tp201269x1 by dbfQd67

VIEWS: 0 PAGES: 9

									Supplemental Data




Figure S1. Protein expression for markers of GABA interneuron populations (PV –
parvalbumin, CB – calbindin, CR – calretinin) was assessed by western blot.
Figure S2. Effects of the subunit-selective GABAA-receptor agonist L-838,417 and the
antipsychotic risperidone on behavioral phenotypes relevant to schizophrenia, autism,
and intellectual disability. (A) Social preference was assessed in a three-chambered social
approach/avoidance paradigm. NR1neo-/- mice showed significantly reduced social
preference (group: F1,34=31.5, P<0.0001), but this deficit was not affected by risperidone
(drug: F2,34=0.49, P=0.62) or L-838,417 (drug: F2,26=2.49, P>0.1). (B) Impairments in T-
maze spatial memory performance in NR1neo-/- mice (group: F1,31=50.0, P<0.0001) were
not improved by risperidone (drug: F1,31=0.67, P=0.42) or L-838,417 (F1,30=2.1, P=0.16).
(C) NR1neo-/- mice had a significant deficit in PPI (F1,14=10.75, P<0.006), as observed in
schizophrenia and autism. PPI deficits in NR1neo-/- mice were reversed by L-838,418
(group x drug: F2,24=8.3, P<0.002) and risperidone (group x drug: F2,26=4.1, P<0.03). (D)
NR1neo-/- mice had elevated acoustic startle responses (F1,14=22.4, P<0.0003). Neither L-
838,417 (F2,24=2.7, P=0.09) nor risperidone (F2,26=0.14, P=0.9) had any effect on this
phenotype. (E) NR1neo-/- mice displayed locomotor hyperactivity in a novel environment
at baseline (F1,13=30.8, P<0.0001; n=7-8/group). Risperidone significantly reduced LMA
(F2,36=31.1, P<0.0001, n=10/group). L-838,417 had no effect (F2,20=1.6, P>0.2;
n=6/group) consistent with its pharmacologic profile as a non-sedating anxiolytic drug.
Figures show mean +/- S.E.M., *P<0.05, **P<0.01, ***P<0.001.
Supplemental Experimental Procedures

Parvalbumin Immunohistochemistry: NR1neo-/- and wildtype littermates were used for
stereological population estimates of PV+ cells. Frozen coronal sections (45m thick)
were cut from fixed tissue. Immunolabeling was conducted on every fourth section using
a parvalbumin monoclonal antibody (MAB1572, Chemicon, 1:1000) and an HRP-
conjugated secondary antibody (EnVision + Dual Link HRP, DakoCytomation,
Carpinteria, CA). DAB substrate was added to sections to visualize parvalbumin
immunolabeling. Quantification of stereological population estimates was performed in
two regions: (1) prefrontal cortex (PFC; e.g., prelimbic and infralimbic regions 1.34 to
1.78 mm relative to bregma AP) and (2) a broad cortical region (cortical layers I-VI from
-0.82 to 1.54mm relative to bregma AP), encompassing motor and somatosensory cortex
as our region of interest (ROI). Stereological counting was performed by a blinded
experimenter using a computer-assisted microscope (Nikon E800, Stereoinvestigator,
v8.0, MBF Biosciences, Inc.). The optical fractionator method was employed to generate
population estimates of PV+ cells in this ROI 1, 2. Systematic random sampling was
performed on every fourth section. For all sections, the optical disector height was 12m,
with a guard zone height of 2m. The disector counting frame size was 30m² and the
grid size was 150x200 m. Significance was assessed by a two-tailed unpaired t-test.

Parvalbumin In Situ Hybridization: For riboprobe synthesis, total RNA was extracted
from frozen WT murine brain tissues using Trizol (Invitrogen), treated with DNase I
(Promega) then reverse transcribed using Superscript II reverse transcriptase according to
the manufacturer’s instructions (Invitrogen). cDNA fragment corresponding to
parvalbumin was cloned by PCR amplification using the following primers: F-
CCATGGAGGCGATAGGAGCCTTTGCTGC and R-
GTCGACGTCTCCAGCGGCCAGAAGCG. The amplified fragment was cloned into the
pGEMT easy vector (Promega). Digoxigenin-labeled sense and antisense riboprobes
were obtained by in vitro transcription using T7 and SP6 transcriptase (Promega) and
digoxigenin- UTP (Roche). They were stored in hybridization buffer at the concentration
of 10 ug/ml.
        NR1neo-/- and WT littermate mice were transcardially perfused with iced cold
saline solution followed by 4% PFA. Brains were removed, post-fixed in 4% PFA for 1 h
at 4°C, cryoprotected in 10 to 30% sucrose/PBS, frozen and cryosectioned at 50 μm. The
floating sections were stored at -20°C in a cryopreservation solution until being
processed for in situ hybridization. The sections were washed in PBS, then RIPA (150
mM of NaCl, 1% NP-40, 0.5% Na deoxycholate, 0.1% SDS, 1 mM of EDTA, pH 8, 50
mM of Tris, pH 8), post-fixed in 4% PFA for 5 min and treated with 0.25 acetic anhydre
in 0.1 M of triethanolamine. Hybridization was performed with digoxigenin-labeled sense
or antisense riboprobes (1 μg/ml) overnight at 70°C in hybridization buffer (50%
formamide, 5X SSC, 5X Denhardt's, 250 μg/ml yeast tRNA, 125 mg/l salmon sperm
DNA). The sections were washed with 50% formamide/2X SSC/0.1%, Tween 20 for 2 h
at 70°C then MABT (100 mM of maleic acid and 150 mM of NaCl at pH 7.5, 0.1%
Tween 20) at room temperature. After blocking with 10% goat serum/MABT,
hybridization was revealed by incubation with an alkaline phosphatase (AP) coupled
antibody (Roche, dilution 1:1,000 in MABT, 10% heat-inactivated goat serum blocking
buffer) overnight at 4°C. The slides were washed with MABT and with AP buffer (100
mM of Tris, pH 9, 100 mM of NaCl, 50 mM of MgCl2, 0.24 mg/ml levamisole/0.1%,
Tween 20). The sections were then incubated in a 5-bromo-4-chloro-3-indolyl
phosphate/nitroblue tetrazolium (Sigma) solution. Using the same ROI as described
above, PV cell density was determined at 100X using Image ProPlus software (Media
Cybernetics Inc., Silver Springs, MD).

Western Blotting: Brains from NR1neo-/- and WT littermate mice were surgically
removed and flash frozen on dry ice. Left hemispheres were dissected and homogenized
in homogenization buffer [25 mM Hepes pH 7.5, 300 mM NaCl, 0.2 mM EDTA, 1.5 mM
MgCl2, 0.1% Triton supplemented with 0.5 mM DTT, protease and phosphatase
inhibitors]. Homogenates were centrifuged at 16,000g for 20 min at 4oC and protein
concentrations of the supernatants were determined by Bradford assay. Protein extracts
(50 µg) were loaded onto NuPage Novex 4-12% Bis-Tris precast gels (Invitrogen) and
transferred onto PVDF membrane (Millipore). The membrane was blocked in 3% nonfat
milk and probed with anti-NMDAR1 (1:500 goat polyclonal, sc1468, Santa Cruz
Biotechnology), anti-Parvalbumin (1:1000 mouse monoclonal, MAB1572, Millipore),
anti-Calbindin (1:2000 rabbit polyclonal, AB1778, Millipore), anti-Calretinin (1:10000
goat polyclonal, AB1550, Millipore), anti-GAD65 (1:500 rabbit monoclonal, ab75750,
Abcam), anti-GAD67 (1:1000 rabbit polyclonal, 5305S, Cell Signaling Technology), and
anti-β-Actin (1:50000 mouse monoclonal, AB6276, Abcam), followed by secondary
antibodies goat anti-mouse (12-349, Millipore), donkey anti-rabbit (711-035-152,
Jackson), bovine anti-mouse (sc-2375, Santa Cruz Biotechnology), and bovine anti-goat
(sc-2352, Santa Cruz Biotechnology). Blots were developed with chemiluminescence
reagent ECL (Thermo Scientific). Group differences were assessed with a group x marker
ANOVA, followed by Bonferroni post-tests where appropriate.

RNA Analysis: Given lower protein levels, expression of post-synaptic GABAA- and
GABAB-receptor subunits was assessed using qPCR. RNAs were purified using Trizol
from WT and NR1 transgenic mice. Quantitative reverse transcription-PCR (RT-PCR)
was done using the following primers: (GABA) B receptor-1, PrimerBank
ID:131888528b2, F-CTCCTGGACGGATATGGACAC and R-
GTCGGGGTCACATCGGAAAT; (GABA) B receptor-2, PrimerBank ID:124487262b1
F-CTTCCTGGACCTGCGACTCTA and R-CGGCCCATACTTTATTGCATCAT;
(GABA) A receptor, subunit alpha 1, PrimerBank ID:145966746b2 F-
CGACTGCTGGACGGTTATGAC and R-CACTTCAGTTACACGCTCTCC; (GABA)
A receptor, subunit alpha 2, PrimerBank:ID 142353792b2 F-
TTACAGTCCAAGCCGAATGTC, R- AGTGGGCATGAATGAGCATCC and GAPDH
F- GGTGGAGGTCGGTGTGAACG and R- CTCGCTCCTGGAAGATGGTG. For both
receptors, group differences were assessed with a group x subunit ANOVA, followed by
Bonferroni post-tests where appropriate.

Ex Vivo Electrophysiology: Mice were decapitated following isoflurane anesthesia. The
brain was removed and coronal slices (300 μm) containing the hippocampus were cut
with a Vibratome (VT1000S, Leica Microsystems) in an ice-cold artificial cerebrospinal
fluid solution (ACSF), in which NaCl was replaced by an equiosmolar concentration of
sucrose. ACSF consisted of 130 mM NaCl, 3 mM KCl, 1.25 mM NaH2PO4, 26 mM
NaHCO3, 10 mM glucose, 1 mM MgCl2 and 2 mM CaCl2 (pH 7.2–7.4 when saturated
with 95% O2/5% CO2). Slices were incubated in ACSF at 32–34 °C for 45 min and kept
at 22-25 °C thereafter, until transfer to the recording chamber. The osmolarity of all
solutions was 305–315 mOsm. Slices were viewed using infrared differential interference
contrast optics under an upright microscope (Eclipse FN1, Nikon Instruments Inc.) with a
40x water-immersion objective.
        The recording chamber was continuously perfused (1–2 ml/min) with oxygenated
ACSF heated to 32±10 C using an automatic temperature controller (Warner
Instruments). Picrotoxin (100 μM) was added to all solutions to block the GABAA
receptor-mediated currents. The intracellular solution contained (in mM): 145 potassium
gluconate, 2 MgCl2, 2.5 KCl, 2.5 NaCl, 0.1 BAPTA, 10 HEPES, 2 Mg-ATP, 0.5 GTP-
Tris (pH 7.2–7.3 with KOH, osmolarity 280–290 mOsm). Recordings were performed in
whole-cell voltage-clamp (Vh=-65 mV) or whole-cell current-clamp (at resting potential)
modes as indicated. The data was acquired through a MultiClamp700B amplifier
(Molecular Devices). Currents were low-pass filtered at 2 kHz and digitized at 20 kHz
using a Digidata 1440A acquisition board and pClamp10 software (both from Molecular
Devices). Access resistance was monitored throughout the recordings by injection of 10
mV hyperpolarizing pulses (in voltage-clamp) and data was discarded if the access
resistance changed by >25% over the course of data acquisition. Evoked responses were
triggered by constant-current pulses generated by an A310 Accupulser (World Precision
Instruments) and delivered at 0.2 Hz via a bipolar tungsten stimulation electrode
positioned within 100 μm of the recorded cell. The amplitude of the current pulses was
controlled by a stimulus isolator (ISO-Flex, A.M.P.I.) and was adjusted in each cell to
evoke a minimal response with a 25 μs current pulse. The current duration was then
increased to 50, 75, 100, and 125 μs to construct an input-output curve for the evoked
synaptic events.
        All analyses of intracellular recordings were carried out with Clampfit 10
(Molecular Devices). The time constant of decay was based on a monoexponential fit to
the decay phase of an average spontaneous excitatory postsynaptic current (sEPSC) trace
computed from a minimum of 50 individual sEPSCs. Mean sEPSC frequencies were
analyzed from 10–20 s long trace segments. Evoked EPSC amplitudes were computed
from an average of 5-10 responses at each stimulation intensity. Rheobase was measured
as the minimal current (advanced in 10 pA steps) necessary to trigger an action potential.

In Vivo Electrophysiology: Recording of auditory ERPs was performed at least 1 week
after electrode implantation in a home-cage environment, as previously described 3-6.
Cages were placed in a sound attenuated recording chamber inside a Faraday electrical
isolation cage. Electrode pedestals were connected to a 30cm tripolar electrode cable that
exited the chamber to connect to a high impedance differential AC amplifier (A-M
Systems, Carlsborg, WA, USA). Stimuli were generated by Micro1401 hardware with
Spike2 software (Cambridge Electronic Design, Cambridge, UK) and were delivered
through speakers attached to the cage top. For assessment of gamma phase synchrony in
NR1neo-/- mice and WT littermates, the sequencer file consisted of a series of 200 paired
white-noise stimuli presented 500 ms apart at 85 dB (10 ms in duration) with a 8-s
interstimulus (ISI) interval. Recording sessions were preceded by a 15 minute acclimation
phase. Raw EEG was filtered between 1 and 500 Hz. Individual sweeps were rejected for
movement artifact based on a criterion of 2 times the root mean squared amplitude per
mouse.

Signal Processing: Time-frequency decomposition of EEG signal was performed with
the EEGLAB toolbox in Matlab 7. Single trial epochs between -0.3 and 0.8 sec relative
were extracted from the continuous data sampled at 1667 Hz. Total power and evoked
(i.e., phase-locked) power were calculated using Morlet wavelets in 100 linearly spaced
frequency bins between 5-100 Hz, with wavelet cycles linearly increasing from 3 to 6, as
published 8. For each subject, evoked power was averaged from 0-100 ms post-stimulus
in the theta (4-12 Hz), beta (12-25 Hz), and gamma frequency ranges (30-80 Hz). Pre-
stimulus total power was calculated in the same frequency ranges from -300 to -100 ms
relative to the stimulus onset. Finally, gamma signal-to-noise ratio (SNR) was calculated
as the maximal peak in the post-stimulus gamma-band response from 0-100 ms divided
by the average pre-stimulus gamma power.

T-Maze Alternation: Spatial working memory was assessed in a spontaneous alternation
T-maze paradigm. The maze consisted of three identical arms (30 cm long, 10 cm wide,
12 cm tall). Wild-type mice have a natural tendency to alternate when placed in such a
chamber, achieving spontaneous alternation rates up to 75% 9. This paradigm measures
spatial working memory behavior, which is highly sensitive to dysfunction of the
hippocampus and the prefrontal cortex, among other brain regions 10, 11. Two versions of
the T-maze task were performed; a discrete-trial (5 second delay) spontaneous alternation
paradigm was carried out as described 9, and a continuous alternation (8 min) version of
the task, as described 12. NR1neo-/- showed significant deficits in both versions of this task,
so we proceeded with the continuous alternation paradigm, as it is more amenable to
acute pharmacologic testing. Mice were well handled and acclimated to the room prior to
testing, which occurred in low-lux red light to minimize anxiety. In addition, mice had
been well habituated to the T-maze apparatus prior to testing, to avoid neophobia. Mice
were tracked with an overhead video camera and manually scored. A mouse was scored
as having entered an arm when all four paws were located within the runway. An
alternation was defined as sequential entries into each of the three different arms (e.g.,
ABC, BCA, etc.). As such, a non-alternation behavior occurred when a mouse re-entered
an arm that it had visited in the previous trial (e.g., BAB, CBC, etc.). Spontaneous
alternation percentage was calculated as the total number of alternations divided by (total
arm entries – 2). Prior to drug administration, NR1neo-/- and WT mice were tested several
times over the course of two weeks, demonstrating a stable baseline level of performance.

Pharmacology: Acute effects of the pharmacologic compounds baclofen, risperidone,
and L-838,417 were assessed on electrophysiological and behavioral measures. All drugs
were administered via intraperitoneal injections, 15-30 minutes before testing sessions.
The metabotropic GABA(B)-receptor agonist baclofen was dissolved in saline to achieve
concentrations of 1-5 mg/kg. The D2-receptor antagonist risperidone was dissolved in
saline at 0.05 and 0.1 mg/kg. L-838,417, the selective GABA(A)-alpha-2/3/5 partial
agonist and GABA(A)-alpha-1 inverse agonist, was obtained from Tocris and dissolved
at 10-30 mg/kg in a 10% DMSO solution in saline. Control experiments consisted of
saline and 10% DMSO in saline vehicles.

Statistics: Unless stated otherwise above, statistical significance between groups was
assessed with group x drug repeated-measures ANOVA, followed by Bonferroni post-
tests where appropriate, using GraphPad Prism software. In the case of a main drug
effect, planned comparisons were used to assess if the drug significantly altered the
NR1neo-/- group from vehicle control levels. Pearson’s r correlations were calculated to
assess the relationship between electrophysiological and behavioral measures and were
Bonferroni corrected for multiple comparisons. Before applying any T-test, normality of
the distribution was assessed with a K-S test. In the absence of normality, a non-
parametric Mann-Whitney U test was performed.
Supplemental References

1.    West MJ. New stereological methods for counting neurons. Neurobiology of
      aging 1993; 14(4): 275-285.

2.    West MJ, Slomianka L, Gundersen HJ. Unbiased stereological estimation of the
      total number of neurons in thesubdivisions of the rat hippocampus using the
      optical fractionator. The Anatomical record 1991; 231(4): 482-497.

3.    Ehrlichman RS, Gandal MJ, Maxwell CR, Lazarewicz MT, Finkel LH, Contreras
      D et al. N-methyl-d-aspartic acid receptor antagonist-induced frequency
      oscillations in mice recreate pattern of electrophysiological deficits in
      schizophrenia. Neuroscience 2009; 158(2): 705-712.

4.    Gandal MJ, Ehrlichman RS, Rudnick ND, Siegel SJ. A novel electrophysiological
      model of chemotherapy-induced cognitive impairments in mice.
      Neuroscience 2008; 157(1): 95-104.

5.    Halene TB, Ehrlichman RS, Liang Y, Christian EP, Jonak GJ, Gur TL et al.
      Assessment of NMDA receptor NR1 subunit hypofunction in mice as a model
      for schizophrenia. Genes Brain Behav 2009; 8(7): 661-675.

6.    Lazarewicz MT, Ehrlichman RS, Maxwell CR, Gandal MJ, Finkel LH, Siegel SJ.
      Ketamine modulates theta and gamma oscillations. J Cogn Neurosci 2010;
      22(7): 1452-1464.

7.    Delorme A, Makeig S. EEGLAB: an open source toolbox for analysis of single-
      trial EEG dynamics including independent component analysis. Journal of
      neuroscience methods 2004; 134(1): 9-21.

8.    Gandal MJ, Edgar JC, Ehrlichman RS, Mehta M, Roberts TP, Siegel SJ.
      Validating gamma oscillations and delayed auditory responses as
      translational biomarkers of autism. Biol Psychiatry 2010; 68(12): 1100-1106.

9.    Deacon RM, Rawlins JN. T-maze alternation in the rodent. Nat Protoc 2006;
      1(1): 7-12.

10.   Deacon RM, Rawlins JN. Hippocampal lesions, species-typical behaviours and
      anxiety in mice. Behav Brain Res 2005; 156(2): 241-249.

11.   Wall PM, Blanchard RJ, Yang M, Blanchard DC. Infralimbic D2 receptor
      influences on anxiety-like behavior and active memory/attention in CD-1
      mice. Prog Neuropsychopharmacol Biol Psychiatry 2003; 27(3): 395-410.
12.   Belforte JE, Zsiros V, Sklar ER, Jiang Z, Yu G, Li Y et al. Postnatal NMDA
      receptor ablation in corticolimbic interneurons confers schizophrenia-like
      phenotypes. Nat Neurosci 2010; 13(1): 76-83.

								
To top