LISTERIA MONOCYTOGENES.pdf

Document Sample
LISTERIA MONOCYTOGENES.pdf Powered By Docstoc
					                     LISTERIA MONOCYTOGENES

                           Hin-chung Wong
                          Soochow University


________________________________________________________________

 1. INTRODUCTION
 2. TAXONOMY
     2.1. Taxonomy and General Characteristics
     2.2. DNA fingerprinting and Ribotyping
     2.3. Pulsed-field gel electrophoresis
     2.4. Variable-number tandem-repeats analysis
     2.5. Serotyping
     2.6. Lineages
 3. ECOLOGY AND OCCURRENCE IN FOODS
     3.1. Environment
     3.2. In Food Systems
 4. SURVIVAL OF L. MONCYTOGENES IN FOOD
     4.1. Dairy Products
     4.2. Meat and Meat Products
     4.3. Vegetables
 5. ISOLATION AND ENUMERATION
     5.1. Enrichment Procedures
     5.2. Isolation Procedures
     5.3. Confirmation of Listeria species
     5.4. Direct Plating for Isolation and Enumeration
     5.5. Rapid Detection of L. monocytogenes
            5.5.1. Fluorescent Immunoassay and Flow Cytometry
            5.5.2. Electrical Method
            5.5.3. Enzyme-linked Immunosorbent Assay
            5.5.4. Nucleic Acid Probe Hybridization Assays
            5.5.5. Polymerase chain reaction
            5.5.6. Real-time PCR
 6. CONTROL OF L. MONOCYTOGENES
     6.1. Temperature

                                                                1
      6.2. Acidity and organic acid
      6.3. Sodium Chloride
      6.4. Carbon Dioxide and Decreased Oxygen Levels
      6.5. Irradiation
      6.6. Chlorine
      6.7. Nitrate and Nitrite
      6.8. Bacteriocin
      6.9. Other Additives
      6.10. Combined factors
  7. PATHOGENICITY AND TOXIN PRODUCTION
      7.1. Forms of Human Listeriosis
      7.2. Characteristics of Virulent L. monocytogenes
      7.3. Invasiveness and Intracellular Growth
      7.4. Hemolysins of L. monocytogenes
             7.4.1. Production of Listeriolysin
             7.4.2. Purification of Listeriolysin
             7.4.3. Characteristics of Listeriolysin
             7.4.4. Toxicity of Listeriolysin
             7.4.5. Function of Listeriolysin
             7.4.6. Molecular Study of Listeriolysin
             7.4.7. The CAMP Factor
     7.5. Expression of virulence factors
  8. CONCLUSIONS
  9. REFERENCES
_______________________________________________________________




                                                                  2
1. INTRODUCTION

   Listeria is not a new organism. It was probably first seen in tissue sections
from patients as early as 1891 and was first isolated in 1911 from rabbit liver in
Sweden (Wehr, 1987). Listeria monocytogenes was first described in detail in
1926 causing a spontaneous epidemic of infection among laboratory animals.
The generic name was chosen in honor of the surgeon Lord Lister (McLauchlin,
1987). The first report of listeriosis in humans was by Nyfeldt in 1929. This
bacterium has been extensively used in studies on experimental infections in
animals, contributed significantly to the understanding of intracellular
pathogenicity of bacteria and cell-mediated immune system. However, the
isolation techniques were not always successful in the past. As the technique of
isolation and detection improved, and a number of outbreaks occurred over the
world, L. monocytogenes has become a new interest of study.

  Today's concern with Listeria is due to an increased awareness of the
organism's ability to cause food-borne disease and the isolation of Listeria from
foods (Schlech et al., 1983). Food-borne outbreaks implicating Listeria as the
causative agent have been relatively few (Table 1, 2) (McLauchlin, 1987; Wehr,
1987). A case of listeriosis associated with the consumption of a soft cheese
produced in England was reported. Phage-typing of 68 isolates of L.
monocytogenes from cheese samples and the factory showed that 97% were
indistinguishable from the strain isolated from the patient's cerebrospinal fluid
and stool (McLauchlin et al., 1990).




                                                                                 3
   In contrast to these epidemics, human listeriosis typically occurs sporadically.
Due to the changes in agricultural practices, listeriosis in animals has increased,
and also due to the use of untreated human sewage sludge and animal slurry on
agricultural land, listeriosis in human also has increased. In 1985, McLauchlin
estimated that 0.3 case per 105 of the total population, and one case of perinatal
listeriosis per 20,000 births in United Kingdom (Fig. 1) (McLauchlin, 1987).
Cases of adult and perinatal listeriosis also increased in the maritime provinces
of Canada (Schlech et al., 1983).




   The Food and Drug Administration has determined that there is zero
tolerance (<1 organism per 25 g of sample) for Listeria species in food. There
have been several recent recalls of products containing Listeria species; these
have generally consisted of dairy products, notably cheese and ice cream
(Butman et al., 1988).


2. TAXONOMY

2.1. Taxonomy and General Characteristics

   The Genus Listeria contains eight species: L. monocytogenes, L. ivanovii,
L.innocua, L. welshimeri, L. seeligeri, L. murrayi, L. grayi and L. denitrificans
(Seeliger and Jones, 1984). On the basis of numerical taxonomic, serological,

                                                                                  4
and DNA/DNA hybridization studies, a very close relationship was shown
between L. grayi and L. murrayi, and they were, respectively, 3-29% and 1-9%
related to other reference strains of Listeria (Rocourt et al., 1982). The
taxonomic position of these two species is controversial. It is generally agreed
that L. denitrificans is not a member of the Genus Listeria.

   Listeria spp. are regular short rods, 0.4-0.5 μm in diameter and 0.5-2 μm in
length. In older or rough cultures, filaments of 6-20 μm or more in length may
develop. They are Gram-positive, no capsule, no spores, aerobic and
facultatively anaerobic, and motile by a few peritrichous flagella when cultured
at 20-25 C.

  The colonies appear bluish gray by normal illumination and a characteristic
blue-green sheen is produced by obliquely transmitted light.

  Optimum growth temperature is between 30 and 37 C and limits of growth
1-45 C. Minimum growth temperature of L. monocytogenes, determined by
using a flooding technique, in a plate-type continuous temperature gradient
incubator, was 1.1 C. The growth of non-hemolytic Listeria was unobservable at
1.7 C (Junttila et al., 1988), and did not survive heating at 60 C for 30 min
(Seeliger and Jones, 1984).

   General biochemical characteristics are: catalase positive, oxidase negative,
cytochromes produced. Fermentative metabolism of glucose results in the
production of mainly L(+)-lactic acid. Acid but no gas produced from a number
of other sugars, Methyl red positive, Voges-Proskauer positive. Exogenous
citrate is not utilized. Organic growth factors are required. Indole is not
produced. Esculin and sodium hippurate are hydrolyzed. Urea is not hydrolyzed.
Gelatin, casein and milk are not hydrolyzed (Table 3) (Seeliger and Jones, 1984).
Aerobically, all species grow on glucose, forming lactic acid and/or acetic acid,
and maltose and lactose support growth of some strains, but sucrose did not
support growth of any strain tested. Anaerobically, only hexoses and pentoses
supported growth, and only lactic acid was formed (Pine et al., 1989).




                                                                               5
   Listeria strains are reported to be sensitive to ampicillin, carbenicillin,
cephaloridine, chloramphenicol, erythromycin, furazolidone, methicillin,
neomycin, novobiocin, oleandomycin, ticarcillin, azlocillin; less sensitive to
chlortetracycline, oxytetracycline, tetracycline, gentamicin, kanamycin,
nitrofurantoin, pencillin G, streptomycin. Strains are resistant to colistin sulfate,

                                                                                    6
nalidixic acid, polymyxin B and sulfonamides (Seeliger and Jones, 1984).

  A cryptic plasmid has been demonstrated in L. ivanovii (Seeliger and Jones,
1984).

   Bacteriocins are produced by a high proportion of strains examined. The
bacteriocins do not inhibit Gram-negative bacteria but are active against
staphylococci and bacilli (Seeliger and Jones, 1984).

Antibiotic susceptibility of foodborne L. monocytogenes strains were examined
by using the automated VITEK2 system. Clinical breakpoints for Listeria
susceptibility testing are defined according to the Clinical and Laboratory
Standard Institute (CLSI), in the present study the CLSI criteria for
staphylococci were applied. Among the 120 tested strains, 14 (11.7%) displayed
resistance to at least one antibiotic. In particular, resistance to one antibiotic was
more common than multiple resistance, i.e., 10 (8.3%) isolates were resistant to
one antibiotic, 3 (2.5%) to two antibiotics and one (0.8%) to five antibiotics.
Resistance to clindamycin was the most common, followed by linezolid,
ciprofloxacin, ampicillin and rifampicin, trimethoprim/sulphamethoxazole and,
finally, vancomycin and tetracycline. This study shows that L. monocytogenes
strains from food and food-processing environments are susceptible to the
antibiotics commonly used in veterinary and human listeriosis treatment (Table
4) (Conter et al., 2009).




                                                                                     7
 2.2. DNA fingerprinting and Ribotyping

   DNA fingerprinting and ribotyping can be used to discriminate strains of L.
monocytogenes isolated from foods or from clinical specimens (Baloga and
Harlander, 1991; Nocera et al., 1990; Wesley and Ashton, 1991). DNA
fingerprints were done by digesting the cellular DNA with restriction enzymes
(BamHI, HindIII, HaeIII, HhaI, EcoRI, and PstI) followed by agarose gel
electrophoresis. Ribotyping was performed by Southern blot hybridization with
a digoxigenin-labeled cDNA probe transcribed from E. coli 16S and 23S rRNA.
The most discriminating enzyme for ribotyping of strains was EcoRI, which
divided the 28 strains of L. monocytogenes into 6 ribotype groups. DNA
fingerprinting and ribotyping differentiated L. monocytogenes from other
Listeria species (Baloga and Harlander, 1991).

2.3. Pulsed-field gel electrophoresis

PFGE and other subtyping methos were used to analysis 44 human isolates from
apparently sporadic cases of infection in the Lombardy region and in the
Province of Florence, Italy, in the years 1996 to 2007. Based on the results of
the different subtyping methods, 10 occasions were detected when strains of L.
monocytogenes with the same subtype were isolated from more than one
listeriosis case. A total of 28 (66.7%) of 44 isolates were attributed to molecular
subtype clusters (Fig. 2) (Mammina et al., 2009).




                                                                                  8
2.4. Variable-number tandem-repeats analysis

Variable-number tandem-repeats analysis or multiple-locus variable-number
tandem-repeats analysis (MLVA) method for genotyping has proven to be a fast
and reliable typing tool in several bacterial species. The information provided
by two fully sequenced L. monocytogenes strains was used to develop a MLVA
assay coupled with high-resolution capillary electrophoresis and compared it to
pulsed-field gel electrophoresis (PFGE) (Lindstedt et al., 2008). In this method,
the flanking sequences for each of the VNTR loci in the sequenced strains were
aligned and primers were designed. The amplified products were separated by
capillary electrophoresis apparatus and the peaks was assigned to a distinct
allele number and statistically analyzed.

2.5. Serotyping

  Serological studies of L. monocytogenes began in the 1930's. Paterson
succeeded in recognizing serologically different O and H antigen patterns. A
modern serotyping scheme of L. monocytogenes was published by Seeliger and
Hohne (Seeliger and H:ohne, 1979).

   O-antigens are prepared from smooth cultures incubated on 1% glucose
tryptose agar for 24 h at 37C. The harvested cells are suspended in PBS (pH 7.2)
and boiled to destroy the H-antigens. Then phenol is added to a final
concentration of 0.5%. Ultrasonic treatment avoids spontaneous agglutination.
H-antigens are prepared by adding equal amounts of 0.6% formolised saline to
highly motile cultures in phosphate-buffered 1% glucose tryptose broth after
24-48 h incubation at 22-24C. Motility should be cheeked by hanging drop
preparations. Cultures showing rough form should not be used. Sometimes it
may be advisable to use H-antigens grown on the surface of semi-solid agar
medium.

  Antisera against O- and H-antigens are produced by rabbit. Before
immunisation is started the animal ought to be tested for the possible presence
of Listeria agglutinins. Rabbits with serum titers against Listeria of 1:80 and
above should not be used for the production of Listeria antisera. The antisera
are preserved in small aliquots in the deep-freeze without preservative.

                                                                                9
   Factor sera may be produced with strains selected and recommended by
Seeliger and Donker-Voet which are available from the National Collection of
Type Cultures London, The ATCC, Rockville, Md, USA, and the Listeria
Culture Collection of the Institute for Hygiene and Microbiology, Wurzburg,
Germany (Table 5). The procedures for obtaining factor sera by adsorption test
is outlined on Tables 6, 7 and 8 (Seeliger and H:ohne, 1979).




                                                                            10
11
   Distribution of serotypes throughout the world is not uniform. In the U.S.A.
and Canada serotype 4b prevails at a proportion of 65% to 80% of all strains. In
the Eastern European countries, in West Africa, in Central Germany, Finland
and Sweden serotype 1/2a is most frequently found, while in Western Europe,
particularly in France and in the Netherlands serotypes 1/2a and 4b are being
isolated in about the same proportion. In West Germany serotype 1/2a prevailed
until 1958. Since then a definite shift toward serotype 4b has been noted which
in some outbreaks prevailed.

The serogrouping of L. monocytogenes isolates can be determined by a
multiplex PCR targeting ORF2819, ORF2110, lmo0737, and lmo1118.
Specifically, ORF2819 primers recognize serovars 1=2b, 3b, 4b, 4d, and 4e;
ORF2110 primers further separate serovar 4b complex (4b, 4d, 4e) from
serovars 1/2b and 3b; lmo0737 primers identify serovars 1/2a, 3a, 1/2c, and 3c
strains; and lmo1118 further distinguish serovars 1/2c and 3c from 1/2a and 3a.
The lmo1134 primers with specificity for all L. monocytogenes strains except

                                                                              12
serovars 4a and 4c (Table 9)(Doumith et al., 2004).




2.6. Lineages

A total of 133 L. monocytogenes isolates were characterized by ribotyping and
allelic analysis of the virulence genes hly, actA, and inlA to uncover linkages
between independent phylogenetic and specific virulence markers.
PCR-restriction fragment length polymorphisms revealed 8 hly, 11 inl4, and 2
actA alleles (Fig. 3). The combination of these virulence gene alleles and
ribotype patterns separated L. monocytogenes into three distinct lineages (Table
10). While distinct hly and inlA alleles were generally found to cluster into these
three lineages, actA alleles segregated independently. The clinical history of the
L. monocytogenes strains showed evidence for differences in pathogenic
potential among the three lineages. Lineage I contains all strains isolated during
epidemic outbreaks of listeriosis, while no human isolates were found in lineage
III. Animal isolates were found in all three lineages. We found evidence that
isolates from lineages I and III have a higher plaquing efficiency than lineage II
strains in a cell culture assay. Strains from lineage III also seem to form larger
plaques than strains from lineage II. A distinctive ribotype fragment and unique
16S rRNA gene sequences furthermore suggest that lineage III might represent
a L. monocytogenes subspecies. None of the 20 human isolates available but
11% of our animal isolates were grouped in this lineage, indicating that strains
in this lineage might have reduced virulence for humans (Wiedmann et al.,
1997c).




                                                                                 13
14
      Lineage of strains can be determined by the sequence analysis of partial
actA gene by PCR using the primers Line a (5'TGAAGAGGTAAATGCTTC
GGACTT3') and Line b (5'GCATTTCTTGAGTGTTTTCCTGTT3')(Fig. 4)
(Jiang et al., 2008; Wiedmann et al., 1997b).




                                                                            15
3. ECOLOGY AND OCCURRENCE IN FOODS

3.1. Environment

   L. monocytogenes is commonly found in the environment. It is naturally
saprophytic and in close association with soil, with highest populations in mud
and moist soil. Plant matters are also important in the life cycle of
environmental listeriae and is suggested as a common source for many infection.
It is also recovered from silage, sewage, and waters from the environment
(Brackett, 1988). A lot of domestic and wild animals were shown to be
reservoirs of L. monocytogenes and involved in the distribution of this
bacterium in the environment (Brackett, 1988), also A definite epidemiological
relationship of silage and listeriosis of sheep was documented (Gray, 1960).

   L. monocytogenes occurs in sewage, and the sewage sludge cake is widely
used as an agricultural fertilizer in some country, e.g. Iraq (Al-Ghazali and
Al-Azawi, 1990), so sewage is a carrier of this pathogen. A dramatic decrease in
numbers of listerias after each of the activation and digestion stage during
sewage treatment was noticed in cold months, nevertheless, the organisms were
able to survive these treatments and were present in the final effluent and even
in low numbers in the sewage sludge cake. Sufficient dewatering and exposing
the sewage sludge to sun for no less than 8 weeks is recommended to obtain
listeria-free products (Al-Ghazali and Al-Azawi, 1988; Al-Ghazali and
Al-Azawi, 1990).

3.2. In Food Systems

   It is only within the past few years that L. monocytogenes has fully become
established as a foodborne pathognen. Surveys are being done to determine the
extent to which L. monocytogenes is present in various kinds of foods (Table
10a). This organism is commonly isolated from raw meat, it was recovered from
66% of the tissues sample from an inoculated cow (Johnson et al., 1988). Since
milk products have been involved in listeriosis outbreak (Fleming et al., 1985),
dairy products have received the most scrutiny (Brackett, 1988). Raw milk,
pasteurized milk, ice cream, and various kinds of cheese have been shown to be
contaminated to some extent. Various kinds of raw meat, poultry and sausage

                                                                              16
usually have high incidence of L. monocytogenes. Fruits and vegetables are
believed to get this bacterium from soil and manure of animals. Seafood
especially shellfish may also be contaminated and at least one outbreak of
listeriosis has been linked to shellfish and raw fish (Brackett, 1988). From fresh
produce a number of Listeria spp. were also isolated (Heisick et al., 1989b).




  64% of the L. monocytogenes isolated from chicken were serotype 1/2b,
while 18% were 1/2c (Bailey et al., 1989). The majority of the isolates from

                                                                                17
turkey parts and beef steaks were serotype 1, and those from chicken and pork
samples were serotype 4 and others (Wong et al., 1990). Six serotypes of L.
monocytogenes (1/2, 3a, 3b, 3c, 4b, 4d) were isolated from the chickens
sampled in U.K. (Pini and Gilbert, 1988b). The L. monocytogenes isolates from
fresh produce were identified as predominantly serotype 1a (?), factor 1
(Heisick et al., 1989b). Serotype 1a is common in the environment of the
production facility of dairy products and serotype 4 is more often isolated from
finished dairy products (Heisick et al., 1989b). Only serotype 1/2 and 4b were
isolated from cheese sampled in U.K. (Pini and Gilbert, 1988b).

In China, 1275 batches of aquatic products imported from 29 countries were
examined and found that 36 batches from 8 countries were contaminated by
Listeria (2.8%), with L. monocytogenes accounting for 2.6% (33/1275) and L.
innocua for 0.2% (3/1275). Of the 23 selected L. monocytogenes isolates (from
the 33 identified), 15 (65.2%) were of serovar 4b complex (4b, 4d, or 4e), three
(13.0%) of 1/2a or 3a, four (17.4%) of 1/2b or 3b, and one (4.4%) of 1/2c or 3c.
Notably, four of the 23 isolates belonged to epidemic clone I (ECI) and another
four were associated with epidemic clone II (ECII), two highly clonal 4b
clusters responsible for most of the documented listeriosis outbreaks. In the
multilocus sequence typing scheme based on the concatenated genes
gyrB-dapE-hisJ-sigB-ribC-purM-betL-gap-tuf, serovar 4b complex isolates
from imported aquatic products exhibited significant genetic diversity. While
the four ECI isolates were genetically related to those from Chinese diseased
animals, both lacking one proline-rich repeat of ActA, the four ECII isolates
were located between 1/2b or 3b strains. As the L. monocytogenes isolates from
imported aquatic products possessed a nearly complete set of major
infection-related genes, they demonstrated virulence potential in mouse model
(Chen et al., 2009).

Occurrence of L. monocytogenes in the Irish dairy farm environment and in
particular the milking facility was studied. Two hundred ninety-eight
environmental samples were collected from 16 farms in the southern region of
Ireland. A number of farms within the group supply raw milk to the
unpasteurized milk cheese industry. The samples taken included cow feces,
milk, silage, soil, water, etc. Presumptive L. monocytogenes isolates were
purified and confirmed by PCR targeting the hly gene. Overall, 19% of the
samples (57 of 298) were positive for L. monocytogenes. These were serotyped
using conventional and PCR methods; serotypes 1/2a, 1/2b, and 4b made up

                                                                              18
78% of the typeable isolates. A correlation was found between the level of
hygiene standards on the farm and the occurrence of L. monocytogenes. There
was little difference in the occurrence of L. monocytogenes between farms
supplying milk to the unpasteurized milk cheese industry and those supplying
milk for processing (Fox et al., 2009).

Dairy herds in a New York State dairy farm was examined for three years. Fecal
samples were collected every 6 months from all lactating cows. Approximately
20 environmental samples were obtained every 3 months. Bulk tank milk
samples and in-line milk filter samples were obtained weekly. Samples from
milking equipment and the milking parlor environment were obtained in May
2007. Fifty-one of 715 fecal samples (7.1%) and 22 of 303 environmental
samples (7.3%) were positive for L. monocytogenes. A total of 73 of 108 in-line
milk filter samples (67.6%) and 34 of 172 bulk tank milk samples (19.7%) were
positive for L. monocytogenes. Listeria monocytogenes was isolated from 6 of
40 (15%) sampling sites in the milking parlor and milking equipment. In-line
milk filter samples had a greater proportion of L. monocytogenes than did bulk
tank milk samples (P<0.05) and samples from other sources (P<0.05). The
proportion of L. monocytogenes-positive samples was greater among bulk tank
milk samples than among fecal or environmental samples (P<0.05).
Environmental samples were also examined (Table 11) (Latorre et al., 2009b).




                                                                             19
Analysis of 60 isolates by pulsed-field gel electrophoresis (PFGE) yielded 23
PFGE types after digestion with AscI and ApaI endonucleases. Three PFGE
types of L. monocytogenes were repeatedly found in longitudinally collected
samples from bulk tank milk and in-line milk filters (Fig. 5) (Latorre et al.,
2009a).




                                                                            20
  Since Listeria is widespread in the environment and in domestic animals, it is
very unlikely that the food industry can totally avoid contact with this bacterium,
so what we do is to minimize or eliminate L. monocytogenes from foods supply.


4. SURVIVAL OF L. MONCYTOGENES IN FOOD SYSTEMS



                                                                                21
4.1. Dairy Products

   The ability of L. monocytogenes to survive in skim milk during spray drying
and to persist in nonfat dry milk during storage was examined. A reduction of
about 1 to 1.5 log L. monocytogenes/g occurred during the spray drying process,
irrespective of whether the milk was concentrated or not before spray drying.
The organism progressively died during storage (Doyle, 1988).

   Survival of L. monocytogenes in cheese has been studied intensively. If L.
monocytogenes is present in milk, it can grow during the initial stage of cheese
manufacturing until the pH of the cheese is reduced to 5.0 or below. L.
monocytogenes was still recovered from about half of the cottage cheese sample
during the storage period (Ryser et al., 1985). In case of blue cheese and
camembert cheese (with growth of Penicillium during ripening), this pathogen
survived more successfully as the pH of the cheese increased during the late
stage of fermentation (Papageorgiou and Marth, 1989; Ryser and Marth, 1987a).
The survival of L. monocytogenes during cheese making is strain dependent and
also depends on the types of cheese, water content, temperature of ripening, pH,
preservatives (sorbic acid, propionate, lactic acid, acetic acid), etc. (Fig. 6, 7, 8)
(Ryser and Marth, 1987b; Ryser and Marth, 1988; Yousef and Marth, 1988).




                                                                                    22
23
   Survival of L. monocytogenes in fermented milk depends on the species of
lactic acid bacteria used, e.g. S. thermophilus (4-37 wk), S. lactis (2-13 wk), S.
cremoris (4-13 wk), Lactobacillus bulgaricus (3 d - 1 wk) (Schaack and Marth,
1988a). During the fermentation of skim milk and yogurt by mesophilic or
thermophilic lactic acid bacteria, L. monocytogenes is inhibited by the inoculum
size and strains of lactic acid bacteria. When incubated with L. bulgaricus, L.
monocytogenes was inhibited between 9 and 15 h of incubation (Fig. 9)
(Schaack and Marth, 1988b; Schaack and Marth, 1988c). This may be due to the
rapid decrease of pH in case of L. bulgaricus fermentation. Decrease of pH to
below 5 is detrimental to L. monocytogenes.




                                                                                24
   Doubling times of L. monocytogenes at 10C were reduced by up to 3 h when
grown in milk preincubated with Pseudomonas spp. Three strains of P.
fluorescens showed more stimulation of the growth rate of L. monocytogenes. It
suggested that the presence of the pseudomonads may enhance growth of L.
monocytogenes in milk (Marshall and Schmidt, 1988).

  Since cooling systems are widely used in dairy industry, presence of L.
monocytogenes in milk cooling systems may pose a hazard, especially in sweet
water systems that might contain a small amount of milk. Growth of L.
monocytogenes in a simulated milk cooling systems was observed (Petran and
Zottola, 1988).

4.2. Meat and Meat Products

   When a mixture of L. monocytogenes was inoculated to the surface of
processed meat products at 4.4C, it survived but did not grow on summer
sausage, grew only slightly on cooked roast beef, grew well on some wiener
products but not on others, grew well on ham, bologna, and bratwurst, and grew
exceptionally well on sliced chicken and turkey. The organism generally grew
well on meats near or above pH 6 (Glass and Doyle, 1989a). It suggests that it is
important to avoid post-processing contamination of this bacterium. But in
ground beef or liver during storage at 4 or 25 C, the L. monocytogenes
population remained unchanged for 30 days (CHEN and Shelef, 1992).

    When chicken breasts were inoculated with L. monocytogenes and cooked
to one of five different cooking temperatures and packed, this pathogen
increased in all of the samples, except those cooked to 82.2 C (Harrison and
Carpenter, 1989).

   L. monocytogenes could grow at 32.2 C in sausage batter during the
fermentation period if the lactic starter culture was not added (Glass and Doyle,
1989a). L. monocytogenes was able to survive during a 21-day fermentation of
sausage with levels of nitrite and salt commonly used in the meat industry today
(120 ppm NaNO2 and 3.0% NaCl) (Junttila et al., 1989).

Souse is a fully cooked, ready-to-eat gelled pork product. There is a
zero-tolerance policy for L. monocytogenes in ready-to-eat meat products. The

                                                                               25
effectiveness of three different souse formulations (pH 4.3, 4.7, and 5.1) for
controlling the growth of L. monocytogenes at two refrigerated storage
temperatures (5 and 10 C) was evaluated. All products were vacuum packaged.
Uninoculated product was prepared as the control, and other products were
artificially surface contaminated with a three-strain cocktail of L.
monocytogenes (106 CFU/ cm2). Souse did not support the growth of L.
monocytogenes regardless of product formulation or storage temperature. At 5C,
D-values for products with pH values of 4.7 and 5.1 were not different, but
survival of L. monocytogenes in product with a lower pH (4.3) was decreased
compared with survival in products with higher pH values (P < 0.05). Survival
of L. monocytogenes was not impacted by storage temperatures (P > 0.05) (Fig.
10) (Kim et al., 2009).




4.3. Vegetables

  The ability of L. monocytogenes to survive and grow on ready to serve lettuce
was examined (Steinbruegge et al., 1988). Behavior of L. monocytogenes was
variable. In most trials, numbers increased by several log cycles during 14-day
of storage, but in several trials growth never occurred or did not persit for 14
days. Lettuce juice held at 5C was also able to support growth of L.
monocytogenes.


5. ISOLATION AND ENUMERATION



                                                                              26
   The concentration of L. monocytogenes in food is low, therefore, the isolation
methods have necessarily employed enrichment in one or two stages before
isolation on solid media. A number of procedures combining various enrichment
and selection media have been tried. It is nearly impossible for one procedure to
detect all the existing L. monocytogenes in food samples (Pini and Gilbert,
1988a). It is difficult to enumerate this bacterium directly on agar media or by
most-probable-number method (Lovett, 1988).

5.1. Enrichment Procedures

   Cold enrichment was used to select psychrophilic Listeria, a period of weeks
to months was required.

    Antibiotics have been used in enrichment formulation to provide more rapid
enhancement of the Listeria spp. Rodriguez et al. used three complicated
scheme, three enrichment media, and an isolation medium. The enrichment
media contained nalidixic acid, and trypan blue. The isolation agar contained
Ferric ammonium citrate, nalidixic acid, acriflavin, and esculin to highlight the
Listeria colonies (Rodriguez et al., 1984).

   Doyle and Schoeni took advantage of the microaerophilic nature of L.
monocytogenes to provide a selective enrichment culture for the organism. The
selective broth consisted of polymyxin B, acriflavine, nalidixic acid as the
selective reagents. The culture was incubated 24 h at 37 C in an atmosphere
composed of 5% O2, 10% CO2, and 85% N2 (Doyle and Schoeni, 1986).

   The FDA method employs a single enrichment in a selective medium of
trypticase soy broth with yeast extract, acriflavin, nalidixic acid, and
cycloheximide. The sample in enrichment broth will be incubated at 30C for 2
days. At 24 h and 2 days, streak the culture onto modified McBride's agar and
onto lithium chloride-phenylethanol-moxalactam (LPM) agar (Lovett and
Hitchins, 1989).

  The USDA method is mainly based upon the Lee and McClain method (Lee
and McClain, 1986). The sample is first enriched in the Listeria enrichment
broth (UVM, Univ. of Vermont Medium) for 20-24 h at 30 C, and then transfer
to the secondary enrichment in Fraser broth at 35C for 24-48 h. The UVM
contains esculin, naladixic acid, and acriflavin and the Fraser broth contains of

                                                                               27
esculin, naladixic acid and lithium chloride. Blacken or darkened tubes resulting
from esculin hydrolysis in the Fraser broth are to be streaked on MOX agar for
isolation (McClain and Lee, 1988). Tubes that remain the original straw color
are negative for L. monocytogenes (Fraser and Sperber, 1988). MOX (Modified
Oxford Medium) is a highly L. monocytogenes selective medium containing
ferric ammonium citrate, lithium chloride, 1% colistin soln. and Moxalactam
(McClain and Lee, personal communication). Moxalactam, the broad-range
cephalosporin antibiotic, proved to be highly useful, controlling not only the
gram-negative bacteria but also most of the other gram-positives.

   The minimum inhibitory concentrations of four antibiotics used in Listeria
selective agara were determined and ceftazidime, cefotetan, latamoxef and
fosfomycin are recommended for Listeria selective agars (Curtis et al., 1989).




5.2. Isolation Procedures

   The first selective agar medium used in the isolation of L. monocytogenes is
McBride's agar which contains phenyl ethanol agar, glycine anhydride, lithium
chloride, and sheep blood (McBride and Girard, 1960). Modified McBride's
agar is also widely used with the sheep blood replaced by cycloheximide. A
number of selective agars have been formulated (Bannerman and Bille, 1988;
Buchanan et al., 1989; Lee and McClain, 1986; Loessner et al., 1988; Pucci et
al., 1988), nevertheless, the LPM and MOX agars are widely accepted now. The
use of a stereomicroscope with a light source illuminating the plate at an
incident angle of 45o can be useful in determining typical Listeria colonies
which appear to be blue to blue-gray color.

  A new selective medium was formulated by Al-Zoreky and Sandine. This
medium contains the esculin, selective agents (acriflavin, ceftazidime, and
moxalactam) plus agar base. Recognition of Listeria colonies is evident by
black discoloration of the medium due to esculin hydrolysis without need for
special illuminating equipment.

   A number of formulations have been compared for isolation of L.
monocytogenes (Bannerman and Bille, 1988; Doyle and Schoeni, 1987; Hao et
al., 1987; Loessner et al., 1988). Among these media, the Modified Vogel

                                                                               28
Johnson Agar (MVJ) and the LPM are superior in detection of L.
monocytogenes in various kinds of food (Buchanan et al., 1989). MVJ agar was
considered more easy to use (Buchanan et al., 1989). But LPM inhibits 50
non-listeriae, and MVJ inhibits all but one yeast. LPM agar was the best overall
since Scott A was inhibited by MVJ (Loessner et al., 1988).

    Crawford et al. showed that the heat-injured cells of L. monocytogenes were
unable to multiply either during cold storage of milk or in the FDA or USDA
systems (Crawford et al., 1989). Thus L. monocytogenes cells recovered in
finished pasteurized milk products by these detection methods probably
represent uninjured environmental contaminations.

Six chromogenic media similar to Agar Listeria according to Ottaviani and
Agosti (ALOA) were compared using PALCAM agar for inclusivity and
exclusivity (Fig. 11). Additionally, the ability of chromogenic agars to facilitate
growth of stressed L. monocytogenes strains and mixed cultures with
competitive non-Listeria strains was estimated. Finally, the detection and
enumeration of L. monocytogenes were peroformed in artificially inoculated and
naturally contaminated food samples. The results of this study indicated that
chromogenic media are a good supplementation to PALCAM agar. A single
application is not advisable, as the specificity of chromogenic agars is
frequently insufficient (50.0-88.9%), particularly in food samples with a
complex microflora (Table 12) (Stessl et al., 2009).




                                                                                 29
5.3. Confirmation of Listeria species

   According to the USDA procedures, black colonies from MOX agar is
streaked onto Horse blood overlay medium. Colonies with β-hemolysis, Gram
positive, short rods, with tumbling motility proceed with biochemical
indentification (Table 13). It is also easy to observe grey to blue colonies under
fluorescent light on LPM agar. CAMP test is usually done to differentiate
different Listeria species.




                                                                                30
Serology can be used epidemiologically to support the classification of the
isolate.

   Pathogenicity is sometimes used to confirm the classification of the L.
monocytogenes. However, some Listeria species (L. ivanovii, L. denitrificans)
are also mouse pathogens, usually no pathogenic for man. Intraperitoneal
injection of 109 Listeria cells/18-20 g mouse followed by a week of observation
for death is the method most often used. Recently, Stelma et al. described an
immunocompromised mouse model that uses carrageenan to inactivate the
mouse macrophages before i.p. injection of the bacterial suspension. Pathogenic
L. monocytogenes shows 5 or more log reductions in LD50 values when mice are
immunocompromised, whereas nonpathogenic species show relatively little
change in LD50 values (Stelma, Jr. et al., 1987).

   Because the hemolysis produced by L. monocytogenes on blood agar is
frequently difficult to interpret, a microplate technique was developed
(Rodriguez et al., 1986). Pretreatment of erythrocytes with crude exosubstances
of R. equi, Pseudomonas fluorescens, Acinetobacter calcoaceticus, and S.
aureus enhanced the hemolytic activity of all hemolytic Listeria strains. This
microplate method can be used instead of the CAMP test (Rodriguez et al.,
1986).

5.4. Direct Plating for Isolation and Enumeration

  Since Listeria usually occurs in low density in food, probably less than 100/g
of food, it is very difficult to identify by direct plating especially in samples
with heavy contamination of other bacteria.

   A number of selective agars have been evaluated as media for direct plating.
Various densities of L. monocytogenes cells, injured or not, were inoculated into
different types of foods, homogenized and enumerated by direct plate counting
on this agar. LPM was most suitable for analyzing cheese and cabbage, Gum
base-nalidixic acid-tryptone-soya medium was most suitable for analyzing milk
and chocolate ice cream mix (Fig. 12) (Cassiday et al., 1989; Golden et al.,
1988a; Golden et al., 1988b).



                                                                               31
   A overlay thin layer of blood agar on these selective media could be useful in
direct enumeration of hemolytic Listeria (Blanco et al., 1989).


5.5. Rapid Detection of L. monocytogenes

5.5.1. Fluorescent Immunoassay and Flow Cytometry



                                                                               32
   A fluorescent antibody (FA) procedure was developed in 1960 for the
detection of L. monocytogenes, and this method is successful in detecting this
pathogen in cerebrospinal fluid, human tissue, blood, and vaginal swabs, since
in most of these clinical specimens, Listeria exists in pure culture (Donnelly et
al., 1988). Distinct disadvantages were noted with this procedure, which
included: non-specific cross-reactivity of Listeria antiserum with streptococci,
micrococci, and staphylococci; difficulty in visual resolution of Listeria from
contaminants on the basis of morphology and fluorescence intensity; and finally,
the time-consuming and subjective nature of visual microscopic analysis
(Donnelly et al., 1988).

   The fluorescent-labelled bacteria can be identified by a modified method, the
Flow Cytometry (FCM). After enrichment by Listeria Enrichment broth, cells
are disrupted and collected, reacted with Listeria O antiserum, then with
fluorescein isothiocyanate (FITC)-labelled goat anti-rabbit immunoglobulins.
Propidium iodide (PI, labelling DNA) is added. A laser beam cytometer is used
to measure the size by light scatter and relative DNA content. Only cells that
fell into both the DNA gating region and the Listeria scatter region are analyzed
for immunofluorescence. This method yielded a 5.86% false positive rate and a
0.53% false negative rate when compared with culture procedures (Donnelly et
al., 1988; Donnelly and Baigent, 1986). It is not very practical due to high
equipment cost.

5.5.2. Electrical Method

  Growth of L. monocytogenes and other bacteria is in some Listeria selective
media was detected by monitoring the capacitanc signal with a Bactometer.
Profiles of different bacteria grown on an AC medium (one of the Listeria agars)
are different (Fig. 13). Some Bacillus speciec were able to grow in the AC
medium. Adding moxolactam (5 mg/l) and nalidixic acid (50 mg/l) to the AC
medium would inhibit the growth of Bacillus spp. (Phillips and Griffiths, 1989).
This method needs more evaluation.




                                                                               33
5.5.3. Enzyme-linked Immunosorbent Assay

   The cultured Listeria cells were boiled and immunized BALB/c mice. The
splenocytes were fused with mouse myeloma cells and screened for
positive-reacting clones. Fifteen murine monoclonal antibodies (MABs) which
react specifically with a protein antigen found in all species of Listeria were
developed and characterized. The genus-specific antigen was identified as a
heat-stable protein with a molecular weight in the range of 30,000 to 38,000
(under both reducing and nonreducing conditions), depending on the species of
Listeria tested. In L. monocytogenes, L. innocua, L. ivanovii, and L. seeligeri the
antigen has a molecular weight of approximately 30,000 to 34,000. In L. grayi
and L. murrayi it has a molecular weight of approximately 35,000 to 38,000
(Butman et al., 1988). An ELISA method based on two of these MABs was
developed by Organon Teknika and known as Listeria-Tek. Samples are
enriched by the USDA enrichment procedures (2 days) and screened by this
ELISA method (Fig. 14) and finally confirmed by the Micro-ID kit. This
method detected 68% of the 44 vegetable samples in a evaluation of methods,
but detected 100% of the milk samples. However, this method gave 22
false-positive results among 309 samples (Table 14, 15, Fig. 15) (Heisick et al.,
1989a).




                                                                                 34
35
  Immunomagnetic separation (IMS) has been shown to be a very effective tool
for the separation and isolation of specific cells from heterogeneous cell
suspensions, especially for the isolation of specific cells from blood, or more

                                                                             36
likely after some hours of resuscitation or preenrichment in nonselective or
slightly selective media, substantial time can be saved. There is increasing
number of IMS described. IMS with immunomagnetic beads was used to isolate
strains of L. monocytogenes both from pure cultures and from heterogeneous
suspensions. The monoclonal antibodies used recognized all six strains of
serotype 4 but only one of three strains of serotype 1. Less than 100 bacteria per
ml in pure cultures and less than 200 bacteria per ml in enriched foods could be
detected (Skjerve et al., 1990).

   Methodology

      Immunomagnetic beads, 2.8 μm in diam, with covalently linked
sheep anti-mouse IgG antibodies (Dynal A/S, Oslo, Norway) are coated with
monoclonal antiserum by incubating at room temperature for 3 h. Such beads
are added to bacterial cultures (samples) and incubated with slow shaking at
room temperature for 10 min (up to 1 h). A Eppendorf type magnetic particle
concentrator (Dynal A/S) is used to trap the beads. The traped beads are washed
in PBS with 0.1% bovine serum albumin and transferred to agar medium.
Another approach is to establish a ELISA to identified the trapped beads.
Coating procedure, incubation time, and number of immunomagnetic beads
influenced the sensitivity of the isolation method.

5.5.4. Nucleic Acid Probe Hybridization Assays

   The L. monocytogenes DNA was cloned in pUC18 and a clone (pRF106)
containing the presumptive β-hemolysin gene was selected and a fragment of
about 500 bp was used as a gene probe. The cells in the colonies were lysed by
microwaves in the presence of sodium hydroxide, and only the DNA from the
β-hemolytic (CAMP-positive) strains of L. monocytogenes hybridized with this
probe (Datta et al., 1987). From this 500 bp sequence, several synthetic
oligonucleotides were evaluated as gene probe and AD07 (TGA CAG CGT
GTG TAG TAG CA) was selected to detect L. monocytogenes (27). However,
these oligonucleotides were shown to in the upstream of the iap
(ivasion-associated protein) gene that encodes a major extracellular protein (p60)
(Kuhn and Goebel, 1989) and not associated with any hemolytic genes (Ko:hler
et al., 1990).

  A 650-bp HindIII fragment located within the listeriolysin gene and a

                                                                                37
synthetic oligonucleotide (TCG TCC ATC TAT TTG GCA GG) were also used
as probes which were specific for L. monocytogenes at high stringency (Datta et
al., 1990).

   The gene of L. monocytogenes that encodes p60 was cloned in E. coli. The
deduced amino acid sequence of p60 contained a putative N-terminal signal
sequence of 27 amino acids and an extended repeat region consisting of 19
threonine-asparagine units. Hybridization with the entire iap gene revealed the
presence of homologous sequences in most other Listeria species. In contrast, a
400-bp internal iap probe which contained the whole repeated region hybridized
only with genomic DNA from L. monocytogenes (Ko:hler et al., 1990).

   Flamm et al. also cloned a gene msp (major secreted polypeptide, 60 kDa)
which is specific only in L. monocytogenes strains and the possibility of using
this gene as a probe were also discussed. DNA sequence related to msp was not
detected in any other Listeria species or in strains of Bacillus spp. and
Streptococcus spp. when standard stringent DNA hybridization conditions were
used (Flamm et al., 1989). Under nonstringent conditions, related sequences
were detected in L. ivanovii, L. seeligeri, and L. innocua, and immunoblot
analysis indicated that these strains secreted polypeptides of about 60 kDa that
were immunologically related to the msp gene product. This msp gene product
was shown to have hemolytic activity and immunologically distinct from
listeriolysin O. It may be a lipase or protease that can lyse erythrocytes (Flamm
et al., 1989).

  A gene encoding a delayed-hypersensitivity-inducing protein from a virulent
L. monocytogenes serotype 1/2a strain has been cloned and sequenced. The
plasmid pLM10 containing a 1.1 kb of insert ecodes this factor was used as a
probe. This probe hybridized only the pathogenic species, L. monocytogenes
(except serotype 4a) and L. ivanovii. Positive results were obtained with all L.
monocytogenes strains of serogroups 1/2a, 1/2b, 1/2c, 3a, 3b, 3c, 4d, 4ab, and 7.
Of L. monocytogenes serotype 4b strains, a single strain showed no
hybridization. All strains of the rarely occurring serogroup 4a were negative for
hybridization. This probe could be a useful marker in the detection of virulent
Listeria strains (Notermans et al., 1989).

  A gene probe was developed by Gene-Trak. Unique sequences of the 16S
rRNA of L. monocytogenes ATCC 15313 were synthesized and labelled by

                                                                               38
using 32P (Klinger et al., 1988; Klinger and Johnson, 1988). The vast majority of
rRNA is highly conserved and uniform (i.e., nearly identical) throughout all
bacteria; however, small unique regions exist and can serve as excellent specific
targets. Additionally, rRNA is present in great abundance, providing increased
assay sensitivity. The labeled probes hybridized with all of the 139 Listeria
strains tested, representing the seven recognized species; 16 serotypes were
included. All 73 non-Listeria organisms tested were negative in the assay.

   This method has been modified by using dipstick assay and horseradish
peroxidase color reaction instead of radioactive probe (Fig. 16) (Parsons, 1988).
In a comparative test, this Gene-Trak system gave 98% and 45% to the positive
milk and vegetable samples, respectively (Heisick et al., 1989a).




                                                                               39
  Digoxigenin-labeled non-radioactive probes were developed (Kim et al.,
1991; Wong et al., 1992). A chromogen-labeled DNA probe was developed
(Peterkin et al., 1991).

     Preparation of chromogen labeled probe

     Horse-radish peroxidase (HRP) was conjugated to polyethyleneimine, and
the mixture was concentrated about fourfold by dialysis against polyethylene
glycol 8000. HRP-polyethyleneimine was mixed with probe DNA and freshly
denatured by heating at 100C for 10 min, followed by rapid chilling on ice. The
volume of the HRP-polyethyleneimine-single-stranded DNA probe mixture was
made up to 30 μl with 5 mM sodium phosphate, pH 6.8, and 5% glutaraldehyde
(6 μl) added. After incubation at 37C for 10 min, 36 μl of this probe was added
directly to the hybridization solution at the end of prehybridization.

  Non-radioactive RNA probe targeted on the listeriolysin O gene was
developed (Wong et al., 1992).

5.5.5. Polymerase Chain Reaction

  PCR have been applied in the detection of L. monocytogenes. The targets of
amplification are listeriolysin O gene (Bessesen et al., 1990; Border et al., 1990;
Deneer and Boychuk, 1991; Furrer et al., 1991; Niederhauser et al., 1992;
Thomas et al., 1991; Wong et al., 1992), iap gene (Niederhauser et al., 1992),
Dth18-gene (Wernars et al., 1991), and 16S RNA (Border et al., 1990).

  Enrichment cultures were usually obtained and cell lysed for the PCR
analysis (Niederhauser et al., 1992; Thomas et al., 1991).

  The detection limit in dilutions of pure cultures was usually about 1-10 CFU.
But in food samples, the detection limit showed a large variation (Wernars et al.,
1991).

5.5.6. Real-time PCR

   Method coupling International Standard Organization (ISO) enrichment to a
real-time PCR with internal amplification control (IAC), in a duplex format,

                                                                                 40
without additional DNA purification, was developed for the detection of L.
monocytogenes. The performance was tested on different plant products. Limit
of detection (LOD) was about 1 CFU in 25 g after enrichment, except for
soybean sprouts (Badosa et al., 2009).


6. CONTROL OF L. MONOCYTOGENES

 Control of L. monocytogenes is difficult due to its: (1) widespread presence in
the environment, (2) intrinsic physiological resistance, (3) ability to adapt to
external stresses and (4) ability to grow at a wide range of temperatures. Among
the factors that affect the growth of Listeria monocytogenes are temperature, pH,
atmosphere, irradiation and food additives.

6.1. Temperature

   Optimum growth temperature between 30 and 37 C. Temperature limits of
growth 1-45 C. Generation times in different foods ranged from 1.2 to 1.7 days
at 4 C, 5.0 to 7.2 h at 13 C, and 0.65 to 0.69 h at 35 C.

   The D71.7C values computed for milk samples ranged from 0.9 to 2.7 sec
(Bradshaw et al., 1987; Bradshaw et al., 1985). D62C values in milk ranged
between 0.1-0.4 min (Donnelly et al., 1987). Heat resistance of L.
monocytogenes in various kinds of foods has been reviewed by Mackey and
Bratchell (Fig. 17, Table 16, 17) (Mackey and Bratchell, 1989) and concluded
that cooking food to an internal temperature of 70C for 2 min is adequate to
ensure destruction of this pathogen. In case of sausage such as beaker sausage
(made from uncooked meat), heating to an internal temperature of 62.8C
inactivated listeriae to undetectable levels (Glass and Doyle, 1989a). But when
an initial population of 5x106 L. monocytogenes/ml was heated at 72, 82, or 92
C in a milk medium using test-tube method, consistent survival of a population
of 102-103 cells/ml after 30 min was observed (Donnelly et al., 1987).




                                                                              41
42
  Heat resistance of L. monocytogenes did not differ significantly between pH
5.5 and 9.0 (Bradshaw et al., 1985).

  The induction of increased thermotolerance by sublethal heat shock (42-52C)
was generally not significant for L. monocytogenes; nevertheless, the increase
was significant for Salmonella typhimurium (Bunning et al., 1990).

6.2. Acidity and organic acids

  The minimum pH at which L. monocytogenes can grow is yet to be defined.
Growth occurs between pH 6 and 9 (Seeliger and Jones, 1984). In trytic soy
broth supplemented with 0.6% yeast extract, all four strains of tested L.
monocytogenes grew at pH 4.5 and above. L. monocytogenes population
declined at pH below 5 in a model broth system (Parish and Higgins, 1989). L.
monocytogenes grew well in cabbage juice at initial pH 5.0 to 6.1, and could
reduce the pH to 4.14 before complete inactivation occurred (Golden et al.,
1988b). The organism is quite resistant to alkaline pH and can grow in liquid
media at pH 9.6 (Doyle, 1988). Lowering of pH from 5.6 to 4.0 in clarified
cabbage juice increased the rate of thermal inactivation (Fig. 18) (Beuchat et al.,
1986).




                                                                                 43
Lactic acid (LA; 5%, vol/vol) and sodium lauryl sulfate (SLS; 0.5%, wt/vol)
were evaluated individually or as a mixture (LASLS) for control of L.
monocytogenes on frankfurters (Fig. 19) (Byelashov et al., 2008).




                                                                              44
6.3. Sodium Chloride

   L. monocytogenes is quite tolerant to NaCl, being capable of growing in 10%
NaCl and surviving for 1 year in 16% (Doyle, 1988). Growth of Listeria occurs
in complex media such as nutrient broth supplemented with up to 10% NaCl
and some strains have been reported to remain viable after 1 year in 16% NaCl
at pH 6.0 (Seeliger and Jones, 1984). Lowering of temperature enhanced
resistance to salt, the organism survived more than 100 days in 10.5-30% NaCl
at 4C. But it was affected by the constituent of food, it could grow in cabbage
juice with 2% NaCl but not in the presence of 5% NaCl (Conner et al., 1986). It
grew in heat-sterilized unclarified cabbage juice containing less than 5% NaCl
and tryptic phosphate broth containing less than 10% NaCl (Beuchat et al.,
1986).

  The effect of sodium chloride and pH in combination with different
temperatures on the growth of microorganisms is better assessed by gradient
plate method (McClure et al., 1989). Gradient plate is made up of three nutrient
agar layers each contained H2SO4, NaOH or NaCl. It is sprayed with an aqueous
solution of 2-(p-iodophenyl)-3-(p-nitrophenyl)-5-phenyl tetrazolium chloride
for easy detection of the bacterial growth. The growth of bacteria is scanned by
a Densitometer and 3-dimensional images are analyzed (Fig. 20) (McClure et al.,
1989).




                                                                             45
6.4. Carbon Dioxide and Decreased Oxygen Levels

  L. monocytogenes is microaerophilic, and is enhanced under decreased
oxygen concentrations and with supplementation with carbon dioxide.

6.5. Irradiation

   The survival of L. monocytogenes preinoculated into ice cream and
mozzarella cheese prior to gamma-irradiation treatment was also determined.
Samples were maintained at -78 C during irradiation, and the calculated D10
values were 1.4 kGy for mozzarella cheese and 2.0 kGy for ice cream (Fig. 21)
(Hashisaka et al., 1989). In another study, the D10 values on poultry meat were
0.417-0.553 kGy depending on strain and plating medium used, suggesting the
injury by irradiation occurred. Lower values were obtained in phosphate-
buffered saline (Patterson, 1989).




                                                                             46
6.6. Chlorine

  Chlorine is a common antimicrobial agent used in food industry. In one study,
chlorine concentrations less than about 50 ppm showed no antimicrobial effect
but exposure to 50 ppm or greater free residue chlorine resulted in no viable
cells (Brackett, 1987). Cells were treated in phosphate buffer containing the
chlorine and were neutralized with 0.01 M sodium thiosulfate before counting
on the TSA agar (Brackett, 1987). In another study, L. monocytogenes decreased
rapidly in the presence of 0.5-10 ppm during the first 30 s followed by a slower
decrease during the rest of the exposure time (El-Kest and Marth, 1988a). Cells
were more resistant to chlorine when they were: (a) harvested from a 24-rather
than 48-h-old culture, (b) grown in tryptose broth rather than on a slant of

                                                                              47
tryptose agar, and (c) washed and resuspended using a 20 rather than 0.312 mM
phosphate buffer solution. Presence of organic matter such as peptone caused a
large and rapid loss of available chlorine, but glucose or lactose had no effect.
The D-values of L. monocytogenes to different concentrations of available
chlorine is shown in Fig. 22 (El-Kest and Marth, 1988a). Effect of chlorine is
also affected by the pH, temperature and strain. Large numbers of L.
monocytogenes strain Scott A survived at 25 than at 35 or 5 C. The higher the
pH values, in the range of 5 to 9, the greater were the numbers of survivors of L.
monocytogenes and V7 was less resistant to chlorine than strain California
(El-Kest and Marth, 1988b).




  Scanning electron microscopy was done to evaluate the attachment
characteristics of L. monocytogenes on stainless steel. L. monocytogenes was
found to produce a fibrous-like material similar in appearance to acidic
polysaccharide fibrils produced by Pseudomonas sp., which appeared to be
removed by the sanitizer solutions (chlorine or quaternary ammonium)
(Mustapha and Liewen, 1989).

6.7. Nitrate and Nitrite

                                                                                48
   Some kind of smoke products were more effective to L. monocytogenes
(Messina et al., 1988) and levels of nitrite and nitrate with best bacteriostatic
effect on Listeria (200-1000 ppm) are no longer permitted in food (Junttila et al.,
1989).

6.8. Bacteriocin

   Also deferred antagonism and well diffusion assays (Fig. 23), seven among
fourteen bacteriocin-producing strains were inhibitory to L. monocytogenes,
namely Lactobacillus sp., Lactococcus lactis (2 strains, nisin), Leuconostoc
sp., Pediococcus acidilactici (Pediocin PA-1), P. pentosaceus (2 strains,
Pediocin A) (Harris et al., 1989). The bacteriocin PA-1 from P. acidilactici
PAC1.0 was inhibitory to L. monocytogenes over the pH range 5.5 to 7.0 and at
both 4 and 32 C. Inhibition was also demonstrated in several food systems
including dressed cottage cheese, half-and-half cream, and cheese sauce (Pucci
et al., 1988). Nisin (16 IU/ml) was found to have an initial inhibitory effect on
growth of L. monocytogenes (Doyle, 1988).




                                                                                49
   Bacteriocin produced by lactic acid bacteria can be used to control L.
monocytogenes in food. When meat was inoculated with L. monocytogenes, the
bacteriocin from Pediococcus acidilactici reduced the number of attached
bacteria in 2 min by 0.5 to 2.2 log cycles depending upon bacteriocin
concentration (Nielsen et al., 1990). Presence of P. acidilactici or pediocin AcH
also inhibited the growth of L. monocytogenes in wiener exudates (Yousef et al.,
1991).

6.9. Other Additives

  Some other chemical agents have been tested to inhibit L. monocytogenes.
The action of sorbic acid is affected by temperature and pH. At pH 5.6 and 4 C,
the bacterium was inactivated by 0.25 or 0.3% of potassium sorbate, while at
higher temperature (21 or 35C) appreciable growth occurred. At 13 C and pH
5.0, concentrations of 0.2-0.3% potassium sorbate completely inhibited the
growth (El-Shenawy and Marth, 1988a). Similar effect occurred in case of
sodium benzoate inactivation (El-Shenawy and Marth, 1988b). In a milk system
(pH 6.4), phenolic compounds were more effective than potassium sorbate
(Payne et al., 1989). The minimum inhibitory concentrations (MIC) determined
by using agar dilution technique were: tertiary butylhydroquinone (TBHQ) 64
ppm, butylated hydrozyanisole (BHA) 128 ppm, butylated hydroxxytoluene
(BHT) >512 ppm. The most effective FDA approved food antimicrobial was
propyl paraben with MIC of 512 ppm (Payne et al., 1989).

6.10. Combined factors

Simulated dynamic model (Fig. 24) of the stomach and small intestine was used
to assay the survival of L. monocytogenes during storage (82 days, 4 C) in
vacuum packages of inoculated bologna and salami slices (Barmpalia-Davis et
al., 2008).




                                                                               50
7. PATHOGENICITY AND TOXIN PRODUCTION

   Under the right circumstances, anyone can become infected with L.
monocytogenes, but many persons will remain symptomless. Some may develop
lethal diseases, such as pregnant, newborns, infants and adults with a
compromised immune system (Marth, 1988) such as AIDS (Schlech, 1988).
Listeria resistance in mice is determined by autosomal dorminant determinant.

7.1. Forms of Human Listeriosis

Listeriosis of Women during Pregnancy
Symptoms like fever, chills, headache, backache, and discolored urine,
pharyngitis, diarrhea, and pyelitis (inflammation of the pelvis of the kidney).
The "flu-like" symptoms just described are the expression of Listeria
bacteremia. Infection of pregnant woman leads to infection of the fetus through
transplacental route or during delivery, and cause damage to the embryo
resulting in abortion or stillbirth. The women may carry L. monocytogenes in
the genital tract for some time (Marth, 1988).

Listeriosis of the Newborn
Baby infected by L. monocytogenes from mother, develops variable symptoms,
including respiratory distress, heart failure, cyanosis, refusal to drink, vomiting,
convulsions, soft whipering, small cutaneous granulomas (listeriomas) in the
posterior pharyngeal wall, leukocytosis, numerous organs develop nodules, etc.

                                                                                  51
Two of eight had neurodevelopmental handicap after recovery (Marth, 1988).

Meningitic and Meningoencephalitic Listeriosis
Usually occurrs in newborns and in older persons, usually fulminant (comes on
suddenly with great severity), with fatality rate about 70%.

Cutaneous Listeriosis
Primary skin lesions caused by direct contact with the infected animal tissue, so
usually occurs in farmers and veterinarians. Form skin nodules.

Septicemic Listeriosis with Pharyngitis and Mononucleosis
Symptoms include fever, severe pharyngitis, and a leukocytosis accompanied by
mononucleosis. Sometimes it turns into the meningitic form of the disease.

Oculoglandular Listeriosis
Conjunctivities sometimes accompany the septicemic form described above, or
occur independenly, and may also turn to meningitis.

Granulomatosis Septica and Pneumonic Listeriosis
Take a septic course with various clinical manifestations, may develop
symptoms of pneumonia or acute or subacute endocarditis.

Cervicoglandular Listeriosis
Uncommon form, cervical and submandibular lymphadenopathy, may
accompany the septicemic form.

Additional Forms of Listeriosis
Focal infections result in arthritis, osteomyelitis, spinal or brain abscesses,
peritonitis, and cholecystitis.


7.2. Characteristics of Virulent Listeria monocytogenes

Serotype
Virulent Listeria tend to cluster in subgroups 1 and 4, as well as 7, and
serotypes 1 and 4 cause most invasive human infections. Outbreaks have been
associated with serotype 4b (Table 18) (McLauchlin, 1987). However,
environmental strains of L. monocytogenes serotype 4 isolates that appeared to

                                                                               52
be avirulent when injected into mice.




Phage Type
Lysogenic phages are present in all species of Listeria and phage typing of L.
monocytogenes within virulent serogroups has been useful in determining
strains of Listeria that have been responsible for epidemic disease, hoverever,
no information exists concerning the comparative virulence of different phage
types of the same serotype that would suggest a role for phage in promoting
virulence (Schlech, 1988).

Plasmid Type
Plasmids have been sought in strains of L. monocytogenes causing epidemic
disease, large outbreaks of epidemic disease have been attributed to
nonplasmid-bearing strains (Schlech, 1988).

Biotype
The avirulent isolates L. greyii and L. murrayei can be distinguished by nitrate
reduction and a positive mannitol test. Beta-hemolysis and a negative D-xylose
acidification test distinguish L. monocytogenes from organisms which are
avirulent, such as L. welshimeri or L. innocua, and those that have some
capability for virulence, such as L. seeligeri and L. ivanovii. Xylose
acidification and CAMP phenomenon occur in virulent L. monocytogenes.
However, the specificity of these two tests is relatively low (Schlech, 1988).

                                                                              53
Hemolysins
Hemolysins of L. monocytogenes are clearly markers for virulence. However,
they have a variable expression within individual pathogenic strains. Hemolytic
organisms tend to have smooth colonial morphology (Schlech, 1988).

The cytopathogenicity of L. monocytogenes can be determined by a plaque
assay with mouse L cells. L. monocytogenes was grown overnight to stationary
phase at 30°C and inoculated onto the cell monolayer at approximately 3x104
CFU per well. Results were reported as average plaque diameter and as
plaquing efficiency (CFU/PFU). Plaque sizes were measured for all plaques
formed in at least two wells (Wiedmann et al., 1997a).


7.3. Invasiveness and Intracellular Growth of L. monocytogenes

    L. monocytogenes is an invasive bacterial pathogen capable of multiplying
inside many host cells, including macrophages, enterocytes and hepatocytes
(Berche et al., 1988). Phagocytosis also occurs in non-professional phagocytes
such as enterocyte-like Caco-2 cells (human colon carcinonma cell line
(Gaillard et al., 1987). This pathogen is ingested with food and penetrates
through the intestine. The bacteria invasion of the host tissues during infection
starts by rapid phagocytosis of the bacteria in an iron-deprived environment,
which stimulates hemolysin secretion. The directed phagocytosis inhibited by
cytochalasin D was only observed with the pathogenic species (L.
monocytogenes, L. ivanovii), but not in other avirulent Listeria spp. (Fig. 25, 26)
(Gaillard et al., 1987). This clearly indicates that a specific interaction between
invasive bacteria and enterocytes. Recognition structures expressed on the
cellular membranes are probably conserved in many tissues of the host (Berche
et al., 1988). Listeriolysin O is a promoting factor of bacterial growth in vivo.
After being internalized at the same rate as that of its hemolytic revertant strain,
a nonhemolytic mutant from L. monocytogenes failed to replicate significantly
within Caco-2 cell (Fig. 27). Electron microscopic study demonstrated that
bacteria from the nonhemolyitc mutant remained inside phagosomes during
cellular infection, whereas hemolytic bacteria from L. monocytogenes were
released free within the cytoplasm (Fig. 28). This indicates that disruption of
vacuole membranes by listeriolysin O-producing strains of L. monocytogenes
might be a key mechanism allowing bacteria to escape from phagosomes and to

                                                                                  54
multiply unrestricted within cell cytoplasm (Gaillard et al., 1987).




                                                                       55
56
   During bacterial dissemination inside the host tissues, bacteria are visible
inside hepatocytes surrounding infectious foci and are capable of gaining access
to target-organs, including the placenta, central nervous system or skin. This
suggests that bacteria cross endothelial cells of capillaries and that the process
of intracellular multiplication also occurs in various tissues. L. monocytogenes
is capable of growing inside non-immune phagocytes. That even macrophages
might be the site of bacterial growth explains the difficulty encountered by the
immune system in eliminating the bacteria (Berche et al., 1988).

   An extracellular protein (p60, 60 kDa) is involved in intracellular uptake of L.
monocytogenes by mammalian cells. It does not seem to be associated with the
intracellular survival, since p60 teated mutant can penetrate and survived in the
cell (Kuhn and Goebel, 1989). Mutants impaired in the synthesis of this protein
lost the capability of invading nonprofessional phagocytic mouse fibroblast
cells. The p60 mutants formed abnormal long cell chains which disaggregated
to normal-sized single bacteria upon treatment with partially purified p60. These
disaggregated bacterial cells were able to invade mouse fibroblast cells.
Physical disruption of the cell chains by ultrasonication produced similar single
cells which were noninvasive (Fig. 29) (Kuhn and Goebel, 1989).




                                                                                 57
   Cell envelope fragments and purified ribosomes fractions combined with the
adjuvant dimethyldioctadecylammonium bromide (DDA) could protect mice
against lethal Listeria infection. The cell envelope proteins (antigens) involved
in such protection are named as delayed hypersensitivity-inducing proteins. A
purified 20,400 Mol. Wt. was purified and it is believed that more than one
antigens are involved in such protection (Antonissen et al., 1986).


7.4. Hemolysins of L. monocytogenes

  Hemolytic and lipolytic antigens were purified in the early 1970's. The
hemolysin purified by acid precipitation and repeated chromatographies was a
protein of molecular weight 171,000 (Jenkins and Watson, 1971). These
hemolytic and lipolytic antigens were toxic to mouse macrophage monolayers
(Watson and Lavizzo, 1973). This hemolysin could increase the plasma

                                                                               58
β-glucuronidase levels when intraperitoneal injected into mice, and it caused
increased plasma levels of ornithine carbamyltransferase after intravenous
injection (Kingdon and Sword, 1970).

Streptolysin S (SLS) is a bacteriocin-like haemolytic and cytotoxic virulence
factor that plays a key role in the virulence of Group A Streptococcus (GAS),
the causative agent of pharyngitis, impetigo, necrotizing fasciitis and
streptococcal toxic shock syndrome. Although it has long been thought that SLS
and related peptides are produced by GAS and related streptococci only, there is
evidence to suggest that a number of the most notorious Gram-positive
pathogenic bacteria, including L. monocytogenes, Clostridium botulinum and
Staphylococcus aureus, produce related peptides (Fig. 30). The distribution of
the L. monocytogenes cluster is particularly noteworthy in that it is found
exclusively among a subset of lineage I strains; i.e., those responsible for the
majority of outbreaks of listeriosis. Expression of these genes results in the
production of a haemolytic and cytotoxic factor, designated Listeriolysin S,
which contributes to virulence of the pathogen as assessed by murine- and
human polymorphonuclear neutrophil-based studies (Cotter et al., 2008).




                                                                              59
7.4.1 Production of Listeriolysin

   The listeriolysin O is similar to other sulfhydryl-activated hemolysin such as
streptolysin O, pneumolysin, alveolysin, perfringolysin O (Geoffroy et al.,
1987). It is produced by virulent L. monocytogenes and also by L. ivanovii and
L. seeligeri and these two species are also pathogenic, mostly in animals
(Leimeister-W:achter and Chakraborty, 1989; Vazquez-Boland et al., 1989). The
listeriolysin O from L. ivanovii shows good homology to the deduced amino
acid sequence of the listeriolysin O from L. monocytogenes. In culture
supernatants of L. ivanovii a sphingomyelinase and a lecithinase activity could
be detected, both enzymatic activities together contributing to the pronounced
hemolysis caused by L. ivanovii (Kreft et al., 1989).

   It has been postulated that the intracellular environment imposes stress
conditions similar to heat shock on invading bacteria. The intracellular
environment (low pH, presence of H2O2 and other oxidating agents) may
impose a stress on the bacterial cells to which the bacteria may react by
inducing stress proteins, e.g., heat shock proteins. Listeriolysin was still very
efficiently synthesized in one L. monocytogenes strain even intracellularly and
induced under heat shock conditions in another strain. Listeriolysin appears to
be the only major extracellular protein synthesized under heat shock conditions;
other heat shock proteins remain cell associated (Sokolovic and Goebel, 1989).

7.4.2. Purification of Listeriolysin

   Bacteria were grown for 18 h at 37 C in Chelex-treated medium, which
allowed a remarkably greater hemolysin production. The supernatant fluid was
concentrated by ultrafiltration. The crude concentrate was passed through
thiopropyl-Sepharose 6B column (thio-disulfide exchange affinity
chromatography), and further purified by three gel filtrations (Sephacryl S-200,
Bio-Gel P-100, Fractogel HW-50). A single polypeptide chain of MW 60,000,
visualized as one sharp band by SDS-PAGE, was obtained (Geoffroy et al.,
1987). The purification of such SH-cytolysins could be achieved by a further gel
filtration with a reducing agent (dithiothreitol) in the eluent (Vazquez-Boland et
al., 1989).

  Listeriolysin O associated with the rabbit erythrocyte membrane was also

                                                                                60
purified, and the monomer was estimated to be 55,000 to 60,000 by SDS-PAGE.
This hemolysin in form of oligomers embeds within the lipid bilayer generated
generated large transmembrane pores (Parrisius et al., 1986).

  The thiol-activated hemolysin (cytolysin) of 61 kDa produced by L. ivanovii
was also purified and it is also named as ivanolysin O (Vazquez-Boland et al.,
1989).

7.4.3. Characteristics of Listeriolysin

  The purified hemolysin displayed the usual properties of the SH-activated
cytolysins. Activity was inhibited by cholesterol. Epicholesterol is a very weak
inhibitor, while dehydroepiandrosterone (lack aliphatic side chain) was inactive.
Activity is totally inhibited by HgCl2 or p-chloromercuribenzoate. The
mercurial inhibition is reversed by dithiothreitol or cysteine (Geoffroy et al.,
1987). Activity will loose after treatment with cholesterol for 30 min at 37 C.

   This toxin exhibits a narrow pH range of activity, with optimum at pH 5.5,
and no activity at pH 7.0. Hemolytic activity will restore after returning the pH
from 7.0 to 5.5 (Geoffroy et al., 1987).

   This toxin is antigenically related to streptolysin O, the pure toxin gave a
single immunoprecipitate line by gel diffusion versus horse anti-streptolysin
serum (Geoffroy et al., 1987).

7.4.4. Toxicity of Listeriolysin

   The purified toxin is cytolytic at very low doses; and 30-40 molecules of
listeriolysin O is needed to lyse a single erythrocyte (Geoffroy et al., 1987).

    The LD50 of determined by i.v. injection into mice is about 0.8 μg per mouse.
Toxin administered in PBS at pH 5.5-6.8, the mice died within 1 to 2 min, while
at pH 7.2, the mice died after a delay of 30 to 60 min, but the LD50 remains
unchanged. Toxin injected intradermally into mouse will induce rapid
inflammatory, but no mortality was observed up to 5 μg of toxin (Geoffroy et al.,
1987).

7.4.5. Function of Listiolysin

                                                                               61
   A nonhemolytic mutant was generated by inserting a single copy of
transposon Tn917 in the structural gene of listeriolysin O (hlyA) and these
mutant were avirulent in the mouse (Cossart et al., 1989). Two of these
nonhemolytic strains were rapidly destroyed within 48 h of infection. In contrast,
the complemented strain (hlyA::Tn917, pLis4) harboring the hlyA gene on
plasmid pLis4 replicated in spleen and liver, inducing visible abscesses and
early mortality in mice (Cossart et al., 1989). In another paper, Tn916-induced
nonhemolytic mutants of L. monocytogenes are avirulent. When these mutants
and hemolytic virulent strain were incubated with macrophages, both strains
were capable of becoming internalized. The hemolytic strain multiplied rapidly
and the non-hemolytic strains were unable to multiply intracellularly (Kuhn et
al., 1988). The uptake of nonhemolytic mutants and other hemolytic virulent
strains had similar uptake rate by the nonprofessional phagocytes, the mouse
embryonic fibroblast cell line 3T6 (Kuhn et al., 1988).

7.4.6. Molecular Study of Listeriolysin

   By immunoblotting with an antiserum raised against purified listeriolysin O,
Cossart et al. detected the presence of a truncated protein of 52 kD in culture
supernatants of a Tn1545-induced nonhemolytic mutant of L. monocytogenes
(Mengaud et al., 1987). The region of insertion of the transposon (in a open
reading frame, ORF) has been cloned and sequenced and the deduced amino
acid sequence of this open reading frame revealed that listeriolysin O is
homologous to streptolysin O and pneumolysin, although homologies were not
detectable at the DNA level (Mengaud et al., 1987; Mengaud et al., 1988). So it
is why some toxins are immunologically cross-reactive and not hybridize at
stringent condition at the DNA level.

   Chromosomal DNA of L. monocytogenes, digested with MboI, had been
cloned in the BamHI site of the cosmid vector pHC79. After transformation of E.
coli HB101, hemolytic clones were obtained on ampicillin-blood agar plates. By
further selections, pCL102 was obtained and it contained an 8.5 kb insert DNA.
Hemolytic activity could be detected and the production of listeriolysin O was
detected by Western blot analysis of the extracts, using an antiserum (Mengaud
et al., 1988). Sequence of 400 bp in the open reading frame of listeriolysin O
next to the insert transposon DNA (Mengaud et al., 1987) was used as a probe
to identify the location of the listeriolysin O gene in the pCL102 (Mengaud et

                                                                               62
al., 1988).

  The insert was subcloned into linerarized replicative forms of M13mp18,
M13mp19, and M13mp21 and transformed into competent E. coli TG1 cells.
The nucleotide sequence was determined by the dideoxy chain terminator
method. The first ATG in this ORF is preceded, 10 nucleotides upstream, by a
hexanucleotide (AAGGAG) complementary to the 3' end of the 16S RNA of L.
monocytogenes which might be the ribosome binding site (Shine-Dalgarno) for
the listeriolysin O gene (Mengaud et al., 1988).

  The hlyA (encodes listeriolysin O) gene was also cloned in E. coli DH5α by
screening a gene library of about 4-10 kb L. monocytogenes DNA in pUC18
vector (Leimeister-W:achter and Chakraborty, 1989).

  The protein encoded by the ORF starting at the ATG is 529 amino acid long
(586,000). Its amino-terminal sequence presents all the characteristics of signal
sequences of gram-positive bacteria, as follows: the first residues are
hydrophilic and positively charged, followed by about 20 hydrophobic residues.
The putative cleavage site by the signal peptidase lies probably after lysine 25,
as the sequence starting at residue 26 is homologous to the amino-terminal
sequence of the SH-dependent hemolysin secreted by L. ivanovii. Consequently,
the secreted listeriolysin O (without the signal sequence) would contain 504
amino acids and have a molecular mass of 558,000 (Mengaud et al., 1988).

   The analysis of a non-hemolytic variants revealed the presence of a deletion
of 300 bp and a transposon insertion located 1.6 kb and 200 bp upstream of the
hlyA gene, respectively, and suggests that at least two elements at these
upstream position are required for the expression of the hlyA gene
(Leimeister-W:achter et al., 1989). In fact, two ORFs are located adjacent to the
hlyA region, ORF D located 304 bp downstream from hlyA, and ORF U located
224 bp upstream from and in opposite direction to hlyA. Promoter mapping
performed by both primer extension with reverse transcriptase mapping and S1
nuclease mapping with RNAs extracted from cells. The three ORFs are
independently transcribed. The hlyA is transcribed from two promoters
separated by 10 bp (P1 hlyA and P2 hlyA). ORF U is transcribed in the opposite
direction from an adjacent promoter (Fig. 31). The four promoter sequences
have -10 regions related to the E. coli consensus sequence, but only one of them
(P1 hlyA) has a -35 region similar to the E. coli consensus sequence. These two

                                                                               63
promoter regions are separated by a palindrome sequence TTAACAA/
TA/TTGTTAA. This palindrome was also found upstream from the ORF D
promoter, suggesting that all three genes are similarly regulated (Fig. 32)
(Mengaud et al., 1989).




                                                                         64
   Among various strains of L. monocytogenes tested, the gene hlyA and its 3'
adjacent region appeared well-conserved, and a restriction length polymorphism
was detected in the region located upstream from hlyA with no obvious
correlation with the hemolytic phenotype or the serovar of the strains tested
(Gormley et al., 1989). In another paper (Leimeister-W:achter and Chakraborty,
1989), all the serotypes of L. monocytogenes, the hlyA gene is present as a
single-copy gene on the chromosome, regardless of the strength of the
hemolytic phenotype. No differences in DNA hybridization patterns were
obtained with the restriction enzymes EcoRI, SphI, BamHI, or AccI in strains
with various hemolytic activities belonging to the same phenotype. Sequences
within the hlyA structural gene appear to be well conserved from strain to strain,
and it is suspected that the differences observed in hemolytic activity may be
due to mutations that affect the expression of the gene (Leimeister-W:achter and
Chakraborty, 1989). The flanking regions of hlyA were less conserved, and are
somewhat serotype specific (Fig. 33, 34) (Leimeister-W:achter and Chakraborty,
1989).




                                                                                65
 A probe, an 651-bp HindIII fragment from this hlyA gene, only hybridized to L.
monocytogenes, but not to other Listeria spp. (Mengaud et al., 1988). Under
low-stringency hybridization conditions, sequences homologous to the hlyA
gene and its 5' adjacent regions were detected in the hemolytic and pathogenic
species L. ivanovii, and in the hemolytic but non-pathogenic species L. seeligeri
(Gormley et al., 1989; Leimeister-W:achter and Chakraborty, 1989).

Comparison of listeriolysin O with streptolysin O and pneumolysin

   Streptolysin O from Streptococcus pyogenes and pneumolysin from S.
pneumoniae share homologies. These proteins have identical molecular weight,
if one takes into account the secreted form of streptolysin O (471 amino acids),
the pneumolysin (471 amino acids) being a nonsecreted protein. The putative

                                                                              66
signal sequence of listeriolysin (25 amino acids) is shorter than that of
streptolysin (33 amino acids). They have a unique cysteine located in their
carboxy-terminal part, and when one aligns the two sequences at the unique
cysteine, the highest homology lies in the region of this unique cysteine.
Homologies between the three proteins are present along the whole sequence,
but they are stronger towards the carboxy-terminal end. In particular, around the
unique cysteine, an 11-amino-acid peptide is conserved in the three sequences.
The three sequences can be completely aligned at the unique cysteine, if one
introduces two deletions of 1 amino acid for streptolysin O and one delection of
1 amino acid for pneumolysin. The signal sequence of listeriolysin O
corresponds to the N-terminal part of streptolysin O, the hydrophobic amino
acids of listeriolysin O being changed for hydrophilic ones. This is the region of
lowest homology (Mengaud et al., 1988).

7.4.7. The CAMP Factor

  The Christie-Atkins-Munch-Peterson (CAMP) test is useful in confirming
species. The test is performed by streaking a β-hemolytic Staphylococcus aureus
and a Rodococcus equi culture in parallel on a sheep blood agar plate, with
several test culture streaked parallel to one another, but at right angles to and
between the S. aureus and R. equi.

  Some bacteria such as group B streptococci and Listeria induce a distinct
zone of complete hemolysis when grown near the diffusion zone of the
β-hemolysin of S. aureus. The CAMP factor is a protein that stably binds to
ceramide-containing membranes, e.g. erythrocytes, in which the membrane
sphinogomyelin had been converted to ceramide by a sphingomyelinase
produced (Schneewind et al., 1988). Since L. monocytogenes shows positive
CAMP test with staphylococci, the listeriolysin O or another specific CAMP
factor may be responsible.

  In contrast, L. ivanovii is CAMP positive with R. equi, a sphingomyelinase
must be produced, and actually a 27 kD hemolytic sphingomyelinase C was
purified (Vazquez-Boland et al., 1989). Sphingomyelinase and lecithinase
activity could be detected in L. invanovii culture supernatant (Kreft et al., 1989).

7.5. Expression of virulence factors



                                                                                  67
L. monocytogenes genome expression during mouse infection was determined
by microarray. In the spleen of infected mice, approximately 20% of the
Listeria genome is differentially expressed, essentially through gene activation,
as compared to exponential growth in rich broth medium. Data showed that,
during infection, Listeria is in an active multiplication phase, as revealed by the
high expression of genes involved in replication, cell division and multiplication.
In vivo bacterial growth requires increased expression of genes involved in
adaptation of the bacterial metabolism and stress responses, in particular to
oxidative stress. Listeria interaction with its host induces cell wall metabolism
and surface expression of virulence factors. The in vivo differential expression
of the Listeria genome is coordinated by a complex regulatory network, with a
central role for the PrfA-SigB interplay. In particular, L. monocytogenes up
regulates in vivo the two major virulence regulators, PrfA and VirR, and their
downstream effectors. Mutagenesis of in vivo induced genes allowed the
identification of novel L. monocytogenes virulence factors, including an
LPXTG surface protein, suggesting a role for S-layer glycoproteins and for
cadmium efflux system in Listeria virulence (Fig. 35) (Camejo et al., 2009).




                                                                                68
The influence of food-related acid stress on the virulence capacity of L.
monocytogenes was evaluated. The survival of acid-adapted and non-adapted L.
monocytogenes cells during exposure to lethal concentrations of acetic acid was
monitored. Also the effect of sublethal acid stress exposure on the expression
levels of several virulence genes and on the capacity to invade Caco-2 cells was
analyzed. Acid-adapted and non-adapted cells showed different acid tolerance
response (ATR) patterns (Fig. 36). Data also demonstrate that pre-exposure to
sublethal acid stress might lead to gadD2 induction. However, no correlation
with the origin of the strain and with the ATR was noticed, indicating that
probably other genes also could play an important role in this ATR mechanism.
Additionally, our data showed that acid adaptation could influence the virulence

                                                                              69
capacity by regulating the expression levels of virulence genes. Moreover, the
inlA expression data strongly correlated with the results of the in vitro invasion
study. These results lead to the indication that low pH and acetic acid, used in
minimally processed food products, might influence the virulence potential of L.
monocytogenes (Table 19, 20) (Werbrouck et al., 2009).




                                                                                70
L. monocytogenes can respond rapidly to changing environmental conditions, as
illustrated by its ability to transition from a saprophyte to an orally transmitted
facultative intracellular pathogen. Differential associations between various
alternative sigma factors and a core RNA polymerase provide a transcriptional
mechanism for regulating bacterial gene expression that is crucial for survival in
rapidly changing conditions. Alternative sigma factors are key components of
complex L. monocytogenes regulatory networks that include multiple
transcriptional regulators of stress-response and virulence genes, regulation of
genes encoding other regulators, and regulation of small RNAs (Table 21, Fig.
37) (Chaturongakul et al., 2008).




                                                                                 71
72
8. CONCLUSIONS

   L. monocytogenes is a pathogenic bacterium widely distributed in the foods
and environments. It has been involved in foodborne listeriosis in American and
Europian countries. The number of cases is increasing (McLauchlin, 1987).
Also, the incidence of this pathogen in local foods is similar to other reports
(Wong et al., 1990). However, the occurrence of listeriosis in Taiwan is
unknown. The following works could be done to clearify Listeria problems in
this area and improve food safety:

1. Introduce identification methodology to the food industry, clinical

                                                                             73
laboratories, and governmental laboratories.
2. Survey the presence of this pathogen in foods, especially in those unique
Chinese foods.
3. Improve the sanitation operations in food industry with regard to this
pathogen.


9. REFERENCES


Al-Ghazali,M.R.,Al-Azawi,S.K. 1990. Listeria monocytogenes contamination
of crops grown on soil treated with sewage sludge cake. Journal of Applied
Bacteriology 69, 642-647.

Al-Ghazali,M.R.,Al-Azawi,S.K. 1988. Effects of sewage treatment on the
removal of Listeria monocytogenes. Journal of Applied Bacteriology 65,
203-208.

Antonissen,A.C.J.M., Lemmens,P.J.M.R., van den Bosch,J.F., van Boven,C.P.A.
1986. Purification of a delayed hypersensitivity-inducing protein from Listeria
monocytogenes. FEMS Microbiol. Lett. 34, 91-95.

Badosa,E., Chico,N., Pla,M., Pares,D., Montesinos,E. 2009. Evaluation of ISO
enrichment real-time PCR methods with internal amplification control for
detection of Listeria monocytogenes and Salmonella enterica in fresh fruit and
vegetables. Letters in Applied Microbiology 49, 105-111.

Bailey,J.S., Fletcher,D.L., Cox,N.A. 1989. Recovery and serotype distribution
of Listeria monocytogenes from broiler chickens in the Southeastern United
States. Journal of Food Protection 52, 148-150.

Baloga,A.O.,Harlander,S.K. 1991. Comparison of methods for discrimination
between strains of Listeria monocytogenes from epidemiological surveys.
Applied and Environmental Microbiology 57, 2324-2331.

Bannerman,E.S.,Bille,J. 1988. A new selective medium for isolating Listeria
spp. from heavily contaminated material. Applied and Environmental
Microbiology 54, 165-167.

Barmpalia-Davis,I.M., Geornaras,I., Kendall,P.A., SOFOS,J.N. 2008. Survival
of Listeria monocytogenes in a simulated dynamic gastrointestinal model during
                                                                                 74
storage of inoculated bologna and salami slices in vacuum packages. Journal of
Food Protection 71, 2014-2023.

Berche,P., Gaillard,J.-L., Richard,S. 1988. Invasiveness and intracellular growth
of Listeria monocytogenes. Infection 16(suppl.2), S145-S148.

Bessesen,M.T., Luo,Q., Rotbart,H.A., Blaser,M.J., Ellison III,R.T. 1990.
Detection of Listeria monocytogenes by using the polymerase chain reaction.
Applied and Environmental Microbiology 56, 2930-2932.

Beuchat,L.R., Brackett,R.E., Hao,D.Y., Conner,D.E. 1986. Growth and thermal
inactivation of Listeria monocytogenes in cabbage and cabbage juice. Canadian
Journal of Microbiology 32, 791-795.

Blanco,M., Fernandez-Garayzabal,J.F., Dominguez,L., Briones,V.,
Vazquez-Boland,J.A., Blanco,J.L., Garcia,J.A., Suarez,G. 1989. A technique for
the direct identification of haemolytic-pathogenic Listeria on selective plating
media. Letters in Applied Microbiology 9, 125-128.

Border,P.M., Howard,J.J., Plastow,G.S., Siggens,K.W. 1990. Detection of
Listeria species and Listeria monocytogenes using polymerase chain reaction.
Letters in Applied Microbiology 11, 158-162.

Brackett,R.E. 1987. Antimicrobial effect of chlorine on Listeria monocytogenes.
Journal of Food Protection 50, 999-1003.

Brackett,R.E. 1988. Presence and persistence of Listeria monocytogenes in food
and water. Food Techn. 42(4), 162-164.

Bradshaw,J.G., Peeler,J.T., Corwin,J.J., Hunt,J.M., Tierney,J.T., Larkin,E.P.,
Twedt,R.M. 1985. Thermal resistance of Listeria monocytogenes in milk.
Journal of Food Protection 48, 743-745.

Bradshaw,J.G., Peeler,J.T., Corwin,J.J., Hunt,J.M., Twedt,R.M. 1987. Thermal
resistance of Listeria monocytogenes in dairy products. Journal of Food
Protection 50, 543-544.

Buchanan,R.L., Stahl,H.G., Bencivengo,M.M., Del Corral,F. 1989. Comparison
of lithium chloride-phenylethanol-moxalactam and modified Vogel Johnson
Agars for detection of Listeria spp. in retail-level meats, poultry, and seafood.
Applied and Environmental Microbiology 55, 599-603.


                                                                                 75
Bunning,V.K., Crawford,R.G., Tierney,J.T., Peeler,J.T. 1990. Thermotolerance
of Listeria monocytogenes and Salmonella typhimurium after sublethal heat
shock. Applied and Environmental Microbiology 56, 3216-3219.

Butman,B.T., Plank,M.C., Durham,R.J., Mattingly,J.A. 1988. Monoclonal
antibodies which identify a genus-specific Listeria antigen. Applied and
Environmental Microbiology 54, 1564-1569.

Byelashov,O.A., Kendall,P.A., Belk,K.E., Scanga,J.A., SOFOS,J.N. 2008.
Control of Listeria monocytogenes on vacuum-packaged frankfurters sprayed
with lactic acid alone or in combination with sodium lauryl sulfate. Journal of
Food Protection 71, 728-734.

Camejo,A., Buchrieser,C., Couve,E., Carvalho,F., Reis,O., Ferreira,P., Sousa,S.,
Cossart,P., Cabanes,D. 2009. In vivo transcriptional profiling of Listeria
monocytogenes and mutagenesis identify new virulence factors involved in
infection. PLoS Pathog. 5, e1000449.

Cassiday,P.K., Brackett,R.E., Beuchat,L.R. 1989. Evaluation of three newly
developed direct plating media to enumerate Listeria monocytogenes in foods.
Applied and Environmental Microbiology 55, 1645-1648.

Chaturongakul,S., Raengpradub,S., Wiedmann,M., Boor,K.J. 2008. Modulation
of stress and virulence in Listeria monocytogenes. Trends Microbiol. 16,
388-396.

Chen,J., Chen,Q., Jiang,J., Hu,H., Ye,J., Fang,W. 2009. Serovar 4b Complex
Predominates Among Listeria monocytogenes Isolates from Imported Aquatic
Products in China. Foodborne. Pathog. Dis.

CHEN,N.,Shelef,L.A. 1992. Relationship between water activity, salts of lactic
acid, and growth of Lisateria monocytogenes in a meat model system. Journal
of Food Protection 55, 574-578.

Conner,D.E., Brackett,R.E., Beuchat,L.R. 1986. Effect of temperature, sodium
chloride, and pH on growth of Listeria monocytogenes in cabbage juice.
Applied and Environmental Microbiology 52, 59-63.

Conter,M., Paludi,D., Zanardi,E., Ghidini,S., Vergara,A., Ianieri,A. 2009.
Characterization of antimicrobial resistance of foodborne Listeria
monocytogenes. Internation Journal of Food Microbiology 128, 497-500.

                                                                                  76
Cossart,P., Vicente,M.F., Mengaud,J., Baquero,F., Perez-Diaz,J.C., Berche,P.
1989. Listeriolysin O is essential for virulence of Listeria monocytogenes: direct
evidence obtained by gene complementation. Infection & Immunity 57,
3629-3636.

Cotter,P.D., Draper,L.A., Lawton,E.M., Daly,K.M., Groeger,D.S., Casey,P.G.,
Ross,R.P., HILL,C. 2008. Listeriolysin S, a novel peptide haemolysin associated
with a subset of lineage I Listeria monocytogenes. PLoS Pathog. 4, e1000144.

Crawford,R.G., Beliveau,C.M., Peeler,J.T., Donnelly,C.W., Bunning,V.K. 1989.
Comparative recovery of uninjured and heat-injured Listeria monocytogenes
cells from bovine milk. Applied and Environmental Microbiology 55,
1490-1494.

Curtis,G.D.W., Nichols,W.W., Falla,T.J. 1989. Selective agents for Listeria can
inhibit their growth. Letters in Applied Microbiology 8, 169-172.

Datta,A.R., Wentz,B.A., Hill,W.E. 1987. Detection of hemolytic Listeria
monocytogenes by using DNA colony hybridization. Applied and
Environmental Microbiology 53, 2256-2259.

Datta,A.R., Wentz,B.A., Russell,J. 1990. Cloning of the listeriolysin O gene and
development of specific gene probes for Listeria monocytogenes. Applied and
Environmental Microbiology 56, 3874-3877.

Deneer,H.G.,Boychuk,I. 1991. Species-specific detection of Listeria
monocytogenes by DNA amplification. Applied and Environmental
Microbiology 57, 606-609.

Donnelly,C.W.,Baigent,G.J. 1986. Method for flow cytometric detection of
Listeria monocytogenes in milk. Applied and Environmental Microbiology 52,
689-695.

Donnelly,C.W., Baigent,G.J., Briggs,E.H. 1988. Flow cytometry for automated
analysis of milk containing Listeria monocytogenes. J. Assoc. Off. Anal. Chem.
71, 655-664.

Donnelly,C.W., Briggs,E.H., Donnelly,L.S. 1987. Comparison of heat resistance
of Listeria monocytogenes in milk as determined by two methods. Journal of
Food Protection 50, 14-17.

Doumith,M., Buchrieser,C., Glaser,P., JACQUET,C., Martin,P. 2004.
                                                                                  77
Differentiation of the major Listeria monocytogenes serovars by multiplex PCR.
Journal of Clinial Microbiology 42, 3819-3822.

Doyle,M.P. 1988. Effect of environmental and processing conditions on Listeria
monocytogenes. Food Techn. 42(4), 169-171.

Doyle,M.P.,Schoeni,J.L. 1986. Selective-enrichment procedure for isolation of
Listeria monocytogenes from fecal and biologic specimens. Applied and
Environmental Microbiology 51, 1127-1129.

Doyle,M.P.,Schoeni,J.L. 1987. Comparison of procedures for isolating Listeria
monocytogenes in soft, surface-ripened cheese. Journal of Food Protection 50,
4-6.

El-Kest,S.E.,Marth,E.H. 1988a. Inactivation of Listeria monocytogenes by
chlorine. Journal of Food Protection 51, 520-524.

El-Kest,S.E.,Marth,E.H. 1988b. Temperature,pH, and strain of pathogen as
factors affecting inactivation of Listeria monocytogenes by chlorine. Journal of
Food Protection 51, 622-625.

El-Shenawy,M.A.,Marth,E.H. 1988a. Inhibition and inactivation of Listeria
monocytogenes by sorbic acid. Journal of Food Protection 51, 842-847.

El-Shenawy,M.A.,Marth,E.H. 1988b. Sodium benzoate inhibits growth of or
inactivates Listeria monocytogenes. Journal of Food Protection 51, 525-530.

Flamm,R.K., Hinrichs,D.J., Thomashow,M.F. 1989. Cloning of a gene encoding
a major secreted polypeptide of Listeria monocytogenes and its potential use as
a species-specific probe. Applied and Environmental Microbiology 55,
2251-2256.

Fleming,D.W., Cochi,S.L., MacDonald,K.L., Brondum,J., Hayes,P.S.,
Plikaytis,B.D., Holmes,M.B., Audurier,A., Broome,C.V., Remgold,A.L. 1985.
Pasteurized milk as a vehicle of infection in an outbreak of listeriosis. N. Engl. J.
Med. 312, 404-407.

Fox,E., O'Mahony,T., Clancy,M., Dempsey,R., O'Brien,M., Jordan,K. 2009.
Listeria monocytogenes in the Irish dairy farm environment. Journal of Food
Protection 72, 1450-1456.

Fraser,J.A.,Sperber,W.H. 1988. Rapid detection of Listeria spp. in food and

                                                                                  78
environmental samples by esculin hydrolysis. Journal of Food Protection 51,
762-765.

Furrer,B., Candrian,U., Hoefelein C, Luethy,J. 1991. Detection and
identification of Listeria monocytogenes in cooked sausage products and in milk
by in vitro amplification of haemolysin gene fragments. Journal of Applied
Bacteriology 70, 372-379.

Gaillard,J.L., Berche,P., Mounier,J., Richard,S., Sansonetti,P. 1987. In vitro
model of penetration and intracellular growth of Listeria monocytogenes in the
human enterocyte-like cell line Caco-2. Infection & Immunity 55, 2822-2829.

Geoffroy,C., Gaillard,J.L., Alouf,J.E., Berche,P. 1987. Purification,
characterization, and toxicity of the sulfhydryl-activated hemolysin listeriolysin
O from Listeria monocytogenes. Infection & Immunity 55, 1641-1646.

Glass,K.A.,Doyle,M.P. 1989a. Fate and thermal inactivation of Listeria
monocytogenes in beaker sausage and pepperoni. Journal of Food Protection 52,
226-231.

Glass,K.A.,Doyle,M.P. 1989b. Fate of Listeria monocytogenes in processed
meat products during refrigerated storage. Applied and Environmental
Microbiology 55, 1565-1569.

Golden,D.A., Beuchat,L.R., Brackett,R.E. 1988a. Direct plating technique for
enumeration of Listeria monocytogenes in foods. J. Assoc. Off. Anal. Chem. 71,
647-650.

Golden,D.A., Beuchat,L.R., Brackett,R.E. 1988b. Evaluation of selective direct
plating media for their suitability to recover uninjured, heat-injured, and
freeze-injured Listeria monocytogenes from foods. Applied and Environmental
Microbiology 54, 1451-1456.

Gormley,E., Mengaud,J., Cossart,P. 1989. Sequences homologous to the
listeriolysin O gene region of Listeria monocytogenes are present in virulent and
avirulent haemolytic species of the genus Listeria. Res. Microbiol. 140,
631-643.

Gray,M.L. 1960. Isolation of Listeria monocytogenes from oat silage. Science
132, 1767-1768.

Hao,D.Y., Beuchat,L.R., Brackett,R.E. 1987. Comparison of media and methods
                                                                                 79
for detecting and enumerating Listeria monocytogenes in refrigerated cabbage.
Applied and Environmental Microbiology 53, 955-957.

Harris,L.J., Daeschel,M.A., Stiles,M.E., Klaenhammer,T.R. 1989. Antimicrobial
activity of lactic acid bacteria against Listeria monocytogenes. Journal of Food
Protection 52, 384-387.

Harrison,M.A.,Carpenter,S.L. 1989. Survival of large populations of Listeria
monocytogenes on chicken breasts processed using moist heat. Journal of Food
Protection 52, 376-378.

Hashisaka,A.E., Weagant,S.D., Dong,F.M. 1989. Survival of Listeria
monocytogenes in Mozzarella cheese and ice cream exposed to gamma
irradiation. Journal of Food Protection 52, 490-492.

Heisick,J.E., Harrell,F.M., Peterson,E.H., McLaughlin,S., Wagner,D.E.,
Wesley,I.V., Bryner,J. 1989a. Comparison of four procedures to detect Listeria
spp. in foods. Journal of Food Protection 52, 154-157.

Heisick,J.E., Wagner,D.E., Nierman,M.L., Peeler,J.T. 1989b. Listeria spp. found
on fresh market produce. Applied and Environmental Microbiology 55,
1925-1927.

Jenkins,E.M.,Watson,B.B. 1971. Extracellular antigens from Listeria
monocytogenes.I. Purification and resolution of hemolytic and lipolytic antigens
from culture filtrates of Listeria monocytogenes. Infection & Immunity 3,
589-594.

Jiang,L., Chen,J., Xu,J., Zhang,X., Wang,S., Zhao,H., Vongxay,K., Fang,W.
2008. Virulence characterization and genotypic analyses of Listeria
monocytogenes isolates from food and processing environments in eastern
China. Internation Journal of Food Microbiology 121, 53-59.

Johnson,J.L., Doyle,M.P., Cassens,R.G., Schoeni,J.L. 1988. Fate of Listeria
monocytogenes in tissues of experimentally infected cattle and in hard salami.
Applied and Environmental Microbiology 54, 497-501.

Junttila,J.R., Hirn,J., Hill,P., Nurmi,E. 1989. Effect of different levels of nitrite
and nitrate on the survival of Listeria monocytogenes during the manufacture of
fermented sausage. Journal of Food Protection 52, 158-161.

Junttila,J.R., Niemel:a,S.I., Hirn,J. 1988. Minimum growth temperatures of
                                                                                   80
Listeria monocytogenes and non-haemolytic Listeria. Journal of Applied
Bacteriology 65, 321-327.

Kim,C., Swaminathan,B., Cassaday,P.K., Mayer,L.W., Holloway,B.P. 1991.
Rapid confirmation of Listeria monocytogenes isolated from foods by a colony
blot assay using a digoxigenin-labeled synthetic oligonucleotide probe. Applied
and Environmental Microbiology 57, 1609-1614.

Kim,M.K., Bang,W., Drake,M.A., Hanson,D.J., Jaykus,L.A. 2009. Impact of
storage temperature and product pH on the survival of Listeria monocytogenes
in vacuum-packaged souse. Journal of Food Protection 72, 637-643.

Kingdon,G.C.,Sword,C.P. 1970. Biochemical and immunological effects of
Listeria monocytogenes hemolysin. Infection & Immunity 1, 363-372.

Klinger,J.D., Johnson,A., Croan,D., Flynn,P., Whippie,K., Kimball,M.,
Lawrie,J., Curiale,M. 1988. Comparative studies of Nucleic acid hybridization
assay for Listeria in foods. J. Assoc. Off. Anal. Chem. 71, 669-673.

Klinger,J.D.,Johnson,A.R. 1988. A rapid nucleic acid hybridization assay for
Listeria in Foods. Food Techn. 42(7), 66-70.

Ko:hler,S., Leimeister-Wa:chter,M., Chakraborty,T., Lottspeich,F., Goebel,W.
1990. The gene coding for protein p60 of Listeria monocytogenes and its use as
a specific probe for Listeria monocytogenes. Infection & Immunity 58,
1943-1950.

Kreft,J., Funke,D., Haas,A., Lottspeich,F., Goebel,W. 1989. Production,
purification and characterization of hemolysins from Listeria ivanovii and
Listeria monocytogenes Sv4b. FEMS Microbiol. Lett. 57, 197-202.

Kuhn,M.,Goebel,W. 1989. Identification of an extracellular protein of Listeria
monocytogenes possibly involved in intracellular uptake by mammalian cells.
Infection & Immunity 57, 55-61.

Kuhn,M., Kathariou,S., Goebel,W. 1988. Hemolysin supports survival but not
entry of the intracellular bacterium Listeria monocytogenes. Infection &
Immunity 56, 79-82.

Latorre,A.A., Van Kessel,J.A., Karns,J.S., Zurakowski,M.J., Pradhan,A.K.,
Zadoks,R.N., Boor,K.J., Schukken,Y.H. 2009a. Molecular ecology of Listeria
monocytogenes: evidence for a reservoir in milking equipment on a dairy farm.
                                                                                 81
Appl. Environ Microbiol. 75, 1315-1323.

Latorre,A.A., Van Kessel,J.A., Karns,J.S., Zurakowski,M.J., Pradhan,A.K.,
Zadoks,R.N., Boor,K.J., Schukken,Y.H. 2009b. Molecular ecology of Listeria
monocytogenes: evidence for a reservoir in milking equipment on a dairy farm.
Appl. Environ Microbiol. 75, 1315-1323.

Lee,W.H.,McClain,D. 1986. Improved Listeria monocytogenes selective agar.
Applied and Environmental Microbiology 52, 1215-1217.

Leimeister-W:achter,M.,Chakraborty,T. 1989. Detection of listeriolysin, the
thio-dependent hemolysin in Listeria monocytogenes, Listeria ivanovii, and
Listeria seeligeri. Infection & Immunity 57, 2350-2357.

Leimeister-W:achter,M., Goebel,W., Chakraborty,T. 1989. Mutations affecting
hemolysin production in Listeria monocytogenes located outside the
listeriolysin gene. FEMS Microbiol. Lett. 53, 23-29.

Lindstedt,B.A., Tham,W., nielsson-Tham,M.L., Vardund,T., Helmersson,S.,
Kapperud,G. 2008. Multiple-locus variable-number tandem-repeats analysis of
Listeria monocytogenes using multicolour capillary electrophoresis and
comparison with pulsed-field gel electrophoresis typing. J. Microbiol. Methods
72, 141-148.

Loessner,M.J., Bell,R.H., Jay,J.M., Shelef,L.A. 1988. Comparison of seven
plating media for enumeration of Listeria spp. Applied and Environmental
Microbiology 54, 3003-3007.

Lovett,J. 1988. Isolation and enumeration of Listeria monocytogenes. Food
Techn. 42(4), 172-175.

Lovett,J. and Hitchins,A.D. (1989). Listeria isolation. In Bacteriological
analytical manual. Supplement. p. 29.01-29.14. Washington,D.C.: Food and
Drug Administration.

Mackey,B.M.,Bratchell,N. 1989. The heat resistance of Listeria monocytogenes.
Letters in Applied Microbiology 9, 89-94.

Mammina,C., Manfreda,G., Aleo,A., De,C.A., Pellissier,N., Romani,C.,
Nicoletti,P., Pecile,P., Nastasi,A., Pontello,M.M. 2009. Molecular typing reveals
frequent clustering among human isolates of Listeria monocytogenes in Italy.
Journal of Food Protection 72, 876-880.
                                                                               82
Marshall,D.L.,Schmidt,R.H. 1988. Growth of Listeria monocytogenes at 10 C in
milk preincubated with selected pseudomonads. Journal of Food Protection 51,
277-282.

Marth,E.H. 1988. Disease characteristics of Listeria monocytogenes. Food
Techn. 42(4), 165-168.

McBride,M.E.,Girard,K.F. 1960. A selective method for the isolation of Listeria
monocytogenes from mixed bacterial population. J. Lab. Clin. Med. 55,
153-157.

McClain,D.,Lee,W.H. 1988. Development of USDA-FSIS method for isolation
of Listeria monocytogenes from raw meat and poultry. J. Assoc. Off. Anal.
Chem.

McClure,P.J., Roberts,T.A., Oguru,P.O. 1989. Comparison of the effects of
sodium chloride, pH and termperature on the growth of Listeria monocytogenes
on gradient plates and in liquid medium. Letters in Applied Microbiology 9,
95-99.

McLauchlin,J. 1987. Listeria monocytogenes, recent advances in the taxonomy
and epidemiology of listeriosis in humans. Journal of Applied Bacteriology 63,
1-11.

McLauchlin,J., Greenwood,M.H., Pini,P.N. 1990. The occurrence of Listeria
monocytogenes in cheese from a manufacturer associated with a case of
listeriosis. Internation Journal of Food Microbiology 10, 255-262.

Mengaud,J., Chenevert,J., Geoffroy,C., Gaillard,J.L., Cossart,P. 1987.
Identification of the structural gene encoding the SH-activated hemolysin of
Listeria monocytogenes: listeriolysin O is homologous to streptolysin O and
pneumolysin. Infection & Immunity 55, 3225-3227.

Mengaud,J., Vicente,M.F., Chenevert,J., Pereira,J.M., Geoffroy,C.,
Gicquel-Sanzey,B., Baquero,F., Perez-Diaz,J.C., Cossart,P. 1988. Expression in
Escherichia coli and sequence analysis of the listeriolysin O determinant of
Listeria monocytogenes. Infection & Immunity 56, 766-772.

Mengaud,J., Vicente,M.F., Cossart,P. 1989. Transcriptional mapping and
nucleotide sequence of the Listeria monocytogenes hlyA region reveal structural
features that may be involved in regulation. Infection & Immunity 57,

                                                                               83
3695-3701.

Messina,M.C., Ahmad,H.A., Marchello,J.A., Gerba,C.P., Paquette,M.W. 1988.
The effect of liquid smoke on Listeria monocytogenes. Journal of Food
Protection 51, 629-631.

Mustapha,A.,Liewen,M.B. 1989. Destruction of Listeria monocytogenes by
sodium hypochlorite and quaternary ammonium sanitizers. Journal of Food
Protection 52, 306-311.

Niederhauser,C., Candrian,U., Hofelein,C., Jermini,M., Buhler,H.-P., Luthy,J.
1992. Use of polymerase chain reaction for detection of Listeria monocytogenes
in food. Applied and Environmental Microbiology 58, 1564-1568.

Nielsen,J.W., Dickson,J.S., Crouse,J.D. 1990. Use of a bacteriocin produced by
Pediococcus acidilactici to inhibit Listeria monocytogenes associated with fresh
meat. Applied and Environmental Microbiology 56, 2142-2145.

Nocera,D., Bannerman E, Rocourt,J., Jaton-Ogay,K., Bille,J. 1990.
Characterization by DNA restriction endonuclease analysis of Listeria
monocytogenes strains related to the Swiss epidemic of listeriosis Lausanne,
Switzerland. Journal of Clinial Microbiology 28, 2259-2263.

Notermans,S., Chakraborty,T., Leimeister-W:achter,M., Dufrenne,J.,
Heuvelman,K.J., Maas,H., Jansen,W., Wernars,K., Guinee,P. 1989. Specific
gene probe for detection of biotyped and serotyped Listeria strains. Applied and
Environmental Microbiology 55, 902-906.

Papageorgiou,D.K.,Marth,E.H. 1989. Fate of Listeria monocytogenes during the
manufacture and ripening of blue cheese. Journal of Food Protection 52,
459-465.

Parish,M.E.,Higgins,D.P. 1989. Survival of Listeria monocytogenes in Low pH
model broth systems. Journal of Food Protection 52, 144-147.

Parrisius,J., Bhakdi,S., Roth,M., Tranum-Jensen,J., Goebel,W., Seeliger,H.P.
1986. Production of listeriolysin by beta-hemolytic strains of Listeria
monocytogenes. Infection & Immunity 51, 314-319.

Parsons,G. 1988. Development of DNA probe-based commercial assays. Journal
of Clinical Immunoassay 11, 152-160.


                                                                               84
Patterson,M. 1989. Sensitivity of Listeria monocytogenes to irradiation on
poultry meat and in phosphate-buffered saline. Letters in Applied Microbiology
8, 181-184.

Payne,K.D., Rico-Munoz,E., Davidson,P.M. 1989. The antimicrobial activity of
phenolic compounds against Listeria monocytogenes and their effectiveness in a
model milk system. Journal of Food Protection 52, 151-153.

Peterkin,P.I., Idziak,E.S., Sharpe,A.N. 1991. Detection of Listeria
monocytogenes by direct colony hybridization on hydrophobic grid-membrane
filters by using a chromogen-labeled DNA probe. Applied and Environmental
Microbiology 57, 586-591.

Petran,R.,Zottola,E.A. 1988. Survival of Listeria monocytogenes in simulated
milk cooling systems. Journal of Food Protection 51, 172-175.

Phillips,J.D.,Griffiths,M.W. 1989. An electrical method for detecting Listeria
spp. Letters in Applied Microbiology 9, 129-132.

Pine,L., Malcolm,G.B., Brooks,J.B., Daneshvar,M.I. 1989. Physiological studies
on the growth and utilization of sugars by Listeria species. Canadian Journal of
Microbiology 35, 245-254.

Pini,P.N.,Gilbert,R.J. 1988a. A comparison of two procedures for the isolation
of Listeria monocytogenes from raw chickens and soft cheeses. Internation
Journal of Food Microbiology 7, 321-337.

Pini,P.N.,Gilbert,R.J. 1988b. The occurrence in the U.K. of Listeria species in
raw chickens and soft cheeses. Internation Journal of Food Microbiology 6,
317-326.

Pucci,M.J., Vedamuthu,E.R., Kunka,B.S., Vandenbergh,P.A. 1988. Inhibition of
Listeria monocytogenes by using bacteriocin PA-1 produced by Pediococcus
acidilactici PAC 1.0. Applied and Environmental Microbiology 54, 2349-2353.

Rocourt,J., Grimont,F., Grimont,P.A.D., Seeliger,H.P.R. 1982. DNA relatedness
among serovars of Listeria monocytogenes sensu lato. Current Microbiology 7,
383-388.

Rodriguez,L.D., Boland,J.A.V., Garayzabal,J.F.F., Tranchant,P.E.,
Gomez-Lucia,E., Ferri,E.F.R., Fernandez,G.S. 1986. Microplate technique to
determine hemolytic activity for routine typing of Listeria strains. Journal of
                                                                                  85
Clinial Microbiology 24, 99-103.

Rodriguez,L.D., Fernandez,G.S., Garayzabal,J.F.F., Ferri,E.R. 1984. New
methodology for the isolation of Listeria microorganisms from heavily
contaminated environments. Applied and Environmental Microbiology 47,
1188-1190.

Ryser,E.T.,Marth,E.H. 1987a. Fate of Listeria monocytogenes during the
manufacture and ripening of Camembert cheese. Journal of Food Protection 50,
372-378.

Ryser,E.T.,Marth,E.H. 1987b. Behavior of Listeria monocytogenes during the
manufacture and ripening of Cheddar cheese. Journal of Food Protection 50,
7-13.

Ryser,E.T.,Marth,E.H. 1988. Survival of Listeria monocytogenes in cold-pack
cheese food during refrigerated storage. Journal of Food Protection 51, 615-621.

Ryser,E.T., Marth,E.H., Doyle,M.P. 1985. Survival of Listeria monocytogenes
during manufacture and storage of cottage cheese. Journal of Food Protection
48, 746-750.

Schaack,M.M.,Marth,E.H. 1988a. Survival of Listeria monocytogenes in
refrigerated cultured milks and yogurt. Journal of Food Protection 51, 848-852.

Schaack,M.M.,Marth,E.H. 1988b. Behavior of Listeria monocytogenes in skim
milk and in yogurt mix during fermentation by thermophilic lactic acid bacteria.
Journal of Food Protection 51, 607-614.

Schaack,M.M.,Marth,E.H. 1988c. Behavior of Listeria monocytogenes in skim
milk during fermentation with mesophilic lactic starter cultures. Journal of Food
Protection 51, 600-606.

Schlech,W.F., Lavigne,P.M., Bortolussi,R.A., Allen,A.C., Haldane,E.V.,
Wort,A.J., Hightower,A.W., Johnson,S.E., King,S.H., Nicholls,E.S.,
Broome,C.V. 1983. Epidemic listeriosis--evidence for transmission by food. N.
Engl. J. Med. 308, 203-206.

Schlech,W.F.I. 1988. Virulence characteristics of Listeria monocytogenes. Food
Techn. 42(4), 176-178.

Schneewind,O., Friedrich,K., Lu:tticken,R. 1988. Cloning and expression of the

                                                                               86
CAMP factor of group B streptococci in Escherichia coli. Infection & Immunity
56, 2174-2179.

Seeliger,H.P.R. and H:ohne,K. (1979). Serotyping of Listeria monocytogenes
and related species. In Methods in microbiology. vol. 13. ( ed. Bergan,T. and
Norris,J.R.), pp. 31-49. New York: Academic Press.

Seeliger,H.P.R. and Jones,D. (1984). Genus Listeria. In Bergey's manual of
systematic bacteriology. pp. 1235-1245. Baltimore, U.S.A.: Williams and
Wilkins.

Skjerve,E., Rorvik,L.M., Olsvik,O. 1990. Detection of Listeria monocytogenes
in foods by immunomagnetic separation. Applied and Environmental
Microbiology 56, 3478-3481.

Sokolovic,Z.,Goebel,W. 1989. Synthesis of listeriolysin in Listeria
monocytogenes under heat shock conditions. Infection & Immunity 57,
295-298.

Steinbruegge,E.G., Maxcy,R.B., Liewen,M.B. 1988. Fate of Listeria
monocytogenes on ready to serve lettuce. Journal of Food Protection 51,
596-599.

Stelma,G.N., Jr., Reyes,A.L., Peeler,J.T., Francis,D.W., Hunt,J.M.,
Spaulding,P.L., Johnson,C.H., Lovett,J. 1987. Pathogenicity test for Listeria
monocytogenes using immunocompromised mice. Journal of Clinial
Microbiology 25, 2085-2089.

Stessl,B., Luf,W., Wagner,M., Schoder,D. 2009. Performance testing of six
chromogenic ALOA-type media for the detection of Listeria monocytogenes. J.
Appl. Microbiol. 106, 651-659.

Thomas,E.J.G., King,R.K., Burchak,J., Gannon,V.P.J. 1991. Sensitive and
specific detection of Listeria monocytogenes in milk and ground beef with the
polymerase chain reaction. Applied and Environmental Microbiology 57,
2576-2580.

Vazquez-Boland,J.A., Dominguez,L., Rodriguez-Ferri,E.F., Suarez,G. 1989.
Purification and characterization of two Listeria ivanovii cytolysins, a
sphingomyelinase C and a thio-activated toxin (Ivanolysin O). Infection &
Immunity 57, 3928-3935.

                                                                                87
Watson,B.B.,Lavizzo,J.C. 1973. Extracellular antigens from Listeria
monocytogenes. II. Cytotoxicity of hemolytic and lipolytic antigens of Listeria
for cultured mouse macrophages. Infection & Immunity 7, 753-758.

Wehr,H.M. 1987. Listeria monocytogenes--a current dilemma. J. Assoc. Off.
Anal. Chem. 70, 769-772.

Werbrouck,H., Vermeulen,A., Van,C.E., Messens,W., Herman,L., Devlieghere,F.,
Uyttendaele,M. 2009. Influence of acid stress on survival, expression of
virulence genes and invasion capacity into Caco-2 cells of Listeria
monocytogenes strains of different origins. Internation Journal of Food
Microbiology 134, 140-146.

Wernars,K., Heuvelman,C.J., Chakraborty,T., Notermans,S.H.W. 1991. Use of
the polymerase chain reacgion for direct detection of Listeria monocytogenes in
soft cheese. Journal of Applied Bacteriology 70, 121-126.

Wesley,I.V.,Ashton,F. 1991. Restriction enzyme analysis of Listeria
monocytogenes strains associated with food-borne epidemics. Applied and
Environmental Microbiology 57, 969-975.

Wiedmann,M., Bruce,J.L., Keating,C., Johnson,A.E., McDonough,P.L.,
Batt,C.A. 1997c. Ribotypes and virulence gene polymorphisms suggest three
distinct Listeria monocytogenes lineages with differences in pathogenic
potential. Infection & Immunity 65, 2707-2716.

Wiedmann,M., Bruce,J.L., Keating,C., Johnson,A.E., McDonough,P.L.,
Batt,C.A. 1997b. Ribotypes and virulence gene polymorphisms suggest three
distinct Listeria monocytogenes lineages with differences in pathogenic
potential. Infection & Immunity 65, 2707-2716.

Wiedmann,M., Bruce,J.L., Keating,C., Johnson,A.E., McDonough,P.L.,
Batt,C.A. 1997a. Ribotypes and virulence gene polymorphisms suggest three
distinct Listeria monocytogenes lineages with differences in pathogenic
potential. Infection & Immunity 65, 2707-2716.

Wong,H.C., Chao,W.L., Yu,C.M. 1992. Detection of Listeria monocytogenes by
non-radioactive RNA probe and polymerase chain reaction. Chinese Journal of
Microbiology and Immunology 25, 101-107.

Wong,H.-C., Chao,W.-L., Lee,S.-J. 1990. Incidence and characterization of

                                                                                  88
Listeria monocytogenes in foods available in Taiwan. Applied and
Environmental Microbiology 56, 3101-3104.

Yousef,A.E., Luchansky JB, Degnan,A.J., Doyle,M.P. 1991. Behavior of
Listeria monocytogenes in wiener exudates in the presence of Pediococcus
acidilactici H or pediocin AcH during storage at 4 or 25C. Applied and
Environmental Microbiology 57, 1461-1467.

Yousef,A.E.,Marth,E.H. 1988. Behavior of Listeria monocytogenes during the
manufacture and storage of Colby cheese. Journal of Food Protection 51, 12-15.




                                                                            89

				
DOCUMENT INFO
Shared By:
Categories:
Tags:
Stats:
views:29
posted:11/7/2012
language:English
pages:89
tongxiamy tongxiamy http://
About