Your Federal Quarterly Tax Payments are due April 15th Get Help Now >>

Supplementary Table 2 Predicted multiple exon ... - BioMedSearch by ajizai



tary Table 2: Predicted multiple exon skipping events
                 N.A. = not approaved

                      GeneSymbol                               GeneName                         RefSeq       Exon
                         ABCA6        ATP-binding cassette, sub-family A (ABC1), member 6 NM_172346          15-24
                        AHCYL1               S-adenosylhomocysteine hydrolase-like 1          NM_006621      10-13
                         ATP10A                       ATPase, Class V, type 10A               NM_024490       9-11
                         ATP11C                       ATPase, Class VI, type 11C              NM_173694      14-17
                         ATP2A1      ATPase, Ca++ transporting, cardiac muscle, fast twitch 1 NM_173201      10-13
                         ATP2A2      ATPase, Ca++ transporting, cardiac muscle, slow twitch 2NM_170665       11-13
                         ATP2C1           ATPase, Ca++ transporting, type 2C, member 1        NM_014382      14-16
                         ATP8B1                 ATPase, Class I, type 8B, member 1            NM_005603      14-16
                         ATP8B2                 ATPase, Class I, type 8B, member 2            NM_020452      15-17
                         ATP8B3                 ATPase, Class I, type 8B, member 3            NM_138813      15-17
                          ATP9B                        ATPase, Class II, type 9B              NM_198531      15-17
                         C2orf33               chromosome 2 open reading frame 33             NM_020194       7-8
                         CENPE                      centromere protein E, 312kDa              NM_001813      22-26
                         CLCN6                              chloride channel 6                NM_021737       8-9
                        COL19A1                        collagen, type XIX, alpha 1            NM_001858      31-32
                         DCHS2                          dachsous 2 (Drosophila)               NM_017639       6-7
                           ELP4             elongation protein 4 homolog (S. cerevisiae)      NM_019040      10-11
                          FGD3              FYVE, RhoGEF and PH domain containing 3           NM_033086      14-16
                          FMR1                       fragile X mental retardation 1           NM_002024      11-12
                            KL                                     klotho                     NM_153683       2-3
                           LIFR                  leukemia inhibitory factor receptor          NM_002310       4-8
                          MMP2                                                                NM_004530
                      matrix metalloproteinase 2 (gelatinase A, 72kDa gelatinase, 72kDa type IV collagenase)  5-7
                           N.A.                                     N.A.                      NM_133175       7-8
                           N.A.                                     N.A.                      NM_022911      16-17
                           N.A.                                     N.A.                      NM_152449       4-5
                           N.A.                                     N.A.                      NM_002850       5-6
                           N.A.                                     N.A.                      NM_176095       5-6
                           N.A.                                     N.A.                      NM_031913      11-17
                           N.A.                                     N.A.                      NM_033659       5-6
                           N.A.                                     N.A.                      NM_014400       3-4
                           N.A.                                     N.A.                      NM_053029      24-31
                           N.A.                                     N.A.                      NM_152347      10-13
                           N.A.                                     N.A.                      NM_194294       6-9
                           N.A.                                     N.A.                      NM_015605       6-7
                           N.A.                                     N.A.                      NM_176085       3-7
                           N.A.                                     N.A.                      NM_199176       5-6
                           N.A.                                     N.A.                      NM_031363      51-52
                           N.A.                                     N.A.                      NM_030813      13-14
                           N.A.                                     N.A.                      NM_133628       3-4
                           N.A.                                     N.A.                    NM_001002021      2-4
                          NRD1               nardilysin (N-arginine dibasic convertase)       NM_002525       3-4
                           OGT                                                                NM_003605       4-5
   O-linked N-acetylglucosamine (GlcNAc) transferase (UDP-N-acetylglucosamine:polypeptide-N-acetylglucosaminyl transferase)
                          P2RX4         purinergic receptor P2X, ligand-gated ion channel, 4 NM_175568        4-6
                        PHYHD1            phytanoyl-CoA dioxygenase domain containing 1       NM_174933       7-8
                         PLCG1                        phospholipase C, gamma 1                NM_182811      16-22
                          POLL                  polymerase (DNA directed), lambda             NM_013274       3-5
                        POLR2A polymerase (RNA) II (DNA directed) polypeptide A, 220kDa       NM_000937      18-19
                        POLR2A polymerase (RNA) II (DNA directed) polypeptide A, 220kDa       NM_000937      21-22
                         RASAL2                       RAS protein activator like 2            NM_170692       3-4
                         SH3GL3                         SH3-domain GRB2-like 3                NM_003027       2-4
                        SH3GLB2                SH3-domain GRB2-like endophilin B2             NM_020145       6-7
                         SH3YL1         SH3 domain containing, Ysc84-like 1 (S. cerevisiae) NM_015677         5-6
                         SRPK1                           SFRS protein kinase 1                NM_003137       9-11

                                                                Seite 1

      STAB2                                stabilin 2                         NM_017564       61-62
     SUPT3H             suppressor of Ty 3 homolog (S. cerevisiae)            NM_181356        3-4
        TAZ                                                                    Barth syndrome) 3-4
tafazzin (cardiomyopathy, dilated 3A (X-linked), endocardial fibroelastosis 2,NM_181314
      USP31                     ubiquitin specific protease 31                NM_020718        4-10

                                                Seite 2

# skipped
  exons     PfamID                   Pfam description
    10      PF00005   ABC transporter
     4      PF05221   S-adenosyl-L-homocysteine hydrolase
     3      PF00702   haloacid dehalogenase-like hydrolase
     4      PF00702   haloacid dehalogenase-like hydrolase
     4      PF00702   haloacid dehalogenase-like hydrolase
     3      PF00702   haloacid dehalogenase-like hydrolase
     3      PF00702   haloacid dehalogenase-like hydrolase
     3      PF00702   haloacid dehalogenase-like hydrolase
     3      PF00702   haloacid dehalogenase-like hydrolase
     3      PF00702   haloacid dehalogenase-like hydrolase
     3      PF00702   haloacid dehalogenase-like hydrolase
     2      PF05644   Protein of unknown function (DUF800)
     5      PF02344   Myc leucine zipper domain
     2      PF00654   Voltage gated chloride channel
     2      PF01391   Collagen triple helix repeat (20 copies)
     2      PF00028   Cadherin domain
     2      PF05625   PAXNEB protein
     3      PF00169   PH domain
     2      PF00013   KH domain
     2      PF00232   Glycosyl hydrolase family 1
     5      PF00041   Fibronectin type III domain
     3      PF00413   Matrixin
     2      PF00640   Phosphotyrosine interaction domain (PTB/PID)
     2      PF01740   STAS domain
     2      PF01476   LysM domain
     2      PF07679   Immunoglobulin I-set domain
     2      PF05600   Protein of unknown function (DUF773)
     7      PF00168   C2 domain
     2      PF00001   7 transmembrane receptor (rhodopsin family)
     2      PF00021   u-PAR/Ly-6 domain
     8      PF07679   Immunoglobulin I-set domain
     4      PF00036   EF hand
     4      PF01231   Indoleamine 2,3-dioxygenase
     2      PF00102   Protein-tyrosine phosphatase
     5      PF00145   C-5 cytosine-specific DNA methylase
     2      PF01765   Ribosome recycling factor
     2      PF01413   C-terminal tandem repeated domain in type 4 procollagen
     2      PF00168   C2 domain
     2      PF00730   HhH-GPD superfamily base excision DNA repair protein
     3      PF00365   Phosphofructokinase
     2      PF00675   Insulinase (Peptidase family M16)
     2      PF00515   TPR Domain
     3      PF00864   ATP P2X receptor
     2      PF05721   Phytanoyl-CoA dioxygenase (PhyH)
     7      PF00169   PH domain
     3      PF00633   Helix-hairpin-helix motif
     2      PF04998   RNA polymerase Rpb1, domain 5
     2      PF04998   RNA polymerase Rpb1, domain 5
     2      PF00169   PH domain
     3      PF03114   BAR domain
     2      PF03114   BAR domain
     2      PF04366   Family of unknown function (DUF500)
     3      PF00069   Protein kinase domain

                                           Seite 3

2   PF00008   EGF-like domain
2   PF02269   Transcription initiation factor IID, 18kD subunit
2   PF01553   Acyltransferase
7   PF00443   Ubiquitin carboxyl-terminal hydrolase

                                     Seite 4

                EST/cDNA confirmed                                      Exon sequence
                alt. acceptor of exon 15                TGGATGAGGCTGACATCCTGGCTG
                                 confirmed              GTGGCACAGATCAGATTCTGCCCCAAGAAATAAAATTTCAAGGTTCCAGGCACCGA
                        alt. acceptor of exon 10        GGCTCTTCGTGGAGAAGGAAGGCCCCATGATCCACAGTGGTTCGGTGGTGGGAG
                                 confirmed              GACTCTATAGTCCAGAGGTAGAAATTCTGAGTGCTGTCAACTTTTCAGCAGACAAG
                                 confirmed              GCTGGAGTGCAGTGGCACGATCTCGGCTCACGGCAACCTCGCCTCCTGGGTTCAA
                       retained intron in exon 16       ATCACGAGCACCAGCCCTGTGGAGCCTGTGGTGACCACCGAAGGCAGTTCGGGT
                           alt. donor of exon 3         GCTCATGCCAAAGTCTGGCATCTCTACAATACTTCTTTCCGTCCCACTCAGGGAGG
              alt. donor of exon 6 + skipping of exon 7 GCTGTGATCCCCACTGATGCTGATCCCCAGTACTTGAACCCCTGGACACAGATCC
alt. donor of exon 16, skipping of exon 17, alt. acceptor of exon 18
                                 confirmed              CACATTTTATTTTAGACCTAATGGGGCTGGAGATACCAGGCAGAATTTAATTCCGG
                                 confirmed              AAACCTTTG
                    retained intron in exon 5 and 6     GATTGGCAGGAGATTATAGCTCTGTATGAGAAGGACAACACCTACTTAGGTAAAGT
                          alt. donor of exon 14         CCTGCAGATCTGCCTTGGAGATGTCATGACCAACAGAGTGGTGGATGAG
                         alt. acceptor of exon 6        GGGACCCCACTGTCTGCTCCATCTCCAACCCTGATTTTGTCATCTACTCTTCAGTG
                        alt. acceptor of exon 27        ATAAGCCAGACCCCCCAGCTGGCACACCTTGTGCCTCTGACATTCGGAGCTCCTC
                                 confirmed              ATACGCGCAAAATTGTTTCTGAAGGAGAACTAGATCAGTTGGCTCAGATTCGGCCA
                                 confirmed              ACTATGAAGCAAATAAAACAATACTTTAATGGGCCAAATGTGGCCTGAGGGCCACC
                                 confirmed              GCCCTGGTTGCCCTGAGGCGGGTGCTGCTGGCTCAGTTCTCGGCTTTCCCCGTGA
                                 confirmed              GTCCCCTGACAAGCCCACCAGGCCCCCTGCTGAGATGGCTGTGACCCTGGGCTG
                                 confirmed              CAATTGCAGAGCCTGTTTTTGCTGTGGTCAAAGCTGACTGATAGACTGTGGTTTAA
                        retained intron in exon 4       GATTTGTACTGTGTTCGCAGTGACCTGGGGAACCTGCTCAAAGCCCTGGGTCGCT
                   inclusion of a downstream exon       CTCTGCACGCCCACGACCCCGTCTTCAAGAGCATCACACACTCCTTCAAGGTGCA
                                 confirmed              AGTGGCTGAGCTCCCTTCGGGCCCATGTTGTGCGCACTGGCATTGGACGAGCCCG
                                 confirmed              TAGAGATGGGTTTCACCATGTTGGCCAATATGGTCTCGATCTCCTGACCTCGTGAT

                                                 Seite 5


                            Seite 6

               Exon sequence

                                Seite 7


                                Seite 8

                               Exon sequence



                                                Seite 9


                                              Seite 10

                               Exon sequence








                                              Seite 11


                                               Seite 12

                                Exon sequence










                                              Seite 13



                                             Seite 14

                               Exon sequence















                                               Seite 15



                                            Seite 16

                                Exon sequence












                                              Seite 17


                               Seite 18

                                Exon sequence











                                              Seite 19


                                             Seite 20

                               Exon sequence









                                               Seite 21

Seite 22

                                    Exon sequence








                                              Seite 23

Seite 24






                                              Seite 25

Seite 26





                                               Seite 27

Seite 28




                                            Seite 29

Seite 30




                                              Seite 31

Seite 32



                                              Seite 33

Seite 34



                                               Seite 35

Seite 36



                                              Seite 37

Seite 38



                                             Seite 39

Seite 40



                                             Seite 41

Seite 42


                                            Seite 43

Seite 44


                           Seite 45

To top