ALTERNATIVE SPLICING by HC121107071638

VIEWS: 7 PAGES: 5

									                                                                                                       1
                            ALTERNATIVE SPLICING

Textbook: Pages 669-672.

Key words: exon, intron, small ribonucleoprotein particles (SNURPs), spliceosome, DNA splice
sites, branch-point DNA sequence, excised intron, lariat, RNAase, intron degradation, alternative
splicing, C-terminal domain of RNA polymerase II, recruitment of proteins by the CTD, different
patterns of phosphorylation.

      Although we only have about 20,000 to 25,000 genes we can make more than a hundred
thousand different proteins. This is because more than one type of mRNA from many of our genes
due to so-called alternative splicing of the primary RNA transcript from the genes.




                                                                 From: Wikipedia
          The splicing machinery involves both RNA (small nuclear RNA, or snRNA) and proteins.
The proteins include the specific proteins that bind to the snRNAs to from the specific small
ribonucleoprotein particles (SNURPs) and also a wide variety of regulatory proteins of splicing.
Different types of cells in our body (e.g. neurons vs liver cells) contain different sets of these
regulatory, with the result that different types of cells have different patterns of alternative
splicing. A neat example of this involves the synthesis of different forms of the protein called
tropomyosin. This protein is a Ca++ binding protein involved in muscle action in smooth and
skeletal muscle. The forms of tropomyosin are different in these two types of cells. The result is
that smooth and skeletal muscle cells difference in response to the Ca++ signal. (We will talk about
this at later time.) It turns out that other cells also have tropomyosins, but different types. The gene
for tropomyosin is the same in all our cells, but because of alternative splicing different mRNAs
fro tropomysosin are made in different cell types.
                                                                                                  2




The mechansism of RNA splicing

     Splicing has to be completely exact! If the cut between the exon and the intron is off by even
one ribonucleotide, then a frameshift error in ribosome reading of the mRNA message (translation)
will occur.
                                       Exon #1          Intron        Exon #2
Primary mRNA transcript:            THECOPSAWGARBAGESAMRUNOUT

                                     Exon #1   Exon #2
Correct mRNA after splicing:        THECOPSAWSAMRUNOUT

                                    Exon #1     Exon #2
Incorrect mRNA after splicing:     THECOPSAWG SAMRUNOUT

                                         RIBONUCLEOTIDE FROM INTRON

Remember that translation of the mRNA message has two rules:

                     (1) Read in triplets. The only difference in my example above is that we are
                         using a 24 letter alphabet rather than a four letter alphabet.

                     (2) Start at the triplet AUG (in our case at “THE”).

       Clearly, inserting a G into our sentence renders the reading of our sentence meaningless
after THECOPSAW since we have to read our sentence by the “triplet reading” rule.

In the ribosome exact triplet reading of the mRNA is a result of the complementary base-pairing
between the anticodons of transfer RNA (tRNA) and the mRNA. Nothing recognizes a specific
sequence of RNA better than the complementary sequence of RNA! So what better way to identify
the splice exactly than to use a complementary RNA strand!
                                                                                                              3
                              Complementary
                              RNA sequence
                               CACUCC
         AUGAUUGCAUCCGUGAGGAUUGCAUCCAUAACAGCAAUGCCAGAGCUACCGC
             Exon #1         Intron splice site                                               Exon #2
                             sequence
            So one splice site has been “marked”. Like the anticodon “marks” its complementary codon
      in mRNA. The complementary RNA shown in green above is packaged into a small nucleoprotein
      particle (SNURP).



Specific protein binds
to this part of the                                                    Specific protein binds
snRNA                                                                  to this part of the
                                                                       snRNA



                              CACUCC                                        A SNURP
                                                    snRNA


             complementary RNA sequence to the beginning of the intron

          It turns out that the cutting at the first splice site occurs first and froms a rather unexpected
      RNA molecule called a “lariat” because of its shape.
                               Complementary                       Complementary
                               RNA sequence                        RNA sequence
                     CACUCC              UCCUUAC
         AUGAUUGCAUCCGUGAGGAUUGCAUCCAUAACAGGAAUGCCAGAGCUACCGC
             Exon #1         Intron splice site                   Branch point                Exon #2
                             sequence                             sequence (purine –
                                                                  rich)

            The G at beginning of the intron acts as a nucleophilic attacker (remember organic
      chemistry!) of the A in the branch point sequence of the intron. The branch-pont sequenec in the
      intron is, of course(!), marked out by a SNURP containing the appopropriate complementary
      snRNA sequence.

           On the next page is a copy of Fig. 21-24 from your texbook.
                                                                                       4




                                       Becker et al. (2009) “the World of the Cell”



(1) The U1 snurp, with its RNA complementary to the first ribonucleotides of the intron,
    binds to the first splice site.

(2) The U2 snurp, with is RNA complementary to the branch-point sequence of the
    intron, binds to the intron.
                                                                                                  5
          (3) Three other snurps pile on, forming the beginning of a spliceosome.

          (4) The G nucleophilically “attacks” the A in the branch point sequence, forming a
              covalent bond.

          (5) Then the intron is cut off the second exon.

          (6) The two exons are then joined together by a covalent bond.

          (7) The intron RNA, now in the form of a “lariat”. The lariat is degraded into its
              individual ribonucleotides. These are then recyled into new RNA, maybe this time
              into an exon!

         Notice how this mechanism above never results in the dispersal of the exons into the
general nucleosome before they are joined together. They are kept close together to ensure they
can be joined together.

Role of the CTD of RNA polymerase II

         The C-terminal domain (CTD) of RNA polymerase is an amazing example of protein
intercation in cells. We have seen that:

    (1) Maximum phosphorylation of the CTD results in the release of the polymerase from the
        transcription factors TFIIB and TFIID, allowing the plymerase to start moving down the
        DNA template strand.

    (2) The methyl–G capping enzyme complex is recruited to the CTD upon a change the
        phosphorylation pattern of the CTD.

    (3) Recruitment of the components of the spliceosome.

     The components of the spliceosome (snurps and regulatory proteins) are recruited and
assembled on the CTD when the pattern of phosphorylation on the CTD changes yet again.
                                                         (1) The methyl-G cap has already
                                                             been added, so the capping
                                                             complex is no longer on the CTD.
                                                         (2) The “splicing factors” are the
                                                             snurps and regulatory proteins.
                                                         (3) Much of the spliceosome is
                                                             assembled on the CTD, but it is
                                                             pushed off before splicing actually
                                                             occurs in it.
                                                         (4) The recruited of the various
                                                             components of processing of the
                                                             primary RNA transcript are
                                                             assebled togther at the right time
                                                             by being “recruited” to the CTD.
                                                             Which particular processing
                                                             components at a given time is
                                                             determined by the changing
                                                             phosphorylation state of the CTD.
     Weaver (2005) “Molecular Biology”

								
To top