Bead-Beater Genomic DNA Extraction Protocol

Document Sample
Bead-Beater Genomic DNA Extraction Protocol Powered By Docstoc
					Geochemistry & Ecology of Red Mat Systems (GERMS)
Undergraduate Summer Research Program
Red Layer Microbial Observatory (RLMO) National Science Foundation Western Oregon University Yellowstone National Park

Week Four Genomic DNA Isolation and PCR - Monday and Tuesday Goals - Big Picture Isolate high quality, high quantity genomic DNA from mat samples - red and green layers Understand the basic principles and chemistry of DNA extraction Amplify two products from red and green layers: full-length and partial 16S fragments Full-length 16S will be cloned and sequenced during week five Partial 16S fragments will be analyzed for population diversity (DGGE) tomorrow Understand the basic principles of PCR and how different primer sets amplify different products Genomic Isolation Day One Procedures – Carry Out In Fume Hood Obtain ice from organic chemistry lab Prepare mat samples (no more than 0.1 g can be used in this reaction) Fill Bead Beater (BB) vial half-full of 0.1 mm Zirconium Beads Add 800μl Phenol/Chloroform to BB vial, cap, and invert to “wet” the beads Add mat sample, 66 ul 10% SDS, and top off with GTE until no airspace remains (600 – 700 μl approx.) Tightly cap vial and place in BB, beating at max speed (48) for 1 minute (1 increment = 10 seconds) Place tube on ice for 2 minutes and re-beat for another minute; spin at max speed for 10 minutes Carefully remove TOP aqueous layer to new 1.5 μl tube, avoiding debris at interface Perform an additional Phenol/Chloroform extraction (invert 30 seconds, spin 10 minutes at max speed) Remove supernatant to new 1.5 μl tube; add 50μl 3M Sodium Acetate and 1000μl 95% Ethanol Invert tube 40 times, observe for DNA precipitation, and place in -80°C freezer overnight Genomic Isolation Day Two Procedures Chill large, refrigerated department centrifuge with microfuge rotor at least 15 minutes in advance Spin samples at 14K RPM for 15 min at 4°C in above centrifuge Carefully pour off supernatant and wash with 70% Ethanol; dry inverted in fume hood Re-suspend in appropriate amount of 1X TE buffer – your instructor will advise With assistance from your instructor, run 10 μl of product on a prepared agarose gel You will learn about PCR while the gel runs 30-45 minutes Stain and photograph your gel to determine how much to dilute your samples for PCR PCR is in vitro Replication Review DNA Replication Origin bound by primer Helicase DNA Polymerase enzyme dNTPs (N = A, T, G, C) Two full-length genomes Contrast PCR Man-made primers FLANK TARGET GENE Boiling Thermo-tolerant Taq DNA Polymerase dNTPs (N = A, T, G, C) Millions of ONLY TARGET GENE

Start Unwound by Copied by Monomers Products

PCR - In General Carry out procedures using ultraclean materials and workspaces (UV/Bleach/Dedicated Reagents)

Remember: each student will analyze ONE layer (one = red and other = green) using TWO primer sets AND run TWO concentrations of each layer (undiluted & diluted) – each with BOTH primer sets The Promega MasterMix contains: Taq, monomers, and buffer in a 2X concentration The TWO primer sets will be called: DGGE (partial 16S products) and FL16S (full-length 16S) Primer/Source 8FPL - FL16S Reysenbach, 1994 1492RPL - FL16S Reysenbach, 1994 DGGE-1070F - DGGE Ferris, 1996 DGGE-U1392GC - DGGE Ferris, 1996 Universal Bacterial PCR Primers 5’GCGGATCCGCGGCCGCTGCAGTTTGATCCTGGCTCAG3’ 5’GGCTCGAGCGGCCGCCCGGGTTACCTTGTTACGACTT3’ 5’ATGGCTGTCGTCAGCT3’ 5’CGCCCGCCGCGCCCCGCGCCCGGCCCGCCGCCCCCGCCCC ACGGGCGGTGTGTAC3’

Procedures Thaw on ice: both primer sets (DGGE and FL16S), water, Promega PCR MasterMix For each reaction (make sure you think about how many), mix: 25 μl 2X MasterMix 22 μl H2O 1 μl Forward Primer 1 μl Reverse Primer 1 μl DNA template (ALWAYS ADD LAST) Supply Ordering and Price Information Materials in back of office – clean hood or clean fridge Item Bead-Beater Vials 0.1mm Zirconium Beads 10% SDS 1 X GTE Phenol/Chloroform/Isoamyl (pH 6.7-8) 3M Sodium Acetate Ethanol (Anhydrous/Denatured) TE buffer 0.5 M EDTA PCR Master Mix Designer Primers Strip tubes/Strip caps (12-tube) Source/Catalog Bio-Spec Products/cat. #522S Bio-Spec Products/cat. #11079101Z Fisher/ BMA51213 Fisher/NC9012289 Fisher/BP1752I-100 Fisher/BMA51203 Fisher/A405P-4 Fisher/BP2473-500 Fisher/PR-V4231 Fisher/Promega/ NC9061652 Invitrogen - Custom Primers Above Fisher/05-407-3A/05-407-4B Units/Cost $110.00 $38.00 500 ml/$35 500 ml/$30 100 ml/$40 500 ml/$40 4L/$20 500 ml/$23 100 ml/$10 /$67.00 Varies 125/$90.00 & 200/$96.00