Docstoc

Basic Genetics

Document Sample
Basic Genetics Powered By Docstoc
					Introductory Genetics

http://www.stats.gla.ac.uk/~paulj/intro_genetics.ppt

Overview of talks
• This talk: broad overview of genetics • Future talks: genetic data analysis
– Important general genetic concepts • heritability, penetrance, linkage/linkage disequilibrium, HardyWeinberg equilibrium – Types of genetic analysis • association analysis – family-based vs population-based – candidate gene vs genome scan – genotype v haplotype – problems: population stratification, missing data, data errors, inferring haplotypes • twin studies – “Omics”: genomics, proteomics, metabolomics, genetical genomics, integrative genomics

Overview of this talk
• • • • Why genetics is important How genes work Mendel’s laws of inheritance for simple genetic traits “Post-genomic” genetics

Why genetics is important

Genetics

G×E interaction

Environment

Health

ISI Web of Science topic search for "genetic AND disease"
8000

7000

Number of journal records

6000

5000

4000

3000

2000

1000

0
1991 1992 1993 1994 1995 1996 1997 1998 1999 2000 2001 2002 2003 2004 2005

How genes work

What is a gene?
• A gene is a stretch of DNA whose sequence determines the structure and function of a specific functional molecule (usually a protein)
DNA
…GAATTCTAATCTCCCTCTC AACCCTACAGTCACCCATTT GGTATATTAAAGATGTGTTG TCTACTGTCTAGTATCC…

Computer program

…function sf(){document. f.q.focus()}…

mRNA

Working copy

Protein

Specific function

Genes are located in the cell nucleus on chromosomes

Karyotype

Down syndrome karyotype (trisomy 21)

DNA (deoxyribonucleic acid)

Protein

mRNA

Transcription movie

Translation

Translation

Translation

Translation movie

Gene expression movie

Summary
• A gene is a length of DNA that contains instructions for making a specific protein • Genes are arranged along 23 pairs of chromosomes in the cell nucleus • Genes work by specifying the amino acid sequence of a protein

Mendel’s laws

Genetic knowledge used for 1000s of years: agriculture

Patterns of disease inheritance known for 1000s of years, e.g. haemophilia

Mendel deduced the underlying principles of genetics from these patterns
1. Segregation 2. Dominance 3. Independent assortment

Mendel’s experiments

Mendel’s data

Mendel’s law of segregation
• • • A normal (somatic) cell has two variants (alleles) for a Mendelian trait. A gamete (sperm, egg, pollen, ovule) contains one allele, randomly chosen from the two somatic alleles. E.g. if you have one allele for brown eyes (B) and one for blue eyes (b), somatic cells have Bb and each gamete will carry one of B or b chosen randomly.
Sperm

B
Eggs

b

B BB Bb b Bb bb

Mendel’s law of dominance
• If your two alleles are different (heterozygous, e.g. Bb), the trait associated with only one of these will be visible (dominant) while the other will be hidden (recessive). E.g. B is dominant, b is recessive.

Sperm

B
Eggs

b

B BB Bb b Bb bb

Mendel’s law of dominance
• If your two alleles are different (heterozygous, e.g. Bb), the trait associated with only one of these will be visible (dominant) while the other will be hidden (recessive). E.g. B is dominant, b is recessive.

Sperm

B
Eggs

b

B BB Bb b Bb bb

Terminology…

• Haploid: containing one copy of each chromosome (n=23)

Sperm

B
Eggs

b

• Diploid: containing two copies of each chromosome (2n=46)

B BB Bb b Bb bb

Terminology…
• Genotype: the states of the two alleles at one or more locus associated with a trait • Phenotype: the state of the observable trait

Genotype
BB (homozygous) Bb (heterozygous) bb (homozygous)

Phenotype
Brown eyes Brown eyes Blue eyes

Mendel’s law of independent assortment
• Knowledge of which allele has been inherited at one locus gives no information on the allele has been inherited at the other locus

S/s

Y/y

SY 25%

Sy 25%

sY 25%

sy 25%

Mendel’s law of independent assortment

Gametophytes (gameteproducing cells)

S s

Y y

Segregation S Gametes s A a Y y b Recombinants B

Mendel’s law of independent assortment

Gametophytes (gameteproducing cells)

S s

Y y Recombination Segregation

S Gametes s S s

Y y y Recombinants Y

Statistical aside: Mendel’s data too good to be true?

Human eye colour
• Simplified view of eye colour inheritance: biallelic Mendelian trait
– Brown dominant: – Blue recessive: BB, Bb bb
Sperm

B
Eggs

b

B BB Bb b Bb bb

Human eye colour

?
What is the probability of a child being born with blue eyes?

Human eye colour

?

Human eye colour

B?

B?

B?

bb

bb

B? B?

?

Human eye colour

Bb

Bb

B?

bb

bb

B? Bb

?

Human eye colour

Bb

Bb

B? Bb

?

Human eye colour

Bb

Bb

P(BB)=1/3 P(Bb)=2/3

Bb

?

Human eye colour

Bb

Bb

P(BB)=1/3 P(Bb)=2/3

Bb

P(b)=2/3x1/2=1/3

P(b)=1/2

?

Human eye colour

Bb

Bb

P(BB)=1/3 P(Bb)=2/3

Bb

P(b)=2/3x1/2=1/3

P(b)=1/2

?
P(bb)=1/3x1/2=1/6

Non-Mendelian inheritance: Haemophilia

• Haemophilia A • Males with a mutant gene are affected • Females with one mutant gene are unaffected carriers

Non-Mendelian inheritance: additive traits

Dominant vs additive inheritance
100%

Trait value

50%

Dominant Additive

0% 0 1 Number trait alleles inherited 2

Non-Mendelian inheritance: additive traits Brown eye colour is dominant
Dominant vs additive inheritance
100%

Trait value

50%

Dominant Additive

0% 0 1 Number trait alleles inherited 2

Non-Mendelian inheritance: additive traits Snapdragon red colour is additive
Dominant vs additive inheritance
100%

Trait value

50%

Dominant Additive

0% 0 1 Number trait alleles inherited 2

Non-Mendelian inheritance: polygenic traits
Distribution of trait measures for single gene additive trait

0.6

0.5

0.4

Frequency

0.3

0.2

0.1

0 0 1 Trait value 2

Non-Mendelian inheritance: polygenic traits
Distribution of trait measures for polygenic additive trait (2 loci)

0.4 0.35 0.3

Frequency

0.25 0.2 0.15 0.1 0.05 0 0 1 2 Trait value 3 4

Non-Mendelian inheritance: polygenic traits
Distribution of trait measures for polygenic additive trait (10 loci)

0.2 0.18 0.16 0.14

Frequency

0.12 0.1 0.08 0.06 0.04 0.02 0

10

12

14

16

18

Trait value

20

0

2

4

6

8

Non-Mendelian inheritance: polygenic traits For example, height

Non-Mendelian inheritance: mtDNA

Phenotypes associated with mtDNA mutations
• • • • • • • • Longevity Optic neuritis Occipital stroke in migraine Asthenozoospermia Migraine without aura Cyclic vomiting syndrome Bipolar disorder Athletic performance

Summary
• Mendel deduced three simple laws of inheritance:
– Segregation – Dominance – Random assortment

• The majority of traits don’t follow these rules but Mendel’s laws are nevertheless crucial to understanding almost all genetic inheritance

“Post-genomic” genetics

Human Genome Project
• Sequenced almost all 3 billion DNA base pairs (2003) • Current work includes:
– ENCODE Project (ENCyclopedia Of DNA Elements) to characterise functional elements in genome • 20,000-25,000 genes (1.5% of genome) • The bits in between (98.5% of genome) – Characterise human DNA sequence variation • Find and describe DNA sequence variation (International HapMap Project) • Find significance of sequence variation (e.g. contribution to complex diseases)

HapMap project

Frequency

Case

0.200

Odds ratio: 1.26

Control 0.165

1. Eye-catching headline of the form “Gene for…” 2. Highly qualified factual paragraph

HTR1D

HTR1D

Summary
• Post-genomic genetics has enormous promise for tracking down the genes involved in common complex diseases • Currently our ability to exploit this potential is limited by
– study size – difficulty of correcting for confounding factors


				
DOCUMENT INFO
Shared By:
Categories:
Stats:
views:41
posted:11/6/2009
language:English
pages:62