Ic Marek Chicago molecular LFM 3

Document Sample
Ic Marek Chicago molecular LFM 3 Powered By Docstoc
					  Molecular Marker Evaluation Data
              Laura Fredrick Marek
             ISU/NCRPIS, Ames, IA




supporting presentations by:
   Chuck Simon           Clare Coyne
   PGRU, Geneva, NY WRPIS, Pullman, WA
    grape SSR information   pea SNP information
      Molecular Session
Provide an overview of current organization of
molecular descriptors/information in GRIN.


Present and solicit suggestions about what
information should be included in GRIN.
   What do users want to see?

Present and solicit suggestions about how the
data should be organized and presented in GRIN.
   Does standardization of presentation format make searching GRIN
   easier and assist database connectivity?
     Crops with defined molecular
             descriptors
              clover          sorghum
              cucumis         sugar beet
              grape           sunflower
              hazelnut        vaccinium
              maize           woody-landscape

Not many crops; good time to evaluate/modify data organization
and content.
Molecular category can be strictly defined.
                   A sampling of molecular descriptors
        Crop         DQNAME               GRIN list name
                                        GRIN link name             definition
alfalfa           GENEDIST     Chloroplast DNA hypervariability   Chloroplast DNA hypervariability. The average distance relative to all other measured. Additional com
clover            ALLELEEFF    Allele Effectiveness               Effective number of alleles per locus; based on 10 isozyme loci with 28 alleles
clover            ALLELENUM    Allele Number                      Mean number of alleles per polymorphic locus.
clover            HETEREXP     Expected Heterozygosity            Expected heterozygosity (Nei's 1978 unbiased heterozygosity).
cucumis           CSATGPI1     glucosephosphate isomerase loc     glucosephosphate isomerase locus 1.
cucumis           CSATGPI2     glucosephosphate isomerase loc     glucosephosphate isomerase locus 2
cucumis           CSATIDH      isocitrate dehydrogenase           isocitrate dehydrogenase
cucumis           CSATMDH1     malic dehydrogenase locus 1        malic dehydrogenase locus 1
cucumis           CSATMDH2     malic dehydrogenase locus 2        malic dehydrogenase locus 2
cucumis           CSATMDH3     malic dehydrogenase locus 3        malic dehydrogenase locus 3
maize             LOCUS-GOT1   locus gluta-oxa. transaminase1     Locus got1 glutamate-oxaloacetic transaminase1
maize             LOCUS-GOT2   locus gluta-oxa. transaminase2     Locus got2 glutamate-oxaloacetic transaminase2
maize             LOCUS-GOT3   locus gluta-oxa. transaminase3     Locus got3 glutamate-oxaloacetic transaminase3
maize             LOCUS-IDH1   locus isocitr. dehydrogenase1      Locus idh1 isocitrate dehydrogenase1
maize             LOCUS-IDH2   locus isocitr. dehydrogenase2      Locus idh1 isocitrate dehydrogenase2
maize             LOCUS-MDH1   locus malate dehydrogenase1        Locus mdh1 malate dehydrogenase1
maize             LOCUS-MDH2   locus malate dehydrogenase2        Locus mdh2 malate dehydrogenase2
maize             LOCUS-MDH3   locus malate dehydrogenase3        Locus mdh3 malate dehydrogenase3
maize             LOCUS-MDH4   locus malate dehydrogenase4        Locus mdh4 malate dehydrogenase4
maize             LOCUS-MDH5   locus malate dehydrogenase5        Locus mdh5 malate dehydrogenase5
maize             P-PHI024     p-phi024-cct(SSR)                  p-phi024-cct (SSR).
sugarbeet-rapd    AB09         Primer AB09                        Primer AB09
sugarbeet-rapd    AB11         Primer AB11                        Primer AB11
sugarbeet-rapd    AC15         Primer AC15                        Primer AC15
sugarbeet-rapd    AD04         Primer AD04                        Primer AD04
sunflower         ACO1         aconitate hydratase - 1            Aconitate hydratase; locus 1 (Aco1; 4.3.1.3). Comment: See Cronn et al. TAG (1997) 95:532-545 for
sunflower         ACO2         aconitate hydratase - 2            Aconitate hydratase; locus 2 (Aco1; 4.3.1.3). Comment: See Cronn et al. TAG (1997) 95:532-545 for
sunflower         IDH1         isocitrate dehydrogenase - 1       isocitrate dehydrogenase; locus 1 (Idh1; E.C. 1.1.1.41). Comment: See Cronn et al. TAG (1997) 95:5
sunflower         MDH1         NAD+ malate dehydrogenase - 1      NAD+ malate dehydrogenase; locus 1 (Mdh1; E.C. 1.1.1.37). Comment: See Cronn et al. TAG (1997
vaccinium         CA112F       SSR-CA112F                         GenBank Accession Number: CF810443 SSR Motif: (AG)7 Forward Primer: TCCACCCACTTCACA
vaccinium         CA169F       SSR-CA169F                         GenBank Accession Number: CF811071 SSR Motif: (GAT)4 Forward Primer: TAGTGGAGGGTTTT
vaccinium         CA190R       SSR-CA190R                         GenBank Accession Number: CF811085 SSR Motif: (TGC)5 Forward Primer: TTATGCTTGCCATG
vaccinium         CA236F       SSR-CA236F                         GenBank Accession Number: CF810540 SSR Motif: (TG)17 Forward Primer: GTTAAGCTTTTAGA
woody-landscape   CHEMMARK     chemical marker                    Pigmentation and other chemical marker characterization (by locus when possible).
woody-landscape   DNA          DNA marker                         DNA marker Characterization (by locus when possible)
woody-landscape   ISOZYME      isozyme marker                     Isozyme marker characterization (by locus when possible)
woody-landscape   MORPHMARK    morphological marker               Morphological marker characterization (by locus when possible)


  Currently every molecular descriptor is unique; DQ name and definition.
  There is significant variation in definition field content.
         Molecular Descriptors
     Molecular category can be strictly defined;
descriptors involve specific DNA marker information.

      indirect detection (gene products):
             isozymes, allozymes*
      direct detection (DNA sequence):
             RFLPs
             RAPDs*
             AFLPs
             SSRs*
             STRs
             SNPs
             others
             *marker types with data in GRIN
Example of molecular GRIN data:
           isozymes

       data from multiple crops

       data for the same enzyme
       from multiple crops
                         Isozyme Raw Data


             PI 599761




                                 PI 599761




                                                                     PI 599761
                         A                               PI 240660
                                             C
allelle 1                    B                   D   E
                                                                                 invariant mito. band
allelle 2



                                                               l-102
                                                               B-4
            gel by M. Brothers                                 MDH




       Malate Dehydrogenase (MDH1)
               sunflower gel
                 Isozyme data set in GRIN
                    MDH1 in study SUNFLOWER.SUN.ISOZYME.CORE.03

                                                                             Sample size is critical
                                                                             information to include.




One way to get data in an excel file is to search by descriptor in Oracle forms database (curators’ GRIN).
                      Isozyme descriptors in GRIN
   CROP         DQNAME                    GRIN link name                                                    definition
  clover*      ALLELEEFF                 Allele Effectiveness           Effective number of alleles per locus; based on 10 isozyme loci with 28 alleles
  clover*      ALLELENUM                    Allele Number               Mean number of alleles per polymorphic locus.
  clover*      HETEREXP               Expected Heterozygosity           Expected heterozygosity (Nei's 1978 unbiased heterozygosity).
  clover*      HETEROBS               Observed Heterozygosity           Observed heterozygosity.
  clover*       POLYLOCI                  Polymorphic Loci              Percent of polymorphic loci.
  cucumis       CSATGPI1         glucosephosphate isomerase loc         glucosephosphate isomerase locus 1.
  cucumis       CSATGPI2         glucosephosphate isomerase loc         glucosephosphate isomerase locus 2
  cucumis       CSATIDH               isocitrate dehydrogenase          isocitrate dehydrogenase
  cucumis      CSATMDH1             malic dehydrogenase locus 1         malic dehydrogenase locus 1
  cucumis      CSATMDH2             malic dehydrogenase locus 2         malic dehydrogenase locus 2
  cucumis      CSATMDH3             malic dehydrogenase locus 3         malic dehydrogenase locus 3
  cucumis    12 additional isozymes
   maize      LOCUS-CAT3                   locus catalase3              Locus cat3 catalase3
   maize      LOCUS-GOT1          locus gluta-oxa. transaminase1        Locus got1 glutamate-oxaloacetic transaminase1
   maize      LOCUS-GOT2          locus gluta-oxa. transaminase2        Locus got2 glutamate-oxaloacetic transaminase2
   maize      LOCUS-GOT3          locus gluta-oxa. transaminase3        Locus got3 glutamate-oxaloacetic transaminase3
   maize      LOCUS-IDH1           locus isocitr. dehydrogenase1        Locus idh1 isocitrate dehydrogenase1
   maize      LOCUS-IDH2           locus isocitr. dehydrogenase2        Locus idh1 isocitrate dehydrogenase2
   maize      LOCUS-MDH1           locus malate dehydrogenase1          Locus mdh1 malate dehydrogenase1
   maize      LOCUS-MDH2           locus malate dehydrogenase2          Locus mdh2 malate dehydrogenase2
   maize      LOCUS-MDH3           locus malate dehydrogenase3          Locus mdh3 malate dehydrogenase3
   maize      LOCUS-MDH4           locus malate dehydrogenase4          Locus mdh4 malate dehydrogenase4
   maize      LOCUS-MDH5           locus malate dehydrogenase5          Locus mdh5 malate dehydrogenase5
   maize     12 additional isozymes
                                                                        Aconitate hydratase; locus 1 (Aco1; 4.3.1.3). Comment: See Cronn et al. TAG
 sunflower         ACO1               aconitate hydratase - 1           (1997) 95:532-545 for locus and allele designation.
                                                                        Aconitate hydratase; locus 2 (Aco1; 4.3.1.3). Comment: See Cronn et al. TAG
 sunflower         ACO2               aconitate hydratase - 2           (1997) 95:532-545 for locus and allele designation.
                                                                        isocitrate dehydrogenase; locus 1 (Idh1; E.C. 1.1.1.41). Comment: See Cronn et
 sunflower         IDH1             isocitrate dehydrogenase - 1        al. TAG (1997) 95:532-545 for locus and allele designation
                                                                        NAD+ malate dehydrogenase; locus 1 (Mdh1; E.C. 1.1.1.37). Comment: See
  sunflower      MDH1           NAD+ malate dehydrogenase - 1           Cronn et al. TAG (1997) 95:532-545 for locus and allele designation
  sunflower 7 additional isozymes
   woody-
 landscape     ISOZYME                isozyme marker                    Isozyme marker characterization (by locus when possible)
*Summary statistics listed by accession.   Allele data not presented.
Field size limitation: link names for different
descriptors appear identical.




   Cucumis molecular
   descriptors in GRIN
                          Isozyme descriptors in GRIN
       CROP          DQNAME                    GRIN link name                                               definition
      clover*       ALLELEEFF                 Allele Effectiveness      Effective number of alleles per locus; based on 10 isozyme loci with 28 alleles
      clover*       ALLELENUM                    Allele Number          Mean number of alleles per polymorphic locus.
      clover*       HETEREXP               Expected Heterozygosity      Expected heterozygosity (Nei's 1978 unbiased heterozygosity).
      clover*       HETEROBS               Observed Heterozygosity      Observed heterozygosity.
      clover*        POLYLOCI                  Polymorphic Loci         Percent of polymorphic loci.
      cucumis        CSATGPI1         glucosephosphate isomerase loc    glucosephosphate isomerase locus 1.
      cucumis        CSATGPI2         glucosephosphate isomerase loc    glucosephosphate isomerase locus 2
      cucumis        CSATIDH               isocitrate dehydrogenase     isocitrate dehydrogenase
      cucumis       CSATMDH1             malic dehydrogenase locus 1    malic dehydrogenase locus 1
      cucumis       CSATMDH2             malic dehydrogenase locus 2    malic dehydrogenase locus 2
      cucumis       CSATMDH3             malic dehydrogenase locus 3    malic dehydrogenase locus 3
      cucumis     12 additional isozymes
       maize       LOCUS-CAT3                   locus catalase3         Locus cat3 catalase3
       maize       LOCUS-GOT1          locus gluta-oxa. transaminase1   Locus got1 glutamate-oxaloacetic transaminase1
       maize       LOCUS-GOT2          locus gluta-oxa. transaminase2   Locus got2 glutamate-oxaloacetic transaminase2
       maize       LOCUS-GOT3          locus gluta-oxa. transaminase3   Locus got3 glutamate-oxaloacetic transaminase3
       maize       LOCUS-IDH1           locus isocitr. dehydrogenase1   Locus idh1 isocitrate dehydrogenase1
       maize       LOCUS-IDH2           locus isocitr. dehydrogenase2   Locus idh1 isocitrate dehydrogenase2
       maize       LOCUS-MDH1           locus malate dehydrogenase1     Locus mdh1 malate dehydrogenase1
       maize       LOCUS-MDH2           locus malate dehydrogenase2     Locus mdh2 malate dehydrogenase2
       maize       LOCUS-MDH3           locus malate dehydrogenase3     Locus mdh3 malate dehydrogenase3
       maize       LOCUS-MDH4           locus malate dehydrogenase4     Locus mdh4 malate dehydrogenase4
       maize       LOCUS-MDH5           locus malate dehydrogenase5     Locus mdh5 malate dehydrogenase5
       maize      12 additional isozymes
                                                                        Aconitate hydratase; locus 1 (Aco1; 4.3.1.3). Comment: See Cronn et al. TAG
      sunflower        ACO1               aconitate hydratase - 1       (1997) 95:532-545 for locus and allele designation.
                                                                        Aconitate hydratase; locus 2 (Aco1; 4.3.1.3). Comment: See Cronn et al. TAG
      sunflower        ACO2               aconitate hydratase - 2       (1997) 95:532-545 for locus and allele designation.
                                                                        isocitrate dehydrogenase; locus 1 (Idh1; E.C. 1.1.1.41). Comment: See Cronn et
      sunflower        IDH1            isocitrate dehydrogenase - 1     al. TAG (1997) 95:532-545 for locus and allele designation
                                                                        NAD+ malate dehydrogenase; locus 1 (Mdh1; E.C. 1.1.1.37). Comment: See
       sunflower      MDH1           NAD+ malate dehydrogenase - 1      Cronn et al. TAG (1997) 95:532-545 for locus and allele designation
  *              7 additional isozymes
       sunflower statistics listed by accession.
      Summary
        woody-
Should a naming convention be used across crops for molecular descriptors? In
      landscape     ISOZYME                isozyme marker         Isozyme marker characterization (by locus when possible)
                         general, Allele is done with morphological descriptors.
 *Summary statistics listed by accession. thisdata not presented.
                   A sampling of molecular descriptors
        Crop         DQNAME               GRIN list name
                                       GRIN link name              definition
alfalfa           GENEDIST     Chloroplast DNA hypervariability   Chloroplast DNA hypervariability. The average distance relative to all other measured. Additional com
clover            ALLELEEFF    Allele Effectiveness               Effective number of alleles per locus; based on 10 isozyme loci with 28 alleles
clover            ALLELENUM    Allele Number                      Mean number of alleles per polymorphic locus.
clover            HETEREXP     Expected Heterozygosity            Expected heterozygosity (Nei's 1978 unbiased heterozygosity).
cucumis           CSATGPI1     glucosephosphate isomerase loc     glucosephosphate isomerase locus 1.
cucumis           CSATGPI2     glucosephosphate isomerase loc     glucosephosphate isomerase locus 2
cucumis           CSATIDH      isocitrate dehydrogenase           isocitrate dehydrogenase
cucumis           CSATMDH1     malic dehydrogenase locus 1        malic dehydrogenase locus 1
cucumis           CSATMDH2     malic dehydrogenase locus 2        malic dehydrogenase locus 2
cucumis           CSATMDH3     malic dehydrogenase locus 3        malic dehydrogenase locus 3
maize             LOCUS-GOT1   locus gluta-oxa. transaminase1     Locus got1 glutamate-oxaloacetic transaminase1
maize             LOCUS-GOT2   locus gluta-oxa. transaminase2     Locus got2 glutamate-oxaloacetic transaminase2
maize             LOCUS-GOT3   locus gluta-oxa. transaminase3     Locus got3 glutamate-oxaloacetic transaminase3
maize             LOCUS-IDH1   locus isocitr. dehydrogenase1      Locus idh1 isocitrate dehydrogenase1
maize             LOCUS-IDH2   locus isocitr. dehydrogenase2      Locus idh1 isocitrate dehydrogenase2
maize             LOCUS-MDH1   locus malate dehydrogenase1        Locus mdh1 malate dehydrogenase1
maize             LOCUS-MDH2   locus malate dehydrogenase2        Locus mdh2 malate dehydrogenase2
maize             LOCUS-MDH3   locus malate dehydrogenase3        Locus mdh3 malate dehydrogenase3
maize             LOCUS-MDH4   locus malate dehydrogenase4        Locus mdh4 malate dehydrogenase4
maize             LOCUS-MDH5   locus malate dehydrogenase5        Locus mdh5 malate dehydrogenase5
maize             P-PHI024     p-phi024-cct(SSR)                  p-phi024-cct (SSR).
sugarbeet-rapd    AB09         Primer AB09                        Primer AB09
sugarbeet-rapd    AB11         Primer AB11                        Primer AB11
sugarbeet-rapd    AC15         Primer AC15                        Primer AC15
sugarbeet-rapd    AD04         Primer AD04                        Primer AD04
sunflower         ACO1         aconitate hydratase - 1            Aconitate hydratase; locus 1 (Aco1; 4.3.1.3). Comment: See Cronn et al. TAG (1997) 95:532-545 for
sunflower         ACO2         aconitate hydratase - 2            Aconitate hydratase; locus 2 (Aco1; 4.3.1.3). Comment: See Cronn et al. TAG (1997) 95:532-545 for
sunflower         IDH1         isocitrate dehydrogenase - 1       isocitrate dehydrogenase; locus 1 (Idh1; E.C. 1.1.1.41). Comment: See Cronn et al. TAG (1997) 95:5
sunflower         MDH1         NAD+ malate dehydrogenase - 1      NAD+ malate dehydrogenase; locus 1 (Mdh1; E.C. 1.1.1.37). Comment: See Cronn et al. TAG (1997
vaccinium         CA112F       SSR-CA112F Vaccinium DQ            GenBank Accession Number: CF810443 SSR Motif: (AG)7 Forward Primer: TCCACCCACTTCACA
vaccinium         CA169F       SSR-CA169F name derived            GenBank Accession Number: CF811071 SSR Motif: (GAT)4 Forward Primer: TAGTGGAGGGTTTT
vaccinium         CA190R       SSR-CA190R from EST source         GenBank Accession Number: CF811085 SSR Motif: (TGC)5 Forward Primer: TTATGCTTGCCATG
vaccinium         CA236F       SSR-CA236F name.                   GenBank Accession Number: CF810540 SSR Motif: (TG)17 Forward Primer: GTTAAGCTTTTAGA
woody-landscape   CHEMMARK     chemical marker                    Pigmentation and other chemical marker characterization (by locus when possible).
woody-landscape   DNA          DNA marker                         DNA marker Characterization (by locus when possible)
woody-landscape   ISOZYME      isozyme marker                     Isozyme marker characterization (by locus when possible)
woody-landscape   MORPHMARK    morphological marker               Morphological marker characterization (by locus when possible)


  Currently every molecular descriptor is unique; DQ name and definition.
  There is significant variation in definition field content.
MWM




                                                              MWM
               Aragon                                 Yonca
                                       Hunter River




      Ted Kisha, W6, SSR gel image and information.


      SSR gel (Licor) of individuals from three
                  alfalfa cultivars.
  SSR and other PCR-based descriptors in GRIN
 CROP        DQNAME         GRIN link name                                                                Definition
                                               Chloroplast DNA hypervariability. The average distance relative to all other measured. Other data downloadable as
                             Chloroplast DNA Excel:135 by 135 matrix and Genetic distance between 2 accessions(8972 combinations)- click on Chloroplast DNA
 alfalfa     GENEDIST         hypervariability hypervariabili.
                                               [Data visible by selecting hazelnut/list of descriptors/molecular. Select descriptor. Select FILBERT. MEHLENBACHER.
                                               Select Mehlenbacher, S., Oregon State University. Select Cultivated.Hazelnut.SSR.2005. Select View a table of the SSR
hazelnut    hidden SSRs            NA          data as an Excel Spreadsheet.] [Data from 20 SSRs, 270 cultivars.]
 maize        P-PHI024      p-phi024-cct(SSR) p-phi024-cct (SSR).
                                               GenBank Accession Number: CF810443 SSR Motif: (AG)7 Forward Primer: TCCACCCACTTCACAGTTCA Reverse
                                               Primer: GTTTATTGGGAGGGAATTGGAAAC Optimum Annealing Temperature: 62 C Separation: ABI 3100 Capillary
                                               Electrophoresis. Comment: Dye: Fam (Operon) Allele Size: 142-184 bp SSR-CA112F (Jeannie Rowland's EST library of
vaccinium      CA112F         SSR-CA112F       cold-acclimated 'Bluecrop' flower buds) BLAST Hit: None BLAST Value: None SSR Location: Unknown
                                               GenBank Accession Number: CF811071 SSR Motif: (GAT)4 Forward Primer: TAGTGGAGGGTTTTGCTTGG Reverse
                                               Primer: GTTTATCGAAGCGAAGGTCAAAGA Optimum Annealing Temperature: 62 C Separation: ABI 3100 Capillary
                                               Electrophoresis. Comment: Dye: Fam (Operon) Allele Size: 109-136bp SSR-CA169F (Jeannie Rowland's EST library of
vaccinium      CA169F         SSR-CA169F       cold-acclimated 'Bluecrop' flower buds) BLAST Hit: None BLAST Value: None SSR Location: Unknown
                                               GenBank Accession Number: CF811085 SSR Motif: (TGC)5 Forward Primer: TTATGCTTGCCATGGTGGTA Reverse
                                               Primer: TTGCGAAGGGACCTAGTAGC Optimum Annealing Temperature: 62 C Separation: Beckman CEQ 8000
                                               Capillary Electrophoresis. Comment: Dye: Light Sabre Blue (Synthegen) Allele Size: 250-280 bp SSR-CA190R (Jeannie
                                               Rowland's EST library of cold-acclimated 'Bluecrop' flower buds) BLAST Hit: None BLAST Value: None SSR Location:
vaccinium     CA190R          SSR-CA190R       Unknown
                                               GenBank Accession Number: CF810540 SSR Motif: (TG)17 Forward Primer: GTTAAGCTTTTAGATGAGTTGATGG
                                               Reverse Primer: GTTTAACCAGTCCCAGACCCAAAT Optimum Annealing Temperature: 64 °C Separation: Beckman
                                               CEQ 8000 Capillary Electrophoresis. Comment: Dye: Light Sabre Blue (Synthegen) Allele Size: 214-241 bp SSR-
                                               CA236F (Jeannie Rowland's EST library of cold-acclimated 'Bluecrop' flower buds) BLAST Hit: None BLAST Value:
vaccinium      CA236F         SSR-CA236F       None SSR Location: Unknown
                                               GenBank Accession Number: CF810543 SSR Motif: (AGA)6 Forward Primer: GAGAGGGTTTCGAGGAGGAG Reverse
                                               Primer: GTTTAGAAACGGGACTGTGAGACG Optimum Annealing Temperature: 62 C Separation: ABI 3100 Capillary
                                               Electrophoresis. Comment: Dye: Hex (Operon) Allele Size: 155-164 bp SSR-CA23F (Jeannie Rowland’s EST library of
vaccinium      CA23F           SSR-CA23F       cold-acclimated ‘Bluecrop’ flower buds) BLAST Hit: None BLAST Value: None SSR Location: Unknown
                                               GenBank Accession Number: CF811000 SSR Motif: (GA)14..(CGA)5 Forward Primer: CGCGTGAAAAACGACCTAAT
                                               Reverse Primer: GTTTACTCGATCCCTCCACCTG Optimum Annealing Temperature 64 C Separation: Beckman CEQ
                                               8000 Capillary Electrophoresis. Comment: Dye: Light Sabre Green (Synthegen) Allele Size: 225-258 bp SSR-CA855F
                                               (Jeannie Rowland's EST library of cold-acclimated 'Bluecrop' flower buds) BLAST Hit: Oryza cDNA clone (AK100986)
vaccinium      CA855F         SSR-CA855F       BLAST Value: 6.00E-21 SSR Location: 5' UTR
vaccinium   22 additional SSRs
  woody-
landscape       DNA           DNA marker      DNA marker Characterization (by locus when possible)

           Blueberry descriptor definition field includes more information than any other crop.
     Blueberry SSR data model
          A tour through public GRIN…
or, what the information looks like to our users….




                          Nahla Bassil, Corvallis
   Select “Research Crops and
Descriptor/Evaluation Data Queries”.
Select “VACCINIUM”
Select “List of Descriptors”
Abbreviated SSR definition on this page.
Combined GRIN/information based choice?


        Select “SSR-CA112F”
     CA stands for “cold acclimated”. (Only defined in
     embedded excel worksheet.)
     Actual descriptor name does not include SSR-
     (affects ability to search in oracle forms
     database version).
             Actual descriptor name does not include SSR- (affects ability
             to search in oracle forms database version).



             Full descriptor definition on this page. Contains
             descriptor specific information for this
             evaluation. More detail than any other descriptor.




                   Select “Observed values”
In sunflower, the equivalent field is named “code values”.
Definition indicated allele range of 142-184 bp.




Go back to the full descriptor definition page.
              Actual descriptor name does not include SSR- (affects
              ability to search in oracle forms database version).




(Called study or environment on this page.)

                  Select “CULTIVATED
                  BLUEBERRY.SSR.2005”
              (Called evaluation on this page.)




Actual descriptor name does not include VACCINIUM (affects
ability to search in oracle forms database version).

     If select “VACCINIUM CA112F”, will go
     back to full definition page.

     If select “54 Accessions …
Blueberry accessions are clonal.
In an out crossing seed crop, data
in this category could look like….
Population sample size critical
information to include.




  Back to the
  evaluation page…
Select “an Excel Spreadsheet”.
Table 1. Fingerprints of 69 blueberry accessions using 13 SSR loci developed in the CULTIVATED.BLUEBERRY.SSR.2005 study from a floral bud cold acclimated (CA) EST

 Accession                                          Genotype                                                                  SSR Loci
     #     clocal     local        taxon           Designation  CA23F             CA112F            CA169F                CA190R            CA236F            CA344F            CA421F
PI 554833 CVAC         1190 Vaccinium corymbosum L. 1613A       155/158           142/144/146       112/115               240/243           238               153/156/159/162   180/182/192
PI 554798 CVAC       47.001 Vaccinium corymbosum L. Atlantic    155/158           142/148           109/112/115/127       240/243/246       238               156/159/162       170/182/186/210
                                                            a
                            Vaccinium corymbosum L. Aurora      155/158           142/144/146       109/112/121           240/243           230               156/159/168       170/180/182
PI 554883     CVAC      849 Vaccinium corymbosum L. Berkeley    155/158           142/144           109/112/115/121       240/243/246       225/230           156/159/162       186/190/192/198
PI 618193     CVAC     1344 Vaccinium hybrid        Biloxi      155/158           142/144/146       112/127               240               230               147/153/159/168   170/182/192/224
PI 554827     CVAC      851 Vaccinium corymbosum L. Bluecrop    155/158           142               109/115               240               230/238           153/156/162/168   166/170/182/198
PI 554846     CVAC      226 Vaccinium corymbosum L. Bluejay     155/158           142/144/146/148   115/121               240/243/246       225/230           160/162/173       186/192/198
PI 554799     CVAC      853 Vaccinium corymbosum L. Blueray     155/158           142/144/148       109/112/115           240/243/246       230/238           153/156           166/170/180/198
PI 554837     CVAC      225 Vaccinium corymbosum L. Bluetta     155/158           142/144/146       112/115/118/121       240/246           0                 156/157/160/162   166/180/184/222
PI 554826     CVAC   78.001 Vaccinium corymbosum L. Cabot       158               142/144/149       112/115/121/127       240/243           225/230           153/154/156/160   166/176/180/210
                                                              b
                            Vaccinium corymbosum L. Chandler    155/158           142/144           109/115/121/127       240               238               153/156/162       170/182/192/198
PI 554829     CVAC   53.001 Vaccinium corymbosum L. Coville     155               142               109/112/115/121       240/243/246       230/238           153/156/160/168   166/182/190/198
PI 618035     CVAC     1020 Vaccinium corymbosum L. Darrow      155/158           142/146           109/115/127           243               225               156/162           176/190/192/198
                                                            b
                            Vaccinium corymbosum L. Draper      155               142               109/112/115           240/243/246       222/230           153/156/159       166/186/198/206
PI 554872     CVAC      703 Vaccinium corymbosum L. Duke        155/158           142/144           112/115               240/246           230/238           156/160/162       166/186/198
PI 554893     CVAC      859 Vaccinium corymbosum L. Earliblue   155/158           142/144/149       112/115/121           240/243           225               156/160/162       166/192/198/222
PI 554894     CVAC      701 Vaccinium corymbosum L. Elliott     155/158           142/144/146       109/115/121/127       243/246           230               153/156           182/190
                                                    Emeralda    155/158           142/171           109/112/115/136       240/246           225/230           153/156/159/168   170/186
PI 554957     CVAC      720 Vaccinium hybrid        Flordablue  155               142/144/172       112/115/121           240/246           230               156/159/162       174/186/192
PI 554873     CVAC      721 Vaccinium corymbosum L. Georgiagem 155/158            142/144           109/112/115           246               223/230           156/159/162       170/192/198
PI 554804     CVAC   57.001 Vaccinium corymbosum L. Grover      155/158           142/144           109/112/115           240/246           224/229/230       156/168/170       176/182/186/194
PI 554805     CVAC   91.001 Vaccinium corymbosum L. Herbert     155/158           142/149           109/115               240/243           230               153/156/159       166/182/186/190
PI 554807     CVAC   92.001 Vaccinium corymbosum L. Ivanhoe     155/158           142/144/149       109/112/115/121       240/243           0                 153/162/168       166/184/192/222
PI 554808     CVAC   90.001 Vaccinium corymbosum L. Jersey      155/158           142/144/149       109/112/115           240/243/246       230/238           156/162/168       176/182/186/198
                                                    Jewela      155/164           142/146           109/112/115/136       240/243/246       225               147/159/165       168/172/186/222
PI 554810     CVAC   63.001 Vaccinium corymbosum L. June        238               153/156/159/162   170/182/192/222       310/326/328       238               153/156/159/162   170/182/192/222
PI 618164     CVAC     1310 Vaccinium hybrid        Legacy      0                 156/159/162/168   170/182/190/192       303/318           0                 156/159/162/168   170/182/190/192
                                                            a
                            Vaccinium corymbosum L. Liberty     230               153/156/160       170/182/198           318               230               153/156/160       170/182/198
PI 618194     CVAC     1345 Vaccinium hybrid        Magnolia    230/232           153/156/159/162   166/170/180/186       318/328           230/232           153/156/159/162   166/170/180/186
PI 554832     CVAC   82.001 Vaccinium corymbosum L. Meader      225/230           156/162/168       166/170/192           310/328           225/230           156/162/168       166/170/192
                                                    Millenniaa  225               153/156/168       170/186               0                 225               153/156/168       170/186
PI 555317     CVAC      718 Vaccinium corymbosum L. Misty       225/230/232       153/156/162/165   186/195/198/220       312/328           225/230/232       153/156/162/165   186/195/198/220
PI 554952     CVAC      702 Vaccinium hybrid        Northland   225/232           156/162           180/182/186/190       0                 225/232           156/162           180/182/186/190
PI 554943     CVAC      217 Vaccinium hybrid        Northsky    0                 156/162/165       170/180/206/222       297/318/322       0                 156/162/165       170/180/206/222
PI -          CVAC     1308 Vaccinium corymbosum L. Nui         230               153/156/162       170/182/192/206       318/326           230               153/156/162       170/182/192/206
PI 554812     CVAC      228 Vaccinium corymbosum L. Olympia     229/230/232       156/159/170       170/176/180           309/339           229/230/232       156/159/170       170/176/180
PI 554944                                           O’ Nealb    225/238           154/159/162       166/198/222           318/328           225/238           154/159/162       166/198/222
PI -          CVAC     1321                         Ozarkblue   223/238           159/160/162/168   166/170/182/192       316/329           223/238           159/160/162/168   166/170/182/192
PI 554843     CVAC      864 Vaccinium corymbosum L. Patriot     230               156/162           166/182/192/198       318/328           230               156/162           166/182/192/198
PI 618192     CVAC     1343 Vaccinium hybrid        Pearl River 225/228/230/235   147/155/156/159   172/180/190/212/224   310/316/318/333   225/228/230/235   147/155/156/159   172/180/190/212/224
PI 554815     CVAC   68.001 Vaccinium corymbosum L. Pioneer     232               156/159/162       170/180/182/210       303               232               156/159/162       170/180/182/210
PI 554816     CVAC   69.001 Vaccinium corymbosum L. Rancocas    230               153/156/162       170/182/198/222       297/310/318       230               153/156/162       170/182/198/222
a
    Patented material obtained from Fall Creek Farm and Nursery (Lowell, Ore.) with permission from the University of Florida or University of Michigan
b
    Non-patented material obtained from Fall Creek Farm and Nursery (Lowell, Ore.)


     Partial listing of CA-type Vaccinium SSRs (descriptors) and observation values.
           Other SSR types (NA, VCC) listed on separate worksheets in the file.
Is useful information missing from
       the blueberry model?

 Publication reference
 BLAST date, search algorithm and database(s) searched
 Population size or sampling information
 Summary statistics (in publication?)

            Information Organization
Put all common descriptor data in evaluation page
description.
Grape SSR data presented by Chuck
 What information should be included?
Experimental details, raw data: Information to allow use of
markers by other labs.
Summary statistics: Information to assess accession diversity.

 How to name descriptors?
 Currently each molecular descriptor is unique. Most will be.
    Should descriptors follow a naming convention across crops?
    Introduce a new field containing molecular marker type (SSR, SNP
    etc) to facilitate cross-genera searching.
    Descriptor definitions should contain descriptor unique information.

 How to define evaluation (environment)?
 Significant variation in content in definition and evaluation fields.
    Should definitions contain similar information across data types and crops?
    Evaluation/environment definitions should contain information in common
    to all descriptors in that evaluation.
        Structure of molecular data in GRIN
  Three models are currently in use. B is most common.
      A                           B                        C
  CROP                        CROP                     CROP
  CROP-isozyme                  molecular                molecular
                                   isozyme#1                isozyme
  CROP-SSR                         SSR#1                       enzyme locus
  CROP-SNP                         SSR#2                    SSR
  etc.                             SSR#3                       DQ name
                                                               DQ name
                                   SNP#1
                                                            SNP
                                   SNP#2                       DQ name
                                   etc.
                                                               DQ name
                                                            etc.

Consider how data organization affects searching ability in GRIN curators
database version (oracle forms).
Which format best handles multiple accessions with multiple descriptors within
multiple data types (blueberry model of 54/28 is a conservative amount of data)?
      Re-categorize some molecular descriptors
                                                                                                                                     Proposed        proposed
  CROP        DQNAME              GRIN link name                                Definition                                           category        descriptor
  grape     GENOMESZBP         Genome Size Base Pairs Genome size in millions of base pairs per haploid genome                        cytologic      no change
  grape     GENOMESZPG        Genome Size in picograms Genome size in picograms per diploid genome.                                   cytologic      no change
                                                                                                                                    physiology or
 hazelnut   DORMALLELE*            dormancy alleles       dormancy alleles                                                             stress         no change
                                                                                                                                    physiology or
 hazelnut   INCOMPATAL*         incompatibility alleles   incompatability alleles, where d = dominant and r = recessive                stress         no change
                                                          Accessions crossed to various male-sterile (A-lines) lines in
                                                          order to test their ability to restore fertility in F1 hybrids within a
 sorghum       RESTORER            B/R line restorer      particular cytoplasmic system.                                              cytologic     cytoplasm type
* no information in GRIN about how data were obtained.




other chromosome related information presented in the category “cytologic”
other cytoplasmic male sterility data presented in the category “cytoplasm type”
              Summary: Molecular Session
          What information should be included in GRIN?
                   What do users want to see?


Information to include in descriptor definition (as per SSR data model).
Experimental details unique to individual descriptor such as:
Primer sequences          Population sampling size
GenBank reference         Publication reference or information source.
For BLAST search results, include search algorithm, date of search
and database(s) searched.

Information to include in evalutation/environment definition.
Experimental details in common to all descriptors in environment.
Sample gel image(s) with standards (molecular weight and standard accession).

Include allele sizes and frequency data in GRIN.
         Summary: Molecular Session

     How should the data be organized and presented
     in GRIN?
         Would standardization of presentation format make
         searching GRIN easier and assist database connectivity?


Select descriptor name to allow cross crop searching.

Introduce a new field containing molecular marker type (SSR,
SNP etc) to facilitate cross crop searches.

Embed information links in GRIN not on local WEB pages.

Consider re-categorization of descriptors to streamline searching.
                   Helianthus niveus ssp. niveus
endemic to Baja California, only Heilanthus taxa not represented in NPGS
  on the Pacific coast sand dunes west of Vincente Guerrero, BC, Mex

				
DOCUMENT INFO
Shared By:
Categories:
Tags:
Stats:
views:0
posted:1/30/2013
language:Latin
pages:36