ND sequencing order form by 04f774

VIEWS: 4 PAGES: 3

									                                                           Internal Sequencing Order Form




         Name
         Email
          P.I.
       FOAPAL #

             ND Internal Use Only
 Request Form Number
    Date Received
   Date Completed

*Have all template concentrations the same
** Primer concentration needs to be 10mM (10 pmoles/mL) and be in a separate tube from the template




                                                                                         Template
                          Sample Tube or Well ID   Sample Name       Template Type       Size (bp)
Example (single sample)            1               testsample#1   Plasmid/PCR product      1000

            1
            2
            3
            4
            5
            6
            7
            8
            9
           10
           11
           12
           13
           14
           15
           16
           17
           18
           19
           20
           21
           22
           23
           24
           25
           26
           27
28
29
30
      Universal Primers We Currently Have
M13(-20) Forward 5' GTAAAACGACGGCCAGT 3'
M13 Reverse       5' CACACAGGAAACAGCTATGACCAT 3'
T7 (short)        5' TAATACGACTCACTATAGGG 3'
T7 Terminal       5' GCTAGTTATTGCTCAGCGG 3'
T3                5' AATTAACCCTCACTAAAGGGA 3'
SP6               5' ATTTAGGTGACACTATAG 3'
pGEX Forward      5' CTGGCAAGCCACGTTTGGTG 3'
pGEX Reverse      5' GGAGCTGCATGTGTCAGAGG 3'




                                                                      Method of
  Volume (µl)   Conc. (ng/µl)* Primer Name**   Read Direction   Preparation/Purification
      10            150          M13(-20) F       Forward       MiniPrep/Gel Purification

								
To top