Invitrogen Oligo Ordering Form by jAC0rP3g

VIEWS: 7 PAGES: 22

									Please complete required fields
                  SC USE Only
          Customer Account #
              Customer Phone




                 *Attn/bldg/Rm
               *Phone number


      *End-user Email Address
                  Plate or Tube TUBE
            *# Primers in Order




                                                    Primer Name (Max
 Well Location (if plate order)   Researcher Name        30 char.)
                 Use this form for tube orders only,



 To Order please email this spreadsheet to: supply_center@urmc.rochester.edu
                For questions or concerns please call 275-5731




Sequence                                                                 (can
                           not exceed 100 bases)                                Scale of Syn
Shipping Address:
Instutition Name:
Address:
City, State, Zip:


Billing Address:
Instutition Name:
Address:
City, State, Zip:




     5' Mods        3' Mods   Purity   Special Handling
Excel Ordering Instructions

To eliminate additional handling and manipulation that could lead to error for large volume orders, please follow our s

Researcher Name       Primer Name      Sequence                                                   Scale
Example               Example          ATCGAGCGGAGCTAGCTGAGGCGATCG                                50N



Form Instructions
(Do not modify format)
1.   "RESEARCHER NAME": Enter Researcher Name for Each Oligo Ordered,
2.   "PRIMER NAME": Enter your primer name.
3.   "SEQUENCE": Each sequence must be entered IN A SINGLE CELL using all CAPITAL letters.
4.   "SCALE OF SYNTHESIS":
25N = 10 nmol ( 50-base maximum )
50N = 50 nmol ( 100-base maximum )
200N = 200 nmol ( 100-base maximum )
1UN = 1 µmol ( 100-base maximum )
10U = 10 µmol ( 100-base maximum )
5. "MODIFICATIONS": See http://www.invitrogen.com/content.cfm?pageid=10881
6. PURITY
DSL = desalted (25N: 10-100, 50N+: 5-100)
COP = cartridge (50N – 1U: 7-60 bases)
HPL = HPLC (50nm+, 10-55 bases)
PAG = PAGE (50nm+, 7-100 bases)
7. SPECIAL INSTRUCTIONS: Enter any special instructions or clarifications.
8. E-Mail the completed form as an ATTACHMENT to:

Contact Information
Customer Service is available Monday through Friday, 8:00am to 8:00pm, Eastern Standard Time. Please feel free to call if you
Phone:
800-955-6288 option 3, x46636
e-mail:
genomicorders@invitrogen.com
web:
www.lifetechnologies.com
orders, please follow our standard ordering format.

             5' Mods     3' Mods    Purity      Special Handling
                                    DSL




Please feel free to call if you have any questions.
        5' Modification                        Format Codes
     General Modifications     Tube                                   T
Aldehyde                 ALD   Plate                                  P
Amino                    AMN
Biotin                   BIO                3' Modification Codes
Phosphate                PHO   Biotin                                BIO
Thiol                    THL   Phosphate                            PHO
Gateway Forward          GWF
Gateway Reverse          GWR                 Purification Codes
      Fluorescent Dye Mod      Desalted                             DSL
FAM                      FAM   Cartridge                            COP
Fluorescein              FLO   HPLC                                 HPL
HEX                      HEX   PAGE                                 PAG
ROX                      ROX
TET                      TET                  Synthesis Scales
TAMRA                    TAM   25 nmoles                             25N
    Molecular Probe Dyes       50 nmoles                             50N
Alexa 488                488   200 nmoles                           200N
Alexa 532                532   1 µmole                                1U
Alexa 546                546   10 µmoles                             10U
Alexa 555                555
Alexa 594                594
Alexa 647                647
Alexa 660                660
Alexa 750                750
BODIPY FL                BDA
BODIPY 530/550           BDB
BODIPY® 493/503          BDC
BODIPY 558/569           BDE
BODIPY 564/570           BDF
BODIPY 576/589           BDG
BODIPY 581/591           BDH
BODIPY FL-X              BDI
BODIPY TR-X              BDJ
BODIPY TMR               BDK
BODIPY R6G               BDL
BODIPY R6G-X             BDM
BODIPY 630/650-X         BDN
BODIPY 650/665           BDP
CASCADE BLUE®            CSB
JOE                      JOE
Marina Blue™             MNB
Oregon Green 500         OGA
Oregon Green 514         OGB
Oregon Green 488     OGC
Oregon Green 488-X   OGD
Pacific Blue™        PFB
Rhodamine Green™     RGA
Rhodol Green         RGB
Rhodamine Green-X    RGC
Rhodamine Red™-X     RRA
Texas Red-X          TRX
Texas Red®           TXR
Buffer Types
Water                                      1       Normalize Conc.
TE                                         FALSE   Volume Normalized
Tris                                       FALSE   Make Aliquots
                                           1       Buffer Type
                                           FALSE   Partial Shipments OK?
                                           1       Scale
                                           1       Ship Medium
Scales                                     1       Remainder Medium
25 nmole                                   TRUE    Ship Remainder
50 nmole                                   1       Pooling Required
200 nmole                                  1       Size
1 µmole                                    3       Plate Type, Max and Working Volume
10 µmole                                   2       Unit of Measure
                                           FALSE   Pooling Allowed?
                                           1       Purification
Shipping Media
Dry
Frozen on Dry Ice
Ambient in Solution

Remaining Order
Discard Remainder
Ship Dry
Ship Frozen

Purification
Desalted
Cartridge
HPLC
PAGE

Size
96
384

Plate Type, Max Volume, Working Volume
PCR shallow plate, 200 µl, 180 µl
Costar 3359, 360µl, 250µl
Abgene AB-0765, 800µl, 650µl
**Special plate type 1, for internal use
Deep 96-A241well plate, 1200µl, 800µl
**Special plate type 2, for internal use

Pooling Required
None
Odd Plate/Even Plate
First Half/Second Half
Other

Normalization
None
Concentration
Volume
Volume & Concentration

Unit of Measure
µM
µg/µl



Plate Name Limit
(15 char.max)
   Sequence Codes
Deoxyadenine           A
Deoxycytosine          C
Deoxyguanidine         G
Deoxythymidine         T
Deoxyuracil            U
Deoxyinosine           I
Amino Modifier C6-dT   Q
A-Phosphorothioate     F
C-Phosphorothioate     O
G-Phosphorothioate     E
T-Phosphorothioate     Z
A+C+G                  V
A+C+G+T (N-Wobble)     N
A+T+G                  D
T+C+G                  B
A+T+C                  H
A+T                    W
C+G                    S
T+G                    K
A+C                    M
C+T                    Y
A+G                    R
rking Volume

								
To top