Effect of Single Nucleotide Polymorfism in Affymetrix probes

Document Sample
Effect of Single Nucleotide Polymorfism in Affymetrix probes Powered By Docstoc
					   Effect of Single Nucleotide
   Polymorphism in Affymetrix
              probes
                   Olivia Sanchez-Graillet
Departments of Biological Sciences and Mathematical Sciences
                   University of Essex (UK)‫‏‬
                       December 2008
   Single Nucleotide
Polymorphisms (SNPs )‫‏‬
         SNPs: a single base pair is
         different between one
         individual and the other.

         Polymorphism: if at least two
         variants have frequencies >
         1% in a population.
   SNPs are the most common type of
    sequence variation between individuals.

   SNPs are markers of phenotypes and
    diseases.


   SNPs may alter the gene expression and
    may change or not the amino acid sequence.
    Other common variations:
   DIP: deletion/insertion polymorphism :   -/T , C/-
   STR: short tandem repeat (microsatellite) polymorphism
        (CA)19/20/21/22/23/24/25/26
   MIXED: cluster containing submissions from 2 or more alleleic classes
        -/AAA/AAAAA/AAAACCAAAAAAAAAAAAAAA
   MNP: multiple nucleotide polymorphism with alleles of common length > 1
        AAA/CCC
We are studying the
relationships between
probes intensities on
Affymetrix GeneChips.




                        Affymetrix Gene chips contain
                        thousands of probes
Probes map to different exons. Because of alternative splicing,
some of the exons may be upregulated whereas others may be
downregulated. We therefore focus on probes within exons.
   Probes mapping to the same exon should
    behave similarly.
   What causes Affymetrix probes to behave as
    outliers with respect to other probes within a
    single exon?

   Objective:
     Study  the impact of SNPs and other common
      variation upon Affymetrix probes on GeneChips.
     Explore whether the existence of a SNP causes a
      probe to behave differently to other probes which
      map uniquely to a single exon.
   Previous research on how SNPs might affect gene
    expression‫‏‬:
       Allele A is over-expressed compared to allele B or vs or both alleles
        are equally expressed (Kumari et al.,2007).
       Hybridization resulted from variation might mislead the interpretation
        of data from individual genes, even if a single probe is affected
        (Alberts et al., 2007).
       In 15 of 25 probesets, SNPs caused a difference in hybridization.
        Not every SNP causes a difference in hybridization (Alberts et al.,
        2007).
       When the SNPs located at the very beginning or end of a probe, it
        might have little or not effect on hybridization (Hughes et al., 2001).
Method:

 A) Generation of exon heatmaps
 B) Identification of probes containing SNPs.
 C) Study of SNP-probes which are outliers.
 (A) Generation of exon heatmaps
1.   CEL files are downloaded from the GEO
     database.
2.   Calibration of microarray data:
        Quality control: detection of spatial flaws.
        Row Quantile Normalisation.
3.   Correlate the intensities for groups of probes,
     using many thousands of GeneChip
     experiments.
Example flaw in CEL
file


W. B. Langdon et al. (2008). A Survey
of Spatial Defects in Homo Sapiens
Affymetrix GeneChips. In IEEE/ACM
Transactions on Computational
Biology and Bioinformatics.
Probe correlations



The correlation in log
intensities between Probe 9
and Probe 11 from probeset
208772_at, obtained from
5,638 HG-U133A
GeneChips.
Probe number on heatmap




 Average intensity in GEO



                                       Standard
The number in each square              deviation in
is the correlation multiplied          GEO
by 10 and rounded

   Blue = low correlation
  Yellow = high correlation




     Relative probe position on exon
4.   Unique mappings (alignments) of probes to individual
     exons (Sanchez-Graillet et al.,2008. Widespread existence of
     uncorrelated probe intensities from within the same probeset on Affymetrix
     GeneChips. In Journal of Integrative Bioinformatics, 5(2):98) :

        avoid cross-hybridization and multiple targeting.
        sense direction (antisense is avoided).

                                                      exon 1


                                                                                transcript 1


                                                                                                      
                                                     probe 1   (25 bases, 100% identity)‫‏‬




               exon 2                                                                       exon 3


                                         transcript 2                                                                 transcript 3   X

              probe 2   (25 bases, 100% identity)‫‏‬                                     probe 2       (25 bases, 96% identity)‫‏‬
(B,C) Identification of probes
 containing SNPs and outlier
         SNP probes
1.        SNPs data downloaded from Ensembl 48 :
         3'    UnTranslated Region, 5' UTR, and coding
              regions.
                                                               3'UTR
                                                                          transcript 1
                                       Gene 1
                                                                          transcript 2
                                                              3'downstream
                                  5'                                                                3'
                  Chromosome 10


                                   Gene 2                                           transcript 3
                                                             5'upstream




     snp_id         chrom_name     chrom_position   allele   gene_id                     trans_id          biotype
     rs11000776     10             75213225         G/A      ENSG00000172586             ENST00000372837   3downstream
     rs11000776     10             75213225         G/A      ENSG00000172586             ENST00000372833   3utr
     rs11000776     10             75213225         G/A      ENSG00000212959             ENST00000391642   5upstream
2.   Identification of exons with SNPs by using
     transcript information and chromosomic
     positions.
3.   Selection of unique exons and probes:
        Only unique exons with more than 4 probes.
        SNP positions on the probes uniquely
         mapping to exons are obtained.
4.   Identification of SNP-probes which are
     outliers:
        The overall correlation matrix median
         (OMM) is compared with each SNP-probe
         median (SPM).
        If OMM – SPM >= 0.15
OMM       SPM_8     SPM_9
0.87      0.84      0.21
Difference 0.03<0.15 0.66>0.15




                                 SNP in an          SNP in an
                                 no-outlier probe   outlier probe
Results
ENSE00001454795
HG_U133_Plus_2




                  O
                  N
                  N
                  N
                  N
ENSE00001191156
HG_U95A

SNP in overlapped probes.

The same SNP is in outlier
probes and no-outliers
probes




Probe position heatmap       probe_id        snp_id       snp position   allele     sequence                  Outlier

   10                1045_s_at-109-625       rs45612038         14       T/C      CTTCAAGAGCATCATGAAGAAGAGT   O
    9                    1045_s_at-237-557   rs45612038         16       T/C      ACCTTCAAGAGCATCATGAAGAAGA   O
    8                    1045_s_at-357-497   rs45612038         18       T/C      AGACCTTCAAGAGCATCATGAAGAA   N
    7                    1045_s_at-586-137   rs45612038         20       T/C      TGAGACCTTCAAGAGCATCATGAAG   N
    6                    1045_s_at-233-503   rs45612038         23       T/C      ATATGAGACCTTCAAGAGCATCATG   N
    5                    1045_s_at-153-611   rs45612038         25       T/C      ACATATGAGACCTTCAAGAGCATCA   N
  ENSE0000129003
  HG_U133A

  SNPs in only
  no-outlier probes




snp_id       probe_id             probe_position_heatmap snp_position_probe allele   seq

rs11038     221667_s_at-512-441            10                   13            A/G    GTTTATGATCTGACCTAGGTCCCCC   N
rs6413487   221667_s_at-570-641             9                     7           C/G    TAAGGACGCTGGGAGCCTGTCAGTT   N
 ENSE00001416163
 HG_U133A
 (5,374 CEL files)

 SNP in only outlier
 probes




snp_id    probe_id            probe_position_heatmap snp_position_probe allele    sequence

rs13505   219768_at-2-233                 8                   24          C/A    CTGAATTTAGATCTCCAGACCCTGC   O
rs13505   219768_at-602-267               9                   4           C/A    CCTGCCTGGCCACAATTCAAATTAA   O
ENSE00001416163
HG_U133_Plus_2
(2,572 CEL files)

SNP in both outlier
and no-outlier
probes




snp_id    probe_id            probe_position_heatmap snp_position_probe allele       sequence

rs13505   219768_at-765-395             8                      24        C/A     CTGAATTTAGATCTCCAGACCCTGC   N
rs13505   219768_at-507-443             9                       4        C/A     CCTGCCTGGCCACAATTCAAATTAA   O
ENSE00001416163
HG_U133A_2
(159 CEL files)

SNP in only
NO-outlier probes




snp_id    probe_id            probe_position_heatmap snp_position_probe allele     sequence

rs13505   219768_at-432-225             8                      24         C/A    CTGAATTTAGATCTCCAGACCCTGC   N
rs13505   219768_at-534-259             9                      4          C/A    CCTGCCTGGCCACAATTCAAATTAA   N
   ~60,000 SNPs distributed in unique exons of ten array
    designs.
       11% in unique exons in which all probes that contain the
        same SNP are outliers.
       5% in which not all the probes containing the same SNP
        are outliers.
       84% in which all probes are not outliers.


   These numbers may vary according to the Ensembl
    version used and the threshold for outliers chosen.
Examination of SNP-Outlier Associations

                   u r e)
                  O tlie (Y s       u r o
                                   O tlie (N )       o l
                                                    T ta


     N
    S P(Y s
         e)          1 .4
                      1 %              8 %
                                      8 .6          10
                                                     0%
                       = ,7 8
                     (n 1 8 )           =3 6)
                                      (n 1 ,8 9




     N
    S P(N )
         o           1 .6
                      1 %              8 %
                                      8 .4          10
                                                     0%
                       =7 3)
                     (n 1 ,2 1         = 3 ,0 5
                                     (n 1 1 3 )


     h      0
    P i =-.0 2
              Cross-validation for HG_U133_Plus_2
Median differences and positions of SNPs on probes in
HG_U133_Plus_2
Median differences and main alleles (A,C,T,G) found in SNPs in
HG_U133_Plus_2
   We have identified other causes of outlier probes:

     Probes  containing a contiguous run of 4 or more
      guanines: formation of G-quadruplexes occurring
      on the surface of a GeneChip. (Upton et al., BMC
      Genomics (in press)).


     Probes located next to bright probes, such as at
      the edge of the Genechip, are affected by blur.

     Motifs‫‏‬or‫‏‬any‫‏‬other‫“‏‬problematic”‫‏‬subsequences.
     Outlier SNP-probes in HG_U133_Plus_2
      with “problematic” sub sequences (PS):
         G’s (>=4), CCTCC, CCACC, GGTGG



                                                             11%

                Gs, CCTCC
                               40%
                CCACC, GGTGG
                                     With PS                            With PS
                                     Without PS                         Without PS

60%


                                                  89%



      Outlier probes                                No-outlier probes
Conclusions
   We have not found a common behaviour when SNPs
    are present in a probe.

   SNPs do not seem to cause outliers in groups of
    probes representing individual exons.

   SNPs may influence other biological events like
    alternative poly(A).

   The genomic region where SNPs are found, the
    position of the SNP in a probe, the main allele, and
    the number of SNPs in a probe does not make a
    probe an outlier in the correlation heatmap.
                 Bioinformatics Group
Dr Andrew Harrison       Physics
Dr Berthold Lausen       Statistics
Dr Abdel Salhi           Mathematics
Professor Graham Upton   Statistics
Dr William Langdon       Physics and Computer Sc.
Dr Olivia Sanchez        Computer Sc.
Dr Maria Stalteri        Inorganic Chemistry & Bioinformatics
Jose Arteaga-Salas       Statistics
Rohmatul Fajriyah        Statistics
Abdelhak Kheniche        Pharmacology & Mathematics
Rahim Bux Khokhar        Mathematics
Zain-Ul-Abdin Khurho     Mathematics
Farhat Memon             Computer Sc.
Joanna Rowsell           Mathematics
Thank you!
Adjacent probes within a cell on a GeneChip have the same sequence – a run of
Guanines will result in closely packed DNA with just the right properties to form
quadruplexes.

				
DOCUMENT INFO
Shared By:
Categories:
Tags:
Stats:
views:4
posted:11/25/2012
language:English
pages:37