Protein Synthesis Pictures

Document Sample
Protein Synthesis Pictures Powered By Docstoc
					Transcription and Protein
       Synthesis
        Chapter 17
          Review Questions
• Why do cells make proteins?
• What is the general structure of the protein
  polymer?
• Where are proteins made in a cell
  (prokaryotic vs. eukaryotic)?
  Why do cells make proteins?
• Remember, proteins make up just about
  everything in our bodies, from the cells
  themselves, to the signals and enzymes
  that regulate the cells!
• The amino acid sequence of the protein is
  the MOST IMPORTANT determinant of
  the shape of the protein.
  – Reminder: primary, secondary, tertiary,
    quaternary
                    Protein Structure
Structurehttp://www.gbiosciences.com/EducationalUploads/EducationalProductsImages/mediumimages/Protein%20structure.jpg
           Protein Folding
• The SHAPE of the protein is CRITICAL to
  the activity of the protein. (Form Suits
  Function)
• How the protein folds (shape) depends on
  the amino acid sequence.
• http://www.youtube.com/watch?v=swEc_s
  UVz5I
 Where do cells make proteins?
• Note the key differences between
  prokaryotic and eukaryotic cells.
  – Location
  – mRNA processing
Figure 17.2 Overview: the roles of transcription and translation
Figure 17.2 Overview: the roles of transcription and translation
Figure 17.2 Overview: the roles of transcription and translation
     RNA: General Structure
• RNA is a polymer of nucleotides.
• RNA nucleotide:
  – Ribose sugar
  – Phosphate group
  – Nitrogenous Bases: A U G C
• RNA is built with an enzyme called RNA
  polymerase.
Figure 17.3 The triplet code



                               This is an overview of
                                 the process only.
      Do you know the code?
• The ribosome “reads” the code.
• t-RNA delivers the appropriate amino acid
  according to the order of codons on the
  codon
• The codons are the three letter “codes”
  that refer to a specific amino acid.
• Always start when you get to the start
  codon, and end at STOP!
            Try This GENE:
3’ TTAATTACCTCGACGGGAAATTAACTT 5’




Met-glu-leu-pro-phe-asn-stop
              Consider This:
• 3’TTAATTACCTCGACGGGATTTTAACTT 5’



• How does the change of one base affect the
  protein? Do you think this matters for protein
  shape and therefore function?
                RNA REVOLUTION
                                Discover Magazine, October 2009


•   mRNA
•   tRNA
•   rRNA
•   snRNA (small nuclear RNA), aka snNRPs
•   miRNA (aka SNPs)
       Key Point: We share 98% of our coding DNA with
       chimpanzees…maybe our key differences are in the areas of
       our DNA that code for RNA regulators. Small nuclear RNA (snRNA) is the
       name used to refer to a number of small RNA molecules found in the nucleus. These RNA molecules are
       important in a number of processes including RNA splicing (removal of the introns from hnRNA) and
       maintenance of the telomeres, or chromosome ends. They are always found associated with specific proteins
       and the complexes are referred to as small nuclear ribonucleoproteins (SNRNP) or sometimes as snurps.
       Antibodies against snurps are found in a number of autoimmune diseases.
            Transcription
• Initiation
• Elongation
• Termination
  Protein Synthesis Steps:pd8
1) transcription
2) mRNA processing
3) find ribosome for translation into product
  – Initiation (AUG)
  – Elongation
  – Termination
4) product shipping
Figure 17.6 The stages of transcription: initiation, elongation, and termination
Figure 17.6 The stages of transcription: initiation, elongation, and termination (Layer
                                          2)
Figure 17.6 The stages of transcription: initiation, elongation, and termination (Layer
                                          3)
Figure 17.6 The stages of transcription: initiation, elongation, and termination (Layer
                                          4)
   Eukaryotic messages need
processed before leaving nucleus
• 5’ Guanosine tri-phosphate cap
  – Like ATP, except “GTP”
  – Will provide energy for translation
• 3’ Poly(A) Tail
  – 50-250 adenines
  – Protection and Regulation
• Splicing
  – snRNPs + pre-mRNA = spliceosome
  – Keep exons (~1200 bp long)
Figure 17.8 RNA processing; addition of the 5 cap and poly(A) tail
Figure 17.9 RNA processing: RNA splicing
   Processed mRNA sets off
• Find 2 ready ribosome subunits
• Bind to P-site with 1st tRNA (methionine)
  – ‘Translation initiation complex’
  – GTP energy used here

• Read transcript 5’ to 3’ (DIFFERENT!)
• tRNA brings amino acids in order until
  “stop” codon
Figure 17.15 Ribosome anatomy
Figure 17.17 initiation of translation
Figure 17.13a Transfer RNA
Figure 17.14




   Aminoacyl
   tRNA
   synthetase
Figure 17.19 termination of translation
    Shipping off the product
• Product’s signals target destination
  – ER, Golgi, plasma membrane, mitochondria,
    other cells


• SPRs attach to ribosome & stay a while-
  detached near end of translation
Figure 17.21 The signal mechanism for targeting proteins to the ER
Figure 17.12 Translation: the basic concept   start here pd 8
             How are mutations created?
• B.P. insertions, deletions, and substitutions can
  cause codon to call for wrong a.a.

• Wobble effect only protects against
  substitutions in 3rd base of codon

• Occasionally fatal or causes disease
  – Sickle cell disease = A instead of T in DNA
  – mRNA: GAA = Glu, but GUA = Val
Figure 17.23 Sickle cell disease: a point mutation
Molecular-Based Definitions

–Wild type has original DNA
 sequence; correct mRNA made;
 correct product
  • Purple stems, Green-leaf fast plants

–Mutant… substitution, deletion or
 addition (causes frameshift)
  • Green stems, yellow-green leaves
Example
Example
Figure 17.25

				
DOCUMENT INFO
Shared By:
Categories:
Tags:
Stats:
views:0
posted:2/27/2013
language:English
pages:45