 line photoperiod (16 hr, 3 days)

col-0age(8_weeks)triangle_embryo_
col-0age(8_weeks)torpedo_embryo_
col-0age(8_weeks)torpedo_embryo_
col-0age(8_weeks)torpedo_embryo_
col-0age(8_weeks)walking-stick_seed_
col-0age(8_weeks)early_curled_cotyledon_
col-0age(8_weeks)early_curled_cotyledon_
cultured cell time after subculture (3 days)
cultured cell time after subculture (5 days)
cultured cell time after subculture (7 days)
Programmed Cell Death Control
seed germination water (3 hours)
seed germination water (3 hours)
seed germination water (6 hours)
seed germination water (6 hours)
no treatment dry seeds
seed dry seed stage no treatment
seed dry seed stage no treatment
seed imbibition water (3 hours)
inflorescence stem base
seeds dry seed stage cold (4 C, 96 hr )

col-0age(21+_days)nodeshoot_
col-0age(7_days)hypocotyl_
col-0age(7_days)hypocotyl_
col-0age(7_days)hypocotyl_
col-0age(21+_days)stage_9_flower_
col-0age(21+_days)stage_10-11_flower_
col-0age(21+_days)stage_10-11_flower_
col-0age(21+_days)stage_10-11_flower_
col-0age(21+_days)carpel_
shoot apex rosette stage KB9 line
greenhouse (29 days);age (29 days ); flower
shoot apex rosette stage
shoot apex rosette stage
shoot apex rosette stage KB31 line photoperiod (16 hr, 3 days)
seed imbibition ABA (3 uM, 24 hours)
seed imbibition ABA (3 uM, 24 hours)
24 h imbibed in water imbibed seeds water (48 hours)
24 h imbibed in water imbibed seeds water (48 hours)
inflorescence stem tip
inflorescence stem tip

col-0age(21+_days)carpelstage_15_flower_
col-0age(6_weeks)pollen_
col-0age(6_weeks)pollen_
vascular leaf late rosette growth Pseudomonas syringae pv. tomato avrRpm1 (10e8
cfu/ml ) time after treatment (2 hours)
vascular leaf late rosette growth Pseudomonas syringae pv. tomato avrRpm1 (10e8
cfu/ml ) time after treatment (2 hours)
vascular leaf late rosette growth Pseudomonas syringae pv. tomato DC3000 hrcC-
(10e8 cfu/ml ) time after treatment (2 hours)
vascular leaf late rosette growth Pseudomonas syringae pv. tomato DC3000 hrcC-
(10e8 cfu/ml ) time after treatment (2 hours)
vascular leaf late rosette growth Pseudomonas syringae pv. Phaseolicola (10e8
cfu/ml ) time after treatment (24 hours)
OrganismPart: Pollen Ecotype: Ler-0 GeneticModification: None NASC:Growth Stage:
5.10 NASC:StockCode: NW20
OrganismPart: Pollen Ecotype: Ler-0 GeneticModification: None NASC:Growth Stage:
5.10 NASC:StockCode: NW20
OrganismPart: Pollen Ecotype: Ler-0 GeneticModification: None NASC:Growth Stage:
5.10 NASC:StockCode: NW20
OrganismPart: Pollen Ecotype: Ler-0 GeneticModification: None NASC:Growth Stage:
5.10 NASC:StockCode: NW20
greenhouse (29 days);age (29 days ); flower
OrganismPart: Whole leaf Age time point: 4 hours Ecotype: col-5 NASC:Growth
Stage: 3.90 NASC:StockCode: N1688
OrganismPart: Whole leaf Age time point: 4 hours Ecotype: col-5 NASC:Growth
Stage: 3.90 NASC:StockCode: N1688
OrganismPart: Whole leaf Age time point: 4 hours Ecotype: col-5 NASC:Growth
Stage: 3.90 NASC:StockCode: N1688
Tumour
inflorescence stem base
Stock Code: N3076 Tissue: axillary buds approx. 2 mm elongated Genetic
background: col-0 Genetic variation: EMS

col-0age(21_days)inflorescencestage_1-6_flower_
cotyledon ; hypocotyl seedling growth light wavelength (far-red light, 45 minutes)
cotyledon ; hypocotyl seedling growth light regime (continuous darkness, 44
minutes) light wavelength (red light, 1 minutes)
cotyledon ; hypocotyl seedling growth light wavelength (red light, 45 minutes)
cotyledon ; hypocotyl seedling growth light wavelength (blue light, 45 minutes)
OrganismPart: whole plant Ecotype: ws-2 NASC:Growth Stage: 1.06
NASC:StockCode: N1601
shoot apex rosette stage
shoot apex rosette stage KB31 line photoperiod (16 hr, 3 days)
seed germination water (3 hours)
seed germination water (3 hours)
seed germination water (6 hours)
seed germination water (6 hours)
OrganismPart: Small excised segments of primary root tissue corresponding to root-
hair elongation zone Ecotype: Columbia GeneticModification: EMS mutant, Plant Cell
(1990) 2:235-243 NASC:Growth Stage: 1.02 NASC:StockCode: N2259 StrainOrLine:
rhd2-1
no treatment dry seeds
no treatment dry seeds
seed dry seed stage no treatment
seed dry seed stage no treatment
fully expanded leaves
seeds dry seed stage cold (4 C, 96 hr )
seeds dry seed stage cold (4 C, 96 hr )

cold_control_0min_root no treatment root
cold_control_0min_root no treatment root
cold_control_30min_root no treatment root
cold_control_30min_root no treatment root
cold (4 C, 24 hours) root
whole plants seedling growth MT-p15-8 35S::ZAP12
heat_3h_root
col-0age(15_days)root_
col-0age(15_days)root_
col-0age(17_days)root_
col-0age(17_days)root_
total roots (primary and all lateral )
OrganismPart: whole seedling Ecotype: Col-0 GeneticModification: Aequorin
transgene NASC:StockCode: StrainOrLine: aeq+
OrganismPart: whole seedling Ecotype: Col-0 GeneticModification: Aequorin
transgene NASC:StockCode: StrainOrLine: aeq+
Small excised segments of primary root tissue corresponding to root-hair elongation
zone
Small excised segments of primary root tissue corresponding to root-hair elongation
zone
OrganismPart: Small excised segments of primary root tissue corresponding to root-
hair elongation zone Ecotype: Columbia GeneticModification: EMS mutant, Plant Cell
(1990) 2:235-243 NASC:Growth Stage: 1.02 NASC:StockCode: N2259 StrainOrLine:
rhd2-1
Small excised segments of primary root tissue corresponding to root-hair elongation
Whole seedlings
OrganismPart: root Ecotype: C24 GeneticModification: Transgenic plant carrying
ANR1::rGR fusion under the 35S promoter control. The ANR1::rGR fusion is stongly
expressed in this line. NASC:Growth Stage: 1.02 NASC:StockCode: StrainOrLine:
Working overexpressor
OrganismPart: root Ecotype: C24 GeneticModification: Transgenic plant carrying
ANR1::rGR fusion under the 35S promoter control. The ANR1::rGR fusion is stongly
expressed in this line. NASC:Growth Stage: 1.02 NASC:StockCode: StrainOrLine:
Working overexpressor
col-0age(7_days)root_

cold_control_0min_root no treatment root
cold_control_30min_root no treatment root
cold (4 C, 24 hours) root
osmotic_6h_root mannitol (300 mM, 6 hours) root
osmotic_12h_root mannitol (300 mM, 12 hours) root
salt_3h_root NaCl (150 mM, 3 hours) root
salt_3h_root NaCl (150 mM, 3 hours) root
salt_24h_root NaCl (150 mM, 24 hours) root
heat_3h_root
heat_3h_root
col-0age(21+_days)internodeshoot_
col-0age(21+_days)internodeshoot_
col-0age(21+_days)internodeshoot_
col-0age(21+_days)nodeshoot_
OrganismPart: whole seedling Ecotype: col-7 NASC:StockCode: N3731
Small excised segments of primary root tissue corresponding to root-hair elongation
zone
inflorescence stem base
inflorescence stem base
inflorescence stem base
inflorescence stem base

col-0age(6_weeks)pollen_
OrganismPart: Pollen Ecotype: Ler-0   GeneticModification: None NASC:Growth Stage:
5.10 NASC:StockCode: NW20
OrganismPart: Pollen Ecotype: Ler-0   GeneticModification: None NASC:Growth Stage:
5.10 NASC:StockCode: NW20
OrganismPart: Pollen Ecotype: Ler-0   GeneticModification: None NASC:Growth Stage:
5.10 NASC:StockCode: NW20
OrganismPart: Pollen Ecotype: Ler-0   GeneticModification: None NASC:Growth Stage:
5.10 NASC:StockCode: NW20
OrganismPart: Pollen Ecotype: Ler-0   GeneticModification: None NASC:Growth Stage:
5.10 NASC:StockCode: NW20
OrganismPart: Pollen Ecotype: Ler-0   GeneticModification: None NASC:Growth Stage:
5.10 NASC:StockCode: NW20
OrganismPart: Pollen Ecotype: Ler-0   GeneticModification: None NASC:Growth Stage:
5.10 NASC:StockCode: NW20
seed germination water (3 hours)
seed germination water (3 hours)
seed germination water (6 hours)
seed germination water (6 hours)
no treatment dry seeds
no treatment dry seeds
seed dry seed stage no treatment
seed dry seed stage no treatment
seed imbibition water (3 hours)
seed imbibition water (3 hours)
seeds dry seed stage cold (4 C, 96 hr )
seeds dry seed stage cold (4 C, 96 hr )

heat_control_0h_25C_cell_culture
heat_control_0h_25C_cell_culture
heat_3h_38C_3h_recover_cell_culture
heat_3h_38C_3h_recover_cell_culture
heat_1h_38C_cell_culture
heat_3h_38C_cell_culture
cultured cell time after subculture (1 days)
OrganismPart: Pollen Ecotype: Ler-0 GeneticModification: None NASC:Growth Stage:
5.10 NASC:StockCode: NW20
seed germination water (3 hours)
seed germination water (3 hours)
seed germination water (6 hours)
seed germination water (6 hours)
seed imbibition ABA (3 uM, 24 hours)
seed imbibition ABA (3 uM, 24 hours)
24 h imbibed in water imbibed seeds water (48 hours)
24 h imbibed in water imbibed seeds water (48 hours)
seeds dry seed stage cold (4 C, 96 hr )
seeds dry seed stage cold (4 C, 96 hr )

cold_control_0min_root no treatment root
cold_control_0min_root no treatment root
cold_control_30min_root no treatment root
cold_control_30min_root no treatment root
osmotic_3h_root mannitol (300 mM, 3 hours) root
osmotic_6h_root mannitol (300 mM, 6 hours) root
osmotic_12h_root mannitol (300 mM, 12 hours) root
osmotic_12h_root mannitol (300 mM, 12 hours) root
salt_3h_root NaCl (150 mM, 3 hours) root
salt_3h_root NaCl (150 mM, 3 hours) root
salt_24h_root NaCl (150 mM, 24 hours) root
col-0age(15_days)root_
col-0age(15_days)root_
col-0age(17_days)root_
total roots (primary and all lateral )
OrganismPart: root Ecotype: C24 GeneticModification: Transgenic plant carrying
ANR1::rGR fusion under the 35S promoter control. The ANR1::rGR fusion is stongly
expressed in this line. NASC:Growth Stage: 1.02 NASC:StockCode: StrainOrLine:
Working overexpressor
col-0age(7_days)root_

col-0age(21_days)inflorescencestage_1-6_flower_
col-0age(21_days)inflorescencestage_1-6_flower_
col-0age(21_days)inflorescencestage_1-6_flower_
col-0age(7_days)hypocotyl_
col-0age(15_days)root_
cotyledon ; hypocotyl seedling growth light wavelength (far-red light, 45 minutes)
cotyledon ; hypocotyl seedling growth light regime (continuous darkness, 44
minutes) light wavelength (red light, 1 minutes)
cotyledon ; hypocotyl seedling growth light wavelength (red light, 45 minutes)
cotyledon ; hypocotyl seedling growth light wavelength (blue light, 45 minutes)
shoot apex rosette stage KB9 line
total roots (primary and all lateral )
OrganismPart: root Ecotype: C24 GeneticModification: Transgenic plant carrying
ANR1::rGR fusion under the 35S promoter control. The ANR1::rGR fusion is stongly
expressed in this line. NASC:Growth Stage: 1.02 NASC:StockCode: StrainOrLine:
Working overexpressor
col-0age(7_days)root_

col-0age(21+_days)stage_12_flower_
col-0age(21+_days)stamen_
col-0age(21+_days)stamen_
col-0age(21+_days)stamen_
col-0age(6_weeks)pollen_
col-0age(6_weeks)pollen_
col-0age(6_weeks)pollen_
OrganismPart: Pollen Ecotype: Ler-0 GeneticModification:   None NASC:Growth Stage:
5.10 NASC:StockCode: NW20
OrganismPart: Pollen Ecotype: Ler-0 GeneticModification:   None NASC:Growth Stage:
5.10 NASC:StockCode: NW20
OrganismPart: Pollen Ecotype: Ler-0 GeneticModification:   None NASC:Growth Stage:
5.10 NASC:StockCode: NW20
OrganismPart: Pollen Ecotype: Ler-0 GeneticModification:   None NASC:Growth Stage:
5.10 NASC:StockCode: NW20
OrganismPart: Pollen Ecotype: Ler-0 GeneticModification:   None NASC:Growth Stage:
5.10 NASC:StockCode: NW20
col-0age(6_weeks) pollen_
ms1ttg-old Flower


cultured cell time after subculture (7 days)
Programmed Cell Death Senescence

Programmed Cell Death Control

Programmed Cell Death Senescence
whole plant 21-day-old plants, vegetative stage Arr21c-ox
whole plant 21-day-old plants, vegetative stage Arr21c-ox
whole plant 21-day-old plants, vegetative stage Arr21c-ox
OrganismPart: Cell suspension
OrganismPart: Cell suspension
OrganismPart: Cell suspension
OrganismPart: Cell suspension
OrganismPart: Cell suspension
OrganismPart: Cell suspension

salt_24h_root NaCl (150 mM, 24 hours) root
whole plants seedling growth MT-WT24h(plate) cold (4C, 24 hours)
col-0age(6_weeks)pollen_
col-0age(15_days)root_
col-0age(15_days)root_
col-0age(17_days)root_
col-0age(17_days)root_
OrganismPart: Pollen Ecotype: Ler-0 GeneticModification: None NASC:Growth Stage:
5.10 NASC:StockCode: NW20
OrganismPart: Pollen Ecotype: Ler-0 GeneticModification: None NASC:Growth Stage:
5.10 NASC:StockCode: NW20
OrganismPart: Pollen Ecotype: Ler-0 GeneticModification: None NASC:Growth Stage:
5.10 NASC:StockCode: NW20
col-0age(6_weeks) pollen_
total roots (primary and all lateral )
whole plant 21-day-old plants, vegetative stage no treatment
whole plant 21-day-old plants, vegetative stage no treatment
MYB61 Overexpressor GROWTHCONDITIONS Dark DEVELOPMENTSTAGE 0.7 Whole
Plant
Small excised segments of primary root tissue corresponding to root-hair elongation
zone
Small excised segments of primary root tissue corresponding to root-hair elongation
zone
OrganismPart: Small excised segments of primary root tissue corresponding to root-
hair elongation zone Ecotype: Columbia GeneticModification: EMS mutant, Plant Cell
(1990) 2:235-243 NASC:Growth Stage: 1.02 NASC:StockCode: N2259 StrainOrLine:
rhd2-1
Small excised segments of primary root tissue corresponding to root-hair elongation
OrganismPart: root Ecotype: C24 GeneticModification: Transgenic plant carrying
ANR1::rGR fusion under the 35S promoter control. The ANR1::rGR fusion is stongly
expressed in this line. NASC:Growth Stage: 1.02 NASC:StockCode: StrainOrLine:
Working overexpressor
col-0age(7_days)root_

col-0age(17_days)petiole_
col-0age(17_days)petiole_
col-0age(17_days)petiole_
col-0age(7_days)hypocotyl_
col-0age(7_days)hypocotyl_
col-0age(7_days)hypocotyl_
col-0age(21+_days)petal_
col-0age(21+_days)petal_
col-0age(21+_days)petal_
col-0age(21+_days)carpel_
col-0age(21+_days)carpelstage_15_flower_
col-0age(21+_days)carpelstage_15_flower_
col-0age(21+_days)carpelstage_15_flower_
col-0age(7_days)leafshoot_apex_
col-0age(7_days)leafshoot_apex_
col-0age(7_days)leafshoot_apex_
col-0age(8_weeks)globular_embryo_
col-0age(8_weeks)globular_embryo_
whole plant 7-day-old seedlings 3-dehydroteasterone (1 uM, 3 hours)

col-0age(17_days)petiole_
col-0age(17_days)petiole_
col-0age(21+_days)internodeshoot_
col-0age(21+_days)internodeshoot_
col-0age(21+_days)internodeshoot_
col-0age(21+_days)nodeshoot_
col-0age(7_days)hypocotyl_
col-0age(7_days)hypocotyl_
col-0age(7_days)hypocotyl_
OrganismPart: Small excised segments of primary root tissue corresponding to root-
hair elongation zone Ecotype: Columbia GeneticModification: EMS mutant, Plant Cell
(1990) 2:235-243 NASC:Growth Stage: 1.02 NASC:StockCode: N2259 StrainOrLine:
rhd2-1
inflorescence stem base
inflorescence stem base

col-0age(21+_days)stamen_
col-0age(21+_days)stamen_
col-0age(21+_days)stamen_
col-0age(6_weeks)pollen_
col-0age(6_weeks)pollen_
vascular leaf late rosette growth Pseudomonas syringae pv. tomato avrRpm1 (10e8
cfu/ml ) time after treatment (2 hours)
vascular leaf late rosette growth Pseudomonas syringae pv. tomato avrRpm1 (10e8
cfu/ml ) time after treatment (2 hours)
OrganismPart: Pollen Ecotype: Ler-0 GeneticModification: None NASC:Growth Stage:
5.10 NASC:StockCode: NW20
OrganismPart: Pollen Ecotype: Ler-0 GeneticModification: None NASC:Growth Stage:
5.10 NASC:StockCode: NW20
col-0age(6_weeks) pollen_
whole plant 7-day-old seedlings cycloheximide (10 uM, 3 hours)
Guard Cell enriched leaves

Guard Cell enriched leaves
MYB61 Overexpressor GROWTHCONDITIONS Dark DEVELOPMENTSTAGE 0.7 Whole
Plant
MYB61 Overexpressor GROWTHCONDITIONS Dark DEVELOPMENTSTAGE 0.7 Whole
Plant

whole plants seedling growth MT-WT7d(plate) cold (4C, 7 days)
whole plants seedling growth MT-WT(zat12) gl1
whole plants seedling growth MT-E2 35S::CBF2
col-0age(7_days)hypocotyl_
col-0age(7_days)hypocotyl_
col-0age(7_days)hypocotyl_
col-0age(8_weeks)torpedo_embryo_
col-0age(8_weeks)torpedo_embryo_
col-0age(8_weeks)torpedo_embryo_
col-0age(8_weeks)walking-stick_seed_
col-0age(8_weeks)early_curled_cotyledon_
col-0age(8_weeks)early_curled_cotyledon_
col-0age(8_weeks)early_curled_cotyledon_
col-0age(8_weeks)early_green_cotyledon_
col-0age(15_days)root_
col-0age(15_days)root_
the entire seedlings;Identification of genes responsive to non-metabolised glucose
analoges as an approach to hexokinase-independent glucose sensing in plants
whole plant 7-day-old seedlings ABA (10 uM, 3 hours)
OrganismPart: whole plant Ecotype: ws-2 NASC:Growth Stage: 10-day-old whole
plant NASC:StockCode: N1601 Experiment: Comparative transcriptome analysis
between wild-type and gpa1 mutant in response to ABA
Growth Room 16 hour days Seedlings were floated on distilled water at 30 degrees
centigrade, then blotted on tissue and frozen in liquid nitrogen
Stock Code: N1093 Developmental stage: 6.1 Tissue: lateral roots
OrganismPart: root Ecotype: C24 GeneticModification: Transgenic plant carrying
ANR1::rGR fusion under the 35S promoter control. The ANR1::rGR fusion is stongly
expressed in this line. NASC:Growth Stage: 1.02 NASC:StockCode: StrainOrLine:
Working overexpressor

cold_control_0min_root no treatment root
cold_control_0min_root no treatment root
cold_control_30min_root no treatment root
cold_control_30min_root no treatment root
cold (4 C, 24 hours) root
cold (4 C, 24 hours) root
whole plants seedling growth MT-p15-8 35S::ZAP12
col-0age(15_days)root_
col-0age(15_days)root_
col-0age(17_days)root_
col-0age(17_days)root_
cotyledon ; hypocotyl seedling growth light wavelength (far-red light, 45 minutes)
cotyledon ; hypocotyl seedling growth light regime (continuous darkness, 44
minutes) light wavelength (red light, 1 minutes)
cotyledon ; hypocotyl seedling growth light wavelength (red light, 45 minutes)
cotyledon ; hypocotyl seedling growth light wavelength (blue light, 45 minutes)
total roots (primary and all lateral )
whole plant 21-day-old plants, vegetative stage no treatment
whole plant 21-day-old plants, vegetative stage no treatment
Small excised segments of primary root tissue corresponding to root-hair elongation
zone
Small excised segments of primary root tissue corresponding to root-hair elongation
zone
OrganismPart: Small excised segments of primary root tissue corresponding to root-
hair elongation zone Ecotype: Columbia GeneticModification: EMS mutant, Plant Cell
(1990) 2:235-243 NASC:Growth Stage: 1.02 NASC:StockCode: N2259 StrainOrLine:
rhd2-1
Small excised segments of primary root tissue corresponding to root-hair elongation
OrganismPart: total tissue Ecotype: Ler GeneticModification: EMS Mutant of N1695
NASC:Growth Stage: 1.04 NASC:StockCode: StrainOrLine: 15B
OrganismPart: total tissue Ecotype: Ler GeneticModification: EMS Mutant of N1695
NASC:Growth Stage: 1.04 NASC:StockCode: StrainOrLine: 15B
OrganismPart: root Ecotype: C24 GeneticModification: Transgenic plant carrying
ANR1::rGR fusion under the 35S promoter control. The ANR1::rGR fusion is stongly
expressed in this line. NASC:Growth Stage: 1.02 NASC:StockCode: StrainOrLine:
Working overexpressor
OrganismPart: root Ecotype: C24 GeneticModification: Transgenic plant carrying
ANR1::rGR fusion under the 35S promoter control. The ANR1::rGR fusion is stongly
expressed in this line. NASC:Growth Stage: 1.02 NASC:StockCode: StrainOrLine:
Working overexpressor
col-0age(7_days)root_

heat_control_0h_25C_cell_culture
heat_control_0h_25C_cell_culture
heat_3h_38C_3h_recover_cell_culture
heat_3h_38C_3h_recover_cell_culture
heat_1h_38C_cell_culture
heat_3h_38C_cell_culture
OrganismPart: Pollen Ecotype: Ler-0 GeneticModification: None NASC:Growth Stage:
5.10 NASC:StockCode: NW20
seed germination water (3 hours)
seed germination water (3 hours)
seed germination water (6 hours)
seed germination water (6 hours)
seed imbibition ABA (3 uM, 24 hours)
seed imbibition ABA (3 uM, 24 hours)
no treatment dry seeds
no treatment dry seeds
24 h imbibed in water imbibed seeds water (48 hours)
seed dry seed stage no treatment
seed dry seed stage no treatment
seed imbibition water (3 hours)
seed imbibition water (3 hours)
cultured cell early stationary phase time after drug removal (0 hours)
cultured cell early stationary phase time after drug removal (2 hours)
seeds dry seed stage cold (4 C, 96 hr )
seeds dry seed stage cold (4 C, 96 hr )

cold_control_0min_root no treatment root
cold_control_30min_root no treatment root
whole plants seedling growth MT-p15-8 35S::ZAP12
col-0age(15_days)root_
col-0age(15_days)root_
col-0age(17_days)root_
col-0age(17_days)root_
cotyledon ; hypocotyl seedling growth light wavelength (far-red light, 45 minutes)
cotyledon ; hypocotyl seedling growth light regime (continuous darkness, 44
minutes) light wavelength (red light, 1 minutes)
cotyledon ; hypocotyl seedling growth light wavelength (red light, 45 minutes)
cotyledon ; hypocotyl seedling growth light wavelength (blue light, 45 minutes)
the entire seedlings;Identification of genes responsive to non-metabolised glucose
analoges as an approach to hexokinase-independent glucose sensing in plants
total roots (primary and all lateral )
OrganismPart: whole seedling Ecotype: Col-0 GeneticModification: Aequorin
transgene NASC:StockCode: StrainOrLine: aeq+
OrganismPart: whole seedling Ecotype: Col-0 GeneticModification: Aequorin
transgene NASC:StockCode: StrainOrLine: aeq+
Small excised segments of primary root tissue corresponding to root-hair elongation
zone
Small excised segments of primary root tissue corresponding to root-hair elongation
zone
OrganismPart: Small excised segments of primary root tissue corresponding to root-
hair elongation zone Ecotype: Columbia GeneticModification: EMS mutant, Plant Cell
(1990) 2:235-243 NASC:Growth Stage: 1.02 NASC:StockCode: N2259 StrainOrLine:
rhd2-1
Small excised segments of primary root tissue corresponding to root-hair elongation
Growth Room 16 hour days Seedlings were floated on distilled water at 30 degrees
centigrade, then blotted on tissue and frozen in liquid nitrogen
OrganismPart: total tissue Ecotype: Ler GeneticModification: EMS Mutant of N1695
NASC:Growth Stage: 1.04 NASC:StockCode: StrainOrLine: 15B
col-0age(7_days)root_

col-0age(6_weeks)pollen_
col-0age(6_weeks)pollen_
col-0age(6_weeks)pollen_
vascular leaf late rosette growth Pseudomonas syringae pv. tomato avrRpm1 (10e8
cfu/ml ) time after treatment (2 hours)
vascular leaf late rosette growth Pseudomonas syringae pv. tomato avrRpm1 (10e8
cfu/ml ) time after treatment (2 hours)
vascular leaf late rosette growth Pseudomonas syringae pv. tomato DC3000 hrcC-
(10e8 cfu/ml ) time after treatment (2 hours)
vascular leaf late rosette growth Pseudomonas syringae pv. tomato DC3000 hrcC-
(10e8 cfu/ml ) time after treatment (2 hours)
OrganismPart: Pollen Ecotype: Ler-0 GeneticModification: None NASC:Growth Stage:
5.10 NASC:StockCode: NW20
OrganismPart: Pollen Ecotype: Ler-0 GeneticModification: None NASC:Growth Stage:
5.10 NASC:StockCode: NW20
OrganismPart: Pollen Ecotype: Ler-0 GeneticModification: None NASC:Growth Stage:
5.10 NASC:StockCode: NW20
OrganismPart: Pollen Ecotype: Ler-0 GeneticModification: None NASC:Growth Stage:
5.10 NASC:StockCode: NW20
col-0age(6_weeks) pollen_
no treatment dry seeds
no treatment dry seeds

cold_control_30min_root no treatment root
col-0age(17_days)root_
col-0age(17_days)root_
OrganismPart: whole plant Ecotype: ws-2 NASC:Growth Stage: 10-day-old whole
plant NASC:StockCode: N1601 Experiment: Comparative transcriptome analysis
between wild-type and gpa1 mutant in response to ABA
OrganismPart: whole plant Ecotype: ws-2 NASC:Growth Stage: 10-day-old whole
plant NASC:StockCode: N1601 Experiment: Comparative transcriptome analysis
between wild-type and gpa1 mutant in response to ABA
total roots (primary and all lateral )

Col-0 Whole Plant
MYB61 Overexpressor GROWTHCONDITIONS Dark DEVELOPMENTSTAGE 0.7 Whole
Plant
OrganismPart: whole seedling Ecotype: col-7 NASC:StockCode: N3731
OrganismPart: whole seedling Ecotype: col-7 NASC:StockCode: N3731
OrganismPart: whole seedling Ecotype: col-7 NASC:StockCode: N3731
Small excised segments of primary root tissue corresponding to root-hair elongation
zone
Small excised segments of primary root tissue corresponding to root-hair elongation
zone
col-0age(7_days)root_

osmotic_12h_root mannitol (300 mM, 12 hours) root
osmotic_12h_root mannitol (300 mM, 12 hours) root
col-0age(21+_days)sepalstage_15_flower_
col-0age(21+_days)sepalstage_15_flower_
col-0age(21+_days)sepalstage_15_flower_
col-0age(21+_days)petalstage_15_flower_
col-0age(21+_days)petalstage_15_flower_
col-0age(21+_days)petalstage_15_flower_
col-0age(8_weeks)early_curled_cotyledon_
col-0age(8_weeks)early_green_cotyledon_
vascular leaf rosette growth Botrytis cinerea (5X10^5 spores/ml ) time after
treatment (18 hours)
vascular leaf rosette growth Botrytis cinerea (5X10^5 spores/ml ) time after
treatment (48 hours)
seed imbibition ABA (3 uM, 24 hours)
seed imbibition ABA (3 uM, 24 hours)
no treatment dry seeds
no treatment dry seeds
24 h imbibed in water imbibed seeds water (48 hours)
24 h imbibed in water imbibed seeds water (48 hours)
seed dry seed stage no treatment
seed dry seed stage no treatment
Tumour
seeds dry seed stage cold (4 C, 96 hr )

col-0age(6_weeks)pollen_
col-0age(6_weeks)pollen_
col-0age(6_weeks)pollen_
OrganismPart: Pollen Ecotype: Ler-0 GeneticModification: None NASC:Growth Stage:
5.10 NASC:StockCode: NW20
OrganismPart: Pollen Ecotype: Ler-0 GeneticModification: None NASC:Growth Stage:
5.10 NASC:StockCode: NW20
col-0age(6_weeks) pollen_
seed germination water (3 hours)
seed germination water (6 hours)
seed germination water (6 hours)
no treatment dry seeds
no treatment dry seeds
seed dry seed stage no treatment
seed dry seed stage no treatment
fully expanded leaves

col-0age(15_days)root_
col-0age(15_days)root_
OrganismPart: Pollen Ecotype: Ler-0 GeneticModification: None NASC:Growth Stage:
5.10 NASC:StockCode: NW20
whole plant 7-day-old seedlings 3-dehydroteasterone (1 uM, 3 hours)
whole plant 7-day-old seedlings 3-dehydroteasterone (1 uM, 3 hours)
whole plant 7-day-old seedlings Methyl Jasmonate (10 uM, 3 hours)
total roots (primary and all lateral )
OrganismPart: whole seedling Ecotype: col-7 NASC:StockCode: N3731
OrganismPart: whole seedling Ecotype: col-7 NASC:StockCode: N3731
Small excised segments of primary root tissue corresponding to root-hair elongation
zone
Small excised segments of primary root tissue corresponding to root-hair elongation
zone
OrganismPart: Small excised segments of primary root tissue corresponding to root-
hair elongation zone Ecotype: Columbia GeneticModification: EMS mutant, Plant Cell
(1990) 2:235-243 NASC:Growth Stage: 1.02 NASC:StockCode: N2259 StrainOrLine:
rhd2-1
Small excised segments of primary root tissue corresponding to root-hair elongation
OrganismPart: root Ecotype: C24 GeneticModification: Transgenic plant carrying
ANR1::rGR fusion under the 35S promoter control. The ANR1::rGR fusion is stongly
expressed in this line. NASC:Growth Stage: 1.02 NASC:StockCode: StrainOrLine:
Working overexpressor
OrganismPart: root Ecotype: C24 GeneticModification: Transgenic plant carrying
ANR1::rGR fusion under the 35S promoter control. The ANR1::rGR fusion is stongly
expressed in this line. NASC:Growth Stage: 1.02 NASC:StockCode: StrainOrLine:
Working overexpressor

col-0age(21_days)inflorescencestage_1-6_flower_
col-0age(21_days)inflorescencestage_1-6_flower_
col-0age(21_days)inflorescencestage_1-6_flower_
col-0age(21+_days)stage_9_flower_
col-0age(21+_days)stage_10-11_flower_
col-0age(21+_days)stage_10-11_flower_
col-0age(21+_days)stage_10-11_flower_
col-0age(21+_days)stage_12_flower_
col-0age(21+_days)carpel_
col-0age(21+_days)carpelstage_15_flower_
col-0age(21+_days)carpelstage_15_flower_
col-0age(21+_days)carpelstage_15_flower_
col-0age(8_weeks)globular_embryo_
col-0age(8_weeks)globular_embryo_
col-0age(8_weeks)globular_embryo_
OrganismPart: inflorescence Ecotype: ws NASC:Growth Stage: 6.0
controlled system (29 days); age (29 days ); flower
greenhouse (29 days);age (29 days ); flower
shoot apex rosette stage
shoot apex rosette stage
inflorescence stem tip
inflorescence stem tip
ms1ttg-old Flower

Old Flower Buds


col-0age(21+_days)stamen_
col-0age(21+_days)stamen_
col-0age(21+_days)stamen_
col-0age(21+_days)stage_15_flower_
col-0age(21+_days)stage_15_flower_
col-0age(21+_days)stage_15_flower_
col-0age(21+_days)stage_15_flowerstamen_
col-0age(21+_days)stage_15_flowerstamen_
col-0age(21+_days)stage_15_flowerstamen_
col-0age(6_weeks)pollen_
col-0age(6_weeks)pollen_
col-0age(6_weeks)pollen_
col-0age(8_weeks)globular_embryo_
col-0age(8_weeks)globular_embryo_
col-0age(8_weeks)globular_embryo_
OrganismPart: Pollen Ecotype: Ler-0 GeneticModification: None NASC:Growth Stage:
5.10 NASC:StockCode: NW20
OrganismPart: Pollen Ecotype: Ler-0 GeneticModification: None NASC:Growth Stage:
5.10 NASC:StockCode: NW20
OrganismPart: Pollen Ecotype: Ler-0 GeneticModification: None NASC:Growth Stage:
5.10 NASC:StockCode: NW20
col-0age(6_weeks) pollen_
controlled system (29 days); age (29 days ); flower
controlled system (29 days); age (29 days ); flower
greenhouse (29 days);age (29 days ); flower

cold_control_0min_root no treatment root
cold_control_0min_root no treatment root
cold_control_30min_root no treatment root
cold_control_30min_root no treatment root
whole plants seedling growth MT-p15-8 35S::ZAP12
col-0age(15_days)root_
col-0age(15_days)root_
col-0age(17_days)root_
col-0age(17_days)root_
total roots (primary and all lateral )
OrganismPart: whole seedling Ecotype: Col-0 GeneticModification: Aequorin
transgene NASC:StockCode: StrainOrLine: aeq+
Small excised segments of primary root tissue corresponding to root-hair elongation
zone
Small excised segments of primary root tissue corresponding to root-hair elongation
zone
OrganismPart: Small excised segments of primary root tissue corresponding to root-
hair elongation zone Ecotype: Columbia GeneticModification: EMS mutant, Plant Cell
(1990) 2:235-243 NASC:Growth Stage: 1.02 NASC:StockCode: N2259 StrainOrLine:
rhd2-1
Small excised segments of primary root tissue corresponding to root-hair elongation
OrganismPart: total tissue Ecotype: Ler GeneticModification: EMS Mutant of N1695
NASC:Growth Stage: 1.04 NASC:StockCode: StrainOrLine: 15B
OrganismPart: root Ecotype: C24 GeneticModification: Transgenic plant carrying
ANR1::rGR fusion under the 35S promoter control. The ANR1::rGR fusion is stongly
expressed in this line. NASC:Growth Stage: 1.02 NASC:StockCode: StrainOrLine:
Working overexpressor
OrganismPart: root Ecotype: C24 GeneticModification: Transgenic plant carrying
ANR1::rGR fusion under the 35S promoter control. The ANR1::rGR fusion is stongly
expressed in this line. NASC:Growth Stage: 1.02 NASC:StockCode: StrainOrLine:
Working overexpressor
col-0age(7_days)root_

col-0age(21+_days)stage_10-11_flower_
col-0age(21+_days)stage_10-11_flower_
col-0age(21+_days)stage_10-11_flower_
col-0age(21+_days)stage_12_flower_
col-0age(21+_days)stamen_
col-0age(21+_days)stamen_
col-0age(21+_days)stamen_

OrganismPart: inflorescence Ecotype: ws NASC:Growth Stage: 6.0

OrganismPart: inflorescence Ecotype: ws NASC:Growth Stage: 6.0
OrganismPart: inflorescence Ecotype: ws NASC:Growth Stage: 6.0

OrganismPart: inflorescence Ecotype: ws NASC:Growth Stage: 6.0
controlled system (29 days); age (29 days ); flower
controlled system (29 days); age (29 days ); flower
greenhouse (29 days);age (29 days ); flower
greenhouse (29 days);age (29 days ); flower
inflorescence stem tip
inflorescence stem tip
inflorescence stem tip
Young Flower Buds


cold_control_30min_root no treatment root
osmotic_24h_shoot mannitol (300 mM, 24 hours) shoot
col-0age(15_days)root_
col-0age(15_days)root_
col-0age(17_days)root_
col-0age(17_days)root_
OrganismPart: Pollen Ecotype:    Ler-0 GeneticModification: None NASC:Growth Stage:
5.10 NASC:StockCode: NW20
OrganismPart: Pollen Ecotype:    Ler-0 GeneticModification: None NASC:Growth Stage:
5.10 NASC:StockCode: NW20
OrganismPart: Pollen Ecotype:    Ler-0 GeneticModification: None NASC:Growth Stage:
5.10 NASC:StockCode: NW20
OrganismPart: Pollen Ecotype:    Ler-0 GeneticModification: None NASC:Growth Stage:
5.10 NASC:StockCode: NW20
col-0age(6_weeks) pollen_
total roots (primary and all lateral )
no treatment dry seeds
seed imbibition water (3 hours)
seed imbibition water (3 hours)
Stock Code: N3076 Tissue: axillary buds approx. 2 mm elongated Genetic
background: col-0 Genetic variation: EMS
seeds dry seed stage cold (4 C, 96 hr )
Young Flower Buds


col-0age(15_days)root_
col-0age(15_days)root_
whole plant 7-day-old seedlings 3-dehydroteasterone (1 uM, 3 hours)
whole plant 7-day-old seedlings 3-dehydroteasterone (1 uM, 3 hours)
whole plant 7-day-old seedlings ABA (10 uM, 1 hours)
whole plant 7-day-old seedlings Methyl Jasmonate (10 uM, 3 hours)
OrganismPart: whole plant Ecotype: ws-2 NASC:Growth Stage: 10-day-old whole
plant NASC:StockCode: N1601 Experiment: Comparative transcriptome analysis
between wild-type and gpa1 mutant in response to ABA
OrganismPart: whole plant Ecotype: ws-2 NASC:Growth Stage: 10-day-old whole
plant NASC:StockCode: N1601 Experiment: Comparative transcriptome analysis
between wild-type and gpa1 mutant in response to ABA
total roots (primary and all lateral )

whole seedlings

whole seedlings
OrganismPart: whole seedling Ecotype: col-7 NASC:StockCode: N3731
OrganismPart: whole seedling Ecotype: col-7 NASC:StockCode: N3731
OrganismPart: whole seedling Ecotype: col-7 NASC:StockCode: N3731
Small excised segments of primary root tissue corresponding to root-hair elongation
zone
Small excised segments of primary root tissue corresponding to root-hair elongation
zone
OrganismPart: Small excised segments of primary root tissue corresponding to root-
hair elongation zone Ecotype: Columbia GeneticModification: EMS mutant, Plant Cell
(1990) 2:235-243 NASC:Growth Stage: 1.02 NASC:StockCode: N2259 StrainOrLine:
rhd2-1
OrganismPart: root Ecotype: C24 GeneticModification: Transgenic plant carrying
ANR1::rGR fusion under the 35S promoter control. The ANR1::rGR fusion is stongly
expressed in this line. NASC:Growth Stage: 1.02 NASC:StockCode: StrainOrLine:
Working overexpressor
col-0age(7_days)root_

col-0age(21+_days)internodeshoot_
col-0age(21+_days)internodeshoot_
col-0age(21+_days)internodeshoot_
col-0age(21+_days)nodeshoot_
Guard Cell enriched leaves

Guard Cell enriched leaves

Guard Cell enriched leaves
Tumour
inflorescence stem tip
inflorescence stem tip
inflorescence stem base
inflorescence stem base
inflorescence stem base
inflorescence stem base
controlled system (29 days); age (29 days ); stem
controlled system (29 days); age (29 days ); stem
greenhouse (29 days); age (29 days ); stem
greenhouse (29 days); age (29 days ); stem

col-0age(15_days)root_
col-0age(15_days)root_
col-0age(17_days)root_
col-0age(17_days)root_
cotyledon ; hypocotyl seedling growth light wavelength (far-red light, 45 minutes)
cotyledon ; hypocotyl seedling growth light regime (continuous darkness, 44
minutes) light wavelength (red light, 1 minutes)
cotyledon ; hypocotyl seedling growth light wavelength (red light, 45 minutes)
cotyledon ; hypocotyl seedling growth light wavelength (blue light, 45 minutes)
total roots (primary and all lateral )
Growth Room 16 hour days Seedlings were floated on distilled water at 30 degrees
centigrade, then blotted on tissue and frozen in liquid nitrogen
Growth Room 16 hour days Seedlings were floated on distilled water at 30 degrees
centigrade, then blotted on tissue and frozen in liquid nitrogen
col-0age(7_days)root_

col-0age(21+_days)nodeshoot_
col-0age(8_weeks)heart_embryo_
col-0age(8_weeks)heart_embryo_
col-0age(8_weeks)triangle_embryo_
col-0age(8_weeks)torpedo_embryo_
col-0age(8_weeks)torpedo_embryo_
cotyledon ; hypocotyl seedling growth light wavelength (far-red light, 45 minutes)
cotyledon ; hypocotyl seedling growth light regime (continuous darkness, 44
minutes) light wavelength (red light, 1 minutes)
cotyledon ; hypocotyl seedling growth light wavelength (red light, 45 minutes)
cotyledon ; hypocotyl seedling growth light wavelength (blue light, 45 minutes)
Guard Cell enriched leaves
greenhouse (29 days); age (29 days ); stem
greenhouse (29 days); age (29 days ); stem

whole plants seedling growth MT-p15-8 35S::ZAP12
whole plants seedling growth MT-WT24h(plate) cold (4C, 24 hours)
whole plants seedling growth MT-WT(zat12) gl1
col-0age(15_days)root_
col-0age(15_days)root_
the entire seedlings;Identification of genes responsive to non-metabolised glucose
analoges as an approach to hexokinase-independent glucose sensing in plants
the entire seedlings;Identification of genes responsive to non-metabolised glucose
analoges as an approach to hexokinase-independent glucose sensing in plants
whole plant 7-day-old seedlings 3-dehydroteasterone (1 uM, 3 hours)
whole plant 7-day-old seedlings ABA (10 uM, 1 hours)
whole plant 7-day-old seedlings ABA (10 uM, 3 hours)
whole plant 7-day-old seedlings Methyl Jasmonate (10 uM, 3 hours)
total roots (primary and all lateral )
OrganismPart: whole seedling Ecotype: Col-0 GeneticModification:           Aequorin
transgene NASC:StockCode: StrainOrLine: aeq+
OrganismPart: whole seedling Ecotype: Col-0 GeneticModification:           Aequorin
transgene NASC:StockCode: StrainOrLine: aeq+
whole plant 21-day-old plants, vegetative stage no treatment
whole plant 21-day-old plants, vegetative stage no treatment
whole plant 21-day-old plants, vegetative stage no treatment
MYB61 Overexpressor GROWTHCONDITIONS Dark DEVELOPMENTSTAGE 0.7 Whole
Plant
OrganismPart: whole seedling Ecotype: col-7 NASC:StockCode: N3731
OrganismPart: whole seedling Ecotype: col-7 NASC:StockCode: N3731
Small excised segments of primary root tissue corresponding to root-hair elongation
zone
Small excised segments of primary root tissue corresponding to root-hair elongation
zone
OrganismPart: Small excised segments of primary root tissue corresponding to root-
hair elongation zone Ecotype: Columbia GeneticModification: EMS mutant, Plant Cell
(1990) 2:235-243 NASC:Growth Stage: 1.02 NASC:StockCode: N2259 StrainOrLine:
rhd2-1
Small excised segments of primary root tissue corresponding to root-hair elongation
Whole seedlings
Whole seedlings
Growth Room 16 hour days Seedlings were floated on distilled water at 30 degrees
centigrade, then blotted on tissue and frozen in liquid nitrogen
Growth Room 16 hour days Seedlings were floated on distilled water at 30 degrees
centigrade, then blotted on tissue and frozen in liquid nitrogen
OrganismPart: total tissue Ecotype: Ler GeneticModification: EMS Mutant of N1695
NASC:Growth Stage: 1.04 NASC:StockCode: StrainOrLine: 15B
OrganismPart: total tissue Ecotype: Ler GeneticModification: EMS Mutant of N1695
NASC:Growth Stage: 1.04 NASC:StockCode: StrainOrLine: 15B
OrganismPart: root Ecotype: C24 GeneticModification: Transgenic plant carrying
ANR1::rGR fusion under the 35S promoter control. The ANR1::rGR fusion is stongly
expressed in this line. NASC:Growth Stage: 1.02 NASC:StockCode: StrainOrLine:
Working overexpressor
OrganismPart: root Ecotype: C24 GeneticModification: Transgenic plant carrying
ANR1::rGR fusion under the 35S promoter control. The ANR1::rGR fusion is stongly
expressed in this line. NASC:Growth Stage: 1.02 NASC:StockCode: StrainOrLine:
Working overexpressor
col-0age(7_days)root_

col-0age(21+_days)stamen_
col-0age(21+_days)stamen_
col-0age(21+_days)stamen_
col-0age(8_weeks)torpedo_embryo_
col-0age(8_weeks)torpedo_embryo_
col-0age(8_weeks)torpedo_embryo_
col-0age(8_weeks)early_curled_cotyledon_
col-0age(8_weeks)early_curled_cotyledon_
col-0age(8_weeks)early_curled_cotyledon_
col-0age(8_weeks)early_green_cotyledon_
inflorescence stem base
inflorescence stem base
inflorescence stem base
greenhouse (29 days); age (29 days ); stem

col-0age(15_days)root_
col-0age(15_days)root_
whole plant 7-day-old seedlings 3-dehydroteasterone (1 uM, 3 hours)
whole plant 7-day-old seedlings 3-dehydroteasterone (1 uM, 3 hours)
OrganismPart: whole plant Ecotype: ws-2 NASC:Growth Stage: 10-day-old whole
plant NASC:StockCode: N1601 Experiment: Comparative transcriptome analysis
between wild-type and gpa1 mutant in response to ABA
OrganismPart: whole plant Ecotype: ws-2 NASC:Growth Stage: 10-day-old whole
plant NASC:StockCode: N1601 Experiment: Comparative transcriptome analysis
between wild-type and gpa1 mutant in response to ABA
total roots (primary and all lateral )
OrganismPart: whole seedling Ecotype: col-7 NASC:StockCode: N3731
OrganismPart: whole seedling Ecotype: col-7 NASC:StockCode: N3731
Small excised segments of primary root tissue corresponding to root-hair elongation
zone
Small excised segments of primary root tissue corresponding to root-hair elongation
zone
OrganismPart: root Ecotype: C24 GeneticModification: Transgenic plant carrying
ANR1::rGR fusion under the 35S promoter control. The ANR1::rGR fusion is stongly
expressed in this line. NASC:Growth Stage: 1.02 NASC:StockCode: StrainOrLine:
Working overexpressor
col-0age(7_days)root_

col-0age(15_days)root_
col-0age(15_days)root_
whole plant 7-day-old seedlings ABA (10 uM, 1 hours)
OrganismPart: whole plant Ecotype: ws-2 NASC:Growth Stage: 10-day-old whole
plant NASC:StockCode: N1601 Experiment: Comparative transcriptome analysis
between wild-type and gpa1 mutant in response to ABA
OrganismPart: whole plant Ecotype: ws-2 NASC:Growth Stage: 10-day-old whole
plant NASC:StockCode: N1601 Experiment: Comparative transcriptome analysis
between wild-type and gpa1 mutant in response to ABA
total roots (primary and all lateral )
OrganismPart: whole seedling Ecotype: col-7 NASC:StockCode: N3731
OrganismPart: whole seedling Ecotype: col-7 NASC:StockCode: N3731
OrganismPart: root Ecotype: C24 GeneticModification: Transgenic plant carrying
ANR1::rGR fusion under the 35S promoter control. The ANR1::rGR fusion is stongly
expressed in this line. NASC:Growth Stage: 1.02 NASC:StockCode: StrainOrLine:
Working overexpressor
OrganismPart: root Ecotype: C24 GeneticModification: Transgenic plant carrying
ANR1::rGR fusion under the 35S promoter control. The ANR1::rGR fusion is stongly
expressed in this line. NASC:Growth Stage: 1.02 NASC:StockCode: StrainOrLine:
Working overexpressor
col-0age(7_days)root_

osmotic_6h_root mannitol (300 mM, 6 hours) root
osmotic_12h_root mannitol (300 mM, 12 hours) root
osmotic_24h_shoot mannitol (300 mM, 24 hours) shoot
col-0age(6_weeks)pollen_
col-0age(6_weeks)pollen_
col-0age(6_weeks)pollen_
vascular leaf late rosette growth GST-Necrosis-inducing Phytophthora Protein 1 (1
uM ) time after treatment (4 hours)
OrganismPart: whole plant Ecotype: ws-2 NASC:Growth Stage: 1.06
NASC:StockCode: N1601
OrganismPart: Pollen Ecotype: Ler-0 GeneticModification: None NASC:Growth Stage:
5.10 NASC:StockCode: NW20
OrganismPart: Pollen Ecotype: Ler-0 GeneticModification: None NASC:Growth Stage:
5.10 NASC:StockCode: NW20
OrganismPart: Pollen Ecotype: Ler-0 GeneticModification: None NASC:Growth Stage:
5.10 NASC:StockCode: NW20
col-0age(6_weeks) pollen_
no treatment dry seeds
no treatment dry seeds
seed dry seed stage no treatment
seed dry seed stage no treatment
seed imbibition water (3 hours)
seed imbibition water (3 hours)

osmotic_6h_root mannitol (300 mM, 6 hours) root
salt_24h_root NaCl (150 mM, 24 hours) root
heat_3h_shoot
heat_3h_shoot
col-0age(21+_days)internodeshoot_
col-0age(21_days)inflorescencestage_1-6_flower_
vascular leaf late rosette growth Pseudomonas syringae pv. tomato avrRpm1 (10e8
cfu/ml ) time after treatment (2 hours)
vascular leaf late rosette growth Pseudomonas syringae pv. tomato avrRpm1 (10e8
cfu/ml ) time after treatment (2 hours)
vascular leaf late rosette growth Pseudomonas syringae pv. tomato DC3000 hrcC-
(10e8 cfu/ml ) time after treatment (2 hours)
vascular leaf late rosette growth Pseudomonas syringae pv. tomato DC3000 hrcC-
(10e8 cfu/ml ) time after treatment (2 hours)
OrganismPart: inflorescence Ecotype: ws NASC:Growth Stage: 6.0

OrganismPart: inflorescence Ecotype: ws NASC:Growth Stage: 6.0
OrganismPart: Pollen Ecotype: Ler-0 GeneticModification: None NASC:Growth Stage:
5.10 NASC:StockCode: NW20
OrganismPart: Pollen Ecotype: Ler-0 GeneticModification: None NASC:Growth Stage:
5.10 NASC:StockCode: NW20
OrganismPart: Pollen Ecotype: Ler-0 GeneticModification: None NASC:Growth Stage:
5.10 NASC:StockCode: NW20
OrganismPart: Pollen Ecotype: Ler-0 GeneticModification: None NASC:Growth Stage:
5.10 NASC:StockCode: NW20
OrganismPart: Pollen Ecotype: Ler-0 GeneticModification: None NASC:Growth Stage:
5.10 NASC:StockCode: NW20
greenhouse (29 days);age (29 days ); flower
OrganismPart: Whole leaf Age time point: 4 hours Ecotype: col-5 NASC:Growth
Stage: 3.90 NASC:StockCode: N1688
OrganismPart: Whole leaf Age time point: 4 hours Ecotype: col-5 NASC:Growth
Stage: 3.90 NASC:StockCode: N1688
OrganismPart: Whole leaf Age time point: 4 hours Ecotype: col-5 NASC:Growth
Stage: 3.90 NASC:StockCode: N1688
Stock Code: N3076 Tissue: axillary buds approx. 2 mm elongated Genetic
background: col-0 Genetic variation: EMS
ms1ttg-young Flower


col-0age(21+_days)sepal_
col-0age(21+_days)sepal_
col-0age(21+_days)sepal_
col-0age(21+_days)petal_
col-0age(21+_days)petal_
col-0age(21+_days)petal_
col-0age(21+_days)stamen_
col-0age(21+_days)stamen_
col-0age(21+_days)stamen_
col-0age(21+_days)sepalstage_15_flower_
col-0age(21+_days)sepalstage_15_flower_
col-0age(21+_days)sepalstage_15_flower_
col-0age(21+_days)petalstage_15_flower_
col-0age(21+_days)petalstage_15_flower_
col-0age(21+_days)petalstage_15_flower_
col-0age(21+_days)stage_15_flowerstamen_
col-0age(21+_days)stage_15_flowerstamen_
col-0age(21+_days)stage_15_flowerstamen_
col-0age(21+_days)carpelstage_15_flower_
col-0age(21+_days)carpelstage_15_flower_
col-0age(21+_days)carpelstage_15_flower_
col-0age(6_weeks)pollen_
col-0age(6_weeks)pollen_
col-0age(6_weeks)pollen_

OrganismPart: inflorescence Ecotype: ws NASC:Growth Stage: 6.0

OrganismPart: inflorescence Ecotype: ws NASC:Growth Stage: 6.0
OrganismPart: Pollen Ecotype: Ler-0 GeneticModification: None NASC:Growth Stage:
5.10 NASC:StockCode: NW20
OrganismPart: Pollen Ecotype: Ler-0 GeneticModification: None NASC:Growth Stage:
5.10 NASC:StockCode: NW20
OrganismPart: Pollen Ecotype: Ler-0 GeneticModification: None NASC:Growth Stage:
5.10 NASC:StockCode: NW20
col-0age(6_weeks) pollen_
greenhouse (29 days);age (29 days ); flower
greenhouse (29 days);age (29 days ); flower
ms1ttg-old Flower


cold_control_30min_root no treatment root
salt_24h_root NaCl (150 mM, 24 hours) root
col-0age(15_days)root_
col-0age(15_days)root_
whole plant 7-day-old seedlings cycloheximide (10 uM, 3 hours)
whole plant 7-day-old seedlings cycloheximide (10 uM, 3 hours)
whole plant 7-day-old seedlings 3-dehydroteasterone (1 uM, 3 hours)
whole plant 7-day-old seedlings 3-dehydroteasterone (1 uM, 3 hours)
whole plant 7-day-old seedlings ABA (10 uM, 1 hours)
OrganismPart: whole plant Ecotype: ws-2 NASC:Growth Stage: 10-day-old whole
plant NASC:StockCode: N1601 Experiment: Comparative transcriptome analysis
between wild-type and gpa1 mutant in response to ABA
OrganismPart: whole plant Ecotype: ws-2 NASC:Growth Stage: 10-day-old whole
plant NASC:StockCode: N1601 Experiment: Comparative transcriptome analysis
between wild-type and gpa1 mutant in response to ABA
total roots (primary and all lateral )

whole seedlings

whole seedlings

whole seedlings
OrganismPart: whole seedling Ecotype: col-7 NASC:StockCode: N3731
OrganismPart: whole seedling Ecotype: col-7 NASC:StockCode: N3731
OrganismPart: whole seedling Ecotype: col-7 NASC:StockCode: N3731
Small excised segments of primary root tissue corresponding to root-hair elongation
zone
Small excised segments of primary root tissue corresponding to root-hair elongation
zone
col-0age(7_days)root_

osmotic_6h_shoot mannitol (300 mM, 6 hours) shoot
osmotic_6h_shoot mannitol (300 mM, 6 hours) shoot
osmotic_24h_shoot mannitol (300 mM, 24 hours) shoot
col-0age(7_days)hypocotyl_
col-0age(7_days)hypocotyl_
col-0age(7_days)hypocotyl_
col-0age(21+_days)stage_9_flower_
col-0age(21+_days)stage_10-11_flower_
col-0age(21+_days)stage_10-11_flower_
col-0age(21+_days)stage_10-11_flower_
col-0age(21+_days)stage_12_flower_
col-0age(21+_days)carpel_
col-0age(21+_days)sepalstage_15_flower_
col-0age(21+_days)sepalstage_15_flower_
col-0age(21+_days)sepalstage_15_flower_
col-0age(21+_days)carpelstage_15_flower_
col-0age(21+_days)carpelstage_15_flower_
col-0age(21+_days)carpelstage_15_flower_
vascular leaf late rosette growth Pseudomonas syringae pv. tomato DC3000 (10e8
cfu/ml ); time after treatment (6 hours)
vascular leaf late rosette growth Pseudomonas syringae pv. tomato avrRpm1 (10e8
cfu/ml ) time after treatment (2 hours)
vascular leaf late rosette growth Pseudomonas syringae pv. tomato avrRpm1 (10e8
cfu/ml ) time after treatment (2 hours)
vascular leaf late rosette growth Pseudomonas syringae pv. tomato avrRpm1 (10e8
cfu/ml ) time after treatment (2 hours)
vascular leaf late rosette growth Pseudomonas syringae pv. tomato DC3000 hrcC-
(10e8 cfu/ml ) time after treatment (2 hours)
vascular leaf late rosette growth Pseudomonas syringae pv. tomato DC3000 hrcC-
(10e8 cfu/ml ) time after treatment (2 hours)
vascular leaf late rosette growth GST-Necrosis-inducing Phytophthora Protein 1 (1
uM ) time after treatment (4 hours)
vascular leaf late rosette growth Phytophthora infestans (10^6 spores/ml ) time
after treatment (6 hours)
vascular leaf rosette growth Botrytis cinerea (5X10^5 spores/ml ) time after
treatment (18 hours)
vascular leaf rosette growth Botrytis cinerea (5X10^5 spores/ml ) time after
treatment (48 hours)
Stock Code: N2614 Developmental stage: 6.0 Tissue: Rosette leaves Genetic
background: ws-2 Genetic variation: T-DNA insert
Stock Code: N2614 Developmental stage: 6.0 Tissue: Rosette leaves Genetic
background: ws-2 Genetic variation: T-DNA insert
OrganismPart: Whole leaf Age time point: 4 hours Ecotype: col-5 NASC:Growth
Stage: 3.90 NASC:StockCode: N1688
OrganismPart: Whole leaf Age time point: 4 hours Ecotype: col-5 NASC:Growth
Stage: 3.90 NASC:StockCode: N1688
OrganismPart: Whole leaf Age time point: 4 hours Ecotype: col-5 NASC:Growth
Stage: 3.90 NASC:StockCode: N1688
OrganismPart: Whole leaf Age time point: 4 hours Ecotype: col-5 NASC:Growth
Stage: 3.90 NASC:StockCode: N1688
OrganismPart: Cell suspension
OrganismPart: Cell suspension

cold_control_30min_root no treatment root
salt_6h_root NaCl (150 mM, 6 hours) root
col-0age(15_days)root_
col-0age(15_days)root_
col-0age(17_days)root_
OrganismPart: whole plant Ecotype: ws-2 NASC:Growth Stage: 10-day-old whole
plant NASC:StockCode: N1601 Experiment: Comparative transcriptome analysis
between wild-type and gpa1 mutant in response to ABA
total roots (primary and all lateral )
MYB761 Knockout, Plant Cell 13, 2777-2791 Overexpressor GROWTHCONDITIONS
Dark DEVELOPMENTSTAGE 0.7 Whole Plant
MYB61 Overexpressor GROWTHCONDITIONS Dark DEVELOPMENTSTAGE 0.7 Whole
Plant
OrganismPart: whole seedling Ecotype: col-7 NASC:StockCode: N3731
OrganismPart: whole seedling Ecotype: col-7 NASC:StockCode: N3731
OrganismPart: whole seedling Ecotype: col-7 NASC:StockCode: N3731
Small excised segments of primary root tissue corresponding to root-hair elongation
zone
Small excised segments of primary root tissue corresponding to root-hair elongation
zone
OrganismPart: Small excised segments of primary root tissue corresponding to root-
hair elongation zone Ecotype: Columbia GeneticModification: EMS mutant, Plant Cell
(1990) 2:235-243 NASC:Growth Stage: 1.02 NASC:StockCode: N2259 StrainOrLine:
rhd2-1
Small excised segments of primary root tissue corresponding to root-hair elongation
OrganismPart: root Ecotype: C24 GeneticModification: Transgenic plant carrying
ANR1::rGR fusion under the 35S promoter control. The ANR1::rGR fusion is stongly
expressed in this line. NASC:Growth Stage: 1.02 NASC:StockCode: StrainOrLine:
Working overexpressor
col-0age(7_days)root_

col-0age(8_weeks)early_curled_cotyledon_
col-0age(8_weeks)early_curled_cotyledon_
col-0age(8_weeks)early_curled_cotyledon_
col-0age(8_weeks)early_green_cotyledon_
seed germination water (3 hours)
seed germination water (3 hours)
seed germination water (6 hours)
seed germination water (6 hours)
no treatment dry seeds
no treatment dry seeds
seed dry seed stage no treatment
seed dry seed stage no treatment
seed imbibition water (3 hours)
seeds dry seed stage cold (4 C, 96 hr )

col-0age(21_days)inflorescencestage_1-6_flower_
col-0age(21_days)inflorescencestage_1-6_flower_
col-0age(21_days)inflorescencestage_1-6_flower_
col-0age(21+_days)stage_9_flower_
col-0age(21+_days)stage_10-11_flower_
col-0age(21+_days)stage_10-11_flower_
col-0age(21+_days)stage_10-11_flower_
col-0age(21+_days)carpel_
col-0age(21+_days)carpelstage_15_flower_
col-0age(21+_days)carpelstage_15_flower_
col-0age(21+_days)carpelstage_15_flower_

OrganismPart: inflorescence Ecotype: ws NASC:Growth Stage: 6.0

OrganismPart: inflorescence Ecotype: ws NASC:Growth Stage: 6.0
OrganismPart: inflorescence Ecotype: ws NASC:Growth Stage: 6.0

Guard Cell enriched leaves

Guard Cell enriched leaves

Guard Cell enriched leaves
Stock Code: N3076 Tissue: axillary buds approx. 2 mm elongated Genetic
background: col-0 Genetic variation: EMS
Stock Code: N3076 Tissue: axillary buds approx. 2 mm elongated Genetic
background: col-0 Genetic variation: EMS

col-0age(21_days)inflorescencestage_1-6_flower_
col-0age(21_days)inflorescencestage_1-6_flower_
col-0age(21_days)inflorescencestage_1-6_flower_
col-0age(21+_days)stage_9_flower_
col-0age(21+_days)stage_10-11_flower_
col-0age(21+_days)stage_10-11_flower_
col-0age(21+_days)stage_10-11_flower_
col-0age(21+_days)stage_12_flower_
col-0age(21+_days)carpelstage_15_flower_
col-0age(21+_days)carpelstage_15_flower_
col-0age(21+_days)carpelstage_15_flower_
controlled system (29 days); age (29 days ); flower
ms1ttg-old Flower

Old Flower Buds

Old Flower Buds

Young Flower Buds


osmotic_6h_shoot mannitol (300 mM, 6 hours) shoot
col-0age(35_days)senescence_leaf_
col-0age(35_days)senescence_leaf_
col-0age(35_days)senescence_leaf_
col-0age(21_days)inflorescencestage_1-6_flower_
col-0age(21_days)inflorescencestage_1-6_flower_
col-0age(21_days)inflorescencestage_1-6_flower_
col-0age(21+_days)stage_9_flower_
col-0age(21+_days)stage_10-11_flower_
col-0age(21+_days)stage_10-11_flower_
col-0age(21+_days)stage_10-11_flower_
col-0age(21+_days)stage_12_flower_
col-0age(21+_days)carpel_
col-0age(21+_days)sepalstage_15_flower_
col-0age(21+_days)sepalstage_15_flower_
col-0age(21+_days)sepalstage_15_flower_
col-0age(21+_days)carpelstage_15_flower_
col-0age(21+_days)carpelstage_15_flower_
col-0age(21+_days)carpelstage_15_flower_
vascular leaf rosette growth Botrytis cinerea (5X10^5 spores/ml ) time after
treatment (48 hours)
Stock Code: N1093 Developmental stage: 3.90: Rosette Growth Complete Tissue:
whole above ground rosettes

Programmed Cell Death Senescence
no treatment dry seeds
no treatment dry seeds
seed dry seed stage no treatment
seed dry seed stage no treatment
seed imbibition water (3 hours)
seed imbibition water (3 hours)
cultured cell mid-exponential phase sucrose (3%, 0 hours)
fully expanded leaves
OrganismPart: Cell suspension
OrganismPart: Cell suspension
OrganismPart: Cell suspension

col-0age(21+_days)stamen_
col-0age(21+_days)stamen_
col-0age(21+_days)stamen_
col-0age(8_weeks)triangle_embryo_
col-0age(8_weeks)torpedo_embryo_
col-0age(8_weeks)torpedo_embryo_
col-0age(8_weeks)torpedo_embryo_
col-0age(8_weeks)early_curled_cotyledon_
col-0age(8_weeks)early_curled_cotyledon_
col-0age(8_weeks)early_curled_cotyledon_
col-0age(8_weeks)early_green_cotyledon_
OrganismPart: Pollen Ecotype: Ler-0 GeneticModification: None NASC:Growth Stage:
5.10 NASC:StockCode: NW20

cold_control_0min_root no treatment root
cold_control_0min_root no treatment root
cold_control_30min_root no treatment root
cold_control_30min_root no treatment root
cold (4 C, 24 hours) root
cold (4 C, 24 hours) root
osmotic_3h_root mannitol (300 mM, 3 hours) root
osmotic_6h_root mannitol (300 mM, 6 hours) root
osmotic_12h_root mannitol (300 mM, 12 hours) root
osmotic_12h_root mannitol (300 mM, 12 hours) root
col-0age(15_days)root_
col-0age(15_days)root_
total roots (primary and all lateral )
OrganismPart: root Ecotype: C24 GeneticModification: Transgenic plant carrying
ANR1::rGR fusion under the 35S promoter control. The ANR1::rGR fusion is stongly
expressed in this line. NASC:Growth Stage: 1.02 NASC:StockCode: StrainOrLine:
Working overexpressor
OrganismPart: root Ecotype: C24 GeneticModification: Transgenic plant carrying
ANR1::rGR fusion under the 35S promoter control. The ANR1::rGR fusion is stongly
expressed in this line. NASC:Growth Stage: 1.02 NASC:StockCode: StrainOrLine:
Working overexpressor
col-0age(7_days)root_

col-0age(35_days)senescence_leaf_
col-0age(35_days)senescence_leaf_
col-0age(35_days)senescence_leaf_
vascular leaf late rosette growth Pseudomonas syringae pv. tomato DC3000 (10e8
cfu/ml ) time after treatment (24 hours)
vascular leaf late rosette growth Pseudomonas syringae pv. tomato DC3000 (10e8
cfu/ml ) time after treatment (24 hours)
vascular leaf late rosette growth Pseudomonas syringae pv. tomato DC3000 (10e8
cfu/ml ) time after treatment (24 hours)
vascular leaf rosette growth Botrytis cinerea (5X10^5 spores/ml ) time after
treatment (48 hours)
vascular leaf rosette growth Botrytis cinerea (5X10^5 spores/ml ) time after
treatment (48 hours)
col-0age(6_weeks) pollen_
Programmed Cell Death Senescence

Programmed Cell Death Senescence
OrganismPart: Whole leaf Age time point: 4 hours Ecotype: col-5 NASC:Growth
Stage: 3.90 NASC:StockCode: N1688
fully expanded leaves

col-0age(21_days)inflorescencestage_1-6_flower_
col-0age(21_days)inflorescencestage_1-6_flower_
col-0age(21_days)inflorescencestage_1-6_flower_
col-0age(21+_days)stage_9_flower_
col-0age(21+_days)stage_10-11_flower_
col-0age(21+_days)stage_10-11_flower_
col-0age(21+_days)stage_10-11_flower_
col-0age(21+_days)stage_12_flower_
col-0age(21+_days)petal_
col-0age(21+_days)petal_
col-0age(21+_days)stamen_
col-0age(21+_days)stamen_
col-0age(21+_days)stamen_
col-0age(21+_days)carpel_
col-0age(7_days)leafshoot_apex_
col-0age(7_days)leafshoot_apex_
col-0age(7_days)leafshoot_apex_
shoot apex rosette stage KB9 line
shoot apex rosette stage
shoot apex rosette stage
shoot apex rosette stage KB31 line photoperiod (16 hr, 3 days)
seed germination water (3 hours)
seed germination water (3 hours)
seed imbibition ABA (3 uM, 24 hours)
24 h imbibed in water imbibed seeds water (48 hours)

vascular leaf 4-week-old plants at 10-11 rossette leaf stage (just before bolting)
Pseudomonas syringae ES4326 avrRpt2 time after treatment (4 hours)
vascular leaf 4-week-old plants at 10-11 rossette leaf stage (just before bolting)
Pseudomonas syringae ES4326 avrRpt2 time after treatment (8 hours)
vascular leaf late rosette growth Pseudomonas syringae pv. tomato avrRpm1 (10e8
cfu/ml ) time after treatment (2 hours)
vascular leaf late rosette growth Pseudomonas syringae pv. tomato avrRpm1 (10e8
cfu/ml ) time after treatment (2 hours)
vascular leaf late rosette growth Pseudomonas syringae pv. tomato DC3000 hrcC-
(10e8 cfu/ml ) time after treatment (2 hours)
vascular leaf late rosette growth Pseudomonas syringae pv. tomato DC3000 hrcC-
(10e8 cfu/ml ) time after treatment (2 hours)
vascular leaf late rosette growth water time after treatment (1 hours)
vascular leaf late rosette growth CaCl2 + MgCl2 (1mM CaCl2 + 2.5 mM MgCl2 ) time
after treatment (1 hours)
vascular leaf late rosette growth water time after treatment (1 hours)
vascular leaf late rosette growth CaCl2 + MgCl2 (1mM CaCl2 + 2.5 mM MgCl2 ) time
after treatment (4 hours)
vascular leaf late rosette growth Phytophthora infestans (10^6 spores/ml ) time
after treatment (6 hours)
vascular leaf late rosette growth Phytophthora infestans (10^6 spores/ml ) time
after treatment (6 hours)
All aerial tissue
whole plant 7-day-old seedlings AgNO3 (10 uM, 3 hours)
OrganismPart: whole plant Ecotype: ws-2 NASC:Growth Stage: 10-day-old whole
plant NASC:StockCode: N1601 Experiment: Comparative transcriptome analysis
between wild-type and gpa1 mutant in response to ABA
OrganismPart: Whole leaf Age time point: 4 hours Ecotype: col-5 NASC:Growth
Stage: 3.90 NASC:StockCode: N1688
OrganismPart: Whole leaf Age time point: 4 hours Ecotype: col-5 NASC:Growth
Stage: 3.90 NASC:StockCode: N1688

col-0age(21+_days)stamen_
col-0age(21+_days)stamen_
col-0age(21+_days)stamen_
col-0age(21+_days)stage_15_flower_
col-0age(21+_days)stage_15_flower_
col-0age(21+_days)stage_15_flower_
col-0age(21+_days)stage_15_flowerstamen_
col-0age(21+_days)stage_15_flowerstamen_
col-0age(21+_days)stage_15_flowerstamen_
col-0age(6_weeks)pollen_
col-0age(6_weeks)pollen_
col-0age(6_weeks)pollen_
col-0age(8_weeks)globular_embryo_
col-0age(8_weeks)globular_embryo_
col-0age(8_weeks)globular_embryo_
OrganismPart: Pollen Ecotype: Ler-0 GeneticModification: None NASC:Growth Stage:
5.10 NASC:StockCode: NW20
OrganismPart: Pollen Ecotype: Ler-0 GeneticModification: None NASC:Growth Stage:
5.10 NASC:StockCode: NW20
OrganismPart: Pollen Ecotype: Ler-0 GeneticModification: None NASC:Growth Stage:
5.10 NASC:StockCode: NW20
col-0age(6_weeks) pollen_
controlled system (29 days); age (29 days ); flower
controlled system (29 days); age (29 days ); flower
greenhouse (29 days);age (29 days ); flower

cold_control_0min_root no treatment root
cold_control_30min_root no treatment root
cold_control_30min_root no treatment root
cold (4 C, 24 hours) root
col-0age(7_days)hypocotyl_
col-0age(7_days)hypocotyl_
col-0age(7_days)hypocotyl_
col-0age(15_days)root_
col-0age(17_days)root_
col-0age(17_days)root_
cotyledon ; hypocotyl seedling growth light wavelength (far-red light, 45 minutes)
cotyledon ; hypocotyl seedling growth light regime (continuous darkness, 44
minutes) light wavelength (red light, 1 minutes)
cotyledon ; hypocotyl seedling growth light wavelength (red light, 45 minutes)
cotyledon ; hypocotyl seedling growth light wavelength (blue light, 45 minutes)
total roots (primary and all lateral )
no treatment dry seeds
no treatment dry seeds
seed dry seed stage no treatment
seed dry seed stage no treatment
seed imbibition water (3 hours)
seed imbibition water (3 hours)
OrganismPart: root Ecotype: C24 GeneticModification: Transgenic plant carrying
ANR1::rGR fusion under the 35S promoter control. The ANR1::rGR fusion is stongly
expressed in this line. NASC:Growth Stage: 1.02 NASC:StockCode: StrainOrLine:
Working overexpressor
seeds dry seed stage cold (4 C, 96 hr )

time after treatment (6 hours) light wavelength (UV-B light, 6 hours) shoot
time after treatment (6 hours) light wavelength (UV-B light, 6 hours) shoot
col-0age(35_days)senescence_leaf_
col-0age(35_days)senescence_leaf_
col-0age(35_days)senescence_leaf_
col-0age(21+_days)sepalstage_15_flower_
col-0age(21+_days)sepalstage_15_flower_
col-0age(21+_days)sepalstage_15_flower_
col-0age(6_weeks)pollen_
vascular leaf late rosette growth Pseudomonas syringae pv. tomato DC3000 (10e8
cfu/ml ); time after treatment (6 hours)
vascular leaf late rosette growth Pseudomonas syringae pv. tomato DC3000 (10e8
cfu/ml ) time after treatment (24 hours)
vascular leaf late rosette growth Pseudomonas syringae pv. tomato DC3000 (10e8
cfu/ml ) time after treatment (24 hours)
vascular leaf late rosette growth Pseudomonas syringae pv. tomato DC3000 (10e8
cfu/ml ) time after treatment (24 hours)
vascular leaf rosette growth Botrytis cinerea (5X10^5 spores/ml ) time after
treatment (48 hours)
vascular leaf rosette growth Botrytis cinerea (5X10^5 spores/ml ) time after
treatment (48 hours)
OrganismPart: Pollen Ecotype: Ler-0 GeneticModification: None NASC:Growth Stage:
5.10 NASC:StockCode: NW20
OrganismPart: Pollen Ecotype: Ler-0 GeneticModification: None NASC:Growth Stage:
5.10 NASC:StockCode: NW20
All aerial tissue
All aerial tissue
Programmed Cell Death Senescence

Programmed Cell Death Senescence
OrganismPart: Whole leaf Age time point: 4 hours Ecotype: col-5 NASC:Growth
Stage: 3.90 NASC:StockCode: N1688
no treatment dry seeds
no treatment dry seeds
seed dry seed stage no treatment
seed dry seed stage no treatment
seed imbibition water (3 hours)
seed imbibition water (3 hours)
fully expanded leaves

cold_control_0min_root no treatment root
cold_control_0min_root no treatment root
cold_control_30min_root no treatment root
cold_control_30min_root no treatment root
salt_24h_root NaCl (150 mM, 24 hours) root
col-0age(17_days)root_
col-0age(17_days)root_
whole plant 7-day-old seedlings ABA (10 uM, 3 hours)
whole plant 7-day-old seedlings Methyl Jasmonate (10 uM, 3 hours)
OrganismPart: whole plant Ecotype: ws-2 NASC:Growth Stage: 10-day-old whole
plant NASC:StockCode: N1601 Experiment: Comparative transcriptome analysis
between wild-type and gpa1 mutant in response to ABA
OrganismPart: whole plant Ecotype: ws-2 NASC:Growth Stage: 10-day-old whole
plant NASC:StockCode: N1601 Experiment: Comparative transcriptome analysis
between wild-type and gpa1 mutant in response to ABA
total roots (primary and all lateral )

Col-0 Whole Plant
MYB61 Overexpressor GROWTHCONDITIONS Dark DEVELOPMENTSTAGE                 0.7 Whole
Plant
MYB61 Overexpressor GROWTHCONDITIONS Dark DEVELOPMENTSTAGE                 0.7 Whole
Plant
OrganismPart: whole seedling Ecotype: col-7 NASC:StockCode: N3731
OrganismPart: whole seedling Ecotype: col-7 NASC:StockCode: N3731
OrganismPart: whole seedling Ecotype: col-7 NASC:StockCode: N3731
Small excised segments of primary root tissue corresponding to root-hair   elongation
zone
Small excised segments of primary root tissue corresponding to root-hair   elongation
zone
col-0age(7_days)root_
seeds dry seed stage average daily temperature (22 C, 96 hr )

cold_control_0min_root no treatment root
cold_control_30min_root no treatment root
whole plants seedling growth MT-p15-8 35S::ZAP12
whole plants seedling growth MT-WT(zat12) gl1
col-0age(7_days)hypocotyl_
col-0age(15_days)root_
col-0age(15_days)root_
col-0age(17_days)root_
col-0age(17_days)root_
cotyledon ; hypocotyl seedling growth light wavelength (far-red light, 45 minutes)
cotyledon ; hypocotyl seedling growth light regime (continuous darkness, 44
minutes) light wavelength (red light, 1 minutes)
cotyledon ; hypocotyl seedling growth light wavelength (red light, 45 minutes)
cotyledon ; hypocotyl seedling growth light wavelength (blue light, 45 minutes)
the entire seedlings;Identification of genes responsive to non-metabolised glucose
analoges as an approach to hexokinase-independent glucose sensing in plants
the entire seedlings;Identification of genes responsive to non-metabolised glucose
analoges as an approach to hexokinase-independent glucose sensing in plants
total roots (primary and all lateral )
OrganismPart: whole seedling Ecotype: Col-0 GeneticModification: Aequorin
transgene NASC:StockCode: StrainOrLine: aeq+
OrganismPart: whole seedling Ecotype: Col-0 GeneticModification: Aequorin
transgene NASC:StockCode: StrainOrLine: aeq+
Small excised segments of primary root tissue corresponding to root-hair elongation
zone
Small excised segments of primary root tissue corresponding to root-hair elongation
zone
OrganismPart: Small excised segments of primary root tissue corresponding to root-
hair elongation zone Ecotype: Columbia GeneticModification: EMS mutant, Plant Cell
(1990) 2:235-243 NASC:Growth Stage: 1.02 NASC:StockCode: N2259 StrainOrLine:
rhd2-1
Small excised segments of primary root tissue corresponding to root-hair elongation
Growth Room 16 hour days Seedlings were floated on distilled water at 30 degrees
centigrade, then blotted on tissue and frozen in liquid nitrogen
Growth Room 16 hour days Seedlings were floated on distilled water at 30 degrees
centigrade, then blotted on tissue and frozen in liquid nitrogen
OrganismPart: root Ecotype: C24 GeneticModification: Transgenic plant carrying
ANR1::rGR fusion under the 35S promoter control. The ANR1::rGR fusion is stongly
expressed in this line. NASC:Growth Stage: 1.02 NASC:StockCode: StrainOrLine:
Working overexpressor
col-0age(7_days)root_

cold (4 C, 12 hours) root
cold (4 C, 24 hours) shoot
cold (4 C, 24 hours) shoot
time after treatment (6 hours) light wavelength (UV-B light, 6 hours) shoot
time after treatment (6 hours) light wavelength (UV-B light, 6 hours) shoot
col-0age(35_days)senescence_leaf_
col-0age(35_days)senescence_leaf_
col-0age(35_days)senescence_leaf_
col-0age(21+_days)sepalstage_15_flower_
col-0age(21+_days)sepalstage_15_flower_
col-0age(21+_days)sepalstage_15_flower_
vascular leaf late rosette growth Pseudomonas syringae pv. tomato DC3000 (10e8
cfu/ml ) time after treatment (24 hours)
vascular leaf late rosette growth Pseudomonas syringae pv. tomato DC3000 (10e8
cfu/ml ) time after treatment (24 hours)
vascular leaf late rosette growth Pseudomonas syringae pv. tomato DC3000 (10e8
cfu/ml ) time after treatment (24 hours)
vascular leaf rosette growth Botrytis cinerea (5X10^5 spores/ml ) time after
treatment (48 hours)
vascular leaf rosette growth Botrytis cinerea (5X10^5 spores/ml ) time after
treatment (48 hours)
All aerial tissue
Programmed Cell Death Senescence
OrganismPart: Whole leaf Age time point: 4 hours Ecotype: col-5 NASC:Growth
Stage: 3.90 NASC:StockCode: N1688
Whole seedlings
Whole seedlings
Growth Room 16 hour days Seedlings were floated on distilled water at 40 degrees
centigrade, then blotted on tissue and frozen in liquid nitrogen
Growth Room 16 hour days Seedlings were floated on distilled water at 40 degrees
centigrade, then blotted on tissue and frozen in liquid nitrogen
Stock Code: N1601 Developmental stage: 3.7 Tissue: unshaded mature rosette
leaves
leaves
fully expanded leaves

osmotic_24h_shoot mannitol (300 mM, 24 hours) shoot
salt_3h_root NaCl (150 mM, 3 hours) root
salt_3h_root NaCl (150 mM, 3 hours) root
time after treatment (6 hours) light wavelength (UV-B light, 6 hours) shoot
col-0age(35_days)senescence_leaf_
col-0age(35_days)senescence_leaf_
col-0age(35_days)senescence_leaf_
vascular leaf rosette growth Botrytis cinerea (5X10^5 spores/ml ) time after
treatment (18 hours)
cultured cell time after subculture (1 days)
cultured cell time after subculture (3 days)
Programmed Cell Death Heat

Programmed Cell Death Control
cultured cell mid-exponential phase sucrose (3%, 10 hours)
cultured cell mid-exponential phase sucrose (3%, 12 hours)
cultured cell early stationary phase sucrose (3%, 4 hours)
OrganismPart: Cell suspension
OrganismPart: Cell suspension
OrganismPart: Cell suspension

col-0age(6_weeks)pollen_
OrganismPart: Pollen Ecotype: Ler-0 GeneticModification: None NASC:Growth Stage:
5.10 NASC:StockCode: NW20
OrganismPart: Pollen Ecotype: Ler-0 GeneticModification: None NASC:Growth Stage:
5.10 NASC:StockCode: NW20
col-0age(6_weeks) pollen_
petiole;Ethylene induced hyponastic growth in Arabidopsis thaliana

Programmed Cell Death Heat

Programmed Cell Death Senescence

Programmed Cell Death Heat

whole leaves

Col-0 Whole Plant
MYB61 Overexpressor GROWTHCONDITIONS Dark DEVELOPMENTSTAGE 0.7 Whole
Plant
Small excised segments of primary root tissue corresponding to root-hair elongation
zone
Stock Code: N1093 Developmental stage: 6.1 Tissue: lateral roots
fully expanded leaves

shoot system seedling growth MT-7dC(soil) cold (4C, 7 days)
salt_6h_shoot NaCl (150 mM, 6 hours) shoot
shoot system seedling growth MT-7dC(soil) cold (4C, 7 days)
whole plants seedling growth MT-WT(zat12) gl1
col-0age(21+_days)nodeshoot_
col-0age(21_days)inflorescencestage_1-6_flower_
col-0age(21_days)inflorescencestage_1-6_flower_
col-0age(21_days)inflorescencestage_1-6_flower_
col-0age(21+_days)stage_9_flower_
col-0age(21+_days)stage_10-11_flower_
col-0age(21+_days)stage_10-11_flower_
col-0age(21+_days)stage_10-11_flower_
col-0age(21+_days)carpel_
col-0age(7_days)leafshoot_apex_
col-0age(7_days)leafshoot_apex_
col-0age(7_days)leafshoot_apex_
shoot apex rosette stage KB9 line
whole plant 7-day-old seedlings ABA (10 uM, 1 hours)
OrganismPart: whole seedling Ecotype: Col-0 GeneticModification: Aequorin
transgene NASC:StockCode: StrainOrLine: aeq+
shoot apex rosette stage
shoot apex rosette stage
shoot apex rosette stage KB31 line photoperiod (16 hr, 3 days)
OrganismPart: total tissue Ecotype: Ler GeneticModification: EMS Mutant of N1695
NASC:Growth Stage: 1.04 NASC:StockCode: StrainOrLine: 15B
OrganismPart: total tissue Ecotype: Ler GeneticModification: EMS Mutant of N1695
NASC:Growth Stage: 1.04 NASC:StockCode: StrainOrLine: 15B

col-0age(21_days)inflorescencestage_1-6_flower_
col-0age(21_days)inflorescencestage_1-6_flower_
col-0age(21_days)inflorescencestage_1-6_flower_
col-0age(21+_days)stage_9_flower_
col-0age(21+_days)stage_10-11_flower_
col-0age(21+_days)stage_10-11_flower_
col-0age(21+_days)stage_10-11_flower_
col-0age(21+_days)stage_12_flower_
col-0age(21+_days)carpel_
col-0age(21+_days)carpelstage_15_flower_
col-0age(21+_days)carpelstage_15_flower_
col-0age(21+_days)carpelstage_15_flower_
col-0age(8_weeks)globular_embryo_
col-0age(8_weeks)globular_embryo_
OrganismPart: inflorescence Ecotype: ws NASC:Growth Stage: 6.0
shoot apex rosette stage KB9 line
greenhouse (29 days);age (29 days ); flower
Guard Cell enriched leaves
shoot apex rosette stage
shoot apex rosette stage
shoot apex rosette stage KB31 line photoperiod (16 hr, 3 days)

col-0age(7_days)hypocotyl_
col-0age(7_days)hypocotyl_
col-0age(7_days)hypocotyl_
col-0age(17_days)root_
col-0age(17_days)root_
cultured cell time after subculture (1 days)
cultured cell time after subculture (7 days)
Programmed Cell Death Control

Programmed Cell Death Senescence

Programmed Cell Death Control

Programmed Cell Death Heat
Stock Code: NW20 Tissue: Cell culture
Stock Code: NW20 Tissue: Cell culture
Stock Code: NW20 Tissue: Cell culture
Stock Code: NW20 Tissue: Cell culture
greenhouse (29 days); age (29 days ); stem
cultured cell early stationary phase sucrose (3%, 2 hours)
cultured cell early stationary phase sucrose (3%, 4 hours)
OrganismPart: Cell suspension

osmotic_24h_shoot mannitol (300 mM, 24 hours) shoot
col-0age(7_days)hypocotyl_
col-0age(7_days)hypocotyl_
col-0age(7_days)hypocotyl_
col-0age(21+_days)stage_10-11_flower_
col-0age(21+_days)stage_10-11_flower_
col-0age(21+_days)stage_10-11_flower_
col-0age(21+_days)stage_12_flower_
col-0age(21+_days)carpel_
col-0age(21+_days)sepalstage_15_flower_
col-0age(21+_days)sepalstage_15_flower_
col-0age(21+_days)sepalstage_15_flower_
col-0age(21+_days)carpelstage_15_flower_
col-0age(21+_days)carpelstage_15_flower_
col-0age(21+_days)carpelstage_15_flower_
vascular leaf late rosette growth Pseudomonas syringae pv. tomato DC3000 (10e8
cfu/ml ) time after treatment (24 hours)
vascular leaf late rosette growth Phytophthora infestans (10^6 spores/ml ) time
after treatment (6 hours)
vascular leaf rosette growth Botrytis cinerea (5X10^5 spores/ml ) time after
treatment (18 hours)
vascular leaf rosette growth Botrytis cinerea (5X10^5 spores/ml ) time after
treatment (48 hours)
vascular leaf rosette growth Botrytis cinerea (5X10^5 spores/ml      ) time after
treatment (48 hours)
shoot apex rosette stage KB9 line
shoot apex rosette stage
shoot apex rosette stage
shoot apex rosette stage KB31 line photoperiod (16 hr, 3 days)
OrganismPart: Whole leaf Age time point: 4 hours Ecotype: col-5     NASC:Growth
Stage: 3.90 NASC:StockCode: N1688
OrganismPart: Whole leaf Age time point: 4 hours Ecotype: col-5     NASC:Growth
Stage: 3.90 NASC:StockCode: N1688
OrganismPart: Whole leaf Age time point: 4 hours Ecotype: col-5     NASC:Growth
Stage: 3.90 NASC:StockCode: N1688
no treatment dry seeds
seed dry seed stage no treatment
seed imbibition water (3 hours)

col-0age(17_days)petiole_
col-0age(21+_days)internodeshoot_
col-0age(21+_days)internodeshoot_
col-0age(21+_days)internodeshoot_
col-0age(21+_days)nodeshoot_
OrganismPart: Cell culture Age time point: 9 day timepoint Ecotype: Ler
NASC:StockCode: NW20
total roots (primary and all lateral )

Guard Cell enriched leaves

Guard Cell enriched leaves

Guard Cell enriched leaves
OrganismPart: Small excised segments of primary root tissue corresponding to root-
hair elongation zone Ecotype: Columbia GeneticModification: EMS mutant, Plant Cell
(1990) 2:235-243 NASC:Growth Stage: 1.02 NASC:StockCode: N2259 StrainOrLine:
rhd2-1
Stock Code: N1093 Developmental stage: 6.1 Tissue: lateral roots
Tumour
Tumour
inflorescence stem tip
inflorescence stem tip
inflorescence stem base
inflorescence stem base
inflorescence stem base
inflorescence stem base
controlled system (29 days); age (29 days ); stem
controlled system (29 days); age (29 days ); stem
greenhouse (29 days); age (29 days ); stem
greenhouse (29 days); age (29 days ); stem
col-0age(7_days)root_

col-0age(21+_days)stage_10-11_flower_
col-0age(21+_days)stamen_
col-0age(21+_days)stamen_
col-0age(21+_days)stamen_
col-0age(6_weeks)pollen_
col-0age(6_weeks)pollen_
col-0age(6_weeks)pollen_
OrganismPart: Pollen Ecotype: Ler-0 GeneticModification: None NASC:Growth Stage:
5.10 NASC:StockCode: NW20
OrganismPart: Pollen Ecotype: Ler-0 GeneticModification: None NASC:Growth Stage:
5.10 NASC:StockCode: NW20
col-0age(6_weeks) pollen_
inflorescence stem tip
inflorescence stem tip
inflorescence stem tip
ms1ttg-young Flower

Young Flower Buds


cold_control_0min_root no treatment root
cold_control_0min_root no treatment root
cold_control_30min_root no treatment root
cold_control_30min_root no treatment root
cold (4 C, 24 hours) root
col-0age(15_days)root_
OrganismPart: whole plant Ecotype:           ws-2   NASC:Growth     Stage:   1.06
NASC:StockCode: N1601
total roots (primary and all lateral )
whole plant 21-day-old plants, vegetative stage Arr21c-ox
whole plant 21-day-old plants, vegetative stage Arr21c-ox
whole plant 21-day-old plants, vegetative stage Arr21c-ox
whole plant 21-day-old plants, vegetative stage no treatment
whole plant 21-day-old plants, vegetative stage no treatment
OrganismPart: Small excised segments of primary root tissue corresponding to root-
hair elongation zone Ecotype: Columbia GeneticModification: EMS mutant, Plant Cell
(1990) 2:235-243 NASC:Growth Stage: 1.02 NASC:StockCode: N2259 StrainOrLine:
rhd2-1
Small excised segments of primary root tissue corresponding to root-hair elongation
OrganismPart: total tissue Ecotype: Ler GeneticModification: EMS Mutant of N1695
NASC:Growth Stage: 1.04 NASC:StockCode: StrainOrLine: 15B
col-0age(7_days)root_

cold_control_0min_root no treatment root
cold_control_0min_root no treatment root
cold_control_30min_root no treatment root
cold_control_30min_root no treatment root
cold (4 C, 24 hours) root
osmotic_3h_root mannitol (300 mM, 3 hours) root
osmotic_6h_root mannitol (300 mM, 6 hours) root
osmotic_12h_root mannitol (300 mM, 12 hours) root
osmotic_12h_root mannitol (300 mM, 12 hours) root
salt_24h_root NaCl (150 mM, 24 hours) root
heat_3h_root
cotyledon ; hypocotyl seedling growth light wavelength (far-red light, 45 minutes)
cotyledon ; hypocotyl seedling growth light regime (continuous darkness, 44
minutes) light wavelength (red light, 1 minutes)
cotyledon ; hypocotyl seedling growth light wavelength (red light, 45 minutes)
cotyledon ; hypocotyl seedling growth light wavelength (blue light, 45 minutes)
total roots (primary and all lateral )
OrganismPart: root Ecotype: C24 GeneticModification: Transgenic plant carrying
ANR1::rGR fusion under the 35S promoter control. The ANR1::rGR fusion is stongly
expressed in this line. NASC:Growth Stage: 1.02 NASC:StockCode: StrainOrLine:
Working overexpressor
col-0age(7_days)root_

col-0age(35_days)senescence_leaf_
col-0age(35_days)senescence_leaf_
col-0age(35_days)senescence_leaf_
col-0age(21+_days)internodeshoot_
col-0age(21+_days)internodeshoot_
col-0age(21+_days)internodeshoot_
col-0age(21+_days)stage_15_flower_
col-0age(21+_days)stage_15_flower_
col-0age(21+_days)stage_15_flower_
col-0age(15_days)root_
Small excised segments of primary root tissue corresponding to root-hair elongation
zone
Small excised segments of primary root tissue corresponding to root-hair elongation
zone
Small excised segments of primary root tissue corresponding to root-hair elongation
inflorescence stem base

col-0age(35_days)senescence_leaf_
col-0age(35_days)senescence_leaf_
col-0age(35_days)senescence_leaf_
col-0age(21+_days)sepalstage_15_flower_
col-0age(21+_days)sepalstage_15_flower_
col-0age(21+_days)sepalstage_15_flower_
vascular leaf late rosette growth Pseudomonas syringae pv. tomato DC3000 (10e8
cfu/ml ); time after treatment (6 hours)
vascular leaf late rosette growth Pseudomonas syringae pv. tomato DC3000 (10e8
cfu/ml ); time after treatment (6 hours)
vascular leaf late rosette growth Pseudomonas syringae pv. tomato DC3000 (10e8
cfu/ml ) time after treatment (24 hours)
vascular leaf late rosette growth Pseudomonas syringae pv. tomato avrRpm1 (10e8
cfu/ml ) time after treatment (2 hours)
vascular leaf late rosette growth Phytophthora infestans (10^6 spores/ml ) time
after treatment (6 hours)
vascular leaf late rosette growth Phytophthora infestans (10^6 spores/ml ) time
after treatment (6 hours)
vascular leaf rosette growth Botrytis cinerea (5X10^5 spores/ml ) time after
treatment (48 hours)
heat_3h_38C_cell_culture
Stock Code: N1093 Developmental stage: 3.90: Rosette Growth Complete Tissue:
whole above ground rosettes

Programmed Cell Death Senescence

Programmed Cell Death Senescence
no treatment dry seeds
no treatment dry seeds
seed dry seed stage no treatment
seed dry seed stage no treatment
seed imbibition water (3 hours)
seed imbibition water (3 hours)
fully expanded leaves
seeds dry seed stage cold (4 C, 96 hr )

col-0age(21+_days)internodeshoot_
col-0age(21+_days)internodeshoot_
col-0age(21+_days)internodeshoot_
col-0age(21+_days)nodeshoot_
col-0age(21+_days)sepal_
col-0age(21+_days)sepal_
col-0age(21+_days)sepal_
col-0age(21+_days)pedicelstage_15_flower_
col-0age(8_weeks)torpedo_embryo_
col-0age(8_weeks)torpedo_embryo_
col-0age(8_weeks)torpedo_embryo_
col-0age(8_weeks)walking-stick_seed_
col-0age(8_weeks)early_curled_cotyledon_
heat_control_0h_25C_cell_culture
heat_control_0h_25C_cell_culture
seed germination water (6 hours)
seed imbibition ABA (3 uM, 24 hours)
seed imbibition ABA (3 uM, 24 hours)
no treatment dry seeds
no treatment dry seeds
24 h imbibed in water imbibed seeds water (48 hours)
24 h imbibed in water imbibed seeds water (48 hours)
seed imbibition water (3 hours)
seed imbibition water (3 hours)
inflorescence stem base
Old Flower Buds


whole seedlings

whole seedlings

Col-0 Whole Plant
MYB761 Knockout, Plant Cell 13, 2777-2791 Overexpressor GROWTHCONDITIONS
Dark DEVELOPMENTSTAGE 0.7 Whole Plant
MYB761 Knockout, Plant Cell 13, 2777-2791 Overexpressor GROWTHCONDITIONS
Dark DEVELOPMENTSTAGE 0.7 Whole Plant
MYB61 Overexpressor GROWTHCONDITIONS Dark DEVELOPMENTSTAGE 0.7 Whole
Plant
MYB61 Overexpressor GROWTHCONDITIONS Dark DEVELOPMENTSTAGE 0.7 Whole
Plant
MYB61 Overexpressor GROWTHCONDITIONS Dark DEVELOPMENTSTAGE 0.7 Whole
Plant
MYB61 Overexpressor GROWTHCONDITIONS Dark DEVELOPMENTSTAGE 0.7 Whole
Plant
seed imbibition ABA (3 uM, 24 hours)
24 h imbibed in water imbibed seeds water (48 hours)
24 h imbibed in water imbibed seeds water (48 hours)
seeds dry seed stage cold (4 C, 96 hr )

osmotic_3h_root mannitol (300 mM, 3 hours) root
osmotic_6h_root mannitol (300 mM, 6 hours) root
col-0age(21+_days)sepalstage_15_flower_
col-0age(21+_days)sepalstage_15_flower_
col-0age(21+_days)sepalstage_15_flower_
col-0age(21+_days)petalstage_15_flower_
col-0age(21+_days)petalstage_15_flower_
col-0age(21+_days)petalstage_15_flower_
col-0age(21+_days)stage_15_flowerstamen_
col-0age(21+_days)stage_15_flowerstamen_
col-0age(21+_days)stage_15_flowerstamen_
col-0age(8_weeks)torpedo_embryo_
col-0age(8_weeks)torpedo_embryo_
col-0age(8_weeks)torpedo_embryo_
col-0age(8_weeks)walking-stick_seed_
col-0age(8_weeks)early_curled_cotyledon_
col-0age(8_weeks)early_curled_cotyledon_
col-0age(8_weeks)early_curled_cotyledon_
col-0age(8_weeks)early_green_cotyledon_

cold_control_0min_root no treatment root
cold_control_0min_root no treatment root
cold_control_30min_root no treatment root
cold_control_30min_root no treatment root
cold (4 C, 24 hours) root
osmotic_3h_root mannitol (300 mM, 3 hours) root
osmotic_6h_root mannitol (300 mM, 6 hours) root
osmotic_12h_root mannitol (300 mM, 12 hours) root
osmotic_12h_root mannitol (300 mM, 12 hours) root
salt_3h_root NaCl (150 mM, 3 hours) root
salt_3h_root NaCl (150 mM, 3 hours) root
salt_24h_root NaCl (150 mM, 24 hours) root
col-0age(15_days)root_
col-0age(15_days)root_
total roots (primary and all lateral )
OrganismPart: root Ecotype: C24 GeneticModification: Transgenic plant carrying
ANR1::rGR fusion under the 35S promoter control. The ANR1::rGR fusion is stongly
expressed in this line. NASC:Growth Stage: 1.02 NASC:StockCode: StrainOrLine:
Working overexpressor
OrganismPart: root Ecotype: C24 GeneticModification: Transgenic plant carrying
ANR1::rGR fusion under the 35S promoter control. The ANR1::rGR fusion is stongly
expressed in this line. NASC:Growth Stage: 1.02 NASC:StockCode: StrainOrLine:
Working overexpressor
col-0age(7_days)root_

cold_control_0min_root no treatment root
cold_control_30min_root no treatment root
col-0age(15_days)root_
col-0age(15_days)root_
whole plant 7-day-old seedlings 3-dehydroteasterone (1 uM, 3 hours)
whole plant 7-day-old seedlings 3-dehydroteasterone (1 uM, 3 hours)
OrganismPart: whole plant Ecotype: ws-2 NASC:Growth Stage: 10-day-old whole
plant NASC:StockCode: N1601 Experiment: Comparative transcriptome analysis
between wild-type and gpa1 mutant in response to ABA
OrganismPart: whole plant Ecotype: ws-2 NASC:Growth Stage: 10-day-old whole
plant NASC:StockCode: N1601 Experiment: Comparative transcriptome analysis
between wild-type and gpa1 mutant in response to ABA
total roots (primary and all lateral )
OrganismPart: whole seedling Ecotype: col-7 NASC:StockCode: N3731
OrganismPart: whole seedling Ecotype: col-7 NASC:StockCode: N3731
OrganismPart: whole seedling Ecotype: col-7 NASC:StockCode: N3731
Small excised segments of primary root tissue corresponding to root-hair elongation
zone
Small excised segments of primary root tissue corresponding to root-hair elongation
zone
OrganismPart: root Ecotype: C24 GeneticModification: Transgenic plant carrying
ANR1::rGR fusion under the 35S promoter control. The ANR1::rGR fusion is stongly
expressed in this line. NASC:Growth Stage: 1.02 NASC:StockCode: StrainOrLine:
Working overexpressor
col-0age(7_days)root_

osmotic_6h_shoot mannitol (300 mM, 6 hours) shoot
time after treatment (6 hours) light wavelength (UV-B light, 6 hours) shoot
col-0age(21_days)inflorescencestage_1-6_flower_
col-0age(21_days)inflorescencestage_1-6_flower_
col-0age(21_days)inflorescencestage_1-6_flower_
col-0age(21+_days)stage_9_flower_
col-0age(21+_days)stage_10-11_flower_
col-0age(21+_days)stage_10-11_flower_
col-0age(21+_days)stage_10-11_flower_
col-0age(21+_days)stage_12_flower_
col-0age(21+_days)carpel_
col-0age(21+_days)carpelstage_15_flower_
col-0age(21+_days)carpelstage_15_flower_
col-0age(21+_days)carpelstage_15_flower_
col-0age(8_weeks)globular_embryo_
col-0age(8_weeks)globular_embryo_
col-0age(8_weeks)globular_embryo_
shoot apex rosette stage KB31 line photoperiod (16 hr, 3 days)
no treatment dry seeds
no treatment dry seeds
seed dry seed stage no treatment
seed dry seed stage no treatment
seed imbibition water (3 hours)
seed imbibition water (3 hours)
fully expanded leaves

cold_control_0min_root no treatment root
cold_control_30min_root no treatment root
cold_control_30min_root no treatment root
salt_6h_root NaCl (150 mM, 6 hours) root
whole plants seedling growth MT-p15-8 35S::ZAP12
whole plants seedling growth MT-WT7d(plate) cold (4C, 7 days)
whole plants seedling growth MT-WT24h(plate) cold (4C, 24 hours)
col-0age(15_days)root_
col-0age(15_days)root_
col-0age(17_days)root_
col-0age(17_days)root_
the entire seedlings;Identification of genes responsive to non-metabolised glucose
analoges as an approach to hexokinase-independent glucose sensing in plants
the entire seedlings;Identification of genes responsive to non-metabolised glucose
analoges as an approach to hexokinase-independent glucose sensing in plants
whole plant 7-day-old seedlings 3-dehydroteasterone (1 uM, 3 hours)
whole plant 7-day-old seedlings 3-dehydroteasterone (1 uM, 3 hours)
whole plant 7-day-old seedlings Methyl Jasmonate (10 uM, 3 hours)
OrganismPart: whole plant Ecotype: ws-2 NASC:Growth Stage: 10-day-old whole
plant NASC:StockCode: N1601 Experiment: Comparative transcriptome analysis
between wild-type and gpa1 mutant in response to ABA
OrganismPart: whole plant Ecotype: ws-2 NASC:Growth Stage: 10-day-old whole
plant NASC:StockCode: N1601 Experiment: Comparative transcriptome analysis
between wild-type and gpa1 mutant in response to ABA
total roots (primary and all lateral )

whole seedlings

whole seedlings
whole seedlings
MYB61 Overexpressor GROWTHCONDITIONS Dark DEVELOPMENTSTAGE 0.7 Whole
Plant
OrganismPart: whole seedling Ecotype: col-7 NASC:StockCode: N3731
OrganismPart: whole seedling Ecotype: col-7 NASC:StockCode: N3731
OrganismPart: whole seedling Ecotype: col-7 NASC:StockCode: N3731
Small excised segments of primary root tissue corresponding to root-hair elongation
zone
Small excised segments of primary root tissue corresponding to root-hair elongation
zone
OrganismPart: Small excised segments of primary root tissue corresponding to root-
hair elongation zone Ecotype: Columbia GeneticModification: EMS mutant, Plant Cell
(1990) 2:235-243 NASC:Growth Stage: 1.02 NASC:StockCode: N2259 StrainOrLine:
rhd2-1
Small excised segments of primary root tissue corresponding to root-hair elongation
OrganismPart: root Ecotype: C24 GeneticModification: Transgenic plant carrying
ANR1::rGR fusion under the 35S promoter control. The ANR1::rGR fusion is stongly
expressed in this line. NASC:Growth Stage: 1.02 NASC:StockCode: StrainOrLine:
Working overexpressor
OrganismPart: root Ecotype: C24 GeneticModification: Transgenic plant carrying
ANR1::rGR fusion under the 35S promoter control. The ANR1::rGR fusion is stongly
expressed in this line. NASC:Growth Stage: 1.02 NASC:StockCode: StrainOrLine:
Working overexpressor
col-0age(7_days)root_

cold_control_0min_root no treatment root
cold_control_0min_root no treatment root
cold_control_30min_root no treatment root
cold_control_30min_root no treatment root
col-0age(15_days)root_
col-0age(15_days)root_
col-0age(17_days)root_
col-0age(17_days)root_
cotyledon ; hypocotyl seedling growth light wavelength (far-red light, 45 minutes)
cotyledon ; hypocotyl seedling growth light regime (continuous darkness, 44
minutes) light wavelength (red light, 1 minutes)
cotyledon ; hypocotyl seedling growth light wavelength (red light, 45 minutes)
cotyledon ; hypocotyl seedling growth light wavelength (blue light, 45 minutes)
whole plant 7-day-old seedlings ABA (10 uM, 3 hours)
whole plant 7-day-old seedlings ABA (10 uM, 3 hours)
OrganismPart: whole plant Ecotype: ws-2 NASC:Growth Stage: 10-day-old whole
plant NASC:StockCode: N1601 Experiment: Comparative transcriptome analysis
between wild-type and gpa1 mutant in response to ABA
OrganismPart: whole seedling Ecotype: Col-0 GeneticModification: Aequorin
transgene NASC:StockCode: StrainOrLine: aeq+
OrganismPart: whole seedling Ecotype: Col-0 GeneticModification: Aequorin
transgene NASC:StockCode: StrainOrLine: aeq+
MYB761 Knockout, Plant Cell 13, 2777-2791 Overexpressor GROWTHCONDITIONS
Dark DEVELOPMENTSTAGE 0.7 Whole Plant
MYB61 Overexpressor GROWTHCONDITIONS Dark DEVELOPMENTSTAGE 0.7 Whole
Plant
MYB61 Overexpressor GROWTHCONDITIONS Dark DEVELOPMENTSTAGE 0.7 Whole
Plant
OrganismPart: whole seedling Ecotype: col-7 NASC:StockCode: N3731
OrganismPart: whole seedling Ecotype: col-7 NASC:StockCode: N3731
Small excised segments of primary root tissue corresponding to root-hair elongation
zone
Small excised segments of primary root tissue corresponding to root-hair elongation
zone
OrganismPart: Small excised segments of primary root tissue corresponding to root-
hair elongation zone Ecotype: Columbia GeneticModification: EMS mutant, Plant Cell
(1990) 2:235-243 NASC:Growth Stage: 1.02 NASC:StockCode: N2259 StrainOrLine:
rhd2-1
Small excised segments of primary root tissue corresponding to root-hair elongation
OrganismPart: root Ecotype: C24 GeneticModification: Transgenic plant carrying
ANR1::rGR fusion under the 35S promoter control. The ANR1::rGR fusion is stongly
expressed in this line. NASC:Growth Stage: 1.02 NASC:StockCode: StrainOrLine:
Working overexpressor
ME or GSM IDs


ME00319
ME00319
ME00319
ME00319
GSM133753
GSM133754
ME00318
ME00318
ME00318
ME00318

ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
GSM142734

GSM142735

GSM142736

GSM142737

GSM142738

GSM142739
ME00350
ME00350
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=14
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=14
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=14
ME00351
ME00351
ME00351
ME00351
ME00348
ME00348

ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00345

ME00345
ME00345
ME00345
GSM142592
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=35


gsm142752


gsm142753
GSM133717
GSM133719
GSM133721


GSM142670


ME00318
ME00318
ME00318
ME00319

ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00331

ME00331

ME00341

ME00341

ME00341
ME00337
GSM260953

GSM260955
ME00356
ME00356
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=29
GSM142834

GSM142844
GSM133717
GSM133738

ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00350
ME00350
ME00350
ME00351
ME00351
ME00351
ME00346
ME00346
ME00346
ME00348
ME00348

ME00325
ME00319
ME00319
ME00319
ME00319
ME00345

ME00345
ME00345
ME00345
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=35
ME00350
ME00350
ME00350
ME00350
ME00351
ME00351
ME00351
GSM133720


GSM142670




GSM142675


ME00348
ME00348

ME00325
ME00325
ME00325
ME00327
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00345

ME00345
ME00345
ME00345
ME00339
ME00346
ME00346
ME00365
GSM133738
ME00348

ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
Analysis of anther development by identifying downstream genes
controlled by MS1

ME00325
ME00325
ME00321
ME00328
ME00321
ME00323
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00317
GSM142876
ME00333
GSM142585
ME00317
ME00317
ME00317
GSM142762


ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00317
ME00317
ME00317

ME00319
ME00319
ME00361
ME00361
ME00352
gsm142698
gsm142692
gsm142695
gsm142750

gsm142751
gsm142753


GSM142675



ME00319
ME00319
ME00319
ME00319
ME00345

ME00345
ME00345
ME00345
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=35
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=14
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=14
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=14


gsm142752


ME00319

ME00325
ME00325
ME00319
ME00319
ME00319
ME00319
ME00345

ME00345
ME00345
ME00345
ME00352
ME00352
GSM142785


GSM142787

http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=35
gsm142698
gsm142695
ME00319

ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
GSM142598
GSM142599;http://affymetrix.arabidopsis.info/narrays/experimentpage
.pl?experimentid=74
GSM142600;http://affymetrix.arabidopsis.info/narrays/experimentpage
.pl?experimentid=74
ME00318
ME00317
ME00317
GSM133747
GSM133748
GSM133752
Analysis of anther development by identifying downstream genes
controlled by MS1
Analysis of anther development by identifying downstream genes
controlled by MS1
Analysis of anther development by identifying downstream genes
controlled by MS1
Analysis of anther development by identifying downstream genes
controlled by MS1

ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
GSM142734

GSM142735

GSM142736

GSM142737

GSM142738

GSM142739


ME00325
ME00325
ME00325
ME00323
ME00320
ME00319
ME00319
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=40
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=35
GSM142585

GSM142586
ME00356
ME00356
ME00356
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=14
gsm142750

gsm142751


gsm142752
gsm142753
GSM142786
GSM142787
GSM142664

GSM142667

GSM142761

GSM142762


GSM142670




GSM142675


ME00319

ME00325
ME00325
ME00339
ME00339
ME00319
ME00319
ME00352
ME00352
ME00333

GSM142785


GSM142787


gsm142750

gsm142751

gsm142753


ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00350
ME00350
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=14
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=14
ME00351
GSM133718
ME00346
ME00346
ME00346
ME00348

ME00327
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00351
ME00346
ME00346
ME00346
ME00346


ME00331

ME00331
ME00367
gsm142878
gsm142879
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=30
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=30
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=30
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=30
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=30
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=30
ME00356
ME00356
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=29
GSM133808
GSM133812
GSM133809
GSM133813
GSM142902
GSM142904
GSM142905

ME00325
ME00325
ME00325
ME00325
ME00323
ME00319
ME00319
ME00319
ME00319
ME00319
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=40
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=40
ME00337
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=35
GSM142585

GSM142586
ME00356
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=14
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=14
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=14
gsm142750

gsm142751


gsm142752


gsm142753

GSM142761

GSM142762


GSM142670




GSM142675


ME00319

ME00325
ME00325
ME00325
ME00325
ME00328
ME00323
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00317
ME00352
ME00333

GSM142787

http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=35
GSM142585
ME00317
ME00317
ME00317
GSM142762
ME00319
Analysis of anther development by identifying downstream genes
controlled by MS1
Analysis of anther development by identifying downstream genes
controlled by MS1

ME00325
ME00319
ME00319
ME00319
ME00345

ME00345
ME00345
ME00345
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=35


GSM142670


ME00319
ME00319
ME00331

GSM133409

GSM142736

GSM142740
ME00319
GSM142585

GSM133787
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=44
GSM260957

GSM142844
gsm142698
gsm142692
gsm142751


GSM142670


GSM133753
GSM133754
ME00318
ME00318
GSM133738
GSM142904
GSM142906
GSM142907


GSM133409

GSM142734

GSM142735
GSM142737

GSM142738
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=44
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=44
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=44
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=29
ME00317
ME00317
ME00350
ME00350
ME00350
ME00350
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=14
GSM142784
GSM142785
GSM260885
ME00348

ME00327
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00331

ME00331
ME00331

ME00331

ME00331

ME00331

ME00332

ME00342

ME00342

ME00341

ME00341

ME00341
ME00317
GSM260953

GSM260955
ME00317
ME00317
ME00317
GSM142833

GSM142834

GSM142830

GSM142844
GSM142904
GSM142905

ME00319
ME00319
ME00319
ME00319
GSM142598
GSM142600;http://affymetrix.arabidopsis.info/narrays/experimentpage
.pl?experimentid=74
ME00318
ME00318
ME00318
GSM133748
GSM260884

GSM260885


ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
GSM142597;
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=74
GSM142598
GSM142736

GSM142739

GSM142740
ME00319
ME00318
Analysis of anther development by identifying downstream genes
controlled by MS1

ME00329
ME00329
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
gsm142878
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=30
ME00351
ME00351
ME00346
ME00346
ME00346
ME00346
GSM133738

ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319

ME00339
ME00339
ME00367
ME00367
ME00367
ME00367
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=30
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=30
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=30
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=30
GSM133808
GSM133812
GSM133809
GSM133813
ME00365
ME00366
ME00366
ME00365
ME00365

GSM142597;
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=74
GSM142740
ME00319
ME00318
ME00318
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=44
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=29
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=14
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=14
GSM133718
ME00318

ME00319
ME00319
ME00319
ME00319
ME00319
GSM142734
GSM142735

GSM142736

GSM142737

GSM142738

GSM142739

GSM142740
ME00318
ME00318
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=14
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=14
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=14
Analysis of anther development by identifying downstream genes
controlled by MS1
Analysis of anther development by identifying downstream genes
controlled by MS1

ME00325
ME00325
ME00325
ME00325
ME00325
ME00327
ME00327
ME00327
ME00328
ME00323
ME00319
ME00319
ME00319
ME00319
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=35
GSM142585

GSM142586
ME00356
ME00356
gsm142750

gsm142751

GSM142664

GSM142667


GSM142670




GSM142675


ME00319

ME00319
ME00319
ME00319
ME00319
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=35
GSM133717
GSM133720
GSM133750
GSM133753
GSM133754
ME00318
ME00318
ME00319

ME00329
ME00329
ME00329
ME00329
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319


GSM142675


ME00348
ME00348

ME00323
ME00331

ME00331

ME00332
ME00332
ME00352
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=29
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=29
ME00350
ME00350
ME00350
gsm142750


gsm142752


gsm142753
ME00351
ME00351
ME00346
ME00346
ME00346
ME00346
ME00348

ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
GSM142885
ME00355
ME00355
ME00355

ME00319
ME00319
ME00319
ME00317
ME00367
ME00367
ME00367
ME00318
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=30
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=30
ME00317
ME00317
GSM133747
GSM133748
ME00366
ME00366
ME00365
ME00365
GSM142903
GSM142906
GSM142907

ME00327
ME00327
ME00327
ME00329
ME00329
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00331

ME00331

ME00332

ME00342

ME00341
ME00317
ME00317

ME00327
ME00327
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00331

ME00331

ME00331

ME00331

ME00331

ME00332

ME00342
ME00317
ME00317
ME00317
ME00317

ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
GSM142597;
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=74
GSM142598
GSM142736

GSM142739
GSM142740
ME00319
ME00318
ME00318
ME00318

ME00325
ME00325
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00352
ME00352
ME00333

GSM142785


GSM142787

http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=14
gsm142698
gsm142695
gsm142750

gsm142751


ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
GSM142739

GSM142740
ME00319

ME00319
ME00319
ME00319
ME00319
ME00319
ME00345

ME00345
ME00345
ME00345
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=35
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=14
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=14
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=14
ME00319
ME00348

ME00325
ME00320
ME00322
ME00319
ME00319
ME00319
ME00319
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=35
gsm142698
gsm142695
gsm142753
ME00319

ME00319
ME00319
ME00319
GSM142734

GSM142735

GSM142736

GSM142737

GSM142738

GSM142739

GSM142740
ME00319
ME00351
ME00351
ME00346
ME00346
ME00346
ME00346

ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
GSM142734

GSM142735

GSM142736

GSM142737

GSM142738

GSM142739

GSM142740
ME00327
ME00329
ME00329
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00331

ME00331

ME00331

ME00331

ME00331

ME00332
GSM142597;
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=74
ME00317
ME00317
ME00317
ME00317

ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00367
ME00367
ME00367
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=30
ME00350
ME00350
ME00350
ME00350
ME00351
ME00346
ME00346
ME00346
GSM133753
ME00348

ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00317
ME00318
ME00317
ME00317
ME00317
ME00351
ME00351
ME00351
ME00351
GSM133747
GSM133748

ME00319
ME00319
ME00319
ME00331

ME00331

ME00331

ME00331

ME00331

GSM142734

GSM142735

GSM142737

GSM142738
ME00318
GSM142833

GSM142834

GSM142830
GSM133719
GSM133750
GSM260884


ME00319
ME00345

ME00345
ME00345
ME00345
GSM142884
ME00317
ME00317
ME00350
ME00350
ME00350
ME00350
gsm142752


ME00351
ME00351
ME00346
ME00346
GSM133738
ME00348
ME00348

ME00325
ME00325
ME00325
ME00325
ME00325
ME00323
ME00339
ME00319
ME00319
ME00319
ME00319
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=35
GSM142585

GSM142586

gsm142750

gsm142751


gsm142752


gsm142753
GSM142787


GSM142670
GSM142675


ME00319

ME00325
ME00325
ME00325
ME00327
ME00327
ME00328
ME00328
ME00328
ME00339
ME00339
ME00319
ME00319
ME00319
ME00319
gsm142692
gsm142751
GSM133749
GSM133750
GSM133753
GSM133754

ME00319
GSM142734

GSM142735

GSM142736

GSM142737

GSM142738

GSM142739

GSM142740
ME00350
ME00350
ME00350
ME00350
ME00351
ME00351
ME00346
ME00346
ME00346
ME00346
ME00348
ME00348

ME00339
ME00339
ME00339
ME00339
ME00339
ME00339
ME00367
GSM142734
ME00350
ME00350
ME00350
ME00350
ME00351
ME00351
ME00351
ME00351
ME00348
ME00348

ME00325
ME00325
ME00325
ME00325
ME00327
ME00327
ME00327
ME00327
ME00328
ME00328
ME00328
ME00319
ME00319
ME00319
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=35


GSM142670


ME00319

ME00319
ME00319
ME00319
ME00319
ME00319
ME00345

ME00345
ME00345
ME00345
ME00317
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=35


GSM142670


ME00319

ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
GSM142735

GSM142736

GSM142738

GSM142739

GSM142740
ME00319
Analysis of anther development by identifying downstream genes
controlled by MS1

ME00367
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=30
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=30
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=30
ME00355
ME00355
ME00355
GSM142902
GSM142903
GSM142904
GSM142905
GSM142906
GSM142907

ME00328
ME00320
ME00319
ME00319
ME00319
ME00319
ME00319
GSM142736

GSM142739

GSM142740
ME00319
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=35
ME00356
ME00356
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=14
gsm142750

gsm142751
gsm142752


gsm142753


GSM142670


ME00319

ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00352

ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319


gsm142752
GSM133749
GSM133754

ME00319
ME00319
ME00319
ME00319
ME00319
ME00331

ME00331

GSM142736

GSM142739
ME00319
ME00361
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=29
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=29
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=14
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=14

ME00320
ME00323
ME00322
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=40
ME00333

GSM142785


GSM142667
GSM133717


GSM142670



ME00325
ME00325
ME00325
ME00325
ME00325
ME00325
ME00323
ME00319
ME00319
ME00319
ME00319
ME00345

ME00345
ME00345
ME00345
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=35
ME00356
ME00356
gsm142750

gsm142751


gsm142752


gsm142753

GSM142761
GSM142762


GSM142670




GSM142675


ME00319

ME00339
ME00339
ME00339
ME00339
ME00339
ME00339
GSM142735
ME00350
ME00350
ME00350
ME00350
ME00351
ME00351
ME00351
ME00351
ME00351
ME00346
ME00346
ME00346
ME00346
ME00365
ME00365
ME00348
ME00348

ME00325
ME00325
ME00323
ME00319
ME00319
ME00319
ME00319
ME00345

ME00345
ME00345
ME00345
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=40
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=35
GSM142585

GSM142586

gsm142750

gsm142751


gsm142752


gsm142753

GSM142667

GSM142761
ME00319

ME00319
ME00319
ME00319
ME00331

ME00331

ME00331

ME00331

GSM142735

GSM142736
GSM142737

GSM142738
ME00319
ME00351
ME00351

ME00325
ME00319
ME00319

GSM142785


GSM142787

http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=35
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=14
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=14
gsm142698
gsm142692
gsm142695
gsm142750

gsm142751
ME00319

ME00327
ME00327
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00341
ME00341
ME00351
ME00351
ME00351
ME00351
ME00351
ME00351
ME00346
ME00346
GSM133721
ME00348

ME00319
ME00319
ME00319
GSM142739

GSM142740
ME00319
ME00350
ME00350
ME00350
ME00351
ME00351
ME00346
ME00346
GSM133738

ME00319
ME00319
GSM142740
ME00352
ME00352
ME00337
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=35
gsm142698
gsm142695
gsm142750

gsm142751
gsm142752


gsm142753


GSM142670




GSM142675



ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
GSM142598
ME00318
ME00318
ME00317
ME00317
GSM133747
GSM133752
Analysis of anther development by identifying downstream genes
controlled by MS1
Analysis of anther development by identifying downstream genes
controlled by MS1

ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
GSM142736

GSM142739

GSM142740
ME00319
ME00318
ME00318
ME00318

ME00325
ME00325
ME00325
ME00325
ME00323
ME00319
ME00319
ME00319
ME00319
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=35
GSM142585

gsm142750

gsm142751


gsm142752
gsm142753

GSM142762


GSM142670




GSM142675


ME00319

ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
GSM142597;
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=74
GSM142598
GSM142599;http://affymetrix.arabidopsis.info/narrays/experimentpage
.pl?experimentid=74
GSM142600;http://affymetrix.arabidopsis.info/narrays/experimentpage
.pl?experimentid=74
ME00318
ME00318
ME00318
ME00318
GSM133747
GSM133748
GSM133752
Analysis of anther development by identifying downstream genes
controlled by MS1

ME00325
ME00327
ME00319
ME00319
ME00319
ME00319
GSM142735

GSM142737

GSM142738

GSM142739
ME00319
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=35
ME00351
ME00346
ME00346
GSM260885
ME00348
Analysis of anther development by identifying downstream genes
controlled by MS1

ME00319
ME00319
ME00352
ME00352
ME00333
ME00337

GSM142785


GSM142787

http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=35
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=44
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=44
gsm142698
gsm142692
gsm142695
gsm142750

gsm142751
gsm142752




GSM142670


ME00319

ME00319
ME00319
ME00319
ME00319
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=29
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=29
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=29
GSM133719
GSM133747
GSM133748
GSM133749
GSM133750
GSM133753
GSM133754
ME00318
ME00318
ME00318
ME00318

ME00319
ME00319
ME00319
ME00319
ME00345

ME00345
ME00345
ME00345
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=35
GSM142664

GSM142667
ME00319

ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00345

ME00345
ME00345
ME00345
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=29
ME00318
ME00318

ME00323
ME00320
ME00323
ME00319
ME00319
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=40
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=40
ME00352
ME00333
ME00333
ME00337
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=35
GSM142585

GSM142586
ME00356
ME00356
ME00356
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=14
gsm142698
gsm142695
gsm142750

gsm142751


gsm142752


gsm142753
GSM142786
GSM142787
GSM142664

GSM142667

GSM142761

GSM142762


GSM142670




GSM142675


ME00319

ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
GSM133749
GSM133753
GSM133754
ME00318

ME00319
ME00319
ME00352
ME00352

GSM142785


GSM142787

http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=35
gsm142698
gsm142695
gsm142750

gsm142751


GSM142670


ME00319

ME00319
ME00319
ME00333

GSM142785


GSM142787

http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=35
gsm142698
gsm142695


GSM142670
GSM142675


ME00319

ME00327
ME00327
ME00327
ME00319
ME00319
ME00319
ME00332

GSM142885

GSM142736

GSM142739

GSM142740
ME00319
ME00351
ME00351
ME00346
ME00346
ME00346
ME00346

ME00327
ME00328
ME00339
ME00339
ME00319
ME00319
ME00331

ME00331

ME00331

ME00331
GSM142597;
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=74
GSM142598
GSM142734

GSM142735

GSM142736

GSM142737

GSM142738
ME00318
GSM142833

GSM142834

GSM142830

GSM260884
Analysis of anther development by identifying downstream genes
controlled by MS1

ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
GSM142597;
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=74
GSM142598
GSM142736

GSM142739

GSM142740
ME00319
ME00318
ME00318
Analysis of anther development by identifying downstream genes
controlled by MS1

ME00325
ME00328
ME00319
ME00319
ME00361
ME00361
ME00352
ME00352
ME00333

GSM142785


GSM142787

http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=35
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=44
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=44
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=44
gsm142698
gsm142692
gsm142695
gsm142750

gsm142751
ME00319

ME00327
ME00327
ME00327
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00331

ME00331

ME00331

ME00331

ME00331

ME00331

ME00332

ME00342

ME00341
ME00341

GSM260953

GSM260955

GSM142833

GSM142834

GSM142830

GSM142844
GSM142904
GSM142905

ME00325
ME00328
ME00319
ME00319
ME00319

GSM142786

http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=35
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=14
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=14
gsm142698
gsm142692
gsm142695
gsm142750

gsm142751


gsm142752


gsm142753
GSM142670


ME00319

ME00319
ME00319
ME00319
ME00319
ME00350
ME00350
ME00350
ME00350
ME00351
ME00351
ME00346
ME00346
ME00346
ME00348

ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
GSM142597;
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=74
GSM142598
GSM142599;http://affymetrix.arabidopsis.info/narrays/experimentpage
.pl?experimentid=74
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=29
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=29
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=29
GSM260884

GSM260885


ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00318
Analysis of anther   development by identifying downstream genes
controlled by MS1
Analysis of anther   development by identifying downstream genes
controlled by MS1
Analysis of anther   development by identifying downstream genes
controlled by MS1
Analysis of anther   development by identifying downstream genes
controlled by MS1

ME00327
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00341
GSM133783;
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=56
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=30
ME00351
ME00351
ME00346
ME00346
ME00346
ME00346
ME00366
GSM133738
GSM142902
GSM142904
GSM142905

ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
GSM142739


ME00325
ME00325
ME00325
ME00325
ME00325
ME00325
ME00327
ME00327
ME00327
ME00327
ME00319
ME00319
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=35


GSM142670




GSM142675


ME00319

ME00319
ME00319
ME00319
ME00331

ME00331

ME00331

ME00341

ME00341
ME00319
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=30
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=30
GSM142844
GSM133738

ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00317
ME00317
ME00317
ME00317
ME00350
ME00350
ME00351
ME00351


ME00353

ME00353

ME00331

ME00331

ME00331

ME00331
ME00332
ME00332
ME00332
ME00332

ME00342

ME00342
GSM142876
ME00360

GSM142786


GSM142834
GSM142830


ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
GSM142736

GSM142739

GSM142740
ME00319
ME00318
ME00318
ME00318

ME00325
ME00325
ME00325
ME00325
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00345

ME00345
ME00345
ME00345
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=35
ME00351
ME00351
ME00346
ME00346
ME00346
ME00346


GSM142670


ME00348

ME00329
ME00329
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00331

ME00331

ME00331

ME00331

ME00341

ME00341

GSM142736

GSM142739
gsm142878
gsm142879
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=30
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=30
GSM142844
ME00351
ME00351
ME00346
ME00346
ME00346
ME00346
GSM133738

ME00325
ME00325
ME00325
ME00325
ME00328
ME00319
ME00319
ME00333
ME00337

GSM142785


GSM142787

http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=35
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=14
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=14
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=14
gsm142698
gsm142692
gsm142695
gsm142750

gsm142751
ME00319
ME00348

ME00325
ME00325
ME00323
ME00323
ME00319
ME00319
ME00319
ME00319
ME00319
ME00345

ME00345
ME00345
ME00345
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=40
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=40
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=35
GSM142585

GSM142586

gsm142750

gsm142751


gsm142752


gsm142753

GSM142664

GSM142667


GSM142670


ME00319

ME00325
ME00325
ME00325
ME00329
ME00329
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00331

ME00331

ME00331

ME00341

ME00341
gsm142878
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=30
GSM142844
GSM142784
GSM142785
GSM142665

GSM142668

GSM133825
GSM142815
GSM133738

ME00327
ME00328
ME00328
ME00329
ME00319
ME00319
ME00319
ME00341
ME00367
ME00367
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=30
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=30
ME00366
ME00366
ME00365
GSM142903
GSM142906
GSM142907

ME00319
GSM142739

GSM142740
ME00319
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=32
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=30
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=30
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=30
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=29
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=14
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=14
gsm142751
GSM133717
GSM133738

ME00321
ME00328
ME00321
ME00323
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00317
ME00333
GSM142585
ME00317
ME00317
ME00317
GSM142761

GSM142762


ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
GSM142598
ME00317
ME00318
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=29
ME00317
ME00317
ME00317

ME00319
ME00319
ME00319
ME00319
ME00319
ME00367
ME00367
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=30
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=30
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=30
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=30
GSM133808
GSM133812
GSM133809
GSM133813
ME00318
ME00365
ME00365
GSM142904

ME00327
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00331

ME00342

ME00341

ME00341
ME00341
ME00317
ME00317
ME00317
ME00317
GSM142833

GSM142834

GSM142844
ME00351
ME00346
ME00346

ME00319
ME00319
ME00319
ME00319
ME00319
GSM142592
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=35
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=29
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=29
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=29


gsm142752


GSM133717
GSM133719
GSM133721
GSM133747
GSM133748
GSM133749
GSM133750
GSM133753
GSM133754
ME00318
ME00318
ME00318
ME00318
ME00319

ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
GSM142736

GSM142739
ME00319
GSM133747
GSM133748
GSM133752
Analysis of anther development by identifying downstream genes
controlled by MS1
Analysis of anther development by identifying downstream genes
controlled by MS1

ME00325
ME00325
ME00325
ME00325
ME00325
ME00319
GSM142885
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=35
ME00355
ME00355
ME00355
ME00356
ME00356


gsm142752
gsm142753

GSM142761
ME00319

ME00325
ME00325
ME00325
ME00325
ME00325
ME00327
ME00327
ME00327
ME00327
ME00328
ME00339
ME00345

ME00345
ME00345
ME00345
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=35


GSM142670


ME00319

ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
gsm142750

gsm142751
gsm142753
GSM133750

ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00331

ME00331

ME00331

ME00331

ME00342

ME00342

ME00341
ME00339
GSM133783;
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=56
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=30
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=30
ME00351
ME00351
ME00346
ME00346
ME00346
ME00346
GSM133738
ME00348

ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00339
ME00339
ME00350
ME00351
ME00351
ME00351
ME00351
ME00351
ME00351
ME00346
ME00346
GSM133753
Analysis of anther development by identifying downstream genes
controlled by MS1

http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=44
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=44
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=14
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=14
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=14
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=14
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=14
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=14
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=14
ME00351
ME00351
ME00351
ME00348

ME00327
ME00327
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319

ME00325
ME00325
ME00325
ME00325
ME00325
ME00327
ME00327
ME00327
ME00327
ME00328
ME00328
ME00328
ME00319
ME00319
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=35


GSM142670
GSM142675


ME00319

ME00325
ME00325
ME00319
ME00319
ME00352
ME00352

GSM142785


GSM142787

http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=35
gsm142698
gsm142692
gsm142695
gsm142750

gsm142751


GSM142670


ME00319

ME00327
ME00329
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00319
ME00317
ME00351
ME00351
ME00346
ME00346
ME00346
ME00346
GSM133738

ME00325
ME00325
ME00325
ME00328
ME00323
ME00320
ME00320
ME00319
ME00319
ME00319
ME00319
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=40
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=40
ME00352
ME00352
ME00337

GSM142784


GSM142786

http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=35
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=44
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=44
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=44
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=14
gsm142698
gsm142692
gsm142695
gsm142750

gsm142751


gsm142752


gsm142753


GSM142670




GSM142675


ME00319

ME00325
ME00325
ME00325
ME00325
ME00319
ME00319
ME00319
ME00319
ME00345

ME00345
ME00345
ME00345
ME00333
ME00333
GSM142786


GSM142585

GSM142586
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=14
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=14
http://affymetrix.arabidopsis.info/narrays/experimentpage.pl?experime
ntid=14
gsm142698
gsm142695
gsm142750

gsm142751


gsm142752


gsm142753


GSM142670
PCW synthesis stages of candidate genes and their motifs


Index                      1. Substrate generation
Number of genes (201)      25
                           AT1G04920,AT1G11860,AT1G25230,AT1G
Genes
                           55265,AT1G68140,AT1G71960,AT1G76890
Number of motifs (273)     45
                           cluster_1010,cluster_101,cluster_1077,clus
Motifs                     ter_11,cluster_12,cluster_126,cluster_1264
                           ,cluster_1276,cluster_129,cluster_1308,clu
                           ster_133,cluster_156,cluster_158,cluster_1
2. Polysaccharide synthases and glycosyl
transferases
0


0
                             4. Assembly, architecture, and
3. Secretion and targeting
                             growth
0                            129
                             AT1G04040,AT1G05210,AT1G0652
                             0,AT1G06930,AT1G08830,AT1G09
0                            161
                             cluster_1004,cluster_1023,cluster_
                             1024,cluster_1031,cluster_1040,cl
                             uster_105,cluster_108,cluster_109
                             ,cluster_1116,cluster_1123,cluster
5. Differentiation and secondary wall
                                                  6. Signaling and response
formation
20                                                27
AT1G08320,AT1G09340,AT1G26230,AT1G44170           AT1G05190,AT1G12310,AT1G52910,AT
,AT1G49240,AT1G64200,AT1G67730,AT1G6809           1G53520,AT1G66180,AT1G75690,AT1G
34                                                33
cluster_1049,cluster_1058,cluster_111,cluster_1   cluster_1078,cluster_1092,cluster_1097,
127,cluster_1136,cluster_1137,cluster_1180,clus   cluster_1100,cluster_1153,cluster_1205,
ter_1221,cluster_1244,cluster_1323,cluster_132    cluster_1219,cluster_1245,cluster_1320,
,cluster_139,cluster_203,cluster_261,cluster_27   cluster_13,cluster_144,cluster_146,clust
Functional annotation of 2,787 genes in 217 co-expression modules

IDs         CAZy   Golgi   Transporter   Transmembrane proteins
AT1G01010                                yes
AT1G01070                  yes           yes
AT1G01110

AT1G01140 yes

AT1G01230                                yes
AT1G01310                                yes

AT1G01340                  yes           yes


AT1G01460

AT1G01560 yes
AT1G01690
AT1G01710


AT1G01720


AT1G01830
AT1G01980
AT1G02140
AT1G02150
AT1G02300          yes                   yes




AT1G02560




AT1G02680
AT1G02690

AT1G02700


AT1G02730 yes   yes         yes


AT1G02790 yes               yes
AT1G02813

AT1G02860




AT1G02900                   yes




AT1G02950


AT1G03050

AT1G03360
AT1G03620
AT1G03740

AT1G03750


AT1G03780


AT1G03820
AT1G03870
AT1G03890
AT1G04040
AT1G04120       yes   yes   yes
AT1G04340                   yes
AT1G04440
AT1G04480
AT1G04540
AT1G04680 yes
AT1G04760       yes   yes
AT1G04880
AT1G04900

AT1G04920 yes

AT1G04960       yes   yes
AT1G05070             yes
AT1G05190
AT1G05210             yes


AT1G05260             yes


AT1G05360             yes
AT1G05385




AT1G05630       yes




AT1G05710


AT1G05760


AT1G05810       yes
AT1G05910
AT1G05920
AT1G05950
AT1G06010             yes
AT1G06430
AT1G06450
AT1G06520             yes




AT1G06640



AT1G06820


AT1G06930
AT1G07280


AT1G07370


AT1G07410       yes


AT1G07610

AT1G07650             yes
AT1G08320
AT1G08350             yes
AT1G08360
AT1G08380             yes
AT1G08500



AT1G08510




AT1G08590             yes

AT1G08640             yes
AT1G08660 yes         yes
AT1G08830


AT1G09160
AT1G09200
AT1G09250


AT1G09340       yes


AT1G09390
AT1G09415
AT1G09460 yes


AT1G09510       yes


AT1G09760
AT1G09790             yes
AT1G09840

AT1G09970             yes
AT1G10120

AT1G10360


AT1G10480

AT1G10522
AT1G10640 yes         yes
AT1G10770             yes
AT1G11000                   yes




AT1G11280 yes               yes
AT1G11410 yes
AT1G11430
AT1G11580 yes   yes         yes
AT1G11670             yes   yes
AT1G11770
AT1G11860

AT1G12000




AT1G12040




AT1G12070
AT1G12090




AT1G12110             yes   yes
AT1G12140



AT1G12310


AT1G12370




AT1G12410




AT1G12430       yes




AT1G12560             yes




AT1G12780 yes   yes


AT1G12800
AT1G12880
AT1G13020

AT1G13080


AT1G13090

AT1G13140             yes
AT1G13195
AT1G13200
AT1G13250 yes



AT1G13270




AT1G13280




AT1G13320       yes

AT1G13580       yes   yes
AT1G13690




AT1G13740




AT1G13890       yes


AT1G13970
AT1G14030


AT1G14080 yes   yes   yes

AT1G14130
AT1G14150
AT1G14210



AT1G14290             yes



AT1G14330
AT1G14345                   yes
AT1G14380
AT1G14400


AT1G14410

AT1G14420 yes               yes
AT1G14560             yes   yes

AT1G14720 yes

AT1G14780

AT1G14840       yes


AT1G14850

AT1G14930
AT1G14940
AT1G14950
AT1G15200
AT1G15210             yes   yes
AT1G15290
AT1G15330
AT1G15480
AT1G15640                   yes


AT1G15660



AT1G15700             yes

AT1G15710

AT1G15820                   yes

AT1G15940

AT1G15950       yes
AT1G15980 yes

AT1G16030
AT1G16220
AT1G16280
AT1G16350

AT1G16370             yes   yes

AT1G16520       yes
AT1G16680       yes         yes
AT1G16780       yes   yes   yes
AT1G16790
AT1G16850                   yes
AT1G16880


AT1G17040




AT1G17110                   yes




AT1G17140       yes
AT1G17340
AT1G17350
AT1G17370
AT1G17380
AT1G17500             yes   yes

AT1G17560


AT1G17580 yes   yes

AT1G17620                   yes

AT1G17650
AT1G17680       yes

AT1G17745


AT1G17760       yes

AT1G17810             yes   yes
AT1G17890       yes
AT1G18050
AT1G18180                   yes
AT1G18210
AT1G18250                   yes
AT1G18270
AT1G18280

AT1G18370       yes


AT1G18570




AT1G18590




AT1G18640



AT1G18650 yes               yes




AT1G18730


AT1G18910
AT1G19050




AT1G19110
AT1G19150




AT1G19220




AT1G19300 yes




AT1G19380                   yes
AT1G19500
AT1G19525
AT1G19540       yes

AT1G19580


AT1G19780             yes   yes
AT1G19850




AT1G19940 yes         yes
AT1G20010
AT1G20050             yes
AT1G20160

AT1G20190




AT1G20440




AT1G20450




AT1G20580
AT1G20650 yes
AT1G20850       yes


AT1G20900


AT1G20960

AT1G21065             yes
AT1G21090             yes
AT1G21250 yes               yes

AT1G21380
AT1G21480 yes
AT1G21500
AT1G21860
AT1G21880                   yes




AT1G21980




AT1G22040
AT1G22050
AT1G22330
AT1G22335
AT1G22440
AT1G22450
AT1G22460                   yes
AT1G22480                   yes
AT1G22600                   yes
AT1G22630
AT1G22670 yes   yes         yes




AT1G22710             yes   yes




AT1G22760
AT1G22780



AT1G23030
AT1G23050                   yes
AT1G23060
AT1G23090             yes   yes
AT1G23100
AT1G23140
AT1G23205 yes
AT1G23350
AT1G23410


AT1G23480 yes   yes         yes




AT1G23550




AT1G23750
AT1G23790

AT1G23800


AT1G23820
AT1G23850                   yes
AT1G23890                   yes
AT1G24090


AT1G24170 yes               yes


AT1G24360
AT1G24400             yes   yes



AT1G24430
AT1G24440
AT1G24520                   yes
AT1G24735
AT1G25230                   yes
AT1G25240
AT1G25260
AT1G25350
AT1G25380             yes   yes


AT1G25490


AT1G25550
AT1G26100                   yes
AT1G26230


AT1G26440             yes   yes


AT1G26450 yes

AT1G26480



AT1G26570




AT1G26770                   yes



AT1G26820
AT1G27120 yes   yes         yes
AT1G27300                   yes
AT1G27385
AT1G27400
AT1G27690
AT1G27930   yes


AT1G27970


AT1G27990   yes
AT1G28080
AT1G28090


AT1G28160




AT1G28270




AT1G28290


AT1G28400
AT1G28520
AT1G28530
AT1G28580
AT1G28630
AT1G29050   yes
AT1G29140


AT1G29150


AT1G29250
AT1G29280
AT1G29330             yes




AT1G29395             yes


AT1G29670
AT1G29680
AT1G29970             yes
AT1G29980
AT1G30110
AT1G30360             yes
AT1G30440




AT1G30460




AT1G30500


AT1G30510




AT1G30530 yes



AT1G30750
AT1G30760             yes
AT1G30825
AT1G30870             yes
AT1G31120       yes   yes
AT1G31330             yes
AT1G31335                   yes
AT1G31550

AT1G31580                   yes

AT1G31750
AT1G31820             yes   yes
AT1G31830             yes   yes
AT1G31970

AT1G32060




AT1G32070




AT1G32080                   yes


AT1G32100       yes         yes


AT1G32120                   yes


AT1G32340


AT1G32530       yes
AT1G32930 yes   yes         yes
AT1G33030
AT1G33110             yes   yes
AT1G33410
AT1G33430 yes   yes         yes
AT1G33590
AT1G33700 yes
AT1G33810
AT1G34065             yes   yes
AT1G34350                   yes
AT1G34370



AT1G34640             yes
AT1G34750
AT1G34770
AT1G35140
AT1G35190
AT1G35340
AT1G35490       yes

AT1G35580 yes




AT1G35620             yes




AT1G35680
AT1G35780
AT1G35880
AT1G36095
AT1G36320
AT1G43560       yes
AT1G43580             yes
AT1G43790             yes
AT1G44090
AT1G44110


AT1G44170
AT1G44575                   yes




AT1G44750             yes   yes


AT1G44800             yes   yes
AT1G45130 yes
AT1G47210
AT1G47270
AT1G47280
AT1G47370
AT1G47410
AT1G47740
AT1G47940
AT1G47980                   yes

AT1G47990




AT1G48050




AT1G48100 yes               yes
AT1G48230             yes   yes
AT1G48240       yes         yes
AT1G48450
AT1G48650
AT1G48930 yes               yes
AT1G49240



AT1G49290


AT1G49300       yes


AT1G49390
AT1G49400
AT1G49490
AT1G49580

AT1G49660 yes


AT1G49670       yes

AT1G49730 yes         yes
AT1G49750 yes

AT1G49820



AT1G49970


AT1G50010

AT1G50110
AT1G50320
AT1G50520             yes
AT1G50570
AT1G50630             yes

AT1G50840

AT1G51060
AT1G51260                   yes


AT1G51570                   yes




AT1G51680




AT1G51690       yes
AT1G51805                   yes
AT1G51940 yes               yes
AT1G52080       yes         yes
AT1G52220                   yes
AT1G52230
AT1G52320
AT1G52580                   yes
AT1G52590
AT1G52810


AT1G52880


AT1G52910                   yes
AT1G53000                   yes
AT1G53520
AT1G53570 yes


AT1G53730                   yes

AT1G53760                   yes
AT1G53770 yes               yes
AT1G53800
AT1G53810
AT1G54070
AT1G54100
AT1G54220
AT1G54280             yes   yes
AT1G54320       yes         yes

AT1G54370       yes   yes   yes




AT1G54490



AT1G54610 yes
AT1G54740
AT1G54780                   yes
AT1G54830
AT1G54860                   yes
AT1G55020


AT1G55120 yes


AT1G55130                   yes
AT1G55190                   yes
AT1G55260
AT1G55265




AT1G55490




AT1G55530
AT1G55560
AT1G55570


AT1G55580



AT1G55740 yes
AT1G55805
AT1G55850 yes   yes         yes

AT1G55900                   yes

AT1G56110
AT1G56310
AT1G56320
AT1G56340
AT1G56580
AT1G56700
AT1G58180
AT1G58190                   yes




AT1G58200             yes   yes




AT1G58470

AT1G59850




AT1G59870             yes   yes




AT1G59890
AT1G59960
AT1G59970
AT1G60660

AT1G60810
AT1G60940


AT1G61010
AT1G61065       yes
AT1G61370 yes   yes
AT1G61667
AT1G61870
AT1G61990
AT1G62050


AT1G62180


AT1G62410
AT1G62480
AT1G62770 yes
AT1G62790       yes
AT1G62810       yes
AT1G62840




AT1G62940       yes




AT1G62960       yes




AT1G62990



AT1G63050       yes
AT1G63060       yes
AT1G63110                   yes


AT1G63120                   yes




AT1G63180 yes   yes


AT1G63290
AT1G63310
AT1G63770
AT1G64185
AT1G64200             yes
AT1G64300
AT1G64450       yes         yes
AT1G64550       yes
AT1G64570
AT1G64640
AT1G64650             yes   yes



AT1G64660




AT1G64670                   yes




AT1G64810                   yes
AT1G65060




AT1G65230
AT1G65240       yes



AT1G65310 yes   yes




AT1G65380       yes

AT1G65610 yes   yes
AT1G65700



AT1G65840




AT1G66150       yes

AT1G66180

AT1G66200

AT1G66210       yes
AT1G66250 yes
AT1G66430
AT1G66620


AT1G66670


AT1G66980 yes   yes
AT1G67060                   yes

AT1G67230       yes

AT1G67240
AT1G67280
AT1G67290
AT1G67330                   yes
AT1G67470 yes


AT1G67500


AT1G67590
AT1G67690                   yes




AT1G67730                   yes




AT1G67910
AT1G67920




AT1G67990




AT1G68080


AT1G68090             yes

AT1G68110
AT1G68140
AT1G68220                   yes
AT1G68260
AT1G68360
AT1G68520
AT1G68590
AT1G68600       yes   yes
AT1G68610             yes


AT1G68840


AT1G68850


AT1G69295 yes




AT1G69390


AT1G69430             yes


AT1G69530


AT1G69580
AT1G69700             yes


AT1G69740

AT1G69790 yes


AT1G69850       yes   yes


AT1G70040             yes


AT1G70140             yes


AT1G70190
AT1G70230             yes
AT1G70540




AT1G70660




AT1G70710 yes               yes

AT1G70770
AT1G70790
AT1G70820
AT1G70830
AT1G70990                   yes
AT1G71040
AT1G71200
AT1G71480
AT1G71695                   yes
AT1G71720

AT1G71770

AT1G71780                   yes
AT1G71790
AT1G71960       yes   yes   yes
AT1G71970
AT1G72175                   yes
AT1G72190
AT1G72230                   yes


AT1G72300                   yes


AT1G72460 yes               yes
AT1G72550
AT1G72680
AT1G72700             yes   yes
AT1G72730
AT1G72810
AT1G72940
AT1G72990 yes               yes



AT1G73177




AT1G73220             yes   yes


AT1G73340                   yes

AT1G73540




AT1G73590             yes   yes




AT1G73640       yes
AT1G73940
AT1G74010
AT1G74020
AT1G74030
AT1G74090




AT1G74260



AT1G74370                   yes


AT1G74470



AT1G74520                   yes
AT1G74530                   yes




AT1G74660




AT1G74690
AT1G74730                   yes

AT1G74970


AT1G75240


AT1G75280       yes


AT1G75500             yes   yes
AT1G75680 yes               yes
AT1G75690                   yes
AT1G75780




AT1G75820             yes




AT1G75870
AT1G75930
AT1G76020


AT1G76080


AT1G76260       yes
AT1G76270             yes
AT1G76360 yes
AT1G76370 yes
AT1G76450




AT1G76540 yes




AT1G76550

AT1G76560

AT1G76760

AT1G76790
AT1G76890
AT1G77120



AT1G77130 yes               yes
AT1G77220                   yes
AT1G77260

AT1G77330

AT1G77580       yes
AT1G77630 yes



AT1G77690             yes   yes



AT1G77750
AT1G77860                   yes
AT1G77950



AT1G77980




AT1G78090 yes

AT1G78140
AT1G78170
AT1G78210
AT1G78310
AT1G78460
AT1G78490
AT1G78550
AT1G78570 yes   yes




AT1G78600

AT1G78670       yes
AT1G78995
AT1G79080
AT1G79340
AT1G79350
AT1G79420



AT1G79500




AT1G79730




AT1G79820             yes   yes
AT1G79950

AT1G80070

AT1G80090
AT1G80140 yes
AT1G80170 yes               yes
AT1G80240
AT1G80280                   yes
AT1G80570
AT1G80690
AT1G80770

AT1G80820       yes




AT2G01120


AT2G01260
AT2G01490
AT2G01540
AT2G01600
AT2G01670
AT2G01720             yes




AT2G01850 yes         yes




AT2G01890


AT2G02070




AT2G02120             yes
AT2G02140             yes




AT2G02160
AT2G02680
AT2G02720 yes         yes

AT2G02760

AT2G02780             yes


AT2G02850


AT2G02870
AT2G03070


AT2G03090             yes


AT2G03200             yes

AT2G03220 yes   yes   yes

AT2G03270
AT2G03310             yes
AT2G03350
AT2G03510       yes   yes


AT2G03710       yes




AT2G04030


AT2G04540
AT2G04700
AT2G04780
AT2G04845
AT2G04850                   yes
AT2G04890

AT2G05380                   yes
AT2G05540
AT2G05580                   yes
AT2G05630
AT2G05790 yes
AT2G05850
AT2G05920       yes


AT2G06005       yes         yes


AT2G06230
AT2G06520                   yes
AT2G06820

AT2G06850 yes               yes




AT2G06925                   yes




AT2G06990




AT2G07040                   yes


AT2G07180 yes
AT2G07200
AT2G07230
AT2G07560             yes   yes
AT2G07690



AT2G10340
AT2G10940
AT2G10970
AT2G11010       yes
AT2G11890
AT2G13290 yes               yes
AT2G13350       yes
AT2G13570

AT2G13650             yes   yes

AT2G13690
AT2G14880
AT2G14890
AT2G14900                   yes
AT2G15000


AT2G15090                   yes


AT2G15410
AT2G15570
AT2G15810
AT2G15890
AT2G15960
AT2G16595                   yes
AT2G16700

AT2G16730 yes               yes
AT2G16740
AT2G16780       yes
AT2G16790
AT2G17130


AT2G17270       yes   yes
AT2G17300


AT2G17370       yes   yes


AT2G17500       yes   yes




AT2G17560




AT2G17720             yes
AT2G17760             yes
AT2G17930
AT2G17972             yes
AT2G18220
AT2G18290
AT2G18360
AT2G18470 yes         yes
AT2G18690             yes
AT2G18820
AT2G18980             yes
AT2G19000
AT2G19170             yes
AT2G19330
AT2G19385
AT2G19460

AT2G19570

AT2G19580             yes
AT2G19650
AT2G19660
AT2G19750
AT2G19770


AT2G19780 yes         yes


AT2G19900


AT2G20240
AT2G20260


AT2G20310




AT2G20370 yes         yes




AT2G20420
AT2G20470
AT2G20500
AT2G20630
AT2G20700             yes
AT2G20800
AT2G20830
AT2G20850 yes         yes
AT2G20875




AT2G20890




AT2G21045
AT2G21050       yes   yes
AT2G21160             yes
AT2G21185             yes
AT2G21290
AT2G21440
AT2G21510       yes
AT2G21540       yes



AT2G21590




AT2G21620

AT2G21770 yes   yes   yes
AT2G21860
AT2G22170             yes
AT2G22180             yes
AT2G22425             yes
AT2G22450
AT2G22470             yes
AT2G22560       yes
AT2G22880
AT2G22900 yes   yes   yes
AT2G23110
AT2G23360       yes
AT2G23540             yes




AT2G23560




AT2G23640             yes
AT2G23780             yes
AT2G23840
AT2G23900 yes
AT2G23930
AT2G23990             yes
AT2G24020
AT2G24120
AT2G24170                   yes
AT2G24230                   yes
AT2G24260



AT2G24270



AT2G24280
AT2G24370 yes

AT2G24450                   yes


AT2G24765       yes




AT2G24790


AT2G24810                   yes




AT2G24840




AT2G25060                   yes
AT2G25080

AT2G25450


AT2G25490

AT2G25510                   yes
AT2G25810             yes   yes
AT2G25830
AT2G25920
AT2G26080
AT2G26340
AT2G26410

AT2G26430

AT2G26450 yes   yes         yes
AT2G26460
AT2G26490       yes
AT2G26500                   yes


AT2G26650             yes   yes


AT2G26690             yes   yes
AT2G26730 yes               yes
AT2G26760
AT2G26910       yes   yes   yes



AT2G27040



AT2G27130                   yes
AT2G27140                   yes
AT2G27180
AT2G27290
AT2G27650


AT2G27690                   yes


AT2G27720
AT2G27810             yes   yes
AT2G27830
AT2G27840
AT2G27960


AT2G27980




AT2G28110 yes   yes




AT2G28190


AT2G28240




AT2G28290




AT2G28330
AT2G28390
AT2G28410
AT2G28570


AT2G28630


AT2G28670
AT2G28740
AT2G28760 yes   yes
AT2G28790

AT2G28800             yes   yes




AT2G28900




AT2G28930 yes


AT2G28950


AT2G29040 yes               yes
AT2G29080

AT2G29130                   yes
AT2G29180                   yes

AT2G29410             yes   yes




AT2G29450




AT2G29460


AT2G29550

AT2G29940             yes   yes
AT2G30060
AT2G30200

AT2G30210                   yes
AT2G30290       yes   yes




AT2G30470




AT2G30490
AT2G30695




AT2G30920 yes




AT2G31040             yes
AT2G31070
AT2G31090             yes
AT2G31110


AT2G31350


AT2G31390

AT2G31500

AT2G31680       yes
AT2G31725
AT2G31750 yes

AT2G31800 yes


AT2G31880                   yes




AT2G31955




AT2G32060
AT2G32090
AT2G32160
AT2G32240       yes         yes
AT2G32280                   yes


AT2G32300                   yes


AT2G32430 yes   yes         yes
AT2G32590
AT2G32610 yes   yes         yes


AT2G32690                   yes



AT2G32700       yes


AT2G32720                   yes

AT2G32800 yes
AT2G32850       yes
AT2G32990 yes
AT2G33040             yes
AT2G33070




AT2G33100 yes   yes         yes
AT2G33210
AT2G33270
AT2G33310


AT2G33380


AT2G33450
AT2G33520
AT2G33590       yes
AT2G33630       yes         yes




AT2G33670                   yes




AT2G33990       yes
AT2G34020                   yes
AT2G34090


AT2G34150


AT2G34360             yes   yes
AT2G34500                   yes




AT2G34520
AT2G35010
AT2G35020

AT2G35170                   yes



AT2G35190       yes         yes



AT2G35210       yes

AT2G35310
AT2G35610 yes               yes




AT2G35650 yes   yes         yes




AT2G35860


AT2G35960                   yes


AT2G36020                   yes


AT2G36070             yes


AT2G36100                   yes
AT2G36190 yes
AT2G36200       yes
AT2G36220
AT2G36250


AT2G36310
AT2G36350
AT2G36380       yes   yes


AT2G36400


AT2G36720
AT2G36835

AT2G36870 yes


AT2G37040




AT2G37090 yes         yes




AT2G37130             yes



AT2G37220



AT2G37300
AT2G37500
AT2G37510
AT2G37630




AT2G37640


AT2G37710 yes               yes
AT2G37750
AT2G37760
AT2G38000

AT2G38040       yes



AT2G38080                   yes


AT2G38090




AT2G38120             yes   yes




AT2G38140

AT2G38465
AT2G38480                   yes
AT2G38530




AT2G38540             yes




AT2G38650 yes         yes




AT2G38700




AT2G38750       yes




AT2G38880


AT2G38905             yes

AT2G39010       yes   yes
AT2G39040
AT2G39130             yes   yes

AT2G39180 yes               yes

AT2G39300       yes
AT2G39350       yes   yes   yes
AT2G39420
AT2G39430



AT2G39450             yes   yes


AT2G39470


AT2G39700




AT2G39730


AT2G39750
AT2G39795
AT2G39900




AT2G39940




AT2G40010
AT2G40020
AT2G40430




AT2G40690
AT2G40820




AT2G40840 yes




AT2G40890




AT2G40930




AT2G41100




AT2G41110

AT2G41160       yes
AT2G41200       yes


AT2G41310



AT2G41460
AT2G41540


AT2G41550

AT2G41680

AT2G41720       yes
AT2G41740
AT2G41790
AT2G41950
AT2G41970 yes
AT2G41990                   yes

AT2G42210             yes   yes

AT2G42220

AT2G42430

AT2G42530
AT2G42570                   yes


AT2G42680


AT2G42690


AT2G42840                   yes



AT2G43040       yes




AT2G43080                   yes
AT2G43230 yes
AT2G43250                   yes
AT2G43535                   yes
AT2G43570 yes               yes
AT2G43640       yes   yes
AT2G43760

AT2G43950



AT2G44100




AT2G44110                   yes




AT2G44350


AT2G44500                   yes
AT2G44560 yes
AT2G44640

AT2G44650



AT2G44790                   yes
AT2G44940


AT2G45180                   yes




AT2G45190




AT2G45200       yes         yes
AT2G45220 yes   yes         yes
AT2G45290
AT2G45430
AT2G45560                   yes
AT2G45590                   yes
AT2G45750                   yes

AT2G45770             yes


AT2G45790
AT2G45800
AT2G45810
AT2G45820
AT2G45870                   yes




AT2G45890




AT2G45920       yes
AT2G46080
AT2G46210                   yes
AT2G46250       yes
AT2G46360
AT2G46370




AT2G46380
AT2G46490
AT2G46620                   yes



AT2G46680       yes




AT2G46860

AT2G46910




AT2G46920




AT2G46930 yes               yes



AT2G47000       yes   yes   yes



AT2G47050 yes               yes

AT2G47180 yes
AT2G47500
AT2G47550 yes   yes


AT2G47620


AT2G47640


AT2G47730


AT2G47840             yes
AT2G47900


AT2G47980       yes




AT2G47990       yes




AT2G48070             yes


AT2G48080
AT2G48130
AT2G48140
AT3G01180 yes
AT3G01190
AT3G01250             yes
AT3G01270 yes
AT3G01340       yes



AT3G01460
AT3G01470




AT3G01480

AT3G01660
AT3G01680

AT3G01700             yes

AT3G01730             yes


AT3G01780


AT3G01790
AT3G01920
AT3G02120
AT3G02210             yes
AT3G02220
AT3G02260

AT3G02310       yes


AT3G02350 yes         yes



AT3G02580             yes


AT3G02600             yes

AT3G02640             yes
AT3G02660
AT3G02730
AT3G02770
AT3G02790
AT3G02810 yes
AT3G02880 yes         yes
AT3G02970
AT3G03020
AT3G03160             yes

AT3G03220


AT3G03310
AT3G03330             yes
AT3G03420
AT3G03430
AT3G03520
AT3G03800       yes   yes
AT3G03980
AT3G04010 yes         yes

AT3G04340       yes   yes

AT3G04350
AT3G04360
AT3G04480
AT3G04550
AT3G04570
AT3G04605
AT3G04700
AT3G04730
AT3G05050 yes


AT3G05060


AT3G05180
AT3G05200             yes
AT3G05260
AT3G05350



AT3G05490



AT3G05500
AT3G05610 yes   yes   yes
AT3G05750
AT3G05810
AT3G05890             yes
AT3G05930
AT3G05990 yes
AT3G06040
AT3G06060       yes   yes
AT3G06140
AT3G06150
AT3G06240


AT3G06260 yes         yes




AT3G06300             yes




AT3G06380




AT3G06400




AT3G06420

AT3G06510 yes         yes

AT3G06530
AT3G06760
AT3G06770 yes
AT3G06840
AT3G07010 yes
AT3G07020 yes
AT3G07110       yes
AT3G07170
AT3G07320 yes
AT3G07340


AT3G07390             yes


AT3G07410       yes
AT3G07510             yes
AT3G07540             yes

AT3G07590
AT3G07760
AT3G07770
AT3G07820 yes
AT3G07830 yes
AT3G07900             yes
AT3G08490             yes
AT3G08630             yes
AT3G08680 yes         yes




AT3G08770




AT3G08990


AT3G09530


AT3G09670
AT3G09900       yes


AT3G09920

AT3G10080
AT3G10150


AT3G10160

AT3G10190
AT3G10260                   yes
AT3G10340
AT3G10350             yes
AT3G10520

AT3G10570                   yes




AT3G10660




AT3G10670             yes


AT3G10710 yes   yes         yes
AT3G10720 yes   yes         yes
AT3G10730       yes


AT3G10740 yes


AT3G10960             yes   yes
AT3G10970
AT3G11050
AT3G11210
AT3G11340 yes
AT3G11420 yes               yes
AT3G11430               yes



AT3G11520

AT3G11630
AT3G11690
AT3G11830
AT3G11964   yes

AT3G11980

AT3G12090               yes


AT3G12160   yes




AT3G12490

AT3G12530
AT3G12570
AT3G12780
AT3G12950
AT3G12955
AT3G13070         yes   yes
AT3G13140
AT3G13230
AT3G13280
AT3G13320         yes   yes
AT3G13360               yes
AT3G13390
AT3G13400


AT3G13520               yes
AT3G13560 yes               yes

AT3G13570

AT3G13610
AT3G13650
AT3G13674

AT3G13750 yes               yes

AT3G13772                   yes
AT3G13845                   yes


AT3G13870                   yes




AT3G14070             yes   yes




AT3G14110       yes         yes




AT3G14270

AT3G14280
AT3G14560       yes

AT3G14570 yes               yes

AT3G14595                   yes
AT3G14610                   yes
AT3G14840 yes               yes


AT3G14940
AT3G15020
AT3G15080
AT3G15095
AT3G15190




AT3G15210




AT3G15280
AT3G15357
AT3G15520


AT3G15580


AT3G15590
AT3G15720 yes               yes
AT3G15770

AT3G15790



AT3G15840


AT3G15880       yes
AT3G15970
AT3G16040
AT3G16060       yes
AT3G16190



AT3G16240             yes   yes
AT3G16250



AT3G16260
AT3G16470
AT3G16630
AT3G16690             yes
AT3G16750




AT3G16770




AT3G16780
AT3G16860             yes
AT3G16920 yes         yes
AT3G17060 yes   yes
AT3G17100
AT3G17390

AT3G17420 yes         yes
AT3G17450
AT3G17470
AT3G17680       yes
AT3G17810


AT3G17840 yes         yes

AT3G17940
AT3G17980
AT3G18035
AT3G18040 yes
AT3G18050
AT3G18190
AT3G18210
AT3G18220             yes
AT3G18270
AT3G18500


AT3G18690



AT3G18710




AT3G18750



AT3G18800             yes
AT3G18860       yes
AT3G18900 yes
AT3G18940
AT3G19020 yes         yes
AT3G19310             yes
AT3G19400       yes   yes


AT3G19450


AT3G19460             yes
AT3G19590       yes
AT3G19660



AT3G19710



AT3G19990
AT3G20010

AT3G20080       yes         yes

AT3G20120
AT3G20190 yes               yes
AT3G20220
AT3G20230
AT3G20250
AT3G20260


AT3G20330


AT3G20370                   yes
AT3G20390

AT3G20410

AT3G20460             yes   yes
AT3G20510                   yes
AT3G20530 yes
AT3G20570                   yes
AT3G20580                   yes
AT3G20830
AT3G20865                   yes


AT3G21055

AT3G21060       yes
AT3G21190




AT3G21230
AT3G21240             yes



AT3G21260
AT3G21370 yes
AT3G21380




AT3G21510




AT3G21570

AT3G21700       yes

AT3G21710
AT3G21760 yes
AT3G21770             yes
AT3G22190
AT3G22260

AT3G22320




AT3G22420 yes



AT3G22425
AT3G22440
AT3G22520       yes
AT3G22600

AT3G22620             yes
AT3G22650 yes
AT3G22760


AT3G22990



AT3G23000 yes




AT3G23050




AT3G23090
AT3G23160
AT3G23190             yes
AT3G23200             yes
AT3G23310       yes
AT3G23340


AT3G23430       yes   yes


AT3G23590             yes
AT3G23610
AT3G23690

AT3G23730 yes

AT3G23760



AT3G23830



AT3G24150
AT3G24160                   yes
AT3G24240                   yes
AT3G24450



AT3G24503




AT3G24590


AT3G24670 yes
AT3G25110



AT3G25140 yes               yes




AT3G25165




AT3G25170



AT3G25540       yes         yes


AT3G25585                   yes


AT3G25620             yes
AT3G25690       yes
AT3G25805                   yes
AT3G25870
AT3G25890


AT3G25900
AT3G25930
AT3G25980

AT3G26060

AT3G26110               yes
AT3G26330               yes
AT3G26560
AT3G26570         yes   yes




AT3G26744




AT3G26760   yes
AT3G26770
AT3G26860               yes




AT3G27060




AT3G27100
AT3G27170         yes   yes

AT3G27190
AT3G27200               yes
AT3G27240
AT3G27520
AT3G27690




AT3G27890


AT3G27960       yes
AT3G28040                   yes
AT3G28200
AT3G28280
AT3G28450 yes               yes
AT3G28720                   yes

AT3G28730

AT3G28750
AT3G28790                   yes
AT3G28830




AT3G28860       yes   yes   yes




AT3G28940
AT3G28980

AT3G29090 yes   yes

AT3G29150
AT3G29170                   yes
AT3G29185
AT3G29230       yes
AT3G29250
AT3G29290
AT3G29575
AT3G29810                   yes
AT3G30250
AT3G30300                   yes
AT3G30390             yes   yes



AT3G30775


AT3G42640             yes   yes
AT3G42950 yes               yes


AT3G42960

AT3G43120
AT3G43500
AT3G43860 yes               yes
AT3G43900

AT3G43920

AT3G43960       yes         yes
AT3G44100                   yes
AT3G44190




AT3G44200 yes




AT3G44320




AT3G44330                   yes
AT3G44720




AT3G44750




AT3G44990 yes


AT3G45010
AT3G45090


AT3G45140


AT3G45160                   yes
AT3G45600                   yes
AT3G45770
AT3G45850       yes
AT3G45870             yes   yes
AT3G45900       yes

AT3G45960                   yes


AT3G45970                   yes


AT3G46230
AT3G46570 yes               yes
AT3G46750
AT3G46780
AT3G46800
AT3G47250                   yes
AT3G47390
AT3G47400 yes   yes
AT3G47440             yes   yes

AT3G47800                   yes
AT3G47860

AT3G47950             yes   yes

AT3G48185                   yes
AT3G48420 yes
AT3G48440
AT3G48490
AT3G48530


AT3G48580 yes


AT3G48830

AT3G48930
AT3G49000
AT3G49100             yes

AT3G49160

AT3G49220 yes   yes         yes
AT3G49430




AT3G49670 yes               yes
AT3G49710       yes
AT3G49900
AT3G49960


AT3G50070


AT3G50620             yes


AT3G50760 yes         yes


AT3G50780




AT3G50820




AT3G50830             yes




AT3G51030



AT3G51050       yes   yes
AT3G51120

AT3G51160       yes




AT3G51300       yes
AT3G51460               yes


AT3G51520               yes




AT3G51600




AT3G51660




AT3G51780   yes




AT3G51790               yes


AT3G51850


AT3G51860         yes   yes
AT3G51870         yes   yes




AT3G51880
AT3G51920




AT3G51950
AT3G52060             yes
AT3G52110
AT3G52140
AT3G52170
AT3G52370

AT3G52470             yes
AT3G52480             yes
AT3G52580
AT3G52600 yes
AT3G52610
AT3G52720

AT3G52750

AT3G52840 yes
AT3G52900       yes
AT3G52920       yes

AT3G52940             yes


AT3G53040
AT3G53190 yes         yes
AT3G53230
AT3G53260

AT3G53280
AT3G53390       yes
AT3G53410
AT3G53430


AT3G53620


AT3G54000
AT3G54030 yes   yes
AT3G54120             yes
AT3G54150
AT3G54190
AT3G54200             yes
AT3G54210




AT3G54220




AT3G54260
AT3G54290
AT3G54350
AT3G54400




AT3G54420 yes




AT3G54480
AT3G54560
AT3G54590             yes

AT3G54620       yes
AT3G54650

AT3G54660
AT3G54770
AT3G54800

AT3G54820       yes   yes


AT3G54860


AT3G54920 yes




AT3G54960




AT3G55005




AT3G55120




AT3G55260 yes




AT3G55330
AT3G55350
AT3G55470
AT3G55530                   yes



AT3G55640             yes   yes


AT3G55800


AT3G55950 yes               yes
AT3G56000 yes   yes         yes


AT3G56100                   yes


AT3G56230




AT3G56240




AT3G56300       yes         yes
AT3G56370                   yes
AT3G56410
AT3G56600
AT3G56640
AT3G56890
AT3G56900       yes
AT3G56910
AT3G56930                   yes


AT3G56950             yes   yes


AT3G56990       yes
AT3G57170             yes
AT3G57180




AT3G57300




AT3G57420 yes         yes


AT3G57610


AT3G57620
AT3G57690             yes


AT3G57920


AT3G58450
AT3G58690 yes         yes
AT3G58710
AT3G58800             yes
AT3G59010 yes   yes   yes



AT3G59060




AT3G59280
AT3G59400




AT3G59420 yes         yes




AT3G59530             yes
AT3G59610 yes
AT3G59640             yes
AT3G59845             yes
AT3G60070       yes   yes
AT3G60330       yes   yes
AT3G60540       yes   yes


AT3G60600


AT3G60680
AT3G60690
AT3G60770
AT3G61100
AT3G61160
AT3G61230


AT3G61430       yes   yes
AT3G61640             yes
AT3G61670
AT3G61760
AT3G61820


AT3G61890       yes


AT3G61960 yes
AT3G61980             yes
AT3G61990
AT3G62020



AT3G62030



AT3G62110 yes
AT3G62170 yes   yes   yes
AT3G62180 yes
AT3G62230
AT3G62240
AT3G62280             yes



AT3G62290       yes



AT3G62300       yes
AT3G62360             yes
AT3G62640
AT3G62710 yes         yes




AT3G62720 yes   yes   yes




AT3G62820 yes
AT3G62840
AT3G63080
AT3G63090




AT3G63410             yes




AT3G63510


AT3G66658             yes



AT4G00100


AT4G00330 yes
AT4G00350       yes   yes

AT4G00490 yes

AT4G00660
AT4G00680
AT4G00700             yes



AT4G00710 yes



AT4G00740             yes
AT4G00810
AT4G00820

AT4G00900       yes   yes

AT4G01080             yes
AT4G01575             yes
AT4G01690
AT4G01700 yes
AT4G01720

AT4G01850


AT4G01950             yes




AT4G02060




AT4G02070



AT4G02075             yes
AT4G02090
AT4G02220
AT4G02250             yes

AT4G02280 yes

AT4G02320 yes   yes   yes
AT4G02410 yes         yes
AT4G02480


AT4G02560


AT4G02580
AT4G02610
AT4G02860
AT4G02930
AT4G03070




AT4G03100
AT4G03110
AT4G03150



AT4G03190




AT4G03205




AT4G03210 yes




AT4G03260
AT4G03290
AT4G03320       yes   yes

AT4G03340 yes         yes
AT4G03410
AT4G03490             yes
AT4G03760
AT4G04350

AT4G04640       yes
AT4G04790


AT4G04930             yes
AT4G04970 yes               yes




AT4G05160                   yes




AT4G05190       yes



AT4G05240
AT4G05460
AT4G05590

AT4G07960 yes   yes         yes




AT4G08150




AT4G08300             yes   yes
AT4G08380
AT4G08685

AT4G08690
AT4G08770
AT4G08780
AT4G09010




AT4G09020 yes




AT4G09030       yes
AT4G09830
AT4G09990       yes
AT4G10020       yes
AT4G10060 yes
AT4G10270
AT4G10620
AT4G10710
AT4G10925
AT4G10970
AT4G11160
AT4G11175
AT4G11290


AT4G11420


AT4G11560
AT4G11860
AT4G12130




AT4G12420       yes
AT4G12730


AT4G12960


AT4G13020


AT4G13030                   yes

AT4G13080 yes

AT4G13130       yes
AT4G13180
AT4G13200
AT4G13345                   yes


AT4G13510             yes   yes


AT4G13560


AT4G13660       yes




AT4G13770                   yes




AT4G13830       yes
AT4G14000
AT4G14020
AT4G14080 yes
AT4G14100                   yes


AT4G14130 yes               yes
AT4G14210


AT4G14230             yes   yes
AT4G14350 yes
AT4G14380
AT4G14500                   yes
AT4G14750
AT4G14770
AT4G14910
AT4G15093


AT4G15560


AT4G15750
AT4G15780       yes         yes




AT4G15880




AT4G15920                   yes
AT4G15980 yes   yes
AT4G16120
AT4G16140                   yes
AT4G16260 yes
AT4G16390       yes


AT4G16420


AT4G16640                   yes
AT4G16650                   yes
AT4G16980                   yes
AT4G17090 yes




AT4G17170       yes
AT4G17180 yes


AT4G17190




AT4G17220       yes

AT4G17340             yes   yes
AT4G17350
AT4G17483       yes         yes
AT4G17520
AT4G17690


AT4G17770 yes


AT4G17790                   yes
AT4G17950
AT4G18020

AT4G18360


AT4G18370


AT4G18390
AT4G18395
AT4G18430       yes
AT4G18460
AT4G18580

AT4G18700 yes
AT4G18740




AT4G18780 yes   yes         yes




AT4G18820
AT4G18970 yes


AT4G19030             yes   yes


AT4G19120                   yes
AT4G19150




AT4G19230                   yes




AT4G19420 yes               yes
AT4G19620

AT4G19840


AT4G19860

AT4G20010
AT4G20030
AT4G20110       yes         yes




AT4G20270                   yes




AT4G20430
AT4G20460 yes   yes
AT4G20480
AT4G20840                   yes
AT4G20890
AT4G20980


AT4G21350

AT4G21580
AT4G22010
AT4G22120                   yes
AT4G22212
AT4G22310
AT4G22470




AT4G22570



AT4G22670       yes

AT4G22753                   yes


AT4G22780

AT4G22820
AT4G23050 yes
AT4G23070                   yes
AT4G23410                   yes
AT4G23450
AT4G23470                   yes
AT4G23490 yes               yes
AT4G23690                   yes
AT4G23800
AT4G23820 yes
AT4G23950       yes         yes
AT4G23990 yes   yes         yes


AT4G24120             yes   yes
AT4G24440
AT4G24480 yes
AT4G24530


AT4G24560             yes



AT4G24640

AT4G24660
AT4G24780 yes
AT4G24930


AT4G25000 yes         yes



AT4G25020
AT4G25030             yes
AT4G25220       yes   yes
AT4G25260 yes
AT4G25320
AT4G25360             yes
AT4G25590
AT4G25730
AT4G25780             yes
AT4G25790             yes


AT4G25810 yes




AT4G25820 yes         yes


AT4G25870             yes
AT4G25880
AT4G25890
AT4G25910


AT4G26010
AT4G26050


AT4G26100


AT4G26230
AT4G26260
AT4G26390
AT4G26520
AT4G26555


AT4G26690       yes   yes


AT4G26750 yes
AT4G26760       yes
AT4G26790
AT4G26830 yes
AT4G26870
AT4G26910
AT4G26940 yes   yes



AT4G27060       yes




AT4G27080             yes



AT4G27400

AT4G27430

AT4G27435       yes   yes
AT4G27440

AT4G27450
AT4G27520                   yes
AT4G27530
AT4G27540                   yes
AT4G27580
AT4G27690
AT4G27710                   yes
AT4G27720             yes   yes
AT4G27730       yes   yes   yes


AT4G27780                   yes


AT4G27820 yes
AT4G27840                   yes
AT4G27860             yes   yes
AT4G28050                   yes
AT4G28080
AT4G28085                   yes
AT4G28150



AT4G28190




AT4G28220



AT4G28250


AT4G28280

AT4G28300       yes

AT4G28395                   yes
AT4G28680


AT4G29030                   yes
AT4G29140             yes   yes
AT4G29180 yes               yes
AT4G29240                   yes
AT4G29360 yes               yes
AT4G29480       yes
AT4G29500
AT4G30060                   yes
AT4G30140                   yes
AT4G30170


AT4G30200


AT4G30220


AT4G30270 yes




AT4G30280 yes               yes




AT4G30290 yes




AT4G30320
AT4G30380                   yes
AT4G30390
AT4G30410
AT4G30590
AT4G30800
AT4G30950                   yes



AT4G30996                   yes
AT4G31130                   yes
AT4G31240
AT4G31360
AT4G31470                   yes
AT4G31700
AT4G31760                   yes




AT4G31800       yes




AT4G31830                   yes
AT4G31840                   yes
AT4G32270
AT4G32340       yes
AT4G32375 yes




AT4G32410 yes   yes         yes



AT4G32420



AT4G32650             yes   yes




AT4G32710 yes
AT4G32720




AT4G32830 yes




AT4G32850
AT4G32910

AT4G33010


AT4G33030       yes
AT4G33140
AT4G33210
AT4G33220 yes   yes
AT4G33300
AT4G33400       yes
AT4G33410                   yes

AT4G33510


AT4G33670
AT4G33700             yes   yes
AT4G33750
AT4G33920
AT4G33950




AT4G34050
AT4G34090


AT4G34215 yes




AT4G34230


AT4G34440 yes         yes




AT4G34460       yes




AT4G34580       yes
AT4G34610


AT4G34620

AT4G34630




AT4G34640                   yes




AT4G34720             yes   yes

AT4G34980                   yes
AT4G35010 yes

AT4G35180             yes   yes
AT4G35250       yes
AT4G35320
AT4G35380
AT4G35410       yes


AT4G35450


AT4G35500




AT4G35570




AT4G35580
AT4G35620


AT4G35630
AT4G35700
AT4G35750
AT4G35780 yes   yes
AT4G35880             yes
AT4G35950       yes




AT4G35970             yes




AT4G36210             yes

AT4G36220             yes




AT4G36380             yes




AT4G36490

AT4G36540

AT4G36690             yes



AT4G36810
AT4G36990



AT4G37080 yes


AT4G37430


AT4G37445


AT4G37450             yes


AT4G37560


AT4G37740



AT4G37890
AT4G38040 yes
AT4G38160
AT4G38360             yes
AT4G38370

AT4G38510       yes

AT4G38540

AT4G38570             yes

AT4G38660
AT4G38680




AT4G38750
AT4G38860
AT4G38890

AT4G38970




AT4G39090       yes




AT4G39110 yes         yes


AT4G39120



AT4G39170       yes   yes
AT4G39220             yes

AT4G39350 yes   yes   yes

AT4G39610
AT4G39670
AT4G39690
AT4G39710


AT4G39780
AT4G39800       yes



AT4G39960       yes
AT4G40000
AT4G40045                   yes


AT4G40060


AT4G40090
AT5G01020 yes
AT5G01075                   yes
AT5G01190             yes   yes
AT5G01310
AT5G01510
AT5G01610
AT5G01650
AT5G01670



AT5G01770       yes



AT5G01910       yes
AT5G01970
AT5G02000
AT5G02020




AT5G02030




AT5G02050
AT5G02100




AT5G02260


AT5G02290 yes

AT5G02420
AT5G02430       yes
AT5G02560
AT5G02580
AT5G02610
AT5G02770
AT5G02790             yes


AT5G02820


AT5G02830
AT5G03170                   yes
AT5G03250
AT5G03260             yes   yes




AT5G03300




AT5G03450



AT5G03530       yes



AT5G03555             yes   yes
AT5G03630


AT5G03650 yes


AT5G03700                   yes



AT5G03760 yes   yes         yes



AT5G03850
AT5G03880                   yes


AT5G04040                   yes




AT5G04140


AT5G04160             yes   yes
AT5G04180

AT5G04400       yes




AT5G04470




AT5G04540
AT5G04740
AT5G04770             yes   yes




AT5G04820
AT5G04960 yes   yes         yes


AT5G05000             yes


AT5G05010       yes
AT5G05160 yes               yes
AT5G05210
AT5G05320
AT5G05460 yes
AT5G05500                   yes
AT5G05600


AT5G05730


AT5G05750       yes
AT5G05820             yes   yes


AT5G05870 yes


AT5G05880 yes
AT5G05890 yes
AT5G05960
AT5G06050                   yes
AT5G06060       yes
AT5G06280
AT5G06370
AT5G06570 yes
AT5G06630                   yes
AT5G06640                   yes
AT5G06660                   yes
AT5G06720                   yes
AT5G06730                   yes


AT5G06870


AT5G06930
AT5G07020
AT5G07030
AT5G07040                   yes
AT5G07100
AT5G07110                   yes
AT5G07230




AT5G07290




AT5G07320             yes   yes
AT5G07390                   yes
AT5G07420 yes   yes
AT5G07430 yes   yes


AT5G07440




AT5G07530                   yes
AT5G07560             yes
AT5G07820
AT5G07910


AT5G08000 yes


AT5G08050             yes
AT5G08070

AT5G08080       yes   yes
AT5G08100
AT5G08110



AT5G08210



AT5G08400
AT5G08535
AT5G08565
AT5G08580             yes
AT5G08610
AT5G08640
AT5G08650       yes

AT5G09300


AT5G09330
AT5G09550

AT5G09650




AT5G09660


AT5G09850
AT5G10020             yes
AT5G10030




AT5G10140




AT5G10180             yes   yes


AT5G10190             yes   yes
AT5G10320
AT5G10400
AT5G10430                   yes


AT5G10440

AT5G10470       yes
AT5G10540
AT5G10560 yes
AT5G10580                   yes
AT5G10740
AT5G10750
AT5G10810
AT5G10970
AT5G10980
AT5G11040
AT5G11060




AT5G11090
AT5G11100               yes
AT5G11180         yes   yes
AT5G11450




AT5G11670




AT5G11770
AT5G11870               yes


AT5G12030


AT5G12130         yes   yes
AT5G12170               yes

AT5G12250



AT5G12290               yes


AT5G12470               yes
AT5G12870
AT5G12880               yes
AT5G12900   yes
AT5G12980
AT5G13090
AT5G13100
AT5G13140
AT5G13180
AT5G13190                   yes


AT5G13220       yes



AT5G13450             yes

AT5G13490             yes   yes
AT5G13800


AT5G13870 yes


AT5G13980 yes
AT5G14030                   yes
AT5G14090
AT5G14130
AT5G14150
AT5G14340


AT5G14380                   yes


AT5G14610

AT5G14640


AT5G14740
AT5G14800




AT5G14890                   yes
AT5G15110 yes
AT5G15140                   yes
AT5G15180                   yes
AT5G15230                   yes




AT5G15410             yes   yes




AT5G15460
AT5G15490



AT5G15600



AT5G15610
AT5G15730 yes               yes
AT5G15830


AT5G16050

AT5G16130
AT5G16190 yes   yes         yes
AT5G16260
AT5G16270

AT5G16460                   yes
AT5G16500 yes
AT5G16510 yes   yes
AT5G16590 yes               yes
AT5G16610

AT5G16710             yes


AT5G16910 yes   yes         yes

AT5G17160
AT5G17230
AT5G17270       yes
AT5G17310
AT5G17380                   yes

AT5G17420 yes   yes         yes


AT5G17480
AT5G17560
AT5G17610
AT5G17620

AT5G17710       yes   yes

AT5G17820                   yes
AT5G17870
AT5G18170




AT5G18250             yes
AT5G18310
AT5G18410
AT5G18460
AT5G18470             yes
AT5G18520             yes
AT5G18550
AT5G18570
AT5G18590       yes


AT5G18620


AT5G18670 yes
AT5G18780             yes




AT5G18830             yes




AT5G18910 yes
AT5G18990 yes   yes
AT5G19050
AT5G19250             yes
AT5G19260
AT5G19310


AT5G19690 yes         yes
AT5G19800
AT5G19890             yes
AT5G19930             yes
AT5G20050 yes         yes
AT5G20130             yes

AT5G20240


AT5G20270             yes

AT5G20390 yes

AT5G20400

AT5G20550


AT5G20570


AT5G20620
AT5G20700
AT5G20710 yes




AT5G20730




AT5G20810
AT5G20935
AT5G20960
AT5G21100       yes   yes
AT5G21120
AT5G21150
AT5G22280
AT5G22320
AT5G22330
AT5G22430             yes
AT5G22460
AT5G22470
AT5G22550                   yes
AT5G22580
AT5G22700

AT5G22740 yes   yes         yes


AT5G22830       yes   yes   yes
AT5G22950
AT5G23050
AT5G23060                   yes




AT5G23080




AT5G23250


AT5G23270             yes   yes



AT5G23420




AT5G23440


AT5G23530 yes




AT5G23580
AT5G23720




AT5G23860


AT5G24150       yes         yes
AT5G24210




AT5G24270




AT5G24290             yes   yes
AT5G24400
AT5G24580
AT5G24620                   yes


AT5G24850


AT5G24930
AT5G25050             yes   yes
AT5G25090                   yes
AT5G25340


AT5G25350


AT5G25610
AT5G25770
AT5G25820 yes               yes
AT5G25880




AT5G25890



AT5G25930                   yes
AT5G26060                   yes
AT5G26260
AT5G26700
AT5G26740                   yes

AT5G26830

AT5G26880
AT5G26910

AT5G27000


AT5G27100             yes   yes


AT5G27150       yes   yes   yes


AT5G27220       yes


AT5G27320 yes


AT5G27490       yes         yes
AT5G27550
AT5G27710
AT5G27870 yes   yes         yes
AT5G27980
AT5G28590
AT5G28680 yes               yes
AT5G28740       yes
AT5G28840 yes   yes


AT5G30380
AT5G30500 yes
AT5G35190                   yes
AT5G35200
AT5G35630
AT5G35700
AT5G35730                   yes
AT5G35740 yes
AT5G35760

AT5G35910

AT5G36250
AT5G36260                   yes
AT5G37010




AT5G37500             yes   yes




AT5G37540                   yes
AT5G37740
AT5G37790 yes
AT5G38030             yes   yes
AT5G38150       yes


AT5G38280 yes               yes

AT5G38520
AT5G38720
AT5G38760
AT5G38850
AT5G38950
AT5G38980                   yes
AT5G39210


AT5G39320
AT5G39370
AT5G39410




AT5G39510       yes         yes




AT5G39600
AT5G39650                   yes



AT5G39660



AT5G39880                   yes
AT5G39970
AT5G40020
AT5G40040
AT5G40150
AT5G40155                   yes
AT5G40380 yes               yes

AT5G40440 yes

AT5G40450
AT5G40730                   yes
AT5G40770




AT5G40890             yes   yes




AT5G41040
AT5G41050
AT5G41060                   yes
AT5G41180                   yes
AT5G41460 yes               yes

AT5G41480

AT5G41600                   yes
AT5G41760             yes   yes
AT5G42010       yes


AT5G42100 yes               yes



AT5G42140
AT5G42180
AT5G42300
AT5G42390
AT5G42400
AT5G42420             yes   yes


AT5G42750


AT5G42860                   yes


AT5G42970       yes


AT5G43020 yes               yes
AT5G43030
AT5G43060       yes
AT5G43080
AT5G43100                   yes


AT5G43170


AT5G43260                   yes
AT5G43270



AT5G43710 yes               yes
AT5G43745                   yes


AT5G43760                   yes


AT5G43930       yes
AT5G44020


AT5G44030 yes   yes         yes



AT5G44130




AT5G44200




AT5G44310
AT5G44460
AT5G44730


AT5G44790             yes   yes


AT5G45020

AT5G45140

AT5G45300 yes
AT5G45310                   yes
AT5G45360
AT5G45390


AT5G45480                   yes
AT5G45620
AT5G45680


AT5G45810 yes




AT5G45820 yes


AT5G45880                   yes
AT5G45900
AT5G45950
AT5G45970       yes
AT5G46140
AT5G46340                   yes
AT5G46450



AT5G46700                   yes



AT5G47000                   yes
AT5G47200       yes
AT5G47210
AT5G47470             yes   yes
AT5G47480
AT5G47810



AT5G47990                   yes



AT5G48140 yes
AT5G48210
AT5G48300




AT5G48310             yes
AT5G48380             yes
AT5G48410       yes   yes


AT5G48450       yes




AT5G48485             yes




AT5G48560
AT5G48590
AT5G48730
AT5G48760
AT5G48770
AT5G48900 yes         yes




AT5G48930




AT5G49010

AT5G49210
AT5G49270             yes


AT5G49460

AT5G49540             yes
AT5G49555


AT5G49570


AT5G49700             yes
AT5G49950             yes
AT5G50030             yes

AT5G50160             yes

AT5G50170             yes


AT5G50200             yes




AT5G50375             yes


AT5G50410
AT5G50420 yes         yes


AT5G50720             yes


AT5G50830


AT5G50920


AT5G51030       yes
AT5G51060             yes




AT5G51100

AT5G51350             yes
AT5G51400             yes
AT5G51560 yes         yes
AT5G51590


AT5G51760


AT5G51890



AT5G51940




AT5G52060




AT5G52120


AT5G52340


AT5G52360
AT5G52420             yes
AT5G52520
AT5G52650
AT5G52780             yes
AT5G53090       yes
AT5G53250                   yes
AT5G53400
AT5G53440


AT5G53490


AT5G53550             yes   yes
AT5G53590
AT5G53620       yes
AT5G53650                   yes
AT5G53740
AT5G53820
AT5G53880
AT5G53940
AT5G54095
AT5G54220                   yes


AT5G54270


AT5G54470


AT5G54500


AT5G54630


AT5G54670       yes




AT5G54690 yes               yes



AT5G54750
AT5G54780
AT5G54900
AT5G55230       yes




AT5G55470       yes   yes   yes



AT5G55480                   yes




AT5G55500 yes               yes

AT5G55530




AT5G55540       yes         yes




AT5G55560



AT5G55630             yes   yes




AT5G55730

AT5G55930             yes   yes
AT5G55950             yes   yes
AT5G56140
AT5G56540                   yes
AT5G56580 yes


AT5G56590 yes


AT5G56600


AT5G56750             yes


AT5G56760


AT5G56870 yes
AT5G56940


AT5G56950


AT5G57060             yes
AT5G57345             yes
AT5G57460       yes

AT5G57530 yes         yes


AT5G57550 yes         yes

AT5G57610 yes
AT5G57700 yes
AT5G57740
AT5G57790
AT5G57810             yes

AT5G57900

AT5G57920
AT5G57990
AT5G58010
AT5G58030
AT5G58050             yes
AT5G58090 yes




AT5G58140




AT5G58170
AT5G58200
AT5G58210 yes




AT5G58230       yes




AT5G58240
AT5G58300 yes         yes
AT5G58480 yes
AT5G58575
AT5G58730
AT5G58930
AT5G59010 yes
AT5G59090
AT5G59170
AT5G59220




AT5G59290 yes   yes




AT5G59320




AT5G59480
AT5G59500                   yes


AT5G59730


AT5G59740             yes   yes


AT5G59800


AT5G59840       yes
AT5G59850
AT5G60020             yes
AT5G60150
AT5G60220                   yes

AT5G60300 yes               yes


AT5G60360       yes         yes
AT5G60490
AT5G60720 yes   yes
AT5G60760
AT5G60920             yes


AT5G60930       yes
AT5G60950
AT5G61000

AT5G61030




AT5G61130 yes


AT5G61340             yes
AT5G61410
AT5G61480             yes


AT5G61640


AT5G61710
AT5G61720
AT5G61840 yes
AT5G61930
AT5G62090
AT5G62290




AT5G62310




AT5G62410       yes
AT5G62420


AT5G62480
AT5G62500


AT5G62580
AT5G62600
AT5G62620 yes   yes   yes

AT5G62640

AT5G62750




AT5G62790




AT5G62960             yes
AT5G63150
AT5G63180 yes         yes
AT5G63190


AT5G63400


AT5G63410 yes         yes
AT5G63680




AT5G63800 yes         yes




AT5G63905
AT5G63920
AT5G63970
AT5G63990
AT5G64040


AT5G64080                   yes
AT5G64100                   yes
AT5G64120
AT5G64150
AT5G64310                   yes




AT5G64330




AT5G64340




AT5G64370

AT5G64640 yes   yes         yes
AT5G64670
AT5G64780
AT5G64790 yes               yes
AT5G64816
AT5G65000             yes   yes


AT5G65020             yes




AT5G65090



AT5G65210       yes
AT5G65220
AT5G65360
AT5G65390                   yes
AT5G65530 yes
AT5G65550 yes               yes
AT5G65620
AT5G65670
AT5G65685

AT5G65730 yes               yes

AT5G65810                   yes
AT5G65850

AT5G65930       yes




AT5G66020                   yes




AT5G66190




AT5G66310
AT5G66390                   yes
AT5G66460 yes
AT5G66520
AT5G66560
AT5G66650                   yes
AT5G66730
AT5G66920             yes   yes
AT5G67070



AT5G67090       yes
AT5G67130       yes
AT5G67200 yes   yes


AT5G67270


AT5G67400

AT5G67480




AT5G67500




AT5G67510
AT5G67520
ATCG00170

ATCG00300       yes


ATCG00760
ATCG00770
ATMG00660
TAIR descriptions (Short_description||Curator_summary)
ANAC001 (Arabidopsis NAC domain containing protein 1); transcription
factor||
nodulin MtN21 family protein||
IQD18 (IQ-domain 18)||
CIPK9 (CBL-INTERACTING PROTEIN KINASE 9); ATP binding / kinase/
protein kinase/ protein serine/threonine kinase||Encodes a CBL-
interacting protein kinase with similarity to SOS2
ORMDL family protein||
allergen V5/Tpx-1-related family protein||
ATCNGC10 (CYCLIC NUCLEOTIDE GATED CHANNEL 10); calmodulin
binding / cyclic nucleotide binding / ion channel||member of Cyclic
nucleotide gated channel family
PIPK11;            1-phosphatidylinositol-4-phosphate           5-kinase/
phosphatidylinositol phosphate kinase||Type I phosphatidylinositol-4-
phosphate 5-kinase, subfamily A.
ATMPK11; MAP kinase/ kinase||member of MAP Kinase
unknown protein||
acyl-CoA thioesterase family protein||
ATAF1; transcription activator/ transcription factor||Belongs to a large
family of putative transcriptional activators with NAC domain. Transcript
level increases in response to wounding and abscisic acid. ATAF1
attentuates ABA signaling and sythesis. Mutants are hyposensitive to
ABA.
armadillo/beta-catenin repeat family protein||
ATSEC1A;       FAD      binding     /     catalytic/  electron    carrier/
oxidoreductase||member of Reticuline oxidase-like family
MAGO (MAGO NASHI); protein binding||
pentatricopeptide (PPR) repeat-containing protein||
cathepsin B-like cysteine protease, putative||



CLPP5 (NUCLEAR ENCODED CLP PROTEASE 5); serine-type
endopeptidase||One of several nuclear-encoded ClpPs (caseinolytic
protease). Contains a highly conserved catalytic triad of Ser-type
proteases (Ser-His-Asp). The name reflects nomenclature described in
Adam et. al (2001).



TAF13 (TBP-ASSOCIATED FACTOR 13); DNA binding / RNA polymerase
II transcription factor||
IMPA-6 (IMPORTIN ALPHA ISOFORM 6); binding / protein
transporter||Putative importin alpha isoform. When overexpressed can
rescue the impa-4 decreased transformation susceptibility phenotype.
unknown protein||
ATCSLD5; 1,4-beta-D-xylan synthase/ cellulose synthase||Encodes a
gene similar to cellulose synthase. Knock-out mutant has reduced
growth, reduced xylan level and reduced xylan synthase activity in
stems.
PGA4 (POLYGALACTURONASE 4); polygalacturonase||encodes a
exopolygalacturonase.
unknown protein||
NLA (nitrogen limitation adaptation); ubiquitin-protein ligase||Encodes a
likely ubiquitin E3 ligase with RING and SPX domains that is involved in
mediating immune responses.
RALF1 (RAPID ALKALINIZATION FACTOR 1); signal transducer||Member
of a diversely expressed predicted peptide family showing sequence
similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed
to play an essential role in the physiology of Arabidopsis. Consists of a
single exon and is characterized by a conserved C-terminal motif and N-
terminal signal peptide.
ATGSTF4        (GLUTATHIONE       S-TRANSFERASE       F4);      glutathione
transferase||Encodes glutathione transferase belonging to the phi class
of GSTs. Naming convention according to Wagner et al. (2002).
epsin N-terminal homology (ENTH) domain-containing protein / clathrin
assembly protein-related||
ATRRP4 (ARABIDOPSIS THALIANA RIBOSOMAL RNA PROCESSING 4);
RNA binding / exonuclease||
phagocytosis and cell motility protein ELMO1-related||
ATP binding / kinase/ protein kinase/ protein serine/threonine kinase/
protein tyrosine kinase||
SWI2 (SWITCH 2); ATP binding / DNA binding / helicase/ nucleic acid
binding||
targeting protein-related||Homolog of vertebrate TPX2. Protein has
three domains involved in nuclear targeting, one in nuclear export and
two in microtubule binding. Involved in mitotic spindle assembly during
late prophase and early prometaphase.
unknown protein||
FLA9      (FASCICLIN-LIKE       ARABINOOGALACTAN           9)||fasciclin-like
arabinogalactan-protein 9 (Fla9)
cupin family protein||
acid phosphatase class B family protein||
ATMRP5; ATPase, coupled to transmembrane movement of substances /
sulfonylurea receptor||member of MRP subfamily
lesion inducing protein-related||
CKL13 (CASEIN KINASE LIKE 13); ATP binding / kinase/ protein kinase/
protein serine/threonine kinase||
60S ribosomal protein L23 (RPL23A)||
C2 domain-containing protein||
pectate lyase family protein||
ATVAMP726||member of Synaptobrevin -like protein family
high mobility group (HMG1/2) family protein / ARID/BRIGHT DNA-
binding domain-containing protein||
unknown protein||
ATSPS3F (sucrose phosphate synthase 3F); sucrose-phosphate
synthase/ transferase, transferring glycosyl groups||Encodes a protein
with putative sucrose-phosphate synthase activity.
||
unknown protein||
emb2394 (embryo defective 2394); structural constituent of ribosome||
||
RCI3 (RARE COLD INDUCIBLE GENE 3); peroxidase||Encodes a cold-
inducible cationic peroxidase that is involved in the stress response. In
response to low temperature, RCI3 transcripts accumulate in the aerial
part and in roots of etiolated seedlings but only in roots of light-grown
seedlings.
unknown protein||
photosystem II 11 kDa protein-related||
5PTASE13; inositol or phosphatidylinositol phosphatase||Encodes an
inositol polyphosphate 5-phosphatase with phosphatase activity toward
only Ins(1,4,5)P3. Induced in response to ABA and wounding
treatments. Expressed in young seedlings and flowers, while no
transcripts were detectable in maturated roots, stems, and rosette
leaves Modulates the development of cotyledon veins through its
regulation of auxin homeostasis. Involved in blue light light杝 timulated
increase in cytosolic calcium ion.
ethylene-responsive protein, putative||
RTM1 (restricted tev movement 1); sugar binding||Specifically restrict
the long-distance movement of tobacco etch potyvirus (TEV) without
involving either hypersensitive cell death or systemic acquired resistance
RABA5E (RAB GTPASE HOMOLOG A5E); GTP binding||
cell division cycle protein 48-related / CDC48-related||
DNA binding||
unknown protein||
unknown protein||
FTSH8; ATP-dependent peptidase/ ATPase/ metallopeptidase/ zinc ion
binding||encodes a FtsH protease that is localized to the chloroplast
CCR4-NOT transcription complex protein, putative||
GPAT1 (GLYCEROL-3-PHOSPHATE ACYLTRANSFERASE 1); 1-acylglycerol-
3-phosphate O-acyltransferase/ acyltransferase||Encodes a membrane
associated mitochondrial localized protein with glycerol-3-phosphate
acyltransferase activity.Expressed in flower buds and siliques.
Homozygous mutant plants are male sterile and have abnormal
glycerolipid levels.
2-oxoglutarate-dependent dioxygenase, putative||encodes a protein
whose sequence is similar to a 2-oxoglutarate-dependent dioxygenase
CRTISO (CAROTENOID ISOMERASE); carotenoid isomerase||Encodes
carotenoid isomerase. Catalyzes the isomerization of poly-cis-carotenoids
to all-trans-carotenoids. Together with PDS and ZDS, CRTiso is required
to complete the synthesis of lycopene from phytoene.
unknown protein||
binding||
PCNA1 (PROLIFERATING CELLULAR NUCLEAR ANTIGEN); DNA binding /
DNA polymerase processivity factor/ protein binding||Encodes putative
proliferating cell nuclear antigen involved in cell cycle regulation.
ATRABA2B (ARABIDOPSIS RAB GTPASE HOMOLOG A2B); GTP binding /
GTPase/ protein binding||
MT1C; copper ion binding||one of the five metallothioneins (MTs) genes
identified in Arabidopsis. MTs are cysteine-rich proteins required for
heavy metal tolerance.
leucine-rich repeat transmembrane protein kinase, putative||
bZIP family transcription factor||
endomembrane protein 70 family protein||
60S ribosomal protein L10A (RPL10aA)||
PSAO (photosystem I subunit O)||Encodes subunit O of photosystem I.
plastocyanin-like domain-containing protein||
FATB (fatty acyl-ACP thioesterases B); acyl carrier/ acyl-[acyl-carrier-
protein] hydrolase||Encodes an acyl-acyl carrier protein thioesterase.
Hydrolyzes primarily saturated acyl-ACPs with chain lengths that vary
between 8 and 18 carbons. Involved in saturated fatty acid synthesis.
Nuclear-encoded, plastid-targeted globular protein that is functional as
dimer.
CLAVATA1 receptor kinase (CLV1)||similar to CLV1-like leucine rich
repeat transmembrane receptor-like protein kinase (Ipomoea nil)
(U77888)
unknown protein||
glycosyl transferase family 29 protein / sialyltransferase family protein||
CSD1 (COPPER/ZINC SUPEROXIDE DISMUTASE 1); superoxide
dismutase||Encodes a cytosolic copper/zinc superoxide dismutase CSD1
that can detoxify superoxide radicals. Its expression is affected by
miR398-directed mRNA cleavage. Regulated by biotic and abiotic stress.
protein phosphatase 2C-related / PP2C-related||
histone H3||
transcription factor||
CRB (CHLOROPLAST RNA BINDING); binding / catalytic/ coenzyme
binding||Encodes CHLOROPLAST RNA BINDING (CRB), a putative RNA-
binding protein. CRB is important for the proper functioning of the
chloroplast. Mutations in CRB also affects the circadian system, altering
the expression of both oscillator and output genes.
GDSL-motif lipase/hydrolase family protein||
NIMIN-3 (NIM1-INTERACTING 3)||encodes a kinase that physically
interacts with NPR1/NIM1
glucan endo-1,3-beta-glucosidase-related||
cinnamyl-alcohol dehydrogenase family / CAD family||similar to
Eucalyptus gunnii alcohol dehydrogenase of unknown physiological
function (GI:1143445), Vigna unguiculata (gi:1854445), NOT a cinnamyl-
alcohol dehydrogenase
U2A' (U2 small nuclear ribonucleoprotein A); protein binding||
COBL6 (COBRA-LIKE PROTEIN 6 PRECURSOR)||
ATSK41 (SHAGGY-LIKE PROTEIN KINASE 41); ATP binding / protein
kinase/ protein serine/threonine kinase||
LRR XI-23; ATP binding / kinase/ protein kinase/ protein
serine/threonine kinase||
DNA binding / transcription factor||
ATGSTU18 (GLUTATHIONE S-TRANSFERASE TAU 18); glutathione
transferase||Encodes glutathione transferase belonging to the tau class
of GSTs. Naming convention according to Wagner et al. (2002).
ZFP5 (ZINC FINGER PROTEIN 5); nucleic acid binding / transcription
factor/ zinc ion binding||Encodes a zinc finger protein containing only a
single zinc finger.
unknown protein||
polygalacturonase||
invertase/pectin methylesterase inhibitor family protein||
MLO4 (MILDEW RESISTANCE LOCUS O 4); calmodulin binding||A
member of a large family of seven-transmembrane domain proteins
specific to plants, homologs of the barley mildew resistance locus o
(MLO) protein. The Arabidopsis genome contains 15 genes encoding
MLO proteins, with localization in plasma membrane. Phylogenetic
analysis revealed four clades of closely-related AtMLO genes. ATMLO4
belongs to the clade I, with AtMLO11 and AtMLO14. The gene is
expressed during early seedling growth, in roots and lateral root
primordia, in flower and fruit abscission zone, in vascular system of root,
cotyledons and young leaves, it was not expressed in mature rosette
leaves, as shown by GUS activity patterns. The expression of several
phylogenetically closely-related AtMLO genes showed similar or
overlapping tissue specificity and analogous responsiveness to external
stimuli, suggesting functional redundancy, co-function, or antagonistic
function(s).
S-locus protein kinase, putative||
S-locus protein kinase, putative||
plastid developmental protein DAG, putative||
PMEPCRA       (METHYLESTERASE          PCR     A);    enzyme      inhibitor/
pectinesterase||
MATE efflux family protein||
FAD binding / catalytic/ electron carrier/ oxidoreductase||
aminomethyltransferase, putative||
pyrophosphate--fructose-6-phosphate         1-phosphotransferase       beta
subunit, putative / pyrophosphate-dependent 6-phosphofructose-1-
kinase, putative||
LRX1 (LEUCINE-RICH REPEAT/EXTENSIN 1); histidine phosphotransfer
kinase/ protein binding / structural constituent of cell wall||encodes a a
chimeric leucine-rich repeat/extensin protein that regulates root hair
morphogenesis and elongation. Null mutants develop root hairs that
frequently abort, swell, or branch. Gene is expressed in root hair cells
and protein is specifically localized in the wall of the hair proper.
Rho GDP-dissociation inhibitor family protein||
ELP (EXTENSIN-LIKE PROTEIN); lipid binding||extensin-like protein
(ELP)
NRT1.1; nitrate transmembrane transporter/ transporter||Encodes
NRT1.1 (CHL1), a dual-affinity nitrate transporter. The protein is
expressed in guard cells and function in stomatal opening. Mutants have
less transpiration and are more tolerant to drought. Expressed in lateral
roots. Involved in nitrate signaling which enables the plant root system
to detect and exploit nitrate-rich soil patches. Comparing to the wild
type, the mutant displays a strongly decreased lateral root proliferation
phenotype in nitrate rich patches on growth medium.
FMO GS-OX5 (FLAVIN-MONOOXYGENASE GLUCOSINOLATE S-
OXYGENASE 5); 8-methylthiopropyl glucosinolate S-oxygenase/ flavin-
containing monooxygenase/ monooxygenase||belongs to the flavin-
monooxygenase (FMO) family, encodes a glucosinolate S-oxygenase
that catalyzes the conversion of methylthioalkyl glucosinolates to
methylsulfinylalkyl glucosinolates
calmodulin, putative||
PHR1 (PHOTOLYASE 1); DNA photolyase||encodes an amino acid
sequence with significant homology to the recently characterized type II
photolyases. The uvr2-1 mutant is unable to remove CPDs in vivo, and
plant extracts lack detectable photolyase activity , is sensitive to UV-B
and is an allele
CLP2 (CLP PROTEASE PROTEOLYTIC SUBUNIT 2); serine-type
endopeptidase||Encodes a ClpP-related sequence. Though similar to
ClpP proteins, this does not contains the highly conserved catalytic triad
of Ser-type proteases (Ser-His-Asp). The name reflects nomenclature
described in Adam et. al (2001).
ARK3 (ARMADILLO REPEAT KINESIN 3); ATP binding / binding /
microtubule motor||Encodes the kinesin-like protein PAK has an
Armadillo motif tail and is involved in guard cell development in
Arabidopsis (from Genbank record AF159052).However, no defect in
stomatal complexes has been observed in loss of function mutations.
ATEXPA7 (ARABIDOPSIS THALIANA EXPANSIN A7)||Member of Alpha-
Expansin Gene Family. Naming convention from the Expansin Working
Group (Kende et al, 2004. Plant Mol Bio). Containing a conserved root
hair-specific cis-element RHE. Expressed specifically in root hair cell.

UGE1 (UDP-D-glucose/UDP-D-galactose 4-epimerase 1); UDP-glucose 4-
epimerase/ protein dimerization||Encodes a UDP-glucose epimerase that
catalyzes the interconversion of the sugar nucleotides UDP-glucose UDP-
galactose via a UDP-4-keto-hexose intermediate. Responsive to stress.
S1 RNA-binding domain-containing protein||
atnudt12 (Arabidopsis thaliana Nudix hydrolase homolog 12);
hydrolase||
eukaryotic translation initiation factor, putative (EIF4B5)||
CYP71B2 (CYTOCHROME P450 71B2); electron carrier/ heme binding /
iron ion binding / monooxygenase/ oxygen binding||cytochrome P450
monooxygenase
CYP71B28; electron carrier/ heme binding / iron ion binding /
monooxygenase/ oxygen binding||putative cytochrome P450
CYP86C3; electron carrier/ heme binding / iron ion binding /
monooxygenase/ oxygen binding||member of CYP86C
zinc finger (C3HC4-type RING finger) family protein||
F-box family protein||
GATL3 (Galacturonosyltransferase-like 3); polygalacturonate 4-alpha-
galacturonosyltransferase/ transferase, transferring glycosyl groups /
transferase, transferring hexosyl groups||Encodes a protein with
putative galacturonosyltransferase activity.
MAP1C (METHIONINE AMINOPEPTIDASE 1B); aminopeptidase/
metalloexopeptidase||Encodes a methionine aminopeptidase formerly
called MAP1B, renamed to MAP1C.
AOC4 (ALLENE OXIDE CYCLASE 4); allene-oxide cyclase||Encodes allene
oxide cyclase. One of four genes in Arabidopsis that encode this
enzyme, which catalyzes an essential step in jasmonic acid biosynthesis.
Gene expression is reduced during senescence, a process that involves
jasmonic acid signalling pathway.
PP2AA3 (PROTEIN PHOSPHATASE 2A SUBUNIT A3); binding / protein
phosphatase type 2A regulator||one of three genes encoding the 65 kDa
regulatory subunit of protein phosphatase 2A (PP2A)
LAG13 (LAG1 LONGEVITY ASSURANCE HOMOLOG 3)||
ATE1; nucleic acid binding / nucleotide binding||AtE1 - stimulates the
ATPase activity of DnaK/DnaJ
AFP2 (ABI FIVE BINDING PROTEIN 2)||Encodes a member of a small
plant-specific gene family whose members interact with ABI5 and
appear to be involved in mediating stress responses. AFP2 mutants
affect a number of ABA mediated processes such as germination and
response to osmotic and sugar stress. AFP2 nuclear localization is stress
dependent.
SNAP30 (SOLUBLE N-ETHYLMALEIMIDE-SENSITIVE FACTOR ADAPTOR
PROTEIN 30); SNAP receptor||Encodes a member of a gene family
homologous to mammalian SNAP25, a type of SNARE proteins with two
chains. There are three members in Arabidopsis: SNAP30, SNAP29, and
SNAP33.
unknown protein||
ribulose-1,5 bisphosphate carboxylase oxygenase large subunit N-
methyltransferase, putative||
FUT6 (FUCOSYLTRANSFERASE 6); fucosyltransferase/ transferase,
transferring glycosyl groups||member of Xyloglucan fucosyltransferase
family
2-oxoglutarate-dependent dioxygenase, putative||
oxygen evolving enhancer 3 (PsbQ) family protein||
ribonuclease T2 family protein||
SBH2 (SPHINGOID BASE HYDROXYLASE 2); catalytic/ sphingosine
hydroxylase||Encodes one of the two redundant sphingoid base
hydroxylases (SBH). Involved in sphingolipid trihydroxy long-chain base
(4-hydroxysphinganine) biosynthesis. Double mutants of SBHs were
dwarfed and not able to progress from vegetative to reproductive
growth.
kelch repeat-containing F-box family protein||
oxidoreductase||
IQD28 (IQ67 DOMAIN PROTEIN 28); calmodulin binding||
UBC1     (UBIQUITIN        CARRIER     PROTEIN      1);  ubiquitin-protein
ligase||ubiquitin carrier protein
WHY1 (WHIRLY 1); DNA binding / telomeric DNA binding||Encodes a
homolog of the potato p24 protein. Binds single strand telomeric
repeats. Negatively regulates telomerase activity and telomere length.
AT59; lyase/ pectate lyase||
mitochondrial substrate carrier family protein||
XTR2     (XYLOGLUCAN         ENDOTRANSGLYCOSYLASE         RELATED 2);
hydrolase, acting on glycosyl bonds / xyloglucan:xyloglucosyl
transferase||member of Glycoside Hydrolase Family 16
||
ATMAP70-4 (microtubule-associated proteins 70-4); microtubule
binding||Encodes a microtubule associated protein (MAP70-4).
Expressed in all tissues.
NUP155; nucleocytoplasmic transporter||Encodes a protein similar to
nucleoporin, a a major component of the nuclear pore complex (NPC)
involved in cellular nucleo-cytoplasmic transport
major latex protein-related / MLP-related||
major latex protein-related / MLP-related||
major latex protein-related / MLP-related||
protein-protein interaction regulator family protein||
PDR7 (PLEIOTROPIC DRUG RESISTANCE 7); ATPase, coupled to
transmembrane movement of substances||
binding||
CBS domain-containing protein||
DNA binding||
unknown protein||
CENP-C (CENTROMERE PROTEIN C)||Encodes a homologue of the
human centromeric protein C (CENP-C). CENP-C co-localizes with the
180 bp centromeric regions of chromosomes throughout the cell cycle,
but does not completely cover the 180 bp regions.
ATPC2; enzyme regulator||One of two genes that encode the gamma
subunit of Arabidopsis chloroplast ATP synthase. It is thought to be
involved in the regulation of the ATP synthase activity.
prephenate dehydrogenase family protein||
LHCB6 (LIGHT HARVESTING COMPLEX PSII SUBUNIT 6); chlorophyll
binding||Lhcb6 protein (Lhcb6), light harvesting complex of photosystem
II.
binding||
CCR1      (CINNAMOYL         COA    REDUCTASE        1);   cinnamoyl-CoA
reductase||Encodes a cinnamoyl CoA reductase. Involved in lignin
biosynthesis.
NDF1 (NDH-DEPENDENT CYCLIC ELECTRON FLOW 1)||encodes a novel
subunit of the chloroplast NAD(P)H dehydrogenase complex, involved in
cyclic electron flow around photosystem I to produce ATP.
Hsp70b (heat shock protein 70B); ATP binding||
protein phosphatase 2C family protein / PP2C family protein||
DEAD/DEAH box helicase, putative||
inosine-5'-monophosphate dehydrogenase, putative||
OCT6 (ORGANIC CATION/CARNITINE TRANSPORTER 6); carbohydrate
transmembrane transporter/ sugar:hydrogen symporter||
unknown protein||
DNAJ heat shock N-terminal domain-containing protein / S-locus protein,
putative||
vacuolar-type H+-translocating inorganic pyrophosphatase, putative||
ribosomal protein-related||
unknown protein||
uridylyltransferase-related||
SHA (SH2 DOMAIN PROTEIN A); protein binding / signal transducer/
transcription factor||Encodes a protein that contains an SH2 domain. It
can pull down a 120-kD tyrosine-phosphorylated protein in vitro. It is
predicted to act as a transcription factor.
UBP15 (UBIQUITIN-SPECIFIC PROTEASE 15); ubiquitin-specific
protease||Encodes a ubiquitin-specific protease, and its activity has been
confirmed in an in vitro assay. ubp15 mutants have defects in cell
proliferation, and the associated processes of leaf, root, stem, flower,
and silique development. UBP15 can be found in the nucleus and
cytoplasm in transient assays. Though UBP15 is expressed in many
tissues, UBP15 transcript levels are higher in rosette leaves and
inflorescences than in other parts of the plant.
tropomyosin-related||
phosphoinositide phosphatase family protein||
auxin-induced-related / indole-3-acetic acid induced-related||
UBP1B (oligouridylate binding protein 1B); mRNA 3'-UTR binding||
JAZ5 (JASMONATE-ZIM-DOMAIN PROTEIN 5)||
ATPase, coupled to transmembrane movement of ions, phosphorylative
mechanism||
HLL (HUELLENLOS); structural constituent of ribosome||Mutant shows
abnormal ovule development
MYA1 (MYOSIN 1); motor/ protein binding||Encodes a member of the
type XI myosin protein family involved in organelle trafficking and overall
plant development.
||
GLYR2 (GLYOXYLATE REDUCTASE 2); glyoxylate reductase (NADP)/
phosphogluconate        dehydrogenase        (decarboxylating)||Glyoxylate
reductase located in chloroplasts.
transcription factor-related||
PGDH (3-PHOSPHOGLYCERATE DEHYDROGENASE); phosphoglycerate
dehydrogenase||encodes a 3-Phosphoglycerate dehydrogenase
CSTF77; protein binding||Encodes a homolog of the mammalian protein
CstF77, a polyadenylation factor subunit.
BETA-TIP      (BETA-TONOPLAST         INTRINSIC      PROTEIN);    water
channel||beta-tonoplast intrinsic protein (beta-TIP) mRNA, complete
GER2; binding / catalytic/ coenzyme binding||
SWAP (Suppressor-of-White-APricot)/surp domain-containing protein||
oxidoreductase, acting on the CH-CH group of donors||
calcium-binding protein, putative||
ATLP-1||encodes a thaumatin-like protein
ketose-bisphosphate aldolase class-II family protein||
protease inhibitor/seed storage/lipid transfer protein (LTP) family
protein||
HIK (HINKEL); ATP binding / microtubule motor||Mutant has cytokinesis
defects; seedling lethal
MYB51 (MYB DOMAIN PROTEIN 51); DNA binding / transcription
factor||Encodes a member of the R2R3-MYB transcription family.
Involved in indole glucosinolate biosynthesis.
SOT17 (SULFOTRANSFERASE 17); desulfoglucosinolate sulfotransferase/
sulfotransferase||encodes a desulfoglucosinolate sulfotransferase,
involved in the final step of glucosinolate core structure biosynthesis.
Has a broad-substrate specificity with preference with methionine-
derived desulfoglucosinolates.
PSP       (3-PHOSPHOSERINE            PHOSPHATASE);       phosphoserine
phosphatase||Encodes a 3-phosphoserine phosphatase acting in the last
step of serine biosynthesis within the chloroplast.
PDCB3 (PLASMODESMATA CALLOSE-BINDING PROTEIN 3); callose
binding / polysaccharide binding||Encodes a member of the X8-GPI
family of proteins. It localizes to the plasmodesmata and is predicted to
bind callose.
NDF6 (NDH DEPENDENT FLOW 6)||likely a subunit of the chloroplast
NAD(P)H dehydrogenase complex, involved in PSI cyclic electron
transport. Located on the thylakoid membrane. Mutant has impaired
NAD(P)H dehydrogenase activity.
protein binding / zinc ion binding||
ARR7 (RESPONSE REGULATOR 7); transcription regulator/ two-
component response regulator||Encodes a member of the Arabidopsis
response regulator (ARR) family, most closely related to ARR15. A two-
component response regulator protein containing a phosphate accepting
domain in the receiver domain but lacking a DNA binding domain in the
output domain. Involved in response to cytokinin and meristem stem cell
maintenance. Arr7 protein is stabilized by cytokinin.
inter-alpha-trypsin inhibitor heavy chain-related||
LHCA6; chlorophyll binding||PSI type II chlorophyll a/b-binding protein
(Lhca2*1) mRNA,
ARF19 (AUXIN RESPONSE FACTOR 19); DNA binding / transcription
factor||Encodes an auxin response factor that contains the conserved
VP1-B3 DNA-binding domain at its N-terminus and the Aux/IAA-like
domains III and IV present in most ARFs at its C-terminus. The protein
interacts with IAA1 (yeast two hybrid) and other auxin response
elements such as ER7 and ER9 (yeast one hybrid). ARF19 protein can
complement many aspects of the arf7 mutant phenotype and , together
with ARF7, is involved in the response to ethylene. In the arf7 arf19
double mutant, several auxin-responsive genes (e.g. IAA5, LBD16,
LBD29 and LBD33) are no longer upregulated by auxin.
PARVUS            (PARVUS);           polygalacturonate          4-alpha-
galacturonosyltransferase/ transferase, transferring glycosyl groups /
transferase, transferring hexosyl groups||The PARVUS/GLZ1 gene
encodes a putative family 8 glycosyl transferase that contributes to xylan
biosynthesis. Its gene expression shows good co-variance with the IRX3
gene involved in secondary cell wall synthesis. PARVUS/GLZ1 is
predicted to have galacturonosyltransferase activity and may be involved
in the formation of the complex oligosaccharide sequence present at the
reducing end of xylan. PARVUS is expressed in cells undergoing
secondary wall thickening, and parvus mutants have thinner cell walls.
unknown protein||
unknown protein||
||
isoflavone reductase, putative||
GAMMA CA1 (GAMMA CARBONIC ANHYDRASE 1); carbonate
dehydratase||Encodes mitochondrial gamma carbonic anhydrase.
Component of the NADH dehydrogenase complex.
ATCNGC8 (CYCLIC NUCLEOTIDE GATED CHANNEL 8); calmodulin
binding / cyclic nucleotide binding / ion channel||member of Cyclic
nucleotide gated channel family
MP (MONOPTEROS); transcription factor||Encodes a transcription factor
(IAA24) mediating embryo axis formation and vascular development.
Similar to AUXIN RESPONSIVE FACTOR 1 (ARF1) shown to bind to auxin
responsive elements (AREs), and to the maize transcriptional activator
VIVIPAROUS 1( VP1). In situ hybridization shows expression in
provascular tissue of embryos, the emerging shoot primordia, then is
restricted to provascular tissue, and in the root central vascular cylinder.
AtGH9B5 (Arabidopsis thaliana Glycosyl Hydrolase 9B5); catalytic/
hydrolase, hydrolyzing O-glycosyl compounds||
TUB5; structural constituent of cytoskeleton||beta tubulin
HYD1 (HYDRA1); C-8 sterol isomerase||C-8 sterol isomerase
ATSBT5.2; identical protein binding / serine-type endopeptidase||
ATEXPA11 (ARABIDOPSIS THALIANA EXPANSIN 11)||member of Alpha-
Expansin Gene Family. Naming convention from the Expansin Working
Group (Kende et al, 2004. Plant Mol Bio)
COR47 (COLD-REGULATED 47)||Belongs to the dehydrin protein family,
which contains highly conserved stretches of 7-17 residues that are
repetitively scattered in their sequences, the K-, S-, Y- and lysine rich
segments. Cold regulated gene, amino acid sequence homology with
Group II LEA (late embryogenesis abundant) proteins. Also responds to
osmotic stress, ABA, dehydration and inhibits e.coli growth while
overexpressed. COR47 and RAB18 double overexpressor plants are cold
tolerant.
ERD10 (EARLY RESPONSIVE TO DEHYDRATION 10); actin
binding||Encodes a gene induced by low temperature and dehydration.
Inhibits e.coli growth while overexpressed. Belongs to the dehydrin
protein family, which contains highly conserved stretches of 7-17
residues that are repetitively scattered in their sequences, the K-, S-, Y-
and lysine rich segments. LTI29 and LTI30 double overexpressors confer
cold tolerance. Localized to membranes and cytoplasm.
small nuclear ribonucleoprotein, putative / snRNP, putative / Sm protein,
putative||
ATP binding / protein kinase/ protein serine/threonine kinase||
XCP2 (xylem cysteine peptidase 2); cysteine-type peptidase/ peptidase||
ESC (ESCAROLA); double-stranded DNA binding||Encodes an AT hook
domain containing protein that acts redundantly with SOB3 to modulate
hypocotyl growth inhibition in response to light.
emb1507 (embryo defective 1507); ATP binding / ATP-dependent
helicase/ helicase/ nucleic acid binding / nucleoside-triphosphatase/
nucleotide binding||
unknown protein||
hydroxyproline-rich glycoprotein family protein||
WAK1 (CELL WALL-ASSOCIATED KINASE); kinase||cell wall-associated
kinase, may function as a signaling receptor of extracellular matrix
component.
VHS domain-containing protein / GAT domain-containing protein||
exostosin family protein||
unknown protein||
sks7 (SKU5 Similar 7); copper ion binding / oxidoreductase||
LYM1 (LYSM DOMAIN GPI-ANCHORED PROTEIN 1 PRECURSOR)||
ATPIP5K1 (PHOSPHATIDYLINOSITOL-4-PHOSPHATE 5-KINASE 1); 1-
phosphatidylinositol-4-phosphate 5-kinase/ actin filament binding / actin
monomer binding / phosphatidylinositol phosphate kinase||Type I
phosphatidylinositol-4-phosphate 5-kinase. Preferentially phosphorylates
PtdIns4P. Induced by water stress and abscisic acid in Arabidopsis
thaliana. Expressed in procambial cells of leaves, flowers and roots. A N-
terminal Membrane Occupation and Recognition Nexus (MORN)affects
enzyme activity and distribution.
kelch repeat-containing F-box family protein||
MUB6       (MEMBRANE-ANCHORED           UBIQUITIN-FOLD         PROTEIN     6
PRECURSOR)||
RNA binding / nucleic acid binding / nucleotide binding||
||
alcohol dehydrogenase, putative||
COX6B (CYTOCHROME C OXIDASE 6B); cytochrome-c oxidase||subunit
6b of cytochrome c oxidase
unknown protein||
plastocyanin-like domain-containing protein||
||
unknown protein||
protease-associated zinc finger (C3HC4-type RING finger) family
protein||
SUC2        (SUCROSE-PROTON          SYMPORTER         2);      carbohydrate
transmembrane transporter/ sucrose transmembrane transporter/
sucrose:hydrogen symporter/ sugar:hydrogen symporter||Encodes for a
high-affinity transporter essential for phloem loading and long-distance
transport. A major sucrose transporter, AtSUC2 can also transport a
wide range of physiological and synthetic glucose conjugates with both
α- or β-linkage.
PAB3 (POLY(A) BINDING PROTEIN 3); RNA binding / translation
initiation factor||Putative poly(A) binding protein May there fore function
in posttranscriptional regulation, including mRNA turnover and
translational initiation. Expression detected only in floral organs.
PFL (POINTED FIRST LEAVES); RNA binding / nucleic acid binding /
structural constituent of ribosome||S18 ribosomal protein involved in the
binding of f-Met tRNA during initiation of mRNA translation. Expression
restricted to meristems. Mutant phenotype-pointed first leaves,reduced
fresh weight, growth retardation.
armadillo/beta-catenin repeat family protein / U-box domain-containing
protein||
hydroxyproline-rich glycoprotein family protein||
unknown protein||
AST91 (SULFATE TRANSPORTER 91); sulfate transmembrane
transporter||Encodes AST91 mRNA for sulfate transporter.
10 kDa chaperonin, putative||
C2 domain-containing protein||
invertase/pectin methylesterase inhibitor family protein||
invertase/pectin methylesterase inhibitor family protein||
ubiquitin extension protein, putative / 40S ribosomal protein S27A
(RPS27aA)||
ATCSLA03 (CELLULOSE SYNTHASE-LIKE A3); cellulose synthase/
transferase, transferring glycosyl groups||encodes a gene similar to
cellulose synthase
SRO2       (SIMILAR      TO      RCD     ONE       2);     NAD+     ADP-
ribosyltransferase||Encodes a protein with similarity to RCD1 but without
the WWE domain. The protein does have a PARP signature upstream of
the C-terminal protein interaction domain. The PARP signature may bind
NAD+ and attach the ADP-ribose-moiety from NAD+ to the target
molecule. Its presence suggests a role for the protein in ADP
ribosylation.
DNA-binding protein-related||
unknown protein||
ALDH2B7;       3-chloroallyl    aldehyde    dehydrogenase/      aldehyde
dehydrogenase       (NAD)||Encodes       a     mitochondrial    aldehyde
dehydrogenase; nuclear gene for mitochondrial product.
SPDS1 (spermidine synthase 1); spermidine synthase||Spermidine
synthase.
unknown protein||
NHL repeat-containing protein||
RNase H domain-containing protein||
LGT9; polygalacturonate 4-alpha-galacturonosyltransferase/ transferase,
transferring glycosyl groups / transferase, transferring hexosyl
groups||Encodes a protein with putative galacturonosyltransferase
activity.
3-oxoacyl-(acyl-carrier protein) reductase, chloroplast / 3-ketoacyl-acyl
carrier protein reductase||
LHT2 (LYSINE HISTIDINE TRANSPORTER 2); acidic amino acid
transmembrane transporter/ amino acid transmembrane transporter/
neutral amino acid transmembrane transporter||High-affinity transporter
for neutral and acidic amino acids, expressed in tapetum tissue of
anthers
transferase/ transferase, transferring acyl groups other than amino-acyl
groups||
protein binding / zinc ion binding||
BCP1||Male fertility gene acting on tapetum and microspore
O-methyltransferase||
purple acid phosphatase family protein||
epsin N-terminal homology (ENTH) domain-containing protein / clathrin
assembly protein-related||
acidic ribosomal protein P0-related||
OVA9 (ovule abortion 9); glutamine-tRNA ligase||
mitochondrial substrate carrier family protein||
RCN1 (ROOTS CURL IN NPA); protein phosphatase type 2A
regulator||One of three genes encoding phosphoprotein phosphatase 2A
regulatory subunit A; Recessive ethylene-response mutant EER1
displays increased ethylene sensitivity in the hypocotyl and stem
myb family transcription factor||
cytochrome B561 family protein||
chaperonin, putative||
ATUPS5 (ARABIDOPSIS THALIANA UREIDE PERMEASE 5); allantoin
uptake transmembrane transporter/ uracil transmembrane transporter/
xanthine transmembrane transporter||uptake assays in a yeast mutant
indicated this splice variant is not a cellular importer for allantoin, uracil
or xanthine
beta-1,3-glucanase-related||
GRF12 (GENERAL REGULATORY FACTOR 12); protein binding / protein
phosphorylated amino acid binding||14-3-3 protein GF14iota (grf12)
UGD1 (UDP-GLUCOSE DEHYDROGENASE 1); NAD or NADH binding /
UDP-glucose 6-dehydrogenase/ binding / catalytic/ coenzyme binding /
oxidoreductase/ oxidoreductase, acting on the CH-OH group of donors,
NAD or NADP as acceptor||
ATEXPA10 (ARABIDOPSIS THALIANA EXPANSIN A 10); structural
constituent of cell wall||Encodes an expansin. Naming convention from
the Expansin Working Group (Kende et al, Plant Mol Bio). Involved in
the formation of nematode-induced syncytia in roots of Arabidopsis
thaliana.
RNS3 (RIBONUCLEASE 3); RNA binding / endoribonuclease/
ribonuclease T2||Encodes ribonuclease RNS3.
galactosyltransferase family protein||
unknown protein||
unknown protein||
60S ribosomal protein L17 (RPL17A)||
unknown protein||
unknown protein||
NTF2B (NUCLEAR TRANSPORT FACTOR 2B); Ran GTPase binding /
protein transporter||Encodes an ortholog of yeast NTF2, a nuclear
envelop transport protein that functions as the nuclear import receptor
for RanGDP, an essential player in nucleocytoplasmic transport.
unknown protein||
unknown protein||
polynucleotide adenylyltransferase family protein||
ethylene-responsive element-binding family protein||encodes a member
of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2
transcription factor family. The protein contains one AP2 domain. There
are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7,
and leafy petiole.
RALFL4 (ralf-like 4); signal transducer||Member of a diversely expressed
predicted peptide family showing sequence similarity to tobacco Rapid
Alkalinization Factor (RALF), and is believed to play an essential role in
the physiology of Arabidopsis. Consists of a single exon and is
characterized by a conserved C-terminal motif and N-terminal signal
peptide.
AGP31        (arabinogalactan-protein    31)||Encodes     an      atypical
arabinogalactan protein that is localized to the plasma membrange.
AGP31 is highly expressed in flowers and vascular tissue and is
repressed by jasmonic acid. AGP31 may play a role in vascular tissue
function during defense and development.
unknown protein||
VOZ1 (VASCULAR PLANT ONE ZINC FINGER PROTEIN); transcription
activator||
unknown protein||
GDSL-motif lipase, putative||
unknown protein||
unknown protein||
pollen Ole e 1 allergen and extensin family protein||
ATS9 (ARABIDOPSIS NON-ATPASE SUBUNIT 9)||specifically interacts
with FUS6/COP11 via the C-terminal domain of FUS6/COP11 and
associates with an ATPase subunit of the 19S proteasome regulatory
complex, AtS6A.
nucleic acid binding||
WRKY65; transcription factor||member of WRKY Transcription Factor;
Group II-e
ERD2 (ENDOPLASMIC RETICULUM RETENTION DEFECTIVE 2); KDEL
sequence binding / receptor||Encodes a protein similar in sequence to
animal and yeast endoplasmic reticulum retention signal receptor. This
protein can functionally complement the yeast homologue. Transcript is
detected in flower buds, stems, root, and leaves.
COR414-TM1||encodes a protein similar to the cold acclimation protein
WCOR413 in wheat. Expression is induced by short-term cold-treatment,
water deprivation, and abscisic acid treatment. Possibly targeted to
thylakoid membrane.
GDSL-motif lipase/hydrolase family protein||
unknown protein||
RPL18AA (60S RIBOSOMAL PROTEIN L18A-1); structural constituent of
ribosome||
||
ATNUDX25 (ARABIDOPSIS THALIANA NUDIX HYDROLASE HOMOLOG
25); bis(5'-nucleosyl)-tetraphosphatase (asymmetrical)||
ERD4 (early-responsive to dehydration 4)||
phototropic-responsive NPH3 family protein||
CPSF30; RNA binding / calmodulin binding / endonuclease/ nucleic acid
binding / protein binding||Encodes AtCPSF30, the 30-KDa subunit of
cleavage and polyadenylation specificity factor. AtCPSF30 is a probable
processing endonuclease. Nucleus-localized RNA binding protein
capable of interacting with itself and with calmodulin. Its RNA-binding
activity is inhibited by calmodulin in a calcium-dependent fashion.
NF-YA7 (NUCLEAR FACTOR Y, SUBUNIT A7); specific transcriptional
repressor/ transcription factor||
ATRFNR2 (ROOT FNR 2); FAD binding / NADP or NADPH binding /
electron carrier/ ferredoxin-NADP+ reductase/ oxidoreductase||Encodes
a root-type ferredoxin:NADP(H) oxidoreductase.
UGT78D1        (UDP-GLUCOSYL         TRANSFERASE       78D1);      UDP-
glycosyltransferase/ quercetin 3-O-glucosyltransferase/ transferase,
transferring glycosyl groups||The At1g30530 gene encodes a UDP-
rhamnose:flavonol-3-O-rhamnosyltransferase (UGT78D1) attaching a
rhamnosyl residue to the 3-O-position of the flavonols kaempferol and
quercetin
unknown protein||
FAD-binding domain-containing protein||
DIS2 (DISTORTED TRICHOMES 2); structural molecule||Involved in
trichome maturation. mutant displays enlarged trichomes
cationic peroxidase, putative||
KUP10;     potassium     ion    transmembrane    transporter||potassium
transporter
PSAF (photosystem I subunit F)||Encodes subunit F of photosystem I.
unknown protein||
GDSL-motif lipase, putative||
ECS1||Encodes cell wall protein. ECS1 is not a Xcc750 resistance gene,
but the genetic data indicate that ECS1 is linked to a locus influencing
resistance to Xcc750.
proline-rich family protein||
amino acid permease family protein||
amino acid permease family protein||
STRS1 (STRESS RESPONSE SUPPRESSOR 1); ATP binding / ATP-
dependent helicase/ helicase/ nucleic acid binding||
PRK (PHOSPHORIBULOKINASE); ATP binding / phosphoribulokinase/
protein binding||
ATNSI          (NUCLEAR          SHUTTLE        INTERACTING);            N-
acetyltransferase||Encodes a nuclear acetyltransferase (NSI)that
interacts with the geminivirus movement protein NSP. This interaction is
required for viral infection and systemic spread. Acetylates the viral coat
protein (CP) in vitro, but not NSP. NSP inhibits NSI activity in vitro. NSI
is highly transcribed in phloem and in xylem parenchyma cells, and in
the apical meristem and guard cells, within young tissues in Arabidopsis,
and its expression is turned off as tissues mature.
membrane protein, putative||
PRR1 (PINORESINOL REDUCTASE 1); pinoresinol reductase||Encodes a
pinoresinol reductase involved in lignan biosynthesis. Expressed strongly
in roots and less strongly in stems. Shows specificity for pinoresinol and
not lariciresinol.
unknown protein||
NHL8; protein binding / zinc ion binding||Encodes a protein whose
sequence is similar to tobacco hairpin-induced gene (HIN1) and
Arabidopsis non-race specific disease resistance gene (NDR1).
Expression is not detected under normal conditions and in response to
cucumber mosaic virus or spermine.
zinc finger (C3HC4-type RING finger) family protein||
galactosyltransferase family protein||
O-methyltransferase family 2 protein||
MATE efflux family protein||
SAR1 (suppressor of auxin resistance1)||
galactosyltransferase family protein||
disease resistance protein-related / LRR protein-related||
catalytic/ glucosylceramidase||
unknown protein||
SAMC2 (S-adenosylmethionine carrier 2); binding||
unknown protein||
STOP1 (sensitive to proton rhizotoxicity 1); nucleic acid binding /
transcription factor/ zinc ion binding||Encodes a putative nuclear
Cys(2)His(2)-type zinc finger protein involved in H+ and Al3+
rhizotoxicity. In mutants exposed to aluminum stress, there is no
induction of AtALMT1, an malate transporter known to be involved in
the mediation of aluminum toxicity.
unknown protein||
protein phosphatase 2C, putative / PP2C, putative||
MAGE-8 antigen-related||
PHI-1 (PHOSPHATE-INDUCED 1)||At1g35140 (At1g35140/T32G9_32)
mRNA, complete cds
oxidoreductase, 2OG-Fe(II) oxygenase family protein||
ATP-dependent protease La (LON) domain-containing protein||
bZIP family transcription factor||
CINV1 (cytosolic invertase 1); beta-fructofuranosidase||Encodes a
protein with cytosolic (alkaline/neutral) invertase activity. The protein
was shown to interact with PIP5K9.
ATPDIL5-2 (PDI-LIKE 5-2); protein disulfide isomerase||Encodes a
protein disulfide isomerase-like (PDIL) protein, a member of a multigene
family within the thioredoxin (TRX) superfamily. Unlike several other PDI
family members, transcript levels for this gene are not up-regulated in
response to three different chemical inducers of ER stress (dithiothreitol,
beta-mercaptoethanol, and tunicamycin). However, the level of
transcripts for this gene is slightly elevated in atbzip60 mutants.
50S ribosomal protein L21, chloroplast / CL21 (RPL21)||
unknown protein||
||
||
unknown protein||
Aty2 (Arabidopsis thioredoxin y2); electron carrier/ protein disulfide
oxidoreductase||
unknown protein||
TED6 (TRACHEARY ELEMENT DIFFERENTIATION-RELATED 6)||
ATGA20OX5 (ARABIDOPSIS THALIANA GIBBERELLIN 20-OXIDASE 5);
gibberellin 20-oxidase||Encodes a gibberellin 20-oxidase.
CYCA1;1 (Cyclin A1;1); cyclin-dependent protein kinase regulator||
ALDH3H1 (ALDEHYDE DEHYDROGENASE 3H1); 3-chloroallyl aldehyde
dehydrogenase/ aldehyde dehydrogenase (NAD)||Encodes a protein
similar to the aldehyde dehydrogenase cp-ADH from C.plantagineum.
Constitutively expressed at low levels.
NPQ4 (NONPHOTOCHEMICAL QUENCHING); chlorophyll binding /
xanthophyll binding||Encoding PSII-S (CP22), a ubiquitous pigment-
binding protein associated with photosystem II (PSII) of higher plants.
Involved in nonphotochemical quenching rather than in photosynthesis.
Mutant has a normal violaxanthin cycle but has a limited capacity of
quenching singlet excited chlorophylls and is tolerant to lipid
peroxidation.
ATPUP11; purine transmembrane transporter||Member of a family of
proteins related to PUP1, a purine transporter. May be involved in the
transport of purine and purine derivatives such as cytokinins, across the
plasma membrane.
nodulin MtN21 family protein||
BGAL5 (beta-galactosidase 5); beta-galactosidase/ catalytic/ cation
binding||
cyclin family protein||
AtTLP6 (TUBBY LIKE PROTEIN 6); phosphoric diester hydrolase/
transcription factor||Member of TLP family
unknown protein||
Toll-Interleukin-Resistance (TIR) domain-containing protein||
unknown protein||
unknown protein||
||
unknown protein||
ATGA2OX4 (ARABIDOPSIS THALIANA GIBBERELLIN 2-OXIDASE 4);
gibberellin 2-beta-dioxygenase||Encodes a gibberellin 2-oxidase.
AtGA2OX4 expression is responsive to cytokinin and KNOX activities.
KU80; double-stranded DNA binding / protein binding||Ku80 and ku70
form the heterodimer complex Ku, required for proper maintenance of
the telomeric C strand. Ku regulates the extension of the telomeric G
strand. Interacts with WEX, and this interaction stimulates the WEX
exonuclease activity. Binds double stranded DNA breaks as a
heterodimer with Ku70, involved in non-homologous end joining repair.
Mutants are defective in T-DNA integration. Over expression confers
increased resistance to DNA damage agents and increased susceptibility
to T-DNA transformation.
glycoside hydrolase family 28 protein / polygalacturonase (pectinase)
family protein||
phosphate translocator-related||
ATNPSN12; protein transporter||member of NPSN Gene Family
unknown protein||
helicase domain-containing protein||
AtGH9C1 (Arabidopsis thaliana glycosyl hydrolase 9C1); catalytic/
hydrolase, hydrolyzing O-glycosyl compounds||
ACT8 (ACTIN 8); copper ion binding / structural constituent of
cytoskeleton||Member of a subclass of actins composed of ACT2 and
ACT8. Its mRNA is strongly expressed in strongly expressed in leaves,
roots, stems, flowers, pollen, and siliques. However, protein expression,
assayed by a ACT8:GUS fusion reporter, is very low in pollen.
unknown protein||
RABG3E (RAB GTPASE HOMOLOG G3E); GTP binding||encodes a small
GTPase involved in membrane trafficking. Gene expression is induced by
hydrogen peroxide and lines. Lines overexpressing the gene are more
tolerant to high salt and hyperosmotic conditions.
oxidoreductase, 2OG-Fe(II) oxygenase family protein||
emb1129 (embryo defective 1129); structural constituent of ribosome||
leucine-rich repeat family protein / extensin family protein||
calcium-dependent protein kinase, putative / CDPK, putative||
AtCXE5         (Arabidopsis       thaliana         carboxyesterase   5);
carboxylesterase||Encodes a protein with carboxylesterase whose
activity was tested using pNA.
NQR; binding / catalytic/ oxidoreductase/ zinc ion binding||molecular
function has not been defined. Was shown involved in oxidative stress
tolerance.
protein kinase family protein||
leucine-rich repeat family protein||
ATMTK (ARABIDOPSIS THALIANA S-METHYL-5-THIORIBOSE KINASE); S-
methyl-5-thioribose kinase||encodes 5-methylthioribose kinase, involved
in methionine cycle
CLPR1; serine-type endopeptidase||Encodes a ClpP-related sequence.
Though similar to ClpP proteins, this does not contains the highly
conserved catalytic triad of Ser-type proteases (Ser-His-Asp). The name
reflects nomenclature described in Adam et. al (2001).
TUA2; structural constituent of cytoskeleton||Encodes alpha-2,4 tubulin.
TUA2 and TUA4 encode identical proteins.
branched-chain amino acid aminotransferase 6 / branched-chain amino
acid transaminase 6 (BCAT6)||
ATHX; enzyme activator||encodes a prokaryotic thioredoxin
CYP705A27; electron carrier/ heme binding / iron ion binding /
monooxygenase/ oxygen binding||member of CYP705A
C2 domain-containing protein||
unknown protein||
POLGAMMA2 (polymerase gamma 2); DNA binding / DNA-directed DNA
polymerase||DNA Polymerase gamma2. Dual targeting to mitochondria
and plastids due to alternative translation initiation.
HTA10; DNA binding||Encodes HTA10, a histone H2A protein.
LPAT3; 1-acylglycerol-3-phosphate O-acyltransferase||ACYL-COA:1-
ACYLGLYCEROL-3-PHOSPHATE ACYLTRANSFERASE, PUTATIVE SIMILAR
TO ACYL-COA:1-ACYLGLYCEROL-3-PHOSPHATE ACYLTRANSFERASE
GI:4583544 FROM [BRASSICA NAPUS]
C2 domain-containing protein||
4CL1 (4-COUMARATE:COA LIGASE 1); 4-coumarate-CoA ligase||encodes
an isoform of 4-coumarate:CoA ligase (4CL), which is involved in the last
step of the general phenylpropanoid pathway. In addition to 4-
coumarate, it also converts ferulate. The catalytic efficiency was in the
following (descending) order: p-coumaric acid, ferulic acid, caffeic acid
and 5-OH-ferulic acid. At4CL1 was unable to use sinapic acid as
substrate.
ATB ALPHA; nucleotide binding / protein phosphatase type 2A
regulator||55 kDa B regulatory subunit of phosphatase 2A mRNA,
leucine-rich repeat protein kinase, putative||
protein kinase family protein / peptidoglycan-binding LysM domain-
containing protein||
AR791; actin binding||unknown function
||
PSAH2 (PHOTOSYSTEM I SUBUNIT H2)||
unknown protein||
ATRBL5 (ARABIDOPSIS RHOMBOID-LIKE PROTEIN 5)||
||
2-oxoglutarate-dependent dioxygenase-related||
NAM (NO APICAL MERISTEM); transcription factor||Transcription factor
with a NAC domain. Homologous to the petunia gene NAM which is
required for the development of the shoot. Expressed in the embryo.
unknown protein||
cytidylyltransferase family||
chalcone-flavanone isomerase-related||
MAP3KA; ATP binding / kinase/ protein kinase/ protein serine/threonine
kinase||MEK kinase (MAP3Ka)
SRF6 (STRUBBELIG-RECEPTOR FAMILY 6); ATP binding / protein
binding / protein kinase/ protein serine/threonine kinase/ protein
tyrosine kinase||
unknown protein||
unknown protein||
endonuclease||
transposable element gene||
dormancy/auxin associated protein-related||
ALDH7B4 (Aldehyde Dehydrogenase 7B4); 3-chloroallyl aldehyde
dehydrogenase/ oxidoreductase||Aldehyde dehydrogenase
dihydrolipoamide S-acetyltransferase, putative||
haloacid dehalogenase-like hydrolase family protein||
LEM3 (ligand-effect modulator 3) family protein / CDC50 family protein||
NHX5; sodium ion       transmembrane     transporter/ sodium:hydrogen
antiporter||
XRN4 (EXORIBONUCLEASE 4); 5'-3' exonuclease/ 5'-3' exoribonuclease/
nucleic acid binding||Involved in the ethylene response. XRN4 does not
appear to regulate ethylene signaling via an RNA-INDUCED SILENCING
COMPLEX-based RNA silencing mechanism but acts by independent
means. Endogenous suppressor of posttranscriptional gene silencing.
protein kinase family protein||
||
thylakoid lumen 18.3 kDa protein||
NF-YC3 (NUCLEAR FACTOR Y, SUBUNIT C3); DNA binding / transcription
factor||
unknown protein||
LOX1; lipoxygenase||lipoxygenase, a defense gene conferring resistance
Xanthomonas campestris
ATFRUCT5 (BETA-FRUCTOFURANOSIDASE 5); hydrolase, hydrolyzing O-
glycosyl compounds / levanase||Encodes a protein with fructan
exohydrolase (FEH) activity acting on levan-type fructans (6-FEH,
levanase). The enzyme does not have invertase activity.
endomembrane protein 70, putative||
PRA7||
lipid binding||
unknown protein||
CPN60B (CHAPERONIN 60 BETA); ATP binding / protein
binding||encodes the beta subunit of the chloroplast chaperonin 60, a
homologue of bacterial GroEL. Mutants in this gene develops lesions on
its leaves, expresses systemic acquired resistance (SAR) and develops
accelerated cell death to heat shock stress. The protein has molecular
chaperone activity for suppressing protein aggregation in vitro.
zinc finger (C3HC4-type RING finger) family protein||
sks14 (SKU5 Similar 14); copper ion binding / oxidoreductase||
sks12 (SKU5 Similar 12); copper ion binding / oxidoreductase||
LAS (Lateral Suppressor); transcription factor||Encodes a member of the
GRAS family of putative transcriptional regulators. It is involved in the
initiation of axillary meristems during both the vegetative and
reproductive growth phases and functions upstream of REV and AXR1 in
the regulation of shoot branching.
AtSIP1 (Arabidopsis thaliana seed imbibition 1); hydrolase, hydrolyzing
O-glycosyl compounds||
BolA-like family protein||
ATCSLE1; cellulose synthase/ transferase, transferring glycosyl
groups||encodes a protein similar to cellulose synthase
TIM50||component of a translocase in the mitochondrial inner
membrane
NOP56 (Arabidopsis homolog of nucleolar protein Nop56)||NOP56-like
protein
3'-5' exonuclease domain-containing protein||
unknown protein||
CRT1 (CALRETICULIN 1); calcium ion binding / unfolded protein
binding||Encodes calreticulin CRT1.
unknown protein||
pyrrolidone-carboxylate peptidase family protein||
carbonic anhydrase family protein / carbonate dehydratase family
protein||
AtRLP9 (Receptor Like Protein 9); protein binding||
MSL3 (MscS-LIKE 3); ion channel||A member of MscS-like gene family,
structurally very similar to MSL2, comprising of an N-terminal chloroplast
transit peptide, five trans-membrane helices and a C-terminal
cytoplasmic domain. Mutant plants showed abnormalities in the size and
shape of plastids. MSL3-GFP was localized to discrete foci on the plastid
envelope and co-localize with the plastid division protein AtMinE. MSL3
was capable of increasing the osmotic-shock survival of a mutant
bacterial strain lacking MS-ion-channel activity.
ATRBP1 (ARABIDOPSIS THALIANA RNA-BINDING PROTEIN 1); RNA
binding / single-stranded RNA binding||encodes an RNA-binding protein
binding||
PEN3 (PENETRATION 3); ATPase, coupled to transmembrane movement
of substances / cadmium ion transmembrane transporter||ATP binding
cassette transporter. Localized to the plasma membrane in uninfected
cells. In infected leaves, the protein concentrated at infection sites.
Contributes to nonhost resistance to inappropriate pathogens that enter
by direct penetration in a salicylic acid杁ependent manner. Required for
mlo resistance. Has Cd transporter activity (Cd2+ extrusion pump) and
contributes to heavy metal resistance.
SNL5 (SIN3-LIKE 5)||
aldo/keto reductase, putative||
matrixin family protein||
CB5LP (CYTOCHROME B5-LIKE PROTEIN); heme binding||member of
Cytochromes b5
ACLA-2; ATP citrate synthase||One of the three genes encoding subunit
A of the trimeric enzyme ATP Citrate lyase
SNRK2.10 (SNF1-RELATED PROTEIN KINASE 2.10); kinase||encodes a
member of SNF1-related protein kinases (SnRK2) whose activity is
activated by ionic (salt) and non-ionic (mannitol) osmotic stress.
CPSF73-I (CLEAVAGE AND POLYADENYLATION SPECIFICITY FACTOR 73-
I); protein binding||
unknown protein||
S-locus lectin protein kinase family protein||
unknown protein||
PPR336 (pentatricopeptide repeat 336)||
mitochondrial transcription termination factor-related / mTERF-related||
||
APR2 (5'ADENYLYLPHOSPHOSULFATE REDUCTASE 2); adenylyl-sulfate
reductase/ phosphoadenylyl-sulfate reductase (thioredoxin)||encodes a
adenosine 5'-phosphosulfate reductase, involved in sulfate assimilation.
Is a major effect locus for natural variation of shoot sulfate content in
Arabidopsis.
MIF4G domain-containing protein||
vacuolar calcium-binding protein-related||
invertase/pectin methylesterase inhibitor family protein||
protease inhibitor/seed storage/lipid transfer protein (LTP) family
protein||
copper amine oxidase, putative||
unknown protein||
ACOS5 (ACYL-COA SYNTHETASE 5); 4-coumarate-CoA ligase/ long-chain-
fatty-acid-CoA ligase/ medium-chain-fatty-acid-CoA ligase||encodes an
acyl-CoA synthetase, has in vitro activity towards medium- to long-chain
fatty acids and their hydroxylated derivatives. Expressed in the tapetum.
Involved in pollen wall exine formation. Null mutants were devoid of
pollen grains at anther maturity and were completely male sterile.
ACS10 (ACC SYNTHASE 10); 1-aminocyclopropane-1-carboxylate
synthase/ L-aspartate:2-oxoglutarate aminotransferase/ aromatic-amino-
acid:2-oxoglutarate aminotransferase||Encodes an aminotransferase
with broad specificity for aspartate and aromatic amino aids such as
tyrosine and phenylalanine. It does not act on branched chain amino
acids and does not have ACC synthase activity.
KNAT7 (KNOTTED-LIKE HOMEOBOX OF ARABIDOPSIS THALIANA 7);
DNA binding / transcription activator/ transcription factor||Encodes a
homeodomain transcription factor of the Knotted family. May be involved
in secondary cell wall biosynthesis. Mutants have moderately irregular
xylem development. Expression of this gene is upregulated by SND1
and MYB46.
membrane bound O-acyl transferase (MBOAT) family protein||
unknown protein||
cell division cycle protein-related||
ATRBL2 (Arabidopsis thaliana Rhomboid-like 2); serine-type
endopeptidase||AtRBL2 has been identified as a rhomboid protein
involved in regulated intramembrane proteolysis (RIP). The enzyme has
the proteolytic activity and substrate specificity comparable to the
Drosophila Rho-1 protein.
UGE3 (UDP-D-glucose/UDP-D-galactose 4-epimerase 3); UDP-glucose 4-
epimerase/ protein dimerization||Encodes a protein with UDP-D-glucose
4-epimerase activity. Involved in pollen development.
ribulose-phosphate 3-epimerase, cytosolic, putative / pentose-5-
phosphate 3-epimerase, putative||
||
peptidase M1 family protein||
lactoylglutathione lyase family protein / glyoxalase I family protein||
VHA-E3 (VACUOLAR H+-ATPASE SUBUNIT E ISOFORM 3); proton-
transporting ATPase, rotational mechanism||
protein kinase family protein||
proline-rich family protein||
ATGCN3; transporter||member of GCN subfamily
||
plastocyanin-like domain-containing protein||
||
ATMGL (ARABIDOPSIS THALIANA METHIONINE GAMMA-LYASE);
catalytic/ methionine gamma-lyase||Encodes a functional methionine
gamma-lyase, a cytosolic enzyme catalyzes the degradation of
methionine into methanethiol, alpha-ketobutyrate and ammonia. The
catabolism of excess methionine is important to methionine
homeostasis.
BDG1 (BODYGUARD1); hydrolase||Encodes a epidermally expressed
extracellular protein that likely functions as an alpha-beta hydrolase and
is required for normal cuticle formation. Homozygous mutant plants are
dwarfed and have abnormal leaves, collapsed cells, reduced numbers of
trichomes. The specific role of BDG is unclear: it may function in cutin
biosynthesis or as a cross-linking enzyme in the cell wall itself.

APO1 (ACCUMULATION OF PHOTOSYSTEM ONE 1)||chloroplast APO1
4CL3; 4-coumarate-CoA ligase||encodes an isoform of 4-coumarate:CoA
ligase (4CL), which is involved in the last step of the general
phenylpropanoid pathway. mRNA levels are not induced in response to
wounding or to fungal infection by P. parasitica. mRNA is expressed in
flowers, to a lesser degree in mature leaves and siliques and marginally
in seedling roots and bolting stems of mature plants. The catalytic
efficiency was in the following (descending) order: p-coumaric acid,
caffeic acid, ferulic acid, cinnamic acid and 5-OH-ferulic acid. At4CL3
was unable to use sinapic acid as substrate.
unknown protein||
aspartyl protease family protein||
XTH17 (XYLOGLUCAN ENDOTRANSGLUCOSYLASE/HYDROLASE 17);
hydrolase, acting on glycosyl bonds / hydrolase, hydrolyzing O-glycosyl
compounds / xyloglucan:xyloglucosyl transferase||putative xyloglucan
endotransglycosylase/hydrolase, expressed in the mature or basal
regions of both the main and lateral roots, but not in the tip of these
roots where cell division occurs.
CLV2 (clavata 2); protein binding / receptor signaling protein||Receptor-
like protein containing leucine-rich repeats. Regulates both meristem
and organ development in Arabidopsis.
KOR2; catalytic/ hydrolase, hydrolyzing O-glycosyl compounds||
small nuclear ribonucleoprotein, putative / snRNP, putative / Sm protein,
putative||
ATPAO4 (ARABIDOPSIS THALIANA POLYAMINE OXIDASE 4); amine
oxidase/ polyamine oxidase||encodes a peroxisomal polyamine oxidase,
involved in the back-conversion polyamine degradation pathway. Among
the five polyamine oxidases in the Arabidopsis genome, PAO4 is the
major isoform in root peroxisomes.
TMK1 (TRANSMEMBRANE KINASE 1); transmembrane receptor protein
serine/threonine kinase||receptor-like transmembrane kinase I (TMK1)
aspartyl protease family protein||
ATGSR2; copper ion binding / glutamate-ammonia ligase||encodes a
cytosolic glutamate synthetase, this enzyme has low affinity with
substrate ammonium
subtilase family protein||
glycosyl hydrolase family 17 protein||
pfkB-type carbohydrate kinase family protein||
seven in absentia (SINA) protein, putative||
CLPP3; serine-type endopeptidase||One of several nuclear-encoded
ClpPs (caseinolytic protease). Contains a highly conserved catalytic triad
of Ser-type proteases (Ser-His-Asp). The name reflects nomenclature
described in Adam et. al (2001).
protein    kinase    family   protein    /   glycerophosphoryl    diester
phosphodiesterase family protein||
unknown protein||
LINC1 (LITTLE NUCLEI1)||Encodes a nuclear coiled-coil protein related
to the carrot peripheral nuclear protein NMCP1 that is involved in the
determination of plant nuclear structure.
transposable element gene||
lactoylglutathione lyase, putative / glyoxalase I, putative||
glyoxal oxidase-related||
unknown protein||
protein kinase family protein||
ATREV3 (ARABIDOPSIS THALIANA RECOVERY PROTEIN 3); DNA
binding / DNA-directed DNA polymerase||Encodes the catalytic subunit
of DNA polymerase zeta.Mutants are sensitive to UV-B radiation. Gene is
involved in damage-tolerance mechanisms through translesion
synthesis(TLS).
remorin family protein||
metalloendopeptidase||
YBR159; ketoreductase/ oxidoreductase||Encodes one of the two
Arabidopsis homologues to YBR159w encoding a S. cerevisiae beta-
ketoacyl reductase (KCR), which catalyzes the first reduction during
VLCFA (very long chain fatty acids, >18 carbon) elongation: KCR1
(At1g67730), KCR2 (At1g24470). Complementation of the yeast
ybr159Delta mutant demonstrated that the two KCR proteins are
divergent and that only AtKCR1 can restore heterologous elongase
activity similar to the native yeast KCR gene.
unknown protein||
unknown protein||
TSM1;           N1,N5,N10-tris-(5-hydroxyferuloyl)spermidine            O-
methyltransferase/      caffeoyl    CoA:S-adenosyl-L-methionine         O-
methyltransferase/    caffeoyl-CoA    O-methyltransferase/      tricaffeoyl
spermidine:S-adenosyl-L-methionine                 O-methyltransferase/
trihydroxyferuloyl    sper||Encodes       a     tapetum-specific        O-
methyltransferase. In vitro enzyme assay indicated activity with caffeoyl-
CoA, caffeoyl glucose, chlorogenic acid and polyamine conjugates. RNAi
mutants had impaired silique development and seed setting.

iron ion binding / oxidoreductase, acting on paired donors, with
incorporation or reduction of molecular oxygen, 2-oxoglutarate as one
donor, and incorporation of one atom each of oxygen into both donors||
ANN5; calcium ion binding / calcium-dependent phospholipid
binding||Encodes a calcium-binding protein annexin (AnnAt5).
epsin N-terminal homology (ENTH) domain-containing protein / clathrin
assembly protein-related||
||
unknown protein||
thioesterase family protein||
zinc finger protein-related||
zinc finger (B-box type) family protein||
plastid-specific 30S ribosomal protein 3, putative / PSRP-3, putative||
unknown protein||
unknown protein||
RAV2 (REGULATOR OF THE ATPASE OF THE VACUOLAR MEMBRANE);
DNA binding / transcription factor/ transcription repressor||Rav2 is part
of a complex that has been named `regulator of the (H+)-ATPase of the
vacuolar and endosomal membranes' (RAVE)
peroxidase, putative||
PDCB4 (PLASMODESMATA CALLOSE-BINDING PROTEIN 4); callose
binding / polysaccharide binding||Encodes a member of the X8-GPI
family of proteins. It localizes to the plasmodesmata and is predicted to
bind callose.
ATMINE1 (Arabidopsis homologue of bacterial MinE 1); protein
binding||Encodes an Arabidopsis homologue of the bacterial MinE
topological specificity factor ensuring correct division site placement. It
is an essential integral component of the plastid division machinery.
unknown protein||
ATEXPA1 (ARABIDOPSIS THALIANA EXPANSIN A1)||Member of Alpha-
Expansin Gene Family. Naming convention from the Expansin Working
Group (Kende et al, Plant Mol Bio). Involved in the formation of
nematode-induced syncytia in roots of Arabidopsis thaliana.
transcription factor||
ATHVA22C||Part of the AtHVA22 family. Protein expression is ABA- and
stress-inducible.
HEMB1;       catalytic/   metal  ion   binding     /    porphobilinogen
synthase||Encodes a putative 5-aminolevulinate dehydratase involved in
chlorophyll biosynthesis.
protein kinase, putative||
ATNRT1:2 (ARABIDOPSIS THALIANA NITRATE TRANSPORTER 1:2);
calcium ion binding / transporter||Encodes an inducible component of
low-affinity nitrate uptake. mRNA found primarily in root hairs and the
epidermis of roots.
unknown protein||
ATFH8 (formin 8); actin binding / actin filament binding / profilin
binding||Encodes a group I formin. Binds to F-actin barbed ends. Has
severing actin filaments activity. Binds profilin. Involved in the initiation
and tip growth of root hairs through regulation of actin cytoskeleton.
ribosomal protein L12 family protein||
unknown protein||
EDA24 (embryo sac development arrest 24); enzyme inhibitor/
pectinesterase/ pectinesterase inhibitor||
MMZ2 (MMS ZWEI HOMOLOGE 2); protein binding / ubiquitin-protein
ligase||MMZ2/UEV1B encodes a protein that may play a role in DNA
damage responses and error-free post-replicative DNA repair by
participating in lysine-63-based polyubiquitination reactions. UEV1A can
form diubiquitin and triubiquitin chains in combination with
UBC13A/UBC35 in vitro. It can also functionally complement an mms2
mutation in budding yeast, both by increasing mms2 mutant viability in
the presence of the DNA damaging agent MMS, and by reducing the rate
of spontaneous DNA mutation. However, a combination of MMZ2/UEV1B
and UBC13A do not do a good job of rescuing an mms2 ubc13 double
mutant in yeast. MMZ2/UEV1B transcripts are found in most plant
organs, but not in the pollen or in seedlings 6 hours or 2 days post-
germination. The transcript levels do not appear to be stress-inducible.
ATGH9B1 (ARABIDOPSIS THALIANA GLYCOSYL HYDROLASE 9B1);
cellulase/ hydrolase, hydrolyzing O-glycosyl compounds||endo-1,4-beta-
glucanase. Involved in cell elongation.
unknown protein||
C2 domain-containing protein||
phosphoglucomutase, putative / glucose phosphomutase, putative||
MLP28 (MLP-LIKE PROTEIN 28)||
proline-rich family protein||
LPR2 (Low Phosphate Root2); copper ion binding / oxidoreductase||
DNA binding / transcription factor||
nuclear transport factor 2 (NTF2) family protein||
peroxidase 12 (PER12) (P12) (PRXR6)||
S1 RNA-binding domain-containing protein||
PAB5 (POLY(A)-BINDING PROTEIN 5); RNA binding / poly(A) binding /
translation initiation factor||Encodes a Class I polyA-binding protein.
Expressed in floral organs. Binds polyA sepharose in vitro.
unknown protein||
F-actin capping protein beta subunit family protein||
ABC transporter family protein||
unknown protein||
zinc finger (C3HC4-type RING finger) family protein||
oxidoreductase family protein||
plastocyanin-like domain-containing protein||
leucine-rich repeat transmembrane protein kinase, putative||Encodes a
leucine-rich repeat receptor kinase (LRR-RK) involved in the perception
of PSY1. PSY1 is an 18-aa tyrosine-sulfated glycopeptide encoded by
AT5G58650 that promotes cellular proliferation and expansion.
leucine-rich repeat transmembrane protein kinase, putative||
tRNA synthetase beta subunit family protein||
cinnamyl-alcohol dehydrogenase, putative||
haloacid dehalogenase-like hydrolase family protein||
eukaryotic translation initiation factor 4A, putative / eIF-4A, putative||
threonine synthase, putative||
disease resistance protein (TIR-NBS class), putative||
BGAL17 (beta-galactosidase 17); beta-galactosidase/ catalytic/ cation
binding||
BNS (BONSAI)||The BONSAI gene encodes a protein with similarity to
the APC13 component of the Anaphase Promoting Complex. Plants with
lowered level of BONSAI expression, resulting from hypomethylation,
RNAi knock-down, or a T-DNA insertion show some abnormalities in
shoot and inflorescence development.
AtOCT1      (Arabidopsis      thaliana    ORGANIC       CATION/CARNITINE
TRANSPORTER1); carbohydrate transmembrane transporter/ carnitine
transporter/ transporter||
electron carrier/ heme binding / iron ion binding / monooxygenase/
oxygen binding||
atnudt21 (Arabidopsis thaliana Nudix hydrolase homolog 21);
hydrolase||
PIN1 (PIN-FORMED 1); transporter||Encodes an auxin efflux carrier
involved in shoot and root development. It is involved in the
maintenance of embryonic auxin gradients. Loss of function severely
affects organ initiation, pin1 mutants are characterised by an
inflorescence meristem that does not initiate any flowers, resulting in
the formation of a naked inflorescence stem. PIN1 is involved in the
determination of leaf shape by actively promoting development of leaf
margin serrations. In roots, the protein mainly resides at the basal end
of the vascular cells, but weak signals can be detected in the epidermis
and the cortex. Expression levels and polarity of this auxin efflux carrier
change during primordium development suggesting that cycles of auxin
build-up and depletion accompany, and may direct, different stages of
primordium development. PIN1 action on plant development does not
strictly require function of PGP1 and PGP19 proteins.
AtRABA6a (Arabidopsis Rab GTPase homolog A6a); GTP binding||
unknown protein||
strictosidine synthase family protein||
SS2 (STRICTOSIDINE SYNTHASE 2); strictosidine synthase||Encodes
AtSS-2 strictosidine synthase.
enolase, putative||
SOT18 (DESULFO-GLUCOSINOLATE SULFOTRANSFERASE 18); 3-
methylthiopropyl-desulfoglucosinolate            sulfotransferase/          4-
methylthiobutyl-desulfoglucosinolate            sulfotransferase/           5-
methylthiopentyl-desulfoglucosinolate            sulfotransferase/          7-
methylthioheptyl-desulfogluco||encodes          a        desulfoglucosinolate
sulfotransferase, involved in the final step of glucosinolate core structure
biosynthesis. Has a broad-substrate specificity with preference with
methionine-derived desulfoglucosinolates.
PUR4     (purine     biosynthesis    4);    ATP     binding     /   catalytic/
phosphoribosylformylglycinamidine                         synthase||Encodes
formylglycinamidine ribonucleotide synthase an enzyme involved in de
novo purine biosynthesis. PUR4 is localizes to the chloroplast and
mitochondria. Loss of PUR4 function affects male but not female
gametophyte development.
zinc finger (C3HC4-type RING finger) family protein||
geranylgeranyl reductase||Encodes for a multifunctional protein with
geranylgeranyl reductase activity shown to catalyze the reduction of
prenylated geranylgeranyl-chlorophyll a to phytyl-chlorophyll a
(chlorophyll a) and free geranylgeranyl pyrophosphate to phytyl
pyrophosphate.
ATHVA22A||Part of the AtHVA22a family. Protein expression is ABA- and
stress-inducible.
unknown protein||
MIF1 (MINI ZINC FINGER 1); DNA binding / transcription
factor||Constitutive overexpression of MIF1 caused dramatic
developmental defects, seedlings were non-responsive to gibberellin
(GA) for cell elongation, hypersensitive to the GA synthesis inhibitor
paclobutrazol (PAC) and abscisic acid (ABA), and hyposensitive to
auxin, brassinosteroid and cytokinin, but normally responsive to
ethylene.
IQD31 (IQ-domain 31); calmodulin binding||
unknown protein||
RPS9 (RIBOSOMAL PROTEIN S9); structural constituent of
ribosome||ribosomal protein S9, nuclear encoded component of the
chloroplast ribosome
AtHB33 (ARABIDOPSIS THALIANA HOMEOBOX PROTEIN 33); DNA
binding / transcription factor||
isoflavone reductase, putative||isoflavone reductase, putative, identical
to SP:P52577 Isoflavone reductase homolog P3 (EC 1.3.1.-)
{Arabidopsis thaliana}; contains Pfam profile PF02716: isoflavone
reductase. Involved in response to oxidative stress.
nodulin MtN21 family protein||
AtGH9B7 (Arabidopsis thaliana glycosyl hydrolase 9B7); catalytic/
hydrolase, hydrolyzing O-glycosyl compounds||
chaperone protein dnaJ-related||
TUB1; GTP binding / GTPase/ structural molecule||beta tubulin gene
downregulated by phytochrome A (phyA)-mediated far-red light high-
irradiance and the phytochrome B (phyB)-mediated red light high-
irradiance responses
CLV1 (CLAVATA 1); ATP binding / kinase/ protein serine/threonine
kinase/ receptor signaling protein serine/threonine kinase||Putative
receptor kinase with an extracellular leucine-rich domain. Controls shoot
and floral meristem size, and contributes to establish and maintain floral
meristem identity. Negatively regulated by KAPP (kinase-associated
protein phosphatase). CLV3 peptide binds directly CLV1 ectodomain.
unknown protein||
EXL6; acyltransferase/ carboxylesterase/ lipase||member of Lipase
proteins
||
CDSP32 (CHLOROPLASTIC DROUGHT-INDUCED STRESS PROTEIN OF
32 KD)||Encodes a thioredoxin localized in chloroplast stroma. Known
as CDSP32 (CHLOROPLASTIC DROUGHT-INDUCED STRESS PROTEIN OF
32 KD).
transducin family protein / WD-40 repeat family protein||
unknown protein||
protein kinase, putative||
protein kinase, putative||
oxygen-evolving complex-related||
CDKB2;1 (cyclin-dependent kinase B2;1); cyclin-dependent protein
kinase/ kinase/ protein binding||Encodes a cyclin-dependent protein
kinase involved in regulation of the G2/M transition of the mitotic cell
cycle. Specifically binds to the cyclin CYCD4;1, expressed in shoot
meristem, young leaves and vascular tissue during the G2/M phase.
Required for proper organization of the shoot apical meristem and for
hormone signaling.
pyrophosphate--fructose-6-phosphate      1-phosphotransferase      alpha
subunit, putative / pyrophosphate-dependent 6-phosphofructose-1-
kinase, putative||
CP12-3||
ATY1 (ARABIDOPSIS THIOREDOXIN Y1); electron carrier/ protein
disulfide oxidoreductase||Encodes a y-type thioredoxin (Trx-y1) localized
in chloroplast stroma.
O-methyltransferase family 2 protein||
GT2; transcription factor||encodes a plant trihelix DNA-binding protein
ADH1         (ALCOHOL          DEHYDROGENASE            1);    alcohol
dehydrogenase||Catalyzes the reduction of acetaldehyde using NADH as
reductant. Requires zinc for activity. Dimer. Anaerobic response
polypeptide (ANP). Fermentation. The protein undergoes thiolation
following treatment with the oxidant tert-butylhydroperoxide.
PGSIP2 (PLANT GLYCOGENIN-LIKE STARCH INITIATION PROTEIN 2);
transferase, transferring glycosyl groups||
unknown protein||
dehydration-responsive protein-related||
1-aminocyclopropane-1-carboxylate oxidase, putative / ACC oxidase,
putative||similar    to    1-aminocyclopropane-1-carboxylate  oxidase
GI:3386565 from (Sorghum bicolor)
myosin heavy chain-related||
peptidoglycan-binding LysM domain-containing protein||
LAX3 (LIKE AUX1 3); amino acid transmembrane transporter/ auxin
influx transmembrane transporter/ transporter||Encodes an auxin influx
carrier LAX3 (Like Aux1) that promotes lateral root emergence. Auxin-
induced expression of LAX3 in turn induces a selection of cell-wall-
remodelling enzymes, which are likely to promote cell separation in
advance of developing lateral root primordia.
30S ribosomal protein S13, chloroplast, putative||
KOM (KOMPEITO)||mutant has Altered morphology of pollen exine wall;
Seven-Path Transmembrane Protein
AGL67 (AGAMOUS-LIKE 67); transcription factor||
AGL66 (AGAMOUS-LIKE 66); transcription factor||Encodes a member of
the MIKC (MADS box, Keratin binding domain, and C terminal domain
containing )family of transcriptional regulators. AGL66 is expressed in
pollen.It forms heterodimers with other MICK family members (AGL104).
Involved in late stages of pollen development and pollen tube growth.
ATTPPB     (TREHALOSE-6-PHOSPHATE           PHOSPHATASE);   trehalose-
phosphatase||homologous to the C-terminal part of microbial trehalose-
6-phosphate phosphatases
methyltransferase-related||
unknown protein||
hydrolase, alpha/beta fold family protein||
VQ motif-containing protein||
SOUL heme-binding family protein||
CYP708A3; electron carrier/ heme binding / iron ion binding /
monooxygenase/ oxygen binding||member of CYP708A
oxidoreductase, 2OG-Fe(II) oxygenase family protein||
RHM1 (RHAMNOSE BIOSYNTHESIS 1); UDP-L-rhamnose synthase/ UDP-
glucose 4,6-dehydratase/ catalytic||Encodes a UDP-L-Rhamnose
synthase involved in the biosynthesis of rhamnose, a major
monosaccharide component of pectin. Catalyzes the conversion of UDP-
D-Glc to UDP-L-Rha. The dehydrogenase domain of RHM1 was shown
to catalyze the conversion of UDP-D-Glc to the reaction intermediate
UDP-4-keto-6-deoxy-D-Glc using recombinant protein assay but the
activity of the full-length protein was not determined as it could not be
expressed in <i>E. coli</i>.
LZF1 (LIGHT-REGULATED ZINC FINGER PROTEIN 1); transcription
factor/ zinc ion binding||
ATGGH3 (gamma-glutamyl hydrolase 3); catalytic/ hydrolase/ omega
peptidase||
unknown protein||
pentatricopeptide (PPR) repeat-containing protein||
AtMC4 (metacaspase 4); cysteine-type peptidase||
EMB1135 (embryo defective 1135); DNA binding / protein binding / zinc
ion binding||
unknown protein||
2-dehydro-3-deoxyphosphooctonate aldolase / phospho-2-dehydro-3-
deoxyoctonate aldolase / 3-deoxy-D-manno-octulosonic acid 8-
phosphate synthetase (KDSA)||Encodes a protein with 3-deoxy-8-
phosphooctulonate synthase (KDOP synthase) activity which is involved
in the biosynthesis of KDO, a component of cell wall
rhamnogalacturonan II.
ELF7 (EARLY FLOWERING 7)||Encodes a PAF1 homolog that is involved
in the control of flowering time by elevating FLC expression to a level
that creates the vernalization-responsive, winter-annual habit. Yeast
PAF1 is a component of a five-member complex that associates with
RNA pol II and is thought to regulate gene expression by recruiting SET1
(a histone 3 Lys 4 [H3-K4] methyl transferase) to the initially transcribed
[5'] regions of target chromatin. Mutants display reduced H3-K4
methylation in both FLC and FLM chromatin.
SGB1 (SUPPRESSOR OF G PROTEIN BETA1); carbohydrate
transmembrane transporter/ sugar:hydrogen symporter||
helicase-related||
SUS2 (ABNORMAL SUSPENSOR 2)||a genetic locus involved in
embryogenesis. Mutations in this locus result in an abnormal suspensor
and embryo lethality.
CBS domain-containing protein||
glycoside hydrolase family 28 protein / polygalacturonase (pectinase)
family protein||
polygalacturonase, putative / pectinase, putative||
unknown protein||
hydrolase, alpha/beta fold family protein||
F-box family protein (FBL14)||
unknown protein||
PDE318 (pigment defective 318); GTP binding||
CCR2        (CINNAMOYL         COA        REDUCTASE);      cinnamoyl-CoA
reductase||Encodes an cinnamoyl CoA reductase isoform. Involved in
lignin biosynthesis.
ORC4 (ORIGIN RECOGNITION COMPLEX SUBUNIT 4); protein
binding||Origin Recognition Complex subunit 4. Involved in the initiation
of DNA replication. Regulated transcriptionally during cell cycle, peaking
at G1/S-phase. Target of E2F/DF family of transcription factors.
Interacts with all ORC subunits except ORC1b.
unknown protein||
phytanoyl-CoA dioxygenase (PhyH) family protein||
C2 domain-containing protein||
epsin N-terminal homology (ENTH) domain-containing protein||
atnudt17 (Arabidopsis thaliana Nudix hydrolase homolog 17);
hydrolase||
ribophorin I family protein||
EXGT-A3; hydrolase, acting on glycosyl bonds / xyloglucan:xyloglucosyl
transferase||EXGT-A3          has        homology       to      xyloglucan
endotransglucosylases/hydrolases (XTHs). Mutants in this gene show a
lesion mimic phenotype associated with leaf maturation and a reduction
in the number of tertiary veins. Individual tracheary elements in the
mutants are shorter, but phloem transport activity is not severely
affected. EXGT-A3 plays a role in xyloglucan degradation in the
differentiating tracheary elements of rosette leaves.
PAP8 (PURPLE ACID PHOSPHATASE 8); acid phosphatase/ protein
serine/threonine phosphatase||Encodes a purple acid phosphatase (PAP)
belonging to the low molecular weight plant PAP group.
AtIDD5 (Arabidopsis thaliana Indeterminate(ID)-Domain 5); nucleic acid
binding / transcription factor/ zinc ion binding||
PDF2.1; peptidase inhibitor||Predicted to encode a PR (pathogenesis-
related) protein. Belongs to the plant defensin (PDF) family with the
following      members:       At1g75830/PDF1.1,       At5g44420/PDF1.2a,
At2g26020/PDF1.2b,          At5g44430/PDF1.2c,         At2g26010/PDF1.3,
At1g19610/PDF1.4,           At1g55010/PDF1.5,          At2g02120/PDF2.1,
At2g02100/PDF2.2,           At2g02130/PDF2.3,          At1g61070/PDF2.4,
At5g63660/PDF2.5,        At2g02140/PDF2.6,       At5g38330/PDF3.1      and
At4g30070/PDF3.2.
LCR72 (LOW-MOLECULAR-WEIGHT CYSTEINE-RICH 72); peptidase
inhibitor||Predicted to encode a PR (pathogenesis-related) protein.
Belongs to the plant defensin (PDF) family with the following members:
At1g75830/PDF1.1,        At5g44420/PDF1.2a,        At2g26020/PDF1.2b,
At5g44430/PDF1.2c,         At2g26010/PDF1.3,        At1g19610/PDF1.4,
At1g55010/PDF1.5,         At2g02120/PDF2.1,         At2g02100/PDF2.2,
At2g02130/PDF2.3,         At1g61070/PDF2.4,         At5g63660/PDF2.5,
At2g02140/PDF2.6, At5g38330/PDF3.1 and At4g30070/PDF3.2.
zinc finger (CCCH-type) family protein||
DC1 domain-containing protein||
pectate lyase family protein||
ATUBC2 (UBIQUITING-CONJUGATING ENZYME 2); ubiquitin-protein
ligase||ubiquitin conjugating enzyme UBC2. Homolog of the yeast RAD6
gene.
leucine-rich repeat transmembrane protein kinase, putative||
ARPN (PLANTACYANIN); copper ion binding / electron carrier||Encodes
plantacyanin one of blue copper proteins. Involved in anther
development and pollination. Expressed in the transmitting tract of the
pistil.
kelch repeat-containing F-box family protein||
unknown protein||
ATEXPA15 (ARABIDOPSIS THALIANA EXPANSIN A15)||member of Alpha-
Expansin Gene Family. Naming convention from the Expansin Working
Group (Kende et al, 2004. Plant Mol Bio). Involved in the formation of
nematode-induced syncytia in roots of Arabidopsis thaliana.
aspartyl protease family protein||
FT1 (FUCOSYLTRANSFERASE 1); fucosyltransferase/ transferase,
transferring glycosyl groups||member of Glycosyltransferase Family- 37
DNA-binding protein, putative||
unknown protein||
unknown protein||
band 7 family protein||
SEP4 (SEPALLATA 4); DNA binding / transcription factor||This gene
belongs to the family of SEP genes. It is involved in the development of
sepals, petals, stamens and carpels. Additionally, it plays a central role
in the determination of flower meristem and organ identity.
CR88; ATP binding||Encodes a chloroplast-targeted 90-kDa heat shock
protein located in the stroma involved in red-light mediated deetiolation
response. Mutants are resistant to chlorate, have elongated hypocotyls
in light, and affect the expression of NR2, CAB, and RBCS but NOT NR1
and NiR.
3-oxoacyl-(acyl-carrier-protein) synthase II, putative||
ferredoxin thioredoxin reductase catalytic beta chain family protein||
FLA7      (FASCICLIN-LIKE      ARABINOOGALACTAN           7)||fasciclin-like
arabinogalactan-protein 7 (Fla7)
GCN5-related N-acetyltransferase (GNAT) family protein||
auxin-responsive protein-related||
SCL21 (SCARECROW-LIKE 21); transcription factor||Encodes a
scarecrow-like protein (SCL21). Member of GRAS gene family.
GRP3S (GLYCINE-RICH PROTEIN 3 SHORT ISOFORM)||glycine-rich
protein 3 short isoform (GRP3S) mRNA, complete
glycine-rich protein||
unknown protein||
autophagy 8d (APG8d)||in the Arabidopsis autophagy pathway
glycosyl hydrolase family 17 protein||
scpl38 (serine carboxypeptidase-like 38); serine-type carboxypeptidase||
subtilase family protein||
unknown protein||Encodes one of the FRI interacting proteins: FRIGIDA
INTERACTING PROTEIN 1 (FIP1)/At2g06005, FIP2/ At4g17060. FRI
(At4G00650) is a major determinant of natural variation in Arabidopsis
flowering time.
transposable element gene||
PSBX (photosystem II subunit X)||Encodes a protein with sequence
similarity to the spinach photosystem II subunit PsbX.
transposable element gene||
EXGT-A1 (ENDOXYLOGLUCAN TRANSFERASE); hydrolase, acting on
glycosyl bonds / xyloglucan:xyloglucosyl transferase||endoxyloglucan
transferase (EXGT-A1) gene
PLA2-ALPHA; phospholipase A2||Encodes a secretory phospholipase A2
enzyme, which specifically hydrolyzes the sn-2 position of phospholipids.
The enzyme has a preference towards linoleoyl acyl chain over palmitoyl
acyl chain. It also has a slight preference for phosphatidylcholine over
phosphatidylethanolamine.
HEN2      (hua     enhancer    2);    ATP-dependent     helicase/    RNA
helicase||encodes a putative DExH-box RNA helicase that acts
redundantly with HEN1, HUA1, and HUA2 in the specification of floral
organ identity in the third whorl.
PRK2A; ATP binding / protein binding / protein kinase/ protein
serine/threonine kinase/ protein tyrosine kinase||Pollen receptor kinase.
Coexpression of AtPRK2a with AtRopGEF12 resulted in isotropic pollen
tube growth.
protein kinase, putative||
cysteine-type peptidase||
transposable element gene||
AHA6 (Arabidopsis H(+)-ATPase 6); ATPase||
minichromosome maintenance family protein / MCM family
protein||Member of the minichromosome maintenance complex,
involved in DNA replication initiation. Abundant in proliferating and
endocycling tissues. Localized in the nucleus during G1, S and G2
phases of the cell cycle, and are released into the cytoplasmic
compartment during mitosis. Binds chromatin.
unknown protein||
protease inhibitor/seed storage/lipid transfer protein (LTP) family
protein||
invertase/pectin methylesterase inhibitor family protein||
||
adenylate cyclase||adenylate cyclase
glycosyl transferase family 17 protein||
C2 domain-containing protein||
NF-YB7 (NUCLEAR FACTOR Y, SUBUNIT B7); transcription factor||
GONST1 (Golgi Nucleotide Sugar Transporter 1); GDP-mannose
transmembrane        transporter/     nucleotide-sugar     transmembrane
transporter||GDP-mannose transporter
PRLI-interacting factor, putative||
SWIB complex BAF60b domain-containing protein||
AGP9 (ARABINOGALACTAN PROTEIN 9)||putative proline-rich protein
(At2g14890) mRNA, complete
gibberellin-regulated family protein||
unknown protein||
KCS8 (3-KETOACYL-COA SYNTHASE 8); acyltransferase/ catalytic/
transferase, transferring acyl groups other than amino-acyl
groups||Encodes KCS8, a member of the 3-ketoacyl-CoA synthase family
involved in the biosynthesis of VLCFA (very long chain fatty acids).
transposable element gene||
thioredoxin M-type 3, chloroplast (TRX-M3)||chloroplast protein similar
to prokaryotic thioredoxin.
transposable element gene||
MEE14 (maternal effect embryo arrest 14)||
unknown protein||
||
ADF5 (ACTIN DEPOLYMERIZING FACTOR 5); actin binding||Encodes
actin depolymerizing factor 5 (ADF5).
BGAL13; beta-galactosidase||putative beta-galactosidase (BGAL13 gene)
UBC29 (ubiquitin-conjugating enzyme 29); ubiquitin-protein ligase||
MSI2 (MULTICOPY SUPPRESSOR OF IRA1 2)||Encodes a WD-40 repeat
protein similar to yeast MSI1.
shikimate kinase family protein||
IDH2 (ISOCITRATE DEHYDROGENASE SUBUNIT 2); isocitrate
dehydrogenase (NAD+)/ oxidoreductase, acting on the CH-OH group of
donors, NAD or NADP as acceptor||NAD+ dependent isocitrate
dehydrogenase subunit 2 (IDH2)
mitochondrial substrate carrier family protein||
unknown protein||
HMG2       (3-HYDROXY-3-METHYLGLUTARYL-COA           REDUCTASE       2);
hydroxymethylglutaryl-CoA        reductase||Encodes   a    3-hydroxy-3-
methylglutaryl-CoA reductase (HMGR) that is involved in the synthesis of
sterol and triterpenoid compounds.
auxin efflux carrier family protein||
HMGB4 (HIGH MOBILITY GROUP B 4); DNA binding / chromatin binding
/ structural constituent of chromatin / transcription factor||Encodes a
protein belonging to the subgroup of HMGB (high mobility group B)
proteins that have a distinctive DNA-binding motif, the HMG-box
domain. The motif confers non-sequence specific interaction with linear
DNA and structure-specific binding to distorted DNA sites. The HMGB
proteins are involved in the assembly of nucleoprotein complexes. Can
be phosphorylated by CK2alpha.
oxidoreductase, 2OG-Fe(II) oxygenase family protein||
aspartyl protease family protein||
binding / inositol or phosphatidylinositol kinase/ phosphotransferase,
alcohol group as acceptor||
unknown protein||
||
anaphase-promoting complex, subunit 10 family / APC10 family||
hydrolase, alpha/beta fold family protein||
protein kinase family protein||
unknown protein||
transposable element gene||
peroxidase, putative||
||
SLP3; serine-type peptidase||Encodes a novel subtilisin-like serine
protease.
leucine-rich repeat family protein||
zinc ion binding||
unknown protein||
CDA1 (CYTIDINE DEAMINASE 1); cytidine deaminase||Encodes a
cytidine deaminase that deaminates cytidine and deoxycytidine and is
competitively inhibited by cytosine-containing compounds.
TET2 (TETRASPANIN2)||Member of TETRASPANIN family
DC1 domain-containing protein||
DC1 domain-containing protein||
40S ribosomal protein S30 (RPS30A)||
PRF5 (PROFILIN5); actin binding / actin monomer binding||Encodes
profilin 5, originally named profilin 4 (PRO4/PFN4). Low-molecular
weight, actin monomer-binding protein that regulates the organization of
actin cytoskeleton. Pollen-specific plant profilin present predominantly in
mature pollen and growing pollen tubes.
leucine-rich repeat family protein / extensin family protein||
ATNADP-ME1 (NADP-malic enzyme 1); malate dehydrogenase
(oxaloacetate-decarboxylating)         (NADP+)/         malic     enzyme/
oxidoreductase, acting on NADH or NADPH, NAD or NADP as
acceptor||The malic enzyme (EC 1.1.1.40) encoded by AtNADP-ME1 is
expressed in response to developmental and cell-specific signals.
unknown protein||
PSAE-2 (photosystem I subunit E-2); catalytic||Encodes subunit E of
photosystem I.
RIN13 (RPM1 INTERACTING PROTEIN 13)||Encodes RPM1 Interacting
Protein 13 (RIN13), a resistance protein interactor shown to positively
enhance resistance function of RPM1.
MUR3 (MURUS 3); catalytic/ transferase, transferring glycosyl
groups||Encodes a xyloglucan galactosyltransferase located in the
membrane of Golgi stacks that is involved in the biosynthesis of fucose.
It is also involved in endomembrane organization. It is suggested that it
is a dual-function protein that is responsible for actin organization and
the synthesis of cell wall materials.
succinyl-CoA ligase (GDP-forming) beta-chain, mitochondrial, putative /
succinyl-CoA synthetase, beta chain, putative / SCS-beta, putative||
kinase||
unknown protein||
protein phosphatase 2C, putative / PP2C, putative||
unknown protein||
NDB4 (NAD(P)H dehydrogenase B4); NADH dehydrogenase||
folic acid binding / transferase||
SRF1 (strubbelig receptor family 1); kinase||
EPF1 (EPIDERMAL PATTERNING FACTOR 1)||
PSB29||Chloroplast-localized Thylakoid formation1 gene product
involved in vesicle-mediated formation of thylakoid membranes. Thf1
antisense lines contain abnormal chloroplasts early in leaf development
(chloroplasts have loosely stacked thylakoid membranes). Expression
was induced in the light and decreased under dark conditions. G-alpha
interaction partner that functions downstream of the plasma
membrane杁elimited heterotrimeric G-protein (GPA1) in a D-glucose
signaling pathway. Localized to both the outer plastid membrane and
the stroma. Probably involved in the metabolic pathway that controls the
assembly of the PS II complex.
||
amino acid permease, putative||
translocon-associated protein alpha (TRAP alpha) family protein||
unknown protein||
unknown protein||
RNA recognition motif (RRM)-containing protein||
DNAJ heat shock N-terminal domain-containing protein||
SFH3 (SEC14-LIKE 3); phosphatidylinositol transporter||
APL4; glucose-1-phosphate adenylyltransferase||Encodes the large
subunit of ADP-glucose pyrophosphorylase, the enzyme which catalyzes
the first and limiting step in starch biosynthesis. The large subunit plays
a regulatory role whereas the small subunit (ApS) is the catalytic
isoform. Four isoforms of the large subunit (ApL1-4) have been
described.
RD2||Encodes gene that is induced in response to dessication; mRNA
expression is seen 10 and 24 hrs after start of dessication treatment.
CESA9 (CELLULOSE SYNTHASE A9); cellulose synthase/ transferase,
transferring glycosyl groups||cellulose synthase, related to CESA6.
violaxanthin de-epoxidase-related||
lipid-associated family protein||
hydroxyproline-rich glycoprotein family protein||
peptidase||
riboflavin biosynthesis protein, putative||
AGP2 (ARABINOGALACTAN PROTEIN 2)||Encodes arabinogalactan-
protein (AGP2).
||
VQ motif-containing protein||
galactosyl transferase GMA12/MNN10 family protein||
||
transport protein-related||
GDSL-motif lipase/hydrolase family protein||
MES7 (METHYL ESTERASE 7); hydrolase/ hydrolase, acting on ester
bonds / methyl indole-3-acetate esterase/ methyl salicylate
esterase||Encodes a protein shown to have carboxylesterase activity,
methyl salicylate esterase activity, and methyl IAA esterase activity in
vitro. This protein does not act on methyl JA, MeGA4, or MEGA9 in vitro.
MES7 appears to be involved in MeSA hydrolysis in planta. Expression of
MES7 can restore systemic acquired resistance in SAR-deficient tobacco
plants.
reticulon family protein (RTNLB13)||
zinc finger (C3HC4-type RING finger) family protein||
HNH endonuclease domain-containing protein||
glycoside hydrolase family 28 protein / polygalacturonase (pectinase)
family protein||
SNRNP-G (PROBABLE SMALL NUCLEAR RIBONUCLEOPROTEIN G)||
plastocyanin-like domain-containing protein||
unknown protein||
SCA3 (SCABRA 3); DNA binding / DNA-directed RNA polymerase||
endomembrane protein 70, putative||
leucine-rich repeat transmembrane protein kinase, putative||
basic helix-loop-helix (bHLH) family protein||
ALDH11A3; 3-chloroallyl aldehyde dehydrogenase/ glyceraldehyde-3-
phosphate dehydrogenase (NADP+)||Encodes a protein with non-
phosphorylating        NADP-dependent        glyceraldehyde-3-phosphate
dehydrogenase activity. The activity of the enzyme was determined from
leaf extracts; the enzyme has not been purified to confirm activity.
serine carboxypeptidase S28 family protein||
ATP binding / kinase/ protein kinase/ protein serine/threonine kinase||

FLA3 (FASCICLIN-LIKE ARABINOGALACTAN PROTEIN 3 PRECURSOR)||
ARF3 (ADP-RIBOSYLATION FACTOR 3); protein binding||GTPase
required for Golgi targeting of GRIP domain proteins. AtARL1 binds
directly to the GRIP domain of AtGRIP in a GTP-dependent manner
COL3 (CONSTANS-LIKE 3); protein binding / transcription factor/ zinc
ion binding||Positive regulator of photomorphogenesis that acts
downstream of COP1 but can promote lateral root development
independently of COP1 and also function as a daylength-sensitive
regulator of shoot branching.
pathogenesis-related thaumatin family protein||
AGL61 (AGAMOUS-LIKE 61); DNA binding / transcription factor||Encodes
a member of the Agamous-like family of transcription factors. Localized
to the nucleus in the central cell and endosperm of the female
gametophyte. Loss of function mutations show reduced female fertility.
Fifty percent of ovules have defective central cells with abnormal
morphology and patterns of gene expression. Upon fertilization 50% of
seeds abort. Using yeast two hybrid assays AGL61 was shown to interact
with AGL80, another MADS box gene with similar defects in ovule
development. These data suggest that AGL61 and 80 together are
required for proper differentiation of the central cell.
plastocyanin-like domain-containing protein||
ATGPX1        (GLUTATHIONE          PEROXIDASE        1); glutathione
peroxidase||Encodes glutathione peroxidase.
2-oxoglutarate-dependent dioxygenase, putative||encodes a protein
whose sequence is similar to ACC oxidase
EBF1 (EIN3-BINDING F BOX PROTEIN 1); protein binding / ubiquitin-
protein ligase||Encodes an F-box protein involved in the
ubiquitin/proteasome-dependent proteolysis of EIN3.
unknown protein||
TIP4;1 (tonoplast intrinsic protein 4;1); water channel||
YebC-related||
||
AtGLDP2 (Arabidopsis thaliana glycine decarboxylase P-protein 2); ATP
binding / glycine dehydrogenase (decarboxylating)||
unknown protein||
Iqd4 (IQ-domain 4); calmodulin binding||
RCY1 (ARGININE-RICH CYCLIN 1); cyclin-dependent protein kinase
regulator||Encodes an ania-6a type arginine-rich cyclin which confers
tolerance to LiCl and NaCl when expressed in yeast.
pectinesterase family protein||
RED family protein||
transducin family protein / WD-40 repeat family protein||
cytochrome b6f complex subunit (petM), putative||
AKT1 (ARABIDOPSIS K TRANSPORTER 1); cyclic nucleotide binding /
inward rectifier potassium channel||Shaker-like inward rectifying
potassium channel predominantly expressed in predominantly in root
hairs and root endodermis.
nitrate transporter (NTP2)||
leucine-rich repeat transmembrane protein kinase, putative||
CYCB1;4 (Cyclin B1;4); cyclin-dependent protein kinase regulator||
PDR4 (PLEIOTROPIC DRUG RESISTANCE 4); ATPase, coupled to
transmembrane movement of substances||
AGO4 (ARGONAUTE 4); nucleic acid binding||AGO4 is a member of a
class of PAZ/PIWI domain containing proteins involved in siRNA
mediated gene silencing.Loss of function mutations have reduced site
specific CpNpG and CpHpH methylation and increased susceptibility to
bacterial pathogens.
protease inhibitor/seed storage/lipid transfer protein (LTP) family
protein||
heat shock family protein||
unknown protein||
unknown protein||
ubiquitin carboxyl-terminal hydrolase-related||
CYP94C1; fatty acid (omega-1)-hydroxylase/ oxygen binding||Encodes a
CYP94C1. Has highest omega-hydroxylase activity with 9,10-
epoxystearic acid, while also metabolized lauric acid (C12:0) and C18
unsaturated fatty acids. Gene expression is induced in response to
wounding and jasmonic acid treatment.
60S acidic ribosomal protein P2 (RPP2A)||
xanthine/uracil permease family protein||
||
HDT4; histone deacetylase||Belongs to the plant specific HD2 type
proteins; similar to nucleolar Zea mays histone deacetylase; HD2-p39
CKS1 (CYCLIN-DEPENDENT KINASE-SUBUNIT 1); cyclin-dependent
protein kinase/ protein binding||catalytic subunit of cyclin dependent
kinase 1. physically interact with cyclin-dependent kinases (CDKs) and
play an essential, but yet not entirely resolved, role in the regulation of
the cell cycle
protein binding / zinc ion binding||
FRA8        (FRAGILE         FIBER      8);       glucuronosyltransferase/
transferase||Homolog to AT5G22940, a member of glycosyltransferase
family 47 that is involved in secondary cell wall biosynthesis. It exhibits
high sequence similarity to tobacco (Nicotiana plumbaginifolia) pectin
glucuronyltransferase. Protein has a domain that shares significant
similarity with the pfam03016 domain. It is expressed specifically in
developing vessels and fiber cells, and FRA8 is targeted to Golgi.
Mutants have irregular xylem formation, reduced cellulose levels and
plants are smaller than normal siblings.
CSD2 (COPPER/ZINC SUPEROXIDE DISMUTASE 2); superoxide
dismutase||Encodes a chloroplastic copper/zinc superoxide dismutase
CSD2 that can detoxify superoxide radicals. Its expression is affected by
miR398-directed mRNA cleavage.
hydroxyproline-rich glycoprotein family protein||
SYD (SPLAYED); ATPase/ chromatin binding||Encodes a SWI2/SNF2-like
protein in the SNF2 subclass. Homozygous plants with null mutations
exhibit premature termination of the meristem and carpelloid structures
from the inflorescence meristem. Co-activator of floral homeotic gene
expression. Acts with LFY to regulate shoot apical meristem identity.
Required for meristem maintenance. Regulates flowering under a non-
inductive photoperiod. It promotes the expression of CUC2 during
cotyledon boundary formation. Affects reproductive shoot apical
meristem function by regulating the expression of WUS. In CHiP
experiments SYD binds to WUS promoter. Present as two forms in the
nucleus, full-length and truncated, with the latter apparently lacking the
C-terminal domain. The ratio of the two forms differs in juvenile and in
adult tissues. The C-terminal domain is not required for activity.
unknown protein||
SAND family protein||
unknown protein||
unknown protein||
KCS12 (3-KETOACYL-COA SYNTHASE 12); acyltransferase/ catalytic/
transferase, transferring acyl groups other than amino-acyl
groups||Encodes KCS12, a member of the 3-ketoacyl-CoA synthase
family involved in the biosynthesis of VLCFA (very long chain fatty
acids).
disease resistance-responsive family protein / fibroin-related||
HIS4; DNA binding||histone 4
NAD-dependent epimerase/dehydratase family protein||
osmotin-like protein, putative||
ALB3 (ALBINO 3); P-P-bond-hydrolysis-driven protein transmembrane
transporter||member of Chloroplast membrane protein ALBINO3 family
ATOEP16-1 (OUTER PLASTID ENVELOPE PROTEIN 16-1); P-P-bond-
hydrolysis-driven    protein     transmembrane     transporter/   protein
transporter||Encodes AtOEP16, a 16-KDa plastid outer membrane
protein involved in plastid import of protochlorophyllide oxidoreductase
A. Predominantly expressed in leaves and is also inducible by cold
treatment.
APK1B; ATP binding / kinase/ protein kinase/ protein serine/threonine
kinase/ protein tyrosine kinase||
ATEXPA6 (ARABIDOPSIS THALIANA EXPANSIN A6)||Encodes an
expansin. Naming convention from the Expansin Working Group (Kende
et al, 2004. Plant Mol Bio). Involved in the formation of nematode-
induced syncytia in roots of Arabidopsis thaliana.
exostosin family protein||
ftsh3 (FtsH protease 3); ATP-dependent peptidase/ ATPase||encodes an
FtsH protease that is localized to the mitochondrion
LAC2 (laccase 2); laccase||putative laccase, knockout mutant had
reduced root elongation under PEG-induced dehydration
unknown protein||
MTPB1 (METAL TOLERANCE PROTEIN B1); efflux transmembrane
transporter/ inorganic anion transmembrane transporter/ zinc ion
transmembrane transporter||member of Zinc transporter (ZAT) family
ATGSTU5 (ARABIDOPSIS THALIANA GLUTATHIONE S-TRANSFERASE
TAU 5); glutathione binding / glutathione transferase||Encodes a
member of the TAU glutathione S-transferase gene family. Gene
expression is induced by exposure to auxin, pathogen and herbicides.
Naming convention according to Wagner et al. (2002)
ATGSTU4 (ARABIDOPSIS THALIANA GLUTATHIONE S-TRANSFERASE
TAU 4); glutathione transferase||Encodes glutathione transferase
belonging to the tau class of GSTs. Naming convention according to
Wagner et al. (2002).
TUB7; structural constituent of cytoskeleton||Encodes a beta-tubulin
that is expressed in leaves, roots and flowers.
PDR3 (PLEIOTROPIC DRUG RESISTANCE 3); ATPase, coupled to
transmembrane movement of substances||
Ran-binding protein 1b (RanBP1b)||
[acyl-carrier-protein] S-malonyltransferase/ binding / catalytic/
transferase||
LAC3 (laccase 3); laccase||putative laccase, a member of laccase family
of genes (17 members in Arabidopsis).
vacuolar sorting receptor, putative||
HSI2 (HIGH-LEVEL EXPRESSION OF SUGAR-INDUCIBLE GENE 2);
transcription factor/ transcription repressor||HSI2 is a member of a
novel family of B3 domain proteins with a sequence similar to the ERF-
associated amphiphilic repression (EAR) motif. It functions as an active
repressor of the Spo minimal promoter (derived from a gene for sweet
potato sporamin A1) through the EAR motif. It contains a plant-specific
B3 DNA-binding domain. The Arabidopsis genome contains 42 genes
with B3 domains which could be classified into three families that are
represented by ABI3, ARF1 and RAV1. HSI2 belongs to the ABI3 family.
It is expressed at similar levels in all organs. Treatment with 6% sucrose
showed a slight increase in transcript levels after 24 h. No changes were
observed after treatment with 50礛 ABA. It is localized in the nucleus via
a nuclear localization sequence located in the fourth conserved region of
the C-terminal B3 domain.
C4H        (CINNAMATE-4-HYDROXYLASE);              trans-cinnamate       4-
monooxygenase||Encodes a cinnamate-4-hydroxylase.
||
ATCOQ3        (ARABDIOPSIS        THALIANA        COENZYME          Q   3);
hexaprenyldihydroxybenzoate                              methyltransferase/
polyprenyldihydroxybenzoate methyltransferase||The enzyme encoded
by this gene has been shown to complement the Saccharomyces
cerevisiae     coq3      mutation     and,       therefore,      to   have
hexaprenyldihydroxybenzoate methyltransferase activity. It is however
likely that, in Arabidopsis, the enzyme catalyzes the methylation of
nonaprenyldihydroxybenzoate as it is the prevalent polyprenoid in this
plant species. The enzyme is a mitochondrial-localized methyltransferase
involved in ubiquinone biosynthesis.
ATP synthase protein I -related||
TCP10 (TCP DOMAIN PROTEIN 10); transcription factor||TCP family
protein involved in heterchronic regulation of leaf differentiation.
unknown protein||
unknown protein||
GLX2-5 (GLYOXALASE 2-5); hydroxyacylglutathione hydrolase/ iron ion
binding / zinc ion binding||Encodes a mitochondrial glyoxalase 2 that
can accommodate a number of different metal centers and with the
predominant metal center being Fe(III)Zn(II).
pfkB-type carbohydrate kinase family protein||
CPK24; ATP binding / calcium ion binding / calmodulin-dependent
protein kinase/ kinase/ protein kinase/ protein serine/threonine
kinase||member of Calcium Dependent Protein Kinase
AtRABA5d (Arabidopsis Rab GTPase homolog A5d); GTP binding||
unknown protein||
UGT74D1 (UDP-glucosyl transferase 74D1); UDP-glycosyltransferase/
abscisic acid glucosyltransferase/ transferase, transferring glycosyl
groups / transferase, transferring hexosyl groups||
ankyrin protein kinase, putative||
leucine-rich repeat transmembrane protein kinase, putative||Encodes a
putative leucine rich repeat transmembrane protein that is expressed in
response to Pseudomonas syringae. Expression of SRRLK may be
required for silencing via lsiRNAs.
CNX2 (COFACTOR OF NITRATE REDUCTASE AND XANTHINE
DEHYDROGENASE 2); catalytic||COFACTOR OF NITRATE REDUCTASE
AND XANTHINE DEHYDROGENASE 2. Encodes a protein involved in
molybdenum cofactor biosynthesis. Homologous to E.coli moaA.
Expression is abundant in all tissues examined, particularly in roots.
Appears to have targeting signals for chloroplast or mitochondria.
40S ribosomal protein S12 (RPS12C)||
lactoylglutathione lyase family protein / glyoxalase I family protein||
||
||
unknown protein||
UCC1 (UCLACYANIN 1); copper ion binding / electron carrier||Encodes a
uclacyanin, a protein precursor that is closely related to precursors of
stellacyanins and a blue copper protein from pea pods.
galactosyltransferase family protein||
||
ATCSLB01; cellulose synthase/ transferase/ transferase, transferring
glycosyl groups||encodes a gene similar to cellulose synthase
GRP23 (GLYCINE-RICH PROTEIN 23)||Glycine-rich protein similar in
structure to GRP5. The expression of GRP23 is induced by HPA (cutin
monomer, salicylic acid, and abscisic acid.
WD-40 repeat family protein||Encodes a WD40 repeat and LUFS domain
containing protein that is similar to LUG. Interacts physically with SEUSS
and likely functions as part of a repressor complex that represses AG.
CB5-B (CYTOCHROME B5 ISOFORM B); heme binding||member of
Cytochromes b5
AP4.3A; ATP binding / protein kinase/ protein serine/threonine kinase/
protein tyrosine kinase||
protein kinase family protein||
AtGH9B8 (Arabidopsis thaliana glycosyl hydrolase 9B8); catalytic/
hydrolase, hydrolyzing O-glycosyl compounds||
ATP synthase gamma chain, mitochondrial (ATPC)||
NSP2 (NITRILE SPECIFIER PROTEIN 2)||Encodes a nitrile-specifier
protein NSP2. NSP2 is one out of five (At3g16400/NSP1,
At2g33070/NSP2,         At3g16390/NSP3,         At3g16410/NSP4      and
At5g48180/NSP5) A. thaliana epithiospecifier protein (ESP) homologues
that promote simple nitrile, but not epithionitrile or thiocyanate
formation.
ATCSLD1; cellulose synthase/ transferase, transferring glycosyl
groups||encodes a gene similar to cellulose synthase
HSP60-2 (HEAT SHOCK PROTEIN 60-2); ATP binding||
ACHT3 (ATYPICAL CYS HIS RICH THIOREDOXIN 3)||Encodes a member
of the thioredoxin family protein. Located in the chloroplast.
IAA13; transcription factor||Auxin induced gene, IAA13 (IAA13).
RD20      (RESPONSIVE      TO     DESSICATION       20);    calcium  ion
binding||Encodes a calcium binding protein whose mRNA is induced
upon treatment with NaCl, ABA and in response to dessication. mRNA
expression under drought conditions is apparent particularly in leaves
and flowers.
50S ribosomal protein L28, chloroplast (CL28)||
||
cinnamoyl-CoA reductase family||
3-beta hydroxysteroid dehydrogenase/isomerase family protein||
MLO5 (MILDEW RESISTANCE LOCUS O 5); calmodulin binding||A
member of a large family of seven-transmembrane domain proteins
specific to plants, homologs of the barley mildew resistance locus o
(MLO) protein. The Arabidopsis genome contains 15 genes encoding
MLO proteins, with localization in plasma membrane. Phylogenetic
analysis revealed four clades of closely-related AtMLO genes. ATMLO5
belongs to the clade III, with AtMLO7, AtMLO8, AtMLO9, and AtMLO10.
The gene is expressed during seedling growth, in cotyledon vascular
system, and in stigma, anther and pollen grains; it was not expressed in
rosette leaves, as shown by GUS activity patterns. The expression of
several phylogenetically closely-related AtMLO genes showed similar or
overlapping tissue specificity and analogous responsiveness to external
stimuli, suggesting functional redundancy, co-function, or antagonistic
function(s).
iqd9 (IQ-domain 9); calmodulin binding||
calcium ion binding||
MEE18 (maternal effect embryo arrest 18)||
WAVE1; actin monomer binding||Encodes a member of the SCAR
family.These proteins are part of a complex (WAVE) complex.The SCAR
subunit activates the ARP2/3 complex which in turn act as a nucleator
for actin filaments.
antiporter/ drug transporter/ transporter||
CYP710A1 (cytochrome P450, family 710, subfamily A, polypeptide 1); C-
22 sterol desaturase/ oxygen binding||Encodes a protein with C22-sterol
desaturase activity. The enzyme was shown to catalyze in the presence
of NADPH the conversion of &beta;-sitosterol to stigmasterol, but not
that of 24-<i>epi</i>-campesterol to brassicasterol (unlike CYP710A2).
RPS14 (mitochondrial ribosomal protein S14); structural constituent of
ribosome||nuclear-encoded mitochondrial ribosomal protein S14
ATO1 (Arabidopsis thioredoxin O1)||
UTP--glucose-1-phosphate uridylyltransferase family protein||
MORN (Membrane Occupation and Recognition Nexus) repeat-containing
protein /phosphatidylinositol-4-phosphate 5-kinase-related||
NPSN11 (NOVEL PLANT SNARE 11); SNAP receptor/ protein
transporter||plant-specific SNARE located in cell plate of dividing cells.
cofractionates with the cytokinesis-specific syntaxin, KNOLLE, which is
required for the formation of the cell plate.
RPA (ROOT AND POLLEN ARFGAP); ARF GTPase activator/ DNA binding
/ zinc ion binding||A member of ARF GAP domain (AGD), A thaliana has
15 members, grouped into four classes.
transcriptional factor B3 family protein||
||
ATCSLA07 (CELLULOSE SYNTHASE LIKE); mannan synthase/
transferase,      transferring     glycosyl     groups||a   member      of
Glycosyltransferase- Family 2 and encodes a beta-mannan synthase
based on in vitro enzyme assays from heterologously expressed protein.
Mutants exhibit defects in pollen tube growth and embryo development.
The defective embryonic development was associated with reduced
proliferation and failed cellularization of the endosperm.
FLA16       (FASCICLIN-LIKE        ARABINOGALACTAN         PROTEIN     16
PRECURSOR)||
NHL12||Encodes a protein whose sequence is similar to tobacco hairpin-
induced gene (HIN1) and Arabidopsis non-race specific disease
resistance gene (NDR1). Expression is not altered in response to
cucumber mosaic virus or spermine.
HVA22J (HVA22-LIKE PROTEIN J)||
ATTIM44-2; protein-transmembrane transporting ATPase||One of two
genes in Arabidopsis that encode a putative subunit of the mitochondrial
inner membrane translocase complex. TIM44 subunit is thought to
provide the energy for translocation via hydrolysis of ATP.
integral membrane family protein||
AtcwINV4 (Arabidopsis thaliana cell wall invertase 4); hydrolase,
hydrolyzing O-glycosyl compounds||
kinesin motor protein-related||
unknown protein||
FTSZ2-1; protein binding / structural molecule||Encodes one of two FtsZ
proteins, tubulin-like proteins, in Arabidopsis. It is involved in
chloroplast division.
URH1 (URIDINE-RIBOHYDROLASE 1); adenosine nucleosidase/
hydrolase/ inosine nucleosidase/ uridine nucleosidase||
protein kinase, putative||
PDR6; ATPase, coupled to transmembrane movement of substances||
AtGRF3      (GROWTH-REGULATING            FACTOR     3);    transcription
activator||Growth regulating factor encoding transcription activator. One
of the nine members of a GRF gene family, containing nuclear targeting
domain. Mutants result in smaller leaves indicating the role of the gene
in leaf development. Expressed in root, shoot and flower.
PHD finger transcription factor, putative||
unknown protein||
xyloglucan:xyloglucosyl    transferase,     putative    /     xyloglucan
endotransglycosylase, putative / endo-xyloglucan transferase, putative||
pal1 (Phe ammonia lyase 1); phenylalanine ammonia-lyase||encodes a
protein similar to phenylalanine ammonia-lyase
IRX9 (IRREGULAR XYLEM 9); transferase, transferring glycosyl groups /
xylosyltransferase||The IRX9 gene encodes a putative family 43 glycosyl
transferase. It was coordinately expressed with the cellulose synthase
subunits during secondary cell wall formation. Cell wall analysis
revealed a decrease in the abundance of xylan in the irx9 mutant,
indicating that IRX9 is required for xylan synthesis. Mutants have
irregular xylem phenotype suggesting a role in secondary cell wall
biosynthesis.
peroxidase 21 (PER21) (P21) (PRXR5)||
29 kDa ribonucleoprotein, chloroplast, putative / RNA-binding protein
cp29, putative||Encodes a chloroplast RNA binding protein. A substrate
of the type III effector HopU1 (mono-ADP-ribosyltransferase). Protein is
tyrosine-phosphorylated and its phosphorylation state is modulated in
response to ABA in Arabidopsis thaliana seeds.
unknown protein||
arginine biosynthesis protein ArgJ family||
RNA-binding protein, putative||
AS1 (ASYMMETRIC LEAVES 1); DNA binding / protein homodimerization/
transcription factor||Encodes a MYB-domain protein involved in
specification of the leaf proximodistal axis. Mutation results in lobed and
dissected leaves with a characteristic asymmetry. Homologous to the
Antirrhinum PHANTASTICA (PHAN) and maize ROUGH SHEATH2 (RS2)
genes Asymmetric placement of auxin response at the distal leaf tip
precedes visible asymmetric leaf growth. Acts alongside AXR1 to
exclude BP expression in leaves and with PIN1 to repress BP and
promote lateral organ growth. Interacts physically with AS2 to form a
complex that binds to the BP promoter and silences BP.
EXP3||member of Alpha-Expansin Gene Family. Naming convention from
the Expansin Working Group (Kende et al, 2004. Plant Mol Bio).
Involved in the formation of nematode-induced syncytia in roots of
Arabidopsis thaliana.
RLK (receptor lectin kinase); kinase||Induced in response to Salicylic
acid.
unknown protein||
aldo/keto reductase family protein||
chaperone protein dnaJ-related||
CAC3; acetyl-CoA carboxylase||encodes the carboxyltransferase alpha
subunit of acetyl-CoA carboxylase, involved in de novo fatty acid
biosynthesis
IRX12 (IRREGULAR XYLEM 12); laccase||Encodes a protein with
similarity to putative laccase, a member of laccase family (17 members
in Arabidopsis). Might be involved in cell wall biosynthesis. Mutants have
a mild irregular xylem phenotype.
myb family transcription factor||
AUX1 (AUXIN RESISTANT 1); amino acid transmembrane transporter/
auxin     binding      /   auxin    influx transmembrane       transporter/
transporter||Encodes an auxin influx transporter. AUX1 resides at the
apical plasma membrane of protophloem cells and at highly dynamic
subpopulations of Golgi apparatus and endosomes in all cell types.
AUX1 action in the lateral root cap and/or epidermal cells influences
lateral root initiation and positioning.
PSRP4 (PLASTID-SPECIFIC RIBOSOMAL PROTEIN 4); structural
constituent of ribosome||plastid-specific ribosomal protein 4 (PSRP4)
mRNA, complete
unknown protein||
integral membrane protein, putative||
LTP2 (LIPID TRANSFER PROTEIN 2); lipid binding||Involved in lipid
transfer between membranes. Belongs to a family of Lipid transfer
proteins. Sequence similarity to other plant/Arabidopsis LPT genes but
highest similarity to LPT1. Stress and pathogen-inducible motifs found in
the upstream region. Expressed in flower, leaves and siliques but absent
in roots. Predicted to be a member of PR-14 pathogenesis-related
protein family with the following members:              At2g38540/LTP1,
At2g38530/LTP2, At5g59320/LTP3, At5g59310/LTP4, At3g51600/LTP5,
At3g08770/LTP6, At2g15050/LTP7, At2g18370/LTP8, At2g15325/LTP9,
At5g01870/LTP10,            At4g33355/LTP11,          At3g51590/LTP12,
At5g44265/LTP13, At5g62065/LTP14, At4g08530/LTP15.
LP1; calmodulin binding||Non-specific lipid transfer protein. Binds
calmodulin in a Ca2+-independent manner. Localized to the cell wall.
Specifically expressed in L1 epidermal layer. Predicted to be a member
of PR-14 pathogenesis-related protein family with the following
members:       At2g38540/LTP1, At2g38530/LTP2, At5g59320/LTP3,
At5g59310/LTP4, At3g51600/LTP5, At3g08770/LTP6, At2g15050/LTP7,
At2g18370/LTP8,            At2g15325/LTP9,            At5g01870/LTP10,
At4g33355/LTP11,           At3g51590/LTP12,           At5g44265/LTP13,
At5g62065/LTP14, At4g08530/LTP15.
GAUT7 (GALACTURONOSYLTRANSFERASE 7); polygalacturonate 4-alpha-
galacturonosyltransferase/ transferase, transferring glycosyl groups||
MVD1      (MEVALONATE        DIPHOSPHATE       DECARBOXYLASE         1);
diphosphomevalonate                 decarboxylase/               protein
homodimerization||Encodes mevalonate diphosphate decarboxylase, the
enzyme that catalyzes the synthesis of isopentenyl diphosphate, used in
sterol and isoprenoid biosynthesis. The protein appears to form a
homodimeric complex. Incidentally, it was shown that the Arabidopsis
MVD protein could also interact with its yeast homolog to form a
heterodimer.
ANNAT4 (ANNEXIN ARABIDOPSIS 4); calcium ion binding / calcium-
dependent phospholipid binding||Annexins are a family of calcium
dependent membrane binding proteins though to be involved in Golgi
mediated secretion. This is one of four annexins identified in
Arabidopsis.
NF-YB1 (NUCLEAR FACTOR Y, SUBUNIT B1); transcription
factor||Encodes a transcription factor from the nuclear factor Y (NF-Y)
family, AtNF-YB1. Confers drought tolerance.
hydrophobic protein, putative / low temperature and salt responsive
protein, putative||
PIP2E (PLASMA MEMBRANE INTRINSIC PROTEIN 2E); water channel||
peroxidase, putative||
amino acid transporter family protein||
CCR2 (ARABIDOPSIS THALIANA CRINKLY4 RELATED 2); ATP binding /
kinase/ protein kinase/ protein serine/threonine kinase/ protein tyrosine
kinase/ receptor||
unknown protein||
ABC transporter family protein||
esterase/lipase/thioesterase family protein||
disease resistance-responsive protein-related / dirigent protein-related||
MTP11;      cation    transmembrane       transporter/   manganese     ion
transmembrane transporter/ manganese:hydrogen antiporter||Encodes
a Golgi-localized manganese transporter that is involved in Mn tolerance.
When expressed into yeast cells, this gene confer Mn<sup>2+</sup>
and Cu<sup>2+</sup> tolerance.
PPL2 (PsbP-like protein 2); calcium ion binding||
ATEXPA4 (ARABIDOPSIS THALIANA EXPANSIN A4)||putative expansin.
Naming convention from the Expansin Working Group (Kende et al,
2004. Plant Mol Bio). Involved in the formation of nematode-induced
syncytia in roots of Arabidopsis thaliana.
RCA (RUBISCO ACTIVASE); ADP binding / ATP binding / enzyme
regulator/        ribulose-1,5-bisphosphate         carboxylase/oxygenase
activator||Rubisco activase, a nuclear-encoded chloroplast protein that
consists of two isoforms arising from alternative splicing in most plants.
Required for the light activation of rubisco.
dehydration-responsive family protein||
mitochondrial glycoprotein family protein / MAM33 family protein||
LIM domain-containing protein||
COI1 (CORONATINE INSENSITIVE 1); protein binding / ubiquitin-protein
ligase||Encodes a protein containing Leu-rich repeats and a degenerate
F-box motif. Associates with AtCUL1, AtRbx1, and the Skp1-like proteins
ASK1 and ASK2 to assemble SCF COI1 ubiquitin-ligase complexes in
planta. A single amino acid substitution in the F-box motif of COI1
abolishes the formation of the SCF(COI1) complexes and results in loss
of the JA response. Required for wound- and jasmonates-induced
transcriptional regulation.
60S acidic ribosomal protein P0 (RPP0A)||
||
||
GLY1; glycerol-3-phosphate dehydrogenase (NAD+)||Encodes a putative
dihydroxyacetone phosphate (DHAP) reductase involved in glycerol-3-
phosphate supply within the chloroplast for synthesis of glycerolipids.
Mutants have reduced levels of hexadecatrienoic acid, which is rescued
by exogenous glycerol-3-phosphate. This gene appears to be involved
in the flux of fatty acids in the prokaryotic glyerolipid biosynthesis
pathway.
||
DPE2 (DISPROPORTIONATING ENZYME 2); 4-alpha-glucanotransferase/
heteroglycan binding||Encodes a cytosolic protein with transglucosidase
and amylomaltase activity. It is an essential component of the pathway
from starch to sucrose and cellular metabolism in leaves at night. The
protein binds to heteroglycans and utilizes glucose, mannose and xylose
as acceptors. Fucose and galactose can also act as acceptors but less
efficiently than the previous three. It was also was also recently
reported to act on maltodextrins. On the other hand, arabinose and
fructose were not efficiently used. Its role probably includes
metabolizing maltose exported from the chloroplast. Studies using
maltose extracted from the double mutant be2-1 be3-2 showed that this
enzyme is preferentially active of &#946;-maltose.
CYP98A3 (cytochrome P450, family 98, subfamily A, polypeptide 3);
monooxygenase/ p-coumarate 3-hydroxylase||encodes coumarate 3-
hydroxylase (C3H), a P450-dependent monooxygenase. Involved in
lignin biosynthesis and flavonoid biosynthesis. Also affects the
biosynthesis of coumarins such as scopoletin and scopolin as a
branching-out-pathway from the phenylpropanoid acid level.
UBP5      (UBIQUITIN-SPECIFIC      PROTEASE      5);    ubiquitin-specific
protease||Encodes ubiquitin-specific protease with nuclear localization
signals that is likely to be involved in ubiquitin-mediated protein
degradation.
TCH3 (TOUCH 3); calcium ion binding||encodes a calmodulin-like
protein, with six potential calcium binding domains. Calcium binding
shown by Ca(2+)-specific shift in electrophoretic mobility. Expression
induced by touch and darkness. Expression may also be developmentally
controlled. Expression in growing regions of roots, vascular tissue,
root/shoot junctions, trichomes, branch points of the shoot, and regions
of siliques and flowers.
CAM2 (CALMODULIN 2); calcium ion binding / protein binding||Encodes
a touch-inducible calmodulin that has higher affinity to kinesin-like
calmodulin binding motor protein than CAM4 or CAM6.
ubiquitin-associated (UBA)/TS-N domain-containing protein||
unknown protein||
ATRR3 (RESPONSE REGULATOR 3); transcription regulator/ two-
component response regulator||Encodes an A- type response Regulator
that is primarily expressed in the root and is involved in cytokinin-
mediated signalling.
ARP; DNA-(apurinic or apyrimidinic site) lyase||apurinic endonuclease-
redox protein. It functions as an apurinic/apyrimidinic class II
endonuclease, and is involved in DNA repair.
GPDHC1; NAD or NADH binding / glycerol-3-phosphate dehydrogenase
(NAD+)||Encodes a protein with NAD-dependent glycerol-3-phosphate
(G3P) dehydrogenase which was shown to complement an Escherichia
coli strain: BB20-14, auxotrophic for glycerol/G3P due to a loss-of-
function mutation in the gpsA gene.
transcription termination factor||
NTRC (NADPH-DEPENDENT THIOREDOXIN REDUCTASE C); thioredoxin-
disulfide reductase||Encodes a NADPH thioredoxin reductase involved in
chloroplast protection against oxidative damage.
EMB2654 (EMBRYO DEFECTIVE 2654)||
VLN2 (VILLIN 2); actin binding||Encodes a protein with high homology
to animal villin.
peptidase M16 family protein / insulinase family protein||
unknown protein||
protein kinase, putative||
unknown protein||
mitochondrial      import    inner    membrane       translocase    subunit
Tim17/Tim22/Tim23 family protein||Homologous to pea OEP16 and
barley pPORA (OEP16), a member of Arabidopsis OEP16 family.
rhodanese-like domain-containing protein||
LBD16 (LATERAL ORGAN BOUNDARIES-DOMAIN 16)||LOB-domain
protein gene LBD16. This gene contains one auxin-responsive element
(AuxRE).
COR15B (COLD REGULATED 15B)||
unknown protein||
MBF1A (MULTIPROTEIN BRIDGING FACTOR 1A); DNA binding /
transcription coactivator||One of three genes in A. thaliana encoding
multiprotein bridging factor 1, a highly conserved transcriptional
coactivator. May serve as a bridging factor between a bZIP factor and
TBP. Its expression is developmentally regulated.
lipase, putative||
PDF1 (PROTODERMAL FACTOR 1)||Encodes a putative extracellular
proline-rich protein is exclusively expressed in the L1 layer of vegetative,
inflorescence and floral meristems and the protoderm of organ
primordia.
NPG1 (no pollen germination 1); calmodulin binding||encodes a
calmodulin-binding protein that is expressed specifically in pollen and is
required for pollen development.
AT-P4H-1 (A. THALIANA P4H ISOFORM 1); oxidoreductase, acting on
paired donors, with incorporation or reduction of molecular oxygen, 2-
oxoglutarate as one donor, and incorporation of one atom each of
oxygen into both donors / procollagen-proline 4-dioxygen||Encodes a
prolyl-4 hydroxylase that can hydroxylate poly(L-proline),the collagen
model peptide (Pro-Pro-Gly)10 and other proline rich peptides.
serine/threonine protein kinase, putative||
unknown protein||
trypsin inhibitor, putative||Encodes a defensin-like (DEFL) family protein.
chitinase, putative||
signal recognition particle 14 kDa family protein / SRP14 family protein||
molybdopterin biosynthesis MoaE family protein||
OEP37; ion channel||Constitutes a peptide sensitive ion channel in
chloroplast outer membranes. Accumulates in germinating seeds and
developing embryos.
ATGDI1      (ARABIDOPSIS       THALIANA      GUANOSINE       NUCLEOTIDE
DIPHOSPHATE DISSOCIATION INHIBITOR 1); RAB GDP-dissociation
inhibitor||GDP dissociation inhibitor involved in vesicular membrane
traffic
MLO15 (MILDEW RESISTANCE LOCUS O 15); calmodulin binding||A
member of a large family of seven-transmembrane domain proteins
specific to plants, homologs of the barley mildew resistance locus o
(MLO) protein. The Arabidopsis genome contains 15 genes encoding
MLO proteins, with localization in plasma membrane. Phylogenetic
analysis revealed four clades of closely-related AtMLO genes. ATMLO15
belongs to the clade II, with ATMLO13 and ATMLO15. The gene is
expressed during early seedling growth, in root tips and flower (papillae,
anthers and pollen grains), as shown by GUS activity patterns. The
expression of several phylogenetically closely-related AtMLO genes
showed similar or overlapping tissue specificity and analogous
responsiveness to external stimuli, suggesting functional redundancy, co-
function, or antagonistic function(s).
ATCS; ATP binding / ATP citrate synthase/ citrate (SI)-
synthase||encodes a mitochrondrion targeted citrate synthase, the first
enzyme of the tricarboxylic acid cycle, catalyzing the condensation of
acetyl-CoA and oxaloacetate, finally yielding citrate and CoA.
unknown protein||
AtGH9B11 (Arabidopsis thaliana glycosyl hydrolase 9B11); catalytic/
hydrolase, hydrolyzing O-glycosyl compounds||
||
CHL-CPN10       (CHLOROPLAST         CHAPERONIN         10);   chaperone
binding||Encodes a chloroplast-localized chaperonin 10 whose mRNA is
expressed in leaves and stems but not roots.
UCC2 (UCLACYANIN 2); copper ion binding / electron carrier||Encodes a
uclacyanin, a protein precursor that is closely related to precursors of
stellacyanins and a blue copper protein from pea pods.
AP2 domain-containing transcription factor TINY, putative||encodes a
member of the DREB subfamily A-4 of ERF/AP2 transcription factor
family. The protein contains one AP2 domain. There are 17 members in
this subfamily including TINY.
protease inhibitor/seed storage/lipid transfer protein (LTP) family
protein||
AFO (ABNORMAL FLORAL ORGANS); protein binding / transcription
factor/ transcription regulator||Encodes a member of the YABBY family
of transcriptional regulators that is involved in abaxial cell type
specification in leaves and fruits. YAB1 acts in a non-cell autonomous
fashion within the meristem to affect phyllotactic patterning. The non-
autonomous effect on the central region of the meristem is mediated
through the activity if Lateral Suppressor (LAS).
GOS12 (GOLGI SNARE 12); SNARE binding||Encodes a member of the
GOS1 (Golgi SNARE) gene family.
pectinesterase family protein||
transketolase, putative||
DNA-binding protein-related||
CYP76C1; electron carrier/ heme binding / iron ion binding /
monooxygenase||cytochrome P450 monooxygenase
protein kinase family protein||
dehydration-responsive family protein||
CPFTSY; 7S RNA binding / GTP binding / nucleoside-triphosphatase/
nucleotide binding||chloroplast SRP receptor homolog, alpha subunit
CPFTSY. Required for LHCP integration into isolated thylakoids.
PMM (PHOSPHOMANNOMUTASE); phosphomannomutase||encodes a
phosphomannomutase, involved in ascorbate biosynthesis
LIM domain-containing protein||
DEAD/DEAH box helicase, putative||
DNA-binding protein, putative||
unknown protein||
ROPGEF4 (RHO GUANYL-NUCLEOTIDE EXCHANGE FACTOR 4); Rho
guanyl-nucleotide exchange factor||Encodes a member of KPP-like gene
family, homolog of KPP (kinase partner protein) gene in tomato. Also a
member of the RopGEF (guanine nucleotide exchange factor) family,
containing the novel PRONE domain (plant-specific Rop nucleotide
exchanger), which is exclusively active towards members of the Rop
subfamily.
U-box domain-containing protein||
||
delta-8 sphingolipid desaturase, putative||
myosin heavy chain-related||
unknown protein||
JAR1 (JASMONATE RESISTANT 1); ATP binding / adenylyltransferase/
catalytic/ jasmonate-amino synthetase||Encodes a jasmonate-amido
synthetase that is a member of the GH3 family of proteins. JAR1
catalyzes the formation of a biologically active jasmonyl-isoleucine (JA-
Ile) conjugate. JA-Ile promotes the interaction between JAZ1 and COI1
in the jasmonate signaling pathway. JAR1 localizes to the cytoplasm and
is also a phytochrome A signaling component. JAR1 is an auxin-induced
gene. Loss of function mutants are defective in a variety of responses to
jasmonic acid. JAR1 has additional enzymatic activities in vitro, (e.g. the
ability to synthesize adenosine 5'-tetraphosphate and other JA
conjugates), but there are no data to show whether JAR1 catalyzes
many of these reactions in vivo. JAR1 is involved in pathogen defense,
sensitivity to ozone, and wound responses.
unknown protein||
unknown protein||
AAA-type ATPase family protein||
ATHB-7 (ARABIDOPSIS THALIANA HOMEOBOX 7); transcription
activator/ transcription factor||encodes a putative transcription factor
that contains a homeodomain closely linked to a leucine zipper motif.
Transcript is detected in all tissues examined. Is transcriptionally
regulated in an ABA-dependent manner and may act in a signal
transduction pathway which mediates a drought response.
AtPPa3 (Arabidopsis thaliana pyrophosphorylase 3); inorganic
diphosphatase/ pyrophosphatase||Encodes a protein that might have
inorganic pyrophosphatase activity.
plastid-lipid associated protein PAP / fibrillin family protein||
POL (poltergeist); protein serine/threonine phosphatase||Pol mutations
are recessive, partial suppressors of meristem defects in strong clv1 and
clv3 mutants, and nearly complete suppressors of weak clv1 mutants.
Single mutants appear normal. Acts downstream of the CLV signaling
pathway in meristem development and is required together with PLL1
for stem-cell maintenance through the regulation of WUS.
pectinacetylesterase, putative||
ABCB4 (ATP BINDING CASSETTE SUBFAMILY B4); ATPase, coupled to
transmembrane movement of substances / xenobiotic-transporting
ATPase||Multidrug resistance P-glycoprotein (MDR/PGP) subfamily of
ABC transporters. Functions in the basipetal redirection of auxin from
the root tip. Exhibits apolar plasma membrane localization in the root
cap and polar localization in tissues above.
invertase/pectin methylesterase inhibitor family protein||
AtGolS1 (Arabidopsis thaliana galactinol synthase 1); transferase,
transferring glycosyl groups / transferase, transferring hexosyl groups||
ATP binding / microtubule motor||
pectinesterase family protein||
ATSWI3A        (SWITCH/SUCROSE       NONFERMENTING       3A);    DNA
binding||Homologous to yeast SWI3 and a member of the Arabidopsis
SWI3 gene family. Protein physically interacts with ATSWI3B and
ATSWI3C, the other two members of the SWI3 family.
small nuclear ribonucleoprotein D2, putative / snRNP core protein D2,
putative / Sm protein D2, putative||
ATGSTF8 (ARABIDOPSIS THALIANA GLUTATHIONE S-TRANSFERASE
PHI 8); glutathione binding / glutathione transferase||Encodes
glutathione transferase belonging to the phi class of GSTs. Naming
convention according to Wagner et al. (2002).
tic20 protein-related||
AtTLP3 (TUBBY LIKE PROTEIN 3); phosphoric diester hydrolase/
transcription factor||Member of TLP family
SCC3 (SISTER-CHROMATID COHESION PROTEIN 3); binding||Essential
to the monopolar orientation of the kinetochores during meiosis.
SWA1 (SLOW WALKER1); nucleotide binding||Encodes a transducin
family nucleolar protein with six WD40 repeats that is most likely
involved in 18S rRNA biogenesis. The slow progression of the
gametophytic division cycles in swa1 suggested that the SWA1 protein is
required for the normal progression of mitotic division cycles through the
regulation of cell metabolism. Ubiquitously expressed throughout the
plant.
RPH1 (RESISTANCE TO PHYTOPHTHORA 1)||Encodes a chloroplast
protein RPH1 (resistance to Phytophthora 1). Involved in immune
response to Phytophthora brassicae. rph1 mutant plants (in Ws
background) are susceptible to P. brassicae.
oxidoreductase, 2OG-Fe(II) oxygenase family protein||
protease inhibitor/seed storage/lipid transfer protein (LTP) family
protein||
EDA4 (embryo sac development arrest 4); lipid binding||
AtSS2 (starch synthase 2); transferase, transferring glycosyl groups||
peroxidase 27 (PER27) (P27) (PRXR7)||
unknown protein||
pectate lyase family protein||
protein transport protein SEC13 family protein / WD-40 repeat family
protein||
MBD9; DNA binding / methyl-CpG binding||Encodes a protein with a
methyl-CpG-binding domain. Has sequence similarity to human MBD
proteins. Involved in the modification of the FLC chromatin acetylation
state to affect FLC expression. Mutants show an early flowering, and
enhanced shoot branching phenotypes.
ATHB-1 (ARABIDOPSIS THALIANA HOMEOBOX 1); DNA binding /
protein homodimerization/ sequence-specific DNA binding / transcription
activator/ transcription factor||Encodes a homeodomain leucine zipper
class I (HD-Zip I) transcriptional activator involved in leaf development.
CYP38 (cyclophilin 38); peptidyl-prolyl cis-trans isomerase||Encodes a
chloroplast cyclophilin functioning in the assembly and maintenance of
photosystem II (PSII) supercomplexes.
methyltransferase||
unknown protein||
AGP11||Encodes an arabinogalactan protein that is expressed in pollen,
pollen sac and pollen tube. Loss of AGP11 function results in decreased
fertility due to defects in pollen tube growth.
unknown protein||
TPLATE; binding||Encodes TPLATE, a cytokinesis protein targeted to the
cell plate. Functions in vesicle-trafficking events required for site-
specific cell wall modifications during pollen germination and for
anchoring of the cell plate to the mother wall at the correct cortical
position.
ribosomal protein L13 family protein||
yrdC family protein||
hydroxyproline-rich glycoprotein family protein||
COBL1 (COBRA-LIKE PROTEIN 1 PRECURSOR)||
unknown protein||
BIG (BIG); binding / ubiquitin-protein ligase/ zinc ion binding||Calossin-
like protein required for polar auxin transport
SEP2 (SEPALLATA 2); DNA binding / protein binding / transcription
factor||MADS-box protein, binds K domain of AG in vivo
GAUT9 (Galacturonosyltransferase 9); polygalacturonate 4-alpha-
galacturonosyltransferase/ transferase, transferring glycosyl groups /
transferase, transferring hexosyl groups||Encodes a protein with
putative galacturonosyltransferase activity.
STE1 (STEROL 1); C-5 sterol desaturase||Brassinosteroid biosynthetic
enzyme, catalyzes delta7 sterol C-5 desaturation step. Mutant has dwarf
phenotype.
LPP3       (LIPID   PHOSPHATE        PHOSPHATASE      3);   phosphatidate
phosphatase||Encodes phosphatidic acid phosphatase. Expressed during
germination.
unknown protein||
emb2768 (EMBRYO DEFECTIVE 2768); ATP binding / RNA binding /
aminoacyl-tRNA ligase/ nucleotide binding / tyrosine-tRNA ligase||
TRXF1 (THIOREDOXIN F-TYPE 1); enzyme activator||
dimethylmenaquinone methyltransferase family protein||
zinc finger (C2H2 type) family protein||
protein kinase family protein||
leucine-rich repeat transmembrane protein kinase, putative||
EXL6 (EXORDIUM LIKE 6)||
unknown protein||
unknown protein||
ATEXPA13 (ARABIDOPSIS THALIANA EXPANSIN A13)||member of Alpha-
Expansin Gene Family. Naming convention from the Expansin Working
Group (Kende et al, 2004. Plant Mol Bio)
lecithin:cholesterol acyltransferase family protein / LACT family protein||
short-chain dehydrogenase/reductase (SDR) family protein||
Ku70-binding family protein||
polcalcin, putative / calcium-binding pollen allergen, putative||
phosphoesterase family protein||
SYP131 (SYNTAXIN OF PLANTS 131); SNAP receptor||member of SYP13
Gene Family
short-chain dehydrogenase/reductase (SDR) family protein||
glycosyl hydrolase family 17 protein||
emb2458 (embryo defective 2458); ATP binding / ATPase/
metalloendopeptidase/ nucleoside-triphosphatase/ nucleotide binding||
unknown protein||
||
endoribonuclease||
unknown protein||
DNA-binding protein-related||
transposable element gene||
unknown protein||
IAA16; transcription factor||early auxin-induced (IAA16)
protein kinase family protein||
SAR DNA-binding protein, putative||SAR DNA-binding protein, putative,
strong similarity to SAR DNA-binding protein-1 (Pisum sativum)
GI:3132696; contains Pfam profile PF01798: Putative snoRNA binding
domain; encodes NOP58-like protein
GDSL-motif lipase/hydrolase family protein||
ATL6; protein binding / zinc ion binding||Encodes a putative RING-H2
zinc finger protein ATL6 (ATL6).
short-chain dehydrogenase/reductase (SDR) family protein||
aminopeptidase/ hydrolase||
RALFL22 (ralf-like 22); signal transducer||Member of a diversely
expressed predicted peptide family showing sequence similarity to
tobacco Rapid Alkalinization Factor (RALF), and is believed to play an
essential role in the physiology of Arabidopsis. Consists of a single exon
and is characterized by a conserved C-terminal motif and N-terminal
signal peptide.
rubber elongation factor (REF) family protein||
pectinesterase family protein||
unknown protein||
unknown protein||
RCI2B (RARE-COLD-INDUCIBLE 2B)||
GLP8 (GERMIN-LIKE PROTEIN 8); manganese ion binding / nutrient
reservoir||germin-like protein (GLP8)
leucine-rich repeat family protein||
ribosomal protein L12 family protein||
short-chain dehydrogenase/reductase (SDR) family protein||
zinc finger (C3HC4-type RING finger) family protein||
unknown protein||
F-box family protein||
GATL4 (Galacturonosyltransferase-like 4); polygalacturonate 4-alpha-
galacturonosyltransferase/ transferase, transferring glycosyl groups /
transferase, transferring hexosyl groups||Encodes a protein with
putative galacturonosyltransferase activity.
AT-P4H-2 (A. THALIANA P4H ISOFORM 2); oxidoreductase, acting on
paired donors, with incorporation or reduction of molecular oxygen, 2-
oxoglutarate as one donor, and incorporation of one atom each of
oxygen into both donors / procollagen-proline 4-dioxygen||Encodes a
prolyl-4 hydroxylase that can hydroxylate poly(L-proline)and other
proline rich peptides, including those with sequences corresponding to
those in arabinogalactan proteins and extensins.
ATTLP9 (TUBBY-LIKE PROTEIN 9); phosphoric diester hydrolase/ protein
binding / transcription factor||Member of TLP family
CHR11 (CHROMATIN-REMODELING PROTEIN 11); ATP binding / DNA
binding / DNA-dependent ATPase/ helicase/ hydrolase, acting on acid
anhydrides, in phosphorus-containing anhydrides / nucleic acid binding /
nucleosome binding||Encodes a SWI2/SNF2 chromatin remodeling
protein belonging to the ISWI family. Involved in nuclear proliferation
during megagametogenesis and cell expansion in the sporophyte.
Constitutively expressed. RNAi induced loss of function in
megagametogenesis results in female sterility.35S:RNAi plants have
reduced stature.
ATG8H (autophagy 8h); microtubule binding||
SFR2 (SENSITIVE TO FREEZING 2); beta-glucosidase/ hydrolase,
hydrolyzing O-glycosyl compounds||Encodes a protein with beta-
glucosidase activity, mutants show increased sensitivity to freezing
binding||
||
glycoside hydrolase family 28 protein / polygalacturonase (pectinase)
family protein||
unknown protein||
pectate lyase family protein||
UDP-glucose:sterol glucosyltransferase (UGT80A2)||
60S ribosomal protein L13A (RPL13aA)||
sterile alpha motif (SAM) domain-containing protein||
glycosyl hydrolase family 17 protein||
basic helix-loop-helix (bHLH) family protein||
AIR12; extracellular matrix structural constituent||isolated from
differential screening of a cDNA library from auxin-treated root culture.
sequence does not show homology to any known proteins and is
predicted to be extracellular.
AtRABA5b (Arabidopsis Rab GTPase homolog A5b); GTP binding||
unknown protein||
formin homology 2 domain-containing protein / FH2 domain-containing
protein||
small nuclear ribonucleoprotein D1, putative / snRNP core protein D1,
putative / Sm protein D1, putative||
||
ATP binding||
polygalacturonase 3 (PGA3) / pectinase||
polygalacturonase, putative / pectinase, putative||
unknown protein||
unknown protein||
||
leucine-rich repeat transmembrane protein kinase, putative||
LTP6; lipid binding||Predicted to encode a PR (pathogenesis-related)
protein. Belongs to the lipid transfer protein (PR-14) family with the
following      members:        At2g38540/LTP1,        At2g38530/LTP2,
At5g59320/LTP3, At5g59310/LTP4, At3g51600/LTP5, At3g08770/LTP6,
At2g15050/LTP7, At2g18370/LTP8, At2g15325/LTP9, At5g01870/LTP10,
At4g33355/LTP11,           At3g51590/LTP12,         At5g44265/LTP13,
At5g62065/LTP14, At4g08530/LTP15.
yippee family protein||
ATEXO70H3 (exocyst subunit EXO70 family protein H3); protein
binding||A member of EXO70 gene family, putative exocyst subunits,
conserved in land plants. Arabidopsis thaliana contains 23 putative
EXO70 genes, which can be classified into eight clusters on the
phylogenetic tree.
PWWP domain-containing protein||
ATRABE1E (ARABIDOPSIS RAB GTPASE HOMOLOG E1E); GTP binding||
PIP5K9 (PHOSPHATIDYL INOSITOL MONOPHOSPHATE 5 KINASE); 1-
phosphatidylinositol-4-phosphate     5-kinase/ ATP binding /
phosphatidylinositol phosphate kinase||
germin-like protein, putative||
PAP16 (PURPLE ACID PHOSPHATASE 16); acid phosphatase/ protein
serine/threonine phosphatase||
DFC      (DHFS-FPGS       HOMOLOG       C);    tetrahydrofolylpolyglutamate
synthase||Encodes a protein with tetrahydrofolylpolyglutamate synthase
activity that is located in the mitochondrial matrix.
calmodulin, putative||
reticulon family protein||
PAL4 (Phenylalanine ammonia-lyase 4); ammonia ligase/ ammonia-
lyase/ catalytic||
anion-transporting ATPase family protein||
AHB2 (ARABIDOPSIS HAEMOGLOBIN 2); oxygen transporter||class 2
non-symbiotic hemoglobin
CYP77A6; electron carrier/ heme binding / iron ion binding /
monooxygenase/ oxygen binding||member of CYP77A
CPK2 (CALMODULIN-DOMAIN PROTEIN KINASE CDPK ISOFORM 2);
calmodulin-dependent protein kinase/ kinase/ protein serine/threonine
kinase||predicted to encode calcium-dependent protein kinase and is
localized to the ER. Protein is myristoylated in a cell-free extract.
Changing the proposed myristoylated site, G residue in the amino
terminal, to A prevented the meristoylation . The G to A mutation
decreased AtCPK2 membrane association by approximately 50%.
ATNAP7; ATPase, coupled to transmembrane movement of substances /
protein binding / transporter||Plastidic SufC-like ATP-binding
cassette/ATPase essential for Arabidopsis embryogenesis. Involved in
the biogenesis and/or repair of oxidatively damaged Fe朣 clusters.
Expressed in embryos and meristems.
pectinesterase family protein||
pectinesterase, putative||
sad1/unc-84-like 2 family protein||
ASD1          (ALPHA-L-ARABINOFURANOSIDASE                1);      alpha-N-
arabinofuranosidase/ hydrolase, acting on glycosyl bonds / xylan 1,4-
beta-xylosidase||Encodes             a          bifunctional         alpha-l-
arabinofuranosidase/beta-d-xylosidase that belongs to family 51 of
glycoside hydrolases. It may be involved in cell wall modification.
xanthine/uracil permease family protein||
haloacid dehalogenase-like hydrolase family protein||
ATFER2 (ferritin 2); binding / ferric iron binding / oxidoreductase/
transition metal ion binding||
GDSL-motif lipase/hydrolase family protein||
UDP-glucoronosyl/UDP-glucosyl transferase family protein||
fringe-related protein||
GPAT5 (GLYCEROL-3-PHOSPHATE ACYLTRANSFERASE 5); 1-acylglycerol-
3-phosphate O-acyltransferase/ acyltransferase/ organic anion
transmembrane transporter||Encodes a protein with glycerol-3-
phosphate acyltransferase activity, involved in the biosynthesis of
suberin polyester.
CYCB1;3       (CYCLIN     B1;3);    cyclin-dependent        protein    kinase
regulator||Encodes a B-type mitotic cyclin.
2-cys peroxiredoxin, chloroplast (BAS1)||Encodes a 2-Cys peroxiredoxin
(2-Cys PrxA) that contains two catalytic Cys residues.
unknown protein||
chaperonin, putative||
RNA binding||
MS2 (MALE STERILITY 2); fatty acyl-CoA reductase (alcohol-forming)/
oxidoreductase, acting on the CH-CH group of donors, NAD or NADP as
acceptor||Similar to fatty acid reductases.
TET6 (TETRASPANIN6)||Member of TETRASPANIN family
RABA4D (RAB GTPASE HOMOLOG A4D); GTP binding||Encodes
RABA4D, a member of the Arabidopsis RabA4 subfamily of Rab GTPase
proteins. It is transported in exocytic vesicles to the apical tip of pollen
tubes where it appears to promote tip growth. Proper localization of
RabA4d depends on ROP1, RIC3, and RIC4 activity.
cysteine protease inhibitor, putative / cystatin, putative||Encodes a
protein with cysteine proteinase inhibitor activity. Overexpression
increases tolerance to abiotic stressors (i.e.salt,osmitic, cold stress).
PSF2||
FYD||
PGK1       (PHOSPHOGLYCERATE          KINASE        1);    phosphoglycerate
kinase||nuclear phosphoglycerate kinase (PGK1)
catalytic||
auxin-responsive protein-related||
CBS domain-containing protein / transporter associated domain-
containing protein||
hydroxyproline-rich glycoprotein family protein||
RNA binding||
||
CAX2      (CATION      EXCHANGER       2);     calcium:cation      antiporter/
calcium:hydrogen antiporter||low affinity calcium antiporter CAX2
WIP3 (WPP-domain Interacting Protein 3)||
sks11 (SKU5 Similar 11); copper ion binding / oxidoreductase||
sks13 (SKU5 Similar 13); copper ion binding / oxidoreductase||
AGP12 (ARABINOGALACTAN PROTEIN 12)||Encodes a GPI-anchored
arabinogalactan (AG) peptide with a short 'classical' backbone of 10
amino acids, seven of which are conserved among the 4 other
Arabidopsis AG peptides. These peptides may be involved in cell
signaling.
glycosyl hydrolase family 17 protein||
SCL30a; RNA binding / nucleic acid binding / nucleotide
binding||encodes an SC35-like splicing factor of 30 kD that is localized to
the nuclear specks.
oxidoreductase, 2OG-Fe(II) oxygenase family protein||
disease resistance response||
unknown protein||
BGAL1 (Beta galactosidase 1); beta-galactosidase/ catalytic/ cation
binding / heme binding / peroxidase/ sugar binding||beta-galactosidase,
glycosyl hydrolase family 35
endomembrane protein 70, putative||
unknown protein||
RHD3 (ROOT HAIR DEFECTIVE 3); GTP binding||required for regulated
cell expansion and normal root hair development. Encodes an
evolutionarily conserved protein with putative GTP-binding motifs that is
implicated in the control of vesicle trafficking between the endoplasmic
reticulum and the Golgi compartments.
CAX9 (CATION EXCHANGER 9); cation transmembrane transporter/
cation:cation antiporter/ manganese ion transmembrane transporter/
potassium ion transmembrane transporter/ sodium ion transmembrane
transporter||Involved in cation (K, Na and Mn) homeostasis and
transport
FLU (FLUORESCENT IN BLUE LIGHT); binding||Encodes a novel coiled-
coil, TPR domain containing protein that is localized to the chloroplast
membrane and is involved in chlorophyll biosynthesis. Mutants
accumulate protochlorophyllide, an intermediate in the chlorophyll
biosynthesis pathway, in dark and release singlet oxygen in plastids in a
controlled and non-invasive manner upon a dark/light shift.
phosphatidylinositol-4-phosphate 5-kinase family protein||Encodes a
FYVE domain protein containing the following domains: FYVE +
Chaperonin + PIP5K.
unknown protein||
unknown protein||
ATGSL04 (glucan synthase-like 4); 1,3-beta-glucan synthase/
transferase, transferring glycosyl groups||encodes a protein similar to
callose synthase
unknown protein||
CYP72A7; electron carrier/ heme binding / iron ion binding /
monooxygenase/ oxygen binding||putative cytochrome P450
leucine-rich repeat family protein / protein kinase family protein||
ATPPC3         (PHOSPHOENOLPYRUVATE               CARBOXYLASE        3);
phosphoenolpyruvate carboxylase||One of four genes encoding
phosphoenolpyruvate carboxylase, its mRNA is most abundantly
expressed in roots and siliques.
malate dehydrogenase (NAD), mitochondrial, putative||
exonuclease family protein||
unknown protein||
chloroplast 30S ribosomal protein S20, putative||
ERF4 (ETHYLENE RESPONSIVE ELEMENT BINDING FACTOR 4); DNA
binding / protein binding / transcription factor/ transcription
repressor||Encodes a member of the ERF (ethylene response factor)
subfamily B-1 of ERF/AP2 transcription factor family (ATERF-4). The
protein contains one AP2 domain. Acts as a negative regulator of JA-
responsive defense gene expression and resistance to the necrotrophic
fungal pathogen Fusarium oxysporum and antagonizes JA inhibition of
root elongation.
unknown protein||
unknown protein||
peptidyl-prolyl cis-trans isomerase TLP38, chloroplast / thylakoid lumen
PPIase of 38 kDa / cyclophilin / rotamase||
APG8H (AUTOPHAGY 8H); APG8 activating enzyme/ APG8-specific
protease/ Atg8 ligase/ microtubule binding||Encodes APG8, a
component of autophagy conjugation pathway. Delivered to the lumens
of vacuole under nitrogen-starvation condition.
DNA-binding protein, putative||
glycoside hydrolase family 28 protein / polygalacturonase (pectinase)
family protein||
unknown protein||
MBD11; DNA binding / methyl-CpG binding||Protein containing methyl-
CpG-binding domain.Has sequence similarity to human MBD proteins.
PIFI (post-illumination chlorophyll fluorescence increase)||Encodes a
chloroplast-targeted protein localized in the stroma that is a novel
component essential for NDH-mediated non-photochemical reduction of
the plastoquinone pool in chlororespiratory electron transport.
protein binding||
Ran-binding protein 1 domain-containing protein / RanBP1 domain-
containing protein||
||
kinesin motor family protein||
isochorismatase hydrolase family protein||
DELTA-TIP; ammonia transporter/ methylammonium transmembrane
transporter/ water channel||Delta tonoplast intrinsic protein, functions
as a water channel and ammonium (NH3) transporter. Highly expressed
in flower, shoot, and stem. Expression shows diurnal regulation and is
induced by ammonium (NH3). Protein localized to vacuolar membrane.
NDF4 (NDH-DEPENDENT CYCLIC ELECTRON FLOW 1); electron carrier/
iron-sulfur cluster binding||encodes a novel subunit of the chloroplast
NAD(P)H dehydrogenase complex, involved in cyclic electron flow
around photosystem I to produce ATP. Contains a 4Fe-4S cluster.
TRZ4 (TRNASE Z 4); 3'-tRNA processing endoribonuclease/
catalytic||Encodes a tRNase Z.
JR1||JA-responsive gene
KINESIN-13A; ATP binding / microtubule motor||Kinesin-13A localized to
entire Golgi stacks. Involved in trichome development.
nodulin MtN3 family protein||
unknown protein||
ATEBP (ETHYLENE-RESPONSIVE ELEMENT BINDING PROTEIN); DNA
binding / protein binding / transcription activator/ transcription
factor||Encodes a member of the ERF (ethylene response factor)
subfamily B-2 of the plant specific ERF/AP2 transcription factor family
(RAP2.3). The protein contains one AP2 domain. There are 5 members
in this subfamily including RAP2.2 AND RAP2.12.It is localized to the
nucleus and acts as a transcriptional activator through the GCC-box. It
has been identified as a suppressor of Bax-induced cell death by
functional screening in yeast and can also suppress Bax-induced cell
death in tobacco plants. Overexpression of this gene in tobacco BY-2
cells confers resistance to H2O2 and heat stresses. Overexpression in
Arabidopsis causes upregulation of PDF1.2 and GST6. It is part of the
ethylene signaling pathway and is predicted to act downstream of EIN2
and CTR1, but not under EIN3.
60S ribosomal protein L19 (RPL19B)||
COBL8 (COBRA-LIKE PROTEIN 8 PRECURSOR)||
chitinase||
pectinesterase family protein||
transcription factor||
MTO3       (METHIONINE       OVER-ACCUMULATOR          3);   methionine
adenosyltransferase||S-adenosylmethionine synthetase
GPK1; ATP binding / kinase/ protein kinase/ protein serine/threonine
kinase||serine/threonine protein kinase-like protein
hAT dimerisation domain-containing protein||
RelA/SpoT domain-containing protein / calcium-binding EF-hand family
protein||
||
dihydroorotate dehydrogenase family protein / dihydroorotate oxidase
family protein||
RLK902; ATP binding / kinase/ protein serine/threonine kinase||Encodes
a receptor-like kinase found at the cell surface of various tissues. Its
function remains unknown.
aldose 1-epimerase family protein||
C2 domain-containing protein||
HON4; DNA binding||A linker histone like protein
MPK9 (MAP KINASE 9); MAP kinase||MAP KINASE 9
unknown protein||
chaperonin, putative||
oxidoreductase, 2OG-Fe(II) oxygenase family protein||
phosphatidic acid phosphatase family protein / PAP2 family protein||
CYP77A5P; catalytic||a cytochrome P450 pseudogene. the second half of
the gene overlaps perfectly with the other gene model.
||
MKS1 (MAP kinase substrate 1); protein binding||Encodes a nuclear-
localized member of a plant specific gene family involved in mediating
responses to pathogens. Interacts with WRKY transcriptional regulators.
PUB29 (PLANT U-BOX 29); ubiquitin-protein ligase||Encodes a protein
containing a U-box and an ARM domain. This protein has E3 ubiquitin
ligase activity based on in vitro assays.
WNK6 (WITH NO K (=LYSINE) 6); kinase/ protein kinase||Encodes a
member of the WNK family (9 members in all) of protein kinases, the
structural design of which is clearly distinct from those of other known
protein kinases, such as receptor-like kinases and mitogen-activated
protein kinases. Its transcription is under the control of circadian
rhythms.
unknown protein||
transducin family protein / WD-40 repeat family protein||
||
clast3-related||
leucine-rich repeat family protein / extensin family protein||
phospholipase C/ phosphoric diester hydrolase||
cysteine proteinase, putative||
ATCAD4; cinnamyl-alcohol dehydrogenase||Encodes a catalytically active
cinnamyl alcohol dehydrogenase which uses p-coumaryl aldehyde as a
preferred substrate. It can also use caffeyl, coniferyl and d-
hydroxyconiferyl aldehydes as substrates.
reticulon family protein (RTNLB11)||
WD-40 repeat family protein / mitotic checkpoint protein, putative||
unknown protein||
BCAT4       (BRANCHED-CHAIN          AMINOTRANSFERASE4);        catalytic/
methionine-oxo-acid transaminase||Belongs to the branched-chain
amino acid aminotransferase gene family. Encodes a methionine-oxo-
acid transaminase. Involved in the methionine chain elongation pathway
that leads to the ultimate biosynthesis of methionine-derived
glucosinolates.
unknown protein||
SNF2 domain-containing protein / helicase domain-containing protein /
RING finger domain-containing protein||
CYP705A15; electron carrier/ heme binding / iron ion binding /
monooxygenase/ oxygen binding||member of CYP705A
CYP705A21; electron carrier/ heme binding / iron ion binding /
monooxygenase/ oxygen binding||member of CYP705A
leucine-rich repeat transmembrane protein kinase, putative||
auxin-responsive protein, putative||
50S ribosomal protein L18 family||
APUM5 (Arabidopsis Pumilio 5); RNA binding / binding||
structural constituent of ribosome||
aspartate      carabmoyltransferase,     chloroplast      /   aspartate
transcarbamylase        /     ATCase     (PYRB)||encodes      aspartate
carbamoyltransferase catalyzing the second step in the de novo
pyrimidine ribonucleotide biosynthesis
meprin and TRAF homology domain-containing protein / MATH domain-
containing protein||
endoribonuclease L-PSP family protein||
CPK9 (calmodulin-domain protein kinase 9); calmodulin-dependent
protein kinase/ kinase||calmodulin-domain protein kinase CDPK isoform
9 (CPK9)
sugar transporter, putative||
unknown protein||
protein kinase family protein||
plastocyanin-like domain-containing protein||
COBL10 (COBRA-LIKE PROTEIN 10 PRECURSOR)||
protein kinase family protein||
AGP40       (arabinogalactan-protein    40)||Encodes        a  putative
arabinogalactan-protein (AGP40).
PSBTN (photosystem II subunit T)||Encodes photosystem II 5 kD
protein subunit PSII-T. This is a nuclear-encoded gene (PsbTn) which
also has a plastid-encoded paralog (PsbTc).
transducin family protein / WD-40 repeat family protein||
unknown protein||
4CL5 (4-coumarate:CoA ligase 5); 4-coumarate-CoA ligase||The gene
encodes a 4-coumarate coenzyme A ligase being able to use sinapate as
substrate. The catalytic efficiency was in the following (descending)
order: p-coumaric acid, caffeic acid, 5-OH-ferulic acid, ferulic acid and
sinapic acid. At4CL5 was unable to use cinnamic acid as substrate.
Knockout of At4CL5 (4cl5) revealed no effect on syringyl lignin content
indicating that the activity observed does probably not occur in vivo.
4CL2 (4-COUMARATE:COA LIGASE 2); 4-coumarate-CoA ligase||encodes
an isoform of 4-coumarate:CoA ligase (4CL), which is involved in the last
step of the general phenylpropanoid pathway. The catalytic efficiency
was in the following (descending) order: p-coumaric acid, caffeic acid,
ferulic acid, 5-OH-ferulic acid and cinnamic acid. At4CL2 was unable to
use sinapic acid as substrate.
glycolipid transfer protein-related||
BGLU19 (BETA GLUCOSIDASE 19); catalytic/ cation binding / hydrolase,
hydrolyzing O-glycosyl compounds||
||
AHP1 (HISTIDINE-CONTAINING PHOSPHOTRANSMITTER 1); histidine
phosphotransfer kinase||Encodes AHP1, one of the six Arabidopsis
thaliana histidine phosphotransfer proteins (AHPs). AHPs function as
redundant positive regulators of cytokinin signaling. Members of the
AHP gene family include: AT3G21510 (AHP1), AT3G29350 (AHP2),
AT5G39340 (AHP3), AT3G16360 (AHP4), AT1G03430 (AHP5) and
AT1G80100 (AHP6).
unknown protein||
SGP2; GTP binding||Monomeric G protein. Expressed in root epidermal
cells that are destined to become atrichoblasts. Also expressed during
pollen development and in the pollen tube tip.
unknown protein||
UDP-glucoronosyl/UDP-glucosyl transferase family protein||
peroxidase 30 (PER30) (P30) (PRXR9)||
IQD5 (IQ-domain 5); calmodulin binding||
OTU-like cysteine protease family protein||
NRPB5; DNA binding / DNA-directed RNA polymerase||Non-catalytic
subunit common to DNA-dependent RNA polymerases I, II, III and IV;
homologous to budding yeast RPB5.
WNK2 (WITH NO K 2); kinase/ protein kinase||Encodes a member of the
WNK family (9 members in all) of protein kinases, the structural design
of which is clearly distinct from those of other known protein kinases,
such as receptor-like kinases and mitogen-activated protein kinases. Its
transcription is under the control of circadian rhythms.
IGPD;           imidazoleglycerol-phosphate          dehydratase||Encodes
imidazoleglycerolphosphate dehydratase.
hydroxyproline-rich glycoprotein family protein||
unknown protein||
protease inhibitor/seed storage/lipid transfer protein (LTP) family
protein||
protease inhibitor/seed storage/lipid transfer protein (LTP) family
protein||
CEG (CEGENDUO)||
SOL1; transcription factor||CXC domain containing TSO1-like protein 1.
The gene is expressed in stamens, pollen mother cells, and immature
ovules.
LFR (LEAF AND FLOWER RELATED); binding||Armadillo-repeat
containing protein. Involved in leaf and flower development. Located in
nucleus. Broadly expressed throughout vegetative and floral tissues.
CIPK7 (CBL-INTERACTING PROTEIN KINASE 7); ATP binding / kinase/
protein     kinase/    protein    serine/threonine   kinase||Encodes    a
serine/threonine protein kinase with similarities to CBL-interacting
protein kinases, SNF1 and SOS2.
IAA7 (INDOLE-3-ACETIC ACID 7); transcription factor||Transcription
regulator acting as repressor of auxin-inducible gene expression. Plays
role in the control of gravitropic growth and development in light-grown
seedlings. Auxin induces the degradation of the protein in a dosage-
dependent manner in a process mediated by AtRac1. Auxin induced the
relocalization of the protein within the nucleus from a diffused
nucleoplasmic pattern to a discrete particulated pattern named nuclear
protein bodies or NPB in a process also mediated by Rac1. Colocalizes
with SCF, CSN and 26S proteasome components.
||
unknown protein||
lesion inducing protein-related||
unknown protein||
protein kinase, putative||
ckl10 (Casein Kinase I-like 10); ATP binding / kinase/ protein kinase/
protein serine/threonine kinase||
PHO1 (phosphate 1)||mutant is deficient in the transfer of phosphate
from root epidermal and cortical cells to the xylem. encodes protein with
the mainly hydrophilic N-terminal and the C-terminal containing 6
potential membrane-spanning domains.
RFR1 (REF4-related 1)||
dual specificity protein phosphatase (DsPTP1)||
basic helix-loop-helix (bHLH) family protein||
xyloglucan:xyloglucosyl    transferase,     putative    /     xyloglucan
endotransglycosylase, putative / endo-xyloglucan transferase, putative||
||
GRP4 (GLYCINE-RICH RNA-BINDING PROTEIN 4); RNA binding / double-
stranded DNA binding / single-stranded DNA binding||encodes a glycine-
rich RNA binding protein. Gene expression is induced by cold and
reduced by ionic (salt) and non-ionic (mannitol) osmotic stress. Lines
overexpressing the gene are slightly more tolerant to osmotic stress
during germination.
unknown protein||
PMP (PUTATIVE TYPE 1 MEMBRANE PROTEIN)||Encodes a putative
Type 1 membrane protein (PMP).
leucine-rich repeat transmembrane protein kinase, putative||
copper-binding family protein||
ALDH2C4;      3-chloroallyl   aldehyde     dehydrogenase/         aldehyde
dehydrogenase (NAD)/ coniferyl-aldehyde dehydrogenase||Arabidopsis
thaliana aldehyde dehydrogenase AtALDH1a mRNA. a sinapaldehyde
dehydrogenase catalyzes both the oxidation of coniferylaldehyde and
sinapaldehyde forming ferulic acid and sinapic acid, respectively
PLSP1 (plastidic type I signal peptidase 1); peptidase||Encodes a signal
peptidase Plsp1 (plastidic type I signal peptidase 1). Required for
thylakoid development. Functions in the maturation of the 75-kD
component of the translocon at the outer envelope membrane of
chloroplasts and oxygen evolving complex subunit 33 (OE33).
pectate lyase family protein||
AtFaTA (Arabidopsis FatA acyl-ACP thioesterase); acyl carrier/ acyl-[acyl-
carrier-protein] hydrolase||Encodes a FatA acyl-ACP thioesterase
QUA1         (QUASIMODO          1);      polygalacturonate       4-alpha-
galacturonosyltransferase/ transferase, transferring glycosyl groups /
transferase, transferring hexosyl groups||Quasimodo1, encodes a
glycosyltransferase, involved in homogalacturonan biosynthesis; mutant
shows cell adhesion defect and lower wall uronic acid content.
RALFL25 (ralf-like 25); signal transducer||Member of a diversely
expressed predicted peptide family showing sequence similarity to
tobacco Rapid Alkalinization Factor (RALF), and is believed to play an
essential role in the physiology of Arabidopsis. Consists of a single exon
and is characterized by a conserved C-terminal motif and N-terminal
signal peptide.
RALFL26 (ralf-like 26); signal transducer||Member of a diversely
expressed predicted peptide family showing sequence similarity to
tobacco Rapid Alkalinization Factor (RALF), and is believed to play an
essential role in the physiology of Arabidopsis. Consists of a single exon
and is characterized by a conserved C-terminal motif and N-terminal
signal peptide.
LAG1||LAG1 homolog 1
AAPT2                         (AMINOALCOHOLPHOSPHOTRANSFERASE);
phosphatidyltransferase/ phosphotransferase, for other substituted
phosphate groups||aminoalcoholphosphotransferase (AAPT2) mRNA,
complete cds
ABC transporter family protein||
CHUP1 (CHLOROPLAST UNUSUAL POSITIONING 1)||actin binding
protein required for normal chloroplast positioning
unknown protein||
unknown protein||
AP2 domain-containing transcription factor, putative||encodes a member
of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2
transcription factor family. The protein contains one AP2 domain. There
are 12 members in this subfamily including RAP2.11.
HMT-1; homocysteine S-methyltransferase||
universal stress protein (USP) family protein||
mitotic spindle checkpoint protein, putative (MAD2)||
ATPRX Q; antioxidant/ peroxiredoxin||encodes periredoxin Q which
decomposes peroxides and plays a role in the protection of the
photosynthetic apparatus
||
CYP71B37; electron carrier/ heme binding / iron ion binding /
monooxygenase/ oxygen binding||putative cytochrome P450
ATP-dependent RNA helicase, putative||
PHT2;1 (PHOSPHATE TRANSPORTER 2;1); low affinity phosphate
transmembrane transporter||low affinity phosphate transporter
ICE1 (INDUCER OF CBF EXPRESSION 1); DNA binding / transcription
activator/ transcription factor||Encodes a MYC-like bHLH transcriptional
activator that binds specifically to the MYC recognition sequences in the
CBF3 promoter. Mutants are defective in cold-regulated gene
expression. Cold stress triggers protein degradation of nuclear GFPICE1
protein, and the RING finger protein HOS1 is required. Sumoylation of
ICE1 controls CBF3/DREB1A expression and freezing tolerance.
short-chain dehydrogenase/reductase (SDR) family protein||
short-chain dehydrogenase/reductase (SDR) family protein||
||
TSO2 (TSO meaning 'ugly' in Chinese); oxidoreductase/ ribonucleoside-
diphosphate reductase/ transition metal ion binding||Encodes one of the
3 ribonucleotide reductase (RNR) small subunit genes. TSO2
transcription occurs predominantly at the S-phase of the cell cycle and
its expression pattern is consistent with its role in dNDP biosynthesis
during DNA replication in actively dividing cells. Critical for cell cycle
progression, DNA damage repair and plant development.
||
CLC-B (CHLORIDE CHANNEL B); anion channel/ voltage-gated chloride
channel||member of Anion channel protein family
uracil phosphoribosyltransferase, putative / UMP pyrophosphorylase,
putative / UPRTase, putative||
plastocyanin-like domain-containing protein||
cytochrome c1, putative||
unknown protein||
LHCB2.3; chlorophyll binding||Encodes Lhcb2.4. Belongs to the Lhc
super-gene family encodes the light-harvesting chlorophyll a/b-binding
(LHC) proteins that constitute the antenna system of the photosynthetic
apparatus.
NQR (NADPH:QUINONE OXIDOREDUCTASE); FMN reductase||Encodes
NAD(P)H:quinone reductase which is an FMN binding protein that
catalyzes the reduction of quinone substrates to hydroquinones.The
enzyme activity was confirmed by in vitro assay.
kinesin light chain-related||
leucine-rich repeat transmembrane protein kinase, putative||
peroxidase, putative||
||
leucine-rich repeat transmembrane protein kinase, putative||
unknown protein||
ATHMG (ARABIDOPSIS THALIANA HIGH MOBILITY GROUP);
transcription factor||encodes a component of the FAcilitates Chromatin
Transcription (FACT) complex, SSRP1
unknown protein||
unknown protein||
unknown protein||
ABCB19; ATPase, coupled to transmembrane movement of substances /
auxin efflux transmembrane transporter||Belongs to the family of ATP-
binding cassette (ABC) transporters. Also known as AtMDR11 and
PGP19. Possibly regulates auxin-dependent responses by influencing
basipetal auxin transport in the root. Acts upstream of phyA in
regulating hypocotyl elongation and gravitropic response. Exerts
nonredundant, partially overlapping functions with the ABC transporter
encoded by AtPGP1.
avirulence-responsive protein, putative / avirulence induced gene (AIG)
protein, putative||
unknown protein||
pectinesterase family protein||Encodes an atypical pectin methylesterase
that does not require salt for its activity and has a blockwise mode of
pectin demethylesterification.
||pseudogene of F-box family protein
unknown protein||
unknown protein||
pentatricopeptide (PPR) repeat-containing protein||
copper ion binding / oxidoreductase||
emb2076 (embryo defective 2076)||
AFP3 (ABI FIVE BINDING PROTEIN 3)||
COBL2 (COBRA-LIKE PROTEIN 2 PRECURSOR)||
transposable element gene||
||
amino acid transporter family protein||Encodes a putative amino acid
transporter.
ERD5 (EARLY RESPONSIVE TO DEHYDRATION 5); proline
dehydrogenase||Encodes a proline oxidase that is predicted to localize to
the inner mitochondrial membrane, its mRNA expression induced by
high levels of Al and by osmotic stress. The promoter contains an L-
proline-inducible element.
AHA8 (Arabidopsis H(+)-ATPase 8); ATPase||
glycoside hydrolase family 28 protein / polygalacturonase (pectinase)
family protein||
ATA1      (ARABIDOPSIS         TAPETUM   1);    binding     /    catalytic/
oxidoreductase||Arabidopsis homolog of TASSELSEED2. Expressed
specifically in tapetal cells.
auxin-responsive protein-related||
unknown protein||
AtGH9A4 (Arabidopsis thaliana Glycosyl Hydrolase 9A4); catalytic/
hydrolase, hydrolyzing O-glycosyl compounds||
unknown protein||
ribonuclease III family protein||Encodes a ribonuclease III family protein
that is required for endogenous RDR2-dependent siRNA (but not miRNA)
formation.
cysteine proteinase, putative||
MD-2-related lipid recognition domain-containing protein / ML domain-
containing protein||
pyridine nucleotide-disulphide oxidoreductase family protein||
NEK6 ("NIMA (NEVER IN MITOSIS, GENE A)-RELATED 6"); ATP binding
/ kinase/ protein kinase/ protein serine/threonine kinase||Encodes
AtNek5, a member of the NIMA-related serine/threonine kinases (Neks)
that have been linked to cell-cycle regulation in fungi and mammals.
Plant Neks might be involved in plant development processes.Interacts
physically with plant kinesins ARK1 and ARK2. Mutants show defects in
root epidermal cell morphology, trichome branching and other epidermal
cell abnormalities suggesting a rol e in epidermal cell differentiation.
NEK6 co-localizes with cortical microtubules.

NIT3 (NITRILASE 3); indole-3-acetonitrile nitrilase/ indole-3-acetonitrile
nitrile hydratase/ nitrilase||This enzyme catalyzes the hydrolysis of
indole-3-acetonitrile (IAN) to indole-3-acetic acid (IAA) (EC 3.5.5.1) and
IAN to indole-3-acetamide (IAM) at lower levels. It is the only one of
the four Arabidopsis nitrilases whose mRNA levels are strongly induced
when plants experience sulphur deprivation. This enzyme likely
participates in other non-auxin-related metabolic pathways.
||
ADT4 (arogenate dehydratase 4); arogenate dehydratase/ prephenate
dehydratase||Encodes a plastid-localized arogenate dehydratase
involved in phenylalanine biosynthesis. Not less than six genes encoding
ADT were identi&#64257;ed in the Arabidopsis genome: ADT1
[At1g11790]; ADT2 [At3g07630]; ADT3 [At2g27820]; ADT4
[At3g44720]; ADT5 [At5g22630]; and ADT6 [At1g08250].
HDA3 (HISTONE DEACETYLASE 3); histone deacetylase/ nucleic acid
binding / zinc ion binding||Encodes a histone deacetylase. Controls the
development of adaxial/abaxial leaf polarity. Two lines with RNAi-
directed against this gene show reduced Agrobacterium-mediated DNA
transformation of the roots.
XTR8      (XYLOGLUCAN        ENDO-TRANSGLYCOSYLASE-RELATED           8);
hydrolase, acting on glycosyl bonds / xyloglucan:xyloglucosyl
transferase||xyloglucan endo-transglycosylase
scpl48 (serine carboxypeptidase-like 48); serine-type carboxypeptidase||
2-phosphoglycerate kinase-related||
LOX2 (LIPOXYGENASE 2); lipoxygenase||Chloroplast lipoxygenase
required for wound-induced jasmonic acid accumulation in
Arabidopsis.Mutants are resistant to Staphylococcus aureus and
accumulate salicylic acid upon infection.
unknown protein||
TET3 (TETRASPANIN3)||Member of TETRASPANIN family
oxidoreductase, zinc-binding dehydrogenase family protein||
kinesin motor protein-related||
integral membrane family protein / nodulin MtN21-related||
unknown protein||
ATEXLA3 (arabidopsis thaliana expansin-like a3)||member of EXPANSIN-
LIKE. Naming convention from the Expansin Working Group (Kende et
al, 2004. Plant Mol Bio)
ATEXLA1 (ARABIDOPSIS THALIANA EXPANSIN-LIKE A1)||member of
EXPANSIN-LIKE. Naming convention from the Expansin Working Group
(Kende et al, 2004. Plant Mol Bio)
ATHSP17.4||member of the class I small heat-shock protein (sHSP)
family, which accounts for the majority of sHSPs in maturing seeds
glycosyl hydrolase family 17 protein||
unknown protein||
PTAC16 (PLASTID TRANSCRIPTIONALLY ACTIVE 16); binding /
catalytic||
DC1 domain-containing protein||
unknown protein||
cytidine/deoxycytidylate deaminase family protein||
pectinesterase family protein||
TIP5;1 (tonoplast intrinsic protein 5;1); urea transmembrane
transporter/ water channel||Encodes AtTIP5;1, functions as water and
urea channels in pollen.
aldose 1-epimerase family protein||
apolipoprotein D-related||
AHA4;      ATPase/    hydrogen-exporting     ATPase,  phosphorylative
mechanism||mutant has Slight reduction in root and shoot growth;
Exaggerated defects in salt stress; Plasma Membrane H+ ATPase
unknown protein||
haloacid dehalogenase-like hydrolase family protein||
zinc finger (CCCH-type) family protein||
unknown protein||
KING1 (SNF1-RELATED PROTEIN KINASE REGULATORY SUBUNIT
GAMMA 1)||
xyloglucan:xyloglucosyl    transferase,     putative    /     xyloglucan
endotransglycosylase, putative / endo-xyloglucan transferase, putative||
polynucleotide adenylyltransferase family protein / RNA recognition motif
(RRM)-containing protein||
EMB1080 (embryo defective 1080); structural constituent of ribosome||
RNA polymerase III subunit RPC82 family protein||
signal recognition particle 9 kDa protein, putative / SRP9, putative||
pyruvate kinase family protein||Expression of the gene is downregulated
in the presence of paraquat, an inducer of photoxidative stress.
pectinesterase family protein||
SRp34a (Ser/Arg-rich protein 34a); RNA binding / nucleic acid binding /
nucleotide binding||
BAM2 (BARELY ANY MERISTEM 2); ATP binding / protein binding /
protein kinase/ protein serine/threonine kinase||Encodes a CLAVATA1-
related receptor kinase-like protein required for both shoot and flower
meristem function. Very similar to BAM1,with more than 85% a.a.
identity. It has a broad expression pattern and is involved in vascular
strand development in the leaf, control of leaf shape, size and
symmetry, male gametophyte development and ovule specification and
function. Anthers of double mutants (bam1bam2) appeared abnormal at
a very early stage and lack the endothecium, middle, and tapetum
layers. Further analyses revealed that cells interior to the epidermis (in
anther tissue) acquire some characteristics of pollen mother cells
(PMCs), suggesting defects in cell fate specification. The pollen mother-
like cells degenerate before the completion of meiosis, suggesting that
these cells are defective. In addition, the BAM2 expression pattern
supports both an early role in promoting somatic cell fates and a
01,cluster_935,cluster_936,clust
pentatricopeptide (PPR) repeat-containing protein||
BTB/POZ domain-containing protein||
peroxidase, putative||
CYCD3;3 (CYCLIN D3;3); cyclin-dependent protein kinase||Encode
CYCD3;3, a CYCD3 D-type cyclin. Important for determining cell
number in developing lateral organs. Mediating cytokinin effects in
apical growth and development.
nodulation protein-related||
GATL2 (Galacturonosyltransferase-like 2); polygalacturonate 4-alpha-
galacturonosyltransferase/ transferase, transferring glycosyl groups /
transferase, transferring hexosyl groups||Encodes a protein with
putative galacturonosyltransferase activity.
||
PSBO2 (PHOTOSYSTEM II SUBUNIT O-2); oxygen evolving/ poly(U)
binding||Encodes a protein which is an extrinsic subunit of photosystem
II and which has been proposed to play a central role in stabilization of
the catalytic manganese cluster. In <i>Arabidopsis thaliana</i> the
PsbO proteins are encoded by two genes: <i>psbO1</i> and
<i>psbO2</i>. PsbO2 is the minor isoform in the wild-type. Mutants
defective in this gene have been shown to be affected in the
dephosphorylation of the D1 protein of PSII.
COR413-PM2 (COLD-REGULATED 413-PLASMA MEMBRANE 2)||cold
acclimation protein WCOR413-like protein beta form. Transcript is not
detectable.
ATTRX1; oxidoreductase, acting on sulfur group of donors, disulfide as
acceptor||encodes a cytosolic thioredoxin that reduces disulfide bridges
of target proteins by the reversible formation of a disulfide bridge
between two neighboring Cys residues present in the active site.
Thioredoxins have been found to regulate a variety of biological
reactions in prokaryotic and eukaryotic cells.
FG-GAP repeat-containing protein||
DNA binding / nucleic acid binding / protein binding / zinc ion binding||
MUR1 (MURUS 1); GDP-mannose 4,6-dehydratase||Catalyzes the first
step in the de novo synthesis of GDP-L-fucose.
ROP1 (RHO-RELATED PROTEIN FROM PLANTS 1); GTP binding / GTPase
activating protein binding / GTPase/ protein binding||Encodes a pollen-
specific Rop GTPase, member of the Rho family of small GTP binding
proteins that interacts with RIC3 and RIC4 to control tip growth in pollen
tubes. These three proteins promote the proper targeting of exocytic
vesicles in the pollen tube tip. ROP1 activity is regulated by the REN1
GTPase activator protein.
RHD4 (ROOT HAIR DEFECTIVE4); phosphatidylinositol-4,5-bisphosphate
5-phosphatase/ phosphatidylinositol-4-phosphate phosphatase||Encodes
RHD4 (ROOT HAIR DEFECTIVE4), a phosphatidylinositol-4-phosphate
phosphatase required for root hair development.
diacylglycerol acyltransferase family||
LTP5 (Lipid transfer protein 5); lipid transporter||Predicted to encode a
PR (pathogenesis-related) protein. Belongs to the lipid transfer protein
(PR-14) family with the following members:               At2g38540/LTP1,
At2g38530/LTP2, At5g59320/LTP3, At5g59310/LTP4, At3g51600/LTP5,
At3g08770/LTP6, At2g15050/LTP7, At2g18370/LTP8, At2g15325/LTP9,
At5g01870/LTP10,           At4g33355/LTP11,            At3g51590/LTP12,
At5g44265/LTP13, At5g62065/LTP14, At4g08530/LTP15.
macrophage migration inhibitory factor family protein / MIF family
protein||
ATBAG4 (ARABIDOPSIS THALIANA BCL-2-ASSOCIATED ATHANOGENE
4); protein binding||A member of Arabidopsis BAG (Bcl-2-associated
athanogene) proteins, plant homologs of mammalian regulators of
apoptosis. BD domain of ATBAG4 had highest similarity to human DB
domain of BAG protein. Plant BAG proteins are multi-functional and
remarkably similar to their animal counterparts, as they regulate
apoptotic-like processes ranging from pathogen attack, to abiotic stress,
to plant development.
ATG1 (ARABIDOPSIS TRANSMEMBRANE PROTEIN G1P-RELATED
1)||putative transmembrane protein G1p (AtG1) mRNA, complete
CPK13; ATP binding / calcium ion binding / calmodulin-dependent
protein kinase/ kinase/ protein kinase/ protein serine/threonine kinase/
protein tyrosine kinase||member of Calcium Dependent Protein Kinase
CAX3     (CATION      EXCHANGER      3);    calcium:cation    antiporter/
calcium:hydrogen antiporter/ cation:cation antiporter||
binding / transporter||
HMGB1 (HIGH MOBILITY GROUP B 1); DNA binding / chromatin binding
/ structural constituent of chromatin / transcription factor||Encodes a
protein belonging to the subgroup of HMGB (high mobility group B)
proteins that have a distinctive DNA-binding motif, the HMG-box
domain. The motif confers non-sequence specific interaction with linear
DNA and structure-specific binding to distorted DNA sites. The HMGB
proteins are involved in the assembly of nucleoprotein complexes. Can
be phosphorylated by CK2alpha. In interphase cells, HMGB1 is found
throughout the nucleus, whereas in mitotic cells it is not chromatin-
associated.
CAM9 (CALMODULIN 9); calcium ion binding||encodes a divergent
member of calmodulin, which is an EF-hand family of Ca2+-binding
proteins. This gene is expressed in leaves, flowers and siliques. The
gene functionally complements yeast calmodulin 1 (CAM1) but only
when selected against the plasmid harboring wild-type yeast sequences.
Also the protein does not form formed a complex with a basic
amphiphilic helical peptide in the presence of Ca2+ in vitro. Authors
suggest that this gene may represent a Ca2+-binding sensor protein
that interacts with a more limited set of target proteins than do more
conventional CaM isoforms. Mutations in this gene alter plant responses
to abiotic stress and abscisic acid.
zinc finger (CCCH-type) family protein / RNA recognition motif (RRM)-
containing protein||
unknown protein||
unknown protein||
tetratricopeptide repeat (TPR)-containing protein||
DNA binding||
FLA15       (FASCICLIN-LIKE       ARABINOGALACTAN       PROTEIN      15
PRECURSOR)||
harpin-induced family protein / HIN1 family protein / harpin-responsive
family protein||
unknown protein||
40S ribosomal protein S14 (RPS14C)||
AtcwINV2 (Arabidopsis thaliana cell wall invertase 2); hydrolase,
hydrolyzing O-glycosyl compounds||
unknown protein||
ACA1 (ALPHA CARBONIC ANHYDRASE 1); carbonate dehydratase/ zinc
ion binding||
FTSZ2-2; GTP binding / GTPase/ structural molecule||Nuclear gene that
encodes a plastidial division protein (FtsZ2-2).
BGAL2 (beta-galactosidase 2); beta-galactosidase/ catalytic/ cation
binding||
unknown protein||
unknown protein||
FK (FACKEL); delta14-sterol reductase||Encodes a sterol C-14 reductase
required for cell division and expansion and is involved in proper
organization of the embryo.
late embryogenesis abundant protein, putative / LEA protein, putative||
pectate lyase family protein||
cell division cycle protein 48, putative / CDC48, putative||
PAL2; phenylalanine ammonia-lyase||Encodes phenylalanine lyase.
CYP71B5 (CYTOCHROME P450 71B5); electron carrier/ heme binding /
iron ion binding / monooxygenase/ oxygen binding||cytochrome P450
monooxygenase
transducin family protein / WD-40 repeat family protein||
zinc finger (C3HC4-type RING finger) family protein||
60S ribosomal protein L12 (RPL12B)||
AtPPa4 (Arabidopsis thaliana pyrophosphorylase 4); inorganic
diphosphatase||Encodes        a    soluble     protein     with   inorganic
pyrophosphatase activity that is highly specific for Mg-inorganic
pyrophosphate.
unknown protein||
protein kinase family protein||
reticulon family protein (RTNLB12)||
embryo-abundant protein-related||
||
||
ribosomal protein L17 family protein||
SCR (SCARECROW); protein binding / protein homodimerization/
sequence-specific DNA binding / transcription factor||Encodes a member
of a novel family having similarity to DNA binding proteins containing
basic-leucine zipper regions; scr is expressed in cortex/endodermal initial
cells and in the endodermal cell lineage. Regulates the radial
organization of the root. Is required cell-autonomously for distal
specification of the quiescent center, which in turn regulates stem cell
fate of immediately surrounding cells. SCR appears to be a direct target
of SHR.
unknown protein||
||
emb1967 (embryo defective 1967)||
aspartyl protease family protein||
ATEP3; chitinase||encodes an EP3 chitinase that is expressed during
somatic embryogenesis in 'nursing' cells surrounding the embryos but
not in embryos themselves. The gene is also expressed in mature pollen
and growing pollen tubes until they enter the receptive synergid, but not
in endosperm and integuments as in carrot. Post-embryonically,
expression is found in hydathodes, stipules, root epidermis and
emerging root hairs.
SKIP5 (SKP1/ASK-INTERACTING PROTEIN 5)||Encodes an SKP1
interacting partner (SKIP5).
HTA11; DNA binding||Encodes HTA11, a histone H2A protein.
ATHRGP1       (HYDROXYPROLINE-RICH          GLYCOPROTEIN);       structural
constituent of cell wall||Encodes a hydroxyproline-rich glycoprotein.
BZIP25 (BASIC LEUCINE ZIPPER 25); protein heterodimerization/
transcription factor||bZIP transcription factor-like protein mRNA
FBL17; ubiquitin-protein ligase||
GR (GLUTATHIONE REDUCTASE); ATP binding / glutathione-disulfide
reductase||Encodes glutathione reductase that is most likely localized in
the chloroplast.
RNA recognition motif (RRM)-containing protein||
pleckstrin homology (PH) domain-containing protein / lipid-binding
START domain-containing protein||
PIP2;5 (PLASMA MEMBRANE INTRINSIC PROTEIN 2;5); water channel||
vacuolar protein sorting protein, putative||Homologous to yeast VPS33.
Forms a complex with VCL1 and AtVPS11. Involved in vacuolar
biogenesis.
PMR6 (powdery mildew resistant 6); lyase/ pectate lyase||Powdery
mildew resistant mutant encodes a pectate lyase-like protein
ATPDIL1-3 (PDI-LIKE 1-3); protein disulfide isomerase||Encodes a
protein disulfide isomerase-like (PDIL) protein, a member of a multigene
family within the thioredoxin (TRX) superfamily. Transcript levels for this
gene are up-regulated in response to three different chemical inducers
of ER stress (dithiothreitol, beta-mercaptoethanol, and tunicamycin).
Neither AtIRE1-2 nor AtbZIP60 appear to be required for this response.

TON1B (tonneau 1b)||Encodes a protein of unknown function that is
involved in cortical microtubule organization. Mutants exhibit abnormal
cell growth and patterns of division. TON1B appears to be redundant
with TON1A. Encodes a novel protein that is similar to human FOP and
OFD1 centrosomal proteins. Localizes to the preprophase band,
cytoplasm and cell cortex where it is probably associated with the
cortical cytoskeleton. TON1B associates with plant centrin CEN1.
TT5 (TRANSPARENT TESTA 5); chalcone isomerase||Catalyzes the
conversion of chalcones into flavanones. Required for the accumulation
of purple anthocyanins in leaves and stems.
HEXO1 (BETA-HEXOSAMINIDASE 1); beta-N-acetylhexosaminidase/
hexosaminidase/ hydrolase, hydrolyzing O-glycosyl compounds||Encodes
a protein with &#946;-hexosaminidase activity (the enzyme is active
with p-nitrophenyl-&#946;-N-acetylglucosaminide as substrate but
displayed only a minor activity toward p-nitrophenyl-&#946;-N-
acetylgalactosaminide). The enzyme displays no distinct preference for a
specific terminal GlcNAc residue and indeed cleaved the
asialoagalactodabsylglycopeptide GnGn to a mixture of products.
PPL1 (PsbP-like protein 1); calcium ion binding||
unknown protein||
C2 domain-containing protein||
SDIR1 (SALT- AND DROUGHT-INDUCED RING FINGER1); protein
binding / ubiquitin-protein ligase/ zinc ion binding||Encodes an
intracellular membrane localized protein with E3 ligase activity that is
involved in regulation of ABA signaling. Loss of function alleles show
decreased sensitivity to ABA. Overexpression results in increased
sensitivity to ABA.
mitochondrial substrate carrier family protein||
SBPASE (sedoheptulose-bisphosphatase); phosphoric ester hydrolase/
sedoheptulose-bisphosphatase||Encodes        the  chloroplast    enzyme
sedoheptulose-1,7-bisphosphatase (SBPase), involved in the carbon
reduction of the Calvin cycle. Increase in SBPase activity in transgenic
lines accumulate up to 50% more sucrose and starch than wild-type.
CCR3 (ARABIDOPSIS THALIANA CRINKLY4 RELATED 3); kinase||
ATCSLA14; cellulose synthase/ transferase, transferring glycosyl
groups||encodes a gene similar to cellulose synthase
MRLK (MERISTEMATIC RECEPTOR-LIKE KINASE); ATP binding / protein
binding / protein kinase/ protein serine/threonine kinase||Protein kinase
expressed in meristematic cells. Phosphorylates AGL24.
speckle-type POZ protein-related||
CCH (COPPER CHAPERONE); copper chaperone||CCH protein belongs to
a family of eukaryotic proteins that participate in intracellular copper
homeostasis by delivering this metal to the secretory pathway; mainly
located along the vascular bundles of senescing leaves and petioles as
well as in stem sieve elements; hypothesized to have a role in copper
mobilization from decaying organs towards reproductive structures, as a
result of metalloprotein breakdown. The plant-specific C-terminal
domain of the CCH protein forms amyloid-like fibrils in vitro.
tRNA synthetase class I (C) family protein||
leucine-rich repeat transmembrane protein kinase, putative||
unknown protein||
inositol or phosphatidylinositol kinase/ phosphotransferase, alcohol
group as acceptor||
exocyst complex subunit Sec15-like family protein||
F-box family protein-related||
aladin-related / adracalin-related||
PSRP5 (PLASTID-SPECIFIC 50S RIBOSOMAL PROTEIN 5)||
zinc finger (DHHC type) family protein||
SIP2;1; transporter||One of the Major Intrinsic Proteins(MIPs) which
facilitate the passive transport of small molecules across
membranes.Belongs to a family of plant aquaporins.Similar to yeast and
radish aquaporins. Located on ER.
EDA7 (embryo sac development arrest 7)||
N-acetylglucosaminyl transferase component family protein / Gpi1 family
protein||
GTP binding||
INO80 (INO80 ORTHOLOG); ATP binding / DNA binding / helicase/
nucleic acid binding||Encodes the Arabidopsis INO80 ortholog of the
SWI/SNF ATPase family. Functions as a positive regulator of DNA
homologous recombination (HR). In INO80 mutants, the HR frequency
is reduced to 15% of that in the wild-type. Mutation in INO80 does not
affect sensitivity to genotoxic agents and efficiency of T-DNA integration.
INO80 was also shown to regulate a subset of the Arabidopsis
transcriptome.
unknown protein||
ADSS        (ADENYLOSUCCINATE           SYNTHASE);        adenylosuccinate
synthase||encoding adenylosuccinate synthetase (AdSS), the enzyme
involved in the first step of the formation of the purine nucleotide AMP
(conversion of IMP to adenylo-succinate)
glyoxal oxidase-related||
AGP23 (ARABINOGALACTAN-PROTEIN 23)||Encodes a putative
arabinogalactan-protein (AGP23).
SPL15 (SQUAMOSA PROMOTER BINDING PROTEIN-LIKE 15); DNA
binding / transcription factor||Encodes a putative transcriptional
regulator that is involved in the vegetative to reproductive phase
transition. Expression is regulated by MIR156b.
universal stress protein (USP) family protein||
protein kinase family protein||
WRKY69; transcription factor||member of WRKY Transcription Factor;
Group II-e
unknown protein||
pectinesterase family protein||
PIL6 (PHYTOCHROME INTERACTING FACTOR 3-LIKE 6); DNA binding /
transcription factor||Encodes a novel Myc-related bHLH transcription
factor, which physically associated with APRR1/TOC1 and is a member
of PIF3 transcription factor family. Involved in shade avoidance.
Functions as negative regulator of PhyB. Protein levels are modulated by
phytochrome B.
TXR1 (THAXTOMIN A RESISTANT 1)||mutant exhibited resistance to
growth on media containing thaxtomin due to a difference in the rate of
uptake of the toxin.We proposed that TXR1 is a component of, or
regulator of, a dispensable transport mechanism.
GUN4; enzyme binding / tetrapyrrole binding||GUN, genomes
uncoupled, is necessary for coupling the expression of some nuclear
genes to the functional state of the chloroplast. Binds to the magnesium
chelatase complex and promotes formation of the substrate,a
tetrapyrrole signaling molecule. Porphyrin-binding protein           that
enhances the activity of Mg-chelatase. Although required for chlorophyll
accumulation under normal growth conditions, GUN4 is not essential
for chlorophyll synthesis.
ACR4 (ARABIDOPSIS CRINKLY4); kinase/ transmembrane receptor
protein kinase||Encodes a membrane localized protein with similarity to
receptor kinases which is involved in epidermal cell differentiation.
Flowers of mutants have disorganized ovule integument growth and
abnormal sepal margins. In the roots, mutants initiate more lateral roots
but fewer laterals actually emerge due to defects in lateral root
formation. Mutants also display disorganized columella. The root
phenotypes can be traced to abnormalities in asymmetric divisions in the
pericycle and root apex. Conflicting data regarding the role of the
kinase domain- which may or may not be required for function.
Complementation studies indicate that the C-terminal domain is also not
required for signaling function. May be regulated by protein turnover
which is mediated by endocytic processes.
strictosidine synthase family protein||
F-box family protein / jacalin lectin family protein||
glycine-rich protein||
NADP-dependent oxidoreductase, putative||
||
AHA7 (Arabidopsis H(+)-ATPase 7); hydrogen-exporting ATPase,
phosphorylative mechanism||
sec61beta family protein||
VAP (VESICLE ASSOCIATED PROTEIN); protein binding||Encodes VAP27
(for Vesicle-Associated Protein). VAP27 has high homology to the
VAP33 family of SNARE-like proteins from animals. May be involved in
vesicular transport to or from the ER. Located exclusively in limiting
membrane of protein storage vacuoles. Binds SRC2.
unknown protein||
auxin-responsive family protein||
40S ribosomal protein S13 (RPS13A)||
unknown protein||
shaggy-related protein kinase beta / ASK-beta (ASK2)||
LIM domain-containing protein||
PIP1A (PLASMA MEMBRANE INTRINSIC PROTEIN 1A); water channel||a
member of the plasma membrane intrinsic protein subfamily PIP1.
localizes to the plasma membrane and exhibits water transport activity
in Xenopus oocyte. expressed ubiquitously and protein level decreases
slightly during leaf development.
AGP20||
unknown protein||
ADL1B (ARABIDOPSIS DYNAMIN-LIKE 1B); GTP binding / GTPase||
aspartyl protease family protein||
ATHB-12 (ARABIDOPSIS THALIANA HOMEOBOX 12); transcription
activator/ transcription factor||Encodes a homeodomain leucine zipper
class I (HD-Zip I) protein. Loss of function mutant has abnormally
shaped leaves and stems.
protein kinase family protein||
serine protease inhibitor, Kazal-type family protein||
O-methyltransferase family 3 protein||
GLP10 (GERMIN-LIKE PROTEIN 10); manganese ion binding / nutrient
reservoir||germin-like protein (GLP10)
peptidyl-prolyl cis-trans isomerase, chloroplast / cyclophilin / rotamase /
cyclosporin A-binding protein (ROC4)||nuclear-encoded chloroplast
stromal cyclophilin CYP20-3 (also known as ROC4). Protein is tyrosine-
phosphorylated and its phosphorylation state is modulated in response
to ABA in Arabidopsis thaliana seeds.
glycoside hydrolase family 28 protein / polygalacturonase (pectinase)
family protein||
VGDH2 (Vanguard 1 homolog 2); enzyme inhibitor/ pectinesterase||
invertase/pectin methylesterase inhibitor family protein||
F-box family protein||
zinc finger (C2H2 type) family protein||
carboxylesterase/ hydrolase, acting on ester bonds||
ATARFA1E (ADP-ribosylation factor A1E); GTP binding / phospholipase
activator/ protein binding||A member of ARF GTPase family. A thaliana
has 21 members of this family, known to be essential for vesicle coating
and uncoating and functions in GTP-binding. The gene is shown to play
a role in cell division, cell expansion and cellulose production using
antisense construct.
agenet domain-containing protein||
carbohydrate binding||
unknown protein||
glycosyl hydrolase family 3 protein||
XT1 (XYLOSYLTRANSFERASE 1); UDP-xylosyltransferase/ transferase/
transferase,     transferring   glycosyl    groups     /   xyloglucan    6-
xylosyltransferase||Encodes a protein with xylosyltransferase activity,
which is specific for UDP-xylose as donor substrate and for
oligosaccharides with a degree of polymerization >4. Although the
enzyme utilizes either cellopentaose or cellohexaose, its activity is four-
fold higher with cellohexaose as an acceptor compared to cellopentaose.
The enzyme is able to add several xylosyl residues to the acceptor
forming mono-, di- and trixylosylated polysaccharides.
invertase/pectin methylesterase inhibitor family protein||
||
ATGPX5 (glutathione peroxidase 5); glutathione peroxidase||Encodes
glutathione peroxidase.
ubiquitin thiolesterase||
APG1 (ALBINO OR PALE GREEN MUTANT 1); 2-methyl-6-phytyl-1,4-
benzoquinone       methyltransferase/    S-adenosylmethionine-dependent
methyltransferase/      methyltransferase||Encodes       a  MPBQ/MSBQ
methyltransferase located in the chloroplast inner envelope membrane.
Mutant plants lack plastoquinone (PQ), suggesting that the APG1 protein
is involved in the methylation step of PQ biosynthesis. The gene product
is also involved in tocopherol (vitamin E) biosynthesis.
FAD binding / catalytic/ tRNA dihydrouridine synthase||
ALDH22a1 (Aldehyde Dehydrogenase 22a1); 3-chloroallyl aldehyde
dehydrogenase/      oxidoreductase||Encodes       a    putative aldehyde
dehydrogenase. The gene is not responsive to osmotic stress and is
expressed constitutively at a low level in plantlets and root cultures.
ATRPS13A (ARABIDOPSIS THALIANA RIBOSOMAL PROTEIN S13A);
structural constituent of ribosome||Encodes a cytoplasmic ribosomal
protein S13 homologue involved in early leaf development
CRCK2; ATP binding / kinase/ protein kinase/ protein serine/threonine
kinase||high overall homology to CRCK1
MATE efflux family protein||
BAM2 (BETA-AMYLASE 2); beta-amylase||Encodes a chloroplast beta-
amylase. The enzyme activity is very weak compared to BAM1 and
BAM3. Mutant of BAM2 has no visible phenotype.
DEAD/DEAH box helicase, putative||
ADF8 (ACTIN DEPOLYMERIZING FACTOR 8); actin binding||
C2 domain-containing protein||
BSK3 (BR-SIGNALING KINASE 3); ATP binding / binding / kinase/
protein kinase/ protein tyrosine kinase||Encodes BR-signaling kinase 3
(BSK3), one of the three homologous BR-signaling kinases (BSK1,
AT4G35230; BSK2, AT5G46570; BSK3, AT4G00710). Mediates signal
transduction from receptor kinase BRI1 by functioning as the substrate
of BRI1. Plasma membrane localized.
dehydration-responsive protein-related||
60S acidic ribosomal protein P1 (RPP1B)||
iqd17 (IQ-domain 17); calmodulin binding||
ECA2 (ER-TYPE CA2+-ATPASE 2); calcium-transporting ATPase||Type
IIA (SERCA-type) Ca2+ ATPase, catalyzes the efflux of calcium from the
cytoplasm.
unknown protein||
serine protease inhibitor, Kazal-type family protein||
PPOX; protoporphyrinogen oxidase||Encodes protoporphyrinogen
oxidase (PPOX).
chitinase, putative||
WRKY47; transcription factor||member of WRKY Transcription Factor;
Group II-b
SAM-2 (S-ADENOSYLMETHIONINE SYNTHETASE 2); copper ion binding
/ methionine adenosyltransferase||
GPAT3         (GLYCEROL-3-PHOSPHATE           ACYLTRANSFERASE           3);
acyltransferase||Encodes a member of a family of proteins with glycerol-
3-phosphate acyltransferase activity.
PRL (PROLIFERA); ATP binding / DNA binding / DNA-dependent ATPase/
nucleoside-triphosphatase/      nucleotide binding||Member        of the
minichromosome maintenance complex, involved in DNA replication
initiation. Abundant in proliferating and endocycling tissues. Localized in
the nucleus during G1, S and G2 phases of the cell cycle, and are
released into the cytoplasmic compartment during mitosis. Binds
chromatin.
MSH6 (MUTS HOMOLOG 6); damaged DNA binding||encodes a DNA
mismatch repair homolog of human MutS gene, MSH6. There are four
MutS genes in Arabidopsis, MSH2, MSH3, MSH6, and MSH7, which all
act as heterodimers and bind to 51-mer duplexes. MSH2*MSH6 bound
the (+T) substrate strongly, (T/G) well, and (+AAG) no better than it did
a (T/A) homoduplex.
PIT1 (pitchoun 1); protein binding / zinc ion binding||
unknown protein||
zinc finger (MYND type) family protein / programmed cell death 2 C-
terminal domain-containing protein||
invertase/pectin methylesterase inhibitor family protein||
SUS3 (sucrose synthase 3); UDP-glycosyltransferase/ sucrose synthase/
transferase, transferring glycosyl groups||Encodes a protein with
sucrose synthase activity (SUS3).
pectinesterase family protein||
lectin protein kinase family protein||
AAA-type ATPase family protein||
LD (luminidependens); transcription factor||Encodes a nuclear localized
protein with similarity to transcriptional regulators. Recessive mutants
are late flowering. Expression of LFY is reduced in LD mutants.
NADH-ubiquinone oxidoreductase 24 kDa subunit, putative||
tryptophan synthase, alpha subunit, putative||
catalytic||
elongation factor Tu, putative / EF-Tu, putative||
AOP1; oxidoreductase, acting on paired donors, with incorporation or
reduction of molecular oxygen, 2-oxoglutarate as one donor, and
incorporation of one atom each of oxygen into both donors||Encodes a
possible 2-oxoglutarate-dependent dioxygenase that is involved in
glucosinolate biosynthesis. The gene is expressed in all ecotypes
examined but the enzymatic activity has not been determined
experimentally. In Col, there is one copy of this gene (aka AOP1.1) but
Ler contains two copies, AOP1.1 and a tightly linked AOP1.2.
rac GTPase activating protein, putative||
RNA-binding protein, putative||
unknown protein||
GRH1 (GRR1-LIKE PROTEIN 1); auxin binding / protein binding /
ubiquitin-protein ligase||Encodes an F box protein belonging to the TIR1
subfamily. This protein forms SCF complexes with ASK1 and CUL1 and
interacts with Aux/IAA proteins in an auxin-dependent manner. It also
has sequence similarity to the yeast protein GRR1, which is involved in
glucose repression.
coproporphyrinogen III oxidase, putative / coproporphyrinogenase,
putative / coprogen oxidase, putative||
XTH9 (XYLOGLUCAN ENDOTRANSGLUCOSYLASE/HYDROLASE 9);
hydrolase, acting on glycosyl bonds / xyloglucan:xyloglucosyl
transferase||encodes          a         member        of       xyloglucan
endotransglucosylase/hydrolases (XTHs) that catalyze the cleavage and
molecular grafting of xyloglucan chains function in loosening and
rearrangement of the cell wall. Gene is expressed in shoot apex region,
flower buds, flower stalks and internodes bearing flowers.
leucine-rich repeat family protein||
calcium-binding protein, putative||
tic20-IV (TRANSLOCON AT THE INNER ENVELOPE MEMBRANE OF
CHLOROPLASTS 20-IV)||
glycosyltransferase family 14 protein / core-2/I-branching enzyme family
protein||
peroxisomal membrane protein-related||
protein binding||
transposable element gene||pseudogene of unknown protein
EMB2369 (EMBRYO DEFECTIVE 2369); ATP binding / aminoacyl-tRNA
ligase/ leucine-tRNA ligase/ nucleotide binding||
ATPC1; enzyme regulator||One of two genes (with ATPC2) encoding the
gamma subunit of Arabidopsis chloroplast ATP synthase.
||
DES-1-LIKE; oxidoreductase/ sphingolipid delta-4 desaturase||Encodes a
sphingolipid delta4-desaturase, involved in sphingolipid biosynthesis.
Specifically expressed in floral tissues. Knockout mutants were devoid of
sphinga-4,8-dienine in floral tissues.
GSL1 (GLUCAN SYNTHASE-LIKE 1); 1,3-beta-glucan synthase/
transferase, transferring glycosyl groups||encodes a gene similar to
callose synthase
4-coumarate--CoA ligase, putative / 4-coumaroyl-CoA synthase,
putative||Encodes a peroxisomal protein involved in the activation of
fatty acids through esterification with CoA. At4g05160 preferentially
activates fatty acids with medium chain length (C6:0 and C7:0) as well
as even-numbered long-chain fatty acids (C14:0, C16:0 and C18:0).
At4g05160 was also able to catalyze the conversion of OPC-6:0 to its
CoA ester and is therefore thought to be involved in the peroxisomal
&#946;-oxidation steps of jasmonic acid biosynthesis.
ATK5 (ARABIDOPSIS THALIANA KINESIN 5); microtubule motor||ATK5
encodes a kinesin protein involved in microtubule spindle
morphogenesis. It acts as a minus-end directed motor as well as a plus-
end tracking protein (+TIP). Localizes to mitotic spindle midzones and
regions rich in growing plus-ends within phragmoplasts.
ubiquitin family protein||
F-box family protein (FBL20)||
unknown protein||
ATCSLC12 (CELLULOSE-SYNTHASE LIKE C12); cellulose synthase/
transferase, transferring glycosyl groups||encodes a gene similar to
cellulose synthase
KNAT1 (KNOTTED-LIKE FROM ARABIDOPSIS THALIANA); transcription
factor||A member of class I knotted1-like homeobox gene family
(together with KNAT2). Similar to the knotted1 (kn1) homeobox gene of
maize. Normally expressed in the peripheral and rib zone of shoot apical
meristem but not in the leaf primordia. It is also expressed in the fourth
floral whorl, in the region that would become style, particularly in the
cell surrounding the transmitting tissue. No expression was detected in
the first three floral whorls. Expression is repressed by auxin and AS1
which results in the promotion of leaf fate.
nodulin MtN21 family protein||
proline-rich extensin-like family protein||
SAH7||Encodes a protein, expressed in leaves, with similarity to pollen
allergens.
SEC14 cytosolic factor family protein / phosphoglyceride transfer family
protein||
peroxidase, putative||
peroxidase, putative||
APX4      (ASCORBATE          PEROXIDASE        4);     heme   binding     /
peroxidase||Encodes a microsomal ascorbate peroxidase APX4.
Ascorbate peroxidases are enzymes that scavenge hydrogen peroxide in
plant cells. Eight types of APX have been described for Arabidopsis:
three cytosolic (APX1, APX2, APX6), two chloroplastic types (stromal
sAPX, thylakoid tAPX), and three microsomal (APX3, APX4, APX5)
isoforms.
ISA3 (ISOAMYLASE 3); alpha-amylase/ isoamylase||Encodes an
isoamylase-like protein. Mutant studies show that the gene is strongly
involved in starch breakdown. A GUS-protein fusion product was shown
to localize to the surface of chloroplastic structures reminiscent of starch
granules. In the mutants, the chloroplastic &#945;-amylase AMY3 is
upregulated.
AGP10 (ARABINOGALACTAN PROTEIN 10)||Encodes arabinogalactan
protein (AGP10).
||
unknown protein||
AtHSD5 (hydroxysteroid dehydrogenase 5); binding / catalytic/
oxidoreductase||
catalytic/ glucosylceramidase||
wound-responsive family protein||
||
SPT16 (global transcription factor C)||encodes a component of the
FAcilitates Chromatin Transcription (FACT) complex, SPT16.
F-box family protein||
unknown protein||
translation initiation factor IF-2, mitochondrial, putative||
translation initiation factor IF-1, chloroplast, putative||
peroxidase, putative||
EIF3A (EUKARYOTIC TRANSLATION INITIATION FACTOR 3A);
translation initiation factor||Encodes a subunit of eukaryotic initiation
factor 3 (eIF3), a multisubunit complex that is required for binding of
mRNA to 40 S ribosomal subunits, stabilization of ternary complex
binding to 40 S subunits, and dissociation of 40 and 60 S subunits.
bromo-adjacent homology (BAH) domain-containing protein||
||
aminomethyltransferase||
SKU5; copper ion binding / oxidoreductase||Encodes a protein of
unknown function involved in directed root tip growth. It is a member of
19-member gene family and is distantly related structurally to the
multiple-copper oxidases ascorbate oxidase and laccase, though it lacks
the copper-binding domains. The protein is glycosylated and GPI-
anchored. It is localized to the plasma membrane and the cell wall. The
gene is expressed most strongly in expanding tissues.
FLA2 (FASCICLIN-LIKE ARABINOGALACTAN 2)||AF333971 Arabidopsis
thaliana fasciclin-like arabinogalactan-protein 2 (Fla2) mRNA, complete
cds
gamma interferon responsive lysosomal thiol reductase family protein /
GILT family protein||
MHK; ATP binding / kinase/ protein kinase/ protein serine/threonine
kinase/ protein tyrosine kinase||Encodes a member of the cdc2+ family
of protein kinases MHK. Similar to the mak genes of rats. mak encodes
a protein kinase that may play a role in spermatogenesis.
unknown protein||
xyloglucan:xyloglucosyl    transferase,     putative    /     xyloglucan
endotransglycosylase, putative / endo-xyloglucan transferase, putative||
DC1 domain-containing protein||
short-chain dehydrogenase/reductase (SDR) family protein||
unknown protein||
MEE55 (maternal effect embryo arrest 55)||
AMT1;1 (AMMONIUM TRANSPORTER 1;1); ammonium transmembrane
transporter||Encodes a plasma membrane localized ammonium
transporter. Contains a cytosolic trans-activation domain essential for
ammonium uptake.
UNE15 (unfertilized embryo sac 15)||
PRR2 (PINORESINOL REDUCTASE 2); pinoresinol reductase||Encodes a
pinoresinol reductase involved in lignan biosynthesis. Expressed strongly
in roots and less strongly in stems. Shows preference for pinoresinol
and not lariciresinol.
CYP83A1 (CYTOCHROME P450 83A1); oxidoreductase, acting on paired
donors, with incorporation or reduction of molecular oxygen, NADH or
NADPH as one donor, and incorporation of one atom of oxygen / oxygen
binding||Encodes a cytochrome p450 enzyme that catalyzes the initial
conversion of aldoximes to thiohydroximates in the synthesis of
glucosinolates not derived from tryptophan. Also has a role in auxin
homeostasis.
J20 (DNAJ-LIKE 20); heat shock protein binding||DnaJ-like protein
(J20); nuclear gene
unknown protein||
rapid alkalinization factor (RALF) family protein||
MEE48 (maternal effect embryo arrest 48); catalytic/ cation binding /
hydrolase, hydrolyzing O-glycosyl compounds||
transferase, transferring glycosyl groups||
XTR7 (XYLOGLUCAN ENDOTRANSGLYCOSYLASE 7); hydrolase, acting
on glycosyl bonds / hydrolase, hydrolyzing O-glycosyl compounds /
xyloglucan:xyloglucosyl transferase||xyloglucan endotransglycosylase-
related protein (XTR7)
PDS3 (PHYTOENE DESATURASE 3); phytoene dehydrogenase||Encodes
phytoene desaturase (phytoene dehydrogenase), an enzyme that
catalyzes the desaturation of phytoene to zeta-carotene during
carotenoid biosynthesis. Processed protein is localized to the plastid.
CBS domain-containing protein-related||
protein kinase family protein||
unknown protein||
||
IQD19 (IQ-domain 19); calmodulin binding||
TCX2 (TESMIN/TSO1-LIKE CXC 2); transcription factor||
imidazoleglycerol-phosphate dehydratase, putative||
catalytic LigB subunit of aromatic ring-opening dioxygenase family||
CLA1 (CLOROPLASTOS ALTERADOS 1); 1-deoxy-D-xylulose-5-phosphate
synthase||Encodes a protein with 1-deoxyxylulose 5-phosphate synthase
activity involved in the MEP pathway. It is essential for chloroplast
development in Arabidopsis
invertase/pectin methylesterase inhibitor family protein||
ATVAMP724||member of VAMP72 Gene Family
ESD4 (EARLY IN SHORT DAYS 4); SUMO-specific protease/ cysteine-
type peptidase||EARLY IN SHORT DAYS 4 Arabidopsis mutant shows
extreme early flowering and alterations in shoot development. It
encodes a SUMO protease, located predominantly at the periphery of the
nucleus. Accelerates the transition from vegetative growth to flowering.
Probably acts in the same pathway as NUA in affecting flowering time,
vegetative and inflorescence development.
||
pectinesterase family protein||
COBL7 (COBRA-LIKE 7)||putative membrane-anchored cell wall protein
proline-rich family protein||
catalytic/ cation binding       /   hydrolase,    hydrolyzing    O-glycosyl
compounds||
||
ADA2B (HOMOLOG OF YEAST ADA2 2B); DNA binding / transcription
coactivator/ transcription factor||Transcriptional co-activator. Essential
for the developmental switch from cell proliferation to cell differentiation
in response to variations in auxin and cytokinin concentrations.
matrix metalloproteinase, putative||
unknown protein||
arabinogalactan-protein family||
CT-BMY (CHLOROPLAST BETA-AMYLASE); beta-amylase||Encodes a
beta-amylase targeted to the chloroplast. Transgenic BMY8 RNAi lines
fail to accumulate maltose during cold shock suggesting that maltose
accumulation coincides with BMY8 expression. Apart from maltose, the
sugar content of the RNAi lines were similar to wildtype (glucose and
sucrose unaffected).
RABB1C (ARABIDOPSIS RAB GTPASE HOMOLOG B1C); GTP binding /
GTPase||member of RAB gene family
glycosyl hydrolase family 17 protein||
FPS2         (FARNESYL         DIPHOSPHATE           SYNTHASE        2);
dimethylallyltranstransferase/     geranyltranstransferase||Encodes    a
protein with farnesyl diphosphate synthase activity, which catalyzes the
rate limiting step in isoprenoid biosynthesis. Its mRNA is most
abundantly expressed in flowers.
ATMAP70-5 (microtubule-associated proteins 70-5); microtubule
binding||Encodes a microtubule associated protein (MAP70-5).
Expressed in all tissues.
TIP2;2 (TONOPLAST INTRINSIC PROTEIN 2;2); water channel||
phosphoinositide binding||
palmitoyl protein thioesterase family protein||
nuclear RNA-binding protein, putative||
peroxidase, putative||
ATTPS5; protein binding / transferase, transferring glycosyl groups /
trehalose-phosphatase||Encodes an enzyme putatively involved in
trehalose biosynthesis. The protein has a trehalose synthase (TPS)-like
domain that may or may not be active as well as a trehalose
phosphatase (TPP)-like domain.
||
DNA-binding family protein||
APRR2;        transcription     factor/     two-component       response
regulator||Encodes pseudo-response regulator 2 (APRR2).
(S)-2-hydroxy-acid oxidase, peroxisomal, putative / glycolate oxidase,
putative / short chain alpha-hydroxy acid oxidase, putative||
DEG5 (DEGP PROTEASE 5); catalytic/ serine-type endopeptidase/ serine-
type peptidase||Encodes DEG5. Forms a hexamer with DEG8 in the
thylakoid lumen. Involved in the cleavage of photodamaged D2 protein
of photosystem II (PSII).
TCP family transcription factor, putative||
unknown protein||
AtRABA1e (Arabidopsis Rab GTPase homolog A1e); GTP binding||
D-Tyr-tRNA(Tyr) deacylase family protein||
unknown protein||
CIPK12 (CBL-INTERACTING PROTEIN KINASE 12); ATP binding / kinase/
protein kinase/ protein serine/threonine kinase||Encodes CBL-interacting
protein kinase 12 (CIPK12).
transcription termination factor||
IRX1 (IRREGULAR XYLEM 1); cellulose synthase/ transferase,
transferring glycosyl groups||Encodes a member of the cellulose
synthase family involved in secondary cell wall biosynthesis. Mutants
have abnormal xylem formation, reduced cellulose content, and
enhanced drought and osmotic stress tolerance. Mediates resistance
towards bacterial pathogens via ABA. Confers resistance towards
bacterial and fungal pathogens, independent of salicylic acid, ethylene
and jasmonate signaling.
ATP binding / DNA binding / DNA-directed DNA polymerase/ nucleoside-
triphosphatase/ nucleotide binding||
GDSL-motif lipase/hydrolase family protein||
NLM1; arsenite transmembrane transporter/ water channel||an
aquaporin whose expression level is reduced by ABA, NaCl, dark, and
dessication. is expressed at relatively low levels under normal
conditions. Also functions in arsenite transport and tolerance.
ERD3 (early-responsive to dehydration 3)||
ankyrin repeat family protein||
CYP707A1; (+)-abscisic acid 8'-hydroxylase/ oxygen binding||Encodes a
protein with ABA 8'-hydroxylase activity, involved in ABA catabolism.
Member of the CYP707A gene family. CYP707A1 appears to play an
important role in determining the ABA levels in dry seeds. Gene involved
in postgermination growth. Overexpression of CYP707A1 leads to a
decrease in ABA levels and a reduction in after-ripening period to break
dormancy.
pectinacetylesterase family protein||
unknown protein||
ATPP2-A1; carbohydrate binding||encodes a protein similar to phloem
lectin in cucumber and celery. Gene is expressed in the phloem,
predominantly in the companion cells.
lecithin:cholesterol acyltransferase family protein / LACT family protein||
PTAC9 (PLASTID TRANSCRIPTIONALLY ACTIVE 9); single-stranded DNA
binding||
RNA recognition motif (RRM)-containing protein||
vacuolar sorting receptor, putative||
BAM3 (BARELY ANY MERISTEM 3); ATP binding / protein binding /
protein kinase/ protein serine/threonine kinase||Encodes a CLAVATA1-
related receptor kinase-like protein required for both shoot and flower
meristem function. It has a broad expression pattern and is involved in
vascular strand development in the leaf, control of leaf shape, size and
symmetry, male gametophyte development and ovule specification and
function.
subtilase family protein||
NAD-dependent epimerase/dehydratase family protein||
unknown protein||
FAD-binding domain-containing protein||
TUB9; GTP binding / GTPase/ structural molecule||tubulin 9
eukaryotic translation initiation factor 3 subunit 7, putative / eIF-3 zeta,
putative / eIF3d, putative||
PUB8 (PLANT U-BOX 8); binding / protein binding / ubiquitin-protein
ligase/ zinc ion binding||Encodes a U-box/ARM repeat protein required
fore self-incompatibility.
oxidoreductase, zinc-binding dehydrogenase family protein||
sks4 (SKU5 Similar 4); copper ion binding / oxidoreductase||
early-responsive to dehydration protein-related / ERD protein-related||
||Encodes a defensin-like (DEFL) family protein.
unknown protein||
protease inhibitor/seed storage/lipid transfer protein (LTP) family
protein||
APT3 (ADENINE PHOSPHORIBOSYL TRANSFERASE 3); adenine
phosphoribosyltransferase||Encodes                  an              adenine
phosphoribosyltransferase (APT; EC 2.4.2.7), which is a constitutively
expressed enzyme involved in the one-step salvage of adenine to AMP.
APT3 has higher affinity for zeatin, isopentenyladenine and
benzyladenine than APT1 but lower Vmax than APT1.
AtHip1 (Arabidopsis thaliana Hsp70-interacting protein 1); binding||
SMO1-3 (STEROL 4-ALPHA METHYL OXIDASE 1-3); 4,4-dimethyl-
9beta,19-cyclopropylsterol-4alpha-methyl oxidase/ catalytic||Encodes a
member of the SMO1 family of sterol 4alpha-methyl oxidases.
ACR7; amino acid binding||Member of a family of ACT domain
containing proteins . ACT domains are involved in amino acid binding .
zinc finger (AN1-like) family protein||
protein kinase, putative||
ATRBL7 (ARABIDOPSIS RHOMBOID-LIKE PROTEIN 7)||
TET5 (TETRASPANIN5)||Member of TETRASPANIN family
zinc finger (C3HC4-type RING finger) family protein||
hydroxyproline-rich glycoprotein family protein||
fringe-related protein||
disease resistance-responsive family protein / dirigent family protein||
high mobility group (HMG1/2) family protein||
glycoside hydrolase family 28 protein / polygalacturonase (pectinase)
family protein||
||
ATCSLG3; cellulose synthase/ transferase/ transferase, transferring
glycosyl groups||encodes a protein similar to cellulose synthase
YSL1 (YELLOW STRIPE LIKE 1); oligopeptide transporter||Member of a
small family of oligopeptide transporters similar to the yellow stripe locus
of maize (ZmYS1).
transcription initiation factor IIA gamma chain / TFIIA-gamma (TFIIA-
S)||
serine/threonine protein kinase, putative||
unknown protein||
UBP16 (UBIQUITIN-SPECIFIC PROTEASE 16); ubiquitin thiolesterase/
ubiquitin-specific protease/ zinc ion binding||Encodes a ubiquitin-specific
protease. There is no evidence for a phenotype in ubp16-1 mutants,
however, double mutant analysis with ubp15 mutants reveals a role for
UBP16 in plant development and cell proliferation.
APPB1;       enzyme        inhibitor/   pectinesterase/    pectinesterase
inhibitor||Encodes AppB protein (AppB1).
ATHB22 (HOMEOBOX PROTEIN 22); DNA binding / transcription factor||
pectate lyase family protein||
thylakoid lumenal 17.9 kDa protein, chloroplast||
AMY1 (ALPHA-AMYLASE-LIKE); alpha-amylase||Predicted to be secreted
protein based on signalP prediction. Involved in starch mobilization.
Mutants are defective in alpha-amylase activity. (Note: AMY1 has been
found in the literature to be referred to as AMY3, which is not to be
confused with AMY3/At1g69830).
KOW domain-containing protein / D111/G-patch domain-containing
protein||
unknown protein||
transporter, putative||
invertase/pectin methylesterase inhibitor family protein||
DNA-binding protein-related||
||
ADF7 (actin depolymerizing factor 7); actin binding||
FtsJ-like methyltransferase family protein||
pathogenesis-related protein, putative||
allergen V5/Tpx-1-related family protein||
XTR6 (XYLOGLUCAN ENDOTRANSGLYCOSYLASE 6); hydrolase, acting
on glycosyl bonds / hydrolase, hydrolyzing O-glycosyl compounds /
xyloglucan:xyloglucosyl transferase||xyloglucan endotransglycosylase-
related protein (XTR6)
XTR9 (XYLOGLUCAN ENDOTRANSGLYCOSYLASE 9); hydrolase, acting
on glycosyl bonds / hydrolase, hydrolyzing O-glycosyl compounds /
xyloglucan:xyloglucosyl       transferase||Encodes       a  xyloglucan
endotransglycosylase with a clear preference for non-fucosylated
xyloglucan polymer.
unknown protein||
APUM6 (Arabidopsis Pumilio 6); RNA binding / binding||
60S acidic ribosomal protein P3 (RPP3A)||
NFU3; structural molecule||Encodes a protein containing the NFU
domain that may be involved in iron-sulfur cluster assembly. Part of a
five member gene family, more closely related to NFU1 and 2 than to
NFU4 and 5. Targeted to the chloroplast.
peroxidase, putative||
leucine-rich repeat family protein||
CK1 (CASEIN KINASE 1); ATP binding / kinase/ protein kinase/ protein
serine/threonine kinase||Encodes a member of the casein kinase 1
protein family that is expressed in punctate particles at the cell periphery
suggesting possible plasmodesmatal localization.
60S ribosomal protein L31 (RPL31B)||
MIOX4; inositol oxygenase||Encodes a myo-inositol oxygenase.
pyruvate kinase, putative||
fructose-bisphosphate aldolase, cytoplasmic||
immunophilin / FKBP-type peptidyl-prolyl cis-trans isomerase family
protein||
SHV3       (SHAVEN      3);   glycerophosphodiester    phosphodiesterase/
kinase||Glycerophosphoryl diester phosphodiesterase-like protein
involved in cell wall cellulose accumulation and pectin linking. Impacts
root hair, trichome and epidermal cell development.
hydroxyproline-rich glycoprotein family protein||
MAP65-2||
GDSL-motif lipase/hydrolase family protein||
catalytic/ cation binding / hydrolase, hydrolyzing O-glycosyl
compounds||
aspartyl-tRNA synthetase, putative / aspartate--tRNA ligase, putative||
2-oxoacid dehydrogenase family protein||
galactosyltransferase family protein||
TOR1 (TORTIFOLIA 1); microtubule binding||Encodes a novel, plant-
specific microtubule-associated protein that regulates the orientation of
cortical microtubules and the direction of organ growth. The protein
plays a role in control of microtubule dependent anisotropic cell
elongation. spr2 mutant rosette leaves, cauline leaves, roots, petioles
and petals curl in an anticlockwise direction.
thioredoxin family protein||Encodes a protein disulfide isomerase-like
(PDIL) protein, a member of a multigene family within the thioredoxin
(TRX) superfamily. Unlike several other PDI family members, transcript
levels for this gene are not up-regulated in response to three different
chemical inducers of ER stress (dithiothreitol, beta-mercaptoethanol, and
tunicamycin).
late embryogenesis abundant protein-related / LEA protein-related||
CIP7 (COP1-INTERACTING PROTEIN 7); transcription activator||Positive
regulator of light-regulated genes. Novel nuclear protein which requires
light for its high level expression.
unknown protein||
PORB        (PROTOCHLOROPHYLLIDE            OXIDOREDUCTASE            B);
oxidoreductase/      protochlorophyllide      reductase||light-dependent
NADPH:protochlorophyllide oxidoreductase B
unknown protein||
plastocyanin-like domain-containing protein||
unknown protein||
PRA1.H (PRENYLATED RAB ACCEPTOR 1.H)||
unknown protein||
VPS26B (VACUOLAR PROTEIN SORTING 26B)||
CYP709B3; electron carrier/ heme binding / iron ion binding /
monooxygenase/ oxygen binding||member of CYP709B
||
OPT6       (OLIGOPEPTIDE        TRANSPORTER         1);      oligopeptide
transporter||oligopeptide transporter
ACBP2 (ACYL-COA BINDING PROTEIN ACBP 2); acyl-CoA binding / lead
ion binding||Encodes acyl-CoA-binding protein with ankyrin repeats
BGLU9 (BETA GLUCOSIDASE 9); catalytic/ cation binding / hydrolase,
hydrolyzing O-glycosyl compounds||
||
integral membrane family protein||
TET7 (TETRASPANIN7)||Member of TETRASPANIN family
binding||
unknown protein||
unknown protein||
ULT1 (ULTRAPETALA1); DNA binding||Encodes a novel Cys-rich protein
with a B-box like domain that acts as a negative regulator of meristem
cell accumulation in inflorescence and floral meristems as loss-of-
function ult1 mutations cause inflorescence meristem enlargement, the
production of extra flowers and floral organs, and a decrease in floral
meristem determinacy.
NDB1 (NAD(P)H dehydrogenase B1); NADH dehydrogenase/ disulfide
oxidoreductase||
ATEXPB3 (ARABIDOPSIS THALIANA EXPANSIN B3)||putative beta-
expansin/allergen protein. Naming convention from the Expansin
Working Group (Kende et al, 2004. Plant Mol Bio). Involved in the
formation of nematode-induced syncytia in roots of Arabidopsis thaliana.
unknown protein||
hydroxyproline-rich glycoprotein family protein||Encodes a protein with
13.6% proline amino acids that is predicted to localize to the cell wall.
ATA7; lipid transporter||related to lipid transfer proteins
tyrosine decarboxylase, putative||Encodes a stress-induced tyrosine
decarboxylase (TyrDC). Recombinant (His)6-TyrDC expressed in E. coli
catalyzes the conversion of L-tyrosine to tyramine. Recombinant TyrDC
forms tetramers.
glycine-rich protein||
MATE efflux protein-related||
leucine-rich repeat protein kinase, putative||
leucine-rich repeat family protein / extensin family protein||
glycosyl hydrolase family 17 protein||
mitochondrial ATP synthase g subunit family protein||
||
unknown protein||
GDSL-motif lipase/hydrolase family protein||
peroxidase, putative||
||Encodes a protein with similarity to VRN5 and VIN3.Contains both a
fibronectin III and PHD finger domain. VEL1 is a part of a polycomb
repressive complex (PRC2) that is involved in epigenetic silencing of the
FLC flowering locus.
RUXF (SMALL NUCLEAR RIBONUCLEOPROTEIN F)||
MERI5B (meristem-5); hydrolase, acting on glycosyl bonds /
xyloglucan:xyloglucosyl transferase||encodes a protein similar to endo
xyloglucan transferase in sequence. It is also very similar to BRU1 in
soybean, which is involved in brassinosteroid response.
XTH18 (XYLOGLUCAN ENDOTRANSGLUCOSYLASE/HYDROLASE 18);
hydrolase, acting on glycosyl bonds / hydrolase, hydrolyzing O-glycosyl
compounds / xyloglucan:xyloglucosyl transferase||putative xyloglucan
endotransglycosylase/hydrolase, expressed in the mature or basal
regions of both the main and lateral roots, but not in the tip of these
roots where cell division occurs.
XTH19 (XYLOGLUCAN ENDOTRANSGLUCOSYLASE/HYDROLASE 19);
hydrolase, acting on glycosyl bonds / hydrolase, hydrolyzing O-glycosyl
compounds / xyloglucan:xyloglucosyl transferase||putative xyloglucan
endotransglycosylase/hydrolase, expressed throughout both the main
and the lateral root, with intensive expression at the dividing and
elongating regions. Is expressed in lateral root primordia but expression
ceases after lateral root begins to grow.
allergen V5/Tpx-1-related family protein||
EXLB2 (EXPANSIN-LIKE B2 PRECURSOR)||
unknown protein||
transcription factor||
plastocyanin-like domain-containing protein||
40S ribosomal protein S11 (RPS11B)||
FAD6 (FATTY ACID DESATURASE 6); omega-6 fatty acid
desaturase||Chloroplastic enzyme responsible for the synthesis of 16:2
and 18:2 fatty acids from galactolipids, sulpholipids and
phosphatidylglycerol. Uses ferredoxin as electron donor. Gene mutation
resulted in reduced level of unsaturated fatty acids leading to
susceptibility to photoinhibition.
unknown protein||
unknown protein||
||
selenium binding||
pathogenesis-related protein, putative||
RPS6 (RIBOSOMAL PROTEIN S6); structural constituent of
ribosome||Encodes a putative ribosomal protein S6 (rps6).
peroxidase, putative||
WRKY18; transcription factor||Pathogen-induced transcription factor.
Binds W-box sequences in vitro. Forms protein complexes with itself
and with WRKY40 and WRKY60. Constitutive expression of WRKY18
enhanced resistance to P. syringae, but its coexpression with WRKY40 or
WRKY60 made plants more susceptible to both P. syringae and B.
cinerea. WRKY18, WRKY40, and WRKY60 have partially redundant roles
in response to the hemibiotrophic bacterial pathogen Pseudomonas
syringae and the necrotrophic fungal pathogen Botrytis cinerea, with
WRKY18 playing a more important role than the other two.
unknown protein||
plastocyanin-like domain-containing protein||
unknown protein||
||
glycoside hydrolase family 28 protein / polygalacturonase (pectinase)
family protein||
CESA1 (CELLULOSE SYNTHASE 1); cellulose synthase/ transferase,
transferring glycosyl groups||Encodes a cellulose synthase isomer.
CESA1 mutants have cellulose defect in the primary cell wall. Multiple
lines of evidence suggest that CESA1, along with CESA3 and CESA6 are
present in the same plasma membrane complex for cellulose
biosynthesis. lasma membrane complex for cellulose biosynthesis.
peptidyl-prolyl cis-trans isomerase cyclophilin-type family protein||
ATKC1 (ARABIDOPSIS THALIANA K+ RECTIFYING CHANNEL 1); cyclic
nucleotide binding / inward rectifier potassium channel||A member of
the Shaker family of voltage-gated potassium channel subunits. Does
not form functional potassium channel on its own. Involved in down-
regulating AKT1 and KAT1 channel activity by forming heteromers with
AKT1 or KAT1.
ATP binding / kinase/ protein kinase/ protein serine/threonine kinase/
protein tyrosine kinase||
AtLa1 (Arabidopsis thaliana La protein 1); RNA binding||Encodes AtLa1,
a member of the highly abundant phosphoprotein La proteins.
Predominantly localized to the nucleoplasm and was also detected in the
nucleolar cavity. Has RNA binding activity. Required for normal
ribosome biogenesis and embryogenesis.
AtAUR1 (ATAURORA1); histone kinase(H3-S10 specific) / kinase/ protein
serine/threonine kinase||Encodes a member of a family of Ser/Thr
kinases whose activities peak during cell division. Transcripts are
abundant in tissues rich in dividing cells like roots and flowers but are
low or absent in fully expanded leaves and stems. In interphase cells,
the protein is predominantly nuclear. During mitosis, the protein
associates with plant-specific cytoskeletal structures (preprophase band,
phragmoplast, nascent cell plate) that are necessary for cytokinesis as
well as with the microtubule spindle. It specifically phosphorylates Ser10
of histone H3 and colocalizes with phosphorylated histone H3 during
mitosis.
nPAP (NUCLEAR POLY(A) POLYMERASE); nucleotidyltransferase/ protein
binding||Encodes a nuclear poly(A) polymerase.
||
AtGLDP1 (Arabidopsis thaliana glycine decarboxylase P-protein 1);
catalytic/ glycine dehydrogenase (decarboxylating)/ pyridoxal phosphate
binding||
SQD1; UDPsulfoquinovose synthase/ sulfotransferase||involved in
sulfolipid biosynthesis
unknown protein||
F-box family protein (FBL15)||
enzyme inhibitor/ pectinesterase||
ADR1-L1 (ADR1-like 1); ATP binding / protein binding||
dem protein-related / defective embryo and meristems protein-related||
signal peptide peptidase family protein||
DHS2 (3-deoxy-d-arabino-heptulosonate 7-phosphate synthase); 3-
deoxy-7-phosphoheptulonate synthase||Enzyme catalyzing the first
committed step in aromatic amino acid biosynthesis
L-galactose    dehydrogenase      (L-GalDH)||Encodes    a     L-galactose
dehydrogenase, involved in ascorbate biosynthesis
CBS domain-containing protein||
||
protein phosphatase 2C family protein / PP2C family protein||
OST1 (OPEN STOMATA 1); calcium-dependent protein serine/threonine
kinase/ kinase/ protein kinase||Encodes calcium-independent ABA-
activated protein kinase, a member of SNF1-related protein kinases
(SnRK2) whose activity is activated by ionic (salt) and non-ionic
(mannitol) osmotic stress. Mutations disrupted ABA induction of
stomatal closure as well as ABA inhibition of light-induced stomatal
opening. However, regulation of stomatal opening/closing by light or
CO(2) is not affected in these mutants. May act in the interval between
ABA perception and reactive oxygen species production in the ABA
signalling network.
caffeoyl-CoA 3-O-methyltransferase, putative||
unknown protein||
hydrolase||Encodes a member of the SGNH-hydrolase superfamily of
enzymes. The enzymes of the SGNH-hydrolase superfamily facilitate the
hydrolysis of ester, thioester and amide bonds in a range of substrates
including complex polysaccharides, lysophospholipids, acyl-CoA esters
and other compounds.
ATCAD5 (CINNAMYL ALCOHOL DEHYDROGENASE 5); cinnamyl-alcohol
dehydrogenase||Encodes a catalytically active cinnamyl alcohol
dehydrogenase which uses p-coumaryl aldehyde as a preferred
substrate. It can also use sinapyl, caffeyl, coniferyl and d-
hydroxyconiferyl aldehydes as substrates.
protein kinase family protein||
AGB1 (GTP BINDING PROTEIN BETA 1); GTPase/ nucleotide binding /
protein binding||Encodes the heterotrimeric G-protein beta subunit and
is involved in organ shape. A significant fraction of the protein is found
in the ER. Mutants carrying null alleles express similar fruit phenotypes,
as seen in er plants, but differ from er in that the stem is only slightly
shorter than that in the wild type, the pedicel is slightly longer than that
in the wild type, and the leaves are rounder than those in er mutants.
Gene is expressed in all tissues examined, with highest expression level
found in siliques. It is involved in resistance to Plectosphaerella
cucumerina. The predicted protein has two DWD motifs. It can bind to
DDB1a in Y2H assays and may be involved in the formation of a CUL4-
based E3 ubiquitin ligase
COW1 (CAN OF WORMS1); phosphatidylinositol transporter/
transporter||Encodes COW1 (can of worms1), a phosphatidylinositol
transfer protein essential for root hair tip growth. The N-terminus of the
COW1 protein is 32% identical to an essential phosphatidylinositol
transfer protein (PITP), the yeast Sec14 protein (sec14p) while the C-
terminus is 34.5% identical to a late nodulin of Lotus japonicus, Nlj16.
Expression of COW1 complements the growth defect associated with
Sec14p dysfunction in yeast. GFP fused to the COW1 protein specifically
accumulates at the site of root hair outgrowth.
BLH6 (BELL1-LIKE HOMEODOMAIN 6); DNA binding / transcription
factor||
SSR16 (SMALL SUBUNIT RIBOSOMAL PROTEIN 16); structural
constituent of ribosome||Encodes ribosomal protein S16, has embryo-
defective lethal mutant phenotype
unknown protein||
SQS1       (SQUALENE        SYNTHASE       1);     farnesyl-diphosphate
farnesyltransferase||Encodes squalene synthase, which converts two
molecules of farnesyl diphosphate (FPP) into squalene via an
intermediate: presqualene diphosphate (PSPP). It is generally thought to
be one of the key enzymes of sterol biosynthesis, since it catalyzes the
first pathway-specific reaction of the sterol branch of the isoprenoid
pathway.
AVA-P1;    ATPase/     proton-transporting  ATPase,       rotational
mechanism||vacuolar H+-pumping ATPase 16 kDa proteolipid (ava-p1)
SLP2; serine-type peptidase||Serine protease similar to subtilisin.
BGAL11 (beta-galactosidase 11); beta-galactosidase||putative beta-
galactosidase (BGAL11 gene)
LHT7 (Lys/His transporter 7); amino acid transmembrane transporter||
vestitone reductase-related||
unknown protein||
guanine nucleotide exchange family protein||
clathrin adaptor complex small chain family protein||
AKR2 (ANKYRIN REPEAT-CONTAINING PROTEIN 2); protein
binding||Involved in targeting of chloroplast outer membrane proteins to
the chloroplast. Double mutants of AKR2A and the highly homologous
AKR2B have yellow leaves, significantly reduced chloroplast proteins,
and no thylakoid membranes.
protein kinase family protein||
HMGB5 (HIGH MOBILITY GROUP B 5); DNA binding / chromatin binding
/ structural constituent of chromatin / transcription factor||Encodes a
protein belonging to the subgroup of HMGB (high mobility group B)
proteins that have a distinctive DNA-binding motif, the HMG-box
domain. The motif confers non-sequence specific interaction with linear
DNA and structure-specific binding to distorted DNA sites. The HMGB
proteins are involved in the assembly of nucleoprotein complexes.
Cannot be phosphorylated by CK2alpha.
NTL9 (NAC transcription factor-like 9); transcription factor||
CYCB2;2 (Cyclin B2;2); cyclin-dependent protein kinase regulator||
PSAT; O-phospho-L-serine:2-oxoglutarate aminotransferase||Encodes a
phosphoserine aminotransferase which is involved in serine biosynthesis
in the chloroplast which operates via the phosphorylated pathway.
zinc finger (C2H2 type) family protein||
Rho-GTPase-activating protein-related||
protein kinase family protein||
aspartyl protease family protein||
ARAC6 (ARABIDOPSIS RAC-LIKE 6); GTP binding||A member of ROP
GTPases gene family-like. GTP binding protein Arac6.
APX5 (ASCORBATE PEROXIDASE 5); L-ascorbate peroxidase/ heme
binding / peroxidase||Encodes a microsomal ascorbate peroxidase APX5.
Ascorbate peroxidases are enzymes that scavenge hydrogen peroxide in
plant cells. Eight types of APX have been described for Arabidopsis:
three cytosolic (APX1, APX2, APX6), two chloroplastic types (stromal
sAPX, thylakoid tAPX), and three microsomal (APX3, APX4, APX5)
isoforms.
unknown protein||
FAH1 (FERULIC ACID 5-HYDROXYLASE 1); ferulate 5-hydroxylase/
monooxygenase||encodes ferulate 5-hydroxylase (F5H). Involved in
lignin biosynthesis.
ROT3 (ROTUNDIFOLIA 3); oxidoreductase, acting on paired donors, with
incorporation or reduction of molecular oxygen, NADH or NADPH as one
donor, and incorporation of one atom of oxygen / oxygen binding /
steroid hydroxylase||Encodes a cytochrome P-450 gene that is involved
in leaf blade expansion by controlling polar cell expansion in the leaf
length direction. Member of the CYP90C CYP450 family. ROT3 was
shown to be involved in brassinosteroid biosynthesis, most likely in the
conversion step of typhasterol (TY) to castasterone (CS). As 6-deoxo-CS
was unable to restore the phenotype of rot3-1, it has been postulated
that ROT3 might be specifically involved in the conversion of TY to CS in
the C6-oxidation pathway of brassinolide. Recently, CYP90C1 was shown
to catalyse the C-23 hydroxylation of several brassinosteroids (the
enzyme has a broad specificity for 22-hydroxylated substrates).

SFH12 (SEC14-LIKE 12); phosphatidylinositol transporter/ transporter||

BEE2 (BR Enhanced Expression 2); DNA binding / transcription factor||

ATU2AF65A; RNA binding / nucleic acid binding / nucleotide binding||
GGPS1      (GERANYLGERANYL          PYROPHOSPHATE      SYNTHASE       1);
farnesyltranstransferase||Encodes a protein with geranylgeranyl
pyrophosphate synthase activity involved in isoprenoid biosynthesis. The
enzyme appears to be targeted to the chloroplast in epidermal cells and
guard cells of leaves, and in etioplasts in roots.
HSF4 (HEAT SHOCK FACTOR 4); DNA binding / transcription factor/
transcription repressor||encodes a protein whose sequence is similar to
heat shock factors that regulate the expression of heat shock proteins.
Transcript level is increased in response to heat shock. However,
overexpression of this gene did not result in the increase of decrease of
heat shock proteins.
unknown protein||
CYP91A2 (CYTOCHROME P450 MONOOXYGENASE 91A2); electron
carrier/ heme binding / iron ion binding / monooxygenase/ oxygen
binding||Encodes a member of the CYP81F cytochrome P450
monooxygenase subfamily.
||
AGP18 (ARABINOGALACTAN PROTEIN 18)||AGP18 is a lysine-rich
arabinogalactan-protein (AGP) and part of a multi-gene family of
glycoproteins with approx. 50 members. It falls into one subclass with
AGP17 and AGP19, other lysine-rich AGPs. It is expressed in young
leaves, shoots, roots and flowers.
formamidase, putative / formamide amidohydrolase, putative||
AtGRF2       (GROWTHREGULATING          FACTOR        2);    transcription
activator||Growth regulating factor encoding transcription activator. One
of the nine members of a GRF gene family, containing nuclear targeting
domain. Mutants result in smaller leaves indicating the role of the gene
in leaf development. Expressed in root, shoot and flower
EDA40 (embryo sac development arrest 40); protein binding / ubiquitin-
protein ligase/ zinc ion binding||
exostosin family protein||
pde191 (pigment defective 191)||
unknown protein||
phosphoglycerate/bisphosphoglycerate mutase family protein||
vacuolar ATP synthase subunit B, putative / V-ATPase B subunit,
putative / vacuolar proton pump B subunit, putative / V-ATPase 57 kDa
subunit, putative||
monooxygenase, putative (MO2)||
PIS2        (PROBABLE          CDP-DIACYLGLYCEROL--INOSITOL             3-
PHOSPHATIDYLTRANSFERASE 2); phosphotransferase, for other
substituted phosphate groups||
thaumatin, putative||
GRP2 (GLYCINE RICH PROTEIN 2); double-stranded DNA binding /
mRNA binding / nucleic acid binding / single-stranded DNA
binding||Encodes a glycine-rich protein that binds nucleic acids and
promotes DNA melting. Its transcript and protein levels are up-regulated
in response to cold treatment with protein levels peaking earlier in
shoots (~10-14 days) than in roots (~21 days). It is normally expressed
in meristematic regions and developing tissues where cell division
occurs. RNAi and antisense lines with lower levels of CSP2/GRP2
transcripts flower earlier than wild type plants and have some defects in
anther and seed development.
unknown protein||
auxin-responsive protein, putative||
dihydrouridine synthase family protein||
fructose-bisphosphate       aldolase,    putative||Protein  is   tyrosine-
phosphorylated and its phosphorylation state is modulated in response
to ABA in Arabidopsis thaliana seeds.
RD19      (RESPONSIVE        TO     DEHYDRATION        19);  cysteine-type
endopeptidase/ cysteine-type peptidase||Similar to cysteine proteinases,
induced by desiccation but not abscisic acid. Required for RRS1-R
mediated resistance against Ralstonia solanacearum. Interacts with the
R. solanacearum type III effector PopP2. RD19 associates with PopP2
to form a nuclear complex that is required for activation of the RRS1-
R杕ediated resistance response.
protein kinase family protein||
IMPL2 (MYO-INOSITOL MONOPHOSPHATASE LIKE 2); 3'(2'),5'-
bisphosphate nucleotidase/ L-galactose-1-phosphate phosphatase/
inositol or phosphatidylinositol phosphatase/ inositol-1(or 4)-
monophosphatase||Encodes a myo-inositol monophosphatase IMPL2
(myo-Inositol monophosphatase like 2).
SEC14 cytosolic factor, putative / phosphoglyceride transfer protein,
putative||
ATRER1A||Key player of retrieval of ER membrane proteins
CESA2 (CELLULOSE SYNTHASE A2); cellulose synthase/ transferase,
transferring glycosyl groups||Encodes a cellulose synthase isomer,
related to CESA6.
unknown protein||
glycolipid binding / glycolipid transporter||
unknown protein||
immunophilin, putative / FKBP-type peptidyl-prolyl cis-trans isomerase,
putative||
AP2 domain-containing transcription factor, putative||encodes a member
of the DREB subfamily A-6 of ERF/AP2 transcription factor family. The
protein contains one AP2 domain. There are 8 members in this subfamily
including RAP2.4.
MIPS1 (MYO-INOSITOL-1-PHOSTPATE SYNTHASE 1); inositol-3-
phosphate synthase||** Referred to as MIPS2 in Mitsuhashi et al 2008.
myo-inositol-1-phosphate synthase isoform 1.Expressed in leaf, root and
silique. Immunolocaliazation experiments with an antibody recognizing
MIPS1, MIPS2, and MIPS3 showed endosperm localization.
DNAJ heat shock family protein||
NOL1/NOP2/sun family protein||
unknown protein||
ATHB16 (ARABIDOPSIS THALIANA HOMEOBOX PROTEIN 16); sequence-
specific DNA binding / transcription activator/ transcription
factor||Encodes a homeodomain leucine zipper class I (HD-Zip I)
protein.
AGP3 (arabinogalactan-protein 3)||
protein kinase family protein||
beta-galactosidase||
LAC10 (laccase 10); laccase||putative laccase, a member of laccase
family of genes (17 members in Arabidopsis).
basic helix-loop-helix (bHLH) family protein||
||
unknown protein||
macrophage migration inhibitory factor family protein / MIF family
protein||
aldose reductase, putative||
RAPTOR2 (RAPTOR2); binding / nucleotide binding||Encodes one of two
Arabidopsis RAPTOR/KOG1 homologs. RAPTOR proteins are binding
partners of the target of rapamycin kinase that is present in all
eukaryotes and play a central role in the stimulation of cell growth and
metabolism in response to nutrients. Mutations in this gene have no
visible effects on embryo or plant development.
unknown protein||
unknown protein||
unknown protein||
unknown protein||
RPL (REPLUMLESS); DNA binding / sequence-specific DNA binding /
transcription factor||Mutant has additional lateral organs and phyllotaxy
defect. Encodes a homeodomain transcription factor. Has sequence
similarity to the Arabidopsis ovule development regulator Bell1. Binds
directly to the AGAMOUS cis-regulatory element. Its localization to the
nucleus is dependent on the coexpression of either STM or BP.
mitochondrial glycoprotein family protein / MAM33 family protein||
UNE18 (UNFERTILIZED EMBRYO SAC 18); oxysterol binding / sterol
binding||Encodes a protein that binds to beta-sitosterol and localizes to
the ER. The WFDE motif in ORP3a appears to be important for a direct
interaction with PVA12 [Plant VAMP-Associated protein 12]. Mutation of
this motif causes ORP3a to relocalize to the Golgi and cytosol. The
interaction between PVA12 and ORP3a does not appear to be sterol-
dependent.
ATEXPA9 (ARABIDOPSIS THALIANA EXPANSIN A9)||member of Alpha-
Expansin Gene Family. Naming convention from the Expansin Working
Group (Kende et al, 2004. Plant Mol Bio)
NAK; ATP binding / kinase/ protein kinase/ protein serine/threonine
kinase/ protein tyrosine kinase||Encodes a candidate protein kinase NAK
that is similar to the oncogenes met and abl.
unknown protein||
WD-40 repeat family protein||
HTA12; DNA binding||Encodes HTA12, a histone H2A protein.
unknown protein||
60S ribosomal protein L35 (RPL35D)||
unknown protein||
In2-1 protein, putative||
RHL2 (ROOT HAIRLESS 2); ATP binding / DNA binding / DNA
topoisomerase (ATP-hydrolyzing)/ identical protein binding / protein
binding||Involved in the patterning and shape of leaf trichomes.
Encodes the DNA topoisomerase VI SPO11-3, involved in
endoreduplication
pentatricopeptide (PPR) repeat-containing protein||
FLA11||
phototropic-responsive NPH3 family protein||
LAC11 (laccase 11); laccase||putative laccase, a member of laccase
family of genes (17 members in Arabidopsis).
ADK2 (ADENOSINE KINASE 2); adenosine kinase/ copper ion binding /
kinase||Encodes adenosine kinase 2 (ADK2), a typical, constitutively
expressed housekeeping enzyme. Shows a high sequence identity with
ADK1. Involved in salvage synthesis of adenylates and methyl recycling.
Enzyme activity is substantially inhibited in roots, siliques and dry seeds
by an unknown compound. May contribute to cytokinin interconversion.
zinc finger (C3HC4-type RING finger) family protein||
RABC2A (RAB GTPASE HOMOLOG C2A); GTP binding / GTP-dependent
protein binding / myosin XI tail binding||Encodes a member of the Rab
GTPase family of proteins. This protein interacts with the tail region of a
myosin XI protein (AT5G43900) in a GTP-dependent manner.
CFP:RabC2a appears to co-localize with peroxisomes.
permease, cytosine/purines, uracil, thiamine, allantoin family protein||
ATMDAR2; monodehydroascorbate reductase (NADH)||
SBE2.2 (starch branching enzyme 2.2); 1,4-alpha-glucan branching
enzyme||Encodes starch branching enzyme (E.C.2.4.1.18) similar to
SBE2 from maize and rice. Expressed throughout the plant and highest
in seedlings and cauline leaves.
PAN domain-containing protein||
ATCSLA09; mannan synthase/ transferase, transferring glycosyl
groups||encodes a beta-mannan synthase that is required for
agrobacterium-mediated plant genetic transformation involves a complex
interaction between the bacterium and the host plant. 3' UTR is involved
in transcriptional regulation and the gene is expressed in the elongation
zone of the root.
40S ribosomal protein S28 (RPS28B)||
electron carrier||
SDP1 (SUGAR-DEPENDENT1); triacylglycerol lipase||Encodes a
triacylglycerol lipase that is involved in storage lipid breakdown during
seed germination. The mutant plant exhibits a much slower rate of
postgerminative growth than the wild type.
GLU1       (GLUTAMATE         SYNTHASE       1);    glutamate    synthase
(ferredoxin)||Encodes a gene whose sequence is similar to ferredoxin
dependent glutamate synthase (Fd-GOGAT). Expression in leaves is
induced by light and sucrose. Proposed to be involved in
photorespiration and nitrogen assimilation.
phosphate translocator-related||
ACA3 (ALPHA CARBONIC ANHYDRASE 3); carbonate dehydratase/ zinc
ion binding||
anac077 (Arabidopsis NAC domain containing protein 77); DNA binding||

SIM (SIAMESE); cyclin-dependent protein kinase inhibitor||Encodes a
novel nuclear 14-kD protein containing a cyclin binding motif and a motif
found in ICK/KRP cell cycle inhibitor proteins. It is required for
coordinating cell division and cell differentiation during the development
of Arabidopsis trichomes, playing a key role in the mitosis-to-
endoreduplication transition. It interacts with D-type cyclins in vivo.
phosphatase/ protein tyrosine phosphatase||
ACT domain-containing protein||
CAT6 (CATIONIC AMINO ACID TRANSPORTER 6); amino acid
transmembrane transporter/ basic amino acid transmembrane
transporter/ cationic amino acid transmembrane transporter||Encodes a
member of the cationic amino acid transporter (CAT) subfamily of amino
acid polyamine choline transporters. Does not mediate efficient uptake
of basic amino acids in yeast or Xenopus systems but can transport
neutral and acidic amino acid analogs. Expressed in sink tissues.
Induced during infestation of roots by the plant parasitic root-knot
nematode, Meloidogyne incognita. Localized in the plasma membrane.
OFP13 (ARABIDOPSIS THALIANA OVATE FAMILY PROTEIN 13)||
pectinesterase family protein||
TOC34 (TRANSLOCON AT THE OUTER ENVELOPE MEMBRANE OF
CHLOROPLASTS 34); GTP binding||Outer membrane protein that may
function in import of nuclear encoded proteins into the chloroplast.
clathrin adaptor complexes medium subunit-related||
leucine-rich repeat transmembrane protein kinase, putative||
nucleolar matrix protein-related||
monooxygenase, putative (MO3)||
hydrolase, acting on glycosyl bonds / mannosyl-glycoprotein endo-beta-
N-acetylglucosaminidase||
pollen Ole e 1 allergen and extensin family protein||
oxidoreductase, 2OG-Fe(II) oxygenase family protein||
ASA1 (ANTHRANILATE SYNTHASE ALPHA SUBUNIT 1); anthranilate
synthase||ASA1 encodes the alpha subunit of anthranilate synthase,
which catalyzes the rate-limiting step of tryptophan synthesis. ASA1 is
induced by ethylene, and forms a link between ethylene signalling and
auxin synthesis in roots.
DNAJ heat shock N-terminal domain-containing protein||
phosphate translocator-related||
UGT76C1 (UDP-glucosyl transferase 76C1); UDP-glycosyltransferase/ cis-
zeatin        O-beta-D-glucosyltransferase/        cytokinin      7-beta-
glucosyltransferase/ cytokinin 9-beta-glucosyltransferase/ trans-zeatin O-
beta-D-glucosyltransferase/ transferase, transferring gly||
UDP-glucoronosyl/UDP-glucosyl transferase family protein||
UDP-glucoronosyl/UDP-glucosyl transferase family protein||
protease inhibitor/seed storage/lipid transfer protein (LTP) family
protein||
dehydration-responsive protein-related||
tropinone reductase, putative / tropine dehydrogenase, putative||
unknown protein||
NC domain-containing protein||
hydrolase||
proline-rich extensin-like family protein||
proline-rich extensin-like family protein||
unknown protein||
peroxidase, putative||
peroxidase, putative||
PGIP2 (POLYGALACTURONASE INHIBITING PROTEIN 2); protein
binding||Encodes a polygalacturonase inhibiting protein involved in plant
defense response. PGIPs inhibit the activity of pectin degrading enzymes
such as those produced by fungal pathogens. PGIP2 is induced by fungal
infection and methyl jasmonate.
||
proline-rich family protein||
aspartic-type endopeptidase||
zinc finger (C3HC4-type RING finger) family protein||
WRKY26; transcription factor||Encodes WRKY DNA-binding protein 26
(WRKY26).
PRA1.B6 (PRENYLATED RAB ACCEPTOR 1.B6)||
protease inhibitor/seed storage/lipid transfer protein (LTP) family
protein||
AML4 (ARABIDOPSIS MEI2-LIKE 4); RNA binding / nucleic acid binding /
nucleotide binding||AML4 A member of mei2-like gene family,
predominantly plant-based family of genes encoding RNA binding
proteins with characteristic presence of a highly conserved RNA binding
motif first described in the mei2 gene of the fission yeast S. pombe. In
silico analyses reveal nine mei2 -like genes in A. thaliana. They were
grouped into four distinct clades, based on overall sequence similarity
and subfamily-specific sequence elements. AML4 is a member of two
sister clades of mei2-like gene family, AML1 through AML5, and belongs
to the clade named ALM14. AML4 is expressed during embryo
development (heart and torpedo stage) and in vegetative and floral
apices.
mitochondrial substrate carrier family protein||
ATRBOHA (respiratory burst oxidase homolog A); calcium ion binding||
pectinesterase family protein||
pectinesterase family protein||
GDH2 (GLUTAMATE DEHYDROGENASE 2); ATP binding / glutamate
dehydrogenase         [NAD(P)+]/      glutamate dehydrogenase/
oxidoreductase||Encodes the alpha-subunit of the glutamate
dehydrogenase. The enzyme is almost exclusively found in the
mitochondria of stem and leaf companion cells.
GRP17 (GLYCINE RICH PROTEIN 17); lipid binding||encodes a glycine-
rich protein that has oleosin domain and is expressed specifically during
flower stages 10 to 12. Protein is found on mature pollen coat.
GRP20 (GLYCINE-RICH PROTEIN 20); lipid binding / nutrient
reservoir||Lipid-binding oleosins, glycine-rich protein.
||
leucine-rich repeat family protein||
E13L3 (GLUCAN ENDO-1,3-BETA-GLUCOSIDASE-LIKE PROTEIN 3);
callose binding / polysaccharide binding||Encodes a member of the X8-
GPI family of proteins. It localizes to the plasmodesmata and binds
callose.
||
TCP17 (TCP DOMAIN PROTEIN 17); transcription factor||TCP gene
involved in heterochronic control of leaf differentiation.
SYP132 (SYNTAXIN OF PLANTS 132); SNAP receptor||member of SYP13
Gene Family
L-asparaginase / L-asparagine amidohydrolase||
DEAD/DEAH box helicase, putative||
MIR834a; miRNA||Encodes a microRNA of unknown function. MicroRNAs
are regulatory RNAs with a mature length of ~21-nucleotides that are
processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can
negatively regulate gene expression by attenuating translation or by
directing         mRNA           cleavage.         Mature        sequence:
UGGUAGCAGUAGCGGUGGUAA
unknown protein||
D111/G-patch domain-containing protein||
positive transcription elongation factor/ zinc ion binding||
calcium-binding EF hand family protein||
DEAD box RNA helicase (RH26)||
FLS (FLAVONOL SYNTHASE); flavonol synthase||Encodes a flavonol
synthase that catalyzes formation of flavonols from dihydroflavonols.
GTP-binding protein LepA, putative||
2-oxoisovalerate dehydrogenase, putative / 3-methyl-2-oxobutanoate
dehydrogenase,       putative     /   branched-chain      alpha-keto   acid
dehydrogenase E1 alpha subunit, putative||
anac082 (Arabidopsis NAC domain containing protein 82); transcription
factor||
RAB GDP-dissociation inhibitor||
AtPPa6 (Arabidopsis thaliana pyrophosphorylase 6); inorganic
diphosphatase/ pyrophosphatase||Encodes a protein with inorganic
pyrophosphatase activity.
PMDH2 (peroxisomal NAD-malate dehydrogenase 2); malate
dehydrogenase||encodes         a    microbody     NAD-dependent      malate
dehydrogenase encodes an peroxisomal NAD-malate dehydrogenase
that is involved in fatty acid beta-oxidation through providing NAD to the
process of converting fatty acyl CoA to acetyl CoA.
transcription elongation factor-related||
leucine-rich repeat transmembrane protein kinase, putative||
TGA4 (TGACG MOTIF-BINDING FACTOR 4); DNA binding / calmodulin
binding / transcription factor||Encodes a member of basic leucine zipper
transcription gene family. Nomenclature according to Xiang, et al.
(1997).
FLC (FLOWERING LOCUS C); specific transcriptional repressor/
transcription factor||MADS-box protein encoded by FLOWERING LOCUS
C - transcription factor that functions as a repressor of floral transition
and contributes to temperature compensation of the circadian clock.
Expression is downregulated during cold treatment. Vernalization, FRI
and the autonomous pathway all influence the state of FLC chromatin.
Histone H3 trimethylation at lysine 4 and histone acetylation are
associated with active FLC expression, whereas histone deacetylation
and histone H3 dimethylation at lysines 9 and 27 are involved in FLC
repression. Expression is also repressed by two small RNAs (30- and 24-
nt) complementary to the FLC sense strand 3?to the polyA site. The
small RNAs are most likely derived from an antisense transcript of FLC.
Interacts with SOC1 and FT chromatin in vivo. Member of a protein
complex.
AST68; sulfate transmembrane transporter||Encodes a low-affinity
sulfate transporter expressed in the root cap and central cylinder, where
it is induced by sulfur starvation. Expression in the shoot vascular
system is not induced by sulfur starvation.
transporter-related||
unknown protein||
histone H3||
AGP4 (ARABINOGALACTAN PROTEIN 4)||Encodes arabinogalactan-
protein (AGP4).
CYCD4;2 (cyclin d4;2); cyclin-dependent protein kinase||Encodes a
cyclin involved in cell proliferation during stomatal cell lineage
development.
kinesin motor protein-related||
peptidase M3 family protein / thimet oligopeptidase family protein||
glycosyl hydrolase family 3 protein||
unknown protein||
protein phosphatase 2C-related / PP2C-related||
unknown protein||
ATER||enhancer of rudimentary homolog ATER
zinc finger (C2H2 type) family protein||
histone H3||
||
KNAT4 (KNOTTED1-LIKE HOMEOBOX GENE 4); transcription activator/
transcription factor||A member of Class II KN1-like homeodomain
transcription factors (together with KNAT3 and KNAT5), with greatest
homology to the maize knox1 homeobox protein. Expression regulated
by light. Detected in all tissues examined, but most prominent in leaves
and young siliques. Transient expression of GFP translational fusion
protein suggests bipartite localization in nucleus and cytoplasm. KNAT4
promoter activity showed cell-type specific pattern along longitudinal
root axis; GUS expression pattern started at the elongation zone,
predominantly in the phloem and pericycle cells, extending to
endodermis toward the base of the root.
serine-rich protein-related||
SYTD||
ATGLR2.6; intracellular ligand-gated ion channel||member of Putative
ligand-gated ion channel subunit family
oxygen-evolving complex-related||
ATNADP-ME2 (NADP-malic enzyme 2); malate dehydrogenase
(oxaloacetate-decarboxylating)        (NADP+)/       malic      enzyme/
oxidoreductase, acting on NADH or NADPH, NAD or NADP as
acceptor||The malic enzyme (EC 1.1.1.40) encoded by AtNADP-ME2 is
presumably a cytosolic enzyme involved in malate metabolism and
possibly assisting the oxidative pentose phosphate pathway. AtNADP-
ME2 counts for the major part of NADP-ME activity in mature tissues of
Arabidopsis.
NADH-ubiquinone oxidoreductase 20 kDa subunit, mitochondrial||
||
AT-HSP17.6A (ARABIDOPSIS THALIANA HEAT SHOCK PROTEIN 17.6A);
unfolded protein binding||Encodes a cytosolic small heat shock protein
with chaperone activity that is induced by heat and osmotic stress and is
also expressed late in seed development.
PDE149 (PIGMENT DEFECTIVE 149)||
unknown protein||
TUB6       (BETA-6       TUBULIN);       structural   constituent     of
cytoskeleton||Encodes a beta-tubulin. Expression of TUB6 has been
shown to decrease in response to cold treatment.
DGS1 (DGD1 SUPPRESSOR 1)||Encodes a mitochondrial outer
membrane protein, involved in galactoglycerolipid biosynthesis. The
dgd1 mutant phenotype is suppressed in the dgs1 mutant background.
unknown protein||
MYB46 (MYB DOMAIN PROTEIN 46); DNA binding / transcription
factor||Member of the R2R3 factor gene family.
proline-rich family protein||
unknown protein||
rcd1-like cell differentiation protein, putative||
unknown protein||
unknown protein||
||
ANAC083 (ARABIDOPSIS NAC DOMAIN CONTAINING PROTEIN 83);
transcription factor||
||
JAZ10 (JASMONATE-ZIM-DOMAIN PROTEIN 10)||Plants overexpressing
At5g13220.3, but not At5g13220.1 showed enhanced insensitivity to
MeJa, whereas RNAi constructs for At5g13220.3 increased MeJA
sensitivity. This isoform modifies growth in response to wounding in a
process that requires jasmonate signaling.
ATP synthase delta chain, mitochondrial, putative / H(+)-transporting
two-sector ATPase, delta (OSCP) subunit, putative||
AAC2 (ADP/ATP carrier 2); ATP:ADP antiporter/ binding||Encodes
mitochondrial ADP/ATP carrier
hydrolase, alpha/beta fold family protein||
EXGT-A4 (ENDOXYLOGLUCAN TRANSFERASE A4); hydrolase, acting on
glycosyl bonds / hydrolase, hydrolyzing O-glycosyl compounds /
xyloglucan:xyloglucosyl         transferase||EXGT-A4,      endoxyloglucan
transferase,
glycosyl hydrolase family 38 protein||
translocon-associated protein beta (TRAPB) family protein||
unknown protein||
peroxidase, putative||
unknown protein||
AtMYB40 (myb domain protein 40); DNA binding / transcription
factor||Member of the R2R3 factor gene family.
AGP6 (Arabinogalactan proteins 6)||Encodes an arabinogalactan protein
that is expressed in pollen, pollen sac and pollen tube. Loss of AGP6
function results in decreased fertility due to defects in pollen tube
growth.
ATP binding / ATP-dependent helicase/ helicase/ nucleic acid binding /
protein binding||
SK13 (SHAGGY-LIKE KINASE 13); ATP binding / protein kinase/ protein
serine/threonine kinase||
CA2 (CARBONIC ANHYDRASE 2); carbonate dehydratase/ zinc ion
binding||Encodes a beta carbonic anhydrase likely to be localized in the
cytoplasm. Expression of its mRNA is seen in etiolated seedlings and
points to a possible nonphotosynthetic role for this isoform.
P5CR (PYRROLINE-5- CARBOXYLATE (P5C) REDUCTASE); pyrroline-5-
carboxylate reductase||Delta 1-pyrroline-5-carboxylate reductase,
catalyzes the final step in proline biosynthesis from glutamate and
ornithine.In situ hybridization indicated that under normal growth
conditions, the highest concentration of P5CR transcripts occurs in the
cortical parenchyma, phloem, vascular cambium and pith parenchyma in
the vicinity of the protoxylem. Single gene in Arabidopsis.
NHL repeat-containing protein||
lyase/ pectate lyase||
aldose 1-epimerase family protein||
peroxidase, putative||
GASA4 (GAST1 PROTEIN HOMOLOG 4)||gibberellin-regulated (GASA4)
DND1 (DEFENSE NO DEATH 1); calcium channel/ calmodulin binding /
cation channel/ cyclic nucleotide binding / intracellular cAMP activated
cation channel/ intracellular cyclic nucleotide activated cation channel/
inward rectifier potassium channel||'defense, no death' gene (DND1)
encodes a mutated cyclic nucleotide-gated cation channel; Same as
CNGC2 (article ID 229): Cyclic nucleotide gated channel, activated by
cAMP, conducts K+ and other monovalent cations but excludes Na+,
does not contain the GYG amino acid sequence found in other channels
with this conductivity profile. Conducts Ca2+ into cells which is linked to
the generation of NO and the NO signaling pathway involved in the
innate immune response to pathogens.
MUB2 (MEMBRANE-ANCHORED UBIQUITIN-FOLD PROTEIN 2)||
UDP-glucose 6-dehydrogenase, putative||
SP1L4 (SPIRAL1-LIKE4)||SPIRAL1-LIKE4 belongs to a six-member gene
family in Arabidopsis; all members share high sequence similarity in
amino- and carboxy-terminal regions. Regulates cortical microtubule
organization. Mutant plants exhibit altered patterns of root, leaf and
petal growth as a result of defective anisotropic cell expansion.
proteasome family protein||
serine/threonine protein kinase, putative||
AtbZIP3 (Arabidopsis thaliana basic leucine-zipper 3); DNA binding /
transcription factor||
GRF5 (GENERAL REGULATORY FACTOR 5); ATP binding / protein
binding / protein phosphorylated amino acid binding||Encodes GF14
upsilon chain, a 14-3-3 gene family member.
40S ribosomal protein S7 (RPS7C)||
ATCSLA11; cellulose synthase/ transferase, transferring glycosyl
groups||encodes a gene similar to cellulose synthase
RNA recognition motif (RRM)-containing protein||
SYN4 (SISTER CHROMATID COHESION 1 PROTEIN 4)||Encodes a
SCC1/REC8 ortholog that may be involved in mitosis and may represent
a mitotic cohesin.
||
protein kinase family protein||
reversibly glycosylated polypeptide, putative||
LRR1; ATP binding / kinase/ protein serine/threonine kinase||
unknown protein||
DHAR3 (dehydroascorbate reductase 1); glutathione dehydrogenase
(ascorbate)||The protein undergoes thiolation following treatment with
the oxidant tert-butylhydroperoxide.
CSLD2 (CELLULOSE-SYNTHASE LIKE D2); cellulose synthase/
transferase, transferring glycosyl groups||encodes a gene similar to
cellulose synthase. Located in golgi membranes.
unknown protein||
phytoene synthase (PSY) / geranylgeranyl-diphosphate geranylgeranyl
transferase||Encodes phytoene synthase.
tetratricopeptide repeat (TPR)-containing protein||
UTP--glucose-1-phosphate uridylyltransferase, putative / UDP-glucose
pyrophosphorylase, putative / UGPase, putative||
pyruvate decarboxylase family protein||
IRX3 (IRREGULAR XYLEM 3); cellulose synthase||Encodes a xylem-
specific cellulose synthase that is phosphorylated on one or more serine
residues (on either S185 or one of S180 or S181).
APC1 (ARABIDOPSIS POLLEN CALCIUM-BINDING PROTEIN 1); calcium
ion binding||
BolA-like family protein||
unknown protein||
||
EMB1241 (embryo defective 1241); adenyl-nucleotide exchange factor/
chaperone binding / protein binding / protein homodimerization||
peroxidase 57 (PER57) (P57) (PRXR10)||
PSRP6 (PLASTID-SPECIFIC 50S RIBOSOMAL PROTEIN 6)||plastid-
specific ribosomal protein 6 precursor (Psrp-6) - like
GDH1 (GLUTAMATE DEHYDROGENASE 1); ATP binding / glutamate
dehydrogenase [NAD(P)+]/ oxidoreductase||Encodes the 43 kDa alpha-
subunit of the glutamate dehydrogenase with a putative mitochondrial
transit polypeptide and NAD(H)- and alpha-ketoglutarate-binding
domains. Mitochondrial localization confirmed by subcellular
fractionation. Combines in several ratios with GDH2 protein (GDH-beta)
to form seven isoenzymes. Catalyzes the cleavage of glycine residues.
May be involved in ammonia assimilation under conditions of inorganic
nitrogen excess. The enzyme is almost exclusively found in the
mitochondria of stem and leaf companion cells.
unknown protein||
unknown protein||
PIR121; transcription activator||distorted trichomes and exhibits a
diffuse actin cytoskeleton
unknown protein||
curculin-like (mannose-binding) lectin family protein||
||
nucleic acid binding / zinc ion binding||
GTP1/OBG family protein||
kelch repeat-containing protein||
CHR17 (CHROMATIN REMODELING FACTOR17); ATP binding / DNA
binding / DNA-dependent ATPase/ helicase/ hydrolase, acting on acid
anhydrides, in phosphorus-containing anhydrides / nucleic acid binding /
nucleosome binding||
BMY3; beta-amylase/ catalytic/ cation binding||putative beta-amylase
BMY3 (BMY3)
F-box family protein||
SPL7 (SQUAMOSA PROMOTER BINDING PROTEIN-LIKE 7); DNA binding
/ transcription factor||Encodes a member of the Squamosa Binding
Protein family of transcriptional regulators. SPL7 is expressed highly in
roots and appears to play a role in copper homeostasis. Mutants are
hypersensitive to copper deficient conditions and display a retarded
growth phenotype. SPL7 binds to the promoter of the copper responsive
miRNAs miR398b and miR389c.
protein kinase family protein||
pectinesterase family protein||
unknown protein||
unknown protein||
unknown protein||
homeotic gene regulator, putative||
STT3A (STAUROSPORIN AND TEMPERATURE SENSITIVE 3-LIKE A);
oligosaccharyl transferase||encodes an oligosaccharyl transferase
involved response to high salt. Mutants are hypersensitive to high salt
conditions
hydroxyproline-rich glycoprotein family protein||
peroxidase, putative||
integral membrane family protein||
protein kinase family protein||
unknown protein||
PI (PISTILLATA); DNA binding / transcription factor||Floral homeotic
gene encoding a MADS domain transcription factor. Required for the
specification of petal and stamen identities.
HHP1         (HEPTAHELICAL          TRANSMEMBRANE        PROTEIN1);
receptor||heptahelical transmembrane protein homologous to human
adiponectin receptors and progestin receptors
beta-1,3-glucanase, putative||
oxidoreductase, 2OG-Fe(II) oxygenase family protein||encodes a protein
whose sequence is similar to flavanone 3 hydroxylase from Malus.
oxidoreductase, 2OG-Fe(II) oxygenase family protein||
RBX1 (RING-BOX 1); protein binding||Encodes a ring-box 1 like protein
and component of the SCF ubiquitinization complex mediating auxin
responses. Forms a E3 ubiquitin ligase complex with CUL3A and
At1g21780.1 a BTB domain protein.
UBQ4; protein binding||encodes a ubiquitin polyprotein.
senescence-associated protein-related||
BGAL7 (beta-galactosidase 7); beta-galactosidase||
NPH4 (NON-PHOTOTROPHIC HYPOCOTYL); DNA binding / transcription
activator/ transcription factor/ transcription regulator||Encodes an auxin-
regulated transcriptional activator. Activates expression of IAA1 and
IAA9 in the presence of auxin. Mutants affect blue light and gravitropic
and auxin mediated growth responses. Together with AUX19, it is
involved in the response to ethylene. In the arf7 arf19 double mutant,
several auxin-responsive genes (e.g. IAA5, LBD16, LBD29 and LBD33)
are no longer upregulated by auxin.
auxin-responsive protein, putative / small auxin up RNA (SAUR_B)||
unknown protein||
AAO1 (ARABIDOPSIS ALDEHYDE OXIDASE 1); aldehyde oxidase/ indole-
3-acetaldehyde oxidase||Encodes aldehyde oxidase AA01.
L-ascorbate oxidase, putative||
EIL2 (ETHYLENE-INSENSITIVE3-LIKE 2); transcription factor||ethylene-
insensitive3-like2 (EIL2)
PAZ domain-containing protein / piwi domain-containing protein||
unknown protein||
leucine-rich repeat family protein||
RIN1 (RESISTANCE TO PSEUDOMONAS SYRINGAE PV MACULICOLA
INTERACTOR 1); protein binding||
unknown protein||
esterase/lipase/thioesterase family protein||
NAD+ ADP-ribosyltransferase||
unknown protein||
||
F-box family protein||
ATCSLA02; mannan synthase/ transferase, transferring glycosyl
groups||encodes a beta-mannan synthase based on in vitro enzyme
assays from heterologously expressed protein
ATMGT10 (MAGNESIUM (MG) TRANSPORTER 10); magnesium ion
transmembrane transporter||putative Mg(2+) transport protein
VPS24.1||
AAE17 (ACYL-ACTIVATING ENZYME 17); catalytic/ ligase||
CaS (Calcium sensing receptor)||
TGH (TOUGH); RNA binding / protein binding||Interacts with TATA-box
binding protein 2. Contains domains with strong similarity to G-patch
and SWAP domains, characteristic of RNA binding and processing
proteins. Colocalizes with the splicing regulator SRp34 to subnuclear
particles. Role in RNA binding or processing. Mutants display
developmental defects, including reduced plant height, polycotyly, and
reduced vascularization. Strong genetic interaction between TGH and
AMP1.
succinyl-CoA ligase (GDP-forming) alpha-chain, mitochondrial, putative /
succinyl-CoA synthetase, alpha chain, putative / SCS-alpha, putative||
STP11 (SUGAR TRANSPORTER 11); carbohydrate transmembrane
transporter/ sugar:hydrogen symporter||
HMGB6; transcription factor||Encodes HMGB6, a protein belonging to
the subgroup of HMGB (high mobility group B) proteins. Localized in the
nucleus. Binds to supercoiled DNA in vitro. HMGB6 is phosphorylated by
protein kinase CK2alpha within its acidic C-terminal domain.
FTRA1 (ferredoxin/thioredoxin reductase subunit A (variable subunit) 1);
catalytic/ ferredoxin reductase/ ferredoxin:thioredoxin reductase/ lipoate
synthase||
AtCXE18 (Arabidopsis thaliana carboxyesterase 18); carboxylesterase||
CDPK9 (CALMODULIN-LIKE DOMAIN PROTEIN KINASE 9); ATP binding /
calcium ion binding / calmodulin-dependent protein kinase/ kinase/
protein kinase/ protein serine/threonine kinase||unique family of
enzymes containing a single polypeptide chain with a kinase domain at
the amino terminus and a putative calcium-binding EF hands structure at
the carboxyl terminus; recombinant protein is fully active and induced by
Ca2+
PHS1        (PROPYZAMIDE-HYPERSENSITIVE           1);     phosphoprotein
phosphatase/ protein tyrosine/serine/threonine phosphatase||Encodes a
protein tyrosine phosphatase Propyzamide-Hypersensitive 1 (PHS1).
One of the mutant alleles, phs1-1, is hypersensitive to the microtubule-
destabilizing drug propyzamide, suggesting that PHS1 may be involved
in phosphorylation cascades that control the dynamics of cortical
microtubules in plant cells. A second allele, phs1-3, is hypersensitive to
abscisic acid, indicating a possible involvement of PHS1 in ABA
signalling.
TUB8; structural constituent of cytoskeleton||beta-tubulin, preferentially
expressed in endodermal and phloem cells of primary roots and in the
vascular tissues of leaves, stems, and flowers.
SQP1; squalene monooxygenase||squalene monooxygenase gene
homolog
lipase class 3 family protein||
SOS3 (SALT OVERLY SENSITIVE 3); calcium ion binding / calcium-
dependent protein serine/threonine phosphatase||encodes a calcium
sensor that is essential for K+ nutrition, K+/Na+ selectivity, and salt
tolerance. The protein is similar to calcineurin B. Lines carrying
recessive mutations are hypersensitive to Na+ and Li+ stresses and is
unable to grow in low K+. The growth defect is rescued by extracellular
calcium.
integral membrane family protein||
emb2024 (embryo defective 2024); 6-phosphogluconolactonase/
catalytic||
copper-binding family protein||
thaumatin-like protein, putative||
CRY3 (cryptochrome 3); DNA binding / DNA photolyase/ FMN
binding||Binds flavin adenine dinucleotide and DNA. It does not have
photolyase activity, and it is likely to act as photoreceptor. Closely
related to Synechocystis cryptochrome.
zinc finger (B-box type) family protein||
integral membrane transporter family protein||
plastocyanin-like domain-containing protein||
unknown protein||
EBF2 (EIN3-BINDING F BOX PROTEIN 2); protein binding||Arabidopsis
thaliana EIN3-binding F-box protein 2 (EBF2) mRNA. Part of the SCF
complex, it is located in the nucleus and is involved in the ethylene-
response pathway.
RD22; nutrient reservoir||responsive to dehydration 22 (RD22) mediated
by ABA
unknown protein||
exostosin family protein||
ATNADP-ME3 (NADP-malic enzyme 3); malate dehydrogenase
(oxaloacetate-decarboxylating)         (NADP+)/        malic       enzyme/
oxidoreductase, acting on NADH or NADPH, NAD or NADP as
acceptor||The malic enzyme (EC 1.1.1.40) encoded by the ATNADP-ME3
is presumably cytosolic and restricted in its expression by both
developmental and cell-specific signals.
IAA28 (INDOLE-3-ACETIC ACID INDUCIBLE 28); transcription
factor||encodes a protein that may be a negative regulator of lateral
root formation in response to auxin. It is a member of IAA/ARF gene
family and is plant-specific. Gain of function mutations in this gene
suppresses lateral root formation and is resistant to inhibition of root
elongation by auxin, cytokinin, and ethylene.
leucine-rich repeat family protein / protein kinase family protein||
S1 self-incompatibility protein-related||
meprin and TRAF homology domain-containing protein / MATH domain-
containing protein||
germin-like protein, putative||
unknown protein||
threonyl-tRNA synthetase / threonine--tRNA ligase (THRRS)||Encodes a
dual-targeted threonyl-tRNA synthetase found in both the chloroplast
and mitochondrion.
tRNA/rRNA methyltransferase (SpoU) family protein||
unknown protein||
ATK4 (ARABIDOPSIS THALIANA KINESIN 4); ATPase/ microtubule
binding / microtubule motor||Encodes a kinesin-like protein that binds
microtubules in an ATP-dependent manner.
ATGLR2.1; intracellular ligand-gated ion channel||member of Putative
ligand-gated ion channel subunit family
NHX1 (NA+/H+ EXCHANGER); protein binding / sodium ion
transmembrane transporter/ sodium:hydrogen antiporter||Encodes a
vacuolar sodium/proton antiporter involved in salt tolerance, ion
homeostasis, and leaf development.
protein transport protein-related||
GID1C (GA INSENSITIVE DWARF1C); hydrolase||Encodes a gibberellin
(GA) receptor ortholog of the rice GA receptor gene (OsGID1). Has GA-
binding activity, showing higher affinity to GA4. Interacts with DELLA
proteins in vivo in the presence of GA4.
integral membrane Yip1 family protein||
ATP binding / microtubule motor||
unknown protein||
pectinesterase family protein||
seed maturation family protein||
DNA-binding protein-related||
protein kinase family protein||
transcription-coupled DNA repair protein-related||
GME (GDP-D-MANNOSE 3',5'-EPIMERASE); GDP-mannose 3,5-
epimerase/ NAD or NADH binding / catalytic||Encodes a protein with
GDP-D-mannose 3',5'-epimerase activity. The enzyme is involved in
ascorbate biosynthesis. It catalyzes the conversion of GDP-D-mannose
to GDP-L-galactose.
transposable element gene||
galactinol synthase, putative||
proline-rich extensin-like family protein||
epsin N-terminal homology (ENTH) domain-containing protein||
GS2       (GLUTAMINE         SYNTHETASE     2);     glutamate-ammonia
ligase||chloroplastic glutamine synthetase
FIM2 (FIMBRIN-LIKE PROTEIN 2); actin binding||
EXS family protein / ERD1/XPR1/SYG1 family protein||
glycosyl hydrolase family protein 17||
beta-galactosidase||
3'-5' exonuclease domain-containing protein / helicase and RNase D C-
terminal domain-containing protein / HRDC domain-containing protein||
protein phosphatase 2C, putative / PP2C, putative||
aspartyl protease family protein||
unknown protein||
GORK (GATED OUTWARDLY-RECTIFYING K+ CHANNEL); cyclic
nucleotide binding / inward rectifier potassium channel/ outward rectifier
potassium channel||encodes a guard cell outward potassium channel.
Mutants have increased water consumption and limited stomatal closure
in response to abscisic and jasmonic acids. It forms a heteromeric K(out)
channels with SKOR. The gene is expressed ubiquitously in root and the
vasculature and guard cells of leaves. Expression is suppressed during
agrobacterium-induced tumor formation and increased in response to
water deprivation and cold.
aspartyl protease family protein||
C2 domain-containing protein||
protein kinase family protein||
MATE efflux family protein||
PMI15 (plastid movement impaired 15)||Involved in chloroplast
avoidance movement under high-light intensities
PR5K; kinase/ transmembrane receptor protein serine/threonine
kinase||putative receptor serine/threonine kinase PR5K (PR5K) mRNA,
PR5-like receptor kinase
hydrolase, alpha/beta fold family protein||
unknown protein||
unknown protein||
disease resistance protein (TIR-NBS-LRR class), putative||
germin-like protein-related||
unknown protein||
CRR7 (CHLORORESPIRATORY REDUCTION 7)||Encodes a protein of the
chloroplastic NAD(P)H dehydrogenase complex (NDH Complex) involved
in respiration, photosystem I (PSI) cyclic electron transport and CO2
uptake. The product of this gene appears to be essential for the stable
formation of the NDH Complex.
UDP-glucose 6-dehydrogenase, putative||
S-locus glycoprotein, putative||
binding / catalytic||
SGR4 (SHOOT GRAVITROPSIM 4); receptor||Encodes a member of
SNARE gene family. Homologous with yeast VTI1 and is involved in
vesicle transport. Mutant alleles such as sgr4/zig are defective in the
shoots response to gravity resulting in a zigzag growth pattern of the
stem. Involved in protein trafficking to lytic vacuoles. Can conditionally
substitute VTI12 in protein storage vacuole trafficking when plants are
devoid of VTI12.
unknown protein||
unknown protein||
CDF2 (CYCLING DOF FACTOR 2); DNA binding / protein binding /
transcription factor||Dof-type zinc finger domain-containing protein,
identical to H-protein promoter binding factor-2a GI:3386546 from
(Arabidopsis thaliana). Interacts with LKP2 and FKF1, but its
overexpression does not change flowering time under short or long day
conditions.
unknown protein||
catalytic||
pathogenesis-related thaumatin family protein||
60S acidic ribosomal protein P2 (RPP2E)||
peroxidase, putative||
||Encodes a defensin-like (DEFL) family protein.
protein kinase family protein||
ATMKK3 (ARABIDOPSIS THALIANA MITOGEN-ACTIVATED PROTEIN
KINASE KINASE 3); MAP kinase kinase||encodes a mitogen-activated
protein kinase kinase
unknown protein||
AGP24||Encodes an arabinogalactan-protein (AGP24).
ATPHB3 (PROHIBITIN 3)||prohibitin 3
ATCLC-A (CHLORIDE CHANNEL A); anion channel/ nitrate
transmembrane transporter/ voltage-gated chloride channel||Encodes a
member of the voltage-dependent chloride channel. Also functions as a
NO3-/H+ exchanger that serves to accumulate nitrate nutrient in
vacuoles. Mutants homozygous for the T-DNA insertion mutation have
reduced nitrate uptake capacity in high nitrate environment and exhibit
hypersensitivity to chlorate.
transferase family protein||
unknown protein||
zinc finger (DHHC type) family protein||
leucine-rich repeat protein kinase, putative||
fringe-related protein||
GLA1 (GLOBULAR ARREST1); dihydrofolate synthase||Encodes a
dihydrofolate synthetase based on yeast complementation experiments.
This protein is involved in folate biosynthesis.
BTI3 (VIRB2-INTERACTING PROTEIN 3)||
nucleotide-sugar transporter family protein||
WD-40 repeat family protein||
ATBG_PAP; glucan endo-1,3-beta-D-glucosidase/ hydrolase, hydrolyzing
O-glycosyl compounds||encodes a plasmodesmal (Pd)-associated
membrane protein involved in plasmodesmal callose degradation, i.e.
beta-1,3-glucanase (EC 3.2.1.39), and functions in the gating of Pd
zinc finger protein, putative / regulator of chromosome condensation
(RCC1) family protein||
peroxidase 64 (PER64) (P64) (PRXR4)||
UBL5 (UBIQUITIN-LIKE PROTEIN 5)||
metalloendopeptidase||
SDG25 (SET DOMAIN PROTEIN 25)||
transporter-related||
BKI1 (BRI1 kinase inhibitor 1); protein heterodimerization||Encodes a
plasma-membrane associated phosphoprotein that interacts directly with
the kinase domain of BRI1. It interferes with the interaction between
BRI1 with its signalling partner, the plasma membrane localised LRR-
receptor kinase BAK1.
unknown protein||
COP8       (CONSTITUTIVE        PHOTOMORPHOGENIC            8);    protein
binding||encodes subunit 4 of COP9 signalosome complex. sequence is
similar to a subunit of the 19S regulatory particle of the 26S
proteasome.      recessive     mutation      causes     derepression    of
photomorphogenesis.
leucine-rich repeat transmembrane protein kinase, putative||
DC1 domain-containing protein||
cysteine proteinase, putative / thiol protease, putative||
CYCA3;1 (Cyclin A3;1); cyclin-dependent protein kinase regulator||
aspartyl protease family protein||
AZF3 (ARABIDOPSIS ZINC-FINGER PROTEIN 3); DNA binding / nucleic
acid binding / transcription factor/ transcription repressor/ zinc ion
binding||Encodes zinc finger protein. mRNA levels are elevated in
response to high salinity and low temperature. The protein is localized to
the nucleus and acts as a transcriptional repressor.
chaperone protein dnaJ-related||
SPL2 (SQUAMOSA PROMOTER BINDING PROTEIN-LIKE 2); DNA binding
/ transcription factor||member of the SPL (squamosa-promoter binding
protein-like) gene family, a novel gene family encoding DNA binding
proteins and putative transcription factors. The genes are characterized
by the presence of the SBP-box, which encodes a protein domain, the
glycoside hydrolase family 47 protein||
phosphotransferase-related||
KCS20 (3-KETOACYL-COA SYNTHASE 20); fatty acid elongase||Encodes
KCS20, a member of the 3-ketoacyl-CoA synthase family involved in the
biosynthesis of VLCFA (very long chain fatty acids).
transducin family protein / WD-40 repeat family protein||
acid phosphatase class B family protein||
CESA4 (CELLULOSE SYNTHASE A4); cellulose synthase/ transferase,
transferring glycosyl groups||Encodes a cellulose synthase involved in
secondary cell wall biosynthesis. Confers resistance towards bacterial
and fungal pathogens, independent of salicylic acid, ethylene and
jasmonate signaling.
FLA13      (FASCICLIN-LIKE      ARABINOGALACTAN          PROTEIN   13
PRECURSOR)||
CBP20 (CAP-BINDING PROTEIN 20); RNA binding / RNA cap
binding||Encodes a nuclear cap-binding protein that forms a
heterodimeric complex with ABH1 (ATCBP80) and is likely to participate
in RNA metabolism. Its mRNA is ubiquitously expressed.Loss of function
mutations suggest a role in processing of pri-miRNA and mRNA splicing.
late embryogenesis abundant domain-containing protein / LEA domain-
containing protein||
calcium-binding protein, putative||
haloacid dehalogenase-like hydrolase family protein||
RAN1 (RESPONSIVE-TO-ANTAGONIST 1); ATPase, coupled to
transmembrane movement of ions, phosphorylative mechanism / copper
ion transmembrane transporter||ATP dependent copper transporter vital
for ethylene response pathway
||
NRPC2; DNA binding / DNA-directed RNA polymerase/ ribonucleoside
binding||Encodes a subunit of RNA polymerase III (aka RNA polymerase
C).
BMY2 (BETA-AMYLASE 2); beta-amylase/ catalytic/ cation binding||
unknown protein||
F-box family protein||
CLPP4 (CLP PROTEASE P4); serine-type endopeptidase||One of several
nuclear-encoded ClpPs (caseinolytic protease). Contains a highly
conserved catalytic triad of Ser-type proteases (Ser-His-Asp). The name
reflects nomenclature described in Adam et. al (2001).
unknown protein||
26S proteasome regulatory subunit, putative (RPN9)||
FK506-binding protein 1 (FKBP13)||
CIPK19 (CBL-INTERACTING PROTEIN KINASE 19); ATP binding / kinase/
protein kinase/ protein serine/threonine kinase||Encodes a member of
the SNF1-related kinase (SnRK) gene family (SnRK3.5), which has also
been reported as a member of the CBL-interacting protein kinases
(CIPK19).
CIPK20 (CBL-INTERACTING PROTEIN KINASE 20); kinase/ protein
serine/threonine kinase||Encodes a CBL-interacting serine/threonine
protein kinase comprised of an N-terminal kinase catalytic domain
similar to SNF1/AMPK and a unique C-terminal regulatory domain.
pollen Ole e 1 allergen and extensin family protein||
APG7 (AUTOPHAGY 7); APG8 activating enzyme||Component of
autophagy conjugation pathway. Required for proper senescence.
GDSL-motif lipase/hydrolase family protein||
ARAC2 (ARABIDOPSIS RAC-LIKE 2); GTP binding||Encodes a Rac-like
protein ARAC2. A member of ROP GTPase gene family.
unknown protein||
O-acetyltransferase-related||
disease resistance protein (TIR-NBS-LRR class), putative||
TRN2 (TORNADO 2)||Encodes a transmembrane protein of the
tetraspanin (TET) family, one of 17 members found in Arabidopsis.
Double mutant analysis showed that TRN1 and TRN2 act in the same
pathway. Required for the maintenance of both the radial pattern of
tissue differentiation in the root and for the subsequent circumferential
pattern within the epidermis.
peroxidase, putative||
ATRAB1A; GTP binding||
nuclear RNA-binding protein, putative||
nodulin MtN21 family protein||
unknown protein||
PFK2 (PHOSPHOFRUCTOKINASE 2); 6-phosphofructokinase||
CYP705A5; oxygen binding / thalian-diol desaturase||encodes a member
of the CYP705A family of cytochrome P450 enzymes. It appears to
catalyze the addition of a double bond to thalian-diol at carbon 15.
Reduced levels of THAD expression lead to a build up of thalian-diol in
root extracts. thad1-1 mutants also have longer roots than wild type
seedlings.
polygalacturonase, putative / pectinase, putative||
unknown protein||
ADG1 (ADP GLUCOSE PYROPHOSPHORYLASE 1); glucose-1-phosphate
adenylyltransferase||Encodes the small subunit of ADP-glucose
pyrophosphorylase. The small subunit is the catalytic isoform responsible
for ADP-glucose pyrophosphorylase activity. The presence of the small
subunit is required for large subunit stability. Two isoforms of the small
subunit (ApS1 and ApS2) have been described. ApS1 is the major small
subunit isoform present in all plant tissues tested.
unknown protein||
leucine-rich repeat family protein / protein kinase family protein||
ATGLR1.3; intracellular ligand-gated ion channel||member of Putative
ligand-gated ion channel subunit family
sks3 (SKU5 Similar 3); copper ion binding / oxidoreductase||Encodes a
protein with two DUF26 domains and a signal peptide for secretion. The
protein is transported to the apoplast when it is expressed as a GFP
fusion protein.
DIR1 (DEFECTIVE IN INDUCED RESISTANCE 1); lipid binding / lipid
transporter||encodes a putative apoplastic lipid transfer protein that is
involved in systemic acquired resistance. Mutants in this gene exhibit
wild-type local resistance to avirulent and virulent Pseudomonas
syringae, but pathogenesis-related gene expression is abolished in
uninoculated distant leaves and fail to develop SAR to virulent
Pseudomonas or Peronospora parasitica.
basic helix-loop-helix (bHLH) family protein||
unknown protein||
pentatricopeptide (PPR) repeat-containing protein||
60S ribosomal protein L13A (RPL13aD)||
disease resistance protein (TIR-NBS-LRR class), putative||
pectate lyase family protein||
HCT          (HYDROXYCINNAMOYL-COA               SHIKIMATE/QUINATE
HYDROXYCINNAMOYL             TRANSFERASE);          quinate        O-
hydroxycinnamoyltransferase/               shikimate               O-
hydroxycinnamoyltransferase/ transferase||At5g48930 has been shown
to encode for the hydroxycinnamoyl-Coenzyme A shikimate/quinate
hydroxycinnamoyltransferase (HCT) both synthesizing and catabolizing
the hydroxycinnamoylesters (coumaroyl/caffeoyl shikimate and quinate)
involved in the phenylpropanoid pathway. Influence on the
accumulation of flavonoids which in turn inhibit auxin transport and
reduce plant growth.
SLD5 (SYNTHETIC LETHALITY WITH DPB11-1 5)||Similar to the SLD5
component of GINS complex, which in other organism was shown to be
involved in the initiation of DNA replication.
unknown protein||
SHV2 (SHAVEN 2)||Involved in successfully establishing tip growth in
root hairs.
ACLB-2 (ATP CITRATE LYASE SUBUNIT B 2); ATP citrate synthase||One
of the two genes encoding subunit B of the cytosolic enzyme ATP Citrate
Lyase (ACL)
unknown protein||
amine oxidase-related||
AtPNG1 (Arabidopsis thaliana peptide-N-glycanase 1); catalytic/ peptide-
N4-(N-acetyl-beta-glucosaminyl)asparagine amidase||Encodes a protein
that has peptide:N-glycanase activity in enzymatic assay in heterologous
systems (although the activity was not detected in wild-type plants).
DNA-binding protein-related||
embryogenesis-associated protein-related||
invertase/pectin methylesterase inhibitor family protein||
FRO8 (FERRIC REDUCTION OXIDASE 8); ferric-chelate reductase/
oxidoreductase||Encodes a ferric chelate reductase that is expressed in
shoots and flowers.
C2 domain-containing protein / GRAM domain-containing protein||
WR3        (WOUND-RESPONSIVE           3);    nitrate      transmembrane
transporter||Wound-responsive gene 3 (WR3). Encodes a high-affinity
nitrate transporter. Up-regulated by nitrate. Involved in jasmonic acid-
independent wound signal transduction.
CPI1           (CYCLOPROPYL           ISOMERASE);            cycloeucalenol
cycloisomerase||Converts pentacyclic cyclopropyl sterols to conventional
tetracyclic sterols. CPI1 function during and just after division and
support gravitropism by establishing polar PIN2 localization. Required for
endocytosis of PIN2
unknown protein||
unknown protein||
ATHVA22E||Encodes one of five HVA22 homologs in Arabidopsis.
HVA22 is an ABA- and stress-inducible gene first isolated from barley.
Members of this gene family have only been found in eukaryotes.
AtHVA22e mRNA is upregulated to varying degrees in response to cold
stress, salt stress, ABA treatment or dehydration.
unknown protein||
CLPC1; ATP binding / ATP-dependent peptidase/ ATPase||Encodes a
protein that is similar to ATP-dependent Clp protease ATP-binding
subunit / ClpC. Involved in protein import into the chloroplast. May
provide ATP source that drives the TIC (Translocon at the Inner
envelope membrane of Chloroplasts) translocation machinery.
short-chain dehydrogenase/reductase (SDR) family protein||
RHD2 (ROOT HAIR DEFECTIVE 2); NAD(P)H oxidase||RHD2 (along with
RHD3 and RHD4) is required for normal root hair elongation. Has
NADPH oxidase activity. Gene is expressed in the elongation and
differention zone in trichoblasts and elongating root hairs. RDH2 is
localized to the growing tips of root hair cells. It is required for the
production of reactive oxygen species in response to extracellular ATP
stimulus. The increase in ROS production stimulates Ca2+ influx.
FSD2 (FE SUPEROXIDE DISMUTASE 2); superoxide dismutase||Fe
superoxide dismutase whose mRNA levels are increased in response to
exposure to UV-B.
leucine-rich repeat transmembrane protein kinase, putative||
unknown protein||
leucine-rich repeat transmembrane protein kinase, putative||
DNA-binding protein-related||
AHG1 (ABA-hypersensitive germination 1); catalytic/ protein
serine/threonine phosphatase||Encodes AHG1 (ABA-hypersensitive
germination 1), a putative protein phosphatase 2C (PP2C). Expressed in
seeds. AHG1 functions in seed development and germination.
peroxidase||encodes peroxidase involved in the lignification of tracheary
elements (TE) in roots
NRPB6A; DNA binding / DNA-directed RNA polymerase||One of two
highly similar proteins that can serve as a non-catalytic subunit of
nuclear DNA-dependent RNA polymerases II, IV and V; homologous to
budding yeast RPB6 and the E. coli RNA polymerase omega subunit.
Probably redundant with At2g04630.
ATBAG1 (ARABIDOPSIS THALIANA BCL-2-ASSOCIATED ATHANOGENE
1); protein binding||A member of Arabidopsis BAG (Bcl-2-associated
athanogene) proteins, plant homologs of mammalian regulators of
apoptosis. Plant BAG proteins are multi-functional and remarkably
similar to their animal counterparts, as they regulate apoptotic-like
processes ranging from pathogen attack, to abiotic stress, to plant
development.
AtPP2-A14 (Phloem protein 2-A14); carbohydrate binding||
ATEXO70A2 (exocyst subunit EXO70 family protein A2); protein
binding||A member of EXO70 gene family, putative exocyst subunits,
conserved in land plants. Arabidopsis thaliana contains 23 putative
EXO70 genes, which can be classified into eight clusters on the
phylogenetic tree.
ADF10 (ACTIN DEPOLYMERIZING FACTOR 10); actin binding||
unknown protein||
OVA6 (OVULE ABORTION 6); ATP binding / aminoacyl-tRNA ligase/
nucleotide binding / proline-tRNA ligase||
40S ribosomal protein S10 (RPS10C)||
unknown protein||
binding / catalytic/ oxidoreductase||
AGP22 (ARABINOGALACTAN PROTEIN 22)||
nuclear movement family protein||
unknown protein||
thylakoid lumenal 17.4 kDa protein, chloroplast||thylakoid lumenal 17.4
kDa protein, chloroplast, identical to SP:P81760 Thylakoid lumenal 17.4
kDa protein, chloroplast precursor (P17.4) {Arabidopsis thaliana}.
Putative pentapeptide protein.
YSL3 (YELLOW STRIPE LIKE 3); oligopeptide transporter||
auxin-responsive family protein||
unknown protein||
unknown protein||
unknown protein||
unknown protein||
unknown protein||
yippee family protein||
unknown protein||
||Encodes a defensin-like (DEFL) family protein.
LHCB3 (LIGHT-HARVESTING CHLOROPHYLL B-BINDING PROTEIN 3);
structural molecule||Lhcb3 protein is a component of the main light
harvesting chlorophyll a/b-protein complex of Photosystem II (LHC II).
zinc finger (B-box type) family protein||
FQR1 (FLAVODOXIN-LIKE QUINONE REDUCTASE 1); FMN binding /
oxidoreductase, acting on NADH or NADPH, quinone or similar
compound as acceptor||Encodes a flavin mononucleotide-binding
flavodoxin-like quinone reductase that is a primary auxin-response gene.
zinc finger protein-related||
ATK3 (ARABIDOPSIS THALIANA KINESIN 3); ATPase/ microtubule
binding / microtubule motor||Encodes a truncated KatC polypeptide
(KatC(207-754)), which includes the carboxyl-terminal region of KatC.
This was expressed in Escherichia coli and was shown to possess
microtubule-stimulated ATPase activity.
GAUT12 (GALACTURONOSYLTRANSFERASE 12); polygalacturonate 4-
alpha-galacturonosyltransferase/ transferase, transferring glycosyl
groups / transferase, transferring hexosyl groups||Encodes a protein
with putative galacturonosyltransferase activity. Mutants defective in
this gene displayed a notable reduction in xylose (>50%) in the cell
walls from stems and roots and a reduction in cellulose (~25%).
transport protein particle (TRAPP) component Bet3, putative||
RAB GTPase activator||
ATRBP45A (RNA-binding protein 45A); RNA binding||
ATMAP65-1 (MICROTUBULE-ASSOCIATED PROTEINS 65-1); microtubule
binding||Binds and bundles microtubules. Plays a role in stabilizing anti-
parallel microtubules in the central spindle at anaphase to early
cytokinesis but is not essential at the midline of the phragmoplast at
later stages. The timing with which the MAP65-1 was targeted to the
spindle appears to be regulated by a phosphorylation sensitive switch.
Enhances microtubule polymerization, promotes nucleation and stabilizes
microtubules against cold treatment and dilution.
ATNHX3; sodium ion transmembrane transporter/ sodium:hydrogen
antiporter||member of Sodium proton exchanger family
SVL1 (SHV3-LIKE 1); glycerophosphodiester phosphodiesterase/
phosphoric        diester       hydrolase||Glycerophosphoryl       diester
phosphodiesterase-like protein involved in cell wall cellulose
accumulation and pectin linking. Impacts root hair, trichome and
epidermal cell development.
XYLT (ARABIDOPSIS THALIANA BETA-1,2-XYLOSYLTRANSFERASE);
xylosyltransferase||Encodes a beta-1,2-xylosyltransferase that is
glycosylated at two positions.
C2 domain-containing protein||
TRN1 (TORNADO 1)||Encodes a large plant-specific protein of unknown
function, with conserved domains also found in a variety of signaling
proteins, In trn mutants, the leaf venation network had a severely
reduced complexity: incomplete loops, no tertiary or quaternary veins,
and vascular islands. The leaf laminas were asymmetric and narrow
because of a severely reduced cell number. TRN1 is required for the
maintenance of both the radial pattern of tissue differentiation in the
root and for the subsequent circumferential pattern within the
epidermis. Double mutant analysis showed that TRN1 and TRN2 act in
the same pathway.
protein kinase family protein||
ATKCO1; calcium-activated potassium channel/ ion channel/ outward
rectifier potassium channel||Encodes AtTPK1 (KCO1), a member of the
Arabidopsis thaliana K+ channel family of AtTPK/KCO proteins. AtTPK1 is
targeted to the vacuolar membrane. Forms homomeric ion channels in
vivo. Voltage-independent and Ca2+-activated K+ channel. Activated by
14-3-3 proteins.
FLA1      (FASCICLIN-LIKE      ARAB     INOGALACTAN      1)||fasciclin-like
arabinogalactan-protein 1 (Fla1)
OPT1        (OLIGOPEPTIDE         TRANSPORTER        1);     oligopeptide
transporter||oligopeptide transporter
transporter-related||
KH domain-containing protein||
AGP14 (ARABINOGALACTAN PROTEIN 14)||Encodes arabinogalactan
protein (AGP14).
MKK6 (MAP KINASE KINASE 6); MAP kinase kinase/ kinase||Encodes a
member of the MAP Kinase Kinase family of proteins. It can
phosphorylate MPK12 in vitro and it can be dephosphorylated by MKP2
in vitro.
glycosyl hydrolase family 17 protein||
PRF3 (PROFILIN 3); actin binding||Encodes profilin3, a low-molecular
weight, actin monomer-binding protein that regulates the organization of
actin cytoskeleton. Originally known as profilin5, and later named
profilin3. Expressed in vegetative organs.
Ndr family protein||
ATSERAT1;1 (ARABIDOPSIS THALIANA SERINE ACETYLTRANSFERASE
1;1); serine O-acetyltransferase||Encodes a cytosolic serine O-
acetyltransferase involved in sulfur assimilation and cysteine
biosynthesis. Expressed in the vascular system.
BGAL4 (beta-galactosidase 4); beta-galactosidase||
ribosomal protein S16 family protein||
NAP1;3       (NUCLEOSOME        ASSEMBLY      PROTEIN      1;3);    DNA
binding||Encodes a member of a small gene family of proteins with
similarity to nucleosome assembly proteins.May function in nucleotide
excision repair. Loss of function mutations have no obvious visible
phenotypes but do seem to affect transcription of NER related genes.
unknown protein||
unknown protein||
unknown protein||
xyloglucan:xyloglucosyl    transferase,     putative    /     xyloglucan
endotransglycosylase, putative / endo-xyloglucan transferase, putative||
XTR3 (XYLOGLUCAN ENDOTRANSGLYCOSYLASE 3); hydrolase, acting
on glycosyl bonds / xyloglucan:xyloglucosyl transferase||xyloglucan
endotransglycosylase-related protein (XTR3)
protein kinase family protein||
BNR/Asp-box repeat family protein||
XBAT32; protein binding / zinc ion binding||ubiquitin ligase
unknown protein||
TET15 (TETRASPANIN15)||Member of TETRASPANIN family
SKIP1 (SKP1 INTERACTING PARTNER 1); protein binding||F-box protein,
interacts with SKP1/ASK1 subunit of SCF ubiquitin ligase in a glucose-
dependent manner
plastocyanin-like domain-containing protein||
UBP23 (UBIQUITIN-SPECIFIC PROTEASE 23); ubiquitin thiolesterase/
ubiquitin-specific protease||Encodes a ubiquitin-specific protease.
basic helix-loop-helix (bHLH) family protein||
transport protein particle (TRAPP) component Bet3 family protein||
SVL4 (SHV3-LIKE 4); glycerophosphodiester phosphodiesterase/
kinase||
glycosyl hydrolase family 17 protein||
PHOT2 (PHOTOTROPIN 2); FMN binding / blue light photoreceptor/
kinase/ protein serine/threonine kinase||Membrane-bound protein
serine/threonine kinase that functions as blue light photoreceptor in
redundancy with PHO1. Involved in stomatal opening, chloroplast
movement and phototropism. Mediates blue light-induced growth
enhancements. PHOT1 and PHOT2 mediate blue light-dependent
activation of the plasma membrane H+-ATPase in guard cell protoplasts.
PHOT2 possesses two LOV (LOV1 and LOV2, for light-oxygen-voltage-
sensing) domains involved in FMN-binding and a C-terminus forming a
serine/threonine kinase domain. LOV2 acts as an inhibitor of phototropin
kinase in the dark, and light cancels the inhibition through cysteine-FMN
adduct formation. LOV1 in contrast acts as an attenuator of
photoactivation. Localized to the Golgi apparatus under the induction of
blue light.
SVL5 (SHV3-LIKE 5); glycerophosphodiester phosphodiesterase/
phosphoric diester hydrolase||
unknown protein||
hydroxyproline-rich glycoprotein family protein||
MSI1 (MULTICOPY SUPRESSOR OF IRA1); protein binding||Encodes a
WD-40 repeat containing protein that functions in chromatin assembly
as part of the CAF1 and FIE complex. Mutants exhibit parthenogenetic
development that includes proliferation of unfertilized endosperm and
embryos. In heterozygous plants 50% of embryos abort. Of the aborted
embryos the early aborted class are homozygous and the later aborting
lass are heterozygotes in which the defective allele is maternally
transmitted. Other phenotypes include defects in ovule morphogenesis
and organ initiation,as well as increased levels of heterochromatic DNA.
MSI1 is needed for the transition to flowering. In Arabidopsis, the three
CAF-1 subunits are encoded by FAS1, FAS2 and, most likely, MSI1,
respectively. Mutations in FAS1 or FAS2 lead to increased frequency of
homologous recombination and T-DNA integration in Arabidopsis. In the
ovule, the MSI1 transcripts are accumulated at their highest level before
fertilization        and          gradually         decrease          after
fertiliz01,cluster_935,cluster_936,cluster_966,cluster_99,cluster_993s
expressed in the endosperm and embryo and is not imprinted. MSI1
bis(5'-adenosyl)-triphosphatase, putative||Encodes a Fhit protein. Has
nucleoside phosphoramidase and adenylylsulfatase activities.
leucine-rich repeat transmembrane protein kinase, putative||
glycosyl hydrolase family 17 protein||
||
pfkB-type carbohydrate kinase family protein||
unknown protein||
protein kinase-related||
ATSBT4.12; identical protein binding / serine-type endopeptidase||
proline-rich family protein||
protein phosphatase 2C, putative / PP2C, putative||
UXS3 (UDP-GLUCURONIC ACID DECARBOXYLASE 3); UDP-glucuronate
decarboxylase/ catalytic||Encodes an isoform of UDP-glucuronic acid
decarboxylase, which is predicted to be cytosolic by PSORT. This enzyme
produces UDP-xylose, which is a substrate for many cell wall
carbohydrates including hemicellulose and pectin. UDP-xylose is also
known to feedback regulate several cell wall biosynthetic enzymes.

LTP3 (LIPID TRANSFER PROTEIN 3); lipid binding||Predicted to encode
a PR (pathogenesis-related) protein. Belongs to the lipid transfer
protein (PR-14) family with the following members: At2g38540/LTP1,
At2g38530/LTP2, At5g59320/LTP3, At5g59310/LTP4, At3g51600/LTP5,
At3g08770/LTP6, At2g15050/LTP7, At2g18370/LTP8, At2g15325/LTP9,
At5g01870/LTP10,          At4g33355/LTP11,        At3g51590/LTP12,
At5g44265/LTP13, At5g62065/LTP14, At4g08530/LTP15.
haloacid dehalogenase-like hydrolase family protein||
unknown protein||
ATEXO70H7 (EXOCYST SUBUNIT EXO70 FAMILY PROTEIN H7); protein
binding||A member of EXO70 gene family, putative exocyst subunits,
conserved in land plants. Arabidopsis thaliana contains 23 putative
EXO70 genes, which can be classified into eight clusters on the
phylogenetic tree.
UDP-galactose/UDP-glucose transporter-related||
MBD7 (METHYL-CPG-BINDING DOMAIN 7); DNA binding / DNA
demethylase/ methyl-CpG binding||Protein containing methyl-CpG-
binding domain.Has sequence similarity to human MBD proteins.
Interacts with arginine methyltransferase 11. (AtPRMT11
Ras-related GTP-binding family protein||
40S ribosomal protein S15A (RPS15aF)||
LAC17 (laccase 17); laccase||putative laccase, a member of laccase
family of genes (17 members in Arabidopsis).
unknown protein||
TET4 (TETRASPANIN4)||Member of TETRASPANIN family
lectin protein kinase family protein||Lectin Receptor Kinase involved in
protein-protein interactions with RGD-containing proteins as potential
ligands. Role in cell wall-plasma membrane adhesion.
AALP       (Arabidopsis       aleurain-like  protease);    cysteine-type
peptidase||Encodes a senescence-associated thiol protease.
FLA12||
unknown protein||
2-phosphoglycerate kinase-related||
COB (COBRA)||Encodes a glycosylphosphatidylinositol-anchored protein
localized primarily in the plasma membrane of the longitudinal sides of
root cells. Necessary for oriented cell expansion in Arabidopsis. Cob
mutants have abnormal roots that expand radially rather than
longitudinally under certain growth conditions.
chromosome-associated kinesin, putative||
COBL5 (COBRA-LIKE PROTEIN 5 PRECURSOR)||
replication protein, putative||
GR-RBP3 (glycine-rich RNA-binding protein 3); ATP binding / RNA
binding||encodes a glycine-rich RNA binding protein. Gene expression is
induced by cold.
PDCB1 (PLASMODESMATA CALLOSE-BINDING PROTEIN 1); callose
binding / polysaccharide binding||Encodes a plasmodesmatal localized
protein with callose binding activity. The function of PDCB1 is unknown
but overexpression leads to the hyperaccumulation of callose.
unknown protein||
RPE; catalytic/ ribulose-phosphate 3-epimerase||Arabidopsis thaliana
ribulose-5-phosphate-3-epimerase mRNA
leucine-rich repeat transmembrane protein kinase, putative||
PMSR1       (PEPTIDEMETHIONINE       SULFOXIDE       REDUCTASE        1);
oxidoreductase, acting on sulfur group of donors, disulfide as acceptor /
peptide-methionine-(S)-S-oxide reductase||ubiquitous enzyme that
repairs oxidatively damaged proteins
unknown protein||
unknown protein||
GUT1; catalytic/ glucuronoxylan glucuronosyltransferase||
APO3 (ACCUMULATION OF PHOTOSYSTEM ONE 3)||ACCUMULATION OF
PHOTOSYSTEM ONE 3
||
nucleotide-sensitive chloride conductance regulator (ICln) family
protein||
IRE (INCOMPLETE ROOT HAIR ELONGATION); kinase/ protein
serine/threonine kinase||Encodes a protein with a serine/threonine
kinase domain. There are two other closely related members in
Arabidopsis. Knock-out mutation results in incomplete root hair
elongation. Expression is found all organs examined but is especially
strong in elongating root hairs.
SMC2 (STRUCTURAL MAINTENANCE OF CHROMOSOMES 2);
transporter||SMC2-1 (SMC2)
aldo/keto reductase family protein||
ATGSTU9 (ARABIDOPSIS THALIANA GLUTATHIONE S-TRANSFERASE
TAU 9); glutathione transferase||Encodes glutathione transferase
belonging to the tau class of GSTs. Naming convention according to
Wagner et al. (2002).
ATEB1B (END BINDING PROTEIN 1B); microtubule binding||encodes a
homolog of animal microtubule-end-binding protein. There are two other
members of this family. EB1 forms foci at regions where the minus ends
of microtubules are gathered during mitosis and early cytokinesis.
binding||
transportin-SR-related||
galactosyltransferase family protein||
proline-rich family protein||nuclear targeted protein involved in flowering
time regulation that affects flowering time independent of FLC
unknown protein||
DXR (1-DEOXY-D-XYLULOSE 5-PHOSPHATE REDUCTOISOMERASE); 1-
deoxy-D-xylulose-5-phosphate reductoisomerase||1-Deoxy-d-xylulose 5-
phosphate reductoisomerase (DXR) catalyzes the first committed step of
the 2-C-methyl-d-erythritol 4-phosphate pathway for isoprenoid
biosynthesis. In Arabidopsis, DXR is encoded by a single-copy gene.
Arabidopsis DXR is targeted to plastids and localizes into chloroplasts of
leaf cells. DXR knockout or strongly silenced lines have a seedling lethal,
albino phenotype. Transgenic, partially silenced lines expressing
35S:DXR have a variegated phenotype.
unknown protein||
unknown protein||
pectate lyase family protein||
MA3 domain-containing protein||
ADK1 (ADENYLATE KINASE 1); ATP binding / adenylate kinase/
nucleobase, nucleoside, nucleotide kinase/ nucleotide kinase/
phosphotransferase, phosphate group as acceptor||encodes a protein
similar to adenylate kinase.
leucine-rich repeat transmembrane protein kinase, putative||
pyruvate kinase, putative||
MUM2 (MUCILAGE-MODIFIED 2); beta-galactosidase||Involved in
mucilage formation. Mutants form columella and outer cell wall
architecture of the mucilage cells resembles wild-type. However, mum2
seeds completely lack seed coat mucilage. This mutation appears to
represent a later step in the development of this cell-type. Encodes a
beta-galactosidase involved in seed coat mucilage biosynthesis. Member
of Glycoside Hydrolase Family 35
unknown protein||
DNA topoisomerase III alpha, putative||
copine-related||
3'(2'),5'-bisphosphate nucleotidase, putative / inositol polyphosphate 1-
phosphatase, putative||
PSAN; calmodulin binding||Encodes the only subunit of photosystem I
located entirely in the thylakoid lumen. May be involved in the
interaction between plastocyanin and the photosystem I complex.
protease inhibitor/seed storage/lipid transfer protein (LTP) family
protein||
peroxidase, putative||
peroxidase, putative||encodes a cell wall bound peroxidase that is
induced by hypo-osmolarity
methylase family protein||
AGP1 (ARABINOGALACTAN PROTEIN 1)||Encodes arabinogalactan-
protein (AGP1).
NPH3 (NON-PHOTOTROPIC HYPOCOTYL 3); protein binding / signal
transducer||Involved in blue light response signaling pathway; interacts
with the blue light photoreceptor NPH1.Null mutations abolish
phototrophic responses of etiolated seedlings to low fluence blue light.
Protein contains multiple protein-protein interaction domains.
SAC51 (SUPPRESSOR OF ACAULIS 51); transcription factor/ transcription
regulator||Encodes a bHLH(basic helix-loop-helix)-type transcription
factor SAC51 [suppressor of acaulis 51]. Upregulation of SAC51
reverses the dwarf phenotype caused by a loss-of-function mutation in
ACL5 (Arabidopsis thaliana ACAULIS 5) gene, suggesting that activation
of SAC51 may lead to the expression of a subset of genes required for
stem elongation.
BETA-UP         (beta-ureidopropionase);     beta-ureidopropionase||PYD3
encodes a beta-ureidopropionase which, when expressed in E. coli, has
been shown to convert beta-ureidopropionate into beta-alanine.
pectinesterase family protein||
ribosomal protein L15 family protein||
||
glycosyl hydrolase family 17 protein||
unknown protein||
nucleotide-sugar transporter family protein||
ANNAT2 (Annexin Arabidopsis 2); calcium ion binding / calcium-
dependent phospholipid binding||Annexins are calcium binding proteins
that are localized in the cytoplasm. When cytosolic Ca2+ increases, they
relocate to the plasma membrane. They may be involved in the Golgi-
mediated secretion of polysaccharides.
BST1 (BRISTLED 1); hydrolase/ inositol or phosphatidylinositol
phosphatase||Encodes a protein involved in root hair morphogenesis
and tip growth. Required for restricting both the size of the root-hair
initiation site and the width of the root hairs during the transition to tip
growth, but, apparently, is not required for normal subsequent tip
growth.
TGA1; DNA binding / calmodulin binding / transcription factor||
ribosomal protein L29 family protein||
histone H3||
AGP7||
protein kinase, putative||
UDP-glucoronosyl/UDP-glucosyl transferase family protein||
peptidase M3 family protein / thimet oligopeptidase family protein||
IAA9 (INDOLE-3-ACETIC ACID INDUCIBLE 9); transcription factor||auxin
(indole-3-acetic acid) induced gene
soluble glycogen synthase-related||
xyloglucan:xyloglucosyl    transferase,     putative    /     xyloglucan
endotransglycosylase, putative / endo-xyloglucan transferase, putative||
unknown protein||
F-box family protein||
ZWI (ZWICHEL); calmodulin binding / microtubule motor||encodes a
novel member of the kinesin superfamily of motor proteins. recessive
mutations have reduced number of trichome branches.
ATSAC1B (SUPPRESSOR OF ACTIN 1B); phosphatidylinositol-4,5-
bisphosphate 5-phosphatase||Mutants in this gene are unable to express
female sterility in response to beta-aminobutyric acid, as wild type plants
do. non-consensus AT donor splice site at exon 7, TA donor splice site
at exon 10, AT acceptor splice at exon 13.
FNR1       (FERREDOXIN-NADP(+)-OXIDOREDUCTASE              1);    NADPH
dehydrogenase/ electron transporter, transferring electrons within the
cyclic electron transport pathway of photosynthesis/ electron
transporter, transferring electrons within the noncyclic electron
transp||Encodes a leaf-type ferredoxin:NADP(H) oxidoreductase. It is
present in both chloroplast stroma and thylakoid membranes but is more
abundant in the thylakoid. The affinity of this enzyme for ferredoxin is
slightly, but significantly, higher than AtLFNR2, an isoform of the same
enzyme. AtLFNR1 forms a heterodimer with AtFNR2 and is also a
prerequisite to attach AtFNR2 to the thylakoid membrane.
kinesin motor family protein||
peroxidase 72 (PER72) (P72) (PRXR8)||
(1-4)-beta-mannan endohydrolase, putative||
pentatricopeptide (PPR) repeat-containing protein||
phototropic-responsive NPH3 family protein||
unknown protein||
zinc finger (C2H2 type) family protein||
sks17 (SKU5 Similar 17); copper ion binding / oxidoreductase||
RALFL34 (ralf-like 34); signal transducer||Member of a diversely
expressed predicted peptide family showing sequence similarity to
tobacco Rapid Alkalinization Factor (RALF), and is believed to play an
essential role in the physiology of Arabidopsis. Consists of a single exon
and is characterized by a conserved C-terminal motif and N-terminal
signal peptide.
subtilase family protein||
phospholipase C/ phosphoric diester hydrolase||
leucine-rich repeat transmembrane protein kinase, putative||
ATEB1C (microtubule end binding protein 1); microtubule
binding||encodes a homolog of animal microtubule-end-binding protein.
There are two other members of this family. EB1 forms foci at regions
where the minus ends of microtubules are gathered during mitosis and
early cytokinesis.
peroxidase 73 (PER73) (P73) (PRXR11)||
BT4 (BTB AND TAZ DOMAIN PROTEIN 4); protein binding / transcription
regulator||BTB and TAZ domain protein. Located in cytoplasm and
expressed in fruit, flower and leaves.
VDAC2 (VOLTAGE DEPENDENT ANION CHANNEL 2); voltage-gated
anion channel||Encodes a voltage-dependent anion channel (VDAC:
AT3G01280/VDAC1,            AT5G67500/VDAC2,         AT5G15090/VDAC3,
AT5G57490/VDAC4, AT5G15090/VDAC5). VDACs are reported to be
porin-type, beta-barrel diffusion pores. They are prominently localized in
the outer mitochondrial membrane and are involved in metabolite
exchange between the organelle and the cytosol.
60S ribosomal protein L26 (RPL26B)||
adenylylsulfate kinase, putative||
||RNA polymerase beta' subunit-2
||encodes PsbZ, which is a subunit of photosystem II. In
Chlamydomonas, this protein has been shown to be essential in the
interaction between PS II and the light harvesting complex II.
||encodes a chloroplast ribosomal protein L36, a constituent of the large
subunit of the ribosomal complex
||chloroplast 30S ribosomal protein S8
||hypothetical protein
Conserved in Populus? (have a clear ortholog)




yes




yes
yes




yes
yes
yes




yes




yes
yes


yes


yes



yes




yes

yes
yes



yes




yes
yes
yes
yes

yes

yes


yes




yes




yes




yes


yes
yes

yes
yes
yes




yes




yes




yes




yes
yes



yes




yes

yes
yes
yes

yes


yes




yes
yes



yes
yes
yes




yes
yes
yes




yes




yes
yes




yes




yes




yes




yes


yes
yes



yes




yes




yes


yes
yes




yes
yes




yes

yes




yes


yes




yes




yes

yes




yes
yes




yes
yes




yes
yes
yes
yes

yes


yes




yes


yes




yes
yes


yes

yes
yes


yes




yes

yes




yes



yes
yes
yes




yes




yes


yes
yes




yes


yes
yes

yes




yes




yes
yes




yes
yes
yes
yes




yes




yes




yes
yes




yes




yes
yes

yes




yes
yes




yes
yes
yes




yes
yes
yes
yes




yes




yes




yes


yes
yes




yes



yes




yes




yes




yes


yes




yes


yes


yes
yes
yes




yes


yes




yes
yes
yes




yes
yes
yes
yes


yes
yes




yes



yes




yes


yes




yes

yes
yes
yes


yes

yes
yes




yes




yes
yes




yes
yes


yes


yes
yes


yes
yes




yes



yes


yes




yes




yes



yes


yes
yes




yes




yes


yes



yes




yes
yes




yes
yes
yes
yes


yes




yes




yes

yes




yes
yes




yes




yes
yes




yes




yes


yes
yes

yes

yes
yes




yes




yes




yes

yes
yes




yes




yes
yes


yes




yes

yes
yes
yes



yes




yes
yes




yes




yes

yes




yes




yes




yes
yes



yes
yes

yes


yes

yes




yes


yes
yes




yes




yes
yes




yes




yes
yes
yes

yes




yes




yes




yes




yes


yes
yes

yes
yes
yes




yes
yes
yes




yes
yes

yes
yes
yes
yes


yes
yes
yes


yes




yes




yes




yes
yes




yes
yes




yes



yes




yes
yes

yes




yes


yes


yes
yes
yes

yes




yes




yes

yes

yes



yes
yes


yes

yes




yes




yes
yes
yes
yes
yes



yes

yes
yes




yes




yes




yes

yes
yes
yes
yes




yes




yes

yes
yes
yes




yes
yes




yes




yes



yes




yes

yes




yes




yes


yes
yes




yes




yes
yes


yes




yes




yes




yes




yes
yes




yes


yes




yes




yes

yes
yes

yes


yes
yes
yes
yes
yes
yes
yes
yes




yes
yes
yes


yes

yes
yes




yes
yes




yes


yes




yes




yes
yes
yes




yes



yes

yes




yes

yes

yes
yes




yes




yes
yes
yes
yes
yes



yes




yes

yes




yes
yes




yes
yes




yes


yes

yes
yes
yes
yes


yes



yes
yes
yes



yes




yes

yes




yes




yes
yes
yes




yes




yes
yes
yes
yes


yes
yes




yes




yes




yes


yes

yes
yes




yes




yes


yes




yes
yes




yes

yes
yes


yes



yes




yes




yes
yes
yes




yes

yes
yes




yes
yes




yes




yes




yes




yes
yes
yes




yes


yes




yes




yes



yes
yes




yes


yes



yes




yes


yes




yes




yes
yes




yes




yes
yes

yes




yes
yes



yes


yes


yes




yes




yes
yes




yes




yes




yes




yes
yes

yes
yes
yes
yes

yes

yes

yes




yes




yes


yes



yes




yes
yes
yes




yes



yes




yes
yes




yes
yes
yes
yes


yes




yes




yes
yes
yes



yes




yes




yes




yes
yes



yes




yes




yes




yes
yes
yes




yes
yes




yes

yes
yes




yes




yes
yes
yes
yes




yes


yes



yes
yes


yes


yes



yes
yes


yes

yes


yes




yes




yes


yes
yes




yes

yes
yes


yes




yes




yes

yes




yes
yes
yes



yes




yes


yes
yes


yes




yes
yes


yes


yes




yes
yes




yes


yes
yes
yes
yes
yes
yes
yes

yes

yes




yes




yes
yes


yes
yes

yes




yes

yes




yes




yes


yes




yes
yes
yes
yes
yes




yes




yes




yes




yes




yes
yes



yes
yes




yes
yes


yes




yes


yes




yes
yes

yes
yes
yes




yes




yes
yes




yes


yes
yes
yes
yes
yes
yes
yes
yes




yes




yes
yes
yes
yes




yes
yes




yes




yes

yes


yes




yes
yes




yes
yes

yes


yes


yes


yes




yes

yes
yes
yes
yes



yes




yes
yes

yes




yes




yes




yes



yes

yes
yes



yes
yes

yes
yes

yes




yes


yes
yes
yes

yes




yes
yes




yes




yes




yes
yes




yes




yes


yes
yes
yes


yes




yes
yes

yes
yes




yes
yes




yes

yes

yes
yes
yes




yes




yes




yes




yes



yes
yes


yes




yes




yes
yes
yes
yes




yes


yes
yes
yes




yes
yes
yes
yes

yes

yes




yes




yes
yes

yes




yes
yes



yes
yes
yes



yes


yes




yes




yes




yes
yes



yes


yes


yes




yes




yes




yes
yes
yes


yes


yes
yes




yes




yes


yes




yes




yes
yes




yes
yes




yes




yes
yes
yes




yes



yes




yes



yes
yes




yes




yes
yes




yes
yes




yes




yes




yes


yes
yes
yes
yes




yes




yes




yes
yes
yes

yes




yes


yes

yes
yes
yes
yes
yes




yes




yes

yes
yes


yes
yes




yes




yes




yes




yes


yes

yes


yes
yes




yes




yes


yes
yes
yes




yes




yes


yes
yes
yes




yes
yes




yes


yes




yes




yes


yes
yes




yes
yes
yes

yes


yes



yes




yes




yes


yes




yes
yes




yes
yes




yes

yes
yes

yes
yes


yes


yes




yes




yes


yes
yes




yes




yes




yes




yes




yes


yes


yes



yes




yes




yes
yes

yes




yes




yes



yes




yes



yes
yes




yes
yes
yes


yes




yes


yes




yes
yes
yes



yes




yes
yes


yes




yes



yes




yes




yes
yes




yes


yes




yes




yes




yes



yes




yes
yes




yes


yes


yes




yes
yes

yes
yes




yes


yes




yes



yes
yes




yes

yes


yes
yes
yes
yes




yes




yes



yes
yes




yes
yes




yes
yes




yes




yes
yes
yes
yes
yes




yes




yes




yes




yes



yes
yes



yes




yes




yes




yes

yes




yes
yes

yes

yes




yes




yes


yes




yes




yes
yes
yes




yes




yes
yes




yes
yes
yes

yes
yes

yes
yes


yes


yes
yes
yes
yes




yes



yes



yes
yes


yes



yes




yes


yes




yes


yes




yes
yes




yes
yes




yes


yes
yes




yes

yes
yes
yes




yes




yes
yes




yes

yes


yes



yes




yes




yes
yes
yes


yes
yes




yes


yes
yes


yes
yes
yes


yes




yes
yes




yes
yes

yes



yes


yes
yes


yes
yes
yes
yes
yes
yes


yes




yes


yes




yes



yes
yes
yes
yes
yes




yes




yes




yes
yes

yes


yes
yes

yes




yes


yes

yes




yes
yes




yes
yes




yes




yes

yes
yes
yes




yes




yes




yes



yes
yes
yes
yes




yes




yes



yes
yes




yes
yes




yes
yes
yes
yes

yes


yes


yes
yes
yes
yes




yes




yes




yes




yes
yes




yes




yes



yes

yes




yes


yes
yes




yes




yes
yes

yes


yes
yes




yes


yes
yes
yes




yes




yes




yes
yes
yes
yes




yes




yes




yes




yes
yes




yes




yes




yes
yes

yes




yes
yes
yes
yes
yes




yes




yes

yes




yes
yes



yes
yes




yes




yes


yes




yes

yes
yes
yes


yes
yes
yes




yes




yes
yes




yes




yes

yes
yes




yes
yes




yes




yes




yes




yes
yes

yes




yes


yes




yes




yes


yes




yes




yes


yes
yes




yes

yes
yes
yes




yes




yes


yes




yes
yes
yes
yes
yes
yes




yes




yes

yes



yes


yes




yes


yes




yes



yes
yes




yes




yes




yes




yes



yes


yes
yes




yes


yes



yes




yes




yes

yes

yes

yes



yes


yes
yes




yes


yes
yes
yes
yes
yes
yes
yes


yes


yes




yes
yes
yes
yes




yes
yes


yes




yes




yes


yes




yes

yes




yes




yes
yes
yes


yes
yes
yes

yes




yes




yes
yes
yes




yes
yes




yes




yes


yes

yes




yes




yes
yes
yes

yes

yes




yes




yes




yes
yes
yes
yes


yes
yes
yes



yes
yes
yes




yes




yes




yes




yes
Transcription factors (TFs) in co-expression modules

TF families          Indexes   Genes        Co-expression modules
C2H2                 1         AT1G10480    81_4
C2H2                 2         AT1G34370    337_2
C2H2                 3         AT1G68360    192_4,81_4
C2H2                 4         AT2G02070    337_2,81_3
C2H2                 5         AT3G02790    323_2
C2H2                 6         AT3G44750    40_3
C2H2                 7         AT3G62240    40_3
C2H2                 8         AT4G35700    147_1
C2H2                 9         AT5G10970    81_4
C2H2                 10        AT5G43170    286_5
C2H2                 11        AT5G54630    192_3
C2H2                 12        AT5G66730    312_1
bHLH                 1         AT1G10120    40_9
bHLH                 2         AT1G71200    40_9
bHLH                 3         AT2G24260    279_1,405_2
bHLH                 4         AT3G07340    121_1
bHLH                 5         AT3G23690    81_4
bHLH                 6         AT3G26744    238_2,318_1,40_2
bHLH                 7         AT3G59060    183_2
bHLH                 8         AT4G36540    154_1
bHLH                 9         AT5G01310    335_1
bHLH                 10        AT5G48560    119_1,2_1,337_2,81_1
bHLH                 11        AT5G58010    279_2,286_1
HB                   1         AT2G46680    192_1
HB                   2         AT3G01470    286_1,44_1,81_1
HB                   3         AT3G61890    52_3
HB                   4         AT4G02560    335_1
HB                   5         AT4G08150    2_2
HB                   6         AT4G34610    208_1
HB                   7         AT4G40060    265_5,345_1,81_1
HB                   8         AT5G02030    318_1,323_6
NAC                  1         AT1G01010    265_2,81_3
NAC                  2         AT1G01720    312_1
NAC                  3         AT1G52880    335_2
NAC                  4         AT4G35580    40_3
NAC                  5         AT5G04400    368_1
NAC                  6         AT5G09330    67_1
NAC                  7         AT5G13180    154_2,181_3
MADS        1   AT1G77950   312_1
MADS        2   AT1G77980   186_1
MADS        3   AT2G03710   323_5
MADS        4   AT2G24840   108_1
MADS        5   AT3G02310   101_1
MADS        6   AT5G10140   15_1,312_5
MADS        7   AT5G20240   249_1
AP2-EREBP   1   AT1G28160   108_2,368_1
AP2-EREBP   2   AT1G68840   335_1,385_1
AP2-EREBP   3   AT2G44940   335_2
AP2-EREBP   4   AT3G15210   337_2
AP2-EREBP   5   AT3G16770   271_1
AP2-EREBP   6   AT3G25890   40_9
AP2-EREBP   7   AT4G39780   40_7
HMG         1   AT2G17560   67_2
HMG         2   AT3G28730   40_3
HMG         3   AT3G51880   312_1
HMG         4   AT4G23800   238_1,323_2,40_1,46_1
HMG         5   AT4G35570   337_3,40_1
HMG         6   AT5G23420   40_1
bZIP        1   AT1G08320   153_1,265_4,286_3,335_4,385_1,44_1
bZIP        2   AT1G35490   147_1,186_1,244_1
bZIP        3   AT3G54620   265_1,81_2
bZIP        4   AT5G10030   101_1
bZIP        5   AT5G15830   81_8
bZIP        6   AT5G65210   323_4,337_2
WRKY        1   AT1G29280   177_1,225_1,362_1
WRKY        2   AT3G58710   184_4,81_5
WRKY        3   AT4G01720   335_1,385_1
WRKY        4   AT4G31800   52_3
WRKY        5   AT5G07100   265_2,81_9
MYB         1   AT1G18570   81_4
MYB         2   AT2G37630   377_1
MYB         3   AT2G38090   2_2,64_2
MYB         4   AT5G12870   119_1,2_1,261_1,384_1
MYB         5   AT5G14340   236_1
C3H         1   AT1G30460   40_2
C3H         2   AT2G02160   192_1
C3H         3   AT3G48440   128_1,155_1
C3H         4   AT3G51950   40_2
C3H         5   AT5G18550   186_1
AUX-IAA     1   AT2G33310   228_1
AUX-IAA        2   AT3G04730   154_1
AUX-IAA        3   AT3G23050   154_1,176_1
AUX-IAA        4   AT5G25890   177_1
AUX-IAA        5   AT5G65670   40_6
PHD            1   AT1G79350   323_2,40_3
PHD            2   AT2G36720   209_1
PHD            3   AT3G01460   40_3
PHD            4   AT3G51120   312_2
ZF-HD          1   AT1G74660   2_2
ZF-HD          2   AT1G75240   398_1,92_2
ZF-HD          3   AT4G24660   81_1
TLP            1   AT1G47270   147_1,244_1
TLP            2   AT2G47900   81_6
TLP            3   AT3G06380   228_1
TCP            1   AT2G31070   81_11
TCP            2   AT4G18390   192_3
TCP            3   AT5G08070   81_1
SBP            1   AT3G57920   92_1
SBP            2   AT5G18830   186_1
SBP            3   AT5G43270   81_9
LIM            1   AT2G39900   279_2,286_2
LIM            2   AT2G45800   141_1,147_1,186_1,244_1
LIM            3   AT3G61230   186_1
GRAS           1   AT1G55580   368_2
GRAS           2   AT2G04890   19_1
GRAS           3   AT3G54220   265_1,40_3,81_4
GARP-G2-like   1   AT1G25550   52_2
GARP-G2-like   2   AT1G69580   184_4,337_3,393_1
GARP-G2-like   3   AT4G18020   40_3
C2C2-CO-like   1   AT1G68520   81_1
C2C2-CO-like   2   AT2G24790   81_3
C2C2-CO-like   3   AT5G24930   40_6
ARF            1   AT1G19220   81_9
ARF            2   AT1G19850   92_1
ARF            3   AT5G20730   67_2
ZIM            1   AT1G17380   323_6,40_9
ZIM            2   AT5G13220   323_4,40_2
PcG            1   AT1G14030   337_5,81_4
PcG            2   AT5G42400   67_2
GRF            1   AT2G36400   184_4,44_4,81_3
GRF            2   AT4G37740   398_1
CPP            1   AT3G22760   147_1
CPP          2   AT4G14770   323_6,40_1
CCAAT-HAP3   1   AT2G13570   186_1
CCAAT-HAP3   2   AT2G38880   40_3
ABI3-VP1     1   AT2G30470   40_3
ABI3-VP1     2   AT2G35310   323_2
Whirly       1   AT1G14410   265_2,81_3
VOZ          1   AT1G28520   312_1
ULT          1   AT4G28190   40_3
Trihelix     1   AT1G76890   183_2
TAZ          1   AT5G67480   312_1
MBF1         1   AT2G42680   335_1
LUG          1   AT2G32700   323_6,335_4
HSF          1   AT4G36990   184_2,337_5,401_2
FHA          1   AT3G54350   40_3
EIL          1   AT5G21120   85_1
CCAAT-HAP5   1   AT1G54830   125_1,19_1,40_8
CCAAT-HAP2   1   AT1G30500   312_1
C2C2-YABBY   1   AT2G45190   184_3
C2C2-Dof     1   AT5G39660   312_1
BES1         1   AT5G45300   323_4,40_1
AS2          1   AT2G42430   337_2
ARID         1   AT1G04880   155_2
1,329 consensus motifs



Motif IDs        Found in module IDs # of motifs      Found in genes

cluster_0                              127            AT4G10020,AT3G48580(XTH11),AT2G43950
                 102_2,102_3,102_4,109_1,125_1,125_2,128_2,131_1,140_1,141_1,144_1,147_1,153_
cluster_1                              117            AT4G10020,AT1G68260,AT5G26700,AT4G14
                 101_1,102_2,102_3,108_2,109_1,119_1,125_1,125_3,131_1,140_1,141_1,15_1,153_1
cluster_2                              73             AT5G24930,AT1G35490,AT2G43950,AT1G68
                 109_1,111_1,125_1,14_1,147_1,153_2,154_1,154_2,155_3,167_1,18_1,181_1,181_2,1
cluster_3                              82             AT4G10020,AT4G24560,AT1G06450,AT4G37
                 101_1,102_2,102_3,102_4,108_1,119_1,125_2,128_2,147_1,149_1,154_3,155_2,16_1
cluster_4                              66             AT1G35490,AT1G50010,AT4G14100,AT1G06
                 102_3,102_4,108_2,124_1,125_3,125_5,128_1,141_1,147_1,154_2,155_1,155_2,167_
cluster_5                              53             AT5G44790,AT3G21760,AT5G54095,AT4G28
                 101_1,102_4,109_1,111_1,124_1,125_2,140_1,147_1,15_1,154_3,167_1,177_1,181_2
cluster_6                              36             AT3G56890,AT5G11090,AT1G68260,AT3G43
                 102_5,125_2,128_2,144_1,155_3,156_1,166_1,177_1,181_1,186_2,19_1,207_2,207_3
cluster_7                              35             AT1G12110,AT3G51520,AT5G64040,AT2G34
                 102_2,153_1,153_2,154_2,16_1,173_1,183_2,184_5,185_2,207_3,208_1,209_1,218_1
cluster_8                              30             AT2G10970,AT5G11090,AT1G12110,AT3G43
                 101_1,102_4,102_5,119_1,125_2,153_1,153_2,156_1,166_1,184_5,185_2,186_3,192_
cluster_9                              21             AT5G11090,AT3G53260(PAL2),AT1G54370,A
                 125_3,14_1,149_1,16_1,173_1,181_3,183_2,231_1,238_1,261_1,279_1,293_1,335_1,4
cluster_10                             17             AT5G23530,AT1G50010,AT1G12110,AT2G38
                 102_5,155_1,155_2,166_1,178_1,181_1,200_1,251_1,271_1,275_1,286_2,337_5,368_
cluster_11       173_1,294_1,61_1,86_1 4              AT4G05590,AT3G53260(PAL2),AT4G00330,A
cluster_12                             15             AT5G23530,AT1G66670,AT5G48380,AT2G33
                 155_2,173_1,184_2,200_1,208_1,219_1,265_4,286_2,309_1,312_4,323_1,337_1,387_
cluster_13                             13             AT5G45390,AT1G21480,AT5G59740,AT1G16
                 125_3,186_2,207_3,286_1,309_1,323_1,337_5,338_1,379_1,385_1,61_1,64_3,99_2
cluster_14                             6
                 102_2,173_1,294_1,380_1,383_1,87_1   AT3G53190,AT5G22580,AT1G23090,AT3G53
cluster_15                             13             AT4G04350,AT1G66670,AT5G45390,AT4G30
                 184_2,207_3,2_1,254_1,286_3,293_1,294_1,312_4,415_1,52_1,61_1,81_11,81_3
cluster_16       124_1,337_5,40_7      3              AT5G45390,AT1G44750,AT2G20420,AT4G14
cluster_17       77_1                  1              AT1G66250,AT1G21880,AT5G25090,AT1G32
cluster_18                             6
                 186_1,228_1,40_2,46_1,81_3,81_9      AT4G02060,AT1G35490,AT1G50010,AT5G54
cluster_19       337_6,99_2            2              AT3G18050,AT5G11090,AT1G49580,AT1G71
cluster_20                             10             AT4G10020,AT5G60220,AT1G17760,AT5G55
                 155_2,18_1,230_1,249_1,312_1,312_2,318_1,337_4,342_1,383_1
cluster_21                             6
                 153_1,18_1,265_2,335_1,77_1,81_7     AT4G29140,AT2G43950,AT1G71960,AT5G43
cluster_22       40_4,40_7,61_1,81_7 4                AT2G43950,AT5G59740,AT1G06450,AT1G09
cluster_23       308_1,383_1,99_2      3              AT5G40150,AT3G53190,AT3G18050,AT1G75
cluster_24                             6
                 124_1,125_1,128_1,238_1,265_4,41_1   AT1G56310,AT4G20480,AT1G49400,AT5G62
cluster_25       397_1,40_8,44_3,74_1 4               AT1G08830,AT5G05010,AT3G43960,AT4G28
cluster_26                             8              AT1G08830,AT5G64100,AT4G38370,AT1G12
                 181_2,192_2,207_1,275_1,334_1,387_1,40_8,74_1
cluster_27                             6
                 154_2,219_1,225_3,278_1,42_3,44_2    AT1G59870,AT3G61960,AT4G14130(XTH15)
cluster_28       125_5                 1              AT4G02320,AT5G17380,AT3G06770,AT4G37
cluster_29       211_1,411_1,415_1     3              AT3G21770(PER30),AT3G24670,AT2G30210
cluster_30                             7              AT5G23530,AT5G28840(GME1),AT5G22950,
                 14_1,184_5,230_2,275_1,401_3,407_1,74_1
cluster_31       207_1,337_4           2              AT4G38370,AT2G36835,AT2G01890,AT3G48
cluster_32                             9              AT5G23530,AT3G53260(PAL2),AT3G56370,A
                 109_1,181_2,184_5,186_2,312_2,41_1,44_3,92_1,99_1
cluster_33                             8              AT4G35450,AT5G10740,AT4G34440,AT1G54
                 124_1,177_1,184_4,186_1,186_3,229_2,388_1,92_1
cluster_34                             5
                 154_1,279_2,399_1,64_1,67_1          AT1G44800,AT2G31955,AT5G09330,AT5G43
cluster_35       125_5,128_2,323_5,64_34              AT4G02320,AT3G51160(GMD2-Mur1),AT1G4
cluster_36       339_1,81_7            2              AT3G57180,AT5G01970,AT2G43950,AT1G31
cluster_37                             6
                 19_1,279_1,339_1,395_1,405_1,405_2   AT3G05490,AT4G30320,AT2G38480,AT3G03
cluster_38   286_5,407_1,40_8,64_3 4              AT1G08830,AT3G51160(GMD2-Mur1),AT5G0
cluster_39   81_4                  1              AT3G08630,AT3G23690,AT5G44790,AT5G22
cluster_40                         5
             141_1,183_2,249_1,308_1,4_1          AT3G28790,AT5G22430,AT1G70790,AT5G03
cluster_41   397_1                 1              AT5G44030(CesA4),AT5G03260(LAC11),AT2
cluster_42   102_4,379_1,387_1     3              AT2G42220,AT5G64100,AT1G16780,AT5G48
cluster_43                         6
             178_1,184_2,207_2,40_1,41_1,81_11    AT3G56890,AT1G65700,AT5G61030,AT5G16
cluster_44                         8              AT1G34350,AT3G43960,AT3G16240,AT5G23
             15_1,153_2,167_1,181_2,192_2,225_1,279_2,41_1
cluster_45   365_1                 1              AT4G16120(COBL7),AT4G18460,AT2G03350
cluster_46   149_1,309_1,42_3      3              AT5G10580,AT2G14900,AT3G22620,AT1G26
cluster_47   119_1,200_1           2              AT5G12870,AT5G42180(PER64),AT3G24670
cluster_48   238_1,308_1,383_1     3              AT3G53190,AT5G16130,AT1G54610,AT1G02
cluster_49                         5
             18_1,279_1,295_1,337_1,92_1          AT2G33450,AT4G30320,AT5G49570,AT5G16
cluster_50                         5
             173_1,181_3,207_1,387_1,68_1         AT5G22580,AT5G64100,AT3G53260(PAL2),A
cluster_51                         5
             101_1,16_1,405_2,44_1,92_2           AT5G07990,AT2G27140,AT5G42180(PER64)
cluster_52   147_1,244_1,40_1      3              AT5G61030,AT1G65700,AT1G54070,AT1G49
cluster_53   238_2,323_3,388_1     3              AT5G23530,AT5G42180(PER64),AT5G65930
cluster_54   335_4,342_1,42_1,99_1 4              AT2G22880,AT5G23530,AT5G15230,AT5G65
cluster_55                         5
             140_1,192_4,337_6,52_2,52_3          AT5G48380,AT5G11090,AT1G49580,AT1G71
cluster_56   173_1,254_1,294_1,86_14              AT1G15950(CCR1),AT5G35190,AT4G05590,A
cluster_57                         5
             109_1,147_1,2_1,244_1,335_1          AT1G35490,AT3G53260(PAL2),AT1G54070,A
cluster_58   265_4,335_2,46_1      3              AT2G26460,AT3G16690,AT3G51050,AT2G37
cluster_59                         5
             230_1,312_4,337_2,40_5,415_1         AT5G03650,AT3G48580(XTH11),AT5G40380
cluster_60   209_1,68_1            2              AT2G47640,AT5G48900,AT5G12880,AT3G28
cluster_61   155_2,99_2            2              AT3G18050,AT5G57810,AT1G75780,AT3G57
cluster_62   125_3,415_1,77_1      3              AT5G39320(UGD1),AT2G29450,AT1G32930,
cluster_63   349_1,44_2            2              AT2G17720,AT5G42180(PER64),AT5G65530
cluster_64   147_1,244_1,343_1,96_14              AT1G35490,AT1G54070,AT1G49290,AT5G54
cluster_65                         5
             101_1,183_2,186_2,335_5,64_2         AT5G07990,AT3G07830,AT1G43640,AT3G22
cluster_66   230_1                 1              AT3G47860,AT3G48580(XTH11),AT5G04040
cluster_67                         4
             181_3,192_3,312_4,377_1              AT5G22580,AT3G27690,AT3G53260(PAL2),A
cluster_68   231_1,238_1,295_1,96_14              AT3G28750,AT3G28790,AT1G54370,AT5G16
cluster_69   125_2,368_2           2              AT3G45970(EXPL1),AT3G48830,AT1G55580,
cluster_70   383_1,87_1            2              AT3G53190,AT5G40150,AT1G70710(CEL1),A
cluster_71   2_2,338_1,395_1,4_1 4                AT1G19940(unknown protein),AT5G23860,A
cluster_72   42_1,52_2             2              AT5G48380,AT4G00330,AT4G12730(FLA2),A
cluster_73   102_3,279_2,81_3      3              AT4G04350,AT1G66670,AT1G50010,AT3G43
cluster_74   2_1,236_1,384_1       3              AT1G22480,AT4G14130(XTH15),AT5G14340
cluster_75   249_1,385_1           2              AT4G01720,AT5G22430,AT3G53280,AT2G42
cluster_76   131_1,87_1            2              AT5G40150,AT1G77630,AT5G42100,AT1G02
cluster_77   185_2,312_5,81_3      3              AT5G23530,AT4G04350,AT1G66670,AT1G50
cluster_78   131_1                 1              AT2G28950(EXP6),AT5G55730(FLA1),AT1G2
cluster_79   156_1,399_1,407_1     3              AT4G03210(XTH9),AT3G61640(AGP20),AT4G
cluster_80                         5
             249_1,295_1,323_6,405_2,96_1         AT3G28790,AT3G28750,AT5G22430,AT1G11
cluster_81   365_1                 1              AT4G16120(COBL7),AT4G18460,AT2G03350
cluster_82   44_1                  1              AT5G49460,AT3G01470,AT5G42180(PER64)
cluster_83    2_2,236_1             2         AT1G19940(unknown protein),AT5G23860,A
cluster_84    125_2,155_3           2         AT2G32160,AT1G71770,AT5G57610,AT1G18
cluster_85                          5
              229_2,254_1,294_1,401_3,52_1    AT3G28790,AT2G25810,AT3G53260(PAL2),A
cluster_86    219_1                 1         AT3G18050,AT1G16880,AT2G10940,AT5G66
cluster_87    265_5                 1         AT1G67910,AT1G14210,AT4G03110,AT4G05
cluster_88    177_1,368_1,379_1     3         AT5G25890,AT5G55540,AT2G31390,AT1G30
cluster_89    52_3                  1         AT3G52840(AtBGAL2),AT4G27450,AT3G5192
cluster_90    20_1                  1         AT5G58480,AT1G66250,AT5G08000(glycosy
cluster_91    380_1,65_1            2         AT2G31350,AT3G45970(EXPL1),AT4G30280(
cluster_92                          4
              147_1,155_1,323_3,335_4         AT5G23530,AT1G54070,AT5G65930,AT5G54
cluster_93                          4
              109_1,166_1,184_1,398_1         AT1G59870,AT5G20050,AT4G37740,AT3G53
cluster_94                          5
              166_1,167_1,323_6,337_4,368_1   AT3G07590,AT4G14770,AT3G11964,AT4G02
cluster_95    131_1,342_1           2         AT2G22880,AT5G42100,AT3G09920,AT5G55
cluster_96    144_1,67_1            2         AT2G31955,AT5G09330,AT5G43930,AT4G01
cluster_97    153_2,18_1            2         AT1G34350,AT1G77750,AT2G32990,AT1G71
cluster_98    225_1,387_1           2         AT5G12880,AT5G64100,AT3G22620,AT5G26
cluster_99    279_1,342_1,405_2,99_14         AT3G56370,AT4G30320,AT2G38480,AT1G27
cluster_100   125_2,184_1,19_1,368_24         AT3G08630,AT5G42180(PER64),AT1G55580
cluster_101   312_5,52_1            2         AT3G28790,AT5G09650,AT5G40040,AT1G78
cluster_102   42_2                  1         AT2G41740,AT4G20010,AT5G04770,AT2G34
cluster_103   303_1                 1         AT1G48930(putative glucanase),AT4G34580
cluster_104   102_5,15_1,335_5      3         AT5G53490,AT5G48450,AT3G10720,AT4G34
cluster_105   102_3,68_1            2         AT5G14740,AT5G12880,AT5G63800(AtBGAL
cluster_106   380_1                 1         AT3G45970(EXPL1),AT3G16860(COBL8),AT4
cluster_107   4_1                   1         AT5G03170(FLA11),AT4G27435,AT2G38080(
cluster_108                         4
              153_1,156_1,364_1,377_1         AT3G54560,AT4G26760,AT4G31840,AT5G65
cluster_109   108_2,236_1,368_1     3         AT5G14340,AT4G14130(XTH15),AT1G78090
cluster_110   397_1,4_1,81_6        3         AT2G47900,AT5G03170(FLA11),AT2G38080(
cluster_111   184_1,368_1,388_1     3         AT1G49580,AT5G42180(PER64),AT5G16710
cluster_112   166_1,186_2,271_1     3         AT3G16770,AT5G04160,AT2G22560,AT4G03
cluster_113                         5
              177_1,181_1,309_1,362_1,411_1   AT5G25890,AT5G10580,AT5G65730(XTH6),A
cluster_114   192_4                 1         AT2G31750,AT2G01120,AT1G68360,AT3G19
cluster_115   345_1,67_1            2         AT1G30440,AT5G09330,AT2G31955,AT1G06
cluster_116   154_2,181_1,231_1     3         AT1G59870,AT4G24780,AT3G16240,AT5G65
cluster_117   377_1                 1         AT2G37630,AT3G54560,AT4G26760,AT1G18
cluster_118   44_2                  1         AT2G17720,AT3G06300(AtP4H2),AT2G35610
cluster_119   349_1                 1         AT1G72230,AT2G17720,AT5G42180(PER64)
cluster_120   92_1                  1         AT5G10320,AT3G42960,AT3G54560,AT4G28
cluster_121   154_2,293_1,92_1      3         AT1G59870,AT3G54560,AT3G16240,AT5G66
cluster_122   181_3,405_2,40_8,81_9 4         AT5G22580,AT1G08830,AT5G05010,AT3G53
cluster_123   335_4,343_1,415_1,81_94         AT5G23530,AT5G65930,AT1G71960,AT1G53
cluster_124                         4
              109_1,279_1,337_1,401_1         AT5G20050,AT1G59870,AT2G01540,AT3G53
cluster_125                         4
              108_2,156_1,265_1,401_1         AT5G65620,AT1G49580,AT4G21350,AT2G31
cluster_126   230_2,64_1            2         AT2G47550,AT4G02280,AT3G05490,AT1G72
cluster_127   362_1                 1         AT3G25930,AT1G30750,AT3G22620,AT1G29
cluster_128   121_1                 1   AT1G79340,AT5G07820,AT2G37130(PER21)
cluster_129   18_1,192_2,278_1      3   AT3G61960,AT1G35190,AT2G32990,AT1G71
cluster_130   44_2                  1   AT2G17720,AT5G51060,AT3G06300(AtP4H2
cluster_131   125_3,154_1,186_1     3   AT3G62640,AT1G70790,AT5G65730(XTH6),A
cluster_132   186_3,200_1,87_1      3   AT5G40150,AT2G48130,AT3G46750,AT2G10
cluster_133   312_5,99_1            2   AT5G09650,AT3G10720,AT5G13140,AT5G15
cluster_134   167_1,181_1,67_1,81_4 4   AT5G44790,AT5G16130,AT5G65730(XTH6),A
cluster_135   184_5,254_1           2   AT5G23530,AT5G35190,AT2G36250,AT3G05
cluster_136   2_1,383_1             2   AT1G22480,AT5G03170(FLA11),AT3G54290,
cluster_137   108_1,184_5,337_1     3   AT5G23530,AT1G35190,AT1G47990,AT2G33
cluster_138   181_3                 1   AT5G22580,AT3G18050,AT3G53260(PAL2),A
cluster_139   186_3,192_1,42_2,85_1 4   AT3G46750,AT4G31760,AT2G02160,AT2G43
cluster_140   181_1,323_5,368_1,86_14   AT4G02320,AT2G42220,AT5G25050,AT4G30
cluster_141   125_2,40_5,74_1       3   AT5G55230,AT5G20130,AT4G22120,AT4G33
cluster_142   108_1,293_1,348_1,99_14   AT5G48900,AT5G38950,AT1G70040,AT3G56
cluster_143   225_3,368_1           2   AT4G14130(XTH15),AT5G39370,AT1G09510
cluster_144   338_1                 1   AT3G15520,AT5G13140,AT2G35190,AT1G53
cluster_145   119_1,44_1,52_3       3   AT5G42180(PER64),AT2G41100,AT2G28110
cluster_146   44_3                  1   AT5G65020,AT1G12310,AT3G43960,AT1G52
cluster_147   153_2,181_1,192_3,40_44   AT1G34350,AT1G71960,AT5G65730(XTH6),A
cluster_148                         4
              102_4,125_5,293_1,380_1   AT4G02320,AT5G17380,AT2G42220,AT3G45
cluster_149                         4
              119_1,261_1,393_1,81_11   AT1G22480,AT4G17350,AT5G03170(FLA11),
cluster_150   337_3                 1   AT1G69580,AT4G36810,AT4G20460(UXE4),A
cluster_151   102_5                 1   AT3G10720,AT5G48450,AT4G02070,AT5G45
cluster_152   401_3                 1   AT4G38860,AT4G24930,AT2G37040(PAL1),A
cluster_153   154_1,184_2,52_2,87_1 4   AT5G48380,AT1G11580(pectin methylestera
cluster_154   155_2,208_1,323_2     3   AT1G76560,AT5G22280,AT2G35020,AT5G14
cluster_155   207_3,229_1,349_1,81_64   AT4G27060,AT5G35730,AT1G16370,AT3G01
cluster_156   334_1,86_1            2   AT4G05590,AT3G10080,AT3G23000,AT1G78
cluster_157   211_1,349_1,405_2,81_64   AT5G01610,AT2G17720,AT5G66920,AT5G56
cluster_158   312_5                 1   AT5G10140,AT5G09650,AT1G69295,AT2G33
cluster_159   368_1                 1   AT5G18990,AT5G04400,AT5G39370,AT2G11
cluster_160   401_2                 1   AT1G23140,AT5G01610,AT5G11090,AT2G17
cluster_161   384_1                 1   AT5G60020(LAC17),AT3G16920,AT5G12870
cluster_162   183_2                 1   AT3G59640,AT1G27400,AT3G59060,AT5G45
cluster_163   279_2,3_1             2   AT1G65610(hypothetical protein),AT3G43960
cluster_164   125_3,251_1,81_4      3   AT3G08630,AT5G44790,AT3G23690,AT5G22
cluster_165   44_4                  1   AT5G18520,AT3G56930,AT4G14750,AT2G36
cluster_166   211_1                 1   AT1G56320,AT5G56540(AGP14),AT2G48140
cluster_167   125_1,279_2,411_1     3   AT5G39320(UGD1),AT4G20480,AT1G75680(
cluster_168   64_1                  1   AT2G47550,AT3G05490,AT4G01700,AT4G25
cluster_169   81_8                  1   AT1G78140,AT4G25020,AT5G02420,AT2G38
cluster_170   14_1                  1   AT5G24210,AT2G22900,AT2G43570,AT3G22
cluster_171   248_1                 1   AT3G25930,AT5G64100,AT3G44320,AT1G30
cluster_172   286_3,339_1           2   AT1G06930,AT2G34500,AT1G25260,AT4G25
cluster_173   156_1,312_2,393_1   3   AT5G13190,AT1G69580,AT3G14280,AT3G52
cluster_174   192_2,309_1         2   AT5G10580,AT1G12800,AT1G14080(FUT6),A
cluster_175   64_2,74_1,99_2      3   AT2G32300(UCC1),AT3G18050,AT2G48130,A
cluster_176   101_1,209_1,294_1   3   AT5G07990,AT5G07280,AT3G53260(PAL2),A
cluster_177   261_1               1   AT1G22480,AT5G03170(FLA11),AT5G12870,
cluster_178   271_1,275_1,52_2    3   AT3G16770,AT5G48380,AT1G50010,AT4G00
cluster_179   271_1,337_3         2   AT1G50630,AT1G50010,AT1G69580,AT4G36
cluster_180   20_1,337_5          2   AT3G56910,AT5G45390,AT2G20420,AT2G44
cluster_181   379_1               1   AT5G55540,AT2G28790,AT1G16780,AT1G21
cluster_182   393_1               1   AT5G13190,AT4G17350,AT1G69580,AT3G14
cluster_183   40_2,40_3,81_9      3   AT4G02060,AT1G02730(CslD5),AT5G25770,
cluster_184   339_1,65_1          2   AT2G31350,AT1G06930,AT5G16460,AT3G43
cluster_185   181_2,265_1,294_1   3   AT5G65620,AT3G53260(PAL2),AT3G16240,A
cluster_186   275_1               1   AT4G26010,AT2G48130,AT1G05260(PER3=R
cluster_187   380_1,42_2          2   AT3G45970(EXPL1),AT4G30280(XTH18),AT2
cluster_188   102_2               1   AT5G22580,AT1G23090,AT5G65730(XTH6),A
cluster_189   125_3,395_1         2   AT2G15090,AT5G13140,AT3G10720,AT5G39
cluster_190   14_1,230_2          2   AT4G02280,AT1G72680(CAD9),AT5G04540,A
cluster_191   173_1,286_2,52_3    3   AT5G23530,AT3G07510,AT1G12110,AT3G53
cluster_192   154_3               1   AT1G59960,AT1G09340,AT3G53260(PAL2),A
cluster_193   176_1               1   AT5G44130(FLA13),AT5G56870(AtBGAL4),A
cluster_194   207_3               1   AT4G27060,AT5G04160,AT4G27690,AT5G18
cluster_195   303_1,405_1         2   AT2G32300(UCC1),AT5G42180(PER64),AT3G
cluster_196   124_1,15_1,64_2     3   AT2G32300(UCC1),AT5G62620,AT3G12490,A
cluster_197   184_2,337_4,81_11   3   AT5G03170(FLA11),AT2G36835,AT3G54420,
cluster_198   141_1,81_3,92_2     3   AT4G04350,AT1G50010,AT5G39880,AT5G54
cluster_199   125_5,286_1,40_3    3   AT4G02320,AT5G59170,AT4G33410,AT1G68
cluster_200   42_1                1   AT1G23030,AT5G04470,AT3G24450,AT4G12
cluster_201   44_2                1   AT2G17720,AT5G51060,AT2G35610,AT3G06
cluster_202   218_1,265_4,303_1   3   AT1G56310,AT3G05490,AT4G34580,AT1G72
cluster_203   149_1               1   AT1G09340,AT1G26230,AT3G15840,AT1G05
cluster_204   18_1                1   AT5G07030,AT1G70710(CEL1),AT1G76790(C
cluster_205   128_2,323_3,85_1    3   AT5G23530,AT5G27100,AT5G65930,AT5G64
cluster_206   144_1,337_5,338_1   3   AT3G56910,AT5G13140,AT5G45390,AT2G35
cluster_207   395_1               1   AT2G15090,AT3G10720,AT5G13140,AT2G04
cluster_208   42_3                1   AT2G25490,AT5G56870(AtBGAL4),AT3G5248
cluster_209   181_3,339_1         2   AT5G22580,AT3G18050,AT3G53260(PAL2),A
cluster_210   108_2               1   AT4G08380,AT5G07040,AT1G09510,AT4G05
cluster_211   153_2,219_1,230_2   3   AT3G18050,AT1G77750,AT1G34350,AT1G71
cluster_212   308_1,87_1          2   AT5G40150,AT3G53190,AT1G70710(CEL1),A
cluster_213   318_1               1   AT1G28290,AT4G03210(XTH9),AT4G20430,A
cluster_214   108_2,337_1,81_9    3   AT1G35190,AT4G24930,AT1G53730,AT4G13
cluster_215   119_1,229_1         2   AT2G32300(UCC1),AT5G12870,AT5G42180(
cluster_216   119_1               1   AT5G12870,AT5G42180(PER64),AT2G04850
cluster_217   278_1               1   AT1G35190,AT3G61960,AT1G11860,AT1G71
cluster_218   144_1,335_2,81_2    3   AT2G33450,AT3G29290,AT1G09250,AT4G03
cluster_219   3_1,323_3,64_3      3   AT5G48900,AT5G13450,AT3G51160(GMD2-M
cluster_220   238_2,64_3,67_1     3   AT3G07590,AT4G20430,AT4G30800,AT1G50
cluster_221   295_1,379_1         2   AT3G28790,AT3G28750,AT5G39880,AT3G20
cluster_222   312_4               1   AT5G39320(UGD1),AT2G17930,AT2G19900,
cluster_223   128_1               1   AT3G15720,AT5G42970,AT1G49400,AT2G01
cluster_224   125_5,294_1,380_1   3   AT4G02320,AT5G17380,AT1G15950(CCR1),A
cluster_225   184_3,186_1,323_3   3   AT4G34440,AT5G10740,AT5G23530,AT1G54
cluster_226   345_1,81_11         2   AT1G63110,AT1G30440,AT5G06660,AT1G06
cluster_227   229_1,278_1,339_1   3   AT1G35190,AT3G61960,AT2G39040,AT1G71
cluster_228   155_1               1   AT3G28790,AT1G05360,AT3G48440,AT1G02
cluster_229   286_2,81_9          2   AT5G23530,AT3G07510,AT1G12110,AT1G53
cluster_230   207_3               1   AT4G27060,AT5G04160,AT4G27690,AT5G18
cluster_231   40_1,81_2           2   AT5G61030,AT1G65700,AT5G16130,AT2G46
cluster_232   177_1,275_1,395_1   3   AT3G10720,AT2G31390,AT4G23690,AT1G30
cluster_233   155_2,192_2,207_1   3   AT4G38370,AT1G12800,AT1G04880,AT1G07
cluster_234   4_1                 1   AT5G03170(FLA11),AT4G27435,AT2G38080(
cluster_235   128_1,153_1,230_1   3   AT3G15720,AT3G48580(XTH11),AT2G30200
cluster_236   108_2,184_5,81_2    3   AT5G23530,AT4G40045,AT1G49580,AT2G33
cluster_237   40_4,81_5,99_2      3   AT1G08830,AT5G59740,AT1G09760,AT5G43
cluster_238   64_1                1   AT2G47550,AT3G05490,AT4G01700,AT4G25
cluster_239   185_2,337_2         2   AT5G03650,AT5G23530,AT1G29330,AT4G37
cluster_240   249_1,343_1,67_2    3   AT5G24580,AT5G22430,AT1G04900,AT3G57
cluster_241   102_5               1   AT5G48450,AT3G10720,AT4G02070,AT5G45
cluster_242   265_1               1   AT1G78310,AT5G65620,AT1G31550,AT4G21
cluster_243   323_4               1   AT5G45300,AT5G65210,AT1G23205,AT2G41
cluster_244   40_1,46_1           2   AT4G10970,AT5G61030,AT1G65700,AT3G02
cluster_245   40_5                1   AT3G10160,AT5G55230,AT4G24440,AT1G26
cluster_246   154_1,238_2,293_1   3   AT4G24780,AT1G11580(pectin methylestera
cluster_247   323_2               1   AT3G59420,AT3G07410,AT5G22280,AT2G27
cluster_248   225_3               1   AT4G14130(XTH15),AT5G03260(LAC11),AT1
cluster_249   335_4,99_2          2   AT4G19230,AT1G09415,AT4G20110,AT1G75
cluster_250   108_2,251_1         2   AT2G32990,AT4G08380,AT4G05240,AT3G13
cluster_251   192_1               1   AT1G09340,AT5G55560,AT1G30360,AT2G02
cluster_252   225_3               1   AT4G14130(XTH15),AT5G03260(LAC11),AT1
cluster_253   108_2,225_3         2   AT4G14130(XTH15),AT4G08380,AT5G07040
cluster_254   323_6,380_1         2   AT3G07590,AT3G45970(EXPL1),AT1G35780,
cluster_255   411_1               1   AT5G66390(PER72),AT3G24670,AT2G30210
cluster_256   81_11               1   AT1G63110,AT5G06660,AT5G03170(FLA11),
cluster_257   200_1,42_2          2   AT3G24670,AT1G17890(GER2),AT2G34500,A
cluster_258   200_1               1   AT1G17890(GER2),AT2G48130,AT5G17820(
cluster_259   415_1               1   AT3G21770(PER30),AT5G66390(PER72),AT2
cluster_260   140_1               1   AT4G03210(XTH9),AT3G54920(PMR6),AT4G
cluster_261   149_1,225_1         2   AT1G09340,AT3G22620,AT5G26260,AT1G26
cluster_262   125_5,184_4         2   AT4G35450,AT5G03650,AT5G17380,AT4G02
cluster_263   186_2               1   AT5G04160,AT2G22560,AT2G19000,AT3G07
cluster_264   153_1               1   AT4G25260,AT4G39220,AT1G61667,AT2G30
cluster_265   275_1               1   AT4G26010,AT4G11290,AT2G48130,AT1G05
cluster_266   16_1                1   AT3G21240(4CL2),AT2G27140,AT2G32990,A
cluster_267   44_2                1   AT2G17720,AT5G51060,AT2G35610,AT3G06
cluster_268   265_4,68_1          2   AT3G16690,AT5G08400,AT5G12880,AT1G56
cluster_269   18_1                1   AT5G07030,AT1G76790(COMT-like8),AT3G5
cluster_270   348_1               1   AT3G10720,AT4G38660,AT3G56370,AT2G14
cluster_271   121_1,225_3,229_1   3   AT2G39040,AT5G07820,AT1G52910,AT4G30
cluster_272   155_3               1   AT1G71770,AT5G57610,AT5G62500,AT2G37
cluster_273   183_2               1   AT1G55265,AT5G45950,AT4G34050(CCoAOM
cluster_274   149_1               1   AT1G26230,AT1G09340,AT3G15840,AT1G05
cluster_275   295_1,96_1          2   AT3G28790,AT3G28750,AT5G39880,AT3G20
cluster_276   323_4               1   AT5G45300,AT5G65210,AT1G23205,AT4G33
cluster_277   42_1                1   AT1G23030,AT3G24450,AT5G04470,AT4G12
cluster_278   229_2,64_3          2   AT5G13450,AT5G25820,AT2G25810,AT3G51
cluster_279   229_2,286_3         2   AT2G25810,AT5G42180(PER64),AT3G05490
cluster_280   231_1               1   AT5G51560,AT2G45180,AT5G64330,AT2G24
cluster_281   211_1,254_1         2   AT5G35190,AT4G40090(AGP3),AT4G30320,A
cluster_282   271_1               1   AT3G16770,AT5G03530,AT1G50010,AT1G12
cluster_283   85_1                1   AT5G30500,AT5G27100,AT3G43500,AT4G31
cluster_284   173_1,86_1          2   AT1G15950(CCR1),AT4G05590,AT2G40890(C
cluster_285   192_2               1   AT5G17820(PER57),AT5G59730,AT1G49820
cluster_286   407_1               1   AT2G28950(EXP6),AT5G55730(FLA1),AT4G0
cluster_287   40_8,42_3           2   AT1G08830,AT3G06840,AT2G25490,AT3G52
cluster_288   153_1,52_2          2   AT5G48380,AT4G00330,AT2G36380,AT5G08
cluster_289   155_1,20_1          2   AT3G28790,AT1G05360,AT1G02790,AT3G48
cluster_290   155_2,207_1         2   AT4G38370,AT3G57690(AGP23),AT1G07410
cluster_291   271_1,81_6          2   AT3G16770,AT5G66920,AT2G47900,AT1G50
cluster_292   2_1,337_2           2   AT5G03650,AT5G40380,AT3G54290,AT3G59
cluster_293   251_1,337_6         2   AT5G11090,AT2G32990,AT1G49580,AT1G71
cluster_294   40_1                1   AT5G61030,AT4G10970,AT3G07410,AT5G16
cluster_295   41_1                1   AT1G15210,AT3G25930,AT5G17820(PER57)
cluster_296   125_1,154_3         2   AT2G42220,AT4G20480,AT3G05490,AT1G20
cluster_297   265_1,405_2         2   AT5G65620,AT1G11670,AT4G21350,AT2G31
cluster_298   102_4,398_1         2   AT4G37740,AT2G42220,AT4G27520,AT3G14
cluster_299   125_1               1   AT4G38360,AT4G20480,AT5G56870(AtBGAL
cluster_300   230_1               1   AT3G47860,AT3G48580(XTH11),AT5G04040
cluster_301   186_3,249_1         2   AT2G10970,AT3G46750,AT5G22430,AT2G42
cluster_302   265_4               1   AT3G16690,AT5G08400,AT1G56310,AT3G05
cluster_303   96_1                1   AT3G28790,AT3G28750,AT5G39880,AT3G20
cluster_304   121_1,128_1         2   AT3G15720,AT5G42970,AT1G49400,AT2G01
cluster_305   207_3               1   AT5G04160,AT4G27690,AT5G18780,AT1G22
cluster_306   209_1,312_5         2   AT5G09650,AT1G05070,AT2G36720,AT1G20
cluster_307   111_1,265_5         2   AT3G21770(PER30),AT1G67910,AT1G14210
cluster_308   185_2,40_1    2   AT5G23530,AT4G10970,AT1G65700,AT5G61
cluster_309   337_1,405_2   2   AT5G01610,AT2G24260,AT2G33450,AT4G13
cluster_310   401_2         1   AT5G01610,AT1G23140,AT5G11090,AT3G56
cluster_311   42_1          1   AT1G23030,AT4G12730(FLA2),AT5G04470,A
cluster_312   184_1         1   AT3G08630,AT5G42180(PER64),AT1G49580
cluster_313   192_2         1   AT5G17820(PER57),AT1G12800,AT1G19050
cluster_314   318_1,4_1     2   AT4G20430,AT1G28290,AT5G03170(FLA11),
cluster_315   397_1,42_2    2   AT3G20570,AT2G34500,AT5G44030(CesA4),
cluster_316   362_1,387_1   2   AT5G12880,AT5G17820(PER57),AT5G56540
cluster_317   121_1         1   AT5G07820,AT1G79340,AT2G37130(PER21)
cluster_318   125_2         1   AT1G01560,AT3G45970(EXPL1),AT5G63905,
cluster_319   184_3         1   AT5G11090,AT2G45290,AT2G45190,AT1G80
cluster_320   20_1,64_1     2   AT2G47550,AT3G05490,AT4G01700,AT4G08
cluster_321   236_1         1   AT4G14130(XTH15),AT5G14340,AT1G78090
cluster_322   261_1,384_1   2   AT3G16920,AT5G12870,AT5G03170(FLA11),
cluster_323   303_1,405_1   2   AT2G32300(UCC1),AT1G48930(putative gluc
cluster_324   323_1         1   AT2G23930,AT1G50110,AT5G57060,AT5G59
cluster_325   156_1,348_1   2   AT4G03210(XTH9),AT3G10720,AT3G54920(P
cluster_326   379_1,40_7    2   AT1G44750,AT4G14500,AT1G06450,AT4G14
cluster_327   380_1         1   AT3G45970(EXPL1),AT3G16860(COBL8),AT4
cluster_328   385_1         1   AT4G01720,AT3G53280,AT1G21480,AT1G76
cluster_329   395_1         1   AT2G15090,AT5G55730(FLA1),AT2G28950(E
cluster_330   125_5         1   AT5G17380,AT3G06770
cluster_331   184_5         1   AT5G23530,AT4G05460,AT1G09840,AT5G64
cluster_332   211_1         1   AT2G48140,AT2G23540,AT3G10340(PAL4)
cluster_333   238_1,337_5   2   AT3G62030,AT4G23800,AT5G45390,AT1G54
cluster_334   111_1         1   AT3G21770(PER30),AT5G66390(PER72),AT1
cluster_335   125_5         1   AT4G02320,AT5G17380,AT3G06770,AT4G37
cluster_336   166_1         1   AT4G27450,AT4G03210(XTH9),AT5G47810,A
cluster_337   183_2         1   AT1G27400,AT3G59640,AT3G59060,AT5G45
cluster_338   192_3         1   AT1G63310,AT5G12880,AT3G27690,AT2G03
cluster_339   309_1,411_1   2   AT2G45430,AT3G54770,AT3G24670,AT5G10
cluster_340   364_1         1   AT4G38660,AT1G75680(endo-beta-1,4-gluca
cluster_341   364_1,411_1   2   AT4G38660,AT3G24670,AT1G75680(endo-be
cluster_342   87_1          1   AT5G40150,AT1G70710(CEL1),AT1G21090,A
cluster_343   141_1         1   AT3G28790,AT3G28750,AT1G70790,AT5G39
cluster_344   20_1          1   AT5G58480,AT1G21880,AT5G08000(glycosy
cluster_345   254_1         1   AT5G35190,AT4G40090(AGP3),AT3G05490,A
cluster_346   312_1         1   AT1G29680,AT1G53760,AT4G10020,AT4G33
cluster_347   211_1,225_3   2   AT4G14130(XTH15),AT5G03260(LAC11),AT1
cluster_348   41_1,64_3     2   AT5G13450,AT3G51160(GMD2-Mur1),AT1G0
cluster_349   121_1         1   AT5G07820,AT1G79340,AT2G37130(PER21)
cluster_350   186_2         1   AT2G22560,AT5G04160,AT3G07830,AT2G19
cluster_351   192_4         1   AT2G31750,AT2G01120,AT3G19710,AT4G02
cluster_352   295_1,96_1    2   AT3G28790,AT3G28750,AT5G39880,AT3G20
cluster_353   339_1,40_3    2   AT5G59170,AT1G68260,AT1G56340,AT4G33
cluster_354   238_2,67_1    2   AT3G07590,AT4G30800,AT4G20430,AT1G50
cluster_355   144_1         1   AT4G01700,AT3G06300(AtP4H2),AT3G27170
cluster_356   149_1         1   AT1G26230,AT1G09340,AT3G15840,AT1G05
cluster_357   208_1         1   AT5G37500,AT1G76560,AT2G35020,AT1G68
cluster_358   238_1,323_5   2   AT4G02320,AT4G30390,AT1G44750,AT4G39
cluster_359   388_1         1   AT2G17370,AT3G17420,AT5G42180(PER64)
cluster_360   401_1         1   AT1G35190,AT1G49580,AT2G24020,AT5G16
cluster_361   74_1,81_4     2   AT3G08630,AT3G23690,AT5G44790,AT5G22
cluster_362   231_1,42_2    2   AT2G34500,AT5G51560,AT2G28110(FRA8),A
cluster_363   323_3,65_1    2   AT5G23530,AT5G65930,AT5G16460,AT1G15
cluster_364   398_1,81_1    2   AT1G20160,AT5G23530,AT3G21760,AT5G40
cluster_365   108_1,92_2    2   AT1G70040,AT5G38950,AT1G47990,AT4G22
cluster_366   192_3,231_1   2   AT1G63310,AT3G27690,AT2G03510,AT5G04
cluster_367   3_1,399_1     2   AT5G48900,AT4G16640,AT1G19050,AT5G65
cluster_368   348_1         1   AT3G10720,AT4G38660,AT3G56370,AT2G14
cluster_369   102_3         1   AT5G14740,AT1G10360,AT5G63800(AtBGAL
cluster_370   343_1         1   AT3G62170,AT2G02720,AT2G24450(FLA3),A
cluster_371   385_1         1   AT4G01720,AT3G53280,AT1G76360,AT1G21
cluster_372   415_1,52_3    2   AT3G52840(AtBGAL2),AT3G21770(PER30),A
cluster_373   128_1,286_1   2   AT3G15720,AT1G11670,AT5G42180(PER64)
cluster_374   399_1         1   AT3G07760,AT4G16640,AT3G14070,AT1G04
cluster_375   81_8          1   AT1G78140,AT4G25020,AT5G02420,AT2G38
cluster_376   401_1,99_1    2   AT1G09970,AT1G49580,AT3G62030,AT3G56
cluster_377   124_1         1   AT4G10925,AT1G17680,AT5G62620,AT3G12
cluster_378   265_2,335_4   2   AT1G30440,AT2G20310,AT5G23530,AT3G06
cluster_379   337_5         1   AT3G56910,AT3G62030,AT5G45390,AT2G20
cluster_380   81_7          1   AT2G43950,AT5G01970,AT3G57180,AT1G31
cluster_381   230_2         1   AT4G02280,AT3G14070,AT5G04540,AT1G72
cluster_382   102_4,303_1   2   AT2G42220,AT1G05190,AT2G20260,AT3G05
cluster_383   279_1,44_1    2   AT4G14130(XTH15),AT2G01540,AT1G11670
cluster_384   401_1         1   AT1G35190,AT1G49580,AT5G16710,AT5G06
cluster_385   155_1         1   AT3G28790,AT1G05360,AT1G02790,AT3G48
cluster_386   185_2         1   AT5G23530,AT4G33510,AT1G29330,AT1G76
cluster_387   399_1,407_1   2   AT4G03210(XTH9),AT3G61640(AGP20),AT4G
cluster_388   401_3         1   AT3G14110,AT2G37040(PAL1),AT1G07610,A
cluster_389   74_1,85_1     2   AT2G48130,AT5G27100,AT4G31760,AT2G30
cluster_390   102_5,19_1    2   AT2G22450,AT1G65240,AT4G14500,AT3G03
cluster_391   184_5,40_2    2   AT4G02060,AT1G49580,AT3G56370,AT5G44
cluster_392   345_1         1   AT1G30440,AT2G17720,AT1G76790(COMT-l
cluster_393   225_1         1   AT5G26260,AT3G22620,AT1G29280,AT5G66
cluster_394   108_2,279_2   2   AT5G58010,AT3G13140,AT5G15730,AT5G07
cluster_395   102_5         1   AT5G48450,AT3G10720,AT4G02070,AT5G45
cluster_396   140_1,156_1   2   AT4G03210(XTH9),AT3G54920(PMR6),AT1G
cluster_397   184_5,337_3   2   AT1G50630,AT5G23530,AT1G69580,AT5G28
cluster_398   86_1          1   AT3G23000,AT1G78570(RHM1),AT4G05590,
cluster_399   111_1         1   AT3G21770(PER30),AT5G66390(PER72),AT1
cluster_400   153_1         1   AT4G25260,AT4G39220,AT1G61667,AT2G30
cluster_401   178_1,81_3    2   AT1G66670,AT4G04350,AT1G50010,AT4G21
cluster_402   380_1         1   AT3G45970(EXPL1),AT3G16860(COBL8),AT4
cluster_403   401_3,52_1    2   AT3G28790,AT4G26830,AT1G78600,AT5G52
cluster_404   111_1,415_1   2   AT5G66390(PER72),AT2G30210(LAC3),AT2G
cluster_405   131_1,183_2   2   AT3G59640,AT3G59060,AT5G42100,AT2G28
cluster_406   407_1         1   AT4G03210(XTH9),AT2G28950(EXP6),AT5G5
cluster_407   108_1         1   AT1G70040,AT5G38950,AT1G47990,AT5G48
cluster_408   407_1         1   AT2G28950(EXP6),AT5G55730(FLA1),AT4G0
cluster_409   141_1,380_1   2   AT5G39880,AT4G35180,AT5G54095,AT5G26
cluster_410   155_2         1   AT1G07410,AT3G57690(AGP23),AT1G04880
cluster_411   312_5         1   AT5G09650,AT5G10140,AT1G69295,AT2G33
cluster_412   323_4         1   AT5G45300,AT5G65210,AT1G23205,AT4G33
cluster_413   337_3,342_1   2   AT1G49970,AT1G50630,AT2G22880,AT3G07
cluster_414   364_1         1   AT4G38660,AT1G75680(endo-beta-1,4-gluca
cluster_415   68_1          1   AT5G48900,AT5G12880,AT3G28860,AT2G44
cluster_416   337_4         1   AT2G36835,AT3G54420,AT2G01890,AT3G48
cluster_417   81_11         1   AT1G63110,AT5G06660,AT5G03170(FLA11),
cluster_418   177_1,225_2   2   AT5G25890,AT3G25930,AT2G31390,AT5G26
cluster_419   248_1         1   AT3G25930,AT5G64100,AT3G44320,AT4G23
cluster_420   236_1,265_1   2   AT4G14130(XTH15),AT5G14340,AT5G65620
cluster_421   348_1         1   AT3G10720,AT3G56370,AT4G38660,AT2G14
cluster_422   401_3         1   AT4G38860,AT2G37040(PAL1),AT4G24930,A
cluster_423   401_3,52_1    2   AT3G28790,AT4G24930,AT2G37040(PAL1),A
cluster_424   271_1,323_5   2   AT4G26100,AT5G03530,AT1G79340,AT4G28
cluster_425   128_2         1   AT3G07540,AT1G18730,AT1G76550,AT2G42
cluster_426   128_2         1   AT3G07540,AT1G18730,AT2G42570,AT1G76
cluster_427   323_6,377_1   2   AT2G37630,AT3G54560,AT1G35780,AT4G26
cluster_428   398_1         1   AT2G37640(EXP3),AT4G37740,AT2G31110,A
cluster_429   207_2,87_1    2   AT2G13690,AT3G56890,AT5G48410,AT1G77
cluster_430   42_1          1   AT2G18290,AT4G36380,AT3G10520,AT1G23
cluster_431   144_1         1   AT4G01700,AT3G06300(AtP4H2),AT3G27170
cluster_432   335_5         1   AT3G22190,AT5G21150,AT4G34630,AT1G06
cluster_433   405_1         1   AT2G32300(UCC1),AT5G42180(PER64),AT3G
cluster_434   176_1,65_1    2   AT2G31350,AT5G56870(AtBGAL4),AT5G5779
cluster_435   81_5          1   AT5G03650,AT1G34750,AT4G36810,AT4G30
cluster_436   124_1,401_1   2   AT1G09970,AT5G62620,AT2G24020,AT1G76
cluster_437   121_1,64_1    2   AT2G47550,AT3G05490,AT5G07820,AT4G01
cluster_438   111_1         1   AT3G21770(PER30),AT5G66390(PER72),AT1
cluster_439   68_1          1   AT5G48900,AT5G12880,AT3G28860,AT2G44
cluster_440   183_2,397_1   2   AT1G27400,AT3G20570,AT5G45950,AT2G48
cluster_441   229_1         1   AT2G32300(UCC1),AT5G39320(UGD1),AT2G
cluster_442   335_1         1   AT4G29140,AT5G43760,AT4G02560,AT3G23
cluster_443   323_5         1   AT4G02320,AT3G22260,AT4G30390,AT1G44
cluster_444   192_3         1   AT1G63310,AT5G12880,AT3G27690,AT3G45
cluster_445   271_1         1   AT3G16770,AT1G50010,AT1G77260,AT5G03
cluster_446   40_6          1   AT3G02600,AT5G48410,AT4G16650,AT5G58
cluster_447   44_4          1   AT5G18520,AT3G56930,AT4G14750,AT2G36
cluster_448   294_1,86_1    2   AT2G21620,AT1G51680(4CL1),AT3G46780,A
cluster_449   44_3          1   AT1G52910,AT2G41110
cluster_450   335_2,362_1   2   AT2G37760,AT1G18210,AT1G69430,AT2G46
cluster_451   119_1,229_1   2   AT5G42180(PER64),AT5G12870,AT2G04850
cluster_452   128_1         1   AT3G16780,AT5G42970,AT1G49400,AT2G01
cluster_453   166_1,81_8    2   AT3G10960,AT4G03210(XTH9),AT3G24160,A
cluster_454   155_1         1   AT3G28790,AT1G05360,AT1G02790,AT3G48
cluster_455   207_3         1   AT4G27060,AT5G04160,AT2G39450,AT5G18
cluster_456   249_1         1   AT5G22430,AT2G42530,AT5G20240,AT1G75
cluster_457   275_1         1   AT4G26010,AT2G48130,AT5G17820(PER57)
cluster_458   102_3,40_3    2   AT5G59170,AT4G33410,AT1G68260,AT5G63
cluster_459   14_1          1   AT2G43570,AT3G22600,AT2G22900
cluster_460   125_3,81_7    2   AT3G57180,AT2G43950,AT2G32590,AT1G20
cluster_461   119_1         1   AT5G42180(PER64),AT1G47410,AT5G46340
cluster_462   121_1,323_5   2   AT3G22260,AT4G02320,AT1G44750,AT2G03
cluster_463   40_9          1   AT5G23530,AT4G03490,AT3G12090,AT4G27
cluster_464   42_2          1   AT2G41740,AT4G20010,AT5G04770,AT2G34
cluster_465   144_1         1   AT4G01700,AT3G06300(AtP4H2),AT1G47740
cluster_466   15_1          1   AT5G53490,AT5G62620,AT1G17810,AT3G16
cluster_467   40_2          1   AT4G02060,AT1G49580,AT3G56370,AT5G44
cluster_468   211_1,81_7    2   AT5G01970,AT3G57180,AT1G31550,AT3G06
cluster_469   335_5,365_1   2   AT3G22190,AT2G45870,AT1G77860,AT1G06
cluster_470   261_1         1   AT1G22480,AT5G12870,AT5G42180(PER64)
cluster_471   67_2          1   AT5G24580,AT1G04900,AT5G17160,AT5G20
cluster_472   380_1         1   AT3G45970(EXPL1),AT3G16860(COBL8),AT4
cluster_473   52_2          1   AT5G48380,AT4G00330,AT2G36380,AT5G08
cluster_474   225_3         1   AT4G14130(XTH15),AT5G03260(LAC11),AT1
cluster_475   211_1,81_6    2   AT5G66920,AT3G27200,AT3G10340(PAL4),A
cluster_476   343_1         1   AT4G15980,AT3G62170,AT2G24450(FLA3),A
cluster_477   154_1,275_1   2   AT4G24780,AT5G25610,AT1G49750,AT5G65
cluster_478   40_4,81_8     2   AT1G78140,AT4G25020,AT2G38080(LAC4),A
cluster_479   2_2           1   AT1G19940(unknown protein),AT5G23860,A
cluster_480   2_1           1   AT5G60020(LAC17),AT3G16920,AT2G23360
cluster_481   254_1         1   AT5G35190,AT4G40090(AGP3),AT4G30320,A
cluster_482   155_3,323_3   2   AT5G23530,AT5G62500,AT2G37710,AT1G15
cluster_483   44_1          1   AT3G01470,AT5G49460,AT5G42180(PER64)
cluster_484   15_1          1   AT5G53490,AT5G10140,AT3G14070,AT3G16
cluster_485   334_1         1   AT4G03210(XTH9),AT4G38660,AT1G04680(p
cluster_486   337_6         1   AT5G11090,AT1G49580,AT1G71960,AT4G20
cluster_487   254_1,405_1   2   AT1G48930(putative glucanase),AT1G12560
cluster_488   335_1        1   AT4G29140,AT1G71780,AT1G71960,AT5G43
cluster_489   334_1,41_1   2   AT3G25930,AT3G13650,AT5G55730(FLA1),A
cluster_490   14_1         1   AT5G24210,AT2G22900,AT2G43570,AT3G22
cluster_491   278_1        1   AT3G61960,AT1G35190,AT1G71960,AT1G11
cluster_492   286_4        1   AT1G27400,AT2G26760,AT5G13870(XTH5),A
cluster_493   153_1        1   AT4G39220,AT4G25260,AT1G61667,AT2G30
cluster_494   286_4        1   AT1G27400,AT2G26760,AT5G13870(XTH5),A
cluster_495   99_1         1   AT5G13140,AT3G10720,AT3G56370,AT5G15
cluster_496   380_1,81_6   2   AT5G65020,AT2G47900,AT5G66920,AT3G16
cluster_497   265_2        1   AT3G06510,AT3G02880,AT1G70660,AT3G17
cluster_498   102_5        1   AT3G10720,AT5G45680
cluster_499   101_1        1   AT5G07990,AT5G07280,AT1G43640,AT5G60
cluster_500   102_2        1   AT5G22580,AT1G23090,AT5G65730(XTH6),A
cluster_501   108_1        1   AT5G38950,AT1G70040,AT1G47990,AT5G48
cluster_502   229_1        1   AT2G32300(UCC1),AT5G39320(UGD1),AT2G
cluster_503   229_2        1   AT5G25820,AT2G25810,AT5G42180(PER64)
cluster_504   293_1        1   AT5G48900,AT2G06850(XTH4),AT4G33220,A
cluster_505   318_1        1   AT1G28290,AT4G20430,AT4G03210(XTH9),A
cluster_506   337_6        1   AT1G49580,AT2G01720,AT4G20110,AT2G41
cluster_507   388_1        1   AT2G17370,AT5G42180(PER64),AT3G17420
cluster_508   395_1        1   AT2G15090,AT5G13140,AT3G10720,AT2G04
cluster_509   401_2        1   AT1G23140,AT5G01610,AT3G56910,AT2G17
cluster_510   401_2        1   AT1G23140,AT5G01610,AT2G17720,AT5G11
cluster_511   401_2        1   AT5G01610,AT1G23140,AT5G11090,AT2G17
cluster_512   405_1        1   AT2G32300(UCC1),AT5G42180(PER64),AT3G
cluster_513   81_9         1   AT5G28840(GME1),AT1G71960,AT1G53730,
cluster_514   108_2        1   AT4G05240,AT3G13140,AT1G09510,AT1G28
cluster_515   44_1         1   AT1G67730,AT1G64200
cluster_516   102_2        1   AT5G22580,AT1G23090,AT5G65730(XTH6),A
cluster_517   111_1        1   AT3G21770(PER30),AT5G66390(PER72),AT1
cluster_518   125_2        1   AT1G01560,AT3G45970(EXPL1),AT2G32160,
cluster_519   18_1         1   AT5G07030,AT1G76790(COMT-like8),AT1G7
cluster_520   181_3        1   AT5G22580,AT3G18050,AT3G53260(PAL2),A
cluster_521   200_1        1   AT1G17890(GER2),AT2G48130,AT5G17820(
cluster_522   265_2        1   AT1G30440,AT2G20310,AT3G06510,AT2G34
cluster_523   334_1        1   AT4G03210(XTH9),AT4G38660,AT1G04680(p
cluster_524   368_1        1   AT5G04400,AT5G18990,AT5G39370,AT2G11
cluster_525   377_1        1   AT2G37630,AT3G54560,AT4G26760,AT5G65
cluster_526   401_1        1   AT1G35190,AT1G49580,AT2G24020,AT5G16
cluster_527   86_1         1   AT1G78570(RHM1),AT3G23000,AT4G05590,
cluster_528   248_1        1   AT2G36100,AT4G13660,AT5G40730(AGP24)
cluster_529   275_1        1   AT2G48130,AT1G05260(PER3=Rcl3),AT5G53
cluster_530   385_1        1   AT5G58575,AT4G01720,AT3G23340
cluster_531   155_1        1   AT5G09550,AT2G20470
cluster_532   312_4        1   AT5G39410,AT3G01480,AT3G16190,AT3G15
cluster_533   141_1   1   AT5G39880,AT4G35180,AT5G54095,AT5G26
cluster_534   144_1   1   AT4G01700,AT3G06300(AtP4H2),AT3G27170
cluster_535   154_1   1   AT4G24780,AT1G11580(pectin methylestera
cluster_536   16_1    1   AT3G21240(4CL2),AT2G27140,AT2G32990,A
cluster_537   261_1   1   AT1G22480,AT5G03170(FLA11),AT5G42180(
cluster_538   279_2   1   AT5G39320(UGD1),AT4G22310,AT3G43960,
cluster_539   385_1   1   AT4G01720,AT3G53280,AT1G21480,AT1G76
cluster_540   16_1    1   AT3G21240(4CL2),AT2G27140,AT2G32990,A
cluster_541   16_1    1   AT3G21240(4CL2),AT2G27140,AT2G32990,A
cluster_542   176_1   1   AT5G44130(FLA13),AT5G56870(AtBGAL4),A
cluster_543   18_1    1   AT5G07030,AT1G76790(COMT-like8),AT1G7
cluster_544   192_1   1   AT1G09340,AT5G55560,AT1G30360,AT2G02
cluster_545   265_5   1   AT1G67910,AT1G14210,AT4G03110,AT4G05
cluster_546   303_1   1   AT1G48930(putative glucanase),AT4G34580
cluster_547   397_1   1   AT5G44030(CesA4),AT5G03260(LAC11),AT2
cluster_548   40_7    1   AT2G38040,AT4G14500,AT1G06450,AT5G67
cluster_549   99_1    1   AT3G10720,AT5G13140,AT3G56370,AT5G15
cluster_550   101_1   1   AT5G07990,AT5G60140,AT1G43640,AT5G59
cluster_551   108_2   1   AT4G08380,AT5G07040,AT1G09510,AT4G05
cluster_552   2_2     1   AT5G23860,AT1G19940(unknown protein),A
cluster_553   225_2   1   AT5G65390(AGP7),AT5G40730(AGP24),AT3G
cluster_554   294_1   1   AT1G15950(CCR1),AT2G16700,AT3G53260(P
cluster_555   3_1     1   AT5G48900,AT4G27520,AT1G19050,AT5G65
cluster_556   323_6   1   AT3G07590,AT5G16130,AT1G35780,AT3G61
cluster_557   40_2    1   AT3G16260,AT5G44200,AT1G02730(CslD5),
cluster_558   68_1    1   AT5G48900,AT5G12880,AT3G28860,AT2G44
cluster_559   286_5   1   AT5G63150,AT4G23070,AT2G33040,AT1G52
cluster_560   102_2   1   AT5G22580,AT1G23090,AT5G65730(XTH6),A
cluster_561   108_2   1   AT4G08380,AT5G07040,AT1G09510,AT4G05
cluster_562   121_1   1   AT5G07820,AT1G79340,AT2G37130(PER21)
cluster_563   125_2   1   AT1G01560,AT3G45970(EXPL1),AT5G63905,
cluster_564   156_1   1   AT2G28950(EXP6),AT3G54920(PMR6),AT2G0
cluster_565   181_1   1   AT5G10180,AT5G14740,AT5G48900,AT2G42
cluster_566   238_1   1   AT3G27060,AT5G16130,AT1G48230,AT1G54
cluster_567   265_5   1   AT1G67910,AT1G14210,AT4G03110,AT4G05
cluster_568   335_2   1   AT2G26460,AT2G37760,AT3G51050,AT1G18
cluster_569   337_1   1   AT1G35190,AT2G17720,AT4G24930,AT5G42
cluster_570   40_4    1   AT5G59740,AT1G09760,AT5G43080,AT5G47
cluster_571   41_1    1   AT3G25930,AT4G23690,AT3G13650,AT4G17
cluster_572   44_4    1   AT5G18520,AT3G56930,AT4G14750,AT2G36
cluster_573   52_3    1   AT4G27450,AT3G52840(AtBGAL2),AT3G5192
cluster_574   64_2    1   AT2G32300(UCC1),AT5G61340,AT2G39430,A
cluster_575   85_1    1   AT5G30500,AT3G43500,AT5G27100,AT4G31
cluster_576   102_3   1   AT5G14740,AT1G10360,AT1G32060,AT4G20
cluster_577   271_1   1   AT3G16770,AT1G12780(UGE1),AT5G15410,A
cluster_578   339_1   1   AT1G06930,AT1G52810
cluster_579   415_1   1   AT5G66390(PER72),AT2G30210(LAC3),AT2G
cluster_580   102_2   1   AT5G22580,AT5G65730(XTH6),AT4G16980,A
cluster_581   108_1   1   AT1G70040,AT5G38950,AT1G47990,AT5G48
cluster_582   124_1   1   AT1G17680,AT4G10925,AT5G62620,AT3G12
cluster_583   128_2   1   AT3G07540,AT1G18730,AT2G42570,AT1G76
cluster_584   154_1   1   AT4G24780,AT1G11580(pectin methylestera
cluster_585   156_1   1   AT2G28950(EXP6),AT4G03210(XTH9),AT3G5
cluster_586   184_5   1   AT5G23530,AT2G36250,AT5G28840(GME1),
cluster_587   218_1   1   AT5G65390(AGP7),AT3G25930,AT2G48130,A
cluster_588   244_1   1   AT3G06420,AT5G54095,AT3G26860,AT3G51
cluster_589   3_1     1   AT5G48900,AT4G27520,AT5G65730(XTH6),A
cluster_590   342_1   1   AT2G22880,AT3G09920,AT1G27930,AT3G07
cluster_591   399_1   1   AT3G14070,AT4G16640,AT3G07760,AT1G04
cluster_592   405_2   1   AT5G01610,AT2G24260,AT2G17720,AT1G11
cluster_593   44_4    1   AT5G18520,AT3G56930,AT4G14750,AT2G36
cluster_594   102_5   1   AT5G48450,AT4G02070,AT5G45680
cluster_595   401_3   1   AT4G38860,AT3G14110,AT4G34090,AT3G60
cluster_596   124_1   1   AT1G17680,AT5G62620,AT3G12490,AT5G45
cluster_597   149_1   1   AT1G09340,AT1G26230,AT3G15840,AT1G05
cluster_598   153_1   1   AT4G39220,AT4G25260,AT1G61667,AT2G30
cluster_599   154_3   1   AT1G09340,AT1G59960,AT5G15230,AT5G23
cluster_600   167_1   1   AT1G27400,AT3G07110,AT3G07590,AT1G16
cluster_601   229_1   1   AT2G32300(UCC1),AT2G17720,AT5G39320(
cluster_602   230_2   1   AT4G02280,AT3G14070,AT5G04540,AT1G72
cluster_603   81_7    1   AT3G57180,AT2G43950,AT5G01970,AT1G31
cluster_604   349_1   1   AT5G42180(PER64),AT3G06300(AtP4H2)
cluster_605   102_2   1   AT5G22580,AT1G23090,AT5G65730(XTH6),A
cluster_606   102_2   1   AT5G22580,AT1G23090,AT5G65730(XTH6),A
cluster_607   102_5   1   AT3G10720,AT5G48450,AT4G02070,AT5G45
cluster_608   108_1   1   AT5G38950,AT1G70040,AT1G47990,AT5G48
cluster_609   121_1   1   AT1G79340,AT5G07820,AT2G37130(PER21)
cluster_610   121_1   1   AT1G79340,AT5G07820,AT2G37130(PER21)
cluster_611   14_1    1   AT5G24210,AT3G22600,AT2G43570,AT2G22
cluster_612   147_1   1   AT5G54095,AT5G65530,AT2G22180,AT4G36
cluster_613   154_1   1   AT4G24780,AT1G11580(pectin methylestera
cluster_614   178_1   1   AT1G72230,AT5G42180(PER64),AT1G02950
cluster_615   184_2   1   AT1G23140,AT1G35190,AT1G28290,AT3G56
cluster_616   184_2   1   AT1G23140,AT1G28290,AT3G56910,AT1G35
cluster_617   186_1   1   AT4G34440,AT1G35490,AT1G54280,AT5G39
cluster_618   207_1   1   AT3G06150,AT4G38370,AT5G59480,AT4G02
cluster_619   209_1   1   AT2G47640,AT1G05070,AT5G05000,AT1G20
cluster_620   211_1   1   AT1G56320,AT5G56540(AGP14),AT2G48140
cluster_621   230_2   1   AT4G02280,AT3G14070,AT1G72680(CAD9),A
cluster_622   248_1   1   AT3G25930,AT5G64100,AT3G44320,AT4G23
cluster_623   254_1   1   AT5G35190,AT4G40090(AGP3),AT3G05490,A
cluster_624   286_2   1   AT5G23530,AT4G35620,AT1G12110,AT4G30
cluster_625   286_5   1   AT4G23070,AT5G04960,AT5G63400,AT5G43
cluster_626   303_1   1   AT1G48930(putative glucanase),AT4G34580
cluster_627   3_1     1   AT5G48900,AT1G19050,AT5G65730(XTH6),A
cluster_628   337_5   1   AT3G56910,AT3G62030,AT5G45390,AT2G20
cluster_629   348_1   1   AT3G10720,AT4G38660,AT3G56370,AT2G14
cluster_630   388_1   1   AT2G17370,AT5G42180(PER64),AT3G17420
cluster_631   40_8    1   AT1G08830,AT1G04680(pectate lyase family
cluster_632   41_1    1   AT1G15210,AT3G25930,AT1G05260(PER3=R
cluster_633   41_1    1   AT3G25930,AT3G13650,AT4G23690,AT4G17
cluster_634   411_1   1   AT5G66390(PER72),AT3G24670,AT2G30210
cluster_635   44_4    1   AT5G18520,AT3G56930,AT4G14750,AT2G36
cluster_636   44_4    1   AT5G18520,AT3G56930,AT4G14750,AT2G36
cluster_637   65_1    1   AT2G31350,AT5G16460,AT5G57790,AT5G22
cluster_638   68_1    1   AT5G48900,AT5G12880,AT3G28860,AT2G44
cluster_639   102_5   1   AT4G02070,AT5G45680
cluster_640   225_3   1   AT4G14130(XTH15),AT5G03260(LAC11),AT4
cluster_641   323_3   1   AT1G15700,AT3G05750,AT1G16680
cluster_642   64_3    1   AT3G06300(AtP4H2),AT1G67330,AT4G16260
cluster_643   46_1    1   AT1G48100,AT2G27040
cluster_644   102_2   1   AT5G22580,AT1G23090,AT5G65730(XTH6),A
cluster_645   14_1    1   AT5G24210,AT2G22900,AT2G43570,AT3G22
cluster_646   155_3   1   AT1G71770,AT5G57610,AT5G62500,AT5G03
cluster_647   178_1   1   AT1G72230,AT1G02950,AT5G42180(PER64)
cluster_648   18_1    1   AT5G07030,AT1G76790(COMT-like8),AT1G7
cluster_649   218_1   1   AT3G25930,AT5G64100,AT1G30750,AT3G21
cluster_650   228_1   1   AT3G45770,AT1G78550,AT4G20030,AT4G15
cluster_651   228_1   1   AT1G49660,AT5G58090,AT2G33310,AT4G20
cluster_652   261_1   1   AT1G22480,AT5G42180(PER64),AT5G03170
cluster_653   293_1   1   AT5G48900,AT2G06850(XTH4),AT4G33220,A
cluster_654   335_2   1   AT2G26460,AT3G51050,AT2G37760,AT1G18
cluster_655   337_2   1   AT5G03650,AT3G20510,AT5G65210,AT3G54
cluster_656   337_6   1   AT5G11090,AT1G49580,AT1G71960,AT2G01
cluster_657   395_1   1   AT2G15090,AT5G13140,AT3G10720,AT2G04
cluster_658   401_1   1   AT1G35190,AT1G49580,AT2G24020,AT5G16
cluster_659   64_1    1   AT2G47550,AT3G05490,AT4G01700,AT4G08
cluster_660   85_1    1   AT5G30500,AT3G43500,AT5G27100,AT4G31
cluster_661   92_1    1   AT5G10320,AT3G42960,AT3G54560,AT4G28
cluster_662   225_1   1   AT2G47000,AT3G22600,AT3G22620
cluster_663   278_1   1   AT1G35190,AT1G11860
cluster_664   303_1   1   AT5G67400(PER73),AT4G25790
cluster_665   99_2    1   AT1G75780,AT3G23760,AT3G45850
cluster_666   102_2   1   AT5G22580,AT1G23090,AT5G65730(XTH6),A
cluster_667   156_1   1   AT4G03210(XTH9),AT2G28950(EXP6),AT3G5
cluster_668   166_1   1   AT4G27450,AT4G03210(XTH9),AT5G47810,A
cluster_669   207_1   1   AT4G38370,AT3G06150,AT1G53000,AT5G59
cluster_670   225_3   1   AT4G14130(XTH15),AT5G03260(LAC11),AT1
cluster_671   99_1    1   AT5G13140,AT3G10720,AT5G15230,AT3G56
cluster_672   275_1   1   AT2G48130,AT1G05260(PER3=Rcl3),AT1G30
cluster_673   46_1    1   AT1G28290,AT4G23800,AT2G27040,AT3G50
cluster_674   178_1   1   AT1G72230,AT5G42180(PER64),AT3G20570
cluster_675   121_1   1   AT1G79340,AT5G07820,AT2G37130(PER21)
cluster_676   125_5   1   AT4G02320,AT5G17380,AT3G06770,AT4G37
cluster_677   128_1   1   AT3G15720,AT5G42970,AT1G49400,AT2G01
cluster_678   15_1    1   AT5G53490,AT5G62620,AT1G17810,AT3G16
cluster_679   153_2   1   AT3G07110,AT3G17940,AT1G77750,AT1G34
cluster_680   155_2   1   AT5G65090,AT5G55950,AT3G51030,AT5G53
cluster_681   181_3   1   AT5G22580,AT3G18050,AT3G53260(PAL2),A
cluster_682   185_2   1   AT2G04700,AT4G33510,AT3G20120,AT1G29
cluster_683   225_2   1   AT5G65390(AGP7),AT5G40730(AGP24),AT3G
cluster_684   225_2   1   AT5G65390(AGP7),AT5G40730(AGP24),AT3G
cluster_685   225_3   1   AT4G14130(XTH15),AT5G03260(LAC11),AT1
cluster_686   254_1   1   AT5G35190,AT4G40090(AGP3),AT3G05490,A
cluster_687   312_4   1   AT5G39320(UGD1),AT2G17930,AT2G19900,
cluster_688   312_5   1   AT5G09650,AT5G10140,AT1G69295,AT2G33
cluster_689   397_1   1   AT5G44030(CesA4),AT5G03260(LAC11),AT2
cluster_690   40_9    1   AT5G23530,AT5G48380,AT1G79820,AT1G54
cluster_691   4_1     1   AT5G03170(FLA11),AT4G27435,AT2G38080(
cluster_692   415_1   1   AT3G21770(PER30),AT5G66390(PER72),AT2
cluster_693   44_2    1   AT2G17720,AT5G51060,AT2G35610,AT3G06
cluster_694   92_2    1   AT3G10570,AT4G22753,AT1G44110,AT5G18
cluster_695   108_2   1   AT1G47370,AT1G09510,AT2G10340
cluster_696   186_3   1   AT2G10970,AT4G17690,AT3G01250,AT1G72
cluster_697   207_1   1   AT4G38370,AT1G17560,AT3G06150,AT1G15
cluster_698   230_2   1   AT4G02280,AT3G14070,AT5G04540
cluster_699   230_2   1   AT4G02280,AT1G72680(CAD9)
cluster_700   254_1   1   AT5G35190,AT4G40090(AGP3),AT3G05490,A
cluster_701   385_1   1   AT3G53280,AT1G21480,AT2G37130(PER21)
cluster_702   4_1     1   AT5G44030(CesA4),AT5G15490(UGD3),AT4G
cluster_703   42_1    1   AT5G16590,AT4G36380,AT3G24450,AT4G12
cluster_704   42_1    1   AT5G16590,AT4G36380,AT4G12730(FLA2),A
cluster_705   52_1    1   AT2G19770,AT3G28790,AT3G47250,AT1G59
cluster_706   52_1    1   AT3G28790,AT5G16510
cluster_707   231_1   1   AT5G51560,AT2G45180,AT5G64330,AT2G24
cluster_708   364_1   1   AT4G38660,AT1G75680(endo-beta-1,4-gluca
cluster_709   397_1   1   AT5G44030(CesA4),AT5G03260(LAC11),AT2
cluster_710   44_2    1   AT2G17720,AT3G06300(AtP4H2),AT5G51060
cluster_711   44_3    1   AT1G12310,AT5G65020,AT3G43960,AT1G52
cluster_712   181_3   1   AT5G22580,AT3G18050,AT3G53260(PAL2),A
cluster_713   294_1   1   AT1G15950(CCR1),AT2G16700,AT3G53260(P
cluster_714   334_1   1   AT4G03210(XTH9),AT4G38660,AT1G66430,A
cluster_715   87_1    1   AT5G40150,AT1G70710(CEL1),AT1G21090,A
cluster_716   109_1   1   AT1G59870,AT5G20050,AT3G53260(PAL2),A
cluster_717   128_1   1   AT3G16780,AT5G64080,AT4G19840,AT3G19
cluster_718   131_1   1   AT2G28950(EXP6),AT5G55730(FLA1),AT1G2
cluster_719   181_3   1   AT5G22580,AT3G18050,AT3G53260(PAL2),A
cluster_720   183_2   1   AT3G59640,AT1G27400,AT3G59060,AT5G45
cluster_721   244_1   1   AT5G61720,AT4G04930,AT3G26860,AT1G29
cluster_722   312_2   1   AT5G59170,AT2G05580,AT1G16850,AT3G51
cluster_723   312_4   1   AT5G39320(UGD1),AT2G17930,AT3G16190,
cluster_724   323_4   1   AT5G45300,AT5G65210,AT1G23205,AT5G40
cluster_725   335_5   1   AT3G22190,AT5G21150,AT4G34630,AT5G64
cluster_726   342_1   1   AT2G22880,AT3G07390(AIR12),AT3G09920,
cluster_727   343_1   1   AT4G15980,AT2G24450(FLA3),AT1G29980,A
cluster_728   349_1   1   AT1G72230,AT2G17720,AT5G42180(PER64)
cluster_729   4_1     1   AT5G03170(FLA11),AT4G27435,AT2G38080(
cluster_730   52_1    1   AT3G28790,AT5G40040,AT1G71770,AT1G78
cluster_731   92_2    1   AT3G10570,AT5G18460,AT1G75240,AT1G67
cluster_732   14_1    1   AT2G22900,AT3G22600,AT2G43570,AT5G43
cluster_733   18_1    1   AT5G07030,AT3G52370(beta-Ig-H3 domain-
cluster_734   14_1    1   AT5G24210,AT3G22600,AT2G43570,AT2G22
cluster_735   154_1   1   AT4G24780,AT1G11580(pectin methylestera
cluster_736   154_3   1   AT3G01680,AT1G09340,AT1G59960,AT2G42
cluster_737   167_1   1   AT3G07590,AT4G30800,AT5G16130,AT2G36
cluster_738   176_1   1   AT5G44130(FLA13),AT5G56870(AtBGAL4),A
cluster_739   208_1   1   AT5G37500,AT1G76560,AT1G68600,AT2G35
cluster_740   208_1   1   AT5G37500,AT1G76560,AT2G35020,AT1G68
cluster_741   286_1   1   AT2G17720,AT3G24240,AT5G42180(PER64)
cluster_742   286_5   1   AT4G23070,AT5G04960,AT5G63400,AT5G43
cluster_743   339_1   1   AT1G06930,AT4G13080(XTH1),AT3G43900,A
cluster_744   395_1   1   AT2G15090,AT3G10720,AT5G13140,AT2G04
cluster_745   42_2    1   AT2G41740,AT4G20010,AT2G34500,AT5G04
cluster_746   44_1    1   AT5G49460,AT3G01470,AT5G42180(PER64)
cluster_747   44_1    1   AT5G49460,AT3G01470,AT5G42180(PER64)
cluster_748   68_1    1   AT5G48900,AT5G12880,AT3G28860,AT2G44
cluster_749   81_2    1   AT3G07510,AT4G40045,AT1G49580,AT2G33
cluster_750   81_7    1   AT3G57180,AT5G01970,AT2G43950,AT1G31
cluster_751   99_2    1   AT3G18050,AT1G75780,AT4G12420(SKU5),A
cluster_752   14_1    1   AT2G22900,AT3G22600,AT5G43260
cluster_753   102_2   1   AT4G16980,AT1G23090,AT1G31580,AT5G65
cluster_754   102_5   1   AT5G48450,AT3G10720,AT4G02070,AT5G45
cluster_755   401_2   1   AT1G23140,AT3G56910,AT2G17720,AT2G47
cluster_756   64_1    1   AT2G47550,AT3G05490,AT4G01700,AT4G08
cluster_757   64_1    1   AT2G47550,AT3G05490,AT4G01700,AT4G25
cluster_758   85_1    1   AT5G30500,AT5G27100,AT3G43500,AT4G31
cluster_759   334_1   1   AT4G03210(XTH9),AT5G55730(FLA1),AT4G1
cluster_760   125_5   1   AT5G17380,AT4G02320,AT3G06770,AT4G37
cluster_761   286_2   1   AT5G23530,AT3G07510,AT4G35620,AT1G12
cluster_762   312_2   1   AT5G59170,AT2G05580,AT1G16850,AT3G51
cluster_763   42_2    1   AT2G41740,AT4G20010,AT2G34500,AT5G04
cluster_764   109_1   1   AT5G20050,AT1G59870,AT3G53260(PAL2),A
cluster_765   144_1   1   AT4G01700,AT3G06300(AtP4H2),AT3G27170
cluster_766   16_1    1   AT3G21240(4CL2),AT2G27140,AT2G32990,A
cluster_767   337_5   1   AT3G56910,AT3G62030,AT5G45390,AT2G20
cluster_768   339_1   1   AT4G13080(XTH1),AT3G43900
cluster_769   18_1    1   AT1G70710(CEL1),AT2G32990
cluster_770   407_1   1   AT4G03210(XTH9),AT5G55730(FLA1),AT2G3
cluster_771   108_2   1   AT4G08380,AT5G07040,AT1G09510,AT4G05
cluster_772   108_2   1   AT4G08380,AT5G07040,AT1G09510,AT4G05
cluster_773   155_2   1   AT5G57810,AT1G04880,AT3G57690(AGP23)
cluster_774   248_1   1   AT3G25930,AT5G64100,AT3G44320,AT4G23
cluster_775   248_1   1   AT3G25930,AT5G64100,AT3G44320,AT3G13
cluster_776   337_2   1   AT5G03650,AT5G65210,AT3G20510,AT5G40
cluster_777   379_1   1   AT5G55540,AT2G28790,AT1G16780,AT5G10
cluster_778   393_1   1   AT5G13190,AT4G17350,AT1G69580,AT3G14
cluster_779   121_1   1   AT1G79340,AT2G37130(PER21),AT2G22470
cluster_780   108_1   1   AT1G70040,AT5G38950,AT5G48770,AT2G24
cluster_781   65_1    1   AT2G31350,AT5G16460,AT5G57790,AT5G22
cluster_782   397_1   1   AT5G44030(CesA4),AT5G03260(LAC11),AT2
cluster_783   46_1    1   AT1G48100,AT3G07540,AT4G23800,AT2G27
cluster_784   368_2   1   AT3G48830,AT1G55580,AT3G46800,AT4G08
cluster_785   44_2    1   AT2G17720,AT5G51060,AT2G35610,AT3G06
cluster_786   87_1    1   AT5G40150,AT1G70710(CEL1),AT1G21090,A
cluster_787   411_1   1   AT3G24670,AT5G14150,AT2G30490(C4H)
cluster_788   229_2   1   AT2G25810,AT5G42180(PER64),AT3G05490
cluster_789   318_1   1   AT4G03210(XTH9),AT1G28290,AT4G20430,A
cluster_790   323_6   1   AT2G27720,AT4G28300,AT5G16130,AT1G35
cluster_791   40_8    1   AT5G05010,AT5G59010,AT1G04680(pectate
cluster_792   87_1    1   AT5G40150,AT1G70710(CEL1),AT1G21090,A
cluster_793   229_1   1   AT3G29250,AT2G39040,AT3G06300(AtP4H2
cluster_794   368_2   1   AT1G55580,AT4G08380,AT3G48830,AT1G01
cluster_795   61_1    1   AT5G12880,AT2G26650,AT3G13610,AT2G21
cluster_796   278_1   1   AT3G61960,AT1G12780(UGE1)
cluster_797   192_1   1   AT1G09340,AT5G55560,AT2G02160,AT1G30
cluster_798   286_4   1   AT5G13870(XTH5),AT1G12560(EXP7),AT2G2
cluster_799   338_1   1   AT3G15520,AT5G13140,AT3G49670,AT2G35
cluster_800   46_1    1   AT1G48100,AT3G07540,AT1G28290,AT4G23
cluster_801   81_9    1   AT2G40020,AT1G53730,AT2G43080(AtP4H1
cluster_802   102_3   1   AT5G14740,AT1G10360,AT5G63800(AtBGAL
cluster_803   15_1    1   AT5G53490,AT5G62620,AT1G17810,AT4G13
cluster_804   186_3   1   AT2G10970,AT3G46750,AT4G17690,AT3G01
cluster_805   312_5   1   AT5G10140,AT5G09650,AT1G69295,AT2G33
cluster_806   411_1   1   AT5G66390(PER72),AT3G24670,AT5G14150
cluster_807   128_1   1   AT3G15720,AT5G42970,AT1G49400,AT2G01
cluster_808   286_1   1   AT1G11670,AT5G42180(PER64),AT3G05490
cluster_809   368_1   1   AT5G39370,AT1G09510,AT5G30500,AT1G44
cluster_810   14_1    1   AT5G24210,AT2G43570,AT2G22900
cluster_811   176_1   1   AT5G56870(AtBGAL4),AT5G51890,AT1G0387
cluster_812   52_1    1   AT5G52340,AT1G18280,AT4G36220(F5H1),A
cluster_813   124_1   1   AT1G17680,AT4G10925,AT4G17180,AT1G03
cluster_814   173_1   1   AT1G15950(CCR1),AT2G40890(C3H1),AT3G5
cluster_815   184_2   1   AT5G01610,AT1G23140,AT1G35190,AT3G56
cluster_816   207_3   1   AT4G27060,AT2G39450,AT5G18780,AT5G35
cluster_817   219_1   1   AT3G18050,AT5G66190,AT1G16880,AT5G64
cluster_818   334_1   1   AT4G03210(XTH9),AT4G38660,AT1G04680(p
cluster_819   337_1   1   AT2G17720,AT1G35190,AT2G33450,AT4G13
cluster_820   337_3   1   AT5G01610,AT1G67920,AT4G36810,AT5G20
cluster_821   398_1   1   AT4G37740,AT2G37640(EXP3),AT2G31110,A
cluster_822   74_1    1   AT4G11290,AT2G48130,AT5G17820(PER57)
cluster_823   81_5    1   AT5G03650,AT1G08830,AT1G34750,AT4G30
cluster_824   121_1   1   AT1G79340,AT5G07820,AT2G22470(AGP2)
cluster_825   207_1   1   AT5G59480,AT1G15660,AT1G53000,AT5G23
cluster_826   208_1   1   AT1G76560,AT1G76550,AT3G24450,AT5G14
cluster_827   211_1   1   AT1G56320,AT2G48140,AT5G56540(AGP14)
cluster_828   286_5   1   AT4G23070,AT5G04960,AT5G63400,AT5G43
cluster_829   401_1   1   AT1G35190,AT1G49580,AT2G24020,AT5G16
cluster_830   387_1   1   AT3G22600,AT1G74970,AT3G21510
cluster_831   279_2   1   AT5G65020,AT3G43960,AT1G52910,AT4G01
cluster_832   323_1   1   AT5G59740,AT1G56110,AT5G51590,AT3G03
cluster_833   323_2   1   AT5G58230,AT4G38370,AT3G07410,AT5G22
cluster_834   337_2   1   AT5G03650,AT3G20510,AT5G65210,AT5G40
cluster_835   40_1    1   AT1G65700,AT4G10970,AT5G61030,AT3G07
cluster_836   44_3    1   AT1G12310,AT5G65020,AT3G43960,AT1G52
cluster_837   81_11   1   AT5G06660,AT5G12130,AT5G03170(FLA11),
cluster_838   275_1   1   AT4G26010,AT2G48130,AT5G53250(AGP22)
cluster_839   46_1    1   AT1G48100,AT1G28290,AT3G07540,AT4G23
cluster_840   81_11   1   AT5G12130,AT4G18780(CesA8)
cluster_841   192_3   1   AT1G63310,AT5G12880,AT3G45970(EXPL1),
cluster_842   218_1   1   AT5G65390(AGP7),AT2G30210(LAC3),AT5G4
cluster_843   102_4   1   AT1G75690,AT2G42840,AT1G05190,AT2G42
cluster_844   125_1   1   AT4G20480,AT4G38360,AT3G05490,AT3G17
cluster_845   181_1   1   AT5G48900,AT5G14740,AT5G10180,AT4G24
cluster_846   184_5   1   AT2G17370,AT3G17470,AT2G36250,AT5G28
cluster_847   102_4   1   AT1G75690,AT1G05190,AT2G42220,AT2G42
cluster_848   124_1   1   AT4G10925,AT5G62620,AT3G12490,AT5G45
cluster_849   155_1   1   AT3G28790,AT1G05360,AT3G48440,AT1G02
cluster_850   238_2   1   AT3G07590,AT1G50110,AT1G77580,AT5G65
cluster_851   279_2   1   AT4G22310,AT3G43960,AT1G52910,AT4G01
cluster_852   286_2   1   AT5G23530,AT4G35620,AT2G01720,AT4G30
cluster_853   312_1   1   AT5G53440,AT1G29680,AT2G32090,AT5G13
cluster_854   323_3   1   AT1G24360,AT3G06840,AT5G65930,AT1G76
cluster_855   337_4   1   AT5G17380,AT2G36835,AT2G01890,AT3G48
cluster_856   348_1   1   AT3G10720,AT4G38660,AT3G56370,AT2G14
cluster_857   67_2    1   AT5G24580,AT1G04900,AT5G17160,AT5G20
cluster_858   74_1    1   AT4G11290,AT2G48130,AT5G17820(PER57)
cluster_859   81_4    1   AT2G31350,AT3G08630,AT3G23690,AT5G44
cluster_860   81_5    1   AT1G08830,AT4G36810,AT2G45770,AT2G41
cluster_861   85_1    1   AT3G43500
cluster_862   265_4   1   AT2G41950,AT5G66920
cluster_863   335_4   1   AT5G23530,AT5G65930,AT2G03270,AT2G28
cluster_864   81_3    1   AT1G66670,AT4G04350,AT1G50010,AT5G45
cluster_865   339_1   1   AT1G06930,AT3G43900,AT1G52810
cluster_866   20_1    1   AT5G58480,AT1G66250,AT5G08000(glycosy
cluster_867   286_4   1   AT1G27400,AT2G26760,AT5G13870(XTH5),A
cluster_868   312_1   1   AT1G29680,AT4G10020,AT1G53760,AT5G60
cluster_869   40_3    1   AT5G59170,AT4G33410,AT1G68260,AT1G56
cluster_870   52_1    1   AT3G28790,AT5G40040,AT4G26830,AT1G71
cluster_871   2_1     1   AT2G35860,AT5G17420(CesA7),AT3G62020,
cluster_872   265_5   1   AT4G40060,AT2G22470(AGP2),AT4G05460
cluster_873   102_5   1   AT5G48450,AT3G10720,AT4G02070,AT5G45
cluster_874   251_1   1   AT2G32990,AT4G20110,AT2G37130(PER21)
cluster_875   251_1   1   AT2G32990,AT4G20110,AT2G37130(PER21)
cluster_876   286_2   1   AT5G23530,AT4G35620,AT3G07510,AT1G12
cluster_877   312_1   1   AT5G12030,AT3G10350,AT5G17230,AT4G13
cluster_878   401_2   1   AT1G23140,AT5G01610,AT2G17720,AT5G11
cluster_879   40_6    1   AT1G49300,AT1G61990,AT3G02600,AT4G16
cluster_880   40_6    1   AT5G24930,AT1G49300,AT4G16650,AT5G48
cluster_881   42_2    1   AT2G41740,AT4G20010,AT5G04770,AT2G34
cluster_882   92_2    1   AT3G10570,AT1G75240,AT1G67990(CCoAOM
cluster_883   92_2    1   AT1G67990(CCoAOMT5),AT3G10570,AT1G75
cluster_884   238_2   1   AT4G20430,AT1G50110,AT4G30800,AT3G07
cluster_885   348_1   1   AT3G10720,AT3G56370,AT4G38660,AT2G14
cluster_886   124_1   1   AT1G17680,AT4G10925,AT5G62620,AT3G12
cluster_887   166_1   1   AT4G27450,AT4G03210(XTH9),AT5G47810,A
cluster_888   2_2     1   AT5G23860,AT1G19940(unknown protein),A
cluster_889   278_1   1   AT3G61960,AT1G35190,AT1G71960,AT1G11
cluster_890   368_1   1   AT5G04400,AT5G18990,AT5G39370,AT1G09
cluster_891   208_1   1   AT1G76560,AT1G76550,AT5G14090
cluster_892   185_2   1   AT5G23530,AT3G20120,AT5G23440,AT1G29
cluster_893   4_1     1   AT5G03170(FLA11),AT2G38080(LAC4),AT4G
cluster_894   181_2   1   AT4G27440,AT4G16980,AT1G49750
cluster_895   81_7    1   AT3G57180,AT2G43950,AT5G01970,AT5G10
cluster_896   186_2   1   AT2G22560,AT5G04160,AT5G25880,AT2G19
cluster_897   111_1   1   AT3G21770(PER30),AT5G66390(PER72),AT1
cluster_898   147_1   1   AT1G49290,AT5G23270,AT3G51300,AT5G65
cluster_899   15_1    1   AT1G02700,AT5G62620,AT1G17810,AT3G16
cluster_900   177_1   1   AT5G25890,AT4G19030,AT3G25930,AT4G15
cluster_901   178_1   1   AT1G72230,AT1G02950,AT5G42180(PER64)
cluster_902   184_2   1   AT1G35190,AT3G56910,AT1G28290,AT1G35
cluster_903   184_3   1   AT5G06730,AT1G70770,AT3G19660,AT4G38
cluster_904   192_1   1   AT5G55560,AT5G05870,AT1G11860,AT2G28
cluster_905   192_1   1   AT1G09340,AT5G55560,AT2G02160,AT1G30
cluster_906   20_1    1   AT5G58480,AT5G08000(glycosyl hydrolase f
cluster_907   20_1    1   AT5G58480,AT5G08000(glycosyl hydrolase f
cluster_908   209_1   1   AT2G47640,AT1G05070,AT3G23310,AT2G36
cluster_909   248_1   1   AT3G25930,AT5G64100,AT3G44320,AT4G23
cluster_910   279_2   1   AT5G39320(UGD1),AT4G22310,AT1G65610(
cluster_911   323_2   1   AT1G28290,AT3G59420,AT5G58230,AT5G22
cluster_912   323_3   1   AT3G06840,AT3G49900,AT3G01780,AT1G76
cluster_913   395_1   1   AT2G15090,AT5G13140,AT3G10720,AT2G04
cluster_914   40_1    1   AT1G65700,AT5G61030,AT5G16130,AT3G13
cluster_915   401_3   1   AT4G38860,AT4G24930,AT2G37040(PAL1),A
cluster_916   40_2    1   AT4G02060,AT3G56370,AT1G49580,AT5G44
cluster_917   40_3    1   AT3G54350,AT4G16420,AT1G68260,AT3G01
cluster_918   40_8    1   AT3G13230,AT2G01600,AT3G06840,AT5G59
cluster_919   415_1   1   AT3G21770(PER30),AT5G66390(PER72),AT2
cluster_920   415_1   1   AT3G21770(PER30),AT5G66390(PER72),AT2
cluster_921   81_6    1   AT2G47900,AT3G27200,AT5G17310,AT5G65
cluster_922   81_7    1   AT4G33010,AT2G43950,AT1G17500,AT1G31
cluster_923   184_4   1   AT5G03650,AT4G35450,AT1G74370,AT1G32
cluster_924   377_1   1   AT4G26760,AT1G18370,AT5G65360,AT3G23
cluster_925   125_5   1   AT5G17380,AT4G02320,AT3G06770,AT4G37
cluster_926   81_8    1   AT1G78140,AT4G25020,AT5G02420,AT2G38
cluster_927   108_1   1   AT1G70040,AT5G38950,AT1G47990,AT5G48
cluster_928   125_1   1   AT4G38360,AT4G20480,AT3G17810,AT1G75
cluster_929   131_1   1   AT5G55730(FLA1),AT2G28950(EXP6),AT1G2
cluster_930   144_1   1   AT4G01700,AT3G06300(AtP4H2),AT3G27170
cluster_931   228_1   1   AT3G45770,AT1G52320,AT4G15780,AT1G71
cluster_932   238_1   1   AT3G27060,AT1G48230,AT1G54370,AT5G16
cluster_933   335_1   1   AT4G29140,AT1G71780,AT1G71960,AT5G43
cluster_934   383_1   1   AT5G40150,AT3G53190,AT1G70710(CEL1),A
cluster_935   388_1   1   AT2G17370,AT5G42180(PER64),AT3G17420
cluster_936   388_1   1   AT2G17370,AT5G42180(PER64),AT3G17420
cluster_937   64_2    1   AT2G32300(UCC1),AT5G61340,AT2G39430,A
cluster_938   411_1   1   AT5G66390(PER72),AT2G30210(LAC3)
cluster_939   153_2   1   AT1G34350,AT3G03220(EXP13)
cluster_940   154_1   1   AT4G24780,AT1G11580(pectin methylestera
cluster_941   102_5   1   AT5G48450,AT4G02070,AT5G45680
cluster_942   312_2   1   AT3G14070,AT1G14950,AT2G33520,AT4G31
cluster_943   339_1   1   AT1G06930,AT3G43900
cluster_944   124_1   1   AT1G17680,AT4G10925,AT5G62620,AT3G12
cluster_945   286_4   1   AT1G27400,AT2G26760,AT5G13870(XTH5),A
cluster_946   309_1   1   AT2G45430,AT3G54770,AT5G10580,AT5G15
cluster_947   399_1   1   AT3G14070,AT3G07760,AT4G16640,AT1G04
cluster_948   41_1    1   AT3G25930,AT3G22600,AT3G13650,AT2G22
cluster_949   99_1    1   AT5G13140,AT3G10720,AT5G15230,AT3G56
cluster_950   108_1   1   AT2G24840,AT4G19620
cluster_951   144_1   1   AT4G01700,AT3G06300(AtP4H2),AT1G47740
cluster_952   265_1   1   AT2G31090,AT5G60920(COB),AT5G05750
cluster_953   293_1   1   AT2G06850(XTH4),AT2G14890(AGP9)
cluster_954   275_1   1   AT1G05260(PER3=Rcl3),AT1G30870
cluster_955   395_1   1   AT2G15090,AT3G10720,AT5G13140,AT2G28
cluster_956   399_1   1   AT3G07760,AT4G16640,AT3G14070,AT1G04
cluster_957   14_1    1   AT5G24210,AT3G22600,AT2G22900,AT2G43
cluster_958   225_3   1   AT4G14130(XTH15),AT5G03260(LAC11),AT1
cluster_959   312_2   1   AT1G16850,AT1G14950,AT4G31830,AT5G64
cluster_960   405_1   1   AT1G48930(putative glucanase),AT4G34580
cluster_961   207_1   1   AT5G59480,AT1G15660,AT1G53000
cluster_962   207_1   1   AT5G59480,AT4G02610,AT3G06150,AT1G17
cluster_963   208_1   1   AT1G76560,AT1G76550,AT3G24450,AT2G47
cluster_964   312_5   1   AT5G09650,AT1G04920
cluster_965   365_1   1   AT4G16120(COBL7),AT4G18460,AT2G03350
cluster_966   81_1    1   AT1G20160,AT5G23530,AT5G40380,AT3G21
cluster_967   64_1    1   AT5G16590,AT5G05880,AT4G01700
cluster_968   380_1   1   AT3G45970(EXPL1),AT3G16860(COBL8),AT4
cluster_969   401_1   1   AT1G35190,AT5G16710,AT5G06730,AT3G54
cluster_970   111_1   1   AT3G21770(PER30),AT5G66390(PER72)
cluster_971   211_1   1   AT2G48140,AT3G10340(PAL4)
cluster_972   111_1   1   AT5G66390(PER72),AT1G05260(PER3=Rcl3)
cluster_973   108_1   1   AT1G70040,AT5G38950,AT5G48770,AT1G13
cluster_974   343_1   1   AT3G62170,AT1G29980,AT3G57690(AGP23)
cluster_975   184_2   1   AT1G23140,AT5G01610,AT2G24020,AT3G15
cluster_976   229_1   1   AT2G32300(UCC1),AT1G72230,AT2G43040
cluster_977   108_1   1   AT4G19620
cluster_978   111_1   1   AT3G21770(PER30),AT5G66390(PER72),AT1
cluster_979   125_1   1   AT4G38360,AT4G20480,AT5G56870(AtBGAL
cluster_980   149_1   1   AT1G09340,AT1G26230,AT3G15840,AT1G05
cluster_981   44_4    1   AT5G18520,AT3G56930,AT4G14750,AT2G36
cluster_982   109_1   1   AT3G19450(CAD2),AT3G53260(PAL2),AT1G1
cluster_983    323_1   1   AT2G23930,AT4G30800,AT5G57060,AT1G56
cluster_984    349_1   1   AT1G72230,AT3G06300(AtP4H2)
cluster_985    46_1    1   AT3G07540,AT1G28290,AT2G27040,AT3G50
cluster_986    323_6   1   AT3G07590,AT2G27720,AT4G28300,AT5G16
cluster_987    40_3    1   AT5G59170,AT1G68260,AT1G56340,AT4G33
cluster_988    87_1    1   AT5G40150,AT1G70710(CEL1),AT1G21090,A
cluster_989    229_1   1   AT2G39040,AT1G52910,AT3G06300(AtP4H2
cluster_990    149_1   1   AT1G09340,AT1G26230,AT3G15840,AT1G05
cluster_991    225_3   1   AT4G14130(XTH15),AT5G03260(LAC11),AT1
cluster_992    279_2   1   AT5G39320(UGD1),AT4G22310,AT3G43960,
cluster_993    405_1   1   AT5G42180(PER64),AT3G05490,AT2G35610
cluster_994    42_3    1   AT2G25490,AT5G56870(AtBGAL4),AT3G5248
cluster_995    44_2    1   AT2G17720,AT5G51060,AT2G35610,AT3G06
cluster_996    184_5   1   AT4G05460,AT1G09840,AT3G14110,AT5G64
cluster_997    244_1   1   AT3G62640,AT1G35490,AT3G03800,AT5G54
cluster_998    125_5   1   AT5G17380,AT4G02320,AT3G06770,AT4G37
cluster_999    387_1   1   AT3G22600,AT1G74970
cluster_1000   229_1   1   AT2G32300(UCC1),AT2G17720,AT5G39320(
cluster_1001   248_1   1   AT3G25930,AT5G64100,AT3G44320,AT1G30
cluster_1002   312_4   1   AT5G39320(UGD1),AT2G17930,AT2G19900,
cluster_1003   368_1   1   AT5G18990,AT2G11010,AT1G09510,AT1G44
cluster_1004   40_8    1   AT1G08830,AT5G05010,AT5G59010,AT3G13
cluster_1005   61_1    1   AT5G12880,AT5G66390(PER72),AT2G18980
cluster_1006   184_4   1   AT4G35450,AT5G03650,AT1G32070,AT1G74
cluster_1007   362_1   1   AT3G25930,AT3G22620,AT1G30750,AT1G29
cluster_1008   92_2    1   AT3G10570,AT4G22753,AT1G44110,AT3G43
cluster_1009   155_3   1   AT1G71770,AT5G57610,AT5G62500,AT5G03
cluster_1010   173_1   1   AT1G15950(CCR1),AT2G40890(C3H1),AT3G5
cluster_1011   184_3   1   AT4G38160,AT2G26760,AT4G00900,AT4G37
cluster_1012   337_1   1   AT4G33510,AT2G17720,AT5G42180(PER64)
cluster_1013   365_1   1   AT4G18460,AT4G16120(COBL7),AT2G03350
cluster_1014   52_1    1   AT5G40040,AT2G36190,AT1G59890,AT4G13
cluster_1015   365_1   1   AT4G18460,AT2G45870
cluster_1016   40_6    1   AT1G49300,AT5G24930,AT5G48410,AT4G16
cluster_1017   342_1   1   AT2G22880,AT1G27930,AT3G21230(4CL4),A
cluster_1018   154_1   1   AT4G24780,AT3G12780,AT5G65730(XTH6),A
cluster_1019   19_1    1   AT3G54800,AT3G18750,AT4G19120,AT1G35
cluster_1020   265_1   1   AT1G78310,AT5G65620,AT1G31550,AT4G21
cluster_1021   286_5   1   AT1G15950(CCR1),AT4G23070,AT5G07290,A
cluster_1022   40_9    1   AT5G23530,AT5G48380,AT1G79820,AT1G54
cluster_1023   42_1    1   AT1G23030,AT4G12730(FLA2),AT3G24450,A
cluster_1024   42_1    1   AT1G23030,AT5G04470,AT3G24450,AT4G12
cluster_1025   44_2    1   AT2G17720,AT2G35610,AT5G51060,AT3G06
cluster_1026   64_3    1   AT5G13450,AT3G51160(GMD2-Mur1),AT5G1
cluster_1027   64_3    1   AT5G13450,AT3G51160(GMD2-Mur1),AT5G1
cluster_1028   85_1    1   AT5G30500,AT3G43500,AT5G27100,AT4G31
cluster_1029   342_1   1   AT1G27930,AT3G09920,AT2G22880,AT3G07
cluster_1030   109_1   1   AT1G59870,AT5G20050,AT3G53260(PAL2),A
cluster_1031   335_5   1   AT3G22190,AT5G21150,AT4G34630,AT5G64
cluster_1032   109_1   1   AT5G20050,AT1G59870,AT3G53260(PAL2),A
cluster_1033   109_1   1   AT5G20050,AT1G59870,AT3G53260(PAL2),A
cluster_1034   109_1   1   AT5G20050,AT1G59870,AT3G53260(PAL2),A
cluster_1035   124_1   1   AT4G10925,AT1G17680,AT5G62620,AT3G12
cluster_1036   181_2   1   AT5G25610,AT3G16240,AT5G23060,AT1G49
cluster_1037   2_1     1   AT1G22480,AT5G03170(FLA11),AT5G12870,
cluster_1038   2_1     1   AT1G22480,AT5G03170(FLA11),AT5G12870,
cluster_1039   295_1   1   AT3G28750,AT3G28790,AT3G20865(AGP),AT
cluster_1040   225_2   1   AT5G65390(AGP7),AT5G40730(AGP24),AT3G
cluster_1041   225_3   1   AT4G14130(XTH15),AT5G03260(LAC11),AT1
cluster_1042   265_5   1   AT1G67910,AT1G14210,AT4G03110,AT4G05
cluster_1043   323_2   1   AT5G58230,AT3G07410,AT4G38370,AT5G22
cluster_1044   337_5   1   AT5G45390,AT2G20420,AT2G44640,AT5G41
cluster_1045   40_6    1   AT5G24930,AT3G02600,AT3G09670,AT5G58
cluster_1046   415_1   1   AT3G21770(PER30),AT5G66390(PER72),AT2
cluster_1047   64_2    1   AT2G32300(UCC1),AT5G61340,AT2G39430,A
cluster_1048   64_2    1   AT2G32300(UCC1),AT5G61340,AT2G39430,A
cluster_1049   149_1   1   AT1G26230,AT3G15840,AT1G05260(PER3=R
cluster_1050   368_1   1   AT5G39370,AT2G11010,AT1G09510
cluster_1051   181_3   1   AT5G22580,AT1G32060,AT3G45140,AT5G54
cluster_1052   209_1   1   AT3G29090,AT5G01020,AT2G21290,AT1G20
cluster_1053   365_1   1   AT4G16120(COBL7),AT4G18460,AT5G56590
cluster_1054   192_2   1   AT5G17820(PER57),AT1G12800,AT5G59730
cluster_1055   312_2   1   AT5G59170,AT2G05580,AT1G16850,AT1G64
cluster_1056   52_2    1   AT5G48380,AT1G25550,AT4G00330,AT1G62
cluster_1057   87_1    1   AT5G40150,AT1G70710(CEL1),AT1G21090,A
cluster_1058   186_3   1   AT2G10970,AT3G46750,AT4G17690,AT3G01
cluster_1059   155_1   1   AT3G28790,AT1G05360,AT1G02790,AT3G48
cluster_1060   155_1   1   AT3G28790,AT1G05360,AT3G48440,AT5G09
cluster_1061   184_4   1   AT5G03650,AT4G35450,AT1G32070,AT1G74
cluster_1062   20_1    1   AT5G58480,AT1G66250,AT5G08000(glycosy
cluster_1063   368_1   1   AT5G30500,AT5G04400,AT2G24810,AT1G13
cluster_1064   399_1   1   AT4G16640,AT3G07760,AT3G14070,AT1G04
cluster_1065   399_1   1   AT4G16640,AT3G07760,AT3G14070,AT1G04
cluster_1066   44_2    1   AT2G17720,AT2G35610,AT3G06300(AtP4H2
cluster_1067   81_8    1   AT1G78140,AT4G25020,AT5G02420,AT3G24
cluster_1068   192_2   1   AT5G17820(PER57),AT1G49820,AT1G19050
cluster_1069   229_2   1   AT2G25810,AT5G25820,AT5G42180(PER64)
cluster_1070   87_1    1   AT5G40150,AT1G70710(CEL1),AT1G21090,A
cluster_1071   178_1   1   AT1G72230,AT3G20570,AT4G35970
cluster_1072   111_1   1   AT3G21770(PER30),AT5G66390(PER72),AT1
cluster_1073   312_1   1   AT4G10020,AT1G53760,AT5G65810,AT2G32
cluster_1074   125_3   1   AT5G39320(UGD1),AT2G29450,AT2G47840,
cluster_1075   67_2    1   AT5G24580,AT1G04900,AT5G20730,AT2G17
cluster_1076   192_4   1   AT2G31750,AT2G01120,AT4G02860,AT3G19
cluster_1077   230_2   1   AT4G02280,AT3G14070,AT1G72680(CAD9),A
cluster_1078   249_1   1   AT5G22430,AT2G42530,AT5G20240,AT1G75
cluster_1079   111_1   1   AT3G21770(PER30),AT5G66390(PER72),AT1
cluster_1080   254_1   1   AT5G35190,AT4G40090(AGP3),AT4G30320,A
cluster_1081   286_1   1   AT2G17720,AT5G42180(PER64),AT5G16050
cluster_1082   286_5   1   AT4G23070,AT5G04960,AT5G63400,AT5G43
cluster_1083   154_1   1   AT4G24780,AT1G44800,AT3G23050,AT3G12
cluster_1084   192_2   1   AT5G17820(PER57),AT1G49820,AT1G12800
cluster_1085   229_1   1   AT2G32300(UCC1),AT2G17720,AT5G39320(
cluster_1086   334_1   1   AT4G03210(XTH9),AT4G38660,AT1G04680(p
cluster_1087   207_2   1   AT2G13690,AT5G48410,AT1G65380(CLV2),A
cluster_1088   207_2   1   AT2G13690,AT5G48410,AT2G35010,AT4G39
cluster_1089   2_1     1   AT1G22480,AT5G03170(FLA11),AT5G67090,
cluster_1090   323_4   1   AT5G45300,AT5G65210,AT4G33410,AT1G23
cluster_1091   337_4   1   AT1G01340,AT5G63680,AT5G40770,AT5G02
cluster_1092   338_1   1   AT3G15520,AT5G13140,AT3G49670,AT2G35
cluster_1093   399_1   1   AT3G07760,AT3G14070,AT4G16640,AT1G04
cluster_1094   40_5    1   AT3G10160,AT3G60690,AT5G20130,AT4G22
cluster_1095   42_2    1   AT2G41740,AT4G20010,AT5G04770,AT2G34
cluster_1096   99_1    1   AT3G10720,AT5G13140,AT3G56370,AT2G35
cluster_1097   44_4    1   AT5G18520,AT3G56930,AT4G14750
cluster_1098   154_1   1   AT5G53880,AT1G44800,AT3G23050,AT3G10
cluster_1099   337_1   1   AT1G35190,AT4G33510,AT1G09970,AT2G20
cluster_1100   44_4    1   AT5G18520,AT3G56930,AT4G14750,AT2G36
cluster_1101   155_2   1   AT5G52340,AT5G57810,AT1G22760,AT3G19
cluster_1102   265_5   1   AT1G67910,AT1G14210,AT4G03110,AT4G05
cluster_1103   323_2   1   AT4G38370,AT3G07410,AT1G66150,AT2G27
cluster_1104   385_1   1   AT4G01720,AT3G53280,AT1G21480,AT1G76
cluster_1105   41_1    1   AT1G15210,AT5G17820(PER57),AT1G05260
cluster_1106   81_1    1   AT5G23530,AT4G24120,AT3G01920,AT5G66
cluster_1107   81_1    1   AT5G23530,AT1G20160,AT5G42180(PER64)
cluster_1108   225_3   1   AT4G14130(XTH15),AT5G03260(LAC11),AT1
cluster_1109   244_1   1   AT3G06420,AT3G20580(phytochelatin synthe
cluster_1110   293_1   1   AT5G48900,AT3G13750(AtBGAL1)
cluster_1111   303_1   1   AT1G48930(putative glucanase),AT5G67400
cluster_1112   303_1   1   AT4G34580,AT5G67400(PER73),AT3G05490
cluster_1113   99_1    1   AT5G13140,AT3G10720,AT2G28950(EXP6),A
cluster_1114   225_3   1   AT5G03260(LAC11),AT1G64640
cluster_1115   40_9    1   AT5G48380,AT1G79820,AT1G54370,AT4G03
cluster_1116   42_3    1   AT2G25490,AT5G02260(EXP9),AT4G01950,A
cluster_1117   153_1   1   AT4G25260,AT4G39220,AT1G61667,AT2G30
cluster_1118   153_1   1   AT4G39220,AT4G25260,AT1G61667,AT2G30
cluster_1119   176_1   1   AT5G44130(FLA13),AT5G56870(AtBGAL4),A
cluster_1120   207_3   1   AT4G27060,AT5G18780,AT2G39450,AT5G35
cluster_1121   3_1     1   AT5G48900,AT1G19050,AT5G65730(XTH6),A
cluster_1122   81_6    1   AT5G65020,AT5G66920,AT3G27200,AT5G05
cluster_1123   144_1   1   AT4G01700,AT3G27170
cluster_1124   176_1   1   AT5G44130(FLA13),AT5G51890
cluster_1125   178_1   1   AT5G42180(PER64),AT4G35970
cluster_1126   184_5   1   AT2G04700,AT2G17370,AT1G25260,AT2G36
cluster_1127   149_1   1   AT1G09340,AT1G26230,AT3G15840,AT1G05
cluster_1128   209_1   1   AT3G29090,AT5G10810,AT5G01020,AT2G21
cluster_1129   166_1   1   AT4G27450,AT4G03210(XTH9),AT5G47810,A
cluster_1130   405_1   1   AT2G32300(UCC1),AT5G42180(PER64),AT3G
cluster_1131   128_1   1   AT3G15720,AT5G42970,AT1G49400,AT2G01
cluster_1132   15_1    1   AT5G53490,AT5G62620,AT4G13030,AT3G16
cluster_1133   2_1     1   AT1G22480,AT5G03170(FLA11),AT5G12870,
cluster_1134   271_1   1   AT3G16770,AT5G03530,AT1G50010,AT3G48
cluster_1135   40_6    1   AT5G24930,AT3G53190,AT1G61990,AT3G02
cluster_1136   44_1    1   AT3G01470,AT5G49460,AT5G42180(PER64)
cluster_1137   44_1    1   AT5G49460,AT3G01470,AT5G42180(PER64)
cluster_1138   64_2    1   AT2G32300(UCC1),AT5G61340,AT2G39430,A
cluster_1139   81_9    1   AT5G28840(GME1),AT1G53730,AT2G24020,
cluster_1140   99_2    1   AT3G18050,AT1G75780,AT4G12420(SKU5),A
cluster_1141   303_1   1   AT4G34580,AT4G40090(AGP3),AT1G12560(E
cluster_1142   323_6   1   AT3G07590,AT1G35780,AT3G61100,AT4G14
cluster_1143   399_1   1   AT3G14070,AT3G07760,AT4G16640,AT1G04
cluster_1144   92_2    1   AT3G10570,AT1G01110,AT4G22753,AT5G18
cluster_1145   121_1   1   AT5G07820,AT1G79340,AT2G22470(AGP2)
cluster_1146   15_1    1   AT5G53490,AT1G02700,AT3G14070,AT3G16
cluster_1147   176_1   1   AT5G44130(FLA13),AT5G56870(AtBGAL4),A
cluster_1148   343_1   1   AT3G62170,AT1G29980,AT3G57690(AGP23)
cluster_1149   261_1   1   AT3G16920,AT5G03170(FLA11),AT4G18780(
cluster_1150   154_1   1   AT5G53880,AT1G44800,AT3G23050,AT4G24
cluster_1151   192_4   1   AT4G19840,AT2G31750,AT2G01120,AT2G24
cluster_1152   238_1   1   AT1G48230,AT1G54370,AT5G16130,AT1G17
cluster_1153   249_1   1   AT5G22430,AT2G42530,AT5G20240,AT1G75
cluster_1154   323_3   1   AT5G23530,AT3G06840,AT3G49900,AT4G32
cluster_1155   192_1   1   AT5G55560,AT1G09340,AT1G30360,AT2G02
cluster_1156   362_1   1   AT3G25930,AT1G15210,AT1G77690,AT2G30
cluster_1157   401_2   1   AT1G23140,AT2G17720,AT5G42180(PER64)
cluster_1158   61_1    1   AT5G66390(PER72),AT1G30870,AT2G18980
cluster_1159   229_1   1   AT3G29250,AT5G39320(UGD1),AT5G15490(
cluster_1160   415_1   1   AT3G21770(PER30),AT5G66390(PER72),AT2
cluster_1161   15_1    1   AT5G62620,AT1G17810,AT3G16190,AT4G33
cluster_1162   323_2   1   AT1G28290,AT3G59420,AT5G22280,AT3G07
cluster_1163   339_1   1   AT1G06930,AT4G13080(XTH1),AT3G43900,A
cluster_1164   368_1   1   AT5G04400,AT5G18990,AT2G11010,AT1G09
cluster_1165   383_1   1   AT3G53190,AT5G40150,AT1G70710(CEL1),A
cluster_1166   67_1    1   AT5G09330,AT2G31955,AT1G11410,AT5G39
cluster_1167   15_1    1   AT5G53490,AT5G62620,AT1G17810,AT4G33
cluster_1168   208_1   1   AT5G37500,AT1G76560,AT1G68600,AT2G35
cluster_1169   229_2   1   AT5G25820,AT2G25810,AT5G42180(PER64)
cluster_1170   286_3   1   AT2G26430,AT3G47800,AT4G25220,AT4G16
cluster_1171   74_1    1   AT4G11290,AT2G48130,AT5G17820(PER57)
cluster_1172   108_2   1   AT4G08380,AT5G53740,AT5G07040,AT1G28
cluster_1173   192_3   1   AT1G32080,AT1G10360,AT3G45970(EXPL1),
cluster_1174   303_1   1   AT1G48930(putative glucanase),AT4G34580
cluster_1175   295_1   1   AT3G28750,AT5G61720,AT1G10770,AT1G29
cluster_1176   81_8    1   AT1G78140,AT4G25020,AT5G02420,AT2G38
cluster_1177   286_4   1   AT5G13870(XTH5),AT1G12560(EXP7)
cluster_1178   184_4   1   AT1G32070,AT1G32930,AT1G73590,AT3G25
cluster_1179   186_2   1   AT5G04160,AT2G22560,AT5G25880,AT2G19
cluster_1180   186_3   1   AT2G10970,AT3G46750,AT4G17690,AT3G01
cluster_1181   211_1   1   AT1G56320,AT5G56540(AGP14),AT2G48140
cluster_1182   312_4   1   AT3G16190,AT1G72175,AT3G15580,AT4G27
cluster_1183   318_1   1   AT1G28290,AT4G03210(XTH9),AT4G20430,A
cluster_1184   380_1   1   AT3G45970(EXPL1),AT3G16860(COBL8),AT4
cluster_1185   64_1    1   AT2G47550,AT3G05490,AT4G01700,AT4G08
cluster_1186   67_2    1   AT1G04900,AT5G17160,AT5G20730,AT2G17
cluster_1187   81_8    1   AT1G78140,AT4G25020,AT2G38080(LAC4),A
cluster_1188   339_1   1   AT1G06930,AT3G43900,AT1G52810
cluster_1189   81_6    1   AT2G47900,AT5G05880,AT2G41110
cluster_1190   125_1   1   AT4G20480,AT5G56870(AtBGAL4),AT3G1781
cluster_1191   368_2   1   AT1G55580,AT3G46800,AT3G48830,AT4G08
cluster_1192   125_1   1   AT4G20480,AT4G38360,AT3G05490,AT1G75
cluster_1193   209_1   1   AT2G47640,AT1G05070,AT3G23310,AT2G36
cluster_1194   208_1   1   AT1G76560,AT2G35020,AT3G24450,AT5G14
cluster_1195   244_1   1   AT1G49290,AT3G03800,AT5G54095,AT3G51
cluster_1196   335_5   1   AT3G22190,AT5G21150,AT4G34630,AT5G64
cluster_1197   362_1   1   AT1G29280,AT3G11340,AT1G80240,AT1G15
cluster_1198   399_1   1   AT3G07760,AT4G16640,AT3G14070,AT1G04
cluster_1199   401_2   1   AT1G23140,AT5G01610,AT3G56910,AT2G17
cluster_1200   18_1    1   AT5G07030,AT3G52370(beta-Ig-H3 domain-
cluster_1201   125_2   1   AT1G01560,AT3G45970(EXPL1),AT2G32160,
cluster_1202   238_2   1   AT3G07590,AT4G20430,AT5G65930,AT3G07
cluster_1203   385_1   1   AT4G01720,AT3G53280,AT1G76360,AT1G21
cluster_1204   335_5   1   AT1G06520,AT1G14130
cluster_1205   249_1   1   AT5G22430,AT2G42530,AT5G20240,AT1G75
cluster_1206   385_1   1   AT4G01720,AT3G53280,AT1G21480,AT1G76
cluster_1207   248_1   1   AT5G66390(PER72),AT4G15093,AT4G29480
cluster_1208   265_2   1   AT2G20310,AT1G30440,AT3G06510,AT2G34
cluster_1209   167_1   1   AT1G16520,AT1G27400,AT3G07590,AT3G07
cluster_1210   265_2   1   AT5G18520,AT1G30440,AT1G29330,AT5G03
cluster_1211   155_3   1   AT1G71770,AT5G57610,AT5G62500,AT5G03
cluster_1212   207_2   1   AT2G13690,AT3G56890,AT5G48410,AT1G65
cluster_1213   401_3   1   AT4G38860,AT2G37040(PAL1),AT4G34090,A
cluster_1214   40_4    1   AT5G59740,AT1G09760,AT5G43080,AT5G23
cluster_1215   192_4   1   AT4G19840,AT2G01120,AT2G24280,AT4G02
cluster_1216   81_7    1   AT3G57180,AT5G01970,AT2G43950,AT1G31
cluster_1217   365_1   1   AT4G18460,AT4G16120(COBL7),AT2G03350
cluster_1218   184_3   1   AT1G70770,AT5G11090,AT4G38160,AT5G42
cluster_1219   338_1   1   AT3G15520,AT2G35190
cluster_1220   181_3   1   AT5G22580,AT3G18050,AT3G53260(PAL2),A
cluster_1221   186_3   1   AT2G10970,AT3G46750,AT4G17690,AT3G01
cluster_1222   19_1    1   AT3G54800,AT2G22450,AT4G17483,AT1G65
cluster_1223   192_4   1   AT2G31750,AT2G01120,AT3G19710,AT4G02
cluster_1224   42_3    1   AT2G25490,AT5G56870(AtBGAL4),AT3G5248
cluster_1225   99_1    1   AT3G10720,AT5G13140,AT5G15230,AT3G56
cluster_1226   125_1   1   AT4G31130,AT1G68140
cluster_1227   140_1   1   AT4G03210(XTH9),AT3G54920(PMR6),AT4G
cluster_1228   303_1   1   AT1G48930(putative glucanase),AT4G34580
cluster_1229   42_1    1   AT1G23030,AT3G24450,AT4G12730(FLA2),A
cluster_1230   40_8    1   AT3G13230,AT3G06840,AT1G04680(pectate
cluster_1231   14_1    1   AT5G24210,AT3G22600,AT2G22900,AT2G43
cluster_1232   167_1   1   AT1G16520,AT3G07590,AT1G27400,AT4G30
cluster_1233   254_1   1   AT5G35190,AT4G30320,AT3G05490,AT5G04
cluster_1234   335_4   1   AT1G09415,AT2G03270,AT5G65930,AT4G20
cluster_1235   81_4    1   AT4G20840,AT3G23690,AT2G32990,AT5G05
cluster_1236   387_1   1   AT3G21770(PER30),AT4G08780,AT5G64100
cluster_1237   401_2   1   AT1G23140,AT5G01610,AT3G56910,AT2G17
cluster_1238   393_1   1   AT5G13190,AT4G17350,AT1G69580,AT3G14
cluster_1239   401_3   1   AT1G07610,AT3G29230,AT4G34090,AT3G18
cluster_1240   286_3   1   AT3G47800,AT2G44110,AT1G61667,AT4G25
cluster_1241   368_1   1   AT1G44090,AT1G18050,AT2G11010,AT1G47
cluster_1242   128_1   1   AT3G15720,AT3G16780,AT5G42970,AT1G13
cluster_1243   153_2   1   AT3G17940,AT3G07110,AT1G34350,AT1G77
cluster_1244   186_3   1   AT2G10970,AT3G46750,AT4G17690,AT3G01
cluster_1245   249_1   1   AT5G22430,AT2G42530,AT5G20240,AT1G75
cluster_1246   379_1   1   AT5G55540,AT2G28790,AT1G16780,AT1G18
cluster_1247   395_1   1   AT2G15090,AT5G13140,AT3G10720,AT2G04
cluster_1248   41_1    1   AT1G15210,AT4G23690,AT3G13650,AT5G67
cluster_1249   236_1   1   AT4G14130(XTH15),AT5G14340,AT3G07900
cluster_1250   81_1    1   AT2G34020,AT2G17720,AT4G35320,AT2G23
cluster_1251   207_2   1   AT2G13690,AT2G35010,AT1G65380(CLV2),A
cluster_1252   337_6   1   AT1G49580,AT2G01720,AT4G20110,AT2G41
cluster_1253   166_1   1   AT4G27450,AT4G03210(XTH9),AT5G47810,A
cluster_1254   184_5   1   AT5G23530,AT2G36250,AT5G28840(GME1),
cluster_1255   365_1   1   AT4G16120(COBL7),AT4G18460,AT2G03350
cluster_1256   334_1   1   AT4G03210(XTH9),AT4G38660,AT1G66430,A
cluster_1257   398_1   1   AT2G37640(EXP3),AT4G37740,AT2G31110,A
cluster_1258   399_1   1   AT3G07760,AT4G16640,AT1G04120,AT1G73
cluster_1259   225_3   1   AT4G14130(XTH15),AT5G03260(LAC11),AT1
cluster_1260   323_6   1   AT2G27720,AT4G28300,AT1G77580,AT5G16
cluster_1261   42_1    1   AT1G16370,AT2G18290,AT5G16590,AT4G36
cluster_1262   153_2   1   AT3G17940,AT3G07110,AT1G77750,AT1G34
cluster_1263   178_1   1   AT1G72230,AT1G02950,AT5G42180(PER64)
cluster_1264   312_5   1   AT5G10140,AT5G09650,AT1G69295,AT2G33
cluster_1265   348_1   1   AT3G10720,AT4G38660,AT3G56370,AT2G14
cluster_1266   395_1   1   AT2G15090,AT3G10720,AT5G13140,AT2G28
cluster_1267   81_2    1   AT1G50630,AT3G07510,AT5G65620,AT2G33
cluster_1268   99_1    1   AT5G13140,AT3G10720,AT5G15230,AT3G56
cluster_1269   229_2   1   AT5G25820,AT2G25810,AT5G42180(PER64)
cluster_1270   85_1    1   AT5G30500,AT4G31760,AT1G13200
cluster_1271   349_1   1   AT1G72230,AT5G42180(PER64)
cluster_1272   349_1   1   AT1G72230,AT2G17720,AT5G42180(PER64)
cluster_1273   16_1    1   AT2G32990,AT1G77630,AT4G34640,AT4G20
cluster_1274   81_2    1   AT1G50630,AT3G07510,AT5G65620,AT1G49
cluster_1275   141_1   1   AT3G28750,AT1G70790,AT3G20865(AGP),AT
cluster_1276   86_1    1   AT1G78570(RHM1),AT3G46780
cluster_1277   362_1   1   AT3G25930,AT3G22620,AT1G30750,AT1G29
cluster_1278   144_1   1   AT4G01700,AT3G06300(AtP4H2),AT1G47740
cluster_1279   219_1   1   AT1G75690,AT1G15980,AT5G66190,AT4G26
cluster_1280   265_2   1   AT1G30440,AT2G20310,AT3G62290,AT1G70
cluster_1281   397_1   1   AT5G03260(LAC11),AT3G20570
cluster_1282   286_2   1   AT1G12110,AT1G48230,AT4G30320,AT2G43
cluster_1283   312_2   1   AT2G05580,AT1G16850,AT1G64660,AT3G51
cluster_1284   335_1   1   AT5G43760,AT1G79950,AT4G02560,AT3G20
cluster_1285   67_2    1   AT5G24580,AT1G04900,AT5G42400,AT3G53
cluster_1286   184_4   1   AT5G03650,AT4G35450,AT1G74370,AT1G69
cluster_1287   335_2   1   AT2G26460,AT3G62720(XT1),AT1G18210,AT
cluster_1288   401_3   1   AT4G38860,AT4G24930,AT2G37040(PAL1),A
cluster_1289   87_1    1   AT1G70710(CEL1),AT1G21090,AT1G02730(C
cluster_1290   323_4   1   AT5G45300,AT5G65210,AT1G23205,AT5G27
cluster_1291   348_1   1   AT3G10720,AT3G56370,AT4G38660,AT2G14
cluster_1292   67_1    1   AT2G31955,AT5G09330,AT5G43930,AT1G11
cluster_1293   154_2   1   AT2G29180,AT4G38970,AT1G16880,AT5G35
cluster_1294   92_2    1   AT3G10570,AT1G01110,AT4G22753,AT1G44
cluster_1295   228_1   1   AT1G49660,AT1G68220,AT1G13090,AT2G33
cluster_1296   155_2   1   AT5G57810,AT1G07410,AT1G04880,AT3G57
cluster_1297   401_3   1   AT4G24930,AT1G07610,AT1G44170,AT3G60
cluster_1298   405_2   1   AT2G24260,AT5G52060
cluster_1299   87_1    1   AT5G40150,AT1G70710(CEL1),AT1G21090,A
cluster_1300   102_5   1   AT5G48450,AT4G02070
cluster_1301   279_1   1   AT5G01610,AT5G35190,AT4G14130(XTH15)
cluster_1302   46_1    1   AT1G48100,AT1G28290,AT3G07540,AT4G23
cluster_1303   309_1   1   AT2G45430,AT3G54770,AT5G10580,AT3G24
cluster_1304   248_1   1   AT3G25930,AT5G64100,AT3G44320,AT4G23
cluster_1305   99_1    1   AT5G13140,AT2G35860,AT3G10720,AT3G56
cluster_1306   387_1   1   AT3G21770(PER30),AT5G12880,AT5G17820
cluster_1307   229_2   1   AT1G32100,AT2G39180,AT2G28670,AT5G65
cluster_1308   86_1    1   AT1G78570(RHM1),AT3G23000,AT4G05590,
cluster_1309   229_1   1   AT2G32300(UCC1),AT2G17720,AT1G52910,A
cluster_1310   155_2   1   AT5G57810,AT3G57690(AGP23),AT1G07410
cluster_1311   67_1    1   AT5G09330,AT2G31955,AT5G43930,AT1G64
cluster_1312   405_2   1   AT5G01610,AT5G65020,AT2G17720,AT2G24
cluster_1313   261_1   1   AT1G22480,AT5G12870,AT5G42180(PER64)
cluster_1314   99_1    1   AT3G10720,AT5G13140,AT3G56370,AT5G15
cluster_1315   411_1   1   AT5G66390(PER72),AT2G30490(C4H)
cluster_1316   40_1    1   AT2G23930,AT4G20430,AT5G19690,AT3G18
cluster_1317   405_2   1   AT5G65020,AT4G00680,AT1G11670,AT5G52
cluster_1318   42_3    1   AT2G25490,AT2G33990
cluster_1319   218_1   1   AT5G65390(AGP7),AT2G48130,AT4G15093,A
cluster_1320   338_1   1   AT3G15520,AT5G13140,AT3G49670,AT1G53
cluster_1321   64_3    1   AT5G13450,AT3G51160(GMD2-Mur1),AT5G1
cluster_1322   211_1   1   AT1G56320,AT2G48140,AT2G23540
cluster_1323   388_1   1   AT2G17370,AT5G42180(PER64),AT3G17420
cluster_1324   125_5   1   AT5G17380,AT3G06770
cluster_1325   362_1   1   AT3G25930,AT1G30750,AT3G22620,AT1G29
cluster_1326   368_1   1   AT5G04400,AT5G39370,AT2G11010,AT1G09
cluster_1327   74_1    1   AT4G11290,AT2G48130,AT5G17820(PER57)
cluster_1328   46_1    1   AT1G48100,AT1G28290,AT3G07540,AT4G23
Motif length   Patterns      Matched motifs in databases

7              GAGAGAG       GAGAGMGSA1,GAGA8HVBKN3,CTRMCAMV35S
9              CTCTCTCTC     GAGAGMGSA1,GAGA8HVBKN3,CTRMCAMV35S
10             GGnGGAGnnG    ABRECE3ZMRAB28
8              GAAGAAGA      TL1ATSAR,TCA1MOTIF
11             TCTTCnnnTTC
13             CCCCCCC
7              CGnCGnCG
8              CCGCCACC      SORLIP1AT,IDRSZMFER1,GCCCORE,GCC-box,ERF1
5              CCTCC         SBOXATRBCS,OBF4,5,ABRECE3ZMRAB28,IDRSZMFER1,OBF5ATGST6
5              CCACC         ACIPVPAL2,SITEIOSPCNA,POLLEN2LELAT52,ACIIPVPAL2,ABRECE1HVA
10             CCGCCGCCnG    GCCCORE,GCC-box,ERF1
11             TCACCAACCCc   MYBPLANT,MYBPZM,PALBOXLPC,MYB,MYB4,BOXLCOREDCPAL
8              GGCGGCGG      GCCCORE,GCC-box,ERF1
6              CGSCGG        REGION1OSOSEM,ERE,PE3ASPHYA3,AGCBOXNPGLB,GRAZMRAB28,GC
6              CCAACC        BOXICHS,MYB4,MYB1,BOXLCOREDCPAL,ACIIPVPAL2,MYBPLANT,MYBP
6              GGYGGS        ACIPVPAL2,REGION1OSOSEM,SITEIOSPCNA,ERE,AGCBOXNPGLB,GRAZ
10             AAGCCGGTTC
10             AACGGCTAGt    MYB2CONSENSUSAT,MYBCOREATCYCB1
6              ACAGGA        DPBF1&2
10             tGCGAGACTG    SURECOREATSULTR11
8              ACACGTGT      DPBFCOREDCDC3,DPBF1&2,ABRERATCAL,ACGTABREMOTIFA2OSEM,G
6              GCCATG        TRANSINITDICOTS,TRANSINITMONOCOTS,RBCSGBOXPS,PE3ASPHYA3
6              GGAGCT        VSF1PVGRP18,PE3ASPHYA3
10             AGAAACCGGC    POLLEN1LELAT52
11             GGCGGCGGCGG   GCC-box,GCCCORE,ERF1
9              TCATCGCTT     PRECONSCRHSP70A
7              CTAGCnA       SE2PVGRP1
7              TGGCCAC       GBOXRELOSAMY3,SORLIP1AT,CPRFPCCHS
10             tTGGTGCGAT    PRECONSCRHSP70A
9              TGACCGCGA     ELRECOREPCRP1,WBOXNTERF3,WBOXNTCHN48,W-box
6              GCATGC        GRAZMRAB28,IDE1HVIDS2,RY-repeat,RYREPEAT4,RYREPEATLEGUMIN
10             cCTGGTGCAG    INTRONLOWER
10             CYCCAnnnnC    ACIPVPAL2,O2F3BE2S1,L4DCPAL1,SBOXATRBCS,MYB1,PALBOXPPC,ID
7              GGAGGAG       ABRECE3ZMRAB28
8              GAGAAGAG      NODCON2GM,OSE2ROOTNODULE
6              GCGCAT
10             TGGGACTAGA
7              GTACAAt       SBP-box
6    CGCATG
10   cATCAGGCTA
8    AACCGGCA
11   CATGCGATGgc     PRECONSCRHSP70A,TRANSINITMONOCOTS
8    aCATGCCa        MYCATERD1,MYCATRD22,AtMYC2
6    CATCAG          OCSGMGH24,OCSGMHSP26A,MEJARELELOX
8    CCTCCACC        IDRSZMFER1
11   TGCCCACTGGc     LFY
11   cGGGACTACAT
11   tTGGAGTTCAa
6    GGCAGG
6    CATACC          SORLIP4#NA#At1g53035.1#-#19829215,SORLIP4#Hudson,SORLIP4A
10   AACAACACTA      DPBF1&2,RAV1AAT,RAV1-A
6    GATAGC          GATA
10   AGCTGAAGnA      LEGUMINBOXLEGA5
7    CTCGATG         TGA1ANTPR1A
9    AATGCACCG
6    GCGCAA
7    GnTTGGT         REALPHALGLHCB21,OCETYPEIIINTHISTONE,BOXLCOREDCPAL,PIIATG
6    AGCAAC          ABRE3HVA1,ARECOREZMGAPC4,GCAACREPEATZMZEIN,GLUTEBP1OS,A
6    GCGTGA          VOZ,OCETYPEIINTHISTONE,CACGCAATGMGH3,IDE2HVIDS2
6    TGGGTG
9    GTGTGCAGA
9    TCGAATAGT       SP8BFIBSP8BIB
10   GCGAGACCTT      SURECOREATSULTR11
10   CCAACATTCG      RAV1AAT,RAV1-A
7    GCAACAg         RAV1AAT,MYBCORE,RAV1-A
7    cCTGGCA
12   gTTTGCTGGGTG
6    ACACCT          RAV1-B,DPBF1&2,RAV1BAT,SBOXATRBCS,PROXBBNNAPA,MYB
13   gACATGAGAACCt
9    gATATCCCG       P1BS,MYBST1
9    GTCCAACCG       MYBCORE,MYBPZM
6    GTACAG          ABRE3HVA22
9    CGTCACTAT       TGACGTVMAMY,ASF1MOTIFCAMV,HEXMOTIFTAH3H4
6    AAAGGC          DR5GMGH3,CArG,PYRIMIDINEBOXOSRAMY1A,-284MOTIFZMSBE1,-314
6    CCTTAC          OCS,AS1CAMV,CArG2,CARG2ATAP3,SARECAMV,OCSELEMENTAT,GLUT
12   tATGGCTATGTg    TRANSINITMONOCOTS
7    CCCGTGA
7    GTTCCTG
11   TCGAACGCTTc
8    tnCACGCA        VOZ,CACGCAATGMGH3
6    ATAGCA          PE1ASPHYA3
11   AAATGATTTGG
9    GCTCAGAAA       POLLEN1LELAT52
10   aaATCTTACC
11   GAGTCTGAnCa    WBOXNTCHN48
9    TGGTTTGnG      REALPHALGLHCB21,SV40COREENHAN,MYB1AT
8    CCAAGCAC
11   CCTAATGGCTA
7    CAGCGAC        PRECONSCRHSP70A
10   AACAGACAGC     GARE1OSREP1,AMYBOX1
9    GCTACAGTA
9    CAACGCGnG      ABRERATCAL,CGCGBOXAT,CE3OSOSEM
6    CTGCAA         INTRONLOWER,PROLAMINBOXOSGLUB1
6    CTGTAT         SORLREP3#Hudson,SORLREP3AT,MEJARELELOX,SORLREP3#NA#At1g
8    GCTGCAGC
8    TGGGGTGT
9    ACACAGGTC      DPBFCOREDCDC3,DPBF1&2,QELEMENTZMZM13
9    CAATGCCCG      LFY
10   CAAATCCACA
6    ACACGT         ABFs,ACE,ABRE3HVA1,ZDNAFORMINGATCAB1,HY5AT,DPBF1&2,ACEAT
6    TATCCC         SREATMSD,MYBST1
10   ACCTGAGGGT     RAV1-B,RAV1BAT
11   TTCTCGTGGTT    MYB1AT,SV40COREENHAN
10   AGCGGTGTAC
7    SCCGGTG        DPBF1&2,ABRECE1HVA22,PREMOTIFNPCABE,PE3ASPHYA3
11   TCTAAGTGTGA
11   AAGCGCAGTAG
11   GTTGAGTTCAG
7    AGCATCC        ABFOS
8    TGTCGCTG       PRECONSCRHSP70A
7    CGTTCAG
11   GAATTGCCTCG    EECCRCAH1
8    ATCTCGTC
8    ATACGGCA
10   CACTAAGGCA
8    AGCCAGAT
6    CACATC         OPAQUE2ZMB32,NAPINMOTIFBN
10   CAACTACCAA     MYB4
12   CATGTTGTCAnC   RAV1-A,RAV1AAT,SEBFCONSSTPR10A,BIHD1OS
11   TATGTTGCGCC    RAV1-A,RAV1AAT
10   TCATACCACA     SV40COREENHAN
6    ACCACA         LREBOX2PSRBCS3,5256BOXLELAT5256,GT,RBCSBOX2PS
6    AGTACC
7    gAACAGG        ANAERO5CONSENSUS
6    CCTCna         SBOXATRBCS,BOXICHS,IDRSZMFER1
9    cAGTGATna      ANAERO3CONSENSUS,LFY,GATA
9    CGCAAACGg      MYBCOREATCYCB1
10   gGATAATGat     GT1CONSENSUS,TATCCAOSAMY,REBETALGLHCB21,SREATMSD,MYBST
10   CAWCCACGAt     UPRMOTIFIIAT
11   gaAGTGGCnnt    SORLIP1#NA#At1g05360.1#+#1564312,SORLIP1#Hudson,SORLIP1A
7    GACCACG        GBOXSORBCS1,GBOXPC
8    CATCGRTG       PRECONSCRHSP70A
6    CACCGA         DRE1COREZMRAB17,DRECRTCOREAT,LTRE,OCETYPEINTHISTONE,DRE
12   anCTACCGATGa   BOXLCOREDCPAL,PRECONSCRHSP70A,MYB4,MYBPZM
8    cnGCATAC
10   cGACATTCTc
7    CACACTg        RNFG2OS,DPBF1&2,SE1PVGRP18,LFY
8    CGGnYCGG       OCETYPEINTHISTONE
12   TACCATTTTAnc   S1FBOXSORPS1L21,GT1CONSENSUS
7    GCGGCng        AGCBOXNPGLB,GCCCORE,REGION1OSOSEM,GCC-box,ERF1,ABREMOTI
8    TSGGCCCA       SORLIP2#Hudson,SORLIP2#NA#At1g05360.1#+#1564211,SITEIIATC
11   GGTTGCnnnng
7    CGGACCG
8    tCGACGCT       VOZ,CGACGOSAMY3,CBFHV,CRTDREHVCBF2
11   ACCCCACGAGC
9    tnCGCAACt      CAREOSREP1
8    aGATCCGC       octamer,OCETYPEIIINTHISTONE,OCTAMERMOTIFTAH3H4,OCETYPEIIN
9    aGAGCTTng
10   aGYGGTTGng     MYBCORE,MYBPZM
6    GAGTTG         CAREOSREP1,MRNASTA2CRPSBD,ARELIKEGHPGDFR2
12   TGAGATCCATna
11   GCCTGGACAGT
12   gCCTGCTAGTCt
6    TCCTAC         ABREA2HVA1,HBOXPVCHS15,ABRE2HVA1,MYB1,HBOXCONSENSUSPVC
7    aGGATGG        BOXLCOREDCPAL
6    GATCCC
8    atGGGCCC       SORLIP2#Hudson,SORLIP2#NA#At1g05360.1#+#1564211,UP1ATMSD
8    TTgGGGMC       SORLIP2#Hudson,SORLIP2#NA#At1g05360.1#+#1564211,SORLIP2A
11   gGAGCACAGGa
8    gAGGGTCg
11   AAGCGAAGATG
11   gCGATATTACg    ROOTMOTIFTAPOX1
11   CAACTCCATAg    CAREOSREP1
11   cCCGCAAGATC
10   CATCAAGCtc
9    aAAAGGGGg      PYRIMIDINEBOXOSRAMY1A
12   anGTTGATGAAC
11   tgnTGGATCCA
10   GAATGCTCGt
12   aATACTCCTGCc
10   CGACCAGAAC
10   CACAACACAC     DPBF1&2,RAV1-A,RAV1AAT
8    AnGACTAC
6    ATGACC         WBOXNTERF3,ELRENTCHN50,QELEMENTZMZM13
6    GGCAAG         IDE1HVIDS2,IDE2HVIDS2,AG
8    CCTGGCAT
8    CTAAACAG
7    ATGTCTA
11   AACAGTnTCTA
8    TCAGTTCC       INRNTPSADB
8    CTACAGTA       TACBBFNTEAS4
11   CAGCGACTCAA
11   ACAGACTCATA    ATB2/AtbZIP53/AtbZIP44/GBF5,PREATPRODH
8    CAGGAAnA
8    GCAGAGCC
6    TGGATA         AMYBOX2,TATCCAOSAMY,NRRBNEXTA,WRECSAA01,TATCCACHVAL21,
9    GCTAGAGTC
6    TATGCG
7    GCGGTAC
6    GGGTAC
6    GCGGGT         DPBF1&2,BS1EGCCR
8    CnCAAGGT
10   GCTGTACAAC
12   GCTGTCACTTAG   SEBFCONSSTPR10A,BIHD1OS
11   GCTGGACGAGG
9    TACAATGGC      TRANSINITDICOTS,TRANSINITMONOCOTS,LFY
6    CTGTCA         ALF1NTPARC,IDE2HVIDS2,TGTCACACMCUCUMISIN,SEBFCONSSTPR10
8    CTGTTGGA       RAV1-A,RAV1AAT,MYBCORE
6    AAGGCT
8    GAGGAnGA
6    AGTAGG
8    GACCACGA
5    CGCCG          REGION1OSOSEM,PE3ASPHYA3
12   GGGACATGTTCC
12   AGATTTGACGGT   WBOXATNPR1,ASF1MOTIFCAMV,W-box
6    ATGCGG
8    GnACACAG       DPBF1&2,SP8BFIBSP8AIB
11   GACATGTCTGA
6    ACATAC         JASE2ATOPR1,JASE2,ASF1ATNOS,20NTNTNOS
10   TACATAGGTA
9    ATCAAGGCG
8    GCAGCnnG       LEGUMINBOXLEGA5,PSREGIONZMZM13,ANAERO2CONSENSUS
6    GACCGT         MSACRCYM,ARECOREZMGAPC4,ANAEROBICCISZMGAPC4
9    TGGACTGCA
8    ACCAAACC       MYBPLANT,MYB1AT,REALPHALGLHCB21,MYB4,MYB
10   ACTCCCTTAn
8    TCCCTTAG
10   ATCATAACGT     GARE2OSREP1,T/GBOXATPIN2,ACGTTBOX
4    TCTC
6    CCGCAA
6    GGTAAG         AGL3,TEFBOXATEEF1AA1,INTRONUPPER,PALBOXLPC,CArG2,CARG2AT
6    AGCGAC         PRECONSCRHSP70A
9    AAGCGATCA      PRECONSCRHSP70A
8    GAGTAGTG
8    TGnGGTTG       MYBPZM
7    TGAGCAG        ANAERO2CONSENSUS
8    TGAGCCAG
6    GTCCCA         GGTCCCATGMSAUR,AUXREPSIAA4,SITEIIBOSPCNA,NDEGMSAUR
10   CTCCATGAGA
6    GCATGA         GRAZMRAB28,RY-repeat,RYREPEATLEGUMINBOX,RYREPEATVFLEB4,RY
10   AAGCCGCTGA
9    CAGATGCTG
8    GGTTGTTG       RAV1-A,RAV1AAT,MYB4
6    AGGTGA         SBOXATRBCS,SRENTTTO1,L1DCPAL1,RAV1-B,RAV1BAT,MYB,ELRE2PCP
10   TGCTGCTAGA     ANAERO2CONSENSUS
6    GCGGAA         27BPDRCONSENSUSPS25S
7    TCCAGCT
6    TGGAGC         ELRE1PCPAL1,MYB1
11   TCACGGATGGA
8    GATGCAGG       INTRONLOWER
7    CCACAGC
11   CAGGGTAAGTA
11   CAGATACAGAT
11   AGAAGGTGCCA
8    CAGCTGAA
11   CTAGTGCTGGA
7    CACACAC        DPBF1&2,LREBOX2PSRBCS3,ACGTSEED2,GT
11   AGATGGAACCG
11   CATGCCGGCTG
11   CCGGTTnnnnT    OCSGMGH24
12   ATCCTGATATCC   TATCCAOSAMY,REBETALGLHCB21,MYBST1
11   TCATCCCAGGC
11   TCATGCTGGCT
10   GATGGCTGAA     TRANSINITMONOCOTS
7    AGCCGTG
11   ACGACGTTTAA    CGACGOSAMY3
11   GATGAGCCAGT    LFY
10   TCAGCGTGTA
12   AAGAGTATAGTA   NODCON2GM,OSE2ROOTNODULE
11   CTACTATTAGT    SP8BFIBSP8BIB,CPBCSPOR
9    GCAGTGAGA
9    GAGCACATG      MYCATERD1,MYCATRD22,AtMYC2
8    GAACGGTG       MYBCOREATCYCB1
11   ATTGTCTCCGC    ARF1,ARFAT,ARF,SEBFCONSSTPR10A,SURECOREATSULTR11
8    CCATTCTT
9    GCCAGAGTC
11   GATGAACAGCT
11   GAATGACCACG    WBOXNTERF3
6    CGTGAA         VOZ,IDE2HVIDS2,RHERPATEXPA7,OCETYPEIINTHISTONE
8    GGGCTTGA       SITEIIATCYTC
10   TTGTCAACCA     WBOXATNPR1,W-box,REALPHALGLHCB21,BIHD1OS
8    TTGGGCTT       SITEIIATCYTC,-284MOTIFZMSBE1
12   AGCTAAGAGCCT   NODCON2GM,OSE2ROOTNODULE
12   CCCAnCCCCnCC   MYBPZM
12   ATATTCTAGTCG   P1BS,-10PEHVPSBD,ROOTMOTIFTAPOX1,PRECONSCRHSP70A
10   CATAGCAACA     RAV1-A,RAV1AAT
11   AGGTCGCAAAC
10   ATGTCACTAT     BIHD1OS
10   AATTTGCTTA
10   AGACTAtgct
8    tcGACACA       CBFHV,CRTDREHVCBF2
12   atgtgtACTCGC   DPBF1&2,MYCATERD1,MYCATRD22,NAPINMOTIFBN,AtMYC2
12   ATACGGCTACaa
8    tACTGGCt
10   CAACCCactc     SEF3MOTIFGM,MYBPZM
8    tGGCACGa       RHERPATEXPA7
12   cggCTATACCCg
7    TGGnCCA        UP1ATMSD,UPRE1AT,SE1PVGRP18,SITEIIATCYTC
12   ttCCyTCCttcc
8    ctCAGCAA
8    CAGGTGaa       RAV1-B,RAV1BAT
10   CAGTACcacg
8    ccATGCTA
8    tACAGCCg
12   acAGATGCTGCA
11   tAACTCACTAa
10   GCTAACctca
6    GGATAG         AMYBOX2,TATCCAOSAMY,REBETALGLHCB21,TATCCACHVAL21,LREBOX
10   GCTGAgtccT
8    ttCTCGGT       DRE1COREZMRAB17
8    aCTGGGTg       LFY
12   tccttcAACCAC
12   agTACCAGGTAC
10   GATGGTgata     BOXLCOREDCPAL,GATA
8    gcGAATGG       E2FCONSENSUS
12   gaGCTGGATGAG   ATB2/AtbZIP53/AtbZIP44/GBF5,PREATPRODH
10   ggctGCACAG
10   TAATGcatgG     SPHCOREZMC1,RYREPEATLEGUMINBOX,RYREPEATBNNAPA,RYREPEAT
12   cCTGAAGagtcc      NODCON2GM,OSE2ROOTNODULE
8    GCnGCnGC          REGION1OSOSEM
8    gaACACGA          DPBF1&2,CANBNNAPA
8    AAGTAGga
8    cgAGTTGG          CAREOSREP1
8    gtAGTCGC          PRECONSCRHSP70A
8    aaGTTGAG
8    atATGCGA          P1BS,CATATGGMSAUR
8    GGTyGnTG          MYBPLANT,PALBOXLPC,BOXLCOREDCPAL,MYB4,ACIIPVPAL2,MYBPZM,
12   ACATCCACGAaa      CELLCYCLESC
12   GAAAACGCGGca      CGCGBOXAT,ABRERATCAL,OCTAMOTIF2
10   ATAGCGGAct
13   cgaaatgCACGGa     LTRE1HVBLT49
13   aTTCAATTACGGa
12   ACATCCATGGTC
10   ACAATGGCAG        TRANSINITDICOTS,TRANSINITMONOCOTS,LFY
12   atGATGAAGCGG      BS1EGCCR
15   acaCTGCCcatttct   POLLEN1LELAT52
6    ACATGC            MYCATERD1,GRAZMRAB28,DPBF1&2,RY-repeat,RYREPEATLEGUMINBO
8    aACGCGGa          CGCGBOXAT,ABRERATCAL
11   tACATATGGGg       CATATGGMSAUR
8    tgTAGCGG          BS1EGCCR
8    TTTGGCGG          E2FCONSENSUS,GCCCORE,GCC-box,ERF1
8    TGGGCCGG          SORLIP2#Hudson,SORLIP2#NA#At1g05360.1#+#1564211,SITEIIATC
8    CGnGTCGG          DRECRTCOREAT,CBFHV,LTRECOREATCOR15,DRE2COREZMRAB17
8    kCGCCGGA
13   aCTACGGTACCGc
10   tcTGAACGGT        MYBCOREATCYCB1
8    aaTACGCC          VOZ
12   taCAACTCCACA      CAREOSREP1
10   agAGCTCGGT
8    TACGGCAA
13   aAAATGGCGGTAa     TRANSINITDICOTS,GT1CONSENSUS,TRANSINITMONOCOTS
8    GTACGGCA
11   tACCAGTGCAt       RYREPEATLEGUMINBOX,RYREPEATBNNAPA,LFY
10   TCAGGATGtt
8    tcTCAGCA
8    GTGCCGcg          CGCGBOXAT
10   gaTGAAGCCG
7    cgnnncg
6    CCGnCc            DRE-like,PALBOXAPC,GRAZMRAB17,PREMOTIFNPCABE,GAREHVAMY1,C
8    AATGCGcg          CGCGBOXAT
10   gACGCTGGCa
8    tgTAGGCG
8    TCACAGCG
9    gGACGAGna
10   gaccTCTGCA      QELEMENTZMZM13
12   taATCACGTGGT    ABRELATERD1,CACGTGMOTIF,RHERPATEXPA7,ABRERATCAL,G-box,IR
8    gTTTTGGT        REALPHALGLHCB21
12   tcatGTGCTGAT    MYCATERD1,MYCATRD22,AtMYC2
12   TGCGCAcattca
10   aaGTGCCTCG
8    atCCTGTA
10   TGCCAAgaat      -10PEHVPSBD
8    gTGTATGa
6    CGATGC          ABFOS
8    aGTATGCa        LEGUMINBOXLEGA5
8    tCCCGAGg
10   ccgaaCCATC      BOXLCOREDCPAL
8    tCCCGCAg
8    gtGTCAAC        WBOXATNPR1,W-box,BIHD1OS
11   aAGTCAAGGCt     WBOXATNPR1,WBOXNTERF3,W-box,WBOXHVISO1
10   aaGGCCCTGA      SORLIP2#Hudson,SORLIP2#NA#At1g05360.1#+#1564211,SORLIP2A
12   tcatAGTAAGTC    EECCRCAH1
10   tAGGCCACTa      SORLIP1AT
10   TAAGCTttaa      TAAAGSTKST1
13   cCGCAGATTCCTc
8    tgTAAGCA
13   tTTGCTTCCgtga
11   aGCCTGTCAGg     BIHD1OS
8    AGCCATga
8    gGCACACa
8    CTCGAGgg
12   CATGCTGAcccg    WBOXNTERF3,WBOXNTCHN48
11   gTCTACGCtta
6    ACGTGA          ABFs,DPBF1&2,GREGIONNTPRB1B,BP5OSWX,T/GBOXATPIN2,ABRELAT
13   tTTGCTCCCGTGa
12   AGACGATCAAta
8    ACGCTCct
6    ACGCAT          SBP-box
8    TGCATGCA        RYREPEATLEGUMINBOX,RYREPEATBNNAPA,RYREPEAT4,RYREPEATGM
8    trGGwTGC        SEF3MOTIFGM
13   aaatgCCCTGAAt
10   ctgGAAAGCc
12   aaagAGTGAGCC    NODCON2GM,SORLIP5#NA#At1g52280.1#-#19535625,INRNTPSADB,
10   GAGCACATgg      MYCATERD1,MYCATRD22,AtMYC2
8    GGnGATGG
11   gCAGGGCAAGt     INTRONLOWER
8    CACGCAGG
6    TTCCAG          HSE
11   tCTACCCCCGt
8    TAGGCAcc
12   tCAGCCGATCAc     PRECONSCRHSP70A
9    cCAGGACAt
12   tcAACGCGGGAC     CGCGBOXAT,ABRERATCAL
8    CAGGATCC
8    GGAnCnGG         PE3ASPHYA3
10   CGGTGTGGtc       DPBF1&2
8    ctCACTCC         SORLIP5#NA#At1g52280.1#-#19535625,INRNTPSADB,SORLIP5#Hud
13   cCCGAGGGACTCa    ATB2/AtbZIP53/AtbZIP44/GBF5,PREATPRODH
8    ccTCACTC         SORLIP5#NA#At1g52280.1#-#19535625,INRNTPSADB,SORLIP5#Hud
8    AGGTTGgc         MYBPZM
10   AGGTGACGgg       ASF1MOTIFCAMV,RAV1-B,RAV1BAT
8    agGTCCGC
12   agAAGGTGGCAA     SORLIP1AT
12   aGTAAGGCActa
11   cCCTGTGGCAg      SORLIP1AT
8    ctCGGATC
11   tTGCAGGGCTt      INTRONLOWER
12   GAGGTGAAGCaa
12   AGCACATCAAgg
11   aGGCATCAAGg
8    taGATAGA         BOXIINTPATPB,GATA
8    TGTCAAcc         WBOXATNPR1,W-box,BIHD1OS
12   AGCCTCACCAag
10   CCAGGATCca
8    aaGCGCGC         CGCGBOXAT
10   gaGCACATAG
13   gTTAGCGCCGTAg
8    gtAGCTAC
11   cCCTGTATCCa      AMYBOX2,TATCCAOSAMY,TATCCACHVAL21,TATCCAYMOTIFOSRAMY3
8    CAATACct
8    GCnGnTCC         octamer,OCETYPEIIINTHISTONE,OCTAMERMOTIFTAH3H4,OCETYPEIIN
13   tCTCATGATCCTa
12   gcGTCTTGCGTC
12   CTCGGTAACAcc     DRE1COREZMRAB17
12   gccaACTTGTcc
12   cTCAAGGAAACt
21                    AGCBOXNPGLB,GCCCORE,GCC-box,ERF1
     cntnnnCCnCCGCnGCCgcct
8    TnttTCGT         GT1GMSCAM4,GLUTECOREOS,CELLCYCLESC
11   gTTGTGGCGCt      SORLIP1AT
10   gaATGGGTAT
8    yrTkGGCC         GCBP2ZMGAPC4,SORLIP2#Hudson,SORLIP2#NA#At1g05360.1#+#15
12   ttGCACCTTTcg     LTRE1HVBLT49
13   tCACCATTACTAc
12   cCATCTTGAGGg    TRANSINITDICOTS,TRANSINITMONOCOTS
12   AAGAGCTTGGtg    NODCON2GM,OSE2ROOTNODULE
10   ctGCGTAGAA
13   tGGGGAGATTGGg   CCAATBOX1
12   agCGTAACTATC    GATA
7    GGGTTGG         SEF3MOTIFGM,BOXLCOREDCPAL,MYB4,MYB1,ACIIPVPAL2,MYBPZM,MY
8    CGTCACAC        VOZ,ASF1MOTIFCAMV,HEXMOTIFTAH3H4,TGACGTVMAMY
10   acgaTAATAC      GT1CONSENSUS,IBOXCORE
8    GAGTTGGG        CAREOSREP1,MRNASTA2CRPSBD
12   GAGTAGTGAGta
9    aGTgGCAGC       SORLIP1AT,LFY
10   gcTCCATGAG      ATB2/AtbZIP53/AtbZIP44/GBF5,PREATPRODH
12   gaGCCGGATGAG    ATB2/AtbZIP53/AtbZIP44/GBF5,PREATPRODH
10   taGTTGCAAA      -300ELEMENT,PROLAMINBOXOSGLUB1
12   AGTTCTAGAGaa
8    AGGACGAG
8    GTTGGTkT        MYBPLANT,MYB1AT,REALPHALGLHCB21,BOXLCOREDCPAL,PIIATGAPB,
18   gGGGnGGGrGnnggggtg
12   TAGTGCAGTAtc
6    ATGCGC
12   CACGATGCTGct    RHERPATEXPA7,ANAERO2CONSENSUS
12   CCATACGCGAcg    HEXAMERATH4,CGACGOSAMY3,PRECONSCRHSP70A,Hexamer
10   GTCTCCTAag      ARF1,ARFAT,ARF,SURECOREATSULTR11
8    GGAGCCAC        SORLIP1#NA#At1g05360.1#+#1564312,SORLIP1#Hudson,SORLIP1A
12   ctAGTAGAGCAA
8    GCTCGAGC
9    nCACGCGCc       DPBF1&2,CGCGBOXAT,ABRERATCAL,ABRECE3ZMRAB28
12   tTCAGGAAGCTt
12   CCCATGTCGCag
12   caACGCAGGACT
10   CCATACacca      DPBF1&2
12   tGGTCGACGCTa    CGACGOSAMY3,CBFHV,CRTDREHVCBF2
8    CGAGCTCG
12   gtCCATGAATCC
13   cACGTCTatgact   WBOXNTERF3,ABRELATERD1,RHERPATEXPA7,ABRE-like,WBOXHVISO1
13   aAGCTCCTGAACa
13   aTAGCGCATAACc   MYB1AT
13   tGCCAAGAGTACt   NODCON2GM,OSE2ROOTNODULE
12   GTGCCTCGCAcg    RHERPATEXPA7
8    GGGTTTTs        SEF3MOTIFGM
13   tCTGCGTACGTTa   GARE2OSREP1
8    GCCnCACm        SE1PVGRP18
13   tCACTTATTCACa
13   cCCACATAGCAGc   ANAERO2CONSENSUS
9    GCCGTCACG       ASF1MOTIFCAMV,RHERPATEXPA7
10   caATCAACTG      MYB2CONSENSUSAT,MYBCORE
10   TCACTCACga      SORLIP5#NA#At1g52280.1#-#19535625,SORLIP5#Hudson,SORLIP5A
12   CCAGAACAACag    RAV1-A,RAV1AAT,MYBCORE
12   taTCACCGCACC    GATA
12   agTTCCGGGGCC    SORLIP2#Hudson,SORLIP2#NA#At1g05360.1#+#1564211,SORLIP2A
11   aCTGCTTACCt
13   aCTTCCGGTAACc   MYB1AT
12   CCACACGTTCct    T/GBOXATPIN2,ABRELATERD1,ABRERATCAL,QARBNEXTA
8    GGCCCATA        SORLIP2#Hudson,SORLIP2#NA#At1g05360.1#+#1564211,UP1ATMSD
12   tcAGAAGCTTAC
7    CCAAAAC         CDA1ATCAB2
8    ACAAGACT
6    CGGACA          ABREBNNAPA,ABRETAEM
6    CCGACA          DRECRTCOREAT,LTRE,DRE-like,CBF1,DREDR1ATRD29AB,CBFHV,PREC
10   CCGTAGACAA
6    ACTCGT          DPBF1&2,MYB2,RSRBNEXTA
10   AAAACCACAA      MYB1AT
8    GACTTCAA        -141NTG13
8    GACTGAAG        INRNTPSADB
6    GACTAG          DRE-like,SORLREP1#Hudson,SORLREP1#NA#At1g53090.1#+#198477
6    CCTACA
10   AAGCGAACAA
10   AGCGAACAAG
8    GTCGACAA        CBFHV,CRTDREHVCBF2
8    AGACTTCC        EECCRCAH1
6    GGAACA
8    CnAGACTC
8    GACTTTGG        T-box,TBOXATGAPB
6    GGTACC
6    TGGCGT          ABREBNNAPA,ACGTSEED3
8    TGGCTCGA        SORLIP1#NA#At1g05360.1#+#1564312,SORLIP1#Hudson
6    ATACCC
6    CACACC          DPBF1&2,RBCSBOX2PS
6    GTACCC
6    TTCACC          L1DCPAL1
6    CTACCC          HBOXPVCHS15,ACIPVPAL2,L1DCPAL1,MYB4,MYB1,HBOXCONSENSUSP
6    TGGCGA          REGION1OSOSEM,ABREBNNAPA,ACGTSEED3
6    TACACC          DPBF1&2
6    GGCATA          TEFBOXATEEF1AA1,TEF1BOXATA1,SE1PVGRP18,TEF-box,OCTAMOTIF2
6    GGCCCG          GCBP2ZMGAPC4,SORLIP2#Hudson,SORLIP2#NA#At1g05360.1#+#15
8    CCsGACCC        LTRECOREATCOR15
8    TGGCCCCG        SORLIP2#Hudson,SORLIP2#NA#At1g05360.1#+#1564211,SORLIP2A
8    TGGnwsCC        GGTCCCATGMSAUR,PSREGIONZMZM13
9    CYGSCSAGR
7    SCYCACC         GCBP2ZMGAPC4,PALBOXLPC,ACIPVPAL2
6    CAGGTT       LREBOXIPCCHS1
6    CAGGTC       DRE-like,QELEMENTZMZM13
8    ACAGATGG
8    ACAGCTTC
6    GTCTAA       MREATCHS,VOZ,BOX2PSGS2,JERECRSTR,MRE
10   ACAGAGGCAG
6    CAGATA       EVENINGAT,EveningElement,CGF1ATCAB2,IBOXLSCMCUCUMISIN,GAT
6    AGATAG       RGATAOS,GLUTEBOX1OSGT3,LREBOX3PSRBCS3,GATA
6    GCTATT       PE1ASPHYA3
6    CTACCT       HBOXPVCHS15,ACIPVPAL2,MYB4,MYB1,HBOXCONSENSUSPVCHS,MYBP
6    CTACGG       PSREGIONZMZM13
6    CTACCA       S1FBOXSORPS1L21,MREATCHS,HBOXPVCHS15,SRENTTTO1,ACIPVPAL
6    CTAATG       ATHB2,SURE2STPAT21
6    CTACGC       VOZ
6    TGCGAT       PRECONSCRHSP70A
8    GCGCTAAG
8    ACCGATAG     PRECONSCRHSP70A
10   GGTACAAAAC
6    TAGGTA       PALBOXLPC,AG,MYB4
10   AGTAGGGTAC
6    AACGCA       VOZ,CDA1ATCAB2,GCAACREPEATZMZEIN,27BPDRCONSENSUSPS25S
6    AACCCA       SEF3MOTIFGM
8    AAACCGCA
6    AACGTA       CONSERVED11NTZMATP1,SORLREP2AT,GARE2OSREP1,SORLREP2#NA
8    TGCAGGTA     INTRONLOWER
8    AATGGGTA     LFY
8    ACAAAACC     MYB1AT
8    AATGGCTG     TRANSINITMONOCOTS,TRANSTART,LFY
10   ATGGCTGAAA   TRANSINITMONOCOTS
8    TGCGAATG
8    GCTGCATC
10   GCTTCAATGG   LFY
8    TCCAATGG     CCAATBOX1,LFY
8    GGCTGGAG
6    CGTAAT       OCSGMGH24,OCS,VOZ,OCSELEMENTAT,ALF1NTPARC,HDZIPIIIAT,PAS
6    CCGAAT
8    ACTTAATG     WUSATAg
6    CTGGTT       MYBATRD22,MYB2,MYB1AT,AtMYB2,L4DCPAL1,ANAEROBICCISZMGAPC
8    GGGTAATG     GT1CONSENSUS,LFY
6    CTGTCT       ARF1,ARFAT,ARF,SEBFCONSSTPR10A
6    CGCAAT       CACGCAATGMGH3
8    CTCCAATG     CCAATBOX1,LEAFYATAG,LFY
6    GGAATG       TE2F2NTPCNA
8    GTGnwTGG     L4DCPAL1,PROXBBNNAPA,2SSEEDPROTBANAPA
8    GCTsGTsG
8    rGCwGCyw       PSREGIONZMZM13,ANAERO2CONSENSUS
8    GCCAAkGr       E2FCONSENSUS,CCAATBOX1,LFY
10   CGATGGAAGT
8    GGAAGCCC       SITEIIATCYTC
6    AAGGAG
6    CGTACG         VOZ,WARBNEXTA,ABRE3OSRAB16,ACGTOSGLUB1,ACGTSEED3
10   ATGGAAGTAC
6    CGCACG         ABRE2HVA22,RHERPATEXPA7,SARECAMV
6    AAGCAT         IDE1HVIDS2
8    GAAGCCAG
10   GGAAGACATG
10   GCTAAACGAT
6    GACACG         ACE,ABRE3HVA1,ZDNAFORMINGATCAB1,VOZ,HY5AT,DPBF1&2,ACEAT
6    GTCACG         VOZ,14BPATERD1,LS5ATPR1,RHERPATEXPA7,LS7,OCETYPEIINTHISTO
6    TACACG         ZDNAFORMINGATCAB1,VOZ,DPBF1&2,WARBNEXTA,GLUTEBOX2OSGT
6    AAGGGG         TEFBOXATEEF1AA1,EIN3ATERF1,EIN3,TEF-box,ELRE1PCPAL1,EIL1
8    GAAGCwGC       ANAERO2CONSENSUS
8    GGAArAGG       NODCON2GM,GT1CONSENSUS,PYRIMIDINEBOXOSRAMY1A,OSE2ROOT
8    TCGCCGAT       PRECONSCRHSP70A
6    GCCCGA         GCBP2ZMGAPC4
8    CAGCCGAT       PRECONSCRHSP70A
8    AAGTGCAG       INTRONLOWER
8    CAGGCGAT       PRECONSCRHSP70A
6    TATCGA         WRECSAA01
10   CCATCGATGG
6    AGTGTC         DPBF1&2
8    GGnGmTGG       PE3ASPHYA3
6    GCGGAC         27BPDRCONSENSUSPS25S
8    GCGGACAT
6    GGACAG
10   GGCAGTCCGG
10   ACATCCCCGA
10   CCATCGCGGA     TRANSINITMONOCOTS,PRECONSCRHSP70A
8    TGCACCGG
10   ACAAGCAACC
8    ACATGATG       ESPASGL01,MYCATERD1,MYCATRD22,AtMYC2
8    TAGCACGG
10   AACTGTCGGA     MYB2AT,MYB2CONSENSUSAT,PRECONSCRHSP70A,LTRECOREATCOR15
10   ACATCAGGAA
8    AGGAACGG       MYBCOREATCYCB1
12   TCCCCTGCGCGG   CGCGBOXAT
12   GACATCAGCAGT
10   TGACGCTCGG     ASF1MOTIFCAMV
6    GAGCGG         BS1EGCCR
8    ACAAGGCA
6    TCGCGG            octamer,OCETYPEINTHISTONE,OCETYPEIIINTHISTONE,OCTAMERMOT
8    ACATGGAC          MYCATERD1,MYCATRD22,AtMYC2
8    ACATTGTG
10   GTCTACGCGG        CGCGBOXAT
12   CAGCAACAGCGG      RAV1-A,BS1EGCCR,RAV1AAT,MYBCORE
6    AGCCGG
12   ACATTCGACATT
8    TGCCTCGG
12   ATCTGTATCGGA
12   ACAACCCATGCC      SEF3MOTIFGM,MYB4
6    GACATC            DRE-like,DREDR1ATRD29AB,PASNTPARA,ASF1NTPARA,DRE
6    GTACGG            SBP-box
8    ACATCCTC
10   ACATCCTCCA
10   ACAAGCGGCT
6    CTCGGA
8    CCGGyGrA          E2FCONSENSUS
8    ACAAAArC          SEF4MOTIFGM7S,GLUTEBOX2OSGT3
8    GnTTGCGG
8    GnCrsCGG          DPBF1&2,REGION1OSOSEM,ABRECE1HVA22
15   GGACASAAGCATCAA   DPBF1&2,DPBFCOREDCDC3
10   GTACCAGTGC        LFY
10   TACGACCGGG
10   TACTCCAGTA
12   ATAGACGCGGTA      CGCGBOXAT
6    TACCCC            L1DCPAL1,LFY
8    TACCAACT          CAREOSREP1
10   GTACCGGGAT        BOXC'PSAS1
8    TACCGTGA
8    TACTAAGG
10   TACGAGAATC
6    GTACCA            S1FBOXSORPS1L21,VOZ,GLUTEBOX2OSGT2
10   TACTTGCAGA
6    TACAGC            D4GMAUX28
10   TACTCAGGAC
6    GTACTT            O2F3BE2S1,ABREMOTIFIOSRAB16B
8    GTACCTAT
8    GTACTGGC
6    TACCAC            MREATCHS,VOZ,GLUTEBOX2OSGT2,GT1MOTIFPSRBCS,SRENTTTO1,GB
8    GGGTCGkT          DRECRTCOREAT,CBFHV,LTRECOREATCOR15,DRE2COREZMRAB17
8    CsGnmCCG          AMMORESVDCRNIA1
7    CCGCrGk           CGCGBOXAT
8    GnTCCGGT
12   GCCGAGAATCAG
6    ATAGCC            LEGUMINBOXLEGA5
6    TATGCC         TEFBOXATEEF1AA1,TEF1BOXATA1,SE1PVGRP18,TEF-box,OCTAMOTIF2
6    TCAGGG
6    GTGGCC         ABFs,ABRE3HVA22,ABREA2HVA1,GBOXRELOSAMY3,O2F2BE2S1,GBOX
10   GAATCAGTAG
8    CsGGyCGr       PRECONSCRHSP70A
8    yCAGCTGs
6    CSGGCC         GCBP2ZMGAPC4,SORLIP2#Hudson,SORLIP2#NA#At1g05360.1#+#15
8    CCATCGCG       TRANSINITMONOCOTS,PRECONSCRHSP70A
6    GGTGCG         SARECAMV
8    GAGTAGCG
10   ATTAACGGCG     MYB2CONSENSUSAT,MYBCOREATCYCB1,MYBCORE
12   AAGGAGCCTGCG
10   AGGTGACGCG     ASF1MOTIFCAMV,CGCGBOXAT,RAV1-B,RAV1BAT
8    ATGTAGCG
10   GATAAAGGCG     TAAAGSTKST1,GT1CONSENSUS,SREATMSD,IBOXCORE,GATA
10   GGGTATGGCG
8    GTATGGCG
6    GACGCG         VOZ,ABADESI2,ABRECE3HVA1,CGCGBOXAT,ABRECE3ZMRAB28
6    CTCGCG
6    GACGTG         UPRMOTIFIAT,OPAQUE2ZMB32,LRENPCABE,O2F1BE2S1,DRE-like,HEXM
8    GGTCCGCG       CGCGBOXAT
6    CATGCG
8    GAAAAGCG
8    CACCAGCG       DPBF1&2
6    ACCGCG         RE1ASPHYA3,GT2OSPHYA,CGCGBOXAT
6    GACCAC         DRE-like,GBOXSORBCS1,SITEIIBOSPCNA,GBOXPC
8    GACGTCCA       ACGTCBOX,HEXMOTIFTAH3H4,TGACGTVMAMY
8    AACCAGCG       MYB1AT
8    GnGGwCCA       UPRE1AT
8    CCnnCGCG       VOZ,PE3ASPHYA3
8    CCrGCGnr       PE3ASPHYA3
8    CGkTTGCG       MYBCORE
8    ArTGGyGG       27BPDRCONSENSUSPS25S,IDRSZMFER1
8    rGTyTGCG
8    ACCAGmGs
8    GGAnCGrC       DRE-like
8    GGAnCnrC       octamer,DRE-like,OCETYPEIIINTHISTONE,OCTAMERMOTIFTAH3H4,OC
8    CksCkGCG
8    GsTGTGCG
6    CATCAC         OCSGMGH24,GREGIONNTPRB1B,ANAERO3CONSENSUS,OCSGMHSP26A
6    CATCCG         PE3ASPHYA3
6    CATTCG         PE2FNTRNR1A
6    CATGTT         ESPASGL01
6    CATCGC         PRECONSCRHSP70A
6    ACCCCT         ELRE1PCPAL1,LFY
6    ACCCAC         SEF3MOTIFGM,ABREAZMRAB28,ACIPVPAL2
6    ACCCGT         DPBF1&2
6    ACCGTC         HEXAMERATH4,PALBOXAPC,Hexamer,CMSRE1IBSPOA
12   ACCTCTGGAAAA   GT1CONSENSUS,GT1GMSCAM4
12   AAGCGAACGGGT   MYBCOREATCYCB1
10   GCGGTGTGGT
8    ACCCCTAC       MYBPZM
10   ACCTGGCAAG     RAV1-B,RAV1BAT
12   ACCTGAAACACC   RAV1-B,RAV1BAT
10   ACCAGGTGTG     DPBF1&2,DPBFCOREDCDC3,RAV1-B,RAV1BAT
8    CCATGGGT       SEF3MOTIFGM
8    CAGAAGGT       HSEs
8    TAACTGGT       MYB2,MYB2AT,MYB2CONSENSUSAT,MYBCORE
12   ACCTCCGAGTTT
8    ACCTCAAG
8    ACCAGCAG       ANAERO2CONSENSUS
12   TCGCGAAAGGGT
8    ACCAGGAT
12   CCGAGTCGAGGT
8    GTGmGGGT
8    ynACGGGT
8    GTGCACCG
6    TAGTAC         VOZ,SP8BFIBSP8BIB,O2F3BE2S1,ABREMOTIFIOSRAB16B
8    AGTGCAGC
6    TGCCGC         E2FBNTRNR,GRAZMRAB28,GCCCORE,GCC-box,OCTAMOTIF2,ERF1,ABR
6    TGCCGT         IDE2HVIDS2
8    GTGCTCAT
8    GTGCTTAT       Ibox,IBOX
8    GTGCAGCA
8    GTGCTTGT
6    ATAGTA         AGL3,D1GMAUX28,SP8BFIBSP8BIB,LREBOX3PSRBCS3
6    GAGTAC         O2F3BE2S1,TACBBFNTEAS4,ABREMOTIFIOSRAB16B
6    CGTGTA         ZDNAFORMINGATCAB1,VOZ,DPBF1&2,WARBNEXTA,GLUTEBOX2OSGT
8    ATGCGTAC       SBP-box
6    TGCGTA         VOZ,ALF1NTPARC,PASNTPARA,ASF1NTPARA,SBP-box
8    GTGCAGAT
8    AGTGCAGA
6    GTGCCT         GBOX10NT,-314MOTIFZMSBE1,ABASEED1
6    TGCGAG
8    GTGCGGkT
12   TATGTACCGACA   DRECRTCOREAT,LTRE,DRE-like,DREDR1ATRD29AB,CBFHV,PRECONSCR
12   TCAGGGTATGTA
8    CGACAACC       PRECONSCRHSP70A
6    CCTATG
8    CCTATGTA
6    GTATGT         JASE2ATOPR1,JASE2,ASF1ATNOS,20NTNTNOS
8    CGAyrTCG       ACGTCBOX
6    TGGTGC         MYB
6    GTTTGC         E2FBNTRNR,LEGUMINBOXLEGA5,RSRBNEXTA,PROXBBNNAPA,2SSEEDP
6    ACGTGC         ABFs,ABREOSRAB21,DPBF1&2,GBOX10NT,BP5OSWX,T/GBOXATPIN2,A
6    ATATGC         P1BS,LREBOX2PSRBCS3,GT,NDEGMSAUR,RBCSBOX2PS,CATATGGMSAU
6    CCCTGT         DPBF1&2,ANAERO5CONSENSUS,TEF1BOXATA1
8    TCCCGAAG
6    GATAAC         SREATMSD,GAREHVAMY1,IBOXCORE,GATA
10   GTCTCCCAGC     ARF1,ARFAT,ARF,SURECOREATSULTR11
8    TCyCrTCA       ASF1MOTIFCAMV
16                  LTRECOREATCOR15
     CTCCCCGACCCCMCMG
11   CTCCMYCWCMC
8    AAGGCGAC       PRECONSCRHSP70A
8    CAAGGCGA
6    GTGAAG         GLUTEBOX1OSGT3,GLUTEBOX1OSGT2
10   AAGGCATCAA
8    CAAGGCAT
8    AGGCTGAT
8    GCGAAAGT       E2FCONSENSUS
6    TATAAG         CArG,TATABOX4,SORLREP1#NA#At1g53090.1#+#19847781,GLUTEBP
8    AnGCGCnT       ABRECE3ZMRAB28,OCSENHANMOTIFAT
8    GGCTATCC       TATCCAOSAMY,REBETALGLHCB21,MYBST1
6    GCTTAC         OCS,OCSELEMENTAT,CArG2,OCSENHANMOTIFAT,CARG2ATAP3
8    GGCTTTTG       -141NTG13
8    mGkCTCCA       SURECOREATSULTR11
6    TATCCG         REBETALGLHCB21,SREATMSD,MYBST1
6    TTCCCG         E2FANTRNR,E2FCONSENSUS,BOXC'PSAS1,E2F1OSPCNA,E2F,E2FAT,TE
6    TCACCG         OCETYPEINTHISTONE
8    ACGsCGTT       MYBCOREATCYCB1
12   TAAGAGACTATG   NODCON2GM,SURECOREATSULTR11,OSE2ROOTNODULE
12   CACGAATGCCTC   RHERPATEXPA7
12   TTGAGATCCCTC
10   GGTATGCCTC
10   TAAGGCCGTG
8    kGAGsCTC
8    CkAAGACG
8    GsTTCsTC
9    GATGGCCTC      TRANSINITMONOCOTS
6    CAAGCA         IDE1HVIDS2,ALF1NTPARC,GLUTEBP1OS,PASNTPARA,RSEPVGRP18,ASF
8    GAGCCTTC
8    CAAGACGC
12   CAAGAAGGTAAT   GT1CONSENSUS
10   CAAGAGTCCC     NODCON2GM,OSE2ROOTNODULE
10   GGCGTATAAG
6    TGTGGC          SORLIP1#NA#At1g05360.1#+#1564312,SORLIP1#Hudson,SORLIP1A
10   ATAAGCGCCA      Ibox,IBOX
6    TGGGGC          SE1PVGRP18
8    AACGsCGT        MYBCOREATCYCB1
6    GAGTAG
10   AACCAAGTGG      MYB1AT,REALPHALGLHCB21
8    TGAGGGTC
8    GkCnnGTG        VOZ,GBOX10NT,SITEIIAOSPCNA,GRAZMRAB17,ABRECE3ZMRAB28,PRE
7    GGknGAG         POLLEN2LELAT52,E2F-varient,PE3ASPHYA3
5    GAGGG           BOXICHS
10   GCCTGTCACG      RHERPATEXPA7,SEBFCONSSTPR10A,BIHD1OS
6    TCACCA          MYB
6    CCTACT
6    CCTGGA          SITEIOSPCNA,RNFG2OS,ANAEROBICCISZMGAPC4
10   GCCTCTTGGC      NODCON2GM,OSE2ROOTNODULE
8    CTACCCAT        MYBPZM
10   CCTACCCATG      BOXLCOREDCPAL,MYB4,MYBPZM
10   GAGATCCATG
10   TGCCTGCATG      INTRONLOWER,RYREPEATBNNAPA
6    CCTAGC
8    TGCCTGCA        INTRONLOWER
8    GCCwCGTs        ABFs,HY5AT,UPRMOTIFIAT,GBOX10NT,LRENPCABE,SORLIP1AT,ABREL
8    GCCnnCGC        REGION1OSOSEM
13   SCCAYGCCTYSCC
6    TAGGAG          SORLREP4#NA#At1g53340.1#+#19905163,MYB1,SORLREP4#Hudson
6    TCGCAT
6    GCATAA          TEFBOXATEEF1AA1,TEF1BOXATA1,TEF-box
6    CGCAGC
12   AGTCCTTCCCGA
8    GAGGCTGA
8    TCCTGTGC
8    AGGTGCTG        RAV1-B,RAV1BAT
6    AGCTGA          PE3ASPHYA3
10   GTCCTTCCCG
10   CAGTTGCTGA      MYB2CONSENSUSAT,MYBCORE
8    CnCAGCTG
8    GCAGCTGA        ANAERO2CONSENSUS
9    YTGCYGCTG       ANAERO2CONSENSUS
8    CAGCTCTA
8    CGTmkACG        CRTDREHVCBF2
8    TGATTGCT
10   TGCTGGATCC
6    TAGTGA          14BPATERD1,GLUTEBOX1OSGT3,RBCSBOX3PS,IDE2HVIDS2,LREBOX3P
12   TCCTGCAGTGAT    INTRONLOWER
8    TGCAGACG
12   AGACGGAGATTG
12   AGACGACCAATA    CCAATBOX1
12   CGTCTCGATGCA    SURECOREATSULTR11
10   ATGTCCTGCA      INTRONLOWER
10   ATGCCCTGCA      INTRONLOWER
10   AAACCTGCAG      INTRONLOWER
10   AGGACCTGCA      INTRONLOWER
8    TGTTGCAG        INTRONLOWER,RAV1-A,RAV1AAT
6    ACGGTC          MSACRCYM,ARECOREZMGAPC4,ANAEROBICCISZMGAPC4
6    ACGCAA          OCS,OCSELEMENTAT,ALF1NTPARC,PASNTPARA,GCAACREPEATZMZEIN
6    ACGTAA          OCSGMGH24,ACGTABOX,OCS,GARE2OSREP1,AS1CAMV,OCSELEMENTA
12   TAGATGCTTGCA
10   GATACCTGCA      INTRONLOWER
8    AkCTGCAG        INTRONLOWER,LEGUMINBOXLEGA5
15   GCRCCGRAGCYGCMGAGCBOXNPGLB,GCCCORE,GCC-box,ERF1
8    TGAATAGG
6    GAAAGG          CArG3,GLUTECOREOS,JERECRSTR,CArG2,CARG2ATAP3,CARG3ATAP3
8    CnGmACnG
6    CTCAGC
6    GCGAGC
8    ATGAAGCC
6    CGAAGC          ABAREG2
8    CAGTCATT        WBOXNTERF3,WBOXHVISO1
8    GCysrGCC
8    GCCnAGsC
8    ATGGACAG
10   ACTTTATGGA      TAAAGSTKST1,NTBBF1ARROLB
10   CACTTTATGG      TAAAGSTKST1,NTBBF1ARROLB
8    CATGGACA
12   TGAAGCCATGGA
6    TAGATG          PASNTPARA
12   AGATAGATGGAC    GATA
8    AGATGGAC
6    GTATGG          JASE2ATOPR1,S2FSORPL21,POLLEN2LELAT52,JASE2
10   AGCGAGATGG      TRANSINITMONOCOTS
10   GCGAGATGGA
8    TCTGCAGG        INTRONLOWER
8    CGGTCAGG        WBOXNTERF3,WBOXNTCHN48
6    TGACGC          OCS,VOZ,AS1CAMV,OCSELEMENTAT,ASF1MOTIFCAMV,TGA1ANTPR1A,
6    TGACGT          OCS,UPRMOTIFIAT,OPAQUE2ZMB32,AS1CAMV,ACGTCBOX,OCSELEMEN
12   GATCTCGTCCCG
6    GGTCCC          GGTCCCATGMSAUR,AUXREPSIAA4,SITEIIBOSPCNA,NDEGMSAUR
10   GGTGATTTGC      EECCRCAH1
15   CGCCCAAGCCYCCCG
10   GCGATGCAGG      INTRONLOWER
6    CCGGCA
8    GGCAwGrG
12   TCGGCATGCCTG   DRECRTCOREAT
6    GTGGGA         BOXCPSAS1,ABREAZMRAB28,ACIPVPAL2,SITEIIBOSPCNA
8    CAGGATGA
10   AGCATCAGGA
10   CAGGAGCCAC     SORLIP1#NA#At1g05360.1#+#1564312,SORLIP1#Hudson,SORLIP1A
12   CAGGCATCCATA
8    GTCCAGGA
12   CAGAGAGTAGCA
12   CAGCATTGTCAA   WBOXATNPR1,W-box,BIHD1OS
12   CAGCCTTGTAGA
10   CAGGGAAACA
8    CAGACCCC
10   CAGTAGTCTG
8    CGGCTGGA
8    CAGCATAC
10   CAGAGGCAGA
8    CAGGGAGT
12   CTGTGAAGGGGA
10   CACTCAGGAC
10   CAGATGCAGC
12   CAGCCTCACCAA
8    CAGGAAGC
12   TGAGGTTGAGGA
12   CAGATTCCTAGC
8    CAGGCCAC       SORLIP1AT
12   TGCGGAACAGGA
10   CAGTACCAGG
12   TCTGGATGAGGA
8    AGTAGCCA       SORLIP1#NA#At1g05360.1#+#1564312,SORLIP1#Hudson
8    CACCTCAG
8    TGTATAGT
8    ATGTAAGC
10   CGGCTATCCC     MYBST1
10   GGTGGATCCA
10   GGTGTGGTCG
8    GGTCTCCC       SURECOREATSULTR11
12   ACTTCGAGTCCC
8    CGGTGTCT       DPBF1&2,ARF1,ARFAT,ARF
8    CAACTCCC       CAREOSREP1
12   TCAGAATCTCCC
8    CATCTCCC
10   TCCATCTCCC
10   CCCGGTGTAT     DPBF1&2,DPBFCOREDCDC3
7    GGTkGCC         O2F2BE2S1,SORLIP1AT
10   GGTGGYTKGG      SORLIP1#NA#At1g05360.1#+#1564312,SORLIP1#Hudson,SORLIP1A
6    CTCATA          O2F2BE2S1,ATB2/AtbZIP53/AtbZIP44/GBF5,CCA1,PREATPRODH
8    AyTCnCCG        E2FCONSENSUS
8    sGCCsGnG        GCBP2ZMGAPC4,SITEIIAOSPCNA,PREMOTIFNPCABE,GAREHVAMY1,PE
8    GnCyCGTC        SITEIIAOSPCNA
12   CGAACAATACCG
8    AGCCTCCG
12   ACTACCTTACCG    MYB4
10   GCAGAGGCCG
12   CAACCCATGCCG    SEF3MOTIFGM,MYBPZM
10   CAATGAACCG      LFY
8    CCGAnCCG        OCETYPEINTHISTONE
8    AAGCCGAC        DRECRTCOREAT,DRE-like,CBFHV,PRECONSCRHSP70A,LTRECOREATCO
8    TTGCCGAC        DRECRTCOREAT,DRE-like,CBFHV,PRECONSCRHSP70A,LTRECOREATCO
7    GGTCCGA
13   CCGSCSSGTCCGA   PALBOXAPC
10   ACTCAGGACT
6    TCACGC          VOZ,IDE2HVIDS2,OCETYPEIINTHISTONE,CACGCAATGMGH3
8    GCACCGGC
12   CGCATGCCGGCT
8    TCnCCGkC
7    CrACGGC         HEXAMERATH4,CGACGOSAMY3,MYB2CONSENSUSAT,MYBCOREATCYC
8    GCCmsCGC
8    GCsCGsGC        CGCGBOXAT
12   GCCCAMGYCYCC    ABREOSRAB21,SITEIIATCYTC
13   SSCGTAGGGAAGC
6    GCCCMC          GCBP2ZMGAPC4,SITEIIAOSPCNA,ABREAZMRAB28,ACIPVPAL2,EIN3,SIT
6    GGTATC
8    GTTGGACC        MYBPZM
8    GGTTGGCA        MYBPZM
10   TCCGGAATCC
8    GTCCGGTT
8    CCGrsTCG
7    CCGGGGC         AMMORESVDCRNIA1
10   GTGGCTATCC      SORLIP1#NA#At1g05360.1#+#1564312,SORLIP1#Hudson,TATCCAOS
8    ATCCACAG        TATCCAOSAMY,TATCCACHVAL21,TATCCAYMOTIFOSRAMY3D,SV40COR
8    ATCCACGT        TATCCAOSAMY,O2F1BE2S1,T/GBOXATPIN2,ABRELATERD1,CACGTGMO
6    GGGGCY          SORLIP2#Hudson,SORLIP2#NA#At1g05360.1#+#1564211,SORLIP2A
12   GGTCCGGGTAGG    BOXLCOREDCPAL,MYB4,MYBPZM
8    TAGGCATC
6    TCGGTC          DRE1COREZMRAB17,DRECRTCOREAT,LTRE,SUREAHVISO1,DRE-like,DR
8    CCTGGTCC
6    AGGGGG          EIN3,EIL1,ACIIPVPAL2
8    GGTnGkTG        SRENTTTO1,MYBPLANT,PALBOXLPC,ACIPVPAL2,L1DCPAL1,BOXLCORE
8    TAGGGTTT        TELOBOXATEEF1AA1,TELO-box,UP2ATMSD,LFY
8    TGGGnTCC        SEF3MOTIFGM,SITEIIATCYTC
8    TTGGkTCC        REALPHALGLHCB21
12   GAGGCTGATACA
10   GAGGACGAGA
8    CGAGGACT
8    GAGsCTCm
6    GCGACT          PRECONSCRHSP70A
6    CGACGC          Nonamer,VOZ,CGACGOSAMY3,NONAMERATH4
8    CGACTGCT        PRECONSCRHSP70A
12   CGACTTTATCGC    TAAAGSTKST1,GT1CONSENSUS,NTBBF1ARROLB,IBOXCORE
10   CGTACCAAGG
10   CGACCACGTC      UPRMOTIFIAT,ABRELATERD1,HEXMOTIFTAH3H4,UPRMOTIFIIAT,HEXA
12   ATCTTGCAAGCC
10   GGATGAGGTG
8    GArnGGTG
13   GCTSGGCGAGGTG
6    TCGATC          Nonamer,RNFG1OS,OCETYPEINTHISTONE,NONAMERATH4
8    TTCATCAA
8    GCGATCAC        PRECONSCRHSP70A
10   GGCGATTTGC      EECCRCAH1
8    GGCGATAA        GT1CONSENSUS,Ibox,PRECONSCRHSP70A,IBOX,IBOXCORE
12   TGCATATATCAA
8    AACAATCC
10   AGCTAATCCT
8    CGAGATCC
10   GCGAAGGAAT
6    CACCAA          MYBPLANT,PALBOXLPC,OCETYPEIIINTHISTONE,MYB4,ACIIPVPAL2,MY
10   AAGCGTCAAG      WBOXATNPR1,ASF1MOTIFCAMV,W-box
10   TGTAGCCAAG
6    CGCCAA          GREGIONNTPRB1B,E2FCONSENSUS
10   GCGATACACC
8    GGCGCrTG        CGCGBOXAT,ABRERATCAL,ABRECE3ZMRAB28
8    TCTGGATG
8    wTGGGrTG
10   GTAACCCACA      SEF3MOTIFGM
10   GTAGACAACG
8    GTATGGAT        AMYBOX2,TATCCAOSAMY,TATCCAYMOTIFOSRAMY3D
12   GAAACAGCCTAG
8    GTAACTGT        D1GMAUX28,MYB2AT,MYB2CONSENSUSAT,MYBCORE
10   GGTATCACAC
6    TAGTAG          SP8BFIBSP8BIB
8    GTAGCACA
10   CCGCAAGTAG
8    GTAAGCCC        SITEIIATCYTC
12   AAGAGCCGCTAG   NODCON2GM,OSE2ROOTNODULE
6    ATCTCG         DRE1COREZMRAB17,TGA1ANTPR1A
10   TCGTCCTCAA
10   GAAAAAGAGC     NODCON2GM,GT1CONSENSUS,GT1GMSCAM4,-300ELEMENT,OSE2ROO
8    ACGGAGCA       VSF1PVGRP18
8    CGGAGCAA
10   CGGAGCAACT     CAREOSREP1
10   GAGCAATACG
12   AGCACAATGCAA
10   AGCAAATCAT     EECCRCAH1
12   AGCAAATCATAC   EECCRCAH1
8    AGCAGTTC
6    CAACGC         VOZ,NONAMERMOTIFTAH3H4,CE3OSOSEM,GCAACREPEATZMZEIN,27B
12   TGTGGTCGACGC   CGACGOSAMY3,CBFHV,CRTDREHVCBF2
12   TGTATCAACCTG
8    CCTGTGCT
12   TGTCTCCCAGCT   ARF1,ARFAT,ARF,SEBFCONSSTPR10A,SURECOREATSULTR11
10   CCTGTAATGC
12   TGTATAAGACGA
10   TAACTCCCCT
6    TGTCAC         VOZ,HY5AT,14BPATERD1,ARE1,IDE2HVIDS2,TGTCACACMCUCUMISIN,
8    TGTTTTGk
8    CTCGnCCC
12   CYCCMACYYCCC   BOXCPSAS1,MYB1,MYBPZM
9    CCMSYSTCC
8    CCACKCCC
12   GCAAAGCAACCA   REALPHALGLHCB21,PROLAMINBOXOSGLUB1
8    GCAATGTC
8    GCAAAGAC       PROLAMINBOXOSGLUB1
10   GCAATACCTT
8    CTyCwCCr       POLLEN2LELAT52
8    CTCCATGA
10   CTCCATGACA     BIHD1OS
10   CCCAAGCGTC
12   CTCACGGTTACC   MYBCORE
10   GATGAGGGTC
12   CCGCATATTGTC   ROOTMOTIFTAPOX1
12   CGCATATTGTCC   ROOTMOTIFTAPOX1
6    GTTGTC         DRE-like
10   GGTCATGGTC     WBOXNTERF3,QELEMENTZMZM13
6    TAGTCG         DRE-like,PRECONSCRHSP70A
8    GGAACTAC       MYB4
6    CCGTGT         DPBF1&2,GLUTEBOX2OSGT2,CGTGTSPHZMC1
8    mCCGTCkC       HEXAMERATH4,CGACGOSAMY3,PRECONSCRHSP70A,Hexamer,SURECO
8    AGGATGAA
12   TGAAGGGAACGA
12   GGCACAGTCAGG   WBOXNTERF3,WBOXNTCHN48,WBOXHVISO1
10   ATGACGCAAA     ASF1MOTIFCAMV
8    GCACCTAC       MYBPLANT,BOXLCOREDCPAL,MYB4,MYBPZM,MYB
6    CGCTTG         WINPSTPIIIK
8    AAGCCTAC       MYBPZM
10   GCGTAGCTTA
10   GTGCCGCGTA     CGCGBOXAT
6    AGCTTA
10   AAGACGCGTA     CGCGBOXAT
12   CATGGAAGTACA
8    ATGGCACG       TRANSINITMONOCOTS,RHERPATEXPA7
8    ATGGACGC       SPHZMC1
8    ATGGGTTC       SEF3MOTIFGM
10   GCAGCTACAC     ANAERO2CONSENSUS
10   GCAGCTACAG     ANAERO2CONSENSUS
10   GCATCAGCAA
8    GCAGACAT
12   TTCCTAATAGGC   CPBCSPOR
12   GCATCAGTACGA
12   GCATATTGTCAC   ROOTMOTIFTAPOX1,TGTCACACMCUCUMISIN,SEBFCONSSTPR10A,BIH
8    GCATCTGG
8    GCATCATA
12   AGGCATAAGCCA   SORLIP1#NA#At1g05360.1#+#1564312,SORLIP1#Hudson
9    GCASCACCY
10   CATCGATGAC
12   CATCAACAGCTC   RAV1-A,RAV1AAT,MYBCORE
10   CATCCTCCAA
8    CATCCACA
8    AAAGCTGG
8    ATAGCTGG
10   GGGTATGTGG
12   CGTTACACAGCT
12   CGTGAAGCATCC   RHERPATEXPA7
8    CGTTCTGC
8    TTGATTGG       CCAATBOX1
8    GGyTTTGG
8    GTTTTnGC       SEF4MOTIFGM7S
8    CGTCCCGC       BS1EGCCR,PALBOXAPC
8    GCGTwGAC       WBOXATNPR1,W-box
8    ATGTTTGG       MYB4
7    TTGTTGG        RAV1-A,RAV1AAT,AACAOSGLUB1,ELRE1PCPAL1
8    TAACTGTG       D1GMAUX28,MYB2AT,MYB2CONSENSUSAT,MYBCORE
8    GGsCCAAm       SORLIP2#Hudson,SORLIP2#NA#At1g05360.1#+#1564211,UP1ATMSD
10   CCCATTCTTG
10   TCCATTCTTG
10   TGCCAACTTG
10   GCCGGAAGAG     NODCON2GM,OSE2ROOTNODULE
8    AATGTGAG
12   AGCGCTCAGAGT
8    AGTkGGAG       BOXCPSAS1,RBENTGA3
8    GCCAAGAG       NODCON2GM,OSE2ROOTNODULE
8    AGyAGAGT
8    TTGTGTGT       DPBF1&2,GLUTEBP1OS
8    TykGGCyC       GCBP2ZMGAPC4,SORLIP2#Hudson,SORLIP2#NA#At1g05360.1#+#15
5    GGGGG          ARELIKEGHPGDFR2,EIN3,EIL1,ACIIPVPAL2
10   TGCAGTACAG
6    GTCGAC         O2F1BE2S1,CBFHV,CRTDREHVCBF2
12   AAGCGGAAGAAT   -10PEHVPSBD
10   CAATGCGGCA     LFY
12   AAGGACCATAAT
10   TGCGTAGAAA     POLLEN1LELAT52
10   GATGCAATGC
10   ATGCGTACGT     ACGTABOX,ACGTOSGLUB1
8    TGCGTACG       VOZ
8    TCCAATGC       CCAATBOX1,LFY
10   CTGCCTGAAT
8    TGCGAGAC       ARF1,ARFAT,ARF,SURECOREATSULTR11
8    GCGGsAGA       E2FAT,E2F-varient
10   CGCGCTTTTG     CGCGBOXAT
8    ACGAACCA       REALPHALGLHCB21,SV40COREENHAN
10   CTTGTACATC
8    TCnACGAA
8    GCCACryC       SORLIP1#NA#At1g05360.1#+#1564312,SORLIP1#Hudson,VOZ,UPRM
8    CCGATTTA
12   CCCGAATAAAAC   POLASIG1
8    CCGACyCG       DRECRTCOREAT,CBFHV,LTRECOREATCOR15,DRE2COREZMRAB17
8    CATGATGC
10   CGCACCTACC     MYBPLANT,BOXLCOREDCPAL,MYB4,MYBPZM,MYB
10   ACTGGACATG     LFY
8    CGCCAGCA
10   CGCTGCAATC
8    CGATGACT       WBOXNTERF3,PRECONSCRHSP70A,WBOXHVISO1
12   ACGATAAGCATC   Ibox,IBOX,IBOXCORE
10   TCGACAACCA     REALPHALGLHCB21,CBFHV,CRTDREHVCBF2
10   TGATCATCCA
8    CrGATCyG
8    CGGAwCnG       octamer,OCETYPEINTHISTONE,OCETYPEIIINTHISTONE,OCTAMERMOT
12   AATTAACGGCGA   MYB2CONSENSUSAT,MYBCOREATCYCB1,MYBCORE
8    AATGGCGC       TRANSINITMONOCOTS,LFY
10   AATGGGACTA       LFY
12   ATGGCGATTTGC     TRANSINITMONOCOTS,EECCRCAH1
10   ATGGGGGCAA       E2FCONSENSUS
10   AGGGAAGCGA
8    AGGAGCCA         SORLIP1#NA#At1g05360.1#+#1564312,SORLIP1#Hudson
8    GAGATGGG
10   GAGCCTTTGC       -300ELEMENT,PROLAMINBOXOSGLUB1
12   TATGGAAGGAGC
8    ATGTTAAG
8    GGCCmAAG         SORLIP2#Hudson,SORLIP2#NA#At1g05360.1#+#1564211,E2FCONSE
8    GAGAmGAC         SURECOREATSULTR11
8    CGGTAGAC
10   CTATGGAGCA
10   GTCATGGTCA       WBOXNTERF3,WBOXNTCHN48,W-box,ELRECOREPCRP1
13   CCGTCACSTCKCC    ABREOSRAB21,ASF1MOTIFCAMV,ABRELATERD1,RHERPATEXPA7
12   AAAGTCGATGAC     CBFHV,T-box,NTBBF1ARROLB,TBOXATGAPB
10   ACGCTGGCAC
8    AGAACTGA         INRNTPSADB
10   CTGACGCTCG       ASF1MOTIFCAMV
12   TGAGAAGACTGA     INRNTPSADB
10   CACTGAGTGA       SORLIP5#NA#At1g52280.1#-#19535625,SORLIP5#Hudson,SORLIP5A
10   AAGCGTATGA
12   ACGCGTACCTAT     CGCGBOXAT,ABRERATCAL
10   ACGCAAACAG
8    GAACATGA
8    TnTTGACG         WBOXATNPR1,JASE2ATOPR1,ASF1MOTIFCAMV,W-box,HEXMOTIFTAH3
8    AmGCGnCG         CGCGBOXAT,ABREMOTIFIIIOSRAB16B
12   AGTACATTCCTA
8    CCTAGTGT         DPBF1&2,DPBFCOREDCDC3
10   TGGTGGATCC
8    GGATCCAG
10   CTACTGTGCT
10   TGCAACAGCT       RAV1-A,RAV1AAT,MYBCORE
10   TAACGCGAGA
12   TAACTAGCTACT
8    AACGAACC
12   AACGCGAAGATA     GATA
7    ACGGGTk          DPBF1&2
8    CTGCATCG         INTRONLOWER
10   GTCTCCAAGA       ARF1,ARFAT,ARF,SURECOREATSULTR11
8    GTCGGACT         PRECONSCRHSP70A,LTRECOREATCOR15
14   GCCGARGGTGTYGS   RAV1-A,CANBNNAPA,RAV1AAT
8    CGGCACCA
8    TCGGACTG
10   CGGGCCACTG       SORLIP2#Hudson,SORLIP2#NA#At1g05360.1#+#1564211,SORLIP1A
6    GTTCAC
10   GATAAGCTGC      Ibox,SREATMSD,IBOX,ANAERO2CONSENSUS,IBOXCORE,GATA
12   CATGACTGCATC    WBOXNTERF3,WBOXHVISO1
8    TGCATCTG
10   CTGCATCATT      INTRONLOWER
8    TGCATCAC
10   CTGCATCACG      INTRONLOWER,RHERPATEXPA7
8    kGTGTTGC        RAV1-A,GLUTEBP1OS,RAV1AAT
8    TCGAGGGG
8    CTTGCACT
10   AGCGTCAAGC      WBOXATNPR1,ASF1MOTIFCAMV,W-box
15   GGSGCGAGYSRSGGC
10   TTACCATTTG      S1FBOXSORPS1L21,GT1CONSENSUS
10   CATAAGCGCC
10   CATGTAAGCA
10   TAGGAGCGCA
8    CATACTTA
8    CATTCGAC
18                   GCCCORE,GCC-box,ERF1
     GRGMGGMGGSGGCGGCGC
12   TCACATGGGTGC    MYCATERD1,MYCATRD22,AtMYC2
10   CTACGCGGTG      CGCGBOXAT
8    TTTATCTG        GT1CONSENSUS,IBOXCORE,GATA
8    AGCTTCTG        HSEs
10   GTGCACCGGC
10   TGCCGCAAAC
12   GTGCCTCCCACG    BOXCPSAS1,UPRMOTIFIIAT
12   TGCACAGCCATA    TRANSINITMONOCOTS
8    TGCCAAGC
10   ATAATGTCAT      POLASIG3,BIHD1OS
6    AGATGT          23BPUASNSCYCB1,PASNTPARA
8    GATTAAGA
8    GGkTyGGG        MYBPZM
10   AGCCTACGAA
12   TGGCGATTTGCC    E2FCONSENSUS,EECCRCAH1
10   TCCATGAGTA      ATB2/AtbZIP53/AtbZIP44/GBF5,PREATPRODH
10   TAGCTCTCAC
8    TAGAACTG        BOXIINTPATPB
12   AGCGGAACCACT    LFY
12   AGCGACTCAACG
12   AGCGGCGATGTT
12   AGCGGTAGTGGG
10   CCACGCCGTA
12   AGCCAAGCAGTA
12   CAATCATTACGT    ACGTABOX
10   CACATAGCAG      ANAERO2CONSENSUS
10   CCTGCAGCAC     INTRONLOWER
8    CCAGCACA
8    GCTTGCAC       -284MOTIFZMSBE1
12   CACTCACTCACC   SORLIP5#NA#At1g52280.1#-#19535625,SORLIP5#Hudson,SORLIP5A
8    CACTCCAG
10   TCACCCTCGA
8    GCTTTTGk       GLUTEBOX2OSGT3
10   TGAGATACCT
12   TGAGATTATACC
8    AGCTCTCA
10   CCCACCTCAG
10   CAACGAAAGT
10   CAACACTGCC     RAV1-A,CANBNNAPA,RAV1AAT
8    CAATGCCA       LFY
10   CAACAGCATC     RAV1-A,CIACADIANLELHC,RAV1AAT,MYBCORE
12   CAACGTGACAAC   BP5OSWX,T/GBOXATPIN2,ABRELATERD1,RHERPATEXPA7,SEBFCONSS
8    GAACTACT
8    AGArCCGC       ERE,GREGIONNTPRB1B,PR2GCNT,EREGCC
11   CKGGYCGYCAS    ASF1MOTIFCAMV,GCCCORE,GCC-box,PRECONSCRHSP70A,ERF1
10   TATGTTGTGC     RAV1-A,RAV1AAT
10   GCTATTCAGA
10   CCTATCACAG     GATA
8    GGAACAGC
11   CCCGCAGRAAC    POLLEN1LELAT52
8    GATGTACT
10   AGGTCTCCCA     BOXCPSAS1,SURECOREATSULTR11
12   CGAAGCAGTCAT   WBOXNTERF3,WBOXHVISO1
10   GAAGCTTACA
9    CTTRCMAGC
12   AGCCATTGCAGC   TRANSINITMONOCOTS,LFY
12   TTTGCCAAGCAA
10   CCAGCAACTG     MYB2CONSENSUSAT,MYBCORE
12   CCATGTCGCAGC   TRANSINITMONOCOTS
10   CCCAAGCATC
12   TCAATAGCGGCA
10   GAAAGACCTG
12   RCCYGGKCCMAC   GCBP2ZMGAPC4,SORLIP2#Hudson,SORLIP2#NA#At1g05360.1#+#15
12   TCAGAAGGTGCC
12   CGAGCAGCATGT   MYCATERD1,MYCATRD22,ANAERO2CONSENSUS,AtMYC2
10   CGAGAAGGGC
12   ACTTGGCCACCT   SORLIP1AT,RAV1-B,RAV1BAT
10   ACTTGTACAT
8    CCAmyACC       CANBNNAPA
8    ATCAATGT       TOPOISOM
8    TTTGTGTG
7    GGCCMGC         GCBP2ZMGAPC4,SORLIP2#Hudson,SORLIP2#NA#At1g05360.1#+#15
12   TTACCAGTGCAT    GT1CONSENSUS,RYREPEATLEGUMINBOX,RYREPEATBNNAPA,LFY
8    wTTCCmGC        E2FANTRNR,E2FCONSENSUS,E2F1OSPCNA,E2F,E2FAT,TE2F2NTPCNA
10   AAGTTGTCCA
10   ATTCTCCCGC      E2FAT,-10PEHVPSBD,BS1EGCCR,E2F-varient
12   TTAAGTACACAT    MYCATERD1,DPBF1&2,MYCATRD22,NAPINMOTIFBN,AtMYC2
12   CACAACTCACTA    CAREOSREP1,MRNASTA2CRPSBD
10   CACATTCGAC
10   ATACTGTCAT      BIHD1OS
8    CCAAAmCA        MYB1AT
12   ATCTGGGCCCGC    SORLIP2#Hudson,SORLIP2#NA#At1g05360.1#+#1564211,BS1EGCCR
12   ATTGTGCCAAGT
12   AGATGAGAAAGA    NODCON1GM,POLLEN1LELAT52,OSE1ROOTNODULE
12   AAGGGAAGCGAT    PRECONSCRHSP70A
8    TCTGCTTy
10   AGCCGTTTAC      MYBCOREATCYCB1
8    TCTACCGC
18   CCCCCCCMSCCMSCSSCA
12   AGCTGCAGAGAT
8    CwGCTTTG
14   CCTTCCTCSTCACT INRNTPSADB,ASF1MOTIFCAMV,BOXLCOREDCPAL
12   CCGCAGCAGTAT
10   CCCTACTTGC
10   CCGCAAGTTG
11   AGTTCATCAAC
12   CCATGTTGGACT    TRANSINITDICOTS,TRANSINITMONOCOTS,RAV1-A,RAV1AAT
8    TTrCGGTT
10   GGATAATGGG      GT1CONSENSUS,TATCCAOSAMY,REBETALGLHCB21,SREATMSD,MYBST
10   GGGAGTATTA      CPBCSPOR
10   TTAATTAACT      MYB2AT,POLASIG2
12   AGAAGGTAATTG
                                            MYB-related
Conserved in Populus?   Palindrome motifs   transcription factors
                                            binding sites?
yes
yes
yes
yes
yes
yes
yes                     yes
yes                                         yes
yes
yes                                         yes
                                            yes
                                            yes
yes                                         yes
yes                                         yes
yes                                         yes
yes                                         yes

yes                                         yes
yes

yes                     yes                 yes
yes
yes

                                            yes

yes
yes


yes                     yes

yes                                         yes
yes
yes
yes

yes
yes

yes

yes   yes
yes




yes
yes
yes
yes
yes
yes

yes
yes   yes
yes   yes
yes
yes




yes   yes
yes

yes   yes

      yes
      yes
yes

yes
yes


yes

yes
yes
yes         yes




            yes


yes
yes
yes   yes




yes
yes         yes
yes         yes

            yes

yes




yes

yes
            yes

yes

yes
yes
            yes




yes
yes
yes
yes
yes
            yes
            yes
yes
yes
      yes
yes

yes


yes   yes

yes
yes




yes
      yes
yes   yes




yes   yes
yes   yes
yes

yes




yes




yes
yes
yes
yes
yes
yes

yes




yes

yes   yes

yes

yes
yes
yes




yes
yes   yes
yes
yes
yes

yes


yes
yes

yes


yes
yes   yes

yes   yes
yes

yes
yes


yes   yes
yes
yes
yes

yes

yes
yes   yes
yes   yes

yes
yes
yes   yes




yes

yes


yes
      yes




      yes
      yes
yes




yes




            yes




yes




            yes


            yes
yes

      yes




yes         yes




            yes
yes
yes   yes

yes


yes

yes         yes




yes         yes




            yes
yes

yes

            yes




yes   yes
yes
yes

            yes

            yes


yes

yes
yes
yes

            yes




            yes

yes

yes


yes




yes         yes




yes
yes   yes




            yes


yes
yes
yes




yes
            yes




yes




yes


yes   yes
            yes




            yes




yes
yes         yes




yes




yes
            yes


yes




yes   yes




      yes




            yes


yes




yes
yes         yes

            yes




            yes




yes
yes
yes

yes         yes
            yes




yes


yes
            yes
yes


      yes




yes

yes
yes         yes

yes
yes




yes
yes
yes         yes
yes   yes




yes   yes

yes
yes
yes
      yes

yes   yes
yes

yes




yes   yes

yes   yes
yes

yes


      yes


yes


yes

yes
yes

yes   yes

yes
yes


yes
yes
yes


yes
      yes


yes




yes         yes

yes
yes




yes




yes
      yes
yes

yes




yes
yes         yes

            yes

yes         yes
      yes


      yes




      yes
yes
yes
yes




yes




yes




yes

yes

yes


yes   yes




yes
yes
yes




yes




      yes


yes




yes

      yes

yes

      yes

yes


yes


yes


yes

yes
yes   yes
yes
yes

      yes

      yes




yes

      yes


yes




yes

yes   yes
yes
yes
      yes
yes


yes
yes

yes

yes
yes
      yes
            yes
yes
yes         yes
yes
yes

yes




yes


yes




yes
      yes
            yes
yes

yes
yes         yes
yes

yes         yes




yes
yes
yes
            yes
yes
yes         yes
yes
            yes

yes

yes

yes         yes
yes
yes

yes         yes
            yes




            yes
yes

yes         yes
yes
yes
yes

yes


yes

            yes


yes

      yes


yes
yes   yes
yes   yes
yes




      yes

yes




yes
yes




yes

yes
yes




yes


      yes
yes


yes   yes




yes




      yes




yes
yes
yes         yes
yes         yes




            yes

            yes




            yes
yes
yes   yes


yes         yes
yes
            yes
            yes




yes
            yes
yes         yes
            yes
yes
            yes




yes         yes
yes         yes
yes




yes


yes




yes

yes
yes

      yes
      yes

yes




yes   yes


yes


yes




      yes

      yes

yes
yes




yes   yes
      yes

      yes


yes




yes
yes

yes   yes
yes
yes


yes

yes




      yes




yes
yes
      yes
yes
      yes

      yes


yes




yes




yes




yes

yes

      yes




yes




yes

yes




yes   yes
yes
      yes
yes




yes
yes         yes

yes   yes




yes




yes
            yes




            yes


yes   yes

            yes
      yes




yes




yes




      yes
yes
      yes

yes

yes

yes




      yes
      yes

yes




yes   yes
yes
      yes

      yes
yes




      yes




yes   yes




yes


      yes




      yes

      yes




yes
yes
yes
yes

yes


      yes




yes   yes




      yes
yes
yes


      yes




yes


      yes

      yes
Lignin biosynthesis related
transcription factors binding
sites?




yes

yes


yes
yes




yes
yes
yes
yes
yes




yes
yes




yes
yes

yes
yes
yes
yes




yes
yes
yes
yes
yes




yes
Motifs found in promoters of co-expressed genes

Genes              # of motifs
AT1G01010          12


AT1G01070          13


AT1G01110          8
AT1G01140          4
AT1G01310          3
AT1G01340          6
AT1G01460          5
AT1G01560          9

AT1G01690          8

AT1G01710          8

AT1G01720          7

AT1G01830          8
AT1G01980          4
AT1G02140          11


AT1G02150          20


AT1G02300          6
AT1G02560          5

AT1G02680          14

AT1G02690          3

AT1G02700          17
AT1G02730(CslD5)   31




AT1G02790          27



AT1G02813          7

AT1G02860          7



AT1G02900          24


AT1G02950          6
AT1G03050          10

AT1G03360          12
AT1G03620          4

AT1G03750          12


AT1G03780          12

AT1G03820          7


AT1G03870(FLA9)    13

AT1G03890          3


AT1G04120          22


AT1G04340          12
AT1G04440          5
AT1G04480             10

AT1G04540             8



                     26
AT1G04680(pectate lyase family protein)


AT1G04760             1
AT1G04880             10

AT1G04900             8


AT1G04920             12


AT1G04960             10

AT1G05070             7

AT1G05190             11

AT1G05210             9




                   70
AT1G05260(PER3=Rcl3)




AT1G05360             17

AT1G05385             5
AT1G05630             4
AT1G05710             5
AT1G05760             4
AT1G05810   23


AT1G05910   6
AT1G05920   10


AT1G05950   15

AT1G06010   4
AT1G06450   7


AT1G06520   12

AT1G06640   6
AT1G06820   4

AT1G06930   13

AT1G07280   3
AT1G07370   4
AT1G07410   11


AT1G07610   18


AT1G07650   5




AT1G08320   40




AT1G08350   5
AT1G08360   11

AT1G08380   12
AT1G08500          32




AT1G08510          7

AT1G08590          6
AT1G08640          6
AT1G08660          5
AT1G08830          12
AT1G09160          5

AT1G09250          13



AT1G09340          23


AT1G09415          8

AT1G09460          12



AT1G09510          28



AT1G09760          8

AT1G09790(COBL6)   7


AT1G09840          22
AT1G09970            37




AT1G10120            6

AT1G10360            12

AT1G10480            5
AT1G10522            10


AT1G10640            16


AT1G10770            14


AT1G11000            12
AT1G11280            5
AT1G11410            11

AT1G11430            8

                    9
AT1G11580(pectin methylesterase, putative)


AT1G11670            22


AT1G11770            5

AT1G11860            18


AT1G12000            8
AT1G12040            6
AT1G12070            1
AT1G12110            12
AT1G12140            3
AT1G12310         8

AT1G12370         12

AT1G12410         7

AT1G12430         7




AT1G12560(EXP7)   46




AT1G12780(UGE1)   25




AT1G12800         13


AT1G12880         8

AT1G13020         6


AT1G13080         18


AT1G13090         6
AT1G13140         11
AT1G13195         5


AT1G13200         30
AT1G13250(GATL3)   24



AT1G13270          8

AT1G13280          7
AT1G13320          3
AT1G13580          7
AT1G13690          5
AT1G13740          6
AT1G13890          5


AT1G13970          20



AT1G14030          15

AT1G14080(FUT6)    5
AT1G14130          10


AT1G14150          13


AT1G14210          12

AT1G14290          10

AT1G14330          8

AT1G14345          8
AT1G14370          5

AT1G14380          14

AT1G14400          6
AT1G14410          12
AT1G14420          19


AT1G14560          6

AT1G14720(XTH28)   13

AT1G14780          5
AT1G14840          9

AT1G14850          8
AT1G14930          5
AT1G14940          6
AT1G14950          6
AT1G15200          8


AT1G15210          21


AT1G15290          11

AT1G15330          12

AT1G15480          7
AT1G15640          3

AT1G15660          13


AT1G15700          8

AT1G15710          9

AT1G15820          9
AT1G15940          5


AT1G15950(CCR1)    23
AT1G15980   19


AT1G16030   6
AT1G16220   6
AT1G16280   6
AT1G16350   9


AT1G16370   17


AT1G16520   17


AT1G16680   15


AT1G16780   10

AT1G16790   7

AT1G16850   7


AT1G16880   19


AT1G17040   16


AT1G17110   6

AT1G17140   7

AT1G17340   12
AT1G17350   1
AT1G17370   6
AT1G17380   8

AT1G17500   11
AT1G17560         29



AT1G17620         8

AT1G17650         7

AT1G17680         11


AT1G17745         14


AT1G17760         6

AT1G17810         9

AT1G17890(GER2)   7

AT1G18050         9

AT1G18180         7
AT1G18210         5
AT1G18250         7

AT1G18270         12


AT1G18280         17


AT1G18370         8
AT1G18570         5
AT1G18590         4
AT1G18640         8

AT1G18650         11

AT1G18730         10


AT1G18910         13
AT1G19050          30




AT1G19110          15




AT1G19150          28




                  25
AT1G19300(GATL1=Parvus)


AT1G19380          6
AT1G19500          12
AT1G19540          3
AT1G19580          6
AT1G19780          3
AT1G19850          9

                   7
AT1G19940(unknown protein)
AT1G20010          5
AT1G20050          9
AT1G20160          4

AT1G20190(EXP11)   13


AT1G20440          8
AT1G20450          2
AT1G20580          8

AT1G20650          6

AT1G20850          12
AT1G20900   11
AT1G20960   4
AT1G21065   12




AT1G21090   37




AT1G21380   8


AT1G21480   12


AT1G21860   10



AT1G21880   27



AT1G21980   11

AT1G22040   7

AT1G22050   7

AT1G22160   9

AT1G22330   10
AT1G22440   3

AT1G22450   12

AT1G22460   4

AT1G22480   16

AT1G22600   5
AT1G22630   3
AT1G22670          7

AT1G22760          7




AT1G22780          35




AT1G23030          10

AT1G23050          7
AT1G23060          6

AT1G23090          13


AT1G23100          8


AT1G23140          23



AT1G23205          13


AT1G23350          7



AT1G23410          27




AT1G23480(CslA3)   31




AT1G23550          10

AT1G23750          8
AT1G23790          7

AT1G23800          7
AT1G23820          5
AT1G23850          6
AT1G23890          8

AT1G24090          10


AT1G24170(GATL8)   18


AT1G24360          16



AT1G24400          18


AT1G24430          5
AT1G24440          3

AT1G24520(BCP1)    16


                 17
AT1G24735(CCoAOMT2)


AT1G25240          9




AT1G25260          34




AT1G25350          11


AT1G25380          16


AT1G25490          7

AT1G25550          8
AT1G26100          5
AT1G26230          10
AT1G26440          5
AT1G26450          5
AT1G26480          12
AT1G26770(EXP10)   5
AT1G26820          5

AT1G27120          14


AT1G27300          9

AT1G27385          11




AT1G27400          34




AT1G27690          8

AT1G27930          8

AT1G27970          7
AT1G27990          4
AT1G28080          6
AT1G28090          5

AT1G28160          18


AT1G28270          18




AT1G28290          35
AT1G28400   14

AT1G28520   4
AT1G28530   6
AT1G28580   2
AT1G28630   6
AT1G29050   5


AT1G29140   28


AT1G29150   5
AT1G29250   4


AT1G29280   21




AT1G29330   20


AT1G29395   12

AT1G29670   11
AT1G29680   6
AT1G29970   3

AT1G29980   18

AT1G30110   6
AT1G30360   6
AT1G30440   12

AT1G30460   7

AT1G30500   7
AT1G30510   3
AT1G30750   27


AT1G30760   4
AT1G30825   6
AT1G30840   7



AT1G30870   24


AT1G31120   3
AT1G31330   9


AT1G31335   16


AT1G31550   16




AT1G31580   25



AT1G31750   10
AT1G31830   5
AT1G31970   5


AT1G32060   25


AT1G32070   11
AT1G32080   6

AT1G32100   17


AT1G32120   17
AT1G32340          4
AT1G32530          4
AT1G32930          7
                   5
AT1G33030(COMT-like5)
AT1G33110          9
AT1G33410          1
AT1G33430          7

AT1G33590          12
AT1G33700          3

AT1G33810          13


AT1G34065          11

AT1G34350          8
AT1G34370          6
AT1G34640          8
AT1G34750          5
AT1G34770          7
AT1G35140          6




AT1G35190          38




AT1G35340          7

AT1G35490          8
AT1G35580          4

AT1G35680          18


AT1G35780          11
AT1G35880          5
AT1G36095         10


AT1G36320         15

AT1G43560         3
AT1G43580         7
AT1G43640         6
AT1G43790         12

AT1G44090         10


AT1G44110         17




AT1G44170         37




AT1G44575         6
AT1G44750         10


AT1G44800         19


AT1G45130(AtBGAL5) 9

AT1G47210         11

AT1G47270         9

AT1G47280         9



AT1G47370         24
AT1G47410           34




AT1G47740           21


AT1G47940           5
AT1G47980           12

AT1G47990           8

AT1G48050           10


AT1G48100           15


AT1G48230           17


AT1G48240           16

AT1G48450           6
AT1G48650           5



                     33
AT1G48930(putative glucanase)




AT1G49240           44




AT1G49290           7
AT1G49300           4
AT1G49390         4
AT1G49400         10
AT1G49490         3


AT1G49580         29


AT1G49660         5
AT1G49670         12
AT1G49730         5

AT1G49750         15


AT1G49820         11

AT1G49970         9


AT1G50010         18


AT1G50110         10

AT1G50320         8

AT1G50520         11

AT1G50570         7

AT1G50630         8

AT1G50840         9
AT1G51060         5
AT1G51260         2

AT1G51570         18



AT1G51680(4CL1)   20


AT1G51690         3
AT1G51940   10
AT1G52080   6
AT1G52220   7
AT1G52230   5
AT1G52320   5
AT1G52580   12
AT1G52590   6
AT1G52810   12
AT1G52880   4



AT1G52910   35




AT1G53000   11

AT1G53520   8

AT1G53570   12

AT1G53730   10

AT1G53760   6

AT1G53800   11

AT1G54070   9
AT1G54100   3
AT1G54220   1
AT1G54280   7


AT1G54320   15


AT1G54370   13


AT1G54490   10
AT1G54610   12

AT1G54740   6
AT1G54780   4


AT1G54830   25




AT1G54860   13

AT1G55020   5

AT1G55120   13

AT1G55130   5
AT1G55190   5



AT1G55260   36




AT1G55265   8

AT1G55490   6

AT1G55530   8


AT1G55560   18



AT1G55570   19


AT1G55580   8
AT1G55740   3
AT1G55805   7
AT1G55850(CslE1)   18


AT1G55900          12

AT1G56110          9
AT1G56310          5
AT1G56320          9

AT1G56340          7
AT1G56580          4
AT1G56700          10

AT1G58180          8

AT1G58190          10

AT1G58200          7

AT1G58470          6

AT1G59850          7


AT1G59870          17



AT1G59890          19


AT1G59960          6
AT1G60660          5

AT1G60810          14

AT1G60940          2
AT1G61010          8
AT1G61065          3
AT1G61370          6
AT1G61667           23


AT1G61870           3
AT1G61990           4
AT1G62050           8


AT1G62180           15


AT1G62410           12


AT1G62480           14




AT1G62790           31




AT1G62840           31




AT1G62940(4CL-like5) 9
AT1G62960           5
AT1G62990           6

AT1G63050           8

AT1G63060           8

AT1G63110           10

AT1G63120           11


AT1G63180(UGE3)     14

AT1G63290           6
AT1G63310            6

AT1G63770            10


AT1G64185            17


AT1G64200            17

AT1G64300            6
AT1G64450            6
AT1G64550            10

AT1G64570            7


AT1G64640            17



AT1G64650            19


AT1G64660            7

AT1G64670            11

AT1G64810            7
AT1G65060(4CL3)      5
AT1G65230            11
AT1G65240            5
AT1G65310(XTH17)     3
AT1G65380(CLV2)      7

                    8
AT1G65610(hypothetical protein)

AT1G65700            11
AT1G65840            5
AT1G66150            8

AT1G66180            8
AT1G66210        2


AT1G66250        23


AT1G66430        9

AT1G66620        11

AT1G66670        7

AT1G66980        12

AT1G67060        8

AT1G67230        7

AT1G67280        9


AT1G67290        13


AT1G67330        12

AT1G67470        7
AT1G67500        6
AT1G67590        5
AT1G67690        10




AT1G67730        31




AT1G67910        7
AT1G67920        6
                 9
AT1G67990(CCoAOMT5)


AT1G68080        13

AT1G68110        4
AT1G68140         16


AT1G68220         6

AT1G68260         9

AT1G68360         7
AT1G68520         4
AT1G68590         11

AT1G68600         7


AT1G68840         17


AT1G69295         11
AT1G69390         5
AT1G69430         5
AT1G69530(EXP1)   7


AT1G69580         14


AT1G69700         12

AT1G69740         10

AT1G69790         7

AT1G69850         7

AT1G70040         10
AT1G70140         6
AT1G70190         4
AT1G70540         11


AT1G70660         15
AT1G70710(CEL1)    41




AT1G70770          5

AT1G70790          17


AT1G70820          11

AT1G70830          8

AT1G70990          6


AT1G71040          24


AT1G71200          6

AT1G71480          12

AT1G71695(PER12)   9

AT1G71720          6


AT1G71770          13


AT1G71780          7

AT1G71790          10



AT1G71960          29



AT1G71970          7

AT1G72175          9
AT1G72190         17




AT1G72230         46




AT1G72300         16


AT1G72460         9


AT1G72550         23



AT1G72680(CAD9)   17


AT1G72700         7


AT1G72730         21


AT1G72810         5
AT1G72940         5


AT1G72990(AtBGAL17)23


AT1G73177         7


AT1G73220         15

AT1G73340         5
AT1G73540         1
AT1G73590         6
AT1G73640         5
AT1G73940            28


AT1G74010            4
AT1G74030            10

AT1G74090            10

AT1G74260            10

AT1G74370            7

AT1G74470            9
AT1G74520            5
AT1G74530            8
AT1G74660            5
AT1G74690            8


AT1G74730            19


AT1G74970            7


AT1G75240            17


AT1G75280            9
AT1G75500            4

                    16
AT1G75680(endo-beta-1,4-glucanase, putative)



AT1G75690            21



AT1G75780            16

AT1G75820            2
AT1G75870         11

AT1G75930         10

AT1G76020         7
AT1G76080         4


AT1G76260         27


AT1G76270         6

AT1G76360         17

AT1G76370         3

AT1G76450         13




AT1G76540         37




AT1G76550         17


AT1G76560         14




AT1G76760         31




                   20
AT1G76790(COMT-like8)


AT1G76890         9
AT1G77120   6


AT1G77130   20


AT1G77220   8

AT1G77260   11


AT1G77330   16


AT1G77580   18




AT1G77630   35




AT1G77690   15


AT1G77750   9

AT1G77860   7
AT1G77950   5
AT1G77980   5


AT1G78090   19


AT1G78140   9

AT1G78170   7
AT1G78210   5
AT1G78310   8

AT1G78460   10
AT1G78490         13

AT1G78550         3
AT1G78570(RHM1)   8

AT1G78600         8


AT1G78670         15


AT1G78995         14

AT1G79080         5


AT1G79340         20



AT1G79350         15


AT1G79500         8

AT1G79730         8
AT1G79820         4
AT1G79950         8


AT1G80070         13


AT1G80090         7


AT1G80140         17


AT1G80170         7

AT1G80240         9


AT1G80280         20
AT1G80570          7

AT1G80690          6

AT1G80770          10

AT1G80820(CCR2)    7

AT2G01120          8

AT2G01260          10

AT2G01490          8
AT2G01540          4
AT2G01600          8

AT2G01670          7




AT2G01720          35




AT2G01850(XTH27)   8


AT2G01890          15


AT2G02070          12


AT2G02120          12


AT2G02140          13


AT2G02160          9
AT2G02680          2


AT2G02720          22
AT2G02760          6
AT2G02780          11

AT2G02850          9

AT2G02870          7
AT2G03070          2

AT2G03090(EXP15)   13


AT2G03200          17


                 9
AT2G03220(FUT1=MUR2)
AT2G03270          5


AT2G03310          20


AT2G03350          7

AT2G03510          7
AT2G03710          6
AT2G04030          11

AT2G04540          9


AT2G04700          22




AT2G04780(FLA7)    54




AT2G04845          4
AT2G04850         17

AT2G04890         4
AT2G05380         3
AT2G05540         4
AT2G05580         5
AT2G05630         6



AT2G05790         35



AT2G05850         2

AT2G05920         15


AT2G06520         7


AT2G06850(XTH4)   16


AT2G06925         8

AT2G06990         10
AT2G07040         3
AT2G07180         9
AT2G07200         5

AT2G07560         15


AT2G10340         18

AT2G10940         2
AT2G10970         9


AT2G11010         12


AT2G11890         7
AT2G13290         8
AT2G13350         2
AT2G13570         4
AT2G13650         8

AT2G13690         9
AT2G14880         5




AT2G14890(AGP9)   58




AT2G14900         7

AT2G15000         8


AT2G15090         16


AT2G15570         7


AT2G15890         17

AT2G15960         5
AT2G16595         5
AT2G16700         9




AT2G16730(AtBGAL13)32




AT2G16740         9

AT2G16780         10
AT2G16790   6

AT2G17130   8

AT2G17270   6
AT2G17300   5


AT2G17370   27


AT2G17500   5
AT2G17560   5




AT2G17720   61




AT2G17930   8
AT2G17972   5
AT2G18220   5
AT2G18290   11



AT2G18360   26




AT2G18470   16


AT2G18690   11

AT2G18980   8
AT2G19000   16


AT2G19170   12


AT2G19330   12

AT2G19385   3
AT2G19570   5

AT2G19580   15

AT2G19650   3
AT2G19660   11

AT2G19750   7



AT2G19770   24



AT2G19780   10


AT2G19900   16

AT2G20240   6
AT2G20260   11
AT2G20310   6

AT2G20420   14


AT2G20470   11
AT2G20500   5
AT2G20630   12


AT2G20700   23
AT2G20800          7
AT2G20830          4
AT2G20850          6

AT2G20875          12


AT2G20890          9


AT2G21045          15


AT2G21290          8

AT2G21440          7
AT2G21510          6
AT2G21540          2
AT2G21590          7

AT2G21620          12

AT2G21770(CesA9)   8

AT2G21860          9

AT2G22170          9


AT2G22180          16

AT2G22425          4
AT2G22450          3




AT2G22470(AGP2)    71
AT2G22560   12


AT2G22880   9


AT2G22900   13

AT2G23110   5
AT2G23360   10

AT2G23540   10


AT2G23560   14

AT2G23780   5
AT2G23840   5


AT2G23900   24



AT2G23930   12


AT2G23990   7



AT2G24020   26


AT2G24120   3

AT2G24170   12


AT2G24230   10


AT2G24260   15


AT2G24270   9

AT2G24280   10
AT2G24370         7



AT2G24450(FLA3)   28


AT2G24765         2
AT2G24810         10

AT2G24840         11



AT2G25060         27



AT2G25080         9

AT2G25450         11

AT2G25490         10


AT2G25510         20


AT2G25810         11

AT2G25830         8

AT2G25920         7

AT2G26080         11



AT2G26340         29


AT2G26410         5
AT2G26430         7
AT2G26450   15

AT2G26460   6
AT2G26490   3
AT2G26500   6
AT2G26650   5
AT2G26690   4



AT2G26730   31




AT2G26760   23


AT2G26910   11



AT2G27040   26



AT2G27130   9

AT2G27140   7
AT2G27180   6
AT2G27290   5
AT2G27690   5


AT2G27720   24


AT2G27810   6

AT2G27830   13


AT2G27840   8

AT2G27980   7
AT2G28110(FRA8)   17


AT2G28190         18


AT2G28240         7

AT2G28290         8
AT2G28330         4
AT2G28390         9

AT2G28410         7
AT2G28570         4
AT2G28630         7

AT2G28670         11

AT2G28740         7




AT2G28760(SUD3)   42




AT2G28790         24


AT2G28800         9

AT2G28900         12
AT2G28930         5
AT2G28950(EXP6)   81




AT2G29040(AtGT11) 4
AT2G29080         6
AT2G29130(LAC2)   6
AT2G29180         10
AT2G29410         1
AT2G29450         7
AT2G29460         5
AT2G29550         2

AT2G29940         14


AT2G30200         10




AT2G30210(LAC3)   72




AT2G30290         6
AT2G30470         7
AT2G30490(C4H)   9

AT2G30695        6

AT2G30920        9

AT2G31040        8

AT2G31070        9


AT2G31090        13


AT2G31110        8


AT2G31350        13


AT2G31390        8


AT2G31500        21


AT2G31680        8
AT2G31725        1
AT2G31750        8
AT2G31800        5
AT2G31880        9

AT2G31955        11
AT2G32060        6
AT2G32090        8

AT2G32160        9
AT2G32240        5
AT2G32280        11
AT2G32300(UCC1)    28



AT2G32430          8

AT2G32590          10

AT2G32610(CslB3)   8

AT2G32690          11


AT2G32700          14


AT2G32720          12

AT2G32800          9

AT2G32850          8




AT2G32990          37




AT2G33040          8

AT2G33070          7

AT2G33100(CslD1)   11
AT2G33210          2
AT2G33270          7
AT2G33310          6
AT2G33380          5

AT2G33450          18


AT2G33520          7
AT2G33590(CCR-like3)9
AT2G33630          6
AT2G33990          8
AT2G34020          4
AT2G34090          6
AT2G34150          7
AT2G34360          6

AT2G34500          18

AT2G35010          6

AT2G35020          16

AT2G35170          5
AT2G35190          10
AT2G35210          3
AT2G35310          8




AT2G35610          32




AT2G35860          28



AT2G35960          6

AT2G36020          9
AT2G36070          6


AT2G36100          27


AT2G36190          6
AT2G36200          8

AT2G36220          11


AT2G36250          13


AT2G36310          10

AT2G36350          9

AT2G36380          9


AT2G36400          21


AT2G36720          5
AT2G36835          8

AT2G36870(XTH32)   7

AT2G37040(PAL1)    12




AT2G37090          34




AT2G37130(PER21)   44




AT2G37220          10

AT2G37300          8
AT2G37500          3
AT2G37510          10
AT2G37630          8

AT2G37640(EXP3)    8

AT2G37710          9

AT2G37750          8
AT2G37760          4
AT2G38000          6
AT2G38040          6


AT2G38080(LAC4)    28



AT2G38090          12

AT2G38120          6


AT2G38140          14

AT2G38465          5
AT2G38470          7


AT2G38480          17

AT2G38530          6
AT2G38540          4
AT2G38650(GAUT7)   5
AT2G38700          5

AT2G38750          15


AT2G38880          10
AT2G38905          5
AT2G39010          6


AT2G39040          22
AT2G39130         11

AT2G39180         9

AT2G39300         10


AT2G39350         17

AT2G39420         6
AT2G39430         11


AT2G39450         12


AT2G39470         7


AT2G39700(EXP4)   13

AT2G39730         4
AT2G39750         8
AT2G39795         6


AT2G39900         18


AT2G39940         7

AT2G40010         12

AT2G40020         11
AT2G40430         3
AT2G40690         7
AT2G40820         4

AT2G40840         13


AT2G40890(C3H1)   11
AT2G40930   13

AT2G41100   6


AT2G41110   26



AT2G41200   10
AT2G41310   5


AT2G41540   22


AT2G41550   6

AT2G41680   9

AT2G41720   6


AT2G41740   13


AT2G41790   10


AT2G41950   15


AT2G41970   12


AT2G41990   10
AT2G42210   6


AT2G42220   20


AT2G42430   7


AT2G42530   13
AT2G42570           32




AT2G42680           8

AT2G42690           8

AT2G42840           11




AT2G43040           31




AT2G43080(AtP4H1)   16


AT2G43230           12

AT2G43250           6
AT2G43535           7


AT2G43570           12


AT2G43640           8

AT2G43760           11


AT2G43950           12


AT2G44100           7


AT2G44110           14


AT2G44350           9
AT2G44500           5
AT2G44560         6


AT2G44640         19


AT2G44650         6




AT2G44790(UCC2)   39




AT2G44940         4
AT2G45180         9
AT2G45190         3


AT2G45200         21


AT2G45220         8

AT2G45290         7

AT2G45430         8

AT2G45560         12

AT2G45590         9


AT2G45750         16

AT2G45770         5
AT2G45790         6

AT2G45800         18


AT2G45810         10

AT2G45820         8

AT2G45870         8
AT2G45890         13


AT2G45920         16


AT2G46080         11

AT2G46210         7

AT2G46250         11
AT2G46360         3
AT2G46370         5
AT2G46380         5
AT2G46490         10

AT2G46620         10
AT2G46680         6
AT2G46860         2
AT2G46910         6
AT2G46920         6
AT2G46930         8


AT2G47000         22




AT2G47050         23


AT2G47180(AtGolS1) 12

AT2G47500         9

AT2G47550         9

AT2G47620         8

AT2G47640         9

AT2G47730         6
AT2G47840          8

AT2G47900          7


AT2G47980          12


AT2G47990          8

AT2G48070          10
AT2G48080          6



AT2G48130          37




AT2G48140          11

AT3G01180          10



AT3G01190(PER27)   26



AT3G01250          9


AT3G01270          17


AT3G01460          11


AT3G01470          22


AT3G01480          11

AT3G01660          8
AT3G01680          4
AT3G01700(AGP11)    32



AT3G01730           6


AT3G01780           24


AT3G01790           6

AT3G01920           13

AT3G02120           2

                   14
AT3G02210(COBRA cell expansion protein COBL3)


AT3G02220           8

AT3G02260           7

AT3G02350(GAUT9)    7


AT3G02580           16


AT3G02600           7


AT3G02640           14

AT3G02660           6
AT3G02730           6
AT3G02770           6
AT3G02790           6

AT3G02880           11

AT3G03020           9
AT3G03160           5
AT3G03220(EXP13)   41




AT3G03310          30



AT3G03330          8
AT3G03420          5
AT3G03430          8

AT3G03800          7

AT3G03980          6

AT3G04010          10

AT3G04340          12

AT3G04350          7
AT3G04360          4
AT3G04480          2
AT3G04550          7

AT3G04570          8


AT3G04700          18


AT3G04730          9
AT3G05050          5
AT3G05060          3
AT3G05180          4
AT3G05200          4
AT3G05260          10
AT3G05350          5
AT3G05490          58




AT3G05500          10


AT3G05610          24



AT3G05750          16


AT3G05810          8



AT3G05890          25




AT3G05930          20


AT3G05990          5
AT3G06040          1
AT3G06060          10

AT3G06140          7


AT3G06150          13

AT3G06240          5

AT3G06260(GATL4)   12
AT3G06300(AtP4H2)   78




AT3G06380           6

AT3G06400           14


AT3G06420           8
AT3G06510           6

AT3G06530           12


AT3G06770           11


AT3G06840           17


AT3G07010           16

AT3G07020           5


AT3G07110           27


AT3G07170           5

AT3G07320           14


AT3G07390(AIR12)    8
AT3G07410   23


AT3G07510   9


AT3G07540   20




AT3G07590   28




AT3G07760   17


AT3G07770   9

AT3G07820   8

AT3G07830   10


AT3G07900   14


AT3G08490   7

AT3G08630   9

AT3G08680   7

AT3G08770   11
AT3G08990   4

AT3G09530   12

AT3G09670   4
AT3G09900   7

AT3G09920   7
AT3G10080         11

AT3G10150         8

AT3G10160         7
AT3G10190         6
AT3G10260         5


AT3G10340(PAL4)   23


AT3G10350         6

AT3G10520         9


AT3G10570         13



AT3G10660         24


AT3G10670         4


AT3G10710         26




AT3G10720         58




AT3G10730         11


AT3G10740         20
AT3G10960   13


AT3G10970   7

AT3G11050   8
AT3G11210   6


AT3G11340   22


AT3G11420   4
AT3G11430   9


AT3G11520   14

AT3G11630   5
AT3G11690   8
AT3G11830   4


AT3G11964   26



AT3G11980   9

AT3G12090   6

AT3G12160   8


AT3G12490   15

AT3G12530   2
AT3G12570   7


AT3G12780   13

AT3G12955   6
AT3G13070   7
AT3G13140          16


AT3G13230          13

AT3G13280          5

AT3G13320          18


AT3G13360          8


AT3G13390          15


AT3G13400          11
AT3G13520(AGP12)   6


AT3G13560          19




AT3G13570          24


AT3G13610          10


AT3G13650          22



AT3G13674          15


AT3G13750(AtBGAL1) 9

AT3G13772          10
AT3G13845          2
AT3G13870          7
AT3G14070           40




AT3G14110           27



AT3G14270           6
AT3G14280           6
AT3G14570(AtGSL4)   6

AT3G14595           15


AT3G14610           11

AT3G14840           9

AT3G14940           9

AT3G15020           11

AT3G15080           10
AT3G15095           6

AT3G15190           18


AT3G15210           7
AT3G15280           5


AT3G15357           29



AT3G15520           10

AT3G15580           11
AT3G15590          5
AT3G15720          9
AT3G15770          4
AT3G15790          7


AT3G15840          14


AT3G15880          13


AT3G15970          11


AT3G16040          14


AT3G16060          13



AT3G16190          23


AT3G16240          12

AT3G16260          8


AT3G16470          22


AT3G16630          6
AT3G16690          4
AT3G16750          4
AT3G16770          9


AT3G16780          13


AT3G16860(COBL8)   15
AT3G16920   28




AT3G17060   24



AT3G17390   11


AT3G17420   20


AT3G17450   3

AT3G17470   18


AT3G17680   8


AT3G17810   16


AT3G17840   7

AT3G17940   10


AT3G17980   22


AT3G18035   9

AT3G18040   7




AT3G18050   33




AT3G18190   10
AT3G18210         5
AT3G18220         6
AT3G18500         5
AT3G18690         6

AT3G18710         14



AT3G18750         21



AT3G18800         14




AT3G18860         30


AT3G18900         6
AT3G18940         5
AT3G19020         8

AT3G19310         7

AT3G19400         8




AT3G19450(CAD2)   32




AT3G19460         11

AT3G19590         11

AT3G19660         11

AT3G19710         8

AT3G19990         7
AT3G20010         5
AT3G20080         4
AT3G20120            17


AT3G20190            18


AT3G20220            18


AT3G20230            7

AT3G20250            8


AT3G20260            19

AT3G20330            3

AT3G20370            12


AT3G20390            18



AT3G20410            22


AT3G20460            7

AT3G20510            12

AT3G20530            10



AT3G20570            27




                    16
AT3G20580(phytochelatin synthetase-related)

AT3G20830            4

AT3G20865(AGP)       16
AT3G21055          7

AT3G21060          12


AT3G21190          17


AT3G21230(4CL4)    18


AT3G21240(4CL2)    7
AT3G21370          3
AT3G21380          3
AT3G21510          11

AT3G21570          10

AT3G21700          9


AT3G21710          17

AT3G21760          6




AT3G21770(PER30)   37




AT3G22190          11

AT3G22260          6

AT3G22320          10
AT3G22425          2
AT3G22520          8
AT3G22600          62




AT3G22620          23


AT3G22650          4
AT3G22760          7

AT3G22990          7

AT3G23000          11


AT3G23050          12


AT3G23090          11

AT3G23160          8

AT3G23190          7

AT3G23200          8
AT3G23310          4

AT3G23340          13


AT3G23430          7
AT3G23590          5
AT3G23610          4
AT3G23690          7

AT3G23730(XTH16)   8
AT3G23760   10
AT3G23830   5
AT3G24160   9

AT3G24240   9



AT3G24450   29



AT3G24503   10

AT3G24590   7


AT3G24670   18

AT3G25110   2

AT3G25165   12


AT3G25170   17


AT3G25540   9


AT3G25585   23


AT3G25620   5
AT3G25690   12
AT3G25805   4
AT3G25870   6
AT3G25890   7

AT3G25900   11
AT3G25930   30




AT3G25980   14

AT3G26060   5

AT3G26110   14

AT3G26330   5
AT3G26560   7


AT3G26570   18


AT3G26744   15

AT3G26760   2
AT3G26770   7

AT3G26860   9

AT3G27060   7

AT3G27100   7

AT3G27170   12


AT3G27190   21




AT3G27200   33




AT3G27520   8
AT3G27690   6
AT3G27890   5
AT3G28040   8
AT3G28200   4
AT3G28280   11


AT3G28450   18


AT3G28720   9

AT3G28730   8


AT3G28750   15




AT3G28790   35




AT3G28830   27



AT3G28860   9


AT3G28940   13

AT3G28980   1


AT3G29090   25



AT3G29170   8

AT3G29185   8
AT3G29230             17


AT3G29250             11


AT3G29290             14

AT3G29575             5
AT3G30300             7
AT3G30775             5
AT3G42640             8
AT3G42960             5
AT3G43120             5
AT3G43500             9

                      7
AT3G43860(cellulase like protein)


AT3G43900             14


AT3G43920             8


AT3G43960             16


AT3G44190             14

AT3G44200             4
AT3G44320             9
AT3G44330             5
AT3G44720             11

AT3G44750             8

AT3G44990(XTH31)      11
AT3G45010             6

AT3G45090             15
AT3G45140          30


AT3G45160          5
AT3G45600          9

AT3G45770          6

AT3G45850          10


AT3G45870          14


AT3G45900          14




AT3G45970(EXPL1)   26


AT3G46230          6
AT3G46570          10

AT3G46750          10

AT3G46780          9
AT3G46800          6



AT3G47250          34



AT3G47390          5
AT3G47440          8

AT3G47800          8

AT3G47860          12
AT3G47950          4
AT3G48185          33




AT3G48420          8


AT3G48440          19


AT3G48490          9

AT3G48530          6
AT3G48580(XTH11)   5
AT3G48830          7


AT3G48930          14


AT3G49000          7


AT3G49100          22


AT3G49160          6
AT3G49220          7

AT3G49430          7

AT3G49670          7

AT3G49710          8

AT3G49900          10



AT3G49960          24
AT3G50070          15


AT3G50620          15


AT3G50760(GATL2)   15

AT3G50780          4

AT3G50820          15


AT3G50830          10

AT3G51030          10
AT3G51050          5
AT3G51120          5
                  10
AT3G51160(GMD2-Mur1)


AT3G51300          20


AT3G51460          10


AT3G51520          18


AT3G51600          10

AT3G51660          10

AT3G51780          7


AT3G51790          14


AT3G51850          11
AT3G51860          4
AT3G51870          11
AT3G51880          6
AT3G51920            7

AT3G51950            8


AT3G52060            15


AT3G52110            15


AT3G52140            9
AT3G52170            3



                     domain-containing protein)
AT3G52370(beta-Ig-H332




AT3G52470            7

AT3G52480            9
AT3G52580            2

AT3G52600            19

AT3G52610            5
AT3G52720            7
AT3G52750            2
AT3G52840(AtBGAL2)   6
AT3G52900            6
AT3G52920            4

AT3G52940            13

AT3G53040            3

AT3G53190            15

AT3G53230            5
AT3G53260(PAL2)   40




AT3G53280         15

AT3G53390         3
AT3G53410         5
AT3G53430         5
AT3G53620         6
AT3G54000         6
AT3G54030         10

AT3G54120         6

AT3G54150         7


AT3G54190         16

AT3G54210         4


AT3G54220         20



AT3G54260         16


AT3G54290         12


AT3G54350         10


AT3G54400         21


AT3G54420         4
AT3G54480         11
AT3G54560         16


AT3G54590         10
AT3G54620         4
AT3G54650         10

AT3G54770         8

AT3G54800         7

AT3G54820         12


AT3G54860         19



AT3G54920(PMR6)   16


AT3G54960         6


AT3G55005         14


AT3G55120         7

AT3G55260         8

AT3G55330         6

AT3G55470         7

AT3G55530         8


AT3G55640         18


AT3G55800         10


AT3G55950         14
AT3G56000(CslA14)   8

AT3G56100           11

AT3G56230           9

AT3G56240           10




AT3G56370           30



AT3G56410           3
AT3G56600           10
AT3G56640           3
AT3G56890           5
AT3G56900           7




AT3G56910           32




AT3G56930           39




AT3G56950           6
AT3G56990           11
AT3G57170           5
AT3G57180           12


AT3G57300           15
AT3G57420          15

AT3G57610          3
AT3G57620          7




AT3G57690(AGP23)   38




AT3G57920          7
AT3G58450          4

AT3G58690          14

AT3G58710          6
AT3G58800          3
AT3G59010          8

AT3G59060          8

AT3G59280          9

AT3G59400          7

AT3G59420          7
AT3G59610          6
AT3G59640          8


AT3G59845          14

AT3G60070          4

AT3G60330          16


AT3G60540          9

AT3G60600          9
AT3G60680          18


AT3G60690          4
AT3G60770          6

AT3G61100          8
AT3G61160          5
AT3G61230          6
AT3G61430          11

AT3G61640(AGP20)   8

AT3G61670          7

AT3G61760          10
AT3G61820          3
AT3G61960          8


AT3G61980          13




AT3G62020          26




AT3G62030          26



AT3G62110          10



AT3G62170          27


AT3G62180