Docstoc

Supplementary Table 2 Predicted multiple exon ... - BioMedSearch

Document Sample
Supplementary Table 2 Predicted multiple exon ... - BioMedSearch Powered By Docstoc
					                                                               Tabelle1



tary Table 2: Predicted multiple exon skipping events
                 N.A. = not approaved


                      GeneSymbol                               GeneName                         RefSeq       Exon
                         ABCA6        ATP-binding cassette, sub-family A (ABC1), member 6 NM_172346          15-24
                        AHCYL1               S-adenosylhomocysteine hydrolase-like 1          NM_006621      10-13
                         ATP10A                       ATPase, Class V, type 10A               NM_024490       9-11
                         ATP11C                       ATPase, Class VI, type 11C              NM_173694      14-17
                         ATP2A1      ATPase, Ca++ transporting, cardiac muscle, fast twitch 1 NM_173201      10-13
                         ATP2A2      ATPase, Ca++ transporting, cardiac muscle, slow twitch 2NM_170665       11-13
                         ATP2C1           ATPase, Ca++ transporting, type 2C, member 1        NM_014382      14-16
                         ATP8B1                 ATPase, Class I, type 8B, member 1            NM_005603      14-16
                         ATP8B2                 ATPase, Class I, type 8B, member 2            NM_020452      15-17
                         ATP8B3                 ATPase, Class I, type 8B, member 3            NM_138813      15-17
                          ATP9B                        ATPase, Class II, type 9B              NM_198531      15-17
                         C2orf33               chromosome 2 open reading frame 33             NM_020194       7-8
                         CENPE                      centromere protein E, 312kDa              NM_001813      22-26
                         CLCN6                              chloride channel 6                NM_021737       8-9
                        COL19A1                        collagen, type XIX, alpha 1            NM_001858      31-32
                         DCHS2                          dachsous 2 (Drosophila)               NM_017639       6-7
                           ELP4             elongation protein 4 homolog (S. cerevisiae)      NM_019040      10-11
                          FGD3              FYVE, RhoGEF and PH domain containing 3           NM_033086      14-16
                          FMR1                       fragile X mental retardation 1           NM_002024      11-12
                            KL                                     klotho                     NM_153683       2-3
                           LIFR                  leukemia inhibitory factor receptor          NM_002310       4-8
                          MMP2                                                                NM_004530
                      matrix metalloproteinase 2 (gelatinase A, 72kDa gelatinase, 72kDa type IV collagenase)  5-7
                           N.A.                                     N.A.                      NM_133175       7-8
                           N.A.                                     N.A.                      NM_022911      16-17
                           N.A.                                     N.A.                      NM_152449       4-5
                           N.A.                                     N.A.                      NM_002850       5-6
                           N.A.                                     N.A.                      NM_176095       5-6
                           N.A.                                     N.A.                      NM_031913      11-17
                           N.A.                                     N.A.                      NM_033659       5-6
                           N.A.                                     N.A.                      NM_014400       3-4
                           N.A.                                     N.A.                      NM_053029      24-31
                           N.A.                                     N.A.                      NM_152347      10-13
                           N.A.                                     N.A.                      NM_194294       6-9
                           N.A.                                     N.A.                      NM_015605       6-7
                           N.A.                                     N.A.                      NM_176085       3-7
                           N.A.                                     N.A.                      NM_199176       5-6
                           N.A.                                     N.A.                      NM_031363      51-52
                           N.A.                                     N.A.                      NM_030813      13-14
                           N.A.                                     N.A.                      NM_133628       3-4
                           N.A.                                     N.A.                    NM_001002021      2-4
                          NRD1               nardilysin (N-arginine dibasic convertase)       NM_002525       3-4
                           OGT                                                                NM_003605       4-5
   O-linked N-acetylglucosamine (GlcNAc) transferase (UDP-N-acetylglucosamine:polypeptide-N-acetylglucosaminyl transferase)
                          P2RX4         purinergic receptor P2X, ligand-gated ion channel, 4 NM_175568        4-6
                        PHYHD1            phytanoyl-CoA dioxygenase domain containing 1       NM_174933       7-8
                         PLCG1                        phospholipase C, gamma 1                NM_182811      16-22
                          POLL                  polymerase (DNA directed), lambda             NM_013274       3-5
                        POLR2A polymerase (RNA) II (DNA directed) polypeptide A, 220kDa       NM_000937      18-19
                        POLR2A polymerase (RNA) II (DNA directed) polypeptide A, 220kDa       NM_000937      21-22
                         RASAL2                       RAS protein activator like 2            NM_170692       3-4
                         SH3GL3                         SH3-domain GRB2-like 3                NM_003027       2-4
                        SH3GLB2                SH3-domain GRB2-like endophilin B2             NM_020145       6-7
                         SH3YL1         SH3 domain containing, Ysc84-like 1 (S. cerevisiae) NM_015677         5-6
                         SRPK1                           SFRS protein kinase 1                NM_003137       9-11




                                                                Seite 1
                                               Tabelle1



      STAB2                                stabilin 2                         NM_017564       61-62
     SUPT3H             suppressor of Ty 3 homolog (S. cerevisiae)            NM_181356        3-4
        TAZ                                                                    Barth syndrome) 3-4
tafazzin (cardiomyopathy, dilated 3A (X-linked), endocardial fibroelastosis 2,NM_181314
      USP31                     ubiquitin specific protease 31                NM_020718        4-10




                                                Seite 2
                                          Tabelle1




# skipped
  exons     PfamID                   Pfam description
    10      PF00005   ABC transporter
     4      PF05221   S-adenosyl-L-homocysteine hydrolase
     3      PF00702   haloacid dehalogenase-like hydrolase
     4      PF00702   haloacid dehalogenase-like hydrolase
     4      PF00702   haloacid dehalogenase-like hydrolase
     3      PF00702   haloacid dehalogenase-like hydrolase
     3      PF00702   haloacid dehalogenase-like hydrolase
     3      PF00702   haloacid dehalogenase-like hydrolase
     3      PF00702   haloacid dehalogenase-like hydrolase
     3      PF00702   haloacid dehalogenase-like hydrolase
     3      PF00702   haloacid dehalogenase-like hydrolase
     2      PF05644   Protein of unknown function (DUF800)
     5      PF02344   Myc leucine zipper domain
     2      PF00654   Voltage gated chloride channel
     2      PF01391   Collagen triple helix repeat (20 copies)
     2      PF00028   Cadherin domain
     2      PF05625   PAXNEB protein
     3      PF00169   PH domain
     2      PF00013   KH domain
     2      PF00232   Glycosyl hydrolase family 1
     5      PF00041   Fibronectin type III domain
     3      PF00413   Matrixin
     2      PF00640   Phosphotyrosine interaction domain (PTB/PID)
     2      PF01740   STAS domain
     2      PF01476   LysM domain
     2      PF07679   Immunoglobulin I-set domain
     2      PF05600   Protein of unknown function (DUF773)
     7      PF00168   C2 domain
     2      PF00001   7 transmembrane receptor (rhodopsin family)
     2      PF00021   u-PAR/Ly-6 domain
     8      PF07679   Immunoglobulin I-set domain
     4      PF00036   EF hand
     4      PF01231   Indoleamine 2,3-dioxygenase
     2      PF00102   Protein-tyrosine phosphatase
     5      PF00145   C-5 cytosine-specific DNA methylase
     2      PF01765   Ribosome recycling factor
     2      PF01413   C-terminal tandem repeated domain in type 4 procollagen
     2      PF00168   C2 domain
     2      PF00730   HhH-GPD superfamily base excision DNA repair protein
     3      PF00365   Phosphofructokinase
     2      PF00675   Insulinase (Peptidase family M16)
     2      PF00515   TPR Domain
     3      PF00864   ATP P2X receptor
     2      PF05721   Phytanoyl-CoA dioxygenase (PhyH)
     7      PF00169   PH domain
     3      PF00633   Helix-hairpin-helix motif
     2      PF04998   RNA polymerase Rpb1, domain 5
     2      PF04998   RNA polymerase Rpb1, domain 5
     2      PF00169   PH domain
     3      PF03114   BAR domain
     2      PF03114   BAR domain
     2      PF04366   Family of unknown function (DUF500)
     3      PF00069   Protein kinase domain




                                           Seite 3
                                    Tabelle1



2   PF00008   EGF-like domain
2   PF02269   Transcription initiation factor IID, 18kD subunit
2   PF01553   Acyltransferase
7   PF00443   Ubiquitin carboxyl-terminal hydrolase




                                     Seite 4
                                                Tabelle1




                EST/cDNA confirmed                                      Exon sequence
                alt. acceptor of exon 15                TGGATGAGGCTGACATCCTGGCTG
                                                        GTAGGCAAGGGCTGCTGTGCTGCTCTCAAAGCTCTTGGAGCAATTGTCTACATTAC
                                                        CGCAGCGTCTGGCCAGGTACCAAGAGGCAGACTCGGAGGAGGAGGAGGTGGTGC
                                                        AATCGAGAAGAGCTGTTTCTACGTGCCTTGTGTTTATGTCATACTGTAGAAATCAAA
                                                        ATGTTTATCATTGACAAGGTGGATGGGGACATCTGCCTCCTGAATGAGTTCTCCAT
                                                        GCAAAGGGTGTGTATGAAAAAGTTGGAGAAGCTACAGAGACTGCTCTCACTTGCCT
                                                        GTTACTGGAGTTGGCTATAATCAATTTGGGGAAGTGATTGTTGATGGTGATGTTGT
                                                        CAAGTTGATTTTAGCTGGAATACATATGCTGATGGGAAGCTTGCATTTTATGACCAC
                                                        AGGCCTGAACCTGTTGACTTCTCCTTCAATCCTCTGGCTGACAAGAAGTTCTTATTT
                                                        GGCCGGATTCAGAGGCCACGACCCGACCTAAG
                                                        ATGCAGTCTCAAGCTGGTGGAAACAATACTGGTTCAACTCCACTAAGAAAAGCCCA
                                 confirmed              GTGGCACAGATCAGATTCTGCCCCAAGAAATAAAATTTCAAGGTTCCAGGCACCGA
                                                        ATACAAGACAAATCTGAAGAGCTCCATATAATAACATCAGAAAAAGATAAATTGTTTT
                        alt. acceptor of exon 10        GGCTCTTCGTGGAGAAGGAAGGCCCCATGATCCACAGTGGTTCGGTGGTGGGAG
                                                        ATTGCACTTCCTCTCTTGGGAGACATCGGTGCTTTGCTCAAG
                                 confirmed              GACTCTATAGTCCAGAGGTAGAAATTCTGAGTGCTGTCAACTTTTCAGCAGACAAG
                                 confirmed              GCTGGAGTGCAGTGGCACGATCTCGGCTCACGGCAACCTCGCCTCCTGGGTTCAA
                       retained intron in exon 16       ATCACGAGCACCAGCCCTGTGGAGCCTGTGGTGACCACCGAAGGCAGTTCGGGT
                                                        GAAATTATGCCACCAAATTCCCTTCCTTCCAATAATTCAAGGGTTGGACCTAATGCC
                           alt. donor of exon 3         GCTCATGCCAAAGTCTGGCATCTCTACAATACTTCTTTCCGTCCCACTCAGGGAGG
                                                        GTCCCGTTCTTGTTATCAGTTGGAGAAAACCAGTATTAAAATTCCAGCTCTTTCACA
                                                        TGGTCCGTGTGAAGTATGGGAACGCCGATGGGGAGTACTGCAAGTTCCCCTTCTT
              alt. donor of exon 6 + skipping of exon 7 GCTGTGATCCCCACTGATGCTGATCCCCAGTACTTGAACCCCTGGACACAGATCC
                                                        TGTGGTGTGGATGTCGACTTCCTCATCTCCCAGAAGAAGAAACTGCTCAAGAAGCA
alt. donor of exon 16, skipping of exon 17, alt. acceptor of exon 18
                                 confirmed              CACATTTTATTTTAGACCTAATGGGGCTGGAGATACCAGGCAGAATTTAATTCCGG
                                 confirmed              AAACCTTTG
                    retained intron in exon 5 and 6     GATTGGCAGGAGATTATAGCTCTGTATGAGAAGGACAACACCTACTTAGGTAAAGT
                          alt. donor of exon 14         CCTGCAGATCTGCCTTGGAGATGTCATGACCAACAGAGTGGTGGATGAG
                         alt. acceptor of exon 6        GGGACCCCACTGTCTGCTCCATCTCCAACCCTGATTTTGTCATCTACTCTTCAGTG
                                                        TCCACGGACAATTCTCGCTGGCAGTGCGGGGTTGCGGTTCGGGACTCCCCGGCA
                        alt. acceptor of exon 27        ATAAGCCAGACCCCCCAGCTGGCACACCTTGTGCCTCTGACATTCGGAGCTCCTC
                                                        CATTCCAGGATGCCTTGAAGATTTTCTGTAGGATAAAAGGTGGTCGAGTTTCAACT
                                                        AGACGGAGTCTCCCTCTGTCTCCCAGGCTGGAGTGCAGTGGCATGATCTCGGCTC
                                 confirmed              ATACGCGCAAAATTGTTTCTGAAGGAGAACTAGATCAGTTGGCTCAGATTCGGCCA
                    inclusion of an upstream exon       ATTACAAAAATTACCAAAGTATATTCTTTTGGAAAATGTTAAAGGTTTTGAAGTATCT
                                 confirmed              ACTATGAAGCAAATAAAACAATACTTTAATGGGCCAAATGTGGCCTGAGGGCCACC
                    inclusion of an upstream exon       AAAGCCTATTCCATCAACTGTGAAAGCTGGGGAATTAGAAAAAATAATAAGTCGCTG
                                                        GGCCGGCTGACAGATGGAAAAGGGAAGACCATTGATTGCAAGGACGCCATCTTCA
                                 confirmed              GCCCTGGTTGCCCTGAGGCGGGTGCTGCTGGCTCAGTTCTCGGCTTTCCCCGTGA
                                 confirmed              GTCCCCTGACAAGCCCACCAGGCCCCCTGCTGAGATGGCTGTGACCCTGGGCTG
                                 confirmed              CAATTGCAGAGCCTGTTTTTGCTGTGGTCAAAGCTGACTGATAGACTGTGGTTTAA
                        retained intron in exon 4       GATTTGTACTGTGTTCGCAGTGACCTGGGGAACCTGCTCAAAGCCCTGGGTCGCT
            inclusion of an exon downstream of exon 4ATTCCAGATGCGACCACTGTGTGTAAATCAGATGCCAGCTGTACTGCCGGCTCTGC
                   inclusion of a downstream exon       CTCTGCACGCCCACGACCCCGTCTTCAAGAGCATCACACACTCCTTCAAGGTGCA
                                                        GTCAGCAGCAGCACAGAGCTGCACTCCAATGAGAAGTGGTTCCATGGGAAGCTAG
                                 confirmed              AGTGGCTGAGCTCCCTTCGGGCCCATGTTGTGCGCACTGGCATTGGACGAGCCCG
                                                        GTCGTCCTCCCCTGTAACCTGCTGCGGATGATCTGGAATGCTCAGAAAATCTTCCA
                                                        GATATTCTGTGCCGTCTGGAGCATACAACGTTGAGGAAGGTGACTGCCAACACAG
                                                        ATACCTGTGGAAGGGGGACAGGAGCAGCAGACAGATTCCACCAAAGGGCGATGC
                                 confirmed              TAGAGATGGGTTTCACCATGTTGGCCAATATGGTCTCGATCTCCTGACCTCGTGAT
                                                        ACGGTGCCTGACTTTCAGGAGACTAGACCTCGTAATTACATTCTCTCGGCCAGCGC
                                 confirmed              ACACATTTACAGCTACATATTCCCTCTGAGCATTGCCCTGGCTGCCTTCCATAAGTG
                                                        TCAGTACTGCTCCCCAGCCTAAACCA




                                                 Seite 5
                           Tabelle1



                       ATACCACTGTTGGGGTGTTCCATCTACGCTCCCCACTGGGCCAGTATAAGCTGACC
      confirmed        AAACTGCTTATCAATAACAGCTGTAGCACTGTGGCTTTTCTCCATGGACTCATGGTG
alt. donor of exon 3   GGATCCTGAAACTCCGCCACATCTGGAACCTGAAGTTGATGCGTTGGTGAGGAGG
                       ATCTTCTTTGACGTGTCCTCATTGTCAGAAACAGAGCAACACTTTTGATCCTTTCCT




                            Seite 6
                               Tabelle1




               Exon sequence
ATAGAAAAGTGATCATGTCCAATGGGAGACTGAAGTGTGCAGGTTCTTCTATGTTTTTGAAAAGAAGGTGGGGTCTTGGATAT
CATGGATGGGTTCAGGGTGGTAAAGCTAAATGAAGTCATCCGGCAAGTCGATGTCGTAATAACTTGCACAG
GAGAAGGATATCACGCCCGACCCAAAGCTGCTGGAGAAGGTGAGTGAGTGTGACAAGAGCCTAGCCGTGGCGAGGCATCAG
GTACGGGTTCACATTTTTAGGAAATCGAAATGGATATATGAGAGTAGAGAACCAAAGAAAAGAAATAGAAGA
CTTGAAGAATGATAAGCCAGTCCGGCCAGGGCAGTATGACGGGCTGGTGGAGCTGGCCACCATCTGTGCCCTCTGCAATGA
GTCATTAAACAGCTGATGAAAAAGGAATTCACTCTAGAGTTTTCACGTGACAGAAAGTCAATGTCGGTTTACTGTACACCAAAT
GCGGGCTGTGTGTGCAATGATGCTGTAATTAGAAACAATACTCTAATGGGGAAGCCAACAGAAGGGGCCTTAATTGCTCTTG
GTCAGCTCAACTACCAGGCAGCCTCTCCCGATGAAGGTGCCCTGGTAAACGCTGCCAGGAACTTTGGCTTTGCCTTCCTCGC
GAGAGCTGTACTACAAAGCTCAGTCCCCAGATGAGGGGGCCCTGGTCACCGCAGCCAGGAACTTTGGTTTTGTTTTCCGCTC
GAGAACCCCTACCTCTGGAACAAGTTCGCCGACGGGAAGCTGCTCTTCCACAATGCGGCCCTGCTGCACCTCGTGCGGACC
GTCGCTCTGGTGCAGTGGACAGAGAGTGTGGGCCTCACGCTGGTCAGCAGGGACCTCACCTCCATGCAGCTGAAGACCCCC
TGTGACACCATCGCCACAACAGGCTCGGGTCTGTCCTCCCCATATGTTACCTGAAGATGGAGCTAATCTTTCCTCTGCTCGTG
CTTTCTTACAAGACCCAAGAACTTCAGGAGAAAACACGTGAGGTTCAAGAAAGACTAAATGAGATGGAACAGCTGAAGGAACA
TTTCAGAGCATCTCCTTACGGAAGATCCAGTTTAACTTCCCCTATTTCCGAAGCGACAG
AATTTCTGTGGCAACTGCCAAGCCAGTGTCCCAGGGCTGAAAAGCAACAAAGGAGAAGAAGGAGGTGCTGGTGAGCCTGGA
GAAGGTTGAAAGAGATGAGGAAGCTGCAGAAAAAAAATTTGAAGCTAGCAGAGGTTGGTTCATGAGGTTTAAGGGAAGACGC
TGGGTGCAAGACAACTACTTGAGACAAGAGAGGAACATTTATCCTCCAGGCTTCTCATACTTACTCAAGCAGAAAGACTCTGC
CTCGAGCCCAGAAAACTATCCTCTAAGACCAGACGTGACAAGGAGAAGCAGAGCTGTAAGAGCTGTGGTGAGACCTTCAACT
GTGTTAGTGGCTTCATCAGTTGTAGCAGGGGAATCCCAGAAACCTGAACTCAAGGCTTGGCAG
CCATCAAGCTGGATGGGGTGGATGTCATCGGGTATACCGCATGGTCCCTCATGGATGGTTTCGAGTGGCACAGAGGTTACAG
CCTTAATTCCAGATACTCCAGAGATCTTGAATTTGTCTGCTGATTTCTCAACCTCTACATTATACCTAAAGTGGAACGACAGGG
CCCTGTTCACCATGGGCGGCAACGCTGAAGGACAGCCCTGCAAGTTTCCATTCCGCTTCCAGGGCACATCCTATGACAGCTG
GGACTTCGCTTTTGTGGCAAGTGACAAAGATAGCTGTATGCTCAAGTGCCATGTGTTTTGCTGTGATGTCCCTGCCAAGGCCA
GCTGCCTCCCCCAAGGGCGCCTCAGTTTCCATTAATGTCAACACCAGCCTTGAAGACATGAGGAGCAACAACGTTGAGGACT
CATTCAGAGTGATTAACAATGGCAAA
AAAGCACTCCGATTCGAG
GGCGAAAATGTCCGAGGAGAACTGCTGGCCCTGGTGAAGGACCTGCCGAGTCAGCTGGCTGAGATTGGGGCAGCGGCTCA
TGGTTTGTCCTGAATGACACAACCAGCGGGCGGCTGCACCTGCGGCTGGAGTGGCTTTCATTGCTTACTGACCAAGAAGTTC
CCTGAGTCCCACCATAGCGCCCAAGCTCAGCTTAGAAGTTCGAAAACTCAGCAATGGCAGATTATCGACATCTTTGAAGCTGG
GTAATGAGAGTGCATACCCGCCCAACGGCGTGGAGTGCTACAGCTGTGTGGGCCTGAGCCGGGAGGCGTGCCAGGGTACA
AGCCGAAGGATGAAGTGGAGGTGTCAGATGATG
GTAACCACATGGTGGATATTGGGGATATTATATTTACTTTGAATGAGCTACAGGAACAGTATGAGGATGTTT
AGTCTCACTCTATCTCCCAGGCTGGAGTGCAGTGGTGTCATCTCGGCTCTCTGCAACCTCTTGCCTCAGTCTCTTGCGTAGC
GCTTTAGAACTTAAGAATCTGCCTGGTGAGTTCAACTCTGGGAATCAACCAAGCAACAGAGAAAAAAACAGATACCGAGATAT
AGACCTCTTGATACAAACAATAGAAAATTGTGGCTTTCAGTACCAAGAGTTTCTATTATCTCCAACCTCT
GAATTGGCCTGGATTAGGAGTCTTAGAGTACCTGGAATCCGGTCCCATCTCTACCACCAACTGGCTGTTTGACCTTGGGCAA
CCAAGCAACAACTCCGCAGGCAGTTACCAAGTACGGCTGGCTACAACTGCTCCATCCGTGCCTCTTTTTAAAGTTCAAACTCA
GGGATGTCCAGATAAGTGACAAGATCACCATCTCAAAGAACTTCAAGGAGAATGTGATTCGCCCTATCCTGAAA
GTATGTCTCTGTATGGCAGCAAATGTGGCCCATGGCCTGCAGCAAAACGTCCTATATGTAGATTCCAATGGAGGGCTGACAG
GCGTGGCACCTCACCTCACACCTGCTCCCTGCTGCTGAGCCCCACGCCAAGCTGGAGAGCGGATGAGAAGCATGTGTAACC
GTCTGCACCTGTTCAGCATTTGGCAGGATGGCAAGCGGAGGAGCAGCAGGGTGAAACTGACACAGTTCTG
GCTGTCACCCTTGACCCAAACTTTCTGGATGCTTATATCAATTTAGGAAATGTCTTGAAAGAGGCACGCATTTTTGACAG
ACCTGCTTTTTTAAAGGCTGCAGAAAACTTCACTCTTTTGGTTAAGAACAACATCTGGTATCCCAAATTTAATTTCAGCAA
ACCTTGGCCAGAAGTCTGGGCCTCCAGATGCCCGTGGTGGTGCAGAGCATGTACATCTTTAAG
GCGGAACGGGAAAGTCCAGCACTGCCGTATCCACTCCCGGCAAGATGCTGGGACCCCCAAGTTCTTCTTGACAGACAACCT
GTACTTGGACCATCCACAGCCCAGCAAGGCAGAGCAGGATGCTTCTATTCCTCCTGGCACCCATGAGGCCCTGCTTCAGACA
GAGTCAAGGAATTGAGCAAGAAGCTGGTGATTGTGAATGGGGATGACCCACTAAGTCGACAGGCCCAGGAAAATGCCACGC
GTTTTGGTGACGACTTGAACTGCATCTTTAATGATGACAATGCAGAGAAGCTGGTGCTCCGTATTCGCATCATGAACAGCGAT
AGGTACCAGCAGAAAGGTCCCCTCGTAGACGGAGTATCTCAGGGACCAGTACATCAGAGAAACCCAACTCCATGGACACTGC
GTTATGAGGCTGGTTCTTGGGTTTGACTCTGGGAATCATGCTCATTGATCTGCTTTTCCTAATCATGTCAGTGAATACCTACAC
CTCTGGAATGATGAAGTGGACAAG
AGTGCCACTCCAGCTTTCTTAGGTTGCCATCTGCATGACACATCTTTCTCCATCCTTTTACTGTCAATCTAATG
GCTGACAAAATGTCAAAGAATAAGAAGAAGAAATTGAAGAAGAAGCAGAAGCGCCAGGCAGAATTACTAGAGAAGCGAATGC




                                Seite 7
                               Tabelle1



GCCAAGTACCACCTGTGCTCAGCAGGCTGGCTGGAGACCGGGCGGGTTGCCTACCCCACAGCCTTCGCCTCCCAGAACTG
CTTCATAGGGAAAACAGATTCTATAGAAATAATTGGAAAATCAGTTTTTCCCTATTGTTATCACAATATCCTTCCACTGCTGAAT
GACCCCTGCAGCTGCAGACATCTGCTTCACCAAGGAGCTACACTCCCACTTCTTCAGCTTGGGCAAGTGTGTGCCTGTGTGC
GCCTCTCTATGTCACTGTAGTGTATCAAGGCAAATGTTCTCACTGCATGAGGATTGGTGTGGCCGTACCTCTGTCTGGGACTG




                                Seite 8
                                               Tabelle1




                               Exon sequence
                TTTACATAGGAATGAAATATGTAACCCAGAACAAATAACATCCTTCATTACTCATCACATCCCCGATGCTAAATTAAAAACAGAA
                GAAATAAGAATGTAGTGACACGGGAGCACTTGGATCGCATGAAAAACAGTTGTATCGTATGCAATATGGGCCACTCCAACACA
                GTGAGGGTGAGGTTTGAGCTGAAGTCCCCGGTGAAGACGATAGAAGACTTCCTGCGGAGGTTCACACCCAGCTGCCTGACC
                ATATGAACTTCTTCACACCTTAAACTTTGATGCTGTCCGGCGACGTATGAGTGTAATTGTGAAGACTCAAGAAG
                GCCAAAGGTGTCTATGAGAAGGTCGGCGAGGCCACCGAGACAGCACTCACCACCCTGGTGGAGAAGATGAATGTGTTCAAC
                GGTGCTCCTGAAGGTGTCATTGACAGGTGCACCCACATTCGAGTTGGAAGTACTAAGGTTCCTATGACCTCTGGAGTCAAAC
                ATGGGTCTTGATGGACTTCAACAAGACTACATCAGAAAAGCTGAATACCCTTTTAGCTCTGAGCAAAAGTGGATGGCTGTTAA
                TAAGAACCCCAGAAGGCAATATCAAGCTTTACTGTAAAGGTGCTGACACTGTTATTTATGAACGGTTACATCGAATGAATCCTA
                TGCGGAATCCAGAGGGGAAGATCCGACTCTACTGCAAAGGGGCTGACACTATCCTACTGGACAGACTGCACCACTCCACTCA
                ACCAGCTGTTGTACCAGGCGGCCTCCCCCGACGAGGGGGCGCTGGTCACCGCAGCCCGGAACTTCGGCTACGTGTTCCTG
                GATGAATCCACGGCAGAAATCACATTCTACATGAAGGGCGCTGACGTGGCCATGTCTCCTATCGTGCAGTATAATGACTGGC
 GGGTCTGTCCTCCCCATATGTTACCTGAAGATGGAGCTAATCTTTCCTCTGCTCGTGGCATTTTGTCGCTTATCCAGTCTTCTACTCGTAGGGCATA
                AATATAGATACTCAAGAACAATTACGAAATGCTCTTGAGTCTCTGAAACAACATCAAGAAACAATTAATACACTAAAATCGAAAA
CCAGTTTAACTTCCCCTATTTCCGAAGCGACAG
 TGTCCCAGGGCTGAAAAGCAACAAAGGAGAAGAAGGAGGTGCTGGTGAGCCTGGAAAGTATGATTCCATGGCCCGGAAG
  CAGAAAAAAAATTTGAAGCTAGCAGAGGTTGGTTCATGAGGTTTAAGGGAAGACGCCATCTCCATTACCTAAAAGTGCAAGATGAAGCAGCAAGTG
 AGAGAGGAACATTTATCCTCCAGGCTTCTCATACTTACTCAAGCAGAAAGACTCTGCATGGGGAGAAGGTTCTTTACAGCATTCCACATTTTTAATGA
                GTCATCTGTGGGAAGTGCTCCGAGTTCAAGGCCGAGAACAGCCGGCAGAGCCGTGTCTGCAGAGATTGTTTCCTGACACAG
AGGGGAATCCCAGAAACCTGAACTCAAGGCTTGGCAG
CATCGGGTATACCGCATGGTCCCTCATGGATGGTTTCGAGTGGCACAGAGGTTACAGCATCAGGCGTGGACTCTTCTATGTTGACTTTCTAAGCCAG
                GTGACCCACAACACAACTCTGAATGGCAAAGATACACTTCATCACTGGAGTTGGGCCTCAGATATGCCCTTGGAATGTGCCAT
                CCATGTCCACTGTTGGTGGGAACTCAGAAGGTGCCCCCTGTGTCTTCCCCTTCACTTTCCTGGGCAACAAATATGAGAGCTG
 AAGATAGCTGTATGCTCAAGTGCCATGTGTTTTGCTGTGATGTCCCTGCCAAGGCCATTGCCAGTGCCCTACATGGGCTTTGTGCCCAG
TTTCCATTAATGTCAACACCAGCCTTGAAGACATGAGGAGCAACAACGTTGAGGACTGCAAGATGATG


TGGCCCTGGTGAAGGACCTGCCGAGTCAGCTGGCTGAGATTGGGGCAGCGGCTCAGCAGTCCCTGGGGGAAGCCATTGACGTGTACCAGGCGTC
               GACCATGGTGGCCTTTCCACTGCCATTCTCGTGGTCTTCTTGGAGAGTGCCTGCAACTTGCCG
CTCAGCTTAGAAGTTCGAAAACTCAGCAATGGCAGATTATCGACATCTTTGAAGCTGGGGCCCCTGCAACCTCGGGGAGTGCCACTTCGGGAGAAG
 GGCGTGGAGTGCTACAGCTGTGTGGGCCTGAGCCGGGAGGCGTGCCAGGGTACATCGCCGCCGGTCGTGAGCTGCTACAACGCCAGCGATCAT
               ATGAGAAGGAGCCCGAGGTTGATTACCGGACAGTGACAATCAATACTGAACAAAAAGTATCTGACTTCTACGACATTGAGGAG
               CAATTACAGAAGGATCACCTTTGAATGAAATTACTTCAGACAGAAAGTTATCAAGTGTAGCAGGATGCTATCTAAAATATAAGA
               GAACCTGGAGACCATCATCTCATTTCCTGGGGGAGAGAGCCTGCATGGTTTTATACTGGTGACTGCTTTGGTAGAGAAAGAA
TGAGTTCAACTCTGGGAATCAACCAAGCAACAGAGAAAAAAACAGATACCGAGATATTCTTCCAT
               CTTGGCATTCCAAATTCAAGGCTACGATATTTTCTTATTGCAAAGCTTCAGTCAGAGCCATTACCCTTTCAAGCCCCTGGTCAG
AGTACCTGGAATCCGGTCCCATCTCTACCACCAACTGGCTGTTTGACCTTGGGCAAGTTGCTTCACTCTCTGGGCCTCCATTTCCTCATCTGCTAAT
 CCAAGTACGGCTGGCTACAACTGCTCCATCCGTGCCTCTTTTTAAAGTTCAAACTCACAGGTGACTCTAAGGTTATCTACTTTTACTCATAAGTAAAA
 ACCATCTCAAAGAACTTCAAGGAGAATGTGATTCGCCCTATCCTGAAA
GGCCCATGGCCTGCAGCAAAACGTCCTATATGTAGATTCCAATGGAGGGCTGACAGCTTCCCGCCTCCTCCAGCTGCTTCAGGCTAAAACCCAGGA
               GAAACTGGCTTTGCCAAGGCCCCCGCTGGGACAGACTGTTTCTTTCACTGCAGTCCTGGGAGCCGAGGGCAAGGGGACAGG
 GATGGCAAGCGGAGGAGCAGCAGGGTGAAACTGACACAGTTCTG
GGATGCTTATATCAATTTAGGAAATGTCTTGAAAGAGGCACGCATTTTTGACAG
               GAGGAATATCCTTCCCAACATCACCACTACTTACCTCAAGTCGTGCATTTATGATGCTAAAACAGATCCCTTCTGCCCCATATT
 GATGCCCGTGGTGGTGCAGAGCATGTACATCTTTAAG
               GTGGTACCACGCGAGCCTGACCAGAGCACAGGCTGAGCACATGCTAATGCGCGTCCCTCGTGATGGGGCCTTCCTGGTGCG
               CCCATCTCTGATGATGAAGCCAGTGATGGGGAAGAAACCCAGGTTAGTGCAGCTGATCTGGAAGCCCTCATCAGTGGCCACT
 GTGATTGTGAATGGGGATGACCCACTAAGTCGACAGGCCCAGGAAAATGCCACGCTGCTCTTCAACATCCACCTGCGGTCCACGTTGTGTTCCCG
TTTAATGATGACAATGCAGAGAAGCTGGTGCTCCGTATTCGCATCATGAACAGCGATGAGAACAAGATGCAAGAG
 AGACGGAGTATCTCAGGGACCAGTACATCAGAGAAACCCAACTCCATGGACACTGCAAATACCTCACCCTTCAAAGTACCA
               GAGCTTTTAAGTGAATAAGACCATTTTCCCAATGAGCAGTGTCATAAACATTGAGGACTCTCTTAAATCAGAAGATGAATGAAT

CCATCTGCATGACACATCTTTCTCCATCCTTTTACTGTCAATCTAATG
              AAGAGTCAAGTACCATTGGCCAGGATCAAACGCTTATGGAACGTGATACAGAGGGTGGTGCAGCAGAAATTAATTGCAATGG




                                                Seite 9
                                              Tabelle1



GCTGGCTGGAGACCGGGCGGGTTGCCTACCCCACAGCCTTCGCCTCCCAGAACTGTGGCTCTGGTGTGGTTGGGATAGTGGACTATGGACCTAGA
 AATAATTGGAAAATCAGTTTTTCCCTATTGTTATCACAATATCCTTCCACTGCTGAATGATTCTGGCAG
 TCACCAAGGAGCTACACTCCCACTTCTTCAGCTTGGGCAAGTGTGTGCCTGTGTGCCGAG
               ATTGTGTTAACAGAAATGTACTATGATGGGTTCCATCGTTCCTTTTGTGATACAGACGACCTGGAAACAGTCCATGAAAGCGA




                                              Seite 10
                                              Tabelle1




                               Exon sequence
               ATCTTTTCAGTGATCTGGATAAGTGTTCTGACCAGGGAGTGACAGGTTATGACATTTCCATGTCAACTCTAAATGAAGTCTTTA
               ACCAGCCTCCGCACTCCGGAGCTGACGTGGGAGCGAGTACGTTCTCAGGTGGACCATGTCATCTGGCCAGATGGCAAACGA
TCCCCGGTGAAGACGATAGAAGACTTCCTGCGGAGGTTCACACCCAGCTGCCTGACCTCAGGCTGCAGCAGCATCGGGAGCCTGGCCGCCAACAA
               GAGACATACTTCTCTTTTGTAAAGGAGCAGACTCGGCAGTTTTTCCCAGAGTGCAAAATCATGAAATTGAGTTAACTAAAGTCC
               GTGATCCGCCAGCTAATGAAGAAGGAATTCACCCTGGAGTTCTCCCGAGACAGAAAGTCCATGTCTGTCTATTGCTCCCCAG
 GGTGCACCCACATTCGAGTTGGAAGTACTAAGGTTCCTATGACCTCTGGAGTCAAACAGAAGATCATGTCTGTCATTCGAGAGTGGGGTAGTGGCA
ACTACATCAGAAAAGCTGAATACCCTTTTAGCTCTGAGCAAAAGTGGATGGCTGTTAAGTGTGTACACCGAACACAGCAG
GCTTTACTGTAAAGGTGCTGACACTGTTATTTATGAACGGTTACATCGAATGAATCCTACTAAGCAAGAAACACAGGATGCCCTGGAT
GACTCTACTGCAAAGGGGCTGACACTATCCTACTGGACAGACTGCACCACTCCACTCAAGAGCTGCTCAACACCACCATGGACCACCTTAAT
CCCCCGACGAGGGGGCGCTGGTCACCGCAGCCCGGAACTTCGGCTACGTGTTCCTGTCCCGCACCCAGGACACCGTCACGATCATGGAGCTGGG
TCTACATGAAGGGCGCTGACGTGGCCATGTCTCCTATCGTGCAGTATAATGACTGGCTGGAAGAGGAG
 ATCTTTCCTCTGCTCGTGGCATTTTGTCGCTTATCCAGTCTTCTACTCGTAGGGCATACCAGCAGATCTTGGATGTGCTGGATGAAAATCGCAG
               ATGGTTGGCATAGATAAAAAACAGGATTTGGAAGCTAAAAATACCCAAACACTAACTGCAGATGTTAAGGATAATGAGATAATT

GTGCTGGTGAGCCTGGAAAGTATGATTCCATGGCCCGGAAG
 GGTTTAAGGGAAGACGCCATCTCCATTACCTAAAAGTGCAAGATGAAGCAGCAAGTGCTGATGGAGAAGCTGCAGCAAGGTATGTAGCAAATCTAG
CAAGCAGAAAGACTCTGCATGGGGAGAAGGTTCTTTACAGCATTCCACATTTTTAATGAGCTTCCTTGCAAAGG
 TCAAGGCCGAGAACAGCCGGCAGAGCCGTGTCTGCAGAGATTGTTTCCTGACACAGCCAGTGGCCCCTGAGAGCACAGAGGTGGGTGCTCCCAG

GTGGCACAGAGGTTACAGCATCAGGCGTGGACTCTTCTATGTTGACTTTCTAAGCCAGGACAAGATGTTGTTGCCAAAGTCTTCAGCCTTGTTCTAC
              GGATACCTGATTCTCAGACTAAGGTTTTTCCTCAAGATAAAGTGATACTTGTAGGCTCAGACATAACATTTTGTTGTGTGAGTC
 AGAAGGTGCCCCCTGTGTCTTCCCCTTCACTTTCCTGGGCAACAAATATGAGAGCTGCACCAGCGCCGGCCGCAGTGACGGAAAGATGTGGTGTG
ATGTCCCTGCCAAGGCCATTGCCAGTGCCCTACATGGGCTTTGTGCCCAG
GCAACAACGTTGAGGACTGCAAGATGATG


ATTGGGGCAGCGGCTCAGCAGTCCCTGGGGGAAGCCATTGACGTGTACCAGGCGTCTGTGGGGTTTGTGTGTGAGAGGTAGAGAGGCCTCAGCT
               AGAAACCCTTTTGACTACCTGAATGGTGAATATCGAGCCAAAAAACTCTCCAGGTTTGCCAGAGTGA
CGACATCTTTGAAGCTGGGGCCCCTGCAACCTCGGGGAGTGCCACTTCGGGAGAAGAAGGCAACCCAAATGGTGGCCATTGTGCTTG
AGGCGTGCCAGGGTACATCGCCGCCGGTCGTGAGCTGCTACAACGCCAGCGATCATGTCTACAAGGGCTGCTTCGACGGCAACGTCACCTTGACG
               CTGTTTGAGCGCATCATTGACGAGGACTTTGAGCTGACGGAGCGTGAGTGCATCAAGTACATGCGGCAGATCTCGGAGGGA
               AAAACTTCTGTGAAGCTATCAGTAAACTTCAAGAAAATTACATTGCAGCAGAAGAACTTCAGTCTATTTTGCCTTCAACAGGAA
               GCTCTTGTTCAGGCCACGAATGCTATCTTGCAGCCCAACCAGGAGGCCCTGCTCCAAGCCCTGCAGCGACTGAGACTGTCTA
AAACAGATACCGAGATATTCTTCCAT
               GTACTGATGGAGTTCCCCAAAATTGAATCTGTACATCCACAAAAATATGCAATGGATGTAGAAAATAAAATTCAAGAAAAGAAC
 TGTTTGACCTTGGGCAAGTTGCTTCACTCTCTGGGCCTCCATTTCCTCATCTGCTAATATAAG
TTTTTAAAGTTCAAACTCACAGGTGACTCTAAGGTTATCTACTTTTACTCATAAGTAAAAGCCCTAGACTGGTGCTAATGTCAAACCACTGGCCTCCAC

CAATGGAGGGCTGACAGCTTCCCGCCTCCTCCAGCTGCTTCAGGCTAAAACCCAGGATGAGGAGGAACAG
GCTGGGACAGACTGTTTCTTTCACTGCAGTCCTGGGAGCCGAGGGCAAGGGGACAGGAAAGAGGAAGTGACCTCAGAGCCTGGTGGCACCAGCAT

CGCATTTTTGACAG
ACTACTTACCTCAAGTCGTGCATTTATGATGCTAAAACAGATCCCTTCTGCCCCATATTCCGTCTTGGCAAAATAGTGGAGAACGCAGGACACAGTTT

              GGCTGAGGGCAAGATCAAGCATTGCCGTGTCCAGCAAGAGGGCCAGACAGTGATGCTAGGGAACTCGGAGTTCGACAGCCT
 ATGGGGAAGAAACCCAGGTTAGTGCAGCTGATCTGGAAGCCCTCATCAGTGGCCACTACCCCACCTCCCTTGAGGGAGATTGTGAGCCTAGCCCA
CCAGGAAAATGCCACGCTGCTCTTCAACATCCACCTGCGGTCCACGTTGTGTTCCCGCCGCATGGCAGAGGAGTTTCGGCTCAGTGGGGAGGCCT
CGCATCATGAACAGCGATGAGAACAAGATGCAAGAG
CAACTCCATGGACACTGCAAATACCTCACCCTTCAAAGTACCA
 TCCCAATGAGCAGTGTCATAAACATTGAGGACTCTCTTAAATCAGAAGATGAATGAATGGATGGAATCTTTGCTGGGATAATATGCAATCAAGCTAA


TCAAACGCTTATGGAACGTGATACAGAGGGTGGTGCAGCAGAAATTAATTGCAATGGAGTGATTGAAGTCATTAATTATACTCAGAACAGTAATAATG




                                              Seite 11
                                              Tabelle1



 TTCGCCTCCCAGAACTGTGGCTCTGGTGTGGTTGGGATAGTGGACTATGGACCTAGACCCAACAAGAGTGAAATGTGGGATGTCTTCTGCTATCGG
ATCCTTCCACTGCTGAATGATTCTGGCAG
AAGTGTGTGCCTGTGTGCCGAG
               GAATTCATTTAAACAACAACCTAAACCACTTGAAATTTGGCTTGGATTATCATAGACTGTCTTCTCCTACACAAACAGCAGCAAA




                                               Seite 12
                                              Tabelle1




                                Exon sequence
               ATTTCGAACAAGTGGAGATGATAAGAGACTCAGAAAGCCTCAATGAAATGGAGCTGGCTCACTCTTCCTTCTCTGAAATGCAG
 TGGGAGCGAGTACGTTCTCAGGTGGACCATGTCATCTGGCCAGATGGCAAACGAGTTGTCCTCCTGGCAGAG
ACCCAGCTGCCTGACCTCAGGCTGCAGCAGCATCGGGAGCCTGGCCGCCAACAAGTCCAGCCACAAGTTGGGCTCCAGCTTCCCGTCCACCCCG
AGACTCGGCAGTTTTTCCCAGAGTGCAAAATCATGAAATTGAGTTAACTAAAGTCCATGTGGAACGTAATGCAATG
 TCACCCTGGAGTTCTCCCGAGACAGAAAGTCCATGTCTGTCTATTGCTCCCCAGCCAAATCTTCCCGGGCTGCTGTGGGCAACAAGATGTTTGTCA
ACCTCTGGAGTCAAACAGAAGATCATGTCTGTCATTCGAGAGTGGGGTAGTGGCAGCGACACACTGCGATGCCTGGCCCTGGCCACTCATGACAAC
AGTGGATGGCTGTTAAGTGTGTACACCGAACACAGCAG
 CATCGAATGAATCCTACTAAGCAAGAAACACAGGATGCCCTGGAT
 TGCACCACTCCACTCAAGAGCTGCTCAACACCACCATGGACCACCTTAAT
CGGCTACGTGTTCCTGTCCCGCACCCAGGACACCGTCACGATCATGGAGCTGGGGGAGGAACGGGTCTACCAGGTCCTGGCCATAATGGACTTCA
CAGTATAATGACTGGCTGGAAGAGGAG
CTACTCGTAGGGCATACCAGCAGATCTTGGATGTGCTGGATGAAAATCGCAG
               ACCATTGAAAACCAGGAAGAATTAAGACTTCTTGGGGATGAACTTAAAAAGCAACAAGAGATAGTTGCACAAGAAAAGAACCA


GATGAAGCAGCAAGTGCTGATGGAGAAGCTGCAGCAAGGTATGTAGCAAATCTAGCTAAGATTCTTGGTGAAG
 TTCCACATTTTTAATGAGCTTCCTTGCAAAGG
 TTGTTTCCTGACACAGCCAGTGGCCCCTGAGAGCACAGAGGTGGGTGCTCCCAGCTCCTGCTCCCCTCCTGGTGGCGCGGCAGAGCCTCCAGAC

 TGACTTTCTAAGCCAGGACAAGATGTTGTTGCCAAAGTCTTCAGCCTTGTTCTACCAAAAGCTGATAGAGAAAAATGGCTTCCCTCCTTTACCTGAA
               ATCCACCAGATACTCCTCAACAACTGAATTGTGAGACACATGATTTAAAAGAAATTATATGTAGTTGGAATCCAGGAAGGGTGA
ACAAATATGAGAGCTGCACCAGCGCCGGCCGCAGTGACGGAAAGATGTGGTGTGCGACCACAGCCAACTACGATGATGACCGCAAGTGGGGCTTC




ACGTGTACCAGGCGTCTGTGGGGTTTGTGTGTGAGAGGTAGAGAGGCCTCAGCTTCTCCTGGTGGGGGTGCTTTGCCTGTGTTCCCCAGCTCATG
               AACAAGGTCAGCAAAGACCCTTCTTCCTATGTCAAACTATCTGTAGGCAAGAAGACACATACAAGTAAG
GCCACTTCGGGAGAAGAAGGCAACCCAAATGGTGGCCATTGTGCTTG
CAACGCCAGCGATCATGTCTACAAGGGCTGCTTCGACGGCAACGTCACCTTGACGGCAG
               AGAATGCGGGGTCTCTGAAGGTCCTCTTTGGCACCCCAGAATTTGTGGCTCCTGAAGTGATCAACTATGAGCCCATCGGCTA
 CAAGAAAATTACATTGCAGCAGAAGAACTTCAGTCTATTTTGCCTTCAACAGGAATTAATTTATTAGATGAAGAATTCCAGAAGATTGTGACAGACAC
 TGCAGCCCAACCAGGAGGCCCTGCTCCAAGCCCTGCAGCGACTGAGACTGTCTATTCAGGACATCACCAAAACCTTAGGACAGATGCATG

               ATATGGAAGCTACATAGAAGGGACAGGGTCTGTGTTACAGACTGCAGAGGATGTGCAG
 TTCCTCATCTGCTAATATAAG
TTTACTCATAAGTAAAAGCCCTAGACTGGTGCTAATGTCAAACCACTGGCCTCCACTCAGGCCTCCATCTTCTCATGCCCTCTTACCAGTATTTAACT

AGGCTAAAACCCAGGATGAGGAGGAACAG
GGGCAAGGGGACAGGAAAGAGGAAGTGACCTCAGAGCCTGGTGGCACCAGCATCATGTCCAGGCTGGGGG


CCTTCTGCCCCATATTCCGTCTTGGCAAAATAGTGGAGAACGCAGGACACAGTTTCCAGGACATGGCCGTGGAG

               GAGCCTGACTACGGGGCCCTGTATGAGGGACGCAACCCTGGCTTCTATGTAGAGGCAAACCCTATGCCAACTTTCAAG
 CTCATCAGTGGCCACTACCCCACCTCCCTTGAGGGAGATTGTGAGCCTAGCCCAGCCCCTGCTGTCCTGGATAAGTGGGTCTGTGCACAGCCCTC
CCACGTTGTGTTCCCGCCGCATGGCAGAGGAGTTTCGGCTCAGTGGGGAGGCCTTCGACTGGCTGCTTGGGGAGATTGAGTCCAAGTTCAACCAA


CAGAAGATGAATGAATGGATGGAATCTTTGCTGGGATAATATGCAATCAAGCTAATAGGTGCCTTACCTGGACCTCCCAACAG


AAATTAATTGCAATGGAGTGATTGAAGTCATTAATTATACTCAGAACAGTAATAATGAAACATTGAGACATAAAGAGGATCTACATAATGCTAATGACT




                                              Seite 13
                                             Tabelle1



GGACTATGGACCTAGACCCAACAAGAGTGAAATGTGGGATGTCTTCTGCTATCGGATGAAAG


              ATTTGGACTGCCTTTTGTGCTGCACTTAGAGAAGACAATAGCTTGGGACCTTCTGCAGAAGGAAATCTTGGAGAAGATGAAGT




                                             Seite 14
                                              Tabelle1




                               Exon sequence
               ATTATTGGTATTTGGAATCGCAATATTCCCTTTGATTGTTGAAAATATAATGTATGCTATGTTAAATGAAAAGATCGATTGGGAA
ATGGCAAACGAGTTGTCCTCCTGGCAGAG
GCCGCCAACAAGTCCAGCCACAAGTTGGGCTCCAGCTTCCCGTCCACCCCGTCCAGCGACGGCATGCTTCTCAGGCTGGAGGAGAGGCTGGGCC
 AACTAAAGTCCATGTGGAACGTAATGCAATG
 TGCTCCCCAGCCAAATCTTCCCGGGCTGCTGTGGGCAACAAGATGTTTGTCAAG
GGGTAGTGGCAGCGACACACTGCGATGCCTGGCCCTGGCCACTCATGACAACCCACTGAGAAGAGAAGAAATGCACCTTGAGGACTCTGCCAACT



 TGGAGCTGGGGGAGGAACGGGTCTACCAGGTCCTGGCCATAATGGACTTCAACAGCACGCGCAAACGGATGTCGGTGCTGG


CTTGGGGATGAACTTAAAAAGCAACAAGAGATAGTTGCACAAGAAAAGAACCATGCCATAAAGAAAGAAGGAGAGCTTTCTAGGACCTGTGACAGAC


AGCAAATCTAGCTAAGATTCTTGGTGAAG

GGTGCTCCCAGCTCCTGCTCCCCTCCTGGTGGCGCGGCAGAGCCTCCAGACACCTGCTCCTGTGCCCCAGCAGCTCCAGCTGCCTCTGCTTTCGG

 CCTTGTTCTACCAAAAGCTGATAGAGAAAAATGGCTTCCCTCCTTTACCTGAAAATCAGCCCCTAGAAGGGACATTTCCCTGTGACTTTGCTTGGGG
GTGAGACACATGATTTAAAAGAAATTATATGTAGTTGGAATCCAGGAAGGGTGACAGCGTTGGTGGGCCCACGTGCTACAAGCTACACTTTAGTTGA
GATGTGGTGTGCGACCACAGCCAACTACGATGATGACCGCAAGTGGGGCTTCTGCCCTGACCAAG




 GGCCTCAGCTTCTCCTGGTGGGGGTGCTTTGCCTGTGTTCCCCAGCTCATGACCCTTCTCCAGTTGTCTTGTTCCCATATAACATTTGAACTCTTTA
              ACCTGTCCCCACAACAAGGACCCTGTGTGGAGCCAGGTGTTCTCCTTCTTTGTGCACAATGTGGCCACTGAGCGGCTCCATC

GTCACCTTGACGGCAG
               AGTCAGTGGCCTTTCCCCCTTCATGGGAGACAACGATAACGAAACCTTGGCCAACGTTACCTCAGCCACCTGGGACTTCGAC
TTCAACAGGAATTAATTTATTAGATGAAGAATTCCAGAAGATTGTGACAGACACTAGTAGAAATG
 GAGACTGTCTATTCAGGACATCACCAAAACCTTAGGACAGATGCATG

TGTGTTACAGACTGCAGAGGATGTGCAG

CTGGCCTCCACTCAGGCCTCCATCTTCTCATGCCCTCTTACCAGTATTTAACTTCTGAGGAAGACAAGTGATGCTAAAACCTGAAATTCCAATGAAGC


GGCACCAGCATCATGTCCAGGCTGGGGG


GGACACAGTTTCCAGGACATGGCCGTGGAG

              TGTGCAGTCAAAGCCCTCTTTGACTACAAGGCCCAGAGGGAGGACGAGCTGACCTTCATCAAGAGCGCCATCATCCAGAATG
AGCCTAGCCCAGCCCCTGCTGTCCTGGATAAGTGGGTCTGTGCACAGCCCTCAAGCCAGAAGGCGACCAATCACAACCTCCATATCACAGAGAAGC
 GGGGAGGCCTTCGACTGGCTGCTTGGGGAGATTGAGTCCAAGTTCAACCAAGCCATT


AATCAAGCTAATAGGTGCCTTACCTGGACCTCCCAACAG


ACAGTAATAATGAAACATTGAGACATAAAGAGGATCTACATAATGCTAATGACTGTGATGTCCAAAATTTGAATCAGGAATCTAGTTTCCTAAGCTCCC




                                               Seite 15
                                            Tabelle1



TCTGCTATCGGATGAAAG


             GTGTGTCCATTCAGCTTGCGTGTGGTCAGTGTTGTTGGAATAACATATTTGCTGCCCCAGGAGGAGCAGCCCTTGTGCCACC




                                            Seite 16
                                              Tabelle1




                                Exon sequence
              AATCAAATATTGAAGATTTTATAAAATCACTGAAGCATCAAAATATACTTTTGGAAGTAGATGACTTTGAAAACAGAAATGGTAC

GTCCACCCCGTCCAGCGACGGCATGCTTCTCAGGCTGGAGGAGAGGCTGGGCCAGCCCACCTCGGCCATCGCCAGCAACGGCTACAGCAGCCA


CTCATGACAACCCACTGAGAAGAGAAGAAATGCACCTTGAGGACTCTGCCAACTTTATTAAATATGAG



AATGGACTTCAACAGCACGCGCAAACGGATGTCGGTGCTGG


GAAAAGAACCATGCCATAAAGAAAGAAGGAGAGCTTTCTAGGACCTGTGACAGACTGGCAGAAGTTGAAGAAAAACTAAAGGAAAAG




GCCTCCAGACACCTGCTCCTGTGCCCCAGCAGCTCCAGCTGCCTCTGCTTTCGGAGTGTCCCTGGGACCAGGATAGATGTGGGTGTGTCTCAGTG

CTTTACCTGAAAATCAGCCCCTAGAAGGGACATTTCCCTGTGACTTTGCTTGGGGAGTTGTTGACAACTACATTCAAGTAAGTCAGCTGACAAAACC
AGGAAGGGTGACAGCGTTGGTGGGCCCACGTGCTACAAGCTACACTTTAGTTGAAAG
AGTGGGGCTTCTGCCCTGACCAAG




CCAGCTCATGACCCTTCTCCAGTTGTCTTGTTCCCATATAACATTTGAACTCTTTACACACCTGAACCTGTGGGGGCCTTGCCCATTTGACCATGTG
             TTCCTGCAAGTGGAGGAACGAGAGCTGGGGAGCCCATACACAGGACCTGAAGCCCTAAAGAAAGGCCCTCTGCTCATCAAG


              AAACCGCCTGGACTGCACGCAGTGCCTTCAGCATCCATGGCTAATGAAAGATACCAAGAACATGGAGGCCAAGAAACTCTCC
GTGACAGACACTAGTAGAAATG




AGTATTTAACTTCTGAGGAAGACAAGTGATGCTAAAACCTGAAATTCCAATGAAGCCATATGAACAGCTGTTCAGTTGCACTTCTAAGACTTTACTTA




              GTGGCGAGGGGACTACGGAGGGAAGAAGCAGCTGTGGTTCCCATCAAACTACGTGGAAGAGATGGTCAACCCCGTGGCCC
GCACAGCCCTCAAGCCAGAAGGCGACCAATCACAACCTCCATATCACAGAGAAGCTGGAAGTTCTGGCCAAAGCCTACAGTGTTCAGGGAGACAAG
AGTTCAACCAAGCCATT




TGCTAATGACTGTGATGTCCAAAATTTGAATCAGGAATCTAGTTTCCTAAGCTCCCAAAATGGAGACAGCAGCACATCTCAAGAAACAGACTCTTGTA




                                              Seite 17
                               Tabelle1




GGCATTAAAATCTTGTGGACCAGGTGGCACTGCTCATGTGAAATTAGTAGTCGAGTGGGACAAGGAGACAAGAGATTT




                               Seite 18
                                              Tabelle1




                                Exon sequence
              GATTATAGATTTTCAGTTGTGTGTAATACCAAGAGATTGCACTGTTTTCCAATTCTTATGAATATTATCAGCAATGGGCTACTTC

GGCTGGGCCAGCCCACCTCGGCCATCGCCAGCAACGGCTACAGCAGCCAGGCGGACAACTGGGCCTCGGAGCTTGCTCAGGAGCAGGAGTCAG


CTGCCAACTTTATTAAATATGAG




TGTGACAGACTGGCAGAAGTTGAAGAAAAACTAAAGGAAAAG




CTGCTTTCGGAGTGTCCCTGGGACCAGGATAGATGTGGGTGTGTCTCAGTGGGGCCCCCAGGCTGGGAACACACTCGGAAGATCCCGTGTGTGC

TGCTTGGGGAGTTGTTGACAACTACATTCAAGTAAGTCAGCTGACAAAACCAATCAGCAGTCTCACCAAGCCCTATCACTA




GAACTCTTTACACACCTGAACCTGTGGGGGCCTTGCCCATTTGACCATGTGGCCCAGGCCAAAGCCCAGTGTTGGCCTTACGCATGGTCGGCAGG
AGCCCATACACAGGACCTGAAGCCCTAAAGAAAGGCCCTCTGCTCATCAAGAAAGTGGCTACCAACCAGGGTCCCAAAGCCCAACCTCAGGAAGAA


              AAAACGGGCAATGCTGTGAGAGCCATTGGAAGACTGTCCTCTATGGCAATGATCTCAGGGCTCAGTGGCAGGAAATCCTCAA




CCAATGAAGCCATATGAACAGCTGTTCAGTTGCACTTCTAAGACTTTACTTAGCAGTAAATTATAGCTCATGTGCATTATTTTCCAGATAACTTAGCTT




GCTGTGGTTCCCATCAAACTACGTGGAAGAGATGGTCAACCCCGTGGCCCTGGAGCCGGAGAGGGAG
ACAGAGAAGCTGGAAGTTCTGGCCAAAGCCTACAGTGTTCAGGGAGACAAGTGGAGGGCCCTGGGCTATGCCAAGGCCATCAATGCCCTCAAGAG




CTAAGCTCCCAAAATGGAGACAGCAGCACATCTCAAGAAACAGACTCTTGTACACCTATAACATCTGAGGTGTCAGACACCATGGTGTGCCAGTCTT




                                              Seite 19
                                             Tabelle1




GCTCATGTGAAATTAGTAGTCGAGTGGGACAAGGAGACAAGAGATTT




                                             Seite 20
                                              Tabelle1




                               Exon sequence
              AGCCACATAGGACTCTGGACTGGGTTGCCGGATGGTTCCTTTTTCTTATTTTTGGTTCTATGTAGCATTTCTCCTTATATCACC

CAGCCAGGCGGACAACTGGGCCTCGGAGCTTGCTCAGGAGCAGGAGTCAGAGCGCGAGCTGCGGTACGAGGCGGAGAGCCCGGATGAGGCCG




CTCAGTGGGGCCCCCAGGCTGGGAACACACTCGGAAGATCCCGTGTGTGCACGCTGGCTTCTCGGGACCAGCCAGGGCCAAGGCTTGGGAACC

CAAAACCAATCAGCAGTCTCACCAAGCCCTATCACTA




CCATGTGGCCCAGGCCAAAGCCCAGTGTTGGCCTTACGCATGGTCGGCAGGAGAGTCAGTTGTGTGCTCTGTTGAAGCCCCACAGAGCAGGTGTT
CATCAAGAAAGTGGCTACCAACCAGGGTCCCAAAGCCCAACCTCAGGAAGAAGGCCCTACAGATTTGCCATGTCCCCCAGACCCTGCTTCTGATAC


AGACTGTCCTCTATGGCAATGATCTCAGGGCTCAGTGGCAGGAAATCCTCAACAGGGTCACCAACCAGCCCGCTCAATGCAGAAAAACTAGAATCT




TTACTTAGCAGTAAATTATAGCTCATGTGCATTATTTTCCAGATAACTTAGCTTATGAGTAGCTTATACAATTATGAAGATTTAATATTACAGATAAAAT




TGGCCCTGGAGCCGGAGAGGGAG
AGACAAGTGGAGGGCCCTGGGCTATGCCAAGGCCATCAATGCCCTCAAGAGCTTCCATAAGCCTGTCACCTCGTACCAG




CTCTTGTACACCTATAACATCTGAGGTGTCAGACACCATGGTGTGCCAGTCTTCCTCAACTGTAGGTCAGTCATTCAGTGAACAACACATTAGCCAAC




                                               Seite 21
Tabelle1




Seite 22
                                              Tabelle1




                                    Exon sequence
              AAAAATGCTAAGTCCCAGCTATGGATTTCAGGCCTCTACACTTCTGCTTACTGGTGTGGGCAGGCACTAGTGGACGTCAGCT

GAGTCAGAGCGCGAGCTGCGGTACGAGGCGGAGAGCCCGGATGAGGCCGCACTGGTGTATGCGGCCAGAGCCTACAACTGCGTGCTTGTGGAG




TGTGTGCACGCTGGCTTCTCGGGACCAGCCAGGGCCAAGGCTTGGGAACCATTTGCATCCAGGAGTTAGATGGGAACAAGTGTCACTCCTGGTCA




GGCAGGAGAGTCAGTTGTGTGCTCTGTTGAAGCCCCACAGAGCAGGTGTTGCCAATGCTGCGGTTCGTGCAGAAGCGGGGAAACTCAACGGTGT
GGAAGAAGGCCCTACAGATTTGCCATGTCCCCCAGACCCTGCTTCTGATACTAAGGACGTATCCAGGAGTACCACAACCACCACCAGTGCTACCAC


TCCTCAACAGGGTCACCAACCAGCCCGCTCAATGCAGAAAAACTAGAATCTGAAG




TTAGCTTATGAGTAGCTTATACAATTATGAAGATTTAATATTACAGATAAAATGTAAACTGTTTCTTTAAAATTGGG




TCAAGAGCTTCCATAAGCCTGTCACCTCGTACCAG




CAGTCTTCCTCAACTGTAGGTCAGTCATTCAGTGAACAACACATTAGCCAACTTCAAGAAAGCATTCGGGCAGAGATACCCTGTGAAGATGAACAAG




                                              Seite 23
Tabelle1




Seite 24
                                              Tabelle1




TGGTGTGGGCAGGCACTAGTGGACGTCAGCTTCTTCATTTTAATTCTCCTTTTAATGTATTTAATTTTCTACATAGAAAACATGCAGTACCTTCTTATT

GGCCAGAGCCTACAACTGCGTGCTTGTGGAGCGGCTGCACGACCAAGTGTCAGTGGAGCTGCCCCACCTGGGCAGGCTCACCTTCGAGCTCCTG




AGTTAGATGGGAACAAGTGTCACTCCTGGTCACCTGGTTGGAGGGCATGGATTGAAGCTGCCCTCAAGTCCAGGCCTTGAGGCCCACCTGAGGGG




GTTCGTGCAGAAGCGGGGAAACTCAACGGTGTACGAGTGGAGGACAGGGACAGAGCCCTCTGTGGTGGAACGACCCCACCTCGAGGAGCTTCCT
 AGGAGTACCACAACCACCACCAGTGCTACCACCGTTGCCACTGAGCCCACATCCCAAGAGACAGGCCCAGAGCCTAAAGGCAAGGACAGTGCCA




TCGGGCAGAGATACCCTGTGAAGATGAACAAGAGCAAGAACATAACGGACCACTGGACAACAAAG




                                              Seite 25
Tabelle1




Seite 26
                                              Tabelle1




TCTACATAGAAAACATGCAGTACCTTCTTATTACAAGCCAAATTGTGTTTGCTTTG

CCACCTGGGCAGGCTCACCTTCGAGCTCCTGCACACACTGGGTTTCGATTCCGTCCGCAAGAGGATGTCAGTGGTGATCCGGCACCCGCTTACCG




AAGTCCAGGCCTTGAGGCCCACCTGAGGGGAGATACTGCCCTTCTCTCTGCCTGCCTCACCTCCAGCTGTCAGAGGGTGAGCAGGGCCCTGGAG




GTGGAACGACCCCACCTCGAGGAGCTTCCTGAGCAGGTGGCAGAAGATGCG
GCCCAGAGCCTAAAGGCAAGGACAGTGCCAAAAGGTTCTGTGAGCCCATCGGGGAGAAGAAGAGTCCAGCCACCATCTTCCTGACTGTCCCAGGT




                                               Seite 27
Tabelle1




Seite 28
                                            Tabelle1




TGTCAGTGGTGATCCGGCACCCGCTTACCGATGAGATCAACGTCTACACCAAGGGGGCCGACTCAGTGGTCATGGATCTCCTGCAGCCCTGCTCT




GCTGTCAGAGGGTGAGCAGGGCCCTGGAGGCAGGCACCCCCTCCTCCTCCTCCCCGTCCCCTTCTCCTCCTCCTCCCCGTCCCCTTCTCCTCCT




CCAGCCACCATCTTCCTGACTGTCCCAGGTCCCCACTCTCCAGGGCCCATCAAGTCACCCAGACCCATGAAATGCCCTGCCTCCCCATTCGCATG




                                            Seite 29
Tabelle1




Seite 30
                                              Tabelle1




GTGGTCATGGATCTCCTGCAGCCCTGCTCTTCAG




CTCCTCCTCCTCCCCGTCCCCTTCTCCTCCTCCTCCCCGTCCCCTTCTCCTCTTCCTCTCCCTCCTTCCTCTCCCTCCGCCTCGCTGTCTTTCTCCTT




CCATGAAATGCCCTGCCTCCCCATTCGCATGGCCGCCCAAGAGGCTGGCTCCCAGCATGTCCTCGCTCAACTCCTTGGCCTCTTCTTGCTTTGACC




                                              Seite 31
Tabelle1




Seite 32
                                              Tabelle1




CCTCTCCCTCCGCCTCGCTGTCTTTCTCCTTCTCCTCTCCCTCCTCCTCCTGCTCCTTCTCCTCCCCGTACCCTTTTTCTACTCTTCCCTCTCCTTCT




CTCAACTCCTTGGCCTCTTCTTGCTTTGACCTGGCAGATATCAGCCTCAACATTGAGTATGCACCTCTCTGCTTAATCTTTTCTAAAATCGCCTGTAT




                                              Seite 33
Tabelle1




Seite 34
                                              Tabelle1




CGTACCCTTTTTCTACTCTTCCCTCTCCTTCTCCTCCTCCTTTCTCTCCCTCCTCCTCCCCCTCCCCTTCTCCTCCTCTCTTTCTCTTCCTCTTTTCCT




CTCTGCTTAATCTTTTCTAAAATCGCCTGTATGAAAAATACCTCGCTGGATGGAAAAGTAGATATGAACTTACATTTCTGTGCAAGTTGTTTTTTCACAA




                                               Seite 35
Tabelle1




Seite 36
                                              Tabelle1




TTCTCCTCCTCTCTTTCTCTTCCTCTTTTCCTCCTCCACTCCTCTTTCTGAGAGTAGCTGCTGCTTTCCCTGACTTCCTTCCTCAAGAATACAGTCTAT




CTTACATTTCTGTGCAAGTTGTTTTTTCACAAAATATCTTCCTAAGAGGCAGCATGGTGTGGTAGAAAGAACACAGGACAAGGGAGAGAGAGCCAAA




                                              Seite 37
Tabelle1




Seite 38
                                            Tabelle1




CCTGACTTCCTTCCTCAAGAATACAGTCTATTCTGGGGGGTTGCAGGACAGCTGAAAAAGAAAACGTGAGTTTCCAGAAAAGCACATCGCCCTTTC




AGAACACAGGACAAGGGAGAGAGAGCCAAACAGGCTGTTTATGGCTCTAGCTGCGTACTGACTATAAAATAGATGCTGGACTCTGGTTG




                                             Seite 39
Tabelle1




Seite 40
                                             Tabelle1




GTGAGTTTCCAGAAAAGCACATCGCCCTTTCTCTCCACTCGACACAGCCTGCGGTTTGCAGTGCCAGCTGCACGTTGGAGTCTCCTGGGAAGCTTC




AAAATAGATGCTGGACTCTGGTTG




                                             Seite 41
Tabelle1




Seite 42
                                            Tabelle1




GCTGCACGTTGGAGTCTCCTGGGAAGCTTCTAGTGTTGATCTCCCTCCTAGAGGCTCAGTGAGGTGATCGGGGGGTCAGTGTGTTTTCA




                                            Seite 43
Tabelle1




Seite 44
                           Tabelle1




GATCGGGGGGTCAGTGTGTTTTCA




                           Seite 45

				
DOCUMENT INFO
Shared By:
Categories:
Tags:
Stats:
views:5
posted:3/25/2013
language:Unknown
pages:45