Docstoc

TRiP_Lines_Template_Constructs

Document Sample
TRiP_Lines_Template_Constructs Powered By Docstoc
					RNAV       UNIVERSIT                                    LAB TYPE          Additional
NAME       Y         LAB NAME                                             Name




(last
name, first
name)       University   free text                      Laboratory
            Harvard
Pearse, Richard                                         Core laboratory
                         Drosophila RNAi Screening Center
LAB      LAB                            LAB
AFFILIAT CONTACT              Additiona CONTACT
ION      NAME                 l Name    EMAIL     First Name Last Name
College,
Academic
Department,
Institute,
School,     free text (last
Consortium, name, first
Division    name)
Mailing   Phone    Resource
Address   Number   Description Title   URL
                                     LAB                            LAB
                                     INVENTORY   LAB                INVENTO
                                     DATA        DELIVERY           RY
Director                 EMAIL       FORMAT      ADDRESS            SYSTEM




                                                 free text - must
From drop down in                                contain
Institution's repository free text   free text   geographic info    yes/no
LAB                      Performs                Resource
MAILING                  Human    Phone          Descripti
ADDRESS Members Performs Study    number    PI   on



            From drop       From drop
            down in         down in
            Institution's   Institution's
free text   repository      repository
                     CONSTRU
      RNAV   CURATOR CTS
      COMMEN COMMEN FORM
URL   TS     TS      VERSION




                    v2
                                                             Cloning
                                            Cloning          vector
                                            vector           term      Accession
NAME                                        type             request   number




                                                                       free text (e.g.
free text (e.g. pCMV-PPARg-Dter)                                       X90563)

VALIUM10 Focal Adhesion Kinase shRNA plasmidshRNA plasmid


VALIUM20 Focal Adhesion Kinase shRNA plasmidshRNA plasmid


VALIUM22 Focal Adhesion Kinase shRNA plasmidshRNA plasmid

VALIUM1 foraging shRNA plasmid              shRNA plasmid

VALIUM1 foraging shRNA plasmid              shRNA plasmid


VALIUM22 foraging shRNA plasmid             shRNA plasmid


                                             shRNA plasmid
VALIUM20 Epidermal growth factor receptor shRNA plasmid

                                             shRNA plasmid
VALIUM1 Epidermal growth factor receptor shRNA plasmid

                                             shRNA plasmid
VALIUM10 Epidermal growth factor receptor shRNA plasmid

                                             shRNA plasmid
VALIUM1 Epidermal growth factor receptor shRNA plasmid

                                             shRNA plasmid
VALIUM1 Epidermal growth factor receptor shRNA plasmid


                                             shRNA plasmid
VALIUM20 Epidermal growth factor receptor shRNA plasmid


VALIUM20 CG10082 shRNA plasmid              shRNA plasmid
VALIUM20 CG10082 shRNA plasmid               shRNA plasmid


VALIUM22 CG10082 shRNA plasmid               shRNA plasmid

VALIUM10 CG10177 shRNA plasmid               shRNA plasmid

VALIUM10 Cad96Ca shRNA plasmid               shRNA plasmid


VALIUM22 CG10260 shRNA plasmid               shRNA plasmid

                                              shRNA plasmid
VALIUM10 atypical protein kinase C shRNA plasmid


VALIUM22 CG10268 shRNA plasmid               shRNA plasmid

VALIUM10 PAK-kinase shRNA plasmid            shRNA plasmid


VALIUM22 PAK-kinase shRNA plasmid            shRNA plasmid

VALIUM10 cdc2c shRNA plasmid                 shRNA plasmid


VALIUM20 cdc2c shRNA plasmid                 shRNA plasmid


VALIUM22 cdc2c shRNA plasmid                 shRNA plasmid


VALIUM22 Integrin linked kinase shRNA plasmid shRNA plasmid

VALIUM10 Protein kinase C delta shRNA plasmidshRNA plasmid


                                           shRNA plasmid
VALIUM20 RPS6-p70-protein kinase shRNA plasmid


                                           shRNA plasmid
VALIUM22 RPS6-p70-protein kinase shRNA plasmid


VALIUM20 Nipped-A shRNA plasmid              shRNA plasmid


                                            shRNA
VALIUM22 Cyclin-dependent kinase 8 shRNA plasmid plasmid
                                            shRNA plasmid
VALIUM22 Bifunctional Phosphopantetheine adenylyltransferase - Dephospho-CoA kinase shRNA plasmid

                                             plasmid
VALIUM10 Ecdysone-induced protein 63E shRNA shRNA plasmid


                                             plasmid
VALIUM20 Ecdysone-induced protein 63E shRNA shRNA plasmid


                                             plasmid
VALIUM22 Ecdysone-induced protein 63E shRNA shRNA plasmid


                                           shRNA plasmid
VALIUM22 Numb-associated kinase shRNA plasmid


VALIUM22 CG10702 shRNA plasmid              shRNA plasmid

VALIUM10 CG10738 shRNA plasmid              shRNA plasmid

VALIUM10 wishful thinking shRNA plasmid     shRNA plasmid


VALIUM22 loki shRNA plasmid                 shRNA plasmid

VALIUM10 four-jointed shRNA plasmid         shRNA plasmid


VALIUM20 CG10924 shRNA plasmid              shRNA plasmid

VALIUM1 ether a go-go shRNA plasmid         shRNA plasmid

VALIUM1 ether a go-go shRNA plasmid         shRNA plasmid

                                            shRNA
VALIUM10 Autophagy-specific gene 1 shRNA plasmid plasmid


                                            shRNA
VALIUM22 Autophagy-specific gene 1 shRNA plasmid plasmid

VALIUM1 MLF1-adaptor molecule shRNA plasmidshRNA plasmid


                                           shRNA plasmid
VALIUM22 MLF1-adaptor molecule shRNA plasmid

VALIUM10 auxillin shRNA plasmid             shRNA plasmid


VALIUM22 auxillin shRNA plasmid             shRNA plasmid
VALIUM10 CG11221 shRNA plasmid               shRNA plasmid

VALIUM10 hippo shRNA plasmid                 shRNA plasmid


VALIUM22 CG11255 shRNA plasmid               shRNA plasmid


VALIUM22 pan gu shRNA plasmid                shRNA plasmid

                                              shRNA plasmid
VALIUM1 Phosphotidylinositol 3 kinase 68D shRNA plasmid


                                              shRNA plasmid
VALIUM22 Phosphotidylinositol 3 kinase 68D shRNA plasmid


VALIUM22 CG11660 shRNA plasmid               shRNA plasmid


VALIUM22 CG11811 shRNA plasmid               shRNA plasmid


VALIUM22 CG11859 shRNA plasmid               shRNA plasmid


VALIUM22 CG43143 shRNA plasmid               shRNA plasmid

VALIUM10 CG43143 shRNA plasmid               shRNA plasmid


VALIUM22 par-1 shRNA plasmid                 shRNA plasmid

VALIUM10 tango shRNA plasmid                 shRNA plasmid

                                            shRNA plasmid
VALIUM1 cAMP-dependent protein kinase 2 shRNA plasmid

                                            shRNA plasmid
VALIUM1 cAMP-dependent protein kinase 2 shRNA plasmid

VALIUM10 CG12069 shRNA plasmid               shRNA plasmid

VALIUM10 warts shRNA plasmid                 shRNA plasmid


VALIUM20 warts shRNA plasmid                 shRNA plasmid


VALIUM22 warts shRNA plasmid                 shRNA plasmid
VALIUM10 Protein kinase 61C shRNA plasmid    shRNA plasmid

VALIUM10 mrityu shRNA plasmid                shRNA plasmid


VALIUM22 mrityu shRNA plasmid                shRNA plasmid

VALIUM1 licorne shRNA plasmid                shRNA plasmid


VALIUM20 polo shRNA plasmid                  shRNA plasmid


VALIUM22 polo shRNA plasmid                  shRNA plasmid


VALIUM20 polychaetoid shRNA plasmid          shRNA plasmid


VALIUM20 Tousled-like kinase shRNA plasmid   shRNA plasmid

VALIUM1 rolled shRNA plasmid                 shRNA plasmid

VALIUM1 rolled shRNA plasmid                 shRNA plasmid


VALIUM20 rolled shRNA plasmid                shRNA plasmid


VALIUM22 rolled shRNA plasmid                shRNA plasmid


VALIUM22 CG1271 shRNA plasmid                shRNA plasmid


VALIUM22 CG13369 shRNA plasmid               shRNA plasmid


VALIUM22 CG1344 shRNA plasmid                shRNA plasmid


VALIUM22 cdc2-related-kinase shRNA plasmid   shRNA plasmid


VALIUM22 Ipk2 shRNA plasmid                  shRNA plasmid


                                             shRNA
VALIUM20 TGF-beta activated kinase 1 shRNA plasmid plasmid
VALIUM20 torso shRNA plasmid                shRNA plasmid


VALIUM21 torso shRNA plasmid                shRNA plasmid


VALIUM22 torso shRNA plasmid                shRNA plasmid

VALIUM1 thickveins shRNA plasmid            shRNA plasmid

VALIUM1 thickveins shRNA plasmid            shRNA plasmid


VALIUM22 thickveins shRNA plasmid           shRNA plasmid


VALIUM22 Bub1 homologue shRNA plasmid       shRNA plasmid

VALIUM1 Tao-1 shRNA plasmid                 shRNA plasmid


VALIUM22 Tao-1 shRNA plasmid                shRNA plasmid

VALIUM10 Ret oncogene shRNA plasmid         shRNA plasmid


VALIUM22 Pak3 shRNA plasmid                 shRNA plasmid

                                            shRNA plasmid
VALIUM10 Calcium/calmodulin-dependent protein kinase I shRNA plasmid


                                            shRNA plasmid
VALIUM22 Calcium/calmodulin-dependent protein kinase I shRNA plasmid

VALIUM10 Ack shRNA plasmid                  shRNA plasmid


VALIUM20 Ack shRNA plasmid                  shRNA plasmid


VALIUM20 Ack shRNA plasmid                  shRNA plasmid


VALIUM22 Ack shRNA plasmid                  shRNA plasmid

VALIUM10 CG15072 shRNA plasmid              shRNA plasmid
VALIUM22 CG42856 shRNA plasmid               shRNA plasmid

                                             shRNA
VALIUM10 Eph receptor tyrosine kinase shRNA plasmid plasmid


                                             shRNA
VALIUM22 Eph receptor tyrosine kinase shRNA plasmid plasmid

                                             shRNA plasmid
VALIUM1 Casein kinase II β subunit shRNA plasmid


                                             shRNA
VALIUM20 Casein kinase II beta subunit shRNA plasmidplasmid

VALIUM1 Downstream of raf1 shRNA plasmid     shRNA plasmid

VALIUM10 Downstream of raf1 shRNA plasmid    shRNA plasmid


VALIUM20 Downstream of raf1 shRNA plasmid    shRNA plasmid


VALIUM20 Downstream of raf1 shRNA plasmid    shRNA plasmid


VALIUM21 Downstream of raf1 shRNA plasmid    shRNA plasmid


VALIUM22 Downstream of raf1 shRNA plasmid    shRNA plasmid


VALIUM20 Downstream of raf1 shRNA plasmid    shRNA plasmid

                                            shRNA plasmid
VALIUM10 cAMP-dependent protein kinase R2 shRNA plasmid

VALIUM1 hopscotch shRNA plasmid              shRNA plasmid

VALIUM1 hopscotch shRNA plasmid              shRNA plasmid


VALIUM20 hopscotch shRNA plasmid             shRNA plasmid


VALIUM22 Gcn2 shRNA plasmid                  shRNA plasmid


VALIUM22 Ceramide kinase shRNA plasmid       shRNA plasmid
VALIUM22 kenny shRNA plasmid                shRNA plasmid


VALIUM22 misshapen shRNA plasmid            shRNA plasmid

VALIUM10 misshapen shRNA plasmid            shRNA plasmid


                                            shRNA plasmid
VALIUM22 homeodomain interacting protein kinase shRNA plasmid


VALIUM22 Adenylate kinase-1 shRNA plasmid   shRNA plasmid

VALIUM10 grapes shRNA plasmid               shRNA plasmid


VALIUM22 grapes shRNA plasmid               shRNA plasmid


VALIUM22 KP78b shRNA plasmid                shRNA plasmid

VALIUM10 KP78b shRNA plasmid                shRNA plasmid

VALIUM10 discs large 1 shRNA plasmid        shRNA plasmid

VALIUM1 discs large 1 shRNA plasmid         shRNA plasmid

VALIUM1 discs large 1 shRNA plasmid         shRNA plasmid


VALIUM20 discs large 1 shRNA plasmid        shRNA plasmid


VALIUM22 discs large 1 shRNA plasmid        shRNA plasmid

VALIUM10 Nek2 shRNA plasmid                 shRNA plasmid


VALIUM22 Nek2 shRNA plasmid                 shRNA plasmid

                                            shRNA plasmid
VALIUM10 SNF4/AMP-activated protein kinase gamma subunit shRNA plasmid


                                            shRNA plasmid
VALIUM22 SNF4/AMP-activated protein kinase gamma subunit shRNA plasmid

VALIUM1 discs large 1 shRNA plasmid         shRNA plasmid
VALIUM10 Lk6 shRNA plasmid                   shRNA plasmid


VALIUM22 Lk6 shRNA plasmid                   shRNA plasmid

VALIUM10 derailed shRNA plasmid              shRNA plasmid


VALIUM22 CG17471 shRNA plasmid               shRNA plasmid

                                             shRNA plasmid
VALIUM1 Casein kinase II α subunit shRNA plasmid


                                               plasmid
VALIUM22 Casein kinase II alpha subunit shRNA shRNA plasmid

VALIUM10 CG17528 shRNA plasmid               shRNA plasmid


VALIUM22 doughnut on 2 shRNA plasmid         shRNA plasmid

                                            shRNA plasmid
VALIUM10 RPS6-protein kinase-II shRNA plasmid


                                            shRNA plasmid
VALIUM22 RPS6-protein kinase-II shRNA plasmid


                                            shRNA plasmid
VALIUM20 TBP-associated factor 1 shRNA plasmid


                                            shRNA plasmid
VALIUM22 TBP-associated factor 1 shRNA plasmid


                                              shRNA plasmid
VALIUM20 G protein-coupled receptor kinase 2 shRNA plasmid


                                              shRNA plasmid
VALIUM22 G protein-coupled receptor kinase 2 shRNA plasmid

                                            shRNA plasmid
VALIUM10 Calcium/calmodulin-dependent protein kinase II shRNA plasmid


                                            shRNA plasmid
VALIUM22 Calcium/calmodulin-dependent protein kinase II shRNA plasmid

VALIUM1 sevenless shRNA plasmid              shRNA plasmid

VALIUM1 sevenless shRNA plasmid              shRNA plasmid


VALIUM20 sevenless shRNA plasmid             shRNA plasmid
                                              shRNA plasmid
VALIUM10 Src homology 2, ankyrin repeat, tyrosine kinase shRNA plasmid


                                              shRNA plasmid
VALIUM22 Src homology 2, ankyrin repeat, tyrosine kinase shRNA plasmid

VALIUM10 Stretchin-Mlck shRNA plasmid         shRNA plasmid

VALIUM10 Stretchin-Mlck shRNA plasmid         shRNA plasmid


                                          shRNA plasmid
VALIUM22 Phosphorylase kinase gamma shRNA plasmid


VALIUM22 Glycerol kinase shRNA plasmid        shRNA plasmid

VALIUM1 Insulin-like receptor shRNA plasmid   shRNA plasmid

VALIUM1 Insulin-like receptor shRNA plasmid   shRNA plasmid


VALIUM22 Insulin-like receptor shRNA plasmid shRNA plasmid

VALIUM10 LIM-kinase1 shRNA plasmid            shRNA plasmid

VALIUM10 LIM-kinase1 shRNA plasmid            shRNA plasmid

                                            shRNA plasmid
VALIUM1 TGF-β activated kinase 1 shRNA plasmid

                                            shRNA plasmid
VALIUM1 TGF-β activated kinase 1 shRNA plasmid


                                             shRNA
VALIUM22 TGF-beta activated kinase 1 shRNA plasmid plasmid


VALIUM22 Ady43A shRNA plasmid                 shRNA plasmid

VALIUM10 mushroom bodies tiny shRNA plasmidshRNA plasmid


VALIUM22 mushroom bodies tiny shRNA plasmidshRNA plasmid

VALIUM10 Furin 2 shRNA plasmid                shRNA plasmid

VALIUM10 Dopamine receptor 2 shRNA plasmid shRNA plasmid


VALIUM22 saxophone shRNA plasmid              shRNA plasmid
VALIUM1 sallimus shRNA plasmid                shRNA plasmid

VALIUM1 sallimus shRNA plasmid                shRNA plasmid


VALIUM22 CG1951 shRNA plasmid                 shRNA plasmid

VALIUM10 Protein C kinase 98E shRNA plasmid shRNA plasmid


VALIUM22 Protein C kinase 98E shRNA plasmid shRNA plasmid


VALIUM20 yata shRNA plasmid                   shRNA plasmid


VALIUM20 yata shRNA plasmid                   shRNA plasmid

VALIUM10 Casein kinase Iα shRNA plasmid       shRNA plasmid


VALIUM22 Casein kinase Ialpha shRNA plasmid shRNA plasmid

VALIUM1 discs overgrown shRNA plasmid         shRNA plasmid

VALIUM10 discs overgrown shRNA plasmid        shRNA plasmid


VALIUM22 discs overgrown shRNA plasmid        shRNA plasmid

                                                shRNA plasmid
VALIUM10 Protein kinase related to protein kinase N shRNA plasmid


                                                shRNA plasmid
VALIUM22 Protein kinase related to protein kinase N shRNA plasmid


                                             shRNA
VALIUM22 pancreatic eIF-2alpha kinase shRNA plasmid plasmid


VALIUM20 abnormal wing discs shRNA plasmid shRNA plasmid


VALIUM22 abnormal wing discs shRNA plasmid shRNA plasmid


                                              shRNA
VALIUM22 female sterile (1) homeotic shRNA plasmid plasmid
VALIUM20 slipper shRNA plasmid              shRNA plasmid


VALIUM22 slipper shRNA plasmid              shRNA plasmid


VALIUM20 CG2577 shRNA plasmid               shRNA plasmid


VALIUM22 IkappaB kinase-like 2 shRNA plasmid shRNA plasmid

VALIUM1 shaggy shRNA plasmid                shRNA plasmid

VALIUM1 shaggy shRNA plasmid                shRNA plasmid


VALIUM22 shaggy shRNA plasmid               shRNA plasmid

VALIUM1 pole hole shRNA plasmid             shRNA plasmid

VALIUM1 pole hole shRNA plasmid             shRNA plasmid


VALIUM22 CG2846 shRNA plasmid               shRNA plasmid


                                             shRNA plasmid
VALIUM20 kinase suppressor of ras shRNA plasmid


                                             shRNA plasmid
VALIUM22 kinase suppressor of ras shRNA plasmid


VALIUM22 Pi4KIIalpha shRNA plasmid          shRNA plasmid


VALIUM22 Hexokinase A shRNA plasmid         shRNA plasmid

VALIUM1 CG3008 shRNA plasmid                shRNA plasmid


VALIUM22 CG3008 shRNA plasmid               shRNA plasmid


VALIUM22 Ipk1 shRNA plasmid                 shRNA plasmid

VALIUM10 Magi shRNA plasmid                 shRNA plasmid
VALIUM22 Magi shRNA plasmid                 shRNA plasmid


VALIUM20 Magi shRNA plasmid                 shRNA plasmid

                                            shRNA plasmid
VALIUM10 SNF1A/AMP-activated protein kinase shRNA plasmid


                                            shRNA plasmid
VALIUM20 SNF1A/AMP-activated protein kinase shRNA plasmid


                                            shRNA plasmid
VALIUM22 SNF1A/AMP-activated protein kinase shRNA plasmid

VALIUM1 aurora shRNA plasmid                shRNA plasmid


VALIUM22 aurora shRNA plasmid               shRNA plasmid


                                             shRNA plasmid
VALIUM22 MAP kinase activated protein-kinase-2 shRNA plasmid

VALIUM10 CG3105 shRNA plasmid               shRNA plasmid


VALIUM22 Wsck shRNA plasmid                 shRNA plasmid

VALIUM10 CG31183 shRNA plasmid              shRNA plasmid

                                            shRNA plasmid
VALIUM10 Phosphoglycerate kinase shRNA plasmid


                                            shRNA plasmid
VALIUM20 Phosphoglycerate kinase shRNA plasmid


                                            shRNA plasmid
VALIUM20 Phosphoglycerate kinase shRNA plasmid


                                            shRNA plasmid
VALIUM22 Phosphoglycerate kinase shRNA plasmid

VALIUM10 polychaetoid shRNA plasmid         shRNA plasmid


VALIUM22 polychaetoid shRNA plasmid         shRNA plasmid


VALIUM22 Adenylate kinase-2 shRNA plasmid   shRNA plasmid
VALIUM1 Tak1-like 1 shRNA plasmid            shRNA plasmid


VALIUM22 CG31431 shRNA plasmid               shRNA plasmid


VALIUM22 twinfilin shRNA plasmid             shRNA plasmid


VALIUM20 CG31873 shRNA plasmid               shRNA plasmid

VALIUM1 bent shRNA plasmid                   shRNA plasmid

VALIUM1 bent shRNA plasmid                   shRNA plasmid


VALIUM22 Arginine kinase shRNA plasmid       shRNA plasmid

VALIUM10 Arginine kinase shRNA plasmid       shRNA plasmid

VALIUM10 CG3216 shRNA plasmid                shRNA plasmid


VALIUM22 Myt1 shRNA plasmid                  shRNA plasmid


VALIUM22 Sphingosine kinase 2 shRNA plasmid shRNA plasmid


VALIUM22 CG32649 shRNA plasmid               shRNA plasmid

VALIUM10 CG32666 shRNA plasmid               shRNA plasmid


                                              shRNA plasmid
VALIUM22 Death-associated protein kinase related shRNA plasmid


VALIUM20 CG32703 shRNA plasmid               shRNA plasmid


VALIUM22 stardust shRNA plasmid              shRNA plasmid


VALIUM22 Smg1 shRNA plasmid                  shRNA plasmid

VALIUM1 Smg1 shRNA plasmid                   shRNA plasmid

VALIUM10 CG32944 shRNA plasmid               shRNA plasmid
                                            shRNA
VALIUM22 Cyclin-dependent kinase 7 shRNA plasmid plasmid

                                           shRNA plasmid
VALIUM10 cGMP-dependent protein kinase 21D shRNA plasmid


VALIUM20 Unc-89 shRNA plasmid                shRNA plasmid

VALIUM1 Nipped-A shRNA plasmid               shRNA plasmid


VALIUM22 CG33671 shRNA plasmid               shRNA plasmid


                                            shRNA plasmid
VALIUM22 6-phosphofructo-2-kinase shRNA plasmid

VALIUM1 CG34123 shRNA plasmid                shRNA plasmid

VALIUM1 CG34123 shRNA plasmid                shRNA plasmid


VALIUM22 trpm shRNA plasmid                  shRNA plasmid

VALIUM10 retinal degeneration A shRNA plasmidshRNA plasmid

VALIUM10 Diacyl glycerol kinase shRNA plasmid shRNA plasmid


VALIUM22 Tousled-like kinase shRNA plasmid   shRNA plasmid

VALIUM1 Tousled-like kinase shRNA plasmid    shRNA plasmid

VALIUM10 Tousled-like kinase shRNA plasmid   shRNA plasmid


VALIUM22 CG3534 shRNA plasmid                shRNA plasmid


VALIUM22 CG3608 shRNA plasmid                shRNA plasmid


                                             shRNA plasmid
VALIUM22 Cyclin-dependent kinase subunit 30A shRNA plasmid


VALIUM22 CG3837 shRNA plasmid                shRNA plasmid

VALIUM10 Derailed 2 shRNA plasmid            shRNA plasmid
                                             shRNA plasmid
VALIUM10 Fak-like tyrosine kinase shRNA plasmid


                                             shRNA plasmid
VALIUM22 Fak-like tyrosine kinase shRNA plasmid


VALIUM22 Phosphofructokinase shRNA plasmid shRNA plasmid

VALIUM1 Akt1 shRNA plasmid                   shRNA plasmid


VALIUM20 Akt1 shRNA plasmid                  shRNA plasmid


VALIUM22 Akt1 shRNA plasmid                  shRNA plasmid


VALIUM22 Haspin shRNA plasmid                shRNA plasmid


VALIUM22 genghis khan shRNA plasmid          shRNA plasmid

                                              shRNA plasmid
VALIUM10 G protein-coupled receptor kinase 1 shRNA plasmid


                                              shRNA plasmid
VALIUM22 G protein-coupled receptor kinase 1 shRNA plasmid

                                               shRNA plasmid
VALIUM1 Inositol 1,4,5-triphosphate kinase 1 shRNA plasmid


                                               shRNA plasmid
VALIUM22 Inositol 1,4,5-triphosphate kinase 1 shRNA plasmid

VALIUM10 Ste20-like kinase shRNA plasmid     shRNA plasmid


VALIUM22 Ste20-like kinase shRNA plasmid     shRNA plasmid

VALIUM10 Abl tyrosine kinase shRNA plasmid   shRNA plasmid


VALIUM22 Abl tyrosine kinase shRNA plasmid   shRNA plasmid


VALIUM22 CG4041 shRNA plasmid                shRNA plasmid


VALIUM22 Dyrk3 shRNA plasmid                 shRNA plasmid
VALIUM10 Pi3K92E shRNA plasmid               shRNA plasmid


                                            shRNA
VALIUM22 immune response deficient 5 shRNA plasmid plasmid

VALIUM10 minibrain shRNA plasmid             shRNA plasmid

VALIUM1 minibrain shRNA plasmid              shRNA plasmid


VALIUM22 minibrain shRNA plasmid             shRNA plasmid


VALIUM22 C-terminal Src kinase shRNA plasmid shRNA plasmid


VALIUM22 Darkener of apricot shRNA plasmid   shRNA plasmid

VALIUM10 CG42347 shRNA plasmid               shRNA plasmid

VALIUM10 CG42366 shRNA plasmid               shRNA plasmid


VALIUM20 CG42366 shRNA plasmid               shRNA plasmid


VALIUM22 meiotic 41 shRNA plasmid            shRNA plasmid


VALIUM22 Pitslre shRNA plasmid               shRNA plasmid

VALIUM10 hemipterous shRNA plasmid           shRNA plasmid


VALIUM22 hemipterous shRNA plasmid           shRNA plasmid

                                            shRNA plasmid
VALIUM1 cAMP-dependent protein kinase 1 shRNA plasmid

                                            shRNA plasmid
VALIUM1 cAMP-dependent protein kinase 1 shRNA plasmid


                                            shRNA plasmid
VALIUM22 cAMP-dependent protein kinase 1 shRNA plasmid


VALIUM22 wee shRNA plasmid                   shRNA plasmid


                                            shRNA plasmid
VALIUM22 PTEN-induced putative kinase 1 shRNA plasmid
                                             plasmid
VALIUM1 PTEN-induced putative kinase 1 shRNAshRNA plasmid

                                             plasmid
VALIUM1 PTEN-induced putative kinase 1 shRNAshRNA plasmid


VALIUM22 Sterile20-like kinase shRNA plasmid shRNA plasmid


VALIUM22 ire-1 shRNA plasmid                   shRNA plasmid

VALIUM10 CG4629 shRNA plasmid                  shRNA plasmid


VALIUM20 Protein kinase at 92B shRNA plasmid shRNA plasmid


VALIUM22 Protein kinase at 92B shRNA plasmid shRNA plasmid


VALIUM22 lethal (2) k01209 shRNA plasmid       shRNA plasmid

VALIUM10 CG4839 shRNA plasmid                  shRNA plasmid


                                            plasmid
VALIUM22 Selenophosphate synthetase 2 shRNAshRNA plasmid

                                            shRNA
VALIUM10 Cyclin-dependent kinase 4 shRNA plasmid plasmid


                                            shRNA
VALIUM22 Cyclin-dependent kinase 4 shRNA plasmid plasmid

VALIUM10 eag-like K+ channel shRNA plasmid shRNA plasmid


VALIUM20 Target of rapamycin shRNA plasmid shRNA plasmid


VALIUM20 Target of rapamycin shRNA plasmid shRNA plasmid


VALIUM22 Target of rapamycin shRNA plasmid shRNA plasmid

                                                  C shRNA plasmid
VALIUM10 neither inactivation nor afterpotential shRNA plasmid


VALIUM20 CG5144 shRNA plasmid                  shRNA plasmid
VALIUM22 CG5144 shRNA plasmid                shRNA plasmid

                                             shRNA plasmid
VALIUM1 Germinal centre kinase III shRNA plasmid


                                             shRNA
VALIUM22 Germinal centre kinase III shRNA plasmid plasmid


                                            shRNA
VALIUM22 Cyclin-dependent kinase 9 shRNA plasmid plasmid

VALIUM10 bonus shRNA plasmid                 shRNA plasmid

                                             shRNA plasmid
VALIUM10 Inverted repeat-binding protein shRNA plasmid


                                             shRNA plasmid
VALIUM22 Inverted repeat-binding protein shRNA plasmid


VALIUM22 CG5288 shRNA plasmid                shRNA plasmid


VALIUM22 nmdyn-D6 shRNA plasmid              shRNA plasmid


VALIUM22 cdc2 shRNA plasmid                  shRNA plasmid

VALIUM10 cdc2 shRNA plasmid                  shRNA plasmid


                                              shRNA plasmid
VALIUM20 Phosphotidylinositol 3 kinase 59F shRNA plasmid


                                              shRNA plasmid
VALIUM22 Phosphotidylinositol 3 kinase 59F shRNA plasmid

                                              shRNA
VALIUM10 Cdk5 activator-like protein shRNA plasmid plasmid


VALIUM22 tribbles shRNA plasmid              shRNA plasmid


                                            shRNA
VALIUM22 deoxyribonucleoside kinase shRNA plasmid plasmid

VALIUM10 Mpk2 shRNA plasmid                  shRNA plasmid


VALIUM22 Mpk2 shRNA plasmid                  shRNA plasmid
                                             shRNA
VALIUM20 Leucine-rich repeat kinase shRNA plasmid plasmid


                                             shRNA
VALIUM22 Leucine-rich repeat kinase shRNA plasmid plasmid


VALIUM22 CG5626 shRNA plasmid              shRNA plasmid

VALIUM1 basket shRNA plasmid               shRNA plasmid

VALIUM1 basket shRNA plasmid               shRNA plasmid


VALIUM20 Basket shRNA plasmid              shRNA plasmid


VALIUM22 fumble shRNA plasmid              shRNA plasmid


VALIUM22 CG5757 shRNA plasmid              shRNA plasmid


VALIUM22 pelle shRNA plasmid               shRNA plasmid

VALIUM10 center divider shRNA plasmid      shRNA plasmid


VALIUM22 center divider shRNA plasmid      shRNA plasmid

VALIUM10 AP-2σ shRNA plasmid               shRNA plasmid


VALIUM22 Dak1 shRNA plasmid                shRNA plasmid

                                            shRNA plasmid
VALIUM10 cAMP-dependent protein kinase 3 shRNA plasmid

VALIUM10 CG6218 shRNA plasmid              shRNA plasmid

VALIUM1 Cyclin T shRNA plasmid             shRNA plasmid


VALIUM20 Cyclin T shRNA plasmid            shRNA plasmid


VALIUM22 Cyclin T shRNA plasmid            shRNA plasmid
VALIUM22 JIL-1 shRNA plasmid                 shRNA plasmid

                                            shRNA plasmid
VALIUM10 Ca2+-channel-protein-beta-subunit shRNA plasmid

                                          shRNA plasmid
VALIUM10 NADH:ubiquinone reductase 42kD subunit precursor shRNA plasmid


                                          shRNA plasmid
VALIUM20 NADH:ubiquinone reductase 42kD subunit precursor shRNA plasmid


                                          shRNA plasmid
VALIUM20 NADH:ubiquinone reductase 42kD subunit precursor shRNA plasmid


VALIUM22 fab1 shRNA plasmid                  shRNA plasmid


VALIUM22 CG6364 shRNA plasmid                shRNA plasmid

VALIUM1 ballchen shRNA plasmid               shRNA plasmid


VALIUM22 ballchen shRNA plasmid              shRNA plasmid

VALIUM10 CG6498 shRNA plasmid                shRNA plasmid


VALIUM22 CG6498 shRNA plasmid                shRNA plasmid

                                               plasmid
VALIUM1 inactivation no afterpotential C shRNA shRNA plasmid

                                               plasmid
VALIUM1 inactivation no afterpotential C shRNA shRNA plasmid


                                               shRNA plasmid
VALIUM20 inactivation no afterpotential C shRNA plasmid


                                               shRNA plasmid
VALIUM20 inactivation no afterpotential C shRNA plasmid

                                             shRNA plasmid
VALIUM10 Signal transducing adaptor molecule shRNA plasmid

VALIUM1 telomere fusion shRNA plasmid        shRNA plasmid


VALIUM22 telomere fusion shRNA plasmid       shRNA plasmid

VALIUM1 fused shRNA plasmid                  shRNA plasmid
VALIUM1 fused shRNA plasmid                  shRNA plasmid


VALIUM22 fused shRNA plasmid                 shRNA plasmid

VALIUM10 IplI-aurora-like kinase shRNA plasmidshRNA plasmid


VALIUM22 IplI-aurora-like kinase shRNA plasmidshRNA plasmid

VALIUM10 Protein C kinase 53E shRNA plasmid shRNA plasmid

                                            shRNA plasmid
VALIUM10 Calcium/calmodulin-dependent protein kinase shRNA plasmid


                                            shRNA plasmid
VALIUM20 Calcium/calmodulin-dependent protein kinase shRNA plasmid


                                            shRNA plasmid
VALIUM22 Calcium/calmodulin-dependent protein kinase shRNA plasmid

                                            shRNA plasmid
VALIUM10 Slowpoke binding protein shRNA plasmid

VALIUM10 abnormal spindle shRNA plasmid      shRNA plasmid


VALIUM22 abnormal spindle shRNA plasmid      shRNA plasmid

VALIUM10 gilgamesh shRNA plasmid             shRNA plasmid


VALIUM22 gilgamesh shRNA plasmid             shRNA plasmid

                                             shRNA plasmid
VALIUM10 Protein kinase-like 17E shRNA plasmid


                                             shRNA plasmid
VALIUM22 Protein kinase-like 17E shRNA plasmid

VALIUM1 four wheel drive shRNA plasmid       shRNA plasmid

VALIUM10 four wheel drive shRNA plasmid      shRNA plasmid


VALIUM22 four wheel drive shRNA plasmid      shRNA plasmid


VALIUM22 CG7028 shRNA plasmid                shRNA plasmid
VALIUM22 Pyruvate kinase shRNA plasmid      shRNA plasmid


VALIUM22 happyhour shRNA plasmid            shRNA plasmid

VALIUM10 Protein Kinase D shRNA plasmid     shRNA plasmid


VALIUM22 CG7156 shRNA plasmid               shRNA plasmid


VALIUM22 Sak kinase shRNA plasmid           shRNA plasmid


                                             shRNA plasmid
VALIUM22 ceramide transfer protein shRNA plasmid

VALIUM10 CG7236 shRNA plasmid               shRNA plasmid


VALIUM22 CG7328 shRNA plasmid               shRNA plasmid


VALIUM20 CG7362 shRNA plasmid               shRNA plasmid

VALIUM10 p38b shRNA plasmid                 shRNA plasmid


VALIUM22 p38b shRNA plasmid                 shRNA plasmid


VALIUM20 CG7497 shRNA plasmid               shRNA plasmid

VALIUM10 Src oncogene at 64B shRNA plasmid shRNA plasmid


VALIUM22 Src oncogene at 64B shRNA plasmid shRNA plasmid


VALIUM20 Cdk12 shRNA plasmid                shRNA plasmid


VALIUM22 Cdk12 shRNA plasmid                shRNA plasmid


VALIUM22 CG7616 shRNA plasmid               shRNA plasmid
VALIUM22 altered disjunction shRNA plasmid   shRNA plasmid


VALIUM22 frayed shRNA plasmid                shRNA plasmid

VALIUM10 Mekk1 shRNA plasmid                 shRNA plasmid


VALIUM22 greatwall shRNA plasmid             shRNA plasmid


VALIUM20 greatwall shRNA plasmid             shRNA plasmid


VALIUM22 Bub1-related kinase shRNA plasmid shRNA plasmid

VALIUM10 nemo shRNA plasmid                  shRNA plasmid


VALIUM22 nemo shRNA plasmid                  shRNA plasmid

VALIUM10 punt shRNA plasmid                  shRNA plasmid


VALIUM22 punt shRNA plasmid                  shRNA plasmid

VALIUM10 similar shRNA plasmid               shRNA plasmid


VALIUM22 CG7995 shRNA plasmid                shRNA plasmid

VALIUM10 lightoid shRNA plasmid              shRNA plasmid

                                             shRNA plasmid
VALIUM10 Btk family kinase at 29A shRNA plasmid


                                             shRNA plasmid
VALIUM22 Btk family kinase at 29A shRNA plasmid


VALIUM20 alicorn shRNA plasmid               shRNA plasmid


VALIUM22 alicorn shRNA plasmid               shRNA plasmid

VALIUM1 CG8173 shRNA plasmid                 shRNA plasmid
VALIUM22 CG8173 shRNA plasmid                shRNA plasmid


VALIUM22 SRPK shRNA plasmid                  shRNA plasmid

                                            shRNA
VALIUM10 Cyclin-dependent kinase 5 shRNA plasmid plasmid


                                            shRNA
VALIUM22 Cyclin-dependent kinase 5 shRNA plasmid plasmid

VALIUM10 baboon shRNA plasmid                shRNA plasmid


VALIUM22 baboon shRNA plasmid                shRNA plasmid

VALIUM10 Alk shRNA plasmid                   shRNA plasmid


VALIUM20 CG8298 shRNA plasmid                shRNA plasmid


VALIUM22 CG8311 shRNA plasmid                shRNA plasmid


VALIUM22 nmdyn-D7 shRNA plasmid              shRNA plasmid


VALIUM22 PAPS synthetase shRNA plasmid       shRNA plasmid


VALIUM22 CG8485 shRNA plasmid                shRNA plasmid

                                            shRNA plasmid
VALIUM10 Selenide,water dikinase shRNA plasmid


                                            shRNA plasmid
VALIUM22 Selenide,water dikinase shRNA plasmid

VALIUM10 tricornered shRNA plasmid           shRNA plasmid


VALIUM22 tricornered shRNA plasmid           shRNA plasmid


                                              shRNA
VALIUM22 Diacyl glycerol kinase epsilon shRNA plasmidplasmid


VALIUM22 CG8726 shRNA plasmid                shRNA plasmid
VALIUM10 cycle shRNA plasmid                shRNA plasmid

                                            shRNA plasmid
VALIUM10 Guanylyl cyclase at 76C shRNA plasmid


VALIUM22 mos shRNA plasmid                  shRNA plasmid

VALIUM10 wallenda shRNA plasmid             shRNA plasmid


VALIUM22 wallenda shRNA plasmid             shRNA plasmid

                                           shRNA plasmid
VALIUM10 Pyruvate dehydrogenase kinase shRNA plasmid


                                           shRNA plasmid
VALIUM22 Pyruvate dehydrogenase kinase shRNA plasmid


VALIUM22 Adenylate kinase 6 shRNA plasmid   shRNA plasmid


VALIUM22 CG8866 shRNA plasmid               shRNA plasmid


VALIUM20 Fps oncogene analog shRNA plasmid shRNA plasmid


VALIUM22 CG8878 shRNA plasmid               shRNA plasmid

VALIUM10 off-track shRNA plasmid            shRNA plasmid

VALIUM10 off-track shRNA plasmid            shRNA plasmid

VALIUM10 varicose shRNA plasmid             shRNA plasmid


VALIUM22 varicose shRNA plasmid             shRNA plasmid


VALIUM22 lkb1 shRNA plasmid                 shRNA plasmid


VALIUM22 MAP kinase kinase 4 shRNA plasmid shRNA plasmid


                                            shRNA
VALIUM20 immune response deficient 1 shRNA plasmid plasmid
                                            shRNA
VALIUM22 immune response deficient 1 shRNA plasmid plasmid

VALIUM10 Rho-kinase shRNA plasmid             shRNA plasmid


VALIUM22 Rho-kinase shRNA plasmid             shRNA plasmid

VALIUM10 CG34357 shRNA plasmid                shRNA plasmid


VALIUM20 CG9961 shRNA plasmid                 shRNA plasmid

VALIUM10 skittles shRNA plasmid               shRNA plasmid


VALIUM22 skittles shRNA plasmid               shRNA plasmid

VALIUM1 CG18854 shRNA plasmid                 shRNA plasmid


VALIUM22 CR18854 shRNA plasmid                shRNA plasmid

                                             shRNA plasmid
VALIUM10 Allatostatin Receptor 2 shRNA plasmid

VALIUM10 fork head shRNA plasmid              shRNA plasmid


VALIUM20 forkhead shRNA plasmid               shRNA plasmid

                                                shRNA plasmid
VALIUM10 brother of odd with entrails limited shRNA plasmid

VALIUM10 traffic jam shRNA plasmid            shRNA plasmid


VALIUM20 traffic jam shRNA plasmid            shRNA plasmid

VALIUM10 ventral veins lacking shRNA plasmid shRNA plasmid

VALIUM10 rhomboid shRNA plasmid               shRNA plasmid

VALIUM10 MBD-R2 shRNA plasmid                 shRNA plasmid


                                             shRNA plasmid
VALIUM20 rho-type guanine exchange factor shRNA plasmid

VALIUM10 Synaptotagmin IV shRNA plasmid       shRNA plasmid
VALIUM10 Retinal Homeobox shRNA plasmid     shRNA plasmid

                                             s
VALIUM1 G protein αi subunit 65A shRNA plasmidhRNA plasmid

VALIUM1 Actin 57B shRNA plasmid             shRNA plasmid

VALIUM10 extra macrochaetae shRNA plasmid   shRNA plasmid

VALIUM10 spire shRNA plasmid                shRNA plasmid


VALIUM20 CR18854 shRNA plasmid              shRNA plasmid


VALIUM20 CG10077 shRNA plasmid              shRNA plasmid

                                            shRNA
VALIUM10 second mitotic wave missing shRNA plasmid plasmid


VALIUM20 CG10107 shRNA plasmid              shRNA plasmid

VALIUM10 phyllopod shRNA plasmid            shRNA plasmid

VALIUM10 pale shRNA plasmid                 shRNA plasmid

VALIUM1 Lamin C shRNA plasmid               shRNA plasmid

                                            s
VALIUM10 zero population growth shRNA plasmidhRNA plasmid

VALIUM10 transformer 2 shRNA plasmid        shRNA plasmid

VALIUM10 CG10132 shRNA plasmid              shRNA plasmid


VALIUM20 CG10133 shRNA plasmid              shRNA plasmid

VALIUM10 CG10137 shRNA plasmid              shRNA plasmid

VALIUM10 M-spondin shRNA plasmid            shRNA plasmid

VALIUM10 CG10147 shRNA plasmid              shRNA plasmid

                                           shRNA
VALIUM10 Proteasome p44.5 subunit shRNA plasmid plasmid

VALIUM10 CG10151 shRNA plasmid              shRNA plasmid


                                             shRNA plasmid
VALIUM20 Sprouty-related protein with EVH-1 domain shRNA plasmid
                                             shRNA shRNA
VALIUM10 Boundary element-associated factor of 32kD plasmidplasmid


                                            shRNA
VALIUM20 Ecdysone-inducible gene L3 shRNA plasmid plasmid


VALIUM20 CG10163 shRNA plasmid               shRNA plasmid

VALIUM10 CG10164 shRNA plasmid               shRNA plasmid

VALIUM1 CG10168 shRNA plasmid                shRNA plasmid

                                               shRNA plasmid
VALIUM10 Microfibril-associated protein 1 shRNA plasmid

                                               shRNA plasmid
VALIUM10 Nuclear transport factor-2-related shRNA plasmid

                                              shRNA
VALIUM10 Multiple drug resistance 65 shRNA plasmid plasmid


VALIUM20 CG10188 shRNA plasmid               shRNA plasmid

                                            shRNA plasmid
VALIUM1 Muscle LIM protein at 84B shRNA plasmid

VALIUM10 knot shRNA plasmid                  shRNA plasmid

VALIUM10 Nup98 shRNA plasmid                 shRNA plasmid

VALIUM10 CG10200 shRNA plasmid               shRNA plasmid

VALIUM10 CG10205 shRNA plasmid               shRNA plasmid


                                           shRNA plasmid
VALIUM20 Na[+]-dependent inorganic phosphate cotransporter shRNA plasmid


VALIUM20 SMC2 shRNA plasmid                  shRNA plasmid

VALIUM1 Topoisomerase 2 shRNA plasmid        shRNA plasmid


VALIUM20 Pcf11 shRNA plasmid                 shRNA plasmid

VALIUM10 katanin 60 shRNA plasmid            shRNA plasmid


VALIUM20 Rpn9 shRNA plasmid                  shRNA plasmid

VALIUM10 Laminin A shRNA plasmid             shRNA plasmid
VALIUM20 Cyp6a17 shRNA plasmid                  shRNA plasmid


VALIUM20 CG10249 shRNA plasmid                  shRNA plasmid

VALIUM10 nautilus shRNA plasmid                 shRNA plasmid

VALIUM10 Lap1 shRNA plasmid                     shRNA plasmid

VALIUM10 CG10267 shRNA plasmid                  shRNA plasmid


VALIUM20 D19A shRNA plasmid                     shRNA plasmid

VALIUM1 grappa shRNA plasmid                    shRNA plasmid

VALIUM1 grappa shRNA plasmid                    shRNA plasmid


VALIUM20 grappa shRNA plasmid                   shRNA plasmid

VALIUM10 CG10274 shRNA plasmid                  shRNA plasmid

VALIUM1 kon-tiki shRNA plasmid                  shRNA plasmid


VALIUM20 GATAe shRNA plasmid                    shRNA plasmid


VALIUM20 GATAe shRNA plasmid                    shRNA plasmid

VALIUM1 Rm62 shRNA plasmid                      shRNA plasmid


VALIUM20 Rm62 shRNA plasmid                     shRNA plasmid

VALIUM10 Antennapedia shRNA plasmid             shRNA plasmid


VALIUM20 CG10289 shRNA plasmid                  shRNA plasmid

VALIUM10 Sex combs reduced shRNA plasmid        shRNA plasmid

VALIUM1 bicoid stability factor shRNA plasmid   shRNA plasmid

VALIUM1 bicoid stability factor shRNA plasmid   shRNA plasmid
VALIUM20 bicoid stability factor shRNA plasmid shRNA plasmid


                                           shRNA plasmid
VALIUM20 Ribosomal protein S26 shRNA plasmid

VALIUM10 poils au dos shRNA plasmid          shRNA plasmid

VALIUM10 CG10321 shRNA plasmid               shRNA plasmid

VALIUM10 abdominal A shRNA plasmid           shRNA plasmid

VALIUM10 TBPH shRNA plasmid                  shRNA plasmid


VALIUM20 CG10333 shRNA plasmid               shRNA plasmid

VALIUM10 spitz shRNA plasmid                 shRNA plasmid


VALIUM20 spitz shRNA plasmid                 shRNA plasmid

VALIUM10 bicoid shRNA plasmid                shRNA plasmid

VALIUM10 neuropeptide F shRNA plasmid        shRNA plasmid


VALIUM20 CG10344 shRNA plasmid               shRNA plasmid

VALIUM10 CG10348 shRNA plasmid               shRNA plasmid


VALIUM20 refractory to sigma P shRNA plasmid shRNA plasmid


VALIUM20 refractory to sigma P shRNA plasmid shRNA plasmid

VALIUM10 CG10366 shRNA plasmid               shRNA plasmid

                                             shRNA plasmid
VALIUM10 Inwardly rectifying potassium channel 3 shRNA plasmid


VALIUM20 Tat-binding protein-1 shRNA plasmid shRNA plasmid

                                             shRNA plasmid
VALIUM1 Heterogeneous nuclear ribonucleoprotein at 27C shRNA plasmid

                                             shRNA plasmid
VALIUM1 Heterogeneous nuclear ribonucleoprotein at 27C shRNA plasmid
                                            shRNA plasmid
VALIUM20 Heterogeneous nuclear ribonucleoprotein at 27C shRNA plasmid


VALIUM20 myoblast city shRNA plasmid         shRNA plasmid


VALIUM20 myoblast city shRNA plasmid         shRNA plasmid

VALIUM10 wrapper shRNA plasmid               shRNA plasmid

VALIUM1 male-specific lethal 1 shRNA plasmid shRNA plasmid


VALIUM22 male-specific lethal 1 shRNA plasmid shRNA plasmid


VALIUM20 tosca shRNA plasmid                 shRNA plasmid

VALIUM10 Ultrabithorax shRNA plasmid         shRNA plasmid


VALIUM20 CG10414 shRNA plasmid               shRNA plasmid

VALIUM10 CG10418 shRNA plasmid               shRNA plasmid


VALIUM20 CG10420 shRNA plasmid               shRNA plasmid


VALIUM20 bag of marbles shRNA plasmid        shRNA plasmid


VALIUM20 CG10426 shRNA plasmid               shRNA plasmid

VALIUM1 daughter of sevenless shRNA plasmid shRNA plasmid

VALIUM10 CG10440 shRNA plasmid               shRNA plasmid


                                              plasmid
VALIUM20 Leukocyte-antigen-related-like shRNAshRNA plasmid

VALIUM10 zerknullt shRNA plasmid             shRNA plasmid


VALIUM20 zerknult 1 shRNA plasmid            shRNA plasmid

VALIUM10 crammer shRNA plasmid               shRNA plasmid
VALIUM10 CG10462 shRNA plasmid                shRNA plasmid

VALIUM10 CG10465 shRNA plasmid                shRNA plasmid

VALIUM1 CG10478 shRNA plasmid                 shRNA plasmid


VALIUM20 zerknult 2 shRNA plasmid             shRNA plasmid


VALIUM20 CG10483 shRNA plasmid                shRNA plasmid

VALIUM10 eyegone shRNA plasmid                shRNA plasmid

VALIUM10 Netrin-B shRNA plasmid               shRNA plasmid

VALIUM1 parkin shRNA plasmid                  shRNA plasmid


                                              shRNA plasmid
VALIUM20 female sterile (2) ltoPP43 shRNA plasmid

VALIUM1 Resistant to dieldrin shRNA plasmid   shRNA plasmid

VALIUM1 Resistant to dieldrin shRNA plasmid   shRNA plasmid

VALIUM1 capping protein alpha shRNA plasmid shRNA plasmid

VALIUM1 Bre1 shRNA plasmid                    shRNA plasmid

VALIUM10 Bre1 shRNA plasmid                   shRNA plasmid

VALIUM10 CG10543 shRNA plasmid                shRNA plasmid

                                            shRNA plasmid
VALIUM1 G protein β-subunit 13F shRNA plasmid

VALIUM10 Serotonin receptor 2 shRNA plasmid shRNA plasmid

VALIUM10 CG10566 shRNA plasmid                shRNA plasmid


                                            shRNA
VALIUM20 Mediator complex subunit 31 shRNA plasmid plasmid

VALIUM10 araucan shRNA plasmid                shRNA plasmid


VALIUM20 DnaJ-like-1 shRNA plasmid            shRNA plasmid
VALIUM20 DnaJ-like-1 shRNA plasmid            shRNA plasmid

VALIUM10 ripped pocket shRNA plasmid          shRNA plasmid

VALIUM10 fringe shRNA plasmid                 shRNA plasmid

VALIUM10 dachs shRNA plasmid                  shRNA plasmid


VALIUM20 dachs shRNA plasmid                  shRNA plasmid

VALIUM10 mirror shRNA plasmid                 shRNA plasmid

                                            shRNA plasmid
VALIUM10 brain-specific homeobox shRNA plasmid

VALIUM1 Odorant receptor 83b shRNA plasmid shRNA plasmid

VALIUM1 Odorant receptor 83b shRNA plasmid shRNA plasmid

VALIUM10 Synaptotagmin 12 shRNA plasmid       shRNA plasmid

VALIUM10 Leucokinin receptor shRNA plasmid    shRNA plasmid

                                               shRNA plasmid
VALIUM10 Inositol 1,4,5,-tris-phosphate receptor shRNA plasmid


VALIUM20 CG10630 shRNA plasmid                shRNA plasmid

VALIUM10 CG10631 shRNA plasmid                shRNA plasmid


VALIUM20 Snf5-related 1 shRNA plasmid         shRNA plasmid

VALIUM1 CG10641 shRNA plasmid                 shRNA plasmid

VALIUM1 lamina ancestor shRNA plasmid         shRNA plasmid

VALIUM10 CG10654 shRNA plasmid                shRNA plasmid

VALIUM10 Shaker cognate b shRNA plasmid       shRNA plasmid

VALIUM10 CG10669 shRNA plasmid                shRNA plasmid


VALIUM20 CG10672 shRNA plasmid                shRNA plasmid
VALIUM20 Nedd8 shRNA plasmid                 shRNA plasmid


VALIUM20 rhino shRNA plasmid                 shRNA plasmid


VALIUM22 rhino shRNA plasmid                 shRNA plasmid

VALIUM10 trailer hitch shRNA plasmid         shRNA plasmid

                                           shRNA
VALIUM10 Asparaginyl-tRNA synthetase shRNA plasmidplasmid


VALIUM20 lethal (2) 37Cc shRNA plasmid       shRNA plasmid


VALIUM20 lethal (2) 37Cc shRNA plasmid       shRNA plasmid

VALIUM1 slowpoke shRNA plasmid               shRNA plasmid

VALIUM1 slowpoke shRNA plasmid               shRNA plasmid

VALIUM10 slowpoke shRNA plasmid              shRNA plasmid

VALIUM10 Dopa decarboxylase shRNA plasmid shRNA plasmid

VALIUM10 GRHRII shRNA plasmid                shRNA plasmid

VALIUM10 Lim3 shRNA plasmid                  shRNA plasmid


VALIUM20 Lim3 shRNA plasmid                  shRNA plasmid

VALIUM1 Moesin shRNA plasmid                 shRNA plasmid

VALIUM10 Moesin shRNA plasmid                shRNA plasmid


VALIUM20 Moesin shRNA plasmid                shRNA plasmid

VALIUM10 twin of eyg shRNA plasmid           shRNA plasmid

                                             shRNA plasmid
VALIUM10 small conductance calcium-activated potassium channel shRNA plasmid

                                              shRNA plasmid
VALIUM10 E2F transcription factor 2 shRNA plasmid

VALIUM10 nebbish shRNA plasmid               shRNA plasmid
VALIUM10 brain tumor shRNA plasmid             shRNA plasmid


VALIUM20 brain tumor shRNA plasmid             shRNA plasmid

VALIUM10 Arrowhead shRNA plasmid               shRNA plasmid

VALIUM1 flare shRNA plasmid                    shRNA plasmid


VALIUM20 barren shRNA plasmid                  shRNA plasmid


VALIUM20 CG10741 shRNA plasmid                 shRNA plasmid

VALIUM10 roadblock shRNA plasmid               shRNA plasmid


                                              shRNA plasmid
VALIUM20 small nuclear ribonucleoprotein at 69D shRNA plasmid

VALIUM10 Gbeta5 shRNA plasmid                  shRNA plasmid

VALIUM10 Furin 1 shRNA plasmid                 shRNA plasmid

VALIUM10 Diptericin B shRNA plasmid            shRNA plasmid

VALIUM10 diminutive shRNA plasmid              shRNA plasmid

VALIUM10 diminutive shRNA plasmid              shRNA plasmid

VALIUM10 CG10804 shRNA plasmid                 shRNA plasmid


VALIUM20 Rheb shRNA plasmid                    shRNA plasmid


                                                  4G shRNA plasmid
VALIUM20 eukaryotic translation initiation factorshRNA plasmid

VALIUM10 CG10814 shRNA plasmid                 shRNA plasmid

VALIUM10 SIFamide receptor shRNA plasmid       shRNA plasmid


VALIUM20 SIFamide receptor shRNA plasmid       shRNA plasmid

VALIUM10 CG10830 shRNA plasmid                 shRNA plasmid

VALIUM10 Contactin shRNA plasmid               shRNA plasmid
VALIUM20 Contactin shRNA plasmid            shRNA plasmid

VALIUM1 Ryanodine receptor 44F shRNA plasmidshRNA plasmid

VALIUM1 Ryanodine receptor 44F shRNA plasmidshRNA plasmid

                                           shRNA plasmid
VALIUM10 Ryanodine receptor 44F shRNA plasmid

                                           shRNA plasmid
VALIUM10 Ryanodine receptor 44F shRNA plasmid

VALIUM10 dynactin-subunit-p25 shRNA plasmid shRNA plasmid


                                             s
VALIUM20 imaginal discs arrested shRNA plasmidhRNA plasmid

VALIUM1 CG10855 shRNA plasmid               shRNA plasmid

VALIUM10 CG10858 shRNA plasmid              shRNA plasmid

                                            shRNA
VALIUM10 Autophagy-specific gene 12 shRNA plasmid plasmid


VALIUM20 CG10863 shRNA plasmid              shRNA plasmid

VALIUM10 CG10864 shRNA plasmid              shRNA plasmid

                                            shRNA plasmid
VALIUM10 oo18 RNA-binding protein shRNA plasmid

VALIUM1 Rhodopsin 3 shRNA plasmid           shRNA plasmid

VALIUM1 Rhodopsin 3 shRNA plasmid           shRNA plasmid

VALIUM1 toutatis shRNA plasmid              shRNA plasmid

VALIUM10 CG1090 shRNA plasmid               shRNA plasmid

VALIUM10 oskar shRNA plasmid                shRNA plasmid


VALIUM20 CG10915 shRNA plasmid              shRNA plasmid

                                              shRNA
VALIUM10 Kinesin-like protein at 67A shRNA plasmid plasmid


                                            shRNA
VALIUM20 Proteasome alpha5 subunit shRNA plasmid plasmid
VALIUM20 Ribosomal protein S6 shRNA plasmid shRNA plasmid

VALIUM10 dpr14 shRNA plasmid                 shRNA plasmid

VALIUM10 CG10949 shRNA plasmid               shRNA plasmid

VALIUM10 Arc-p34 shRNA plasmid               shRNA plasmid

VALIUM1 Rtf1 shRNA plasmid                   shRNA plasmid


VALIUM20 Rtf1 shRNA plasmid                  shRNA plasmid

VALIUM10 CG10959 shRNA plasmid               shRNA plasmid


VALIUM20 CG10960 shRNA plasmid               shRNA plasmid


                                             shRNA plasmid
VALIUM20 TNF-receptor-associated factor 6 shRNA plasmid

VALIUM10 sniffer shRNA plasmid               shRNA plasmid


                                              shRNA plasmid
VALIUM20 Huntingtin interacting protein 1 shRNA plasmid

                                             shRNA plasmid
VALIUM10 Protein tyrosine phosphatase 69D shRNA plasmid

VALIUM10 CG10979 shRNA plasmid               shRNA plasmid

                                              shRNA
VALIUM1 lethal (1) discs degenerate 4 shRNA plasmid plasmid

                                            shRNA plasmid
VALIUM10 Dynamin associated protein 160 shRNA plasmid

VALIUM10 CG10992 shRNA plasmid               shRNA plasmid


VALIUM20 Caf1-180 shRNA plasmid              shRNA plasmid


VALIUM20 ryder cup shRNA plasmid             shRNA plasmid


VALIUM20 Rpn5 shRNA plasmid                  shRNA plasmid


VALIUM20 CG11009 shRNA plasmid               shRNA plasmid
                                             plasmid
VALIUM1 no mechanoreceptor potential C shRNAshRNA plasmid

                                             plasmid
VALIUM1 no mechanoreceptor potential C shRNAshRNA plasmid

                                             shRNA
VALIUM10 ADP ribosylation factor 102F shRNA plasmid plasmid

VALIUM1 CG11033 shRNA plasmid                 shRNA plasmid


VALIUM20 CG11033 shRNA plasmid                shRNA plasmid

VALIUM1 CG11044 shRNA plasmid                 shRNA plasmid

VALIUM10 shaven shRNA plasmid                 shRNA plasmid

VALIUM1 CG1105 shRNA plasmid                  shRNA plasmid

VALIUM1 CG1105 shRNA plasmid                  shRNA plasmid

                                             plasmid
VALIUM10 Neuropeptide-like precursor 2 shRNA shRNA plasmid

VALIUM10 calsyntenin-1 shRNA plasmid          shRNA plasmid

VALIUM1 Gelsolin shRNA plasmid                shRNA plasmid

VALIUM10 Activin-beta shRNA plasmid           shRNA plasmid


VALIUM20 Ajuba LIM protein shRNA plasmid      shRNA plasmid

                                               shRNA shRNA
VALIUM10 Retinoid- and fatty acid-binding glycoproteinplasmid plasmid


                                               shRNA shRNA
VALIUM20 Retinoid- and fatty acid-binding glycoproteinplasmid plasmid

VALIUM10 scarface shRNA plasmid               shRNA plasmid

VALIUM10 CG11071 shRNA plasmid                shRNA plasmid

VALIUM1 CG11077 shRNA plasmid                 shRNA plasmid

VALIUM10 plexin A shRNA plasmid               shRNA plasmid


VALIUM20 prickle shRNA plasmid                shRNA plasmid

VALIUM1 CG11092 shRNA plasmid                 shRNA plasmid
VALIUM20 CG11092 shRNA plasmid               shRNA plasmid


VALIUM20 CG11092 shRNA plasmid               shRNA plasmid

VALIUM10 doublesex shRNA plasmid             shRNA plasmid


VALIUM20 Mes2 shRNA plasmid                  shRNA plasmid

VALIUM10 CG11105 shRNA plasmid               shRNA plasmid

VALIUM10 retinal degeneration B shRNA plasmidshRNA plasmid

VALIUM10 Ssl1 shRNA plasmid                  shRNA plasmid


VALIUM20 alpha-Esterase-7 shRNA plasmid      shRNA plasmid

VALIUM10 sine oculis shRNA plasmid           shRNA plasmid

VALIUM10 CG11134 shRNA plasmid               shRNA plasmid

                                               shRNA plasmid
VALIUM10 Leucine-rich tendon-specific protein shRNA plasmid

                                            shRNA plasmid
VALIUM10 metabotropic glutamate receptor shRNA plasmid


                                            shRNA plasmid
VALIUM20 metabotropic glutamate receptor shRNA plasmid

VALIUM10 CG11148 shRNA plasmid               shRNA plasmid

VALIUM10 Sox102F shRNA plasmid               shRNA plasmid

VALIUM10 ATP synthase-beta shRNA plasmid     shRNA plasmid

VALIUM10 CG11155 shRNA plasmid               shRNA plasmid

VALIUM10 CG11163 shRNA plasmid               shRNA plasmid

VALIUM10 ubisnap shRNA plasmid               shRNA plasmid

VALIUM10 CG11180 shRNA plasmid               shRNA plasmid

VALIUM10 cup shRNA plasmid                   shRNA plasmid

VALIUM10 twin of eyeless shRNA plasmid       shRNA plasmid
VALIUM20 twin of eyeless shRNA plasmid      shRNA plasmid

                                              shRNA plasmid
VALIUM10 Hairy/E(spl)-related with YRPW motif shRNA plasmid

VALIUM1 CG11198 shRNA plasmid               shRNA plasmid

VALIUM10 photorepair shRNA plasmid          shRNA plasmid

VALIUM10 CG11206 shRNA plasmid              shRNA plasmid

VALIUM10 fascetto shRNA plasmid             shRNA plasmid

VALIUM10 pickpocket 6 shRNA plasmid         shRNA plasmid

VALIUM10 Ptc-related shRNA plasmid          shRNA plasmid

VALIUM10 Calcineurin B2 shRNA plasmid       shRNA plasmid


VALIUM20 hippo shRNA plasmid                shRNA plasmid


VALIUM22 hippo shRNA plasmid                shRNA plasmid

VALIUM10 CG11247 shRNA plasmid              shRNA plasmid


VALIUM20 maelstrom shRNA plasmid            shRNA plasmid


VALIUM22 maelstrom shRNA plasmid            shRNA plasmid

VALIUM10 MICAL-like shRNA plasmid           shRNA plasmid

VALIUM10 tartan shRNA plasmid               shRNA plasmid

VALIUM10 capricious shRNA plasmid           shRNA plasmid

VALIUM10 CG1129 shRNA plasmid               shRNA plasmid

VALIUM10 enoki mushroom shRNA plasmid       shRNA plasmid

VALIUM10 CG11293 shRNA plasmid              shRNA plasmid

VALIUM10 CG11294 shRNA plasmid              shRNA plasmid
                                           shRNA plasmid
VALIUM20 polar granule component shRNA plasmid


                                           shRNA plasmid
VALIUM20 polar granule component shRNA plasmid

VALIUM10 scratch shRNA plasmid               shRNA plasmid

VALIUM1 Sirt7 shRNA plasmid                  shRNA plasmid


VALIUM20 Sirt7 shRNA plasmid                 shRNA plasmid

VALIUM10 CG11317 shRNA plasmid               shRNA plasmid

VALIUM10 homer shRNA plasmid                 shRNA plasmid

                                            shRNA plasmid
VALIUM10 Gonadotropin-releasing hormone receptor shRNA plasmid

VALIUM10 Thrombospondin shRNA plasmid        shRNA plasmid

VALIUM10 CG11340 shRNA plasmid               shRNA plasmid

                                               shRNA plasmid
VALIUM10 nicotinic Acetylcholine Receptor beta 64B shRNA plasmid

VALIUM10 Lim1 shRNA plasmid                  shRNA plasmid


VALIUM20 polybromo shRNA plasmid             shRNA plasmid

VALIUM10 CG11376 shRNA plasmid               shRNA plasmid

VALIUM10 cut shRNA plasmid                   shRNA plasmid


VALIUM20 cut shRNA plasmid                   shRNA plasmid


VALIUM20 gluon shRNA plasmid                 shRNA plasmid


VALIUM20 CG11398 shRNA plasmid               shRNA plasmid

VALIUM10 A3-3 shRNA plasmid                  shRNA plasmid

                                              shRNA plasmid
VALIUM1 unconventional prefoldin RPB5 interactor shRNA plasmid
                                            10 shRNA plasmid
VALIUM20 Anaphase promoting complex subunitshRNA plasmid

VALIUM10 ruby shRNA plasmid                shRNA plasmid


VALIUM20 ruby shRNA plasmid                shRNA plasmid

VALIUM1 CG11437 shRNA plasmid              shRNA plasmid


VALIUM20 lazaro shRNA plasmid              shRNA plasmid

VALIUM10 CG11448 shRNA plasmid             shRNA plasmid

VALIUM10 net shRNA plasmid                 shRNA plasmid


VALIUM20 CG11455 shRNA plasmid             shRNA plasmid

VALIUM10 CG11456 shRNA plasmid             shRNA plasmid

                                            shRNA plasmid
VALIUM10 neuropeptide F receptor shRNA plasmid


VALIUM20 Mlh1 shRNA plasmid                shRNA plasmid

VALIUM10 MstProx shRNA plasmid             shRNA plasmid


VALIUM20 CG11490 shRNA plasmid             shRNA plasmid


VALIUM20 broad shRNA plasmid               shRNA plasmid

VALIUM10 broad shRNA plasmid               shRNA plasmid

VALIUM10 BTB-protein-VII shRNA plasmid     shRNA plasmid

VALIUM10 BTB-protein-VII shRNA plasmid     shRNA plasmid

VALIUM10 rasp shRNA plasmid                shRNA plasmid

VALIUM10 seven up shRNA plasmid            shRNA plasmid

VALIUM10 CG11504 shRNA plasmid             shRNA plasmid

VALIUM1 armitage shRNA plasmid             shRNA plasmid
VALIUM20 armitage shRNA plasmid              shRNA plasmid


VALIUM22 armitage shRNA plasmid              shRNA plasmid

                                             shRNA plasmid
VALIUM10 Protein tyrosine phosphatase 99A shRNA plasmid


VALIUM20 Ribosomal protein L6 shRNA plasmid shRNA plasmid

VALIUM10 Cyclin G shRNA plasmid              shRNA plasmid

VALIUM1 Tiggrin shRNA plasmid                shRNA plasmid

VALIUM10 CG11534 shRNA plasmid               shRNA plasmid

VALIUM10 CG11550 shRNA plasmid               shRNA plasmid

                                              shRNA plasmid
VALIUM10 intermediate neuroblasts defective shRNA plasmid

VALIUM10 Rabphilin shRNA plasmid             shRNA plasmid

VALIUM10 CG11560 shRNA plasmid               shRNA plasmid

VALIUM10 smoothened shRNA plasmid            shRNA plasmid

VALIUM10 CG11576 shRNA plasmid               shRNA plasmid

VALIUM1 armadillo shRNA plasmid              shRNA plasmid

VALIUM1 armadillo shRNA plasmid              shRNA plasmid


VALIUM20 CG11585 shRNA plasmid               shRNA plasmid

VALIUM10 VhaM9.7-1 shRNA plasmid             shRNA plasmid


VALIUM20 CG11593 shRNA plasmid               shRNA plasmid


VALIUM20 Ubiquitin-63E shRNA plasmid         shRNA plasmid


VALIUM20 steppke shRNA plasmid               shRNA plasmid

VALIUM10 pou domain motif 3 shRNA plasmid    shRNA plasmid
VALIUM10 Abdominal B shRNA plasmid            shRNA plasmid

VALIUM1 CG11658 shRNA plasmid                 shRNA plasmid


                                            shRNA plasmid
VALIUM20 Neural conserved at 73EF shRNA plasmid

VALIUM10 Ras oncogene at 64B shRNA plasmid shRNA plasmid

VALIUM10 7B2 shRNA plasmid                    shRNA plasmid


VALIUM20 maleless shRNA plasmid               shRNA plasmid

VALIUM10 CG11696 shRNA plasmid                shRNA plasmid


VALIUM20 - shRNA plasmid                      shRNA plasmid

                                             shRNA plasmid
VALIUM10 Adipokinetic hormone-like shRNA plasmid


VALIUM20 Adipokinetic hormone shRNA plasmid shRNA plasmid

VALIUM10 Cyp4g15 shRNA plasmid                shRNA plasmid

VALIUM10 - shRNA plasmid                      shRNA plasmid

VALIUM10 CG11723 shRNA plasmid                shRNA plasmid


VALIUM20 Peroxiredoxin 2540 shRNA plasmid     shRNA plasmid

                                             shRNA
VALIUM10 Hormone receptor-like in 96 shRNA plasmid plasmid


VALIUM20 Superoxide dismutase shRNA plasmidshRNA plasmid

VALIUM10 Superoxide dismutase shRNA plasmidshRNA plasmid

VALIUM10 charlatan shRNA plasmid              shRNA plasmid

VALIUM10 Mnf shRNA plasmid                    shRNA plasmid

                                                shRNA plasmid
VALIUM10 nicotinic acetylcholine receptor beta 21C shRNA plasmid


                                              shRNA plasmid
VALIUM20 Band4.1 inhibitor LRP interactor shRNA plasmid
VALIUM20 Nup358 shRNA plasmid               shRNA plasmid


VALIUM20 Nup358 shRNA plasmid               shRNA plasmid

VALIUM10 Cullin-3 shRNA plasmid             shRNA plasmid

VALIUM1 CG11866 shRNA plasmid               shRNA plasmid


VALIUM20 CG11873 shRNA plasmid              shRNA plasmid

VALIUM1 CG11882 shRNA plasmid               shRNA plasmid


VALIUM20 Rpn2 shRNA plasmid                 shRNA plasmid

VALIUM10 CG11891 shRNA plasmid              shRNA plasmid

VALIUM10 starry night shRNA plasmid         shRNA plasmid

VALIUM10 CG11902 shRNA plasmid              shRNA plasmid

VALIUM10 CG11906 shRNA plasmid              shRNA plasmid

VALIUM10 CG11910 shRNA plasmid              shRNA plasmid


VALIUM20 CG11920 shRNA plasmid              shRNA plasmid

                                          shRNA plasmid
VALIUM10 forkhead domain 96Cb shRNA plasmid


VALIUM20 katanin p60-like 1 shRNA plasmid   shRNA plasmid

VALIUM10 amnesiac shRNA plasmid             shRNA plasmid


VALIUM20 skpC shRNA plasmid                 shRNA plasmid

VALIUM10 coracle shRNA plasmid              shRNA plasmid


VALIUM20 RagA shRNA plasmid                 shRNA plasmid

                                             shRNA
VALIUM10 Enhancer of variegation 3-9 shRNA plasmid plasmid
                                            shRNA plasmid
VALIUM20 Proteasome beta3 subunit shRNA plasmid


VALIUM20 CG11984 shRNA plasmid                shRNA plasmid


VALIUM20 CG11985 shRNA plasmid                shRNA plasmid

VALIUM10 neuralized shRNA plasmid             shRNA plasmid

VALIUM1 hyrax shRNA plasmid                   shRNA plasmid


VALIUM22 hyrax shRNA plasmid                  shRNA plasmid

VALIUM10 Relish shRNA plasmid                 shRNA plasmid


VALIUM20 Relish shRNA plasmid                 shRNA plasmid

VALIUM10 Adenosine deaminase shRNA plasmid shRNA plasmid


VALIUM20 CG11999 shRNA plasmid                shRNA plasmid

VALIUM10 APP-like protein interacting protein 1 shRNA plasmid


                                            shRNA plasmid
VALIUM20 Proteasome beta7 subunit shRNA plasmid


VALIUM20 karst shRNA plasmid                  shRNA plasmid


VALIUM20 CG12012 shRNA plasmid                shRNA plasmid

VALIUM10 PHGPx shRNA plasmid                  shRNA plasmid


VALIUM20 PHGPx shRNA plasmid                  shRNA plasmid

VALIUM10 RabX6 shRNA plasmid                  shRNA plasmid

VALIUM10 Cdc37 shRNA plasmid                  shRNA plasmid

VALIUM10 Patj shRNA plasmid                   shRNA plasmid
VALIUM10 CG12029 shRNA plasmid               shRNA plasmid


                                            shRNA
VALIUM20 Mediator complex subunit 14 shRNA plasmid plasmid

VALIUM10 CG12038 shRNA plasmid               shRNA plasmid

                                         shRNA plasmid
VALIUM10 mushroom body defect shRNA plasmid

VALIUM10 pickpocket 21 shRNA plasmid         shRNA plasmid

VALIUM10 CG12050 shRNA plasmid               shRNA plasmid

VALIUM10 longitudinals lacking shRNA plasmid shRNA plasmid

VALIUM10 CG12061 shRNA plasmid               shRNA plasmid


VALIUM20 CG12065 shRNA plasmid               shRNA plasmid

VALIUM10 CG12071 shRNA plasmid               shRNA plasmid

VALIUM10 Serotonin receptor 7 shRNA plasmid shRNA plasmid


VALIUM20 Serotonin receptor 7 shRNA plasmid shRNA plasmid

VALIUM10 CG12082 shRNA plasmid               shRNA plasmid


VALIUM20 CG12084 shRNA plasmid               shRNA plasmid

                                             shRNA
VALIUM10 poly U binding factor 68kD shRNA plasmid plasmid


                                             shRNA
VALIUM20 poly U binding factor 68kD shRNA plasmid plasmid

                                              shRNA plasmid
VALIUM10 Palmitoyl-protein thioesterase 1 shRNA plasmid

VALIUM10 Caf1-180 shRNA plasmid              shRNA plasmid


VALIUM20 Caf1-180 shRNA plasmid              shRNA plasmid


VALIUM20 Phospholipase D shRNA plasmid       shRNA plasmid

VALIUM10 Sepiapterin reductase shRNA plasmidshRNA plasmid
VALIUM10 multi sex combs shRNA plasmid      shRNA plasmid


VALIUM20 multi sex combs shRNA plasmid      shRNA plasmid


VALIUM20 CG12128 shRNA plasmid              shRNA plasmid


VALIUM20 c12.1 shRNA plasmid                shRNA plasmid


VALIUM20 Lysyl-tRNA synthetase shRNA plasmidshRNA plasmid

VALIUM10 Tetraspanin 42Ej shRNA plasmid     shRNA plasmid


VALIUM20 NELF-B shRNA plasmid               shRNA plasmid


VALIUM22 Hira shRNA plasmid                 shRNA plasmid

VALIUM10 CG12155 shRNA plasmid              shRNA plasmid

VALIUM10 Rab39 shRNA plasmid                shRNA plasmid

                                            shRNA plasmid
VALIUM10 Translocase of outer membrane 40 shRNA plasmid


VALIUM20 CG12163 shRNA plasmid              shRNA plasmid


VALIUM20 CG12163 shRNA plasmid              shRNA plasmid


                                            shRNA plasmid
VALIUM22 Inner centromere protein shRNA plasmid

                                           shRNA plasmid
VALIUM10 Na[+]/H[+] hydrogen exchanger 1 shRNA plasmid


                                            shRNA
VALIUM20 Ring and YY1 Binding Protein shRNA plasmidplasmid

VALIUM10 dpr20 shRNA plasmid                shRNA plasmid


VALIUM20 CG12201 shRNA plasmid              shRNA plasmid

VALIUM10 miple shRNA plasmid                shRNA plasmid
VALIUM10 pebbled shRNA plasmid               shRNA plasmid


VALIUM20 pebbled shRNA plasmid               shRNA plasmid


VALIUM20 pebbled shRNA plasmid               shRNA plasmid

VALIUM10 CG12219 shRNA plasmid               shRNA plasmid

                                             s
VALIUM10 Dorsal switch protein 1 shRNA plasmidhRNA plasmid


VALIUM20 Spt6 shRNA plasmid                  shRNA plasmid


VALIUM20 carnation shRNA plasmid             shRNA plasmid

VALIUM10 G protein α 73B shRNA plasmid       shRNA plasmid

VALIUM10 CG12236 shRNA plasmid               shRNA plasmid


VALIUM20 enhancer of yellow 3 shRNA plasmid shRNA plasmid

VALIUM10 CG12239 shRNA plasmid               shRNA plasmid


VALIUM20 CG12241 shRNA plasmid               shRNA plasmid


VALIUM22 licorne shRNA plasmid               shRNA plasmid

VALIUM1 glial cells missing shRNA plasmid    shRNA plasmid

VALIUM1 glial cells missing shRNA plasmid    shRNA plasmid

VALIUM10 glial cells missing shRNA plasmid   shRNA plasmid


VALIUM20 miranda shRNA plasmid               shRNA plasmid


VALIUM20 Fcp1 shRNA plasmid                  shRNA plasmid


                                            shRNA
VALIUM20 Mediator complex subunit 25 shRNA plasmid plasmid
VALIUM20 CG12262 shRNA plasmid              shRNA plasmid


VALIUM20 CG12262 shRNA plasmid              shRNA plasmid


VALIUM20 CG12264 shRNA plasmid              shRNA plasmid

VALIUM10 Aos1 shRNA plasmid                 shRNA plasmid


VALIUM20 thread shRNA plasmid               shRNA plasmid

VALIUM10 POU domain protein 2 shRNA plasmidshRNA plasmid

VALIUM10 CG12290 shRNA plasmid              shRNA plasmid

VALIUM10 straightjacket shRNA plasmid       shRNA plasmid

VALIUM10 klumpfuss shRNA plasmid            shRNA plasmid


VALIUM20 BG4 shRNA plasmid                  shRNA plasmid

VALIUM10 subito shRNA plasmid               shRNA plasmid


VALIUM20 CG12299 shRNA plasmid              shRNA plasmid

VALIUM10 CG12301 shRNA plasmid              shRNA plasmid


VALIUM22 zucchini shRNA plasmid             shRNA plasmid


VALIUM22 zucchini shRNA plasmid             shRNA plasmid

                                             shRNA plasmid
VALIUM10 temperature-induced paralytic E shRNA plasmid


                                            shRNA plasmid
VALIUM20 Proteasome beta5 subunit shRNA plasmid


                                           shRNA plasmid
VALIUM20 Ribosomal protein S15Ab shRNA plasmid

VALIUM10 CG1233 shRNA plasmid               shRNA plasmid
                                            shRNA
VALIUM10 Autophagy-specific gene 8b shRNA plasmid plasmid


VALIUM20 windei shRNA plasmid                 shRNA plasmid

VALIUM10 CG12344 shRNA plasmid                shRNA plasmid

                                             shRNA plasmid
VALIUM10 Choline acetyltransferase shRNA plasmid

VALIUM1 Shaker shRNA plasmid                  shRNA plasmid


VALIUM20 cap binding protein 20 shRNA plasmidshRNA plasmid

VALIUM1 Ulp1 shRNA plasmid                    shRNA plasmid


                                           shRNA plasmid
VALIUM20 piRNA methyltransferase shRNA plasmid


                                           shRNA plasmid
VALIUM22 piRNA methyltransferase shRNA plasmid

VALIUM10 Lachesin shRNA plasmid               shRNA plasmid

VALIUM10 CG12370 shRNA plasmid                shRNA plasmid

VALIUM1 spt4 shRNA plasmid                    shRNA plasmid


VALIUM20 spt4 shRNA plasmid                   shRNA plasmid

                                               shRNA plasmid
VALIUM10 defective in the avoidance of repellents shRNA plasmid

VALIUM10 CG12391 shRNA plasmid                shRNA plasmid

VALIUM1 CG12393 shRNA plasmid                 shRNA plasmid

VALIUM1 CG12393 shRNA plasmid                 shRNA plasmid


VALIUM20 CG12393 shRNA plasmid                shRNA plasmid


VALIUM20 CG12393 shRNA plasmid                shRNA plasmid

VALIUM1 Mothers against dpp shRNA plasmid     shRNA plasmid

VALIUM1 Mothers against dpp shRNA plasmid     shRNA plasmid
VALIUM1 CG12402 shRNA plasmid                shRNA plasmid

                                            shRNA
VALIUM10 Autophagy-specific gene 2 shRNA plasmid plasmid

                                                80B shRNA plasmid
VALIUM10 nicotinic Acetylcholine Receptor alphashRNA plasmid


VALIUM20 Heat shock protein 83 shRNA plasmidshRNA plasmid


VALIUM20 Heat shock protein 83 shRNA plasmidshRNA plasmid

VALIUM10 CG12432 shRNA plasmid               shRNA plasmid

VALIUM1 raw shRNA plasmid                    shRNA plasmid


VALIUM20 MEP-1 shRNA plasmid                 shRNA plasmid


                                            shRNA
VALIUM20 Mediator complex subunit 27 shRNA plasmid plasmid

VALIUM10 CG12455 shRNA plasmid               shRNA plasmid

VALIUM10 stoned B shRNA plasmid              shRNA plasmid


VALIUM20 sec23 shRNA plasmid                 shRNA plasmid

VALIUM10 Arc1 shRNA plasmid                  shRNA plasmid

VALIUM10 Cdc42 shRNA plasmid                 shRNA plasmid

VALIUM1 Β Adaptin shRNA plasmid              shRNA plasmid

VALIUM10 Beta Adaptin shRNA plasmid          shRNA plasmid

                                            shRNA plasmid
VALIUM10 no mechanoreceptor potential B shRNA plasmid

VALIUM10 CG12594 shRNA plasmid               shRNA plasmid

                                           shRNA plasmid
VALIUM10 Adenosine deaminase acting on RNA shRNA plasmid

VALIUM10 CG33967 shRNA plasmid               shRNA plasmid

VALIUM1 CG12602 shRNA plasmid                shRNA plasmid

VALIUM10 CG12605 shRNA plasmid               shRNA plasmid
VALIUM10 labial shRNA plasmid                 shRNA plasmid

VALIUM10 CG12645 shRNA plasmid                shRNA plasmid

VALIUM10 buttonhead shRNA plasmid             shRNA plasmid

VALIUM10 CG12659 shRNA plasmid                shRNA plasmid

VALIUM10 olf413 shRNA plasmid                 shRNA plasmid

                                           shRNA plasmid
VALIUM10 Checkpoint suppressor homologue shRNA plasmid

VALIUM1 CG12736 shRNA plasmid                 shRNA plasmid


                                               a Rab3 GDP/GTP exchange protein shRNA plasmid
VALIUM20 Calmodulin-binding protein related toshRNA plasmid


VALIUM20 ovarian tumor shRNA plasmid          shRNA plasmid

                                             shRNA plasmid
VALIUM1 Heterogeneous nuclear ribonucleoprotein at 87F shRNA plasmid

                                             shRNA plasmid
VALIUM1 Heterogeneous nuclear ribonucleoprotein at 87F shRNA plasmid


                                             shRNA plasmid
VALIUM20 lethal (3) malignant blood neoplasm shRNA plasmid


VALIUM20 Eaf6 shRNA plasmid                   shRNA plasmid


VALIUM20 Eaf6 shRNA plasmid                   shRNA plasmid

VALIUM1 CG12765 shRNA plasmid                 shRNA plasmid

                                              shRNA
VALIUM10 Dorsal interacting protein 3 shRNA plasmid plasmid

VALIUM10 CG12768 shRNA plasmid                shRNA plasmid

VALIUM10 CG12769 shRNA plasmid                shRNA plasmid

VALIUM10 CG12783 shRNA plasmid                shRNA plasmid


                                               shRNA plasmid
VALIUM10 scavenger receptor acting in neural tissue and majority of rhodopsin is absent shRNA plasmid


VALIUM20 la costa shRNA plasmid               shRNA plasmid
VALIUM10 CG12796 shRNA plasmid                shRNA plasmid

VALIUM10 nervous fingers 2 shRNA plasmid      shRNA plasmid


VALIUM20 Fancl shRNA plasmid                  shRNA plasmid


VALIUM20 slender lobes shRNA plasmid          shRNA plasmid

VALIUM10 CG12858 shRNA plasmid                shRNA plasmid

VALIUM1 Su(var)2-HP2 shRNA plasmid            shRNA plasmid

VALIUM10 Su(var)2-HP2 shRNA plasmid           shRNA plasmid


                                             shRNA
VALIUM20 ALG-2 interacting protein X shRNA plasmid plasmid

VALIUM10 barentsz shRNA plasmid               shRNA plasmid


VALIUM20 CG12879 shRNA plasmid                shRNA plasmid


                                               shRNA I shRNA
VALIUM20 mitochondrial carnitine palmitoyltransferase plasmid plasmid


                                               shRNA I shRNA
VALIUM20 mitochondrial carnitine palmitoyltransferase plasmid plasmid

VALIUM10 CG12942 shRNA plasmid                shRNA plasmid

                                            shRNA plasmid
VALIUM10 salivary gland-expressed bHLH shRNA plasmid

VALIUM10 CG1299 shRNA plasmid                 shRNA plasmid

                                             plasmid
VALIUM10 Neuropeptide-like precursor 3 shRNA shRNA plasmid


VALIUM20 CG13096 shRNA plasmid                shRNA plasmid

VALIUM10 taiman shRNA plasmid                 shRNA plasmid


VALIUM20 taiman shRNA plasmid                 shRNA plasmid

VALIUM10 CG13114 shRNA plasmid                shRNA plasmid
VALIUM10 CG13120 shRNA plasmid               shRNA plasmid

VALIUM10 CG13121 shRNA plasmid               shRNA plasmid

VALIUM10 CG13096 shRNA plasmid               shRNA plasmid

VALIUM10 CG13139 shRNA plasmid               shRNA plasmid


VALIUM22 cutoff shRNA plasmid                shRNA plasmid


VALIUM22 cutoff shRNA plasmid                shRNA plasmid

VALIUM10 CG13204 shRNA plasmid               shRNA plasmid

VALIUM10 Odorant receptor 47b shRNA plasmid shRNA plasmid

                                            shRNA plasmid
VALIUM10 no mechanoreceptor potential A shRNA plasmid

VALIUM1 fbl6 shRNA plasmid                   shRNA plasmid

                                           shRNA plasmid
VALIUM10 Zn finger homeodomain 1 shRNA plasmid

VALIUM10 CG13229 shRNA plasmid               shRNA plasmid


VALIUM20 CG13243 shRNA plasmid               shRNA plasmid

VALIUM10 CG13248 shRNA plasmid               shRNA plasmid

VALIUM10 CG13253 shRNA plasmid               shRNA plasmid

VALIUM10 LSm7 shRNA plasmid                  shRNA plasmid

                                            plasmid
VALIUM10 CAS/CSE1 segregation protein shRNAshRNA plasmid

VALIUM1 CG13298 shRNA plasmid                shRNA plasmid

                                            plasmid
VALIUM10 putative noncoding RNA 013:4 shRNAshRNA plasmid

VALIUM10 Mnt shRNA plasmid                   shRNA plasmid

VALIUM1 Insulin-like peptide 7 shRNA plasmid shRNA plasmid


VALIUM20 Insulin-like peptide 7 shRNA plasmid shRNA plasmid
VALIUM1 tumbleweed shRNA plasmid            shRNA plasmid

VALIUM1 tumbleweed shRNA plasmid            shRNA plasmid

VALIUM1 tumbleweed shRNA plasmid            shRNA plasmid

VALIUM10 tumbleweed shRNA plasmid           shRNA plasmid


VALIUM20 CG13350 shRNA plasmid              shRNA plasmid


VALIUM20 Suv4-20 shRNA plasmid              shRNA plasmid


VALIUM20 pepsinogen-like shRNA plasmid      shRNA plasmid


VALIUM20 pepsinogen-like shRNA plasmid      shRNA plasmid

VALIUM1 embargoed shRNA plasmid             shRNA plasmid


VALIUM20 embargoed shRNA plasmid            shRNA plasmid

                                             shRNA
VALIUM10 A kinase anchor protein 200 shRNA plasmid plasmid


                                           shRNA plasmid
VALIUM20 Ribosomal protein S13 shRNA plasmid

VALIUM1 Chrac-14 shRNA plasmid              shRNA plasmid


VALIUM20 Rpt1 shRNA plasmid                 shRNA plasmid

VALIUM10 bursicon shRNA plasmid             shRNA plasmid


VALIUM20 Argonaute 2 shRNA plasmid          shRNA plasmid

VALIUM10 HGTX shRNA plasmid                 shRNA plasmid

VALIUM10 Leucokinin shRNA plasmid           shRNA plasmid

VALIUM1 dj-1β shRNA plasmid                 shRNA plasmid

VALIUM1 roundabout shRNA plasmid            shRNA plasmid
VALIUM1 roundabout shRNA plasmid             shRNA plasmid

VALIUM10 CG13532 shRNA plasmid               shRNA plasmid


VALIUM20 CG13551 shRNA plasmid               shRNA plasmid

VALIUM10 CG13568 shRNA plasmid               shRNA plasmid

VALIUM1 spaghetti shRNA plasmid              shRNA plasmid

VALIUM10 CG13575 shRNA plasmid               shRNA plasmid

VALIUM10 CG13579 shRNA plasmid               shRNA plasmid

VALIUM10 ion transport peptide shRNA plasmid shRNA plasmid

VALIUM10 CG13604 shRNA plasmid               shRNA plasmid

VALIUM10 CG13624 shRNA plasmid               shRNA plasmid

VALIUM10 Syntaxin 18 shRNA plasmid           shRNA plasmid

VALIUM10 Allatostatin shRNA plasmid          shRNA plasmid

                                            shRNA plasmid
VALIUM10 Nicotinamide mononucleotide adenylytransferase shRNA plasmid

VALIUM10 distal antenna-related shRNA plasmidshRNA plasmid

VALIUM10 Cad96Cb shRNA plasmid               shRNA plasmid

                                            shRNA
VALIUM1 Prothoracicotropic hormone shRNA plasmid plasmid


VALIUM20 CG13692 shRNA plasmid               shRNA plasmid

VALIUM10 sickle shRNA plasmid                shRNA plasmid

                                              shRNA plasmid
VALIUM10 allatostatin C receptor 2 shRNA plasmid

VALIUM1 yolkless shRNA plasmid               shRNA plasmid


VALIUM20 CG13720 shRNA plasmid               shRNA plasmid

VALIUM10 teashirt shRNA plasmid              shRNA plasmid
VALIUM20 CG13745 shRNA plasmid             shRNA plasmid

VALIUM10 PDF receptor shRNA plasmid        shRNA plasmid

VALIUM1 CG13762 shRNA plasmid              shRNA plasmid

VALIUM1 CG13762 shRNA plasmid              shRNA plasmid


VALIUM20 CG13762 shRNA plasmid             shRNA plasmid


VALIUM20 CG13762 shRNA plasmid             shRNA plasmid

VALIUM1 CG13766 shRNA plasmid              shRNA plasmid

VALIUM10 neuroligin shRNA plasmid          shRNA plasmid

VALIUM10 milton shRNA plasmid              shRNA plasmid

VALIUM1 Menin 1 shRNA plasmid              shRNA plasmid


VALIUM22 Menin 1 shRNA plasmid             shRNA plasmid

VALIUM10 CG13779 shRNA plasmid             shRNA plasmid

VALIUM10 tailless shRNA plasmid            shRNA plasmid

VALIUM10 CG13784 shRNA plasmid             shRNA plasmid

                                           shRNA
VALIUM10 Dromyosuppressin receptor 2 shRNA plasmidplasmid


                                             shRNA
VALIUM20 Ribosomal protein LP0-like shRNA plasmid plasmid

VALIUM10 Defensin shRNA plasmid            shRNA plasmid

                                           shRNA plasmid
VALIUM10 mob as tumor suppressor shRNA plasmid


                                           shRNA plasmid
VALIUM20 mob as tumor suppressor shRNA plasmid


VALIUM20 CG13887 shRNA plasmid             shRNA plasmid
VALIUM20 CG13887 shRNA plasmid               shRNA plasmid

VALIUM10 CG13894 shRNA plasmid               shRNA plasmid

VALIUM10 CG13897 shRNA plasmid               shRNA plasmid


VALIUM20 CG13900 shRNA plasmid               shRNA plasmid


VALIUM20 CG13902 shRNA plasmid               shRNA plasmid

VALIUM10 nervous fingers 1 shRNA plasmid     shRNA plasmid

VALIUM10 CG13908 shRNA plasmid               shRNA plasmid

VALIUM10 small optic lobes shRNA plasmid     shRNA plasmid


VALIUM20 multiple wing hairs shRNA plasmid   shRNA plasmid

VALIUM10 CG13928 shRNA plasmid               shRNA plasmid

VALIUM1 Gustatory receptor 21a shRNA plasmidshRNA plasmid

VALIUM1 Gustatory receptor 21a shRNA plasmidshRNA plasmid

VALIUM10 string shRNA plasmid                shRNA plasmid


VALIUM20 string shRNA plasmid                shRNA plasmid

                                             shRNA plasmid
VALIUM10 short neuropeptide F precursor shRNA plasmid

VALIUM10 brain washing shRNA plasmid         shRNA plasmid

VALIUM10 CG13995 shRNA plasmid               shRNA plasmid


VALIUM20 CG13998 shRNA plasmid               shRNA plasmid

VALIUM10 CG14014 shRNA plasmid               shRNA plasmid


VALIUM20 CG14023 shRNA plasmid               shRNA plasmid

VALIUM10 vrille shRNA plasmid                shRNA plasmid
VALIUM10 Septin-1 shRNA plasmid                shRNA plasmid


VALIUM20 CG14034 shRNA plasmid                 shRNA plasmid

VALIUM10 quick-to-court shRNA plasmid          shRNA plasmid

VALIUM1 ran shRNA plasmid                      shRNA plasmid

VALIUM10 SP555 shRNA plasmid                   shRNA plasmid


                                            shRNA plasmid
VALIUM20 Protostome-specific GEF shRNA plasmid

VALIUM1 Ilp6 shRNA plasmid                     shRNA plasmid


VALIUM20 Ilp6 shRNA plasmid                    shRNA plasmid

VALIUM10 CG14050 shRNA plasmid                 shRNA plasmid


VALIUM20 U2A shRNA plasmid                     shRNA plasmid

                                              shRNA plasmid
VALIUM10 Collapsin Response Mediator Protein shRNA plasmid


VALIUM20 SoxNeuro Co-Factor shRNA plasmid shRNA plasmid

VALIUM10 CG14119 shRNA plasmid                 shRNA plasmid


VALIUM20 RhoGAP19D shRNA plasmid               shRNA plasmid


VALIUM20 CG14137 shRNA plasmid                 shRNA plasmid

VALIUM10 bobby sox shRNA plasmid               shRNA plasmid

VALIUM1 Odorant receptor 67d shRNA plasmid shRNA plasmid

VALIUM10 CG1416 shRNA plasmid                  shRNA plasmid

VALIUM1 insulin-like peptide 3 shRNA plasmid   shRNA plasmid


VALIUM20 insulin-like peptide 3 shRNA plasmid shRNA plasmid
VALIUM1 Ilp1 shRNA plasmid                   shRNA plasmid


VALIUM20 Ilp1 shRNA plasmid                  shRNA plasmid

VALIUM10 CG14186 shRNA plasmid               shRNA plasmid


VALIUM20 Ubiquilin shRNA plasmid             shRNA plasmid


VALIUM20 Ubiquilin shRNA plasmid             shRNA plasmid

VALIUM1 domeless shRNA plasmid               shRNA plasmid

VALIUM1 domeless shRNA plasmid               shRNA plasmid

VALIUM10 domeless shRNA plasmid              shRNA plasmid


VALIUM20 domeless shRNA plasmid              shRNA plasmid

VALIUM10 Merlin shRNA plasmid                shRNA plasmid


VALIUM20 Merlin shRNA plasmid                shRNA plasmid

VALIUM10 CG14239 shRNA plasmid               shRNA plasmid

VALIUM10 misato shRNA plasmid                shRNA plasmid

VALIUM10 CG14274 shRNA plasmid               shRNA plasmid

                                            shRNA
VALIUM10 Myocyte enhancing factor 2 shRNA plasmid plasmid

VALIUM10 endophilin A shRNA plasmid          shRNA plasmid


VALIUM20 by S6 shRNA plasmid                 shRNA plasmid

VALIUM1 fruitless shRNA plasmid              shRNA plasmid

VALIUM10 CG14313 shRNA plasmid               shRNA plasmid

VALIUM10 beaten path IIa shRNA plasmid       shRNA plasmid

                                              shRNA plasmid
VALIUM1 sarcoplasmic calcium-binding protein shRNA plasmid
VALIUM10 hattifattener shRNA plasmid         shRNA plasmid

VALIUM10 Odorant receptor 88a shRNA plasmid shRNA plasmid


VALIUM20 CG14377 shRNA plasmid               shRNA plasmid

VALIUM10 CG14419 shRNA plasmid               shRNA plasmid

VALIUM1 CG14420 shRNA plasmid                shRNA plasmid


VALIUM20 CG14446 shRNA plasmid               shRNA plasmid

                                              shRNA plasmid
VALIUM10 Glutamate receptor binding protein shRNA plasmid


VALIUM20 purity of essence shRNA plasmid     shRNA plasmid

VALIUM10 innexin 3 shRNA plasmid             shRNA plasmid

VALIUM10 swi2 shRNA plasmid                  shRNA plasmid


VALIUM20 CG14507 shRNA plasmid               shRNA plasmid

VALIUM10 CG14509 shRNA plasmid               shRNA plasmid

VALIUM10 APC-like shRNA plasmid              shRNA plasmid


VALIUM20 APC-like shRNA plasmid              shRNA plasmid


VALIUM20 Klp10A shRNA plasmid                shRNA plasmid

VALIUM10 TweedleE shRNA plasmid              shRNA plasmid

                                              shRNA
VALIUM10 E(spl) region transcript mβ shRNA plasmid plasmid

VALIUM10 Calcineurin A1 shRNA plasmid        shRNA plasmid


VALIUM22 CG14562 shRNA plasmid               shRNA plasmid


VALIUM20 CG14563 shRNA plasmid               shRNA plasmid
VALIUM10 capa receptor shRNA plasmid         shRNA plasmid


VALIUM20 CR14578 shRNA plasmid               shRNA plasmid


VALIUM20 CG1458 shRNA plasmid                shRNA plasmid

VALIUM10 CG14593 shRNA plasmid               shRNA plasmid

                                            s
VALIUM10 Alkaline phosphatase 4 shRNA plasmidhRNA plasmid


                                            s
VALIUM20 Alkaline phosphatase 4 shRNA plasmidhRNA plasmid

                                              shRNA plasmid
VALIUM10 touch insensitive larva B shRNA plasmid

VALIUM10 eyeless shRNA plasmid               shRNA plasmid


VALIUM20 eyeless shRNA plasmid               shRNA plasmid

VALIUM10 CG14647 shRNA plasmid               shRNA plasmid

VALIUM10 CG14655 shRNA plasmid               shRNA plasmid

VALIUM10 CG14667 shRNA plasmid               shRNA plasmid

VALIUM10 Syntaxin 16 shRNA plasmid           shRNA plasmid

VALIUM1 CG14681/Skeletor shRNA plasmid       shRNA plasmid

VALIUM10 CG14691 shRNA plasmid               shRNA plasmid

                                             shRNA plasmid
VALIUM10 Guanylyl cyclase beta-subunit at 100B shRNA plasmid

VALIUM10 CG14710 shRNA plasmid               shRNA plasmid

VALIUM1 CG14711 shRNA plasmid                shRNA plasmid

                                             shRNA plasmid
VALIUM10 Histamine-gated chloride channel subunit 1 shRNA plasmid

                                            shRNA plasmid
VALIUM10 Cytochrome c oxidase subunit Va shRNA plasmid

VALIUM10 Tachykinin shRNA plasmid            shRNA plasmid

VALIUM1 CG14749 shRNA plasmid                shRNA plasmid
                                              shRNA
VALIUM10 Vacuolar protein sorting 25 shRNA plasmid plasmid

VALIUM1 CG14757 shRNA plasmid                shRNA plasmid

VALIUM10 CG14762 shRNA plasmid               shRNA plasmid

VALIUM1 CG14782 shRNA plasmid                shRNA plasmid

VALIUM10 Rab27 shRNA plasmid                 shRNA plasmid


VALIUM20 CG42666 shRNA plasmid               shRNA plasmid

VALIUM10 Sarcoglycan δ shRNA plasmid         shRNA plasmid

VALIUM1 δ-coatomer protein shRNA plasmid     shRNA plasmid


                                           shRNA
VALIUM20 Phosphoglycerate mutase 5 shRNA plasmid plasmid


                                              shRNA plasmid
VALIUM20 Microtubule-associated protein 205 shRNA plasmid

VALIUM10 flightless I shRNA plasmid          shRNA plasmid

VALIUM10 kurtz shRNA plasmid                 shRNA plasmid


VALIUM20 kurtz shRNA plasmid                 shRNA plasmid

                                           shRNA plasmid
VALIUM10 COP9 complex homolog subunit 5 shRNA plasmid

                                            shRNA plasmid
VALIUM10 Guanylyl cyclase at 89Da shRNA plasmid

                                            shRNA plasmid
VALIUM10 Guanylyl cyclase at 89Db shRNA plasmid

VALIUM10 CG42342 shRNA plasmid               shRNA plasmid

VALIUM1 CG14891 shRNA plasmid                shRNA plasmid

VALIUM10 Cad89D shRNA plasmid                shRNA plasmid

VALIUM10 Allatostatin C shRNA plasmid        shRNA plasmid

VALIUM1 CG14937 shRNA plasmid                shRNA plasmid


VALIUM20 Cyclin Y shRNA plasmid              shRNA plasmid
VALIUM10 Phosphodiesterase 1c shRNA plasmid shRNA plasmid

VALIUM1 extra sexcombs shRNA plasmid       shRNA plasmid


VALIUM20 extra sexcombs shRNA plasmid      shRNA plasmid


VALIUM20 CG14945 shRNA plasmid             shRNA plasmid


VALIUM20 CG14945 shRNA plasmid             shRNA plasmid

VALIUM10 dpr18 shRNA plasmid               shRNA plasmid

VALIUM10 CG14962 shRNA plasmid             shRNA plasmid

VALIUM10 CG14962 shRNA plasmid             shRNA plasmid


VALIUM20 CG14966 shRNA plasmid             shRNA plasmid

VALIUM10 Fermitin 1 shRNA plasmid          shRNA plasmid

                                             plasmid
VALIUM10 Glutamic acid decarboxylase 1 shRNAshRNA plasmid

VALIUM10 furrowed shRNA plasmid            shRNA plasmid

VALIUM10 uncoordinated shRNA plasmid       shRNA plasmid

VALIUM1 archipelago shRNA plasmid          shRNA plasmid


VALIUM20 archipelago shRNA plasmid         shRNA plasmid

VALIUM1 CG15011 shRNA plasmid              shRNA plasmid

VALIUM1 Cip4 shRNA plasmid                 shRNA plasmid

VALIUM10 CG15021 shRNA plasmid             shRNA plasmid


VALIUM20 CG15022 shRNA plasmid             shRNA plasmid

VALIUM10 CG1504 shRNA plasmid              shRNA plasmid

VALIUM10 Ac3 shRNA plasmid                 shRNA plasmid
VALIUM10 CG15073 shRNA plasmid               shRNA plasmid


VALIUM20 lethal (2) 08717 shRNA plasmid      shRNA plasmid

VALIUM1 CG15097 shRNA plasmid                shRNA plasmid

                                              shRNA plasmid
VALIUM1 Topoisomerase I-interacting protein shRNA plasmid

VALIUM1 another B-box affiliate shRNA plasmid shRNA plasmid

VALIUM1 enabled shRNA plasmid                shRNA plasmid

VALIUM10 Serotonin receptor 1B shRNA plasmidshRNA plasmid


VALIUM20 Serotonin receptor 1B shRNA plasmidshRNA plasmid


VALIUM20 CG15117 shRNA plasmid               shRNA plasmid


                                             shRNA
VALIUM20 Myb-interacting protein 40 shRNA plasmid plasmid

VALIUM10 Cullin-2 shRNA plasmid              shRNA plasmid

VALIUM10 beat-IIIc shRNA plasmid             shRNA plasmid

VALIUM10 beethoven shRNA plasmid             shRNA plasmid

VALIUM10 narrow abdomen shRNA plasmid        shRNA plasmid

VALIUM1 CG15177 shRNA plasmid                shRNA plasmid


                                            shRNA
VALIUM20 Proteasome alpha7 subunit shRNA plasmid plasmid

VALIUM10 WASp shRNA plasmid                  shRNA plasmid


VALIUM20 Cyclin K shRNA plasmid              shRNA plasmid

VALIUM10 cacophony shRNA plasmid             shRNA plasmid

VALIUM10 CG15221 shRNA plasmid               shRNA plasmid

VALIUM10 CG15236 shRNA plasmid               shRNA plasmid
VALIUM10 CG15270 shRNA plasmid                shRNA plasmid

                                            shRNA plasmid
VALIUM10 metabotropic GABA-B receptor subtype 1 shRNA plasmid

                                          shRNA plasmid
VALIUM10 gamma-coatomer protein shRNA plasmid

VALIUM10 wing blister shRNA plasmid           shRNA plasmid

VALIUM10 CG15309 shRNA plasmid                shRNA plasmid

VALIUM10 nejire shRNA plasmid                 shRNA plasmid

VALIUM1 nejire shRNA plasmid                  shRNA plasmid

                                             plasmid
VALIUM10 Neuropeptide-like precursor 4 shRNA shRNA plasmid


VALIUM20 CG15365 shRNA plasmid                shRNA plasmid


VALIUM20 eyes shut shRNA plasmid              shRNA plasmid


VALIUM20 eyes shut shRNA plasmid              shRNA plasmid

VALIUM1 tropomodulin shRNA plasmid            shRNA plasmid


VALIUM20 CG15414 shRNA plasmid                shRNA plasmid

VALIUM10 Spindly shRNA plasmid                shRNA plasmid


VALIUM20 cappuccino shRNA plasmid             shRNA plasmid

VALIUM10 CG15423 shRNA plasmid                shRNA plasmid

                                           shRNA plasmid
VALIUM10 Tyramine β hydroxylase shRNA plasmid

                                               shRNA plasmid
VALIUM1 modifier of rpr and grim, ubiquitously expressed shRNA plasmid


VALIUM20 CG15438 shRNA plasmid                shRNA plasmid

VALIUM10 cathD shRNA plasmid                  shRNA plasmid

                                           shRNA
VALIUM10 doublesex-Mab related 99B shRNA plasmid plasmid
VALIUM10 CG15514 shRNA plasmid              shRNA plasmid

VALIUM10 capability shRNA plasmid           shRNA plasmid

VALIUM10 CG15522 shRNA plasmid              shRNA plasmid

VALIUM10 headcase shRNA plasmid             shRNA plasmid

VALIUM10 CG15537 shRNA plasmid              shRNA plasmid

VALIUM10 CG15553 shRNA plasmid              shRNA plasmid

VALIUM10 CG15555 shRNA plasmid              shRNA plasmid

VALIUM10 Odorant receptor 83c shRNA plasmid shRNA plasmid

VALIUM10 myospheroid shRNA plasmid          shRNA plasmid


VALIUM20 myospheroid shRNA plasmid          shRNA plasmid

VALIUM1 CG15609 shRNA plasmid               shRNA plasmid

VALIUM1 CG15611 shRNA plasmid               shRNA plasmid

VALIUM10 hoepel2 shRNA plasmid              shRNA plasmid

                                            shRNA plasmid
VALIUM10 Ionotropic receptor 25a shRNA plasmid


VALIUM20 CG15628 shRNA plasmid              shRNA plasmid

VALIUM10 CG15651 shRNA plasmid              shRNA plasmid

VALIUM10 CG15658 shRNA plasmid              shRNA plasmid

                                             shRNA plasmid
VALIUM10 Misexpression suppressor of KSR 2 shRNA plasmid


                                           shRNA plasmid
VALIUM20 Ribosomal protein S30 shRNA plasmid


VALIUM22 krimper shRNA plasmid              shRNA plasmid


VALIUM22 krimper shRNA plasmid              shRNA plasmid

VALIUM10 CG15710 shRNA plasmid              shRNA plasmid
VALIUM10 CG15744 shRNA plasmid                shRNA plasmid

VALIUM10 CG15765 shRNA plasmid                shRNA plasmid

VALIUM1 Trehalose-sensitivity shRNA plasmid   shRNA plasmid

VALIUM1 Trehalose-sensitivity shRNA plasmid   shRNA plasmid


VALIUM20 CG15784 shRNA plasmid                shRNA plasmid

VALIUM10 ric8a shRNA plasmid                  shRNA plasmid

VALIUM10 Ras opposite shRNA plasmid           shRNA plasmid

VALIUM1 piefke shRNA plasmid                  shRNA plasmid

VALIUM10 piefke shRNA plasmid                 shRNA plasmid

VALIUM10 CG15817 shRNA plasmid                shRNA plasmid

VALIUM1 CG1583 shRNA plasmid                  shRNA plasmid

                                              shRNA plasmid
VALIUM1 Adh transcription factor 1 shRNA plasmid

                                              shRNA plasmid
VALIUM10 Adh transcription factor 1 shRNA plasmid

                                               1 shRNA plasmid
VALIUM10 Sarcoplasmic calcium-binding protein shRNA plasmid

VALIUM1 painless shRNA plasmid                shRNA plasmid

VALIUM1 painless shRNA plasmid                shRNA plasmid

VALIUM1 Ravus shRNA plasmid                   shRNA plasmid

VALIUM10 CG15890 shRNA plasmid                shRNA plasmid

VALIUM10 Ca-α1T shRNA plasmid                 shRNA plasmid

VALIUM10 CG1602 shRNA plasmid                 shRNA plasmid

VALIUM10 CG1603 shRNA plasmid                 shRNA plasmid

VALIUM10 az2 shRNA plasmid                    shRNA plasmid

                                             shRNA
VALIUM10 Open rectifier K+ channel 1 shRNA plasmid plasmid

VALIUM1 comatose shRNA plasmid                shRNA plasmid
VALIUM1 comatose shRNA plasmid               shRNA plasmid

VALIUM10 CG1621 shRNA plasmid                shRNA plasmid


                                            shRNA plasmid
VALIUM20 thioredoxin peroxidase 1 shRNA plasmid


                                            shRNA plasmid
VALIUM20 thioredoxin peroxidase 1 shRNA plasmid

VALIUM10 Neuroglian shRNA plasmid            shRNA plasmid


VALIUM20 CG1636 shRNA plasmid                shRNA plasmid


VALIUM20 CG1637 shRNA plasmid                shRNA plasmid


VALIUM20 lethal (1) 10Bb shRNA plasmid       shRNA plasmid

VALIUM10 sisterless A shRNA plasmid          shRNA plasmid

                                            shRNA
VALIUM10 Autophagy-specific gene 5 shRNA plasmid plasmid

VALIUM10 unplugged shRNA plasmid             shRNA plasmid

VALIUM1 Ankyrin shRNA plasmid                shRNA plasmid

VALIUM10 CG1663 shRNA plasmid                shRNA plasmid

VALIUM10 small bristles shRNA plasmid        shRNA plasmid


VALIUM20 small bristles shRNA plasmid        shRNA plasmid

VALIUM10 Helicase shRNA plasmid              shRNA plasmid

VALIUM1 CG1667 shRNA plasmid                 shRNA plasmid

                                             shRNA shRNA
VALIUM10 Pheromone-binding protein-related protein 2plasmid plasmid


                                           shRNA
VALIUM20 Spatzle-Processing Enzyme shRNA plasmid plasmid

VALIUM10 Serotonin receptor 1A shRNA plasmidshRNA plasmid
VALIUM20 Serotonin receptor 1A shRNA plasmidshRNA plasmid

VALIUM10 transformer shRNA plasmid         shRNA plasmid

VALIUM10 survival motor neuron shRNA plasmidshRNA plasmid

VALIUM10 survival motor neuron shRNA plasmidshRNA plasmid

VALIUM1 Git shRNA plasmid                  shRNA plasmid

VALIUM10 sloppy paired 1 shRNA plasmid     shRNA plasmid


VALIUM20 sloppy paired 1 shRNA plasmid     shRNA plasmid

VALIUM10 CG32295 shRNA plasmid             shRNA plasmid

VALIUM10 pasilla shRNA plasmid             shRNA plasmid

VALIUM10 Tyramine receptor II shRNA plasmid shRNA plasmid

VALIUM10 CG16778 shRNA plasmid             shRNA plasmid


VALIUM20 CG16778 shRNA plasmid             shRNA plasmid

                                           shRNA
VALIUM10 Developmental embryonic B shRNA plasmid plasmid

VALIUM1 CG16793 shRNA plasmid              shRNA plasmid

VALIUM1 CG16793 shRNA plasmid              shRNA plasmid

VALIUM10 alphaPS4 shRNA plasmid            shRNA plasmid

VALIUM10 CG16857 shRNA plasmid             shRNA plasmid

VALIUM10 CG16868 shRNA plasmid             shRNA plasmid

VALIUM10 CG1688 shRNA plasmid              shRNA plasmid

VALIUM10 lozenge shRNA plasmid             shRNA plasmid

VALIUM10 CG16899 shRNA plasmid             shRNA plasmid

VALIUM1 squid shRNA plasmid                shRNA plasmid

VALIUM1 squid shRNA plasmid                shRNA plasmid
VALIUM10 Hr4 shRNA plasmid                   shRNA plasmid

                                              shRNA plasmid
VALIUM10 Epidermal growth factor receptor pathway substrate clone 15 shRNA plasmid


                                              shRNA plasmid
VALIUM20 Epidermal growth factor receptor pathway substrate clone 15 shRNA plasmid


                                              shRNA plasmid
VALIUM20 Epidermal growth factor receptor pathway substrate clone 15 shRNA plasmid


VALIUM20 CG16941 shRNA plasmid               shRNA plasmid

VALIUM1 stress-sensitive B shRNA plasmid     shRNA plasmid

VALIUM1 stress-sensitive B shRNA plasmid     shRNA plasmid

VALIUM1 dim γ-tubulin 2 shRNA plasmid        shRNA plasmid

                                            shRNA plasmid
VALIUM10 Scm-related gene containing four mbt domains shRNA plasmid


                                            shRNA plasmid
VALIUM20 Scm-related gene containing four mbt domains shRNA plasmid


VALIUM20 Roc1a shRNA plasmid                 shRNA plasmid

VALIUM10 skpA shRNA plasmid                  shRNA plasmid


VALIUM20 skpA shRNA plasmid                  shRNA plasmid


VALIUM20 skpA shRNA plasmid                  shRNA plasmid


VALIUM20 dawdle shRNA plasmid                shRNA plasmid

VALIUM1 Roc1b shRNA plasmid                  shRNA plasmid


VALIUM20 CG17002 shRNA plasmid               shRNA plasmid


VALIUM20 GXIVsPLA2 shRNA plasmid             shRNA plasmid

VALIUM10 klarsicht shRNA plasmid             shRNA plasmid
VALIUM10 Methoprene-tolerant shRNA plasmid shRNA plasmid

VALIUM10 Rab-protein 10 shRNA plasmid       shRNA plasmid

VALIUM10 inx6 shRNA plasmid                 shRNA plasmid


VALIUM20 mars shRNA plasmid                 shRNA plasmid

VALIUM10 pointed shRNA plasmid              shRNA plasmid

VALIUM10 Vha100-1 shRNA plasmid             shRNA plasmid


VALIUM20 Host cell factor shRNA plasmid     shRNA plasmid

VALIUM10 clockwork orange shRNA plasmid     shRNA plasmid

VALIUM10 clockwork orange shRNA plasmid     shRNA plasmid


VALIUM20 CG17107 shRNA plasmid              shRNA plasmid

VALIUM10 homothorax shRNA plasmid           shRNA plasmid


VALIUM20 homothorax shRNA plasmid           shRNA plasmid


VALIUM20 Enhancer of bithorax shRNA plasmid shRNA plasmid

VALIUM10 Porin2 shRNA plasmid               shRNA plasmid

VALIUM10 CG17139 shRNA plasmid              shRNA plasmid

VALIUM1 pyrexia shRNA plasmid               shRNA plasmid


                                             plasmid
VALIUM20 Suppressor of variegation 3-3 shRNA shRNA plasmid


                                             plasmid
VALIUM20 Suppressor of variegation 3-3 shRNA shRNA plasmid

VALIUM10 CG17153 shRNA plasmid              shRNA plasmid

VALIUM10 capping protein beta shRNA plasmid shRNA plasmid

VALIUM1 Set2 shRNA plasmid                  shRNA plasmid
VALIUM20 Set2 shRNA plasmid                 shRNA plasmid

VALIUM10 CG40146 shRNA plasmid              shRNA plasmid

                                             shRNA plasmid
VALIUM10 (A+T)-stretch binding protein shRNA plasmid

VALIUM10 CG17181 shRNA plasmid              shRNA plasmid

VALIUM10 CG17186 shRNA plasmid              shRNA plasmid

                                          shRNA plasmid
VALIUM10 Phosphoglyceromutase shRNA plasmid

VALIUM10 CG17219 shRNA plasmid              shRNA plasmid

VALIUM10 prospero shRNA plasmid             shRNA plasmid


VALIUM20 locomotion defects shRNA plasmid   shRNA plasmid

VALIUM10 plexin B shRNA plasmid             shRNA plasmid

VALIUM10 n-synaptobrevin shRNA plasmid      shRNA plasmid


VALIUM20 discs large 1 shRNA plasmid        shRNA plasmid


VALIUM20 discs large 1 shRNA plasmid        shRNA plasmid


VALIUM20 discs large 1 shRNA plasmid        shRNA plasmid

                                            shRNA plasmid
VALIUM10 no circadian temperature entrainment shRNA plasmid

VALIUM10 CG17257 shRNA plasmid              shRNA plasmid


VALIUM20 Sox box protein 14 shRNA plasmid   shRNA plasmid


VALIUM20 CG17273 shRNA plasmid              shRNA plasmid

VALIUM1 Tim8 shRNA plasmid                  shRNA plasmid

                                            shRNA plasmid
VALIUM10 Protein phosphatase 2A at 29B shRNA plasmid
VALIUM20 CG17293 shRNA plasmid               shRNA plasmid

VALIUM10 2mit shRNA plasmid                  shRNA plasmid

VALIUM10 CG1732 shRNA plasmid                shRNA plasmid

VALIUM10 CG17321 shRNA plasmid               shRNA plasmid

VALIUM10 CG17328 shRNA plasmid               shRNA plasmid


VALIUM20 CG17331 shRNA plasmid               shRNA plasmid

VALIUM10 lin-28 shRNA plasmid                shRNA plasmid

                                             shRNA plasmid
VALIUM10 Ligand-gated chloride channel homolog 3 shRNA plasmid


                                            shRNA plasmid
VALIUM20 TBP-associated factor 12 shRNA plasmid

VALIUM10 CG17359 shRNA plasmid               shRNA plasmid

                                               shRNA plasmid
VALIUM10 jing interacting gene regulatory 1 shRNA plasmid


VALIUM20 CG17385 shRNA plasmid               shRNA plasmid

VALIUM10 CG17385 shRNA plasmid               shRNA plasmid

VALIUM10 CG17386 shRNA plasmid               shRNA plasmid

                                               shRNA plasmid
VALIUM10 O/E-associated zinc finger protein shRNA plasmid

                                              shRNA plasmid
VALIUM10 Nuclear transport factor-2 shRNA plasmid


VALIUM20 will die slowly shRNA plasmid       shRNA plasmid

VALIUM1 chaoptic shRNA plasmid               shRNA plasmid

VALIUM1 chaoptic shRNA plasmid               shRNA plasmid


VALIUM20 RhoGAP102A shRNA plasmid            shRNA plasmid


VALIUM20 Ribosomal protein L5 shRNA plasmid shRNA plasmid
VALIUM20 CG17494 shRNA plasmid              shRNA plasmid

VALIUM10 Rab21 shRNA plasmid                shRNA plasmid

VALIUM10 Qm shRNA plasmid                   shRNA plasmid

VALIUM10 CG1756 shRNA plasmid               shRNA plasmid


                                          s
VALIUM20 gamma-Tubulin at 37C shRNA plasmidhRNA plasmid

VALIUM10 CG17568 shRNA plasmid              shRNA plasmid

VALIUM10 scabrous shRNA plasmid             shRNA plasmid

VALIUM10 Usf shRNA plasmid                  shRNA plasmid

VALIUM10 CG17593 shRNA plasmid              shRNA plasmid

VALIUM10 scarecrow shRNA plasmid            shRNA plasmid


VALIUM20 scarecrow shRNA plasmid            shRNA plasmid


VALIUM20 RhoGAP1A shRNA plasmid             shRNA plasmid

VALIUM10 beta[nu] integrin shRNA plasmid    shRNA plasmid

VALIUM10 CG17646 shRNA plasmid              shRNA plasmid

VALIUM10 Ecdysone receptor shRNA plasmid    shRNA plasmid

VALIUM10 Enolase shRNA plasmid              shRNA plasmid

VALIUM10 CG17664 shRNA plasmid              shRNA plasmid

VALIUM1 CG17665 shRNA plasmid               shRNA plasmid

VALIUM10 CG42709 shRNA plasmid              shRNA plasmid

                                            shRNA
VALIUM10 Accessory gland peptide 70A shRNA plasmid plasmid

VALIUM1 concertina shRNA plasmid            shRNA plasmid

VALIUM10 diaphanous shRNA plasmid           shRNA plasmid
VALIUM20 diaphanous shRNA plasmid           shRNA plasmid


                                             shRNA
VALIUM22 DISCO Interacting Protein 1 shRNA plasmid plasmid


                                             shRNA
VALIUM22 DISCO Interacting Protein 1 shRNA plasmid plasmid

VALIUM1 frizzled shRNA plasmid              shRNA plasmid

VALIUM1 frizzled shRNA plasmid              shRNA plasmid

VALIUM10 HDAC4 shRNA plasmid                shRNA plasmid


VALIUM20 HDAC4 shRNA plasmid                shRNA plasmid

VALIUM10 Nipped-B shRNA plasmid             shRNA plasmid

                                           shRNA
VALIUM10 multiple edematous wings shRNA plasmid plasmid


VALIUM20 CG42574 shRNA plasmid              shRNA plasmid

VALIUM10 CG17739 shRNA plasmid              shRNA plasmid

VALIUM1 pleiohomeotic shRNA plasmid         shRNA plasmid


VALIUM22 pleiohomeotic shRNA plasmid        shRNA plasmid


VALIUM20 CG17746 shRNA plasmid              shRNA plasmid

VALIUM10 Medea shRNA plasmid                shRNA plasmid

VALIUM1 G protein α49B shRNA plasmid        shRNA plasmid


VALIUM20 G protein α49B shRNA plasmid       shRNA plasmid


VALIUM20 G protein α49B shRNA plasmid       shRNA plasmid

VALIUM10 tomosyn shRNA plasmid              shRNA plasmid

                                           shRNA plasmid
VALIUM10 Down syndrome cell adhesion molecule shRNA plasmid
VALIUM10 CG17803 shRNA plasmid               shRNA plasmid

VALIUM10 CG17806 shRNA plasmid               shRNA plasmid

                                             plasmid
VALIUM10 Ubiquitin activating enzyme 1 shRNA shRNA plasmid


VALIUM20 Xrp1 shRNA plasmid                  shRNA plasmid


VALIUM20 CG17841 shRNA plasmid               shRNA plasmid

VALIUM10 CG17843 shRNA plasmid               shRNA plasmid

VALIUM1 14-3-3ζ shRNA plasmid                shRNA plasmid

VALIUM10 14-3-3zeta shRNA plasmid            shRNA plasmid

VALIUM10 PAR-domain protein 1 shRNA plasmidshRNA plasmid

VALIUM10 cap-n-collar shRNA plasmid          shRNA plasmid


VALIUM20 cap-n-collar shRNA plasmid          shRNA plasmid

VALIUM10 Acetylcholine esterase shRNA plasmidshRNA plasmid

VALIUM10 CG17912 shRNA plasmid               shRNA plasmid

VALIUM10 CG1792 shRNA plasmid                shRNA plasmid

VALIUM10 HMG protein Z shRNA plasmid         shRNA plasmid

VALIUM10 CG17922 shRNA plasmid               shRNA plasmid

VALIUM1 Accessory gland-specific peptide 95EF shRNA plasmid

VALIUM10 Myosin heavy chain shRNA plasmid    shRNA plasmid

                                            shRNA
VALIUM10 Mediator complex subunit 26 shRNA plasmid plasmid

                                             shRNA plasmid
VALIUM1 Matrix metalloproteinase 2 shRNA plasmid

VALIUM10 dachsous shRNA plasmid              shRNA plasmid


VALIUM20 dachsous shRNA plasmid              shRNA plasmid
VALIUM10 commissureless shRNA plasmid        shRNA plasmid


VALIUM20 alpha Catenin shRNA plasmid         shRNA plasmid

                                             shRNA
VALIUM1 High mobility group protein D shRNA plasmid plasmid


VALIUM20 Z600 shRNA plasmid                  shRNA plasmid

VALIUM1 raspberry shRNA plasmid              shRNA plasmid

VALIUM1 raspberry shRNA plasmid              shRNA plasmid


VALIUM20 partner of drosha shRNA plasmid     shRNA plasmid

VALIUM10 partner of drosha shRNA plasmid     shRNA plasmid

VALIUM10 short wing shRNA plasmid            shRNA plasmid

                                            plasmid
VALIUM10 Ecdysone-induced protein 78C shRNAshRNA plasmid

                                            plasmid
VALIUM10 Ecdysone-induced protein 78C shRNAshRNA plasmid

VALIUM10 SoxNeuro shRNA plasmid              shRNA plasmid


VALIUM20 light shRNA plasmid                 shRNA plasmid

VALIUM10 KaiRIA shRNA plasmid                shRNA plasmid

VALIUM10 short stop shRNA plasmid            shRNA plasmid

VALIUM10 Drosulfakinin shRNA plasmid         shRNA plasmid


                                               plasmid
VALIUM20 Thiolester containing protein I shRNA shRNA plasmid


                                        shRNA plasmid
VALIUM20 mRNA-capping-enzyme shRNA plasmid

VALIUM10 shibire shRNA plasmid               shRNA plasmid

                                            shRNA
VALIUM10 Ecdysis triggering hormone shRNA plasmid plasmid

                                          shRNA
VALIUM10 Immune induced molecule 2 shRNA plasmid plasmid
VALIUM10 CG18110 shRNA plasmid               shRNA plasmid


VALIUM20 formin 3 shRNA plasmid              shRNA plasmid

VALIUM10 Hand shRNA plasmid                  shRNA plasmid

VALIUM10 nimrod C2 shRNA plasmid             shRNA plasmid


VALIUM20 CG17841 shRNA plasmid               shRNA plasmid


VALIUM20 Rpn11 shRNA plasmid                 shRNA plasmid

VALIUM1 deflated shRNA plasmid               shRNA plasmid

VALIUM10 deflated shRNA plasmid              shRNA plasmid


VALIUM20 CG18178 shRNA plasmid               shRNA plasmid

VALIUM10 trio shRNA plasmid                  shRNA plasmid

VALIUM10 bifocal shRNA plasmid               shRNA plasmid

VALIUM10 Toll-4 shRNA plasmid                shRNA plasmid

VALIUM10 CG18249 shRNA plasmid               shRNA plasmid


                                              shRNA plasmid
VALIUM20 Microtubule-associated protein 60 shRNA plasmid


                                              shRNA
VALIUM20 Muscle-specific protein 300 shRNA plasmid plasmid


VALIUM20 CG18259 shRNA plasmid               shRNA plasmid


VALIUM20 CG18262 shRNA plasmid               shRNA plasmid

VALIUM10 CG18265 shRNA plasmid               shRNA plasmid


VALIUM20 CG18271 shRNA plasmid               shRNA plasmid
VALIUM20 CG18271 shRNA plasmid               shRNA plasmid

VALIUM10 CG18278 shRNA plasmid               shRNA plasmid

                                          shRNA plasmid
VALIUM10 Immune induced molecule 10 shRNA plasmid


VALIUM22 dre4 shRNA plasmid                  shRNA plasmid

VALIUM10 igloo shRNA plasmid                 shRNA plasmid

VALIUM10 pickpocket 19 shRNA plasmid         shRNA plasmid

VALIUM10 DopEcR shRNA plasmid                shRNA plasmid

VALIUM10 bendless shRNA plasmid              shRNA plasmid

VALIUM10 CG1832 shRNA plasmid                shRNA plasmid

VALIUM10 CG1832 shRNA plasmid                shRNA plasmid


VALIUM20 cyclope shRNA plasmid               shRNA plasmid


                                           shRNA plasmid
VALIUM20 COP9 complex homolog subunit 3 shRNA plasmid

VALIUM10 trp-like shRNA plasmid              shRNA plasmid


VALIUM20 Sex lethal shRNA plasmid            shRNA plasmid

VALIUM1 dishevelled shRNA plasmid            shRNA plasmid

VALIUM1 dishevelled shRNA plasmid            shRNA plasmid

VALIUM10 Mlx interactor shRNA plasmid        shRNA plasmid

VALIUM1 myoglianin shRNA plasmid             shRNA plasmid

VALIUM1 myoglianin shRNA plasmid             shRNA plasmid

                                              shRNA plasmid
VALIUM1 F box and leucine-rich-repeat gene 4 shRNA plasmid


                                              shRNA plasmid
VALIUM20 Transport and Golgi organization 6 shRNA plasmid
VALIUM10 Sema-1a shRNA plasmid                shRNA plasmid

VALIUM10 CAP shRNA plasmid                    shRNA plasmid

VALIUM1 polyhomeotic proximal shRNA plasmid shRNA plasmid


                                           shRNA plasmid
VALIUM22 polyhomeotic proximal shRNA plasmid


                                           shRNA plasmid
VALIUM20 polyhomeotic proximal shRNA plasmid


VALIUM20 CG18446 shRNA plasmid                shRNA plasmid

VALIUM10 CG1845 shRNA plasmid                 shRNA plasmid

VALIUM10 Optix shRNA plasmid                  shRNA plasmid

VALIUM10 CG18476 shRNA plasmid                shRNA plasmid

VALIUM10 CG18480 shRNA plasmid                shRNA plasmid

VALIUM10 runt shRNA plasmid                   shRNA plasmid


VALIUM20 split ends shRNA plasmid             shRNA plasmid

VALIUM10 Odorant receptor 43a shRNA plasmid shRNA plasmid

VALIUM10 tramtrack shRNA plasmid              shRNA plasmid


                                               shRNA shRNA
VALIUM20 Small ribonucleoprotein particle protein SmEplasmid plasmid


VALIUM20 CG18616 shRNA plasmid                shRNA plasmid

VALIUM10 CG18619 shRNA plasmid                shRNA plasmid

VALIUM10 Ephrin shRNA plasmid                 shRNA plasmid

                                             shRNA
VALIUM10 Hormone receptor-like in 38 shRNA plasmid plasmid

                                             shRNA
VALIUM10 Hormone receptor-like in 38 shRNA plasmid plasmid

VALIUM1 Netrin-A shRNA plasmid                shRNA plasmid
VALIUM1 Netrin-A shRNA plasmid              shRNA plasmid

VALIUM10 Nckx30C shRNA plasmid              shRNA plasmid


VALIUM20 Not1 shRNA plasmid                 shRNA plasmid

VALIUM10 lin-19-like shRNA plasmid          shRNA plasmid


                                            shRNA
VALIUM20 Mediator complex subunit 20 shRNA plasmid plasmid

VALIUM10 Ku80 shRNA plasmid                 shRNA plasmid

VALIUM10 Presenilin shRNA plasmid           shRNA plasmid

VALIUM10 Not1 shRNA plasmid                 shRNA plasmid

VALIUM10 Odorant receptor 19a shRNA plasmid shRNA plasmid

VALIUM1 ATP7 shRNA plasmid                  shRNA plasmid

VALIUM1 CG1890 shRNA plasmid                shRNA plasmid

VALIUM10 saxophone shRNA plasmid            shRNA plasmid

VALIUM10 Drop shRNA plasmid                 shRNA plasmid

VALIUM10 Rab40 shRNA plasmid                shRNA plasmid


VALIUM20 maverick shRNA plasmid             shRNA plasmid

VALIUM1 alphabet shRNA plasmid              shRNA plasmid

VALIUM1 CG1908 shRNA plasmid                shRNA plasmid

VALIUM10 CG1909 shRNA plasmid               shRNA plasmid

                                           shRNA plasmid
VALIUM1 CAP-D2 condensin subunit shRNA plasmid

                                           shRNA plasmid
VALIUM1 CAP-D2 condensin subunit shRNA plasmid

                                             shRNA plasmid
VALIUM10 Guanylyl cyclase alpha-subunit at 99B shRNA plasmid

VALIUM1 α-Tubulin at 84B shRNA plasmid      shRNA plasmid

                                          shRNA plasmid
VALIUM10 Wnt oncogene analog 2 shRNA plasmid
                                          shRNA plasmid
VALIUM10 Wnt oncogene analog 2 shRNA plasmid

VALIUM1 sprouty shRNA plasmid               shRNA plasmid

VALIUM1 sprouty shRNA plasmid               shRNA plasmid

VALIUM10 onecut shRNA plasmid               shRNA plasmid


                                            shRNA
VALIUM22 Ecdysone-inducible gene E2 shRNA plasmid plasmid

VALIUM10 Roughened shRNA plasmid            shRNA plasmid

                                           shRNA plasmid
VALIUM1 ATP-dependent chromatin assembly factor large subunit shRNA plasmid


                                           shRNA plasmid
VALIUM22 ATP-dependent chromatin assembly factor large subunit shRNA plasmid

VALIUM10 CG1970 shRNA plasmid               shRNA plasmid


VALIUM20 RhoGAP100F shRNA plasmid           shRNA plasmid

VALIUM1 discs lost shRNA plasmid            shRNA plasmid

VALIUM10 Thd1 shRNA plasmid                 shRNA plasmid


                                            shRNA plasmid
VALIUM20 Sorbitol dehydrogenase 1 shRNA plasmid

VALIUM1 CG2010 shRNA plasmid                shRNA plasmid

VALIUM10 CG2016 shRNA plasmid               shRNA plasmid


VALIUM20 CG2017 shRNA plasmid               shRNA plasmid

VALIUM10 dispatched shRNA plasmid           shRNA plasmid

VALIUM10 CG2021 shRNA plasmid               shRNA plasmid


                                           shRNA plasmid
VALIUM20 Ribosomal protein S15Aa shRNA plasmid


                                           shRNA plasmid
VALIUM20 COP9 complex homolog subunit 7 shRNA plasmid

VALIUM10 hikaru genki shRNA plasmid         shRNA plasmid
                                              shRNA plasmid
VALIUM20 Larval cuticle protein 4 shRNA plasmid


VALIUM20 fushi tarazu shRNA plasmid          shRNA plasmid

VALIUM10 modulo shRNA plasmid                shRNA plasmid

VALIUM10 CG2052 shRNA plasmid                shRNA plasmid


VALIUM20 CG2064 shRNA plasmid                shRNA plasmid


VALIUM20 CG2065 shRNA plasmid                shRNA plasmid


VALIUM20 Myd88 shRNA plasmid                 shRNA plasmid

VALIUM1 castor shRNA plasmid                 shRNA plasmid

VALIUM10 castor shRNA plasmid                shRNA plasmid


                                             shRNA plasmid
VALIUM20 polypeptide GalNAc transferase 6 shRNA plasmid

VALIUM10 Rab23 shRNA plasmid                 shRNA plasmid

VALIUM10 Fmrf Receptor shRNA plasmid         shRNA plasmid

VALIUM10 CG2116 shRNA plasmid                shRNA plasmid

VALIUM1 cubitus interruptus shRNA plasmid    shRNA plasmid

VALIUM1 cubitus interruptus shRNA plasmid    shRNA plasmid

VALIUM1 cubitus interruptus shRNA plasmid    shRNA plasmid

VALIUM10 cubitus interruptus shRNA plasmid   shRNA plasmid

VALIUM1 Hdac3 shRNA plasmid                  shRNA plasmid


VALIUM20 Histone deacetylase 3 shRNA plasmidshRNA plasmid

                                              shRNA plasmid
VALIUM10 dilute class unconventional myosin shRNA plasmid
                                            shRNA plasmid
VALIUM20 Thioredoxin reductase-1 shRNA plasmid


                                              shRNA plasmid
VALIUM20 Protein-L-isoaspartate (D-aspartate) O-methyltransferase shRNA plasmid


VALIUM20 Nucleoporin 50 shRNA plasmid        shRNA plasmid


VALIUM20 Pabp2 shRNA plasmid                 shRNA plasmid

                                            shRNA
VALIUM10 Triose phosphate isomerase shRNA plasmid plasmid


VALIUM20 Rs1 shRNA plasmid                   shRNA plasmid

VALIUM1 Myosin light chain 2 shRNA plasmid   shRNA plasmid

VALIUM1 Myosin light chain 2 shRNA plasmid   shRNA plasmid


VALIUM20 CG2186 shRNA plasmid                shRNA plasmid

VALIUM10 Deformed shRNA plasmid              shRNA plasmid


VALIUM20 Amalgam shRNA plasmid               shRNA plasmid

VALIUM10 CG2199 shRNA plasmid                shRNA plasmid

VALIUM10 CG2202 shRNA plasmid                shRNA plasmid

VALIUM10 G protein oalpha 47A shRNA plasmid shRNA plasmid


VALIUM20 G protein oalpha 47A shRNA plasmid shRNA plasmid

VALIUM10 swiss cheese shRNA plasmid          shRNA plasmid


VALIUM20 lethal (1) G0289 shRNA plasmid      shRNA plasmid


VALIUM20 lethal (1) G0289 shRNA plasmid      shRNA plasmid

VALIUM10 CG2225 shRNA plasmid                shRNA plasmid
VALIUM20 MTA1-like shRNA plasmid             shRNA plasmid

VALIUM1 CG2247 shRNA plasmid                 shRNA plasmid

VALIUM10 Rac1 shRNA plasmid                  shRNA plasmid

VALIUM1 Upf2 shRNA plasmid                   shRNA plasmid

VALIUM10 Smad on X shRNA plasmid             shRNA plasmid

VALIUM1 Jun-related antigen shRNA plasmid    shRNA plasmid


                                          shRNA plasmid
VALIUM20 NADH:ubiquinone reductase 75kD subunit precursor shRNA plasmid

                                          shRNA plasmid
VALIUM10 NADH:ubiquinone reductase 75kD subunit precursor shRNA plasmid


                                          shRNA plasmid
VALIUM20 NADH:ubiquinone reductase 75kD subunit precursor shRNA plasmid

VALIUM10 Obp44a shRNA plasmid                shRNA plasmid

                                                7E shRNA plasmid
VALIUM10 nicotinic Acetylcholine Receptor alphashRNA plasmid

VALIUM10 even skipped shRNA plasmid          shRNA plasmid


VALIUM20 TER94 shRNA plasmid                 shRNA plasmid

VALIUM10 TER94 shRNA plasmid                 shRNA plasmid

VALIUM10 FMRFamide-related shRNA plasmid     shRNA plasmid

VALIUM10 pipsqueak shRNA plasmid             shRNA plasmid

VALIUM10 late bloomer shRNA plasmid          shRNA plasmid

VALIUM10 Nuclear factor I shRNA plasmid      shRNA plasmid

VALIUM10 Syt7 shRNA plasmid                  shRNA plasmid

VALIUM10 patched shRNA plasmid               shRNA plasmid


VALIUM20 CG2469 shRNA plasmid                shRNA plasmid

VALIUM1 brunelleschi shRNA plasmid           shRNA plasmid
VALIUM1 cdc23 shRNA plasmid                  shRNA plasmid

VALIUM10 like-AP180 shRNA plasmid            shRNA plasmid

VALIUM1 Female sterile (2) Ketel shRNA plasmidshRNA plasmid

                                             shRNA plasmid
VALIUM10 Female sterile (2) Ketel shRNA plasmid

VALIUM10 CG2641 shRNA plasmid                shRNA plasmid

VALIUM1 period shRNA plasmid                 shRNA plasmid

VALIUM1 period shRNA plasmid                 shRNA plasmid

                                              shRNA
VALIUM10 Helix loop helix protein 3B shRNA plasmid plasmid


                                              shRNA
VALIUM20 Helix loop helix protein 3B shRNA plasmid plasmid

VALIUM1 CG2658 shRNA plasmid                 shRNA plasmid

VALIUM1 CG2658 shRNA plasmid                 shRNA plasmid

VALIUM1 lethal (2) giant larvae shRNA plasmid shRNA plasmid

VALIUM1 lethal (2) giant larvae shRNA plasmid shRNA plasmid

VALIUM10 Minute (2) 21AB shRNA plasmid       shRNA plasmid

VALIUM10 CG2678 shRNA plasmid                shRNA plasmid

VALIUM10 goliath shRNA plasmid               shRNA plasmid

VALIUM10 d4 shRNA plasmid                    shRNA plasmid

VALIUM10 gooseberry-neuro shRNA plasmid      shRNA plasmid


VALIUM22 female sterile (1) Yb shRNA plasmid shRNA plasmid


VALIUM22 female sterile (1) Yb shRNA plasmid shRNA plasmid

VALIUM1 deformed wings shRNA plasmid         shRNA plasmid

VALIUM1 cramped shRNA plasmid                shRNA plasmid

VALIUM1 Syntaxin 4 shRNA plasmid             shRNA plasmid
VALIUM1 Syntaxin 4 shRNA plasmid           shRNA plasmid


                                           shRNA plasmid
VALIUM20 Hsp70/Hsp90 organizing protein homolog shRNA plasmid


                                           shRNA plasmid
VALIUM20 Hsp70/Hsp90 organizing protein homolog shRNA plasmid

VALIUM10 CG2747 shRNA plasmid              shRNA plasmid

VALIUM10 white shRNA plasmid               shRNA plasmid

VALIUM1 white shRNA plasmid                shRNA plasmid

VALIUM1 white shRNA plasmid                shRNA plasmid

VALIUM10 white shRNA plasmid               shRNA plasmid


VALIUM20 white shRNA plasmid               shRNA plasmid


VALIUM20 white shRNA plasmid               shRNA plasmid


VALIUM20 white shRNA plasmid               shRNA plasmid


VALIUM20 white shRNA plasmid               shRNA plasmid


VALIUM21 white shRNA plasmid               shRNA plasmid


VALIUM22 white shRNA plasmid               shRNA plasmid

VALIUM10 u-shaped shRNA plasmid            shRNA plasmid


VALIUM20 u-shaped shRNA plasmid            shRNA plasmid

VALIUM10 CG2807 shRNA plasmid              shRNA plasmid


VALIUM20 CG2807 shRNA plasmid              shRNA plasmid

                                           shRNA plasmid
VALIUM10 PvuII-PstI homology 13 shRNA plasmid
VALIUM10 Shaker cognate w shRNA plasmid      shRNA plasmid


VALIUM20 hoepel1 shRNA plasmid               shRNA plasmid

VALIUM10 G protein salpha 60A shRNA plasmid shRNA plasmid

                                              shRNA plasmid
VALIUM10 Transportin-Serine/Arginine rich shRNA plasmid

VALIUM10 Ras-related protein shRNA plasmid   shRNA plasmid


                                            shRNA plasmid
VALIUM22 TBP-associated factor 10 shRNA plasmid

                                            shRNA plasmid
VALIUM1 Poly(ADP-ribose) glycohydrolase shRNA plasmid

VALIUM10 Allatostatin Receptor shRNA plasmid shRNA plasmid

VALIUM10 CG2875 shRNA plasmid                shRNA plasmid


VALIUM20 RabX2 shRNA plasmid                 shRNA plasmid

                                             shRNA plasmid
VALIUM10 Protein phosphatase 4 regulatory subunit 2-related protein shRNA plasmid

VALIUM10 CG2893 shRNA plasmid                shRNA plasmid

VALIUM10 NMDA receptor 1 shRNA plasmid       shRNA plasmid

                                              shRNA kinase substrate shRNA plasmid
VALIUM10 Hepatocyte growth factor regulated tyrosine plasmid

                                              shRNA kinase substrate shRNA plasmid
VALIUM10 Hepatocyte growth factor regulated tyrosine plasmid


                                              shRNA kinase substrate shRNA plasmid
VALIUM20 Hepatocyte growth factor regulated tyrosine plasmid


                                              shRNA kinase substrate shRNA plasmid
VALIUM20 Hepatocyte growth factor regulated tyrosine plasmid


VALIUM20 spenito shRNA plasmid               shRNA plasmid

VALIUM10 yin shRNA plasmid                   shRNA plasmid

VALIUM1 Sep5 shRNA plasmid                   shRNA plasmid


VALIUM20 Origin recognition complex subunit 4 shRNA plasmid
VALIUM10 extra bases shRNA plasmid         shRNA plasmid


VALIUM20 noisette shRNA plasmid            shRNA plasmid


VALIUM20 CG2926 shRNA plasmid              shRNA plasmid

VALIUM10 Bteb2 shRNA plasmid               shRNA plasmid


VALIUM20 sloppy paired 2 shRNA plasmid     shRNA plasmid


VALIUM20 CG2943 shRNA plasmid              shRNA plasmid

VALIUM10 cinnamon shRNA plasmid            shRNA plasmid

VALIUM10 cinnamon shRNA plasmid            shRNA plasmid


VALIUM20 cinnamon shRNA plasmid            shRNA plasmid


VALIUM20 CG2947 shRNA plasmid              shRNA plasmid


VALIUM20 CG2947 shRNA plasmid              shRNA plasmid

VALIUM10 twist shRNA plasmid               shRNA plasmid

VALIUM10 CG2962 shRNA plasmid              shRNA plasmid

VALIUM10 innexin 7 shRNA plasmid           shRNA plasmid

VALIUM10 Troponin C at 41C shRNA plasmid   shRNA plasmid


VALIUM20 CG2982 shRNA plasmid              shRNA plasmid

VALIUM1 alpha-catenin related shRNA plasmid shRNA plasmid

VALIUM10 empty spiracles shRNA plasmid     shRNA plasmid

VALIUM1 G9a shRNA plasmid                  shRNA plasmid

VALIUM10 G9a shRNA plasmid                 shRNA plasmid
VALIUM20 G9a shRNA plasmid                    shRNA plasmid


                                           shRNA plasmid
VALIUM20 Ribosomal protein S28b shRNA plasmid

VALIUM10 unc-13 shRNA plasmid                 shRNA plasmid

VALIUM10 gemini shRNA plasmid                 shRNA plasmid

VALIUM10 CG30020 shRNA plasmid                shRNA plasmid

VALIUM1 CG30022 shRNA plasmid                 shRNA plasmid

VALIUM1 CG30022 shRNA plasmid                 shRNA plasmid

VALIUM10 CG30044 shRNA plasmid                shRNA plasmid

VALIUM10 CG30046 shRNA plasmid                shRNA plasmid

VALIUM10 CG30059 shRNA plasmid                shRNA plasmid

VALIUM10 CG30060 shRNA plasmid                shRNA plasmid


                                            shRNA
VALIUM20 Odorant-binding protein 50a shRNA plasmid plasmid

                                               protein 52 shRNA plasmid
VALIUM1 Z band alternatively spliced PDZ-motif shRNA plasmid

VALIUM10 CG30089 shRNA plasmid                shRNA plasmid

VALIUM1 CG3009 shRNA plasmid                  shRNA plasmid

VALIUM1 jitterbug shRNA plasmid               shRNA plasmid

VALIUM10 CG30106 shRNA plasmid                shRNA plasmid

VALIUM1 CG30158 shRNA plasmid                 shRNA plasmid

VALIUM10 CG30172 shRNA plasmid                shRNA plasmid

VALIUM1 lesswright shRNA plasmid              shRNA plasmid

VALIUM10 CG30203 shRNA plasmid                shRNA plasmid

                                            shRNA plasmid
VALIUM10 metabotropic GABA-B receptor subtype 3 shRNA plasmid

                                             shRNA plasmid
VALIUM1 males absent on the first shRNA plasmid
                                             shRNA plasmid
VALIUM20 males absent on the first shRNA plasmid


VALIUM20 pyd3 shRNA plasmid                  shRNA plasmid

                                             shRNA plasmid
VALIUM10 Inositol polyphosphate 1-phosphatase shRNA plasmid

VALIUM10 orange shRNA plasmid                shRNA plasmid


                                            shRNA
VALIUM20 Mediator complex subunit 22 shRNA plasmid plasmid

VALIUM10 CG30340 shRNA plasmid               shRNA plasmid


VALIUM20 CG30345 shRNA plasmid               shRNA plasmid

VALIUM10 carmine shRNA plasmid               shRNA plasmid




VALIUM20 CG30356 shRNA plasmid               shRNA plasmid


VALIUM20 CG30356 shRNA plasmid               shRNA plasmid


VALIUM20 mangetout shRNA plasmid             shRNA plasmid

VALIUM1 CG30372 shRNA plasmid                shRNA plasmid

VALIUM10 CG30379 shRNA plasmid               shRNA plasmid

VALIUM10 CG30382 shRNA plasmid               shRNA plasmid

                                            shRNA plasmid
VALIUM10 optic ganglion reduced shRNA plasmid

VALIUM10 CG30414 shRNA plasmid               shRNA plasmid

                                               shRNA plasmid
VALIUM10 Activating transcription factor-2 shRNA plasmid

VALIUM1 eggless shRNA plasmid                shRNA plasmid


VALIUM20 eggless shRNA plasmid               shRNA plasmid
VALIUM20 eggless shRNA plasmid              shRNA plasmid

VALIUM1 CG30440 shRNA plasmid               shRNA plasmid

                                            shRNA plasmid
VALIUM10 Tyrosine decarboxylase 1 shRNA plasmid

                                            shRNA plasmid
VALIUM10 Tyrosine decarboxylase 2 shRNA plasmid

VALIUM1 CG30456 shRNA plasmid               shRNA plasmid

VALIUM1 CG30466 shRNA plasmid               shRNA plasmid

VALIUM10 Prosap shRNA plasmid               shRNA plasmid


VALIUM20 CG30494 shRNA plasmid              shRNA plasmid

VALIUM10 boca shRNA plasmid                 shRNA plasmid

                                              shRNA
VALIUM10 Helix loop helix protein 4C shRNA plasmid plasmid

VALIUM10 Sox box protein 14 shRNA plasmid   shRNA plasmid

VALIUM10 halfway shRNA plasmid              shRNA plasmid

VALIUM10 hephaestus shRNA plasmid           shRNA plasmid

VALIUM10 Cad99C shRNA plasmid               shRNA plasmid

VALIUM10 Cad99C shRNA plasmid               shRNA plasmid

VALIUM1 sanpodo shRNA plasmid               shRNA plasmid


                                            shRNA plasmid
VALIUM20 prolyl-4-hydroxylase-alpha EFB shRNA plasmid


                                            shRNA plasmid
VALIUM20 prolyl-4-hydroxylase-alpha EFB shRNA plasmid

VALIUM10 CG31044 shRNA plasmid              shRNA plasmid

VALIUM10 tau shRNA plasmid                  shRNA plasmid

VALIUM10 CG31065 shRNA plasmid              shRNA plasmid

VALIUM1 LpR2 shRNA plasmid                  shRNA plasmid
VALIUM10 LpR1 shRNA plasmid                shRNA plasmid

VALIUM10 Lgr3 shRNA plasmid                shRNA plasmid

VALIUM10 CG31103 shRNA plasmid             shRNA plasmid

VALIUM10 CG31105 shRNA plasmid             shRNA plasmid

VALIUM10 CG31106 shRNA plasmid             shRNA plasmid

VALIUM10 5PtaseI shRNA plasmid             shRNA plasmid

VALIUM10 RabX4 shRNA plasmid               shRNA plasmid


VALIUM20 Histone deacetylase X shRNA plasmidshRNA plasmid

VALIUM10 Syntaxin 1A shRNA plasmid         shRNA plasmid


VALIUM20 twin shRNA plasmid                shRNA plasmid


VALIUM20 twin shRNA plasmid                shRNA plasmid

VALIUM1 erect wing shRNA plasmid           shRNA plasmid

VALIUM1 erect wing shRNA plasmid           shRNA plasmid

VALIUM10 rumi shRNA plasmid                shRNA plasmid


VALIUM20 CG31156 shRNA plasmid             shRNA plasmid


VALIUM20 CG31156 shRNA plasmid             shRNA plasmid

VALIUM1 14-3-3ε shRNA plasmid              shRNA plasmid

                                            shRNA plasmid
VALIUM10 Glutamate receptor IIE shRNA plasmid


VALIUM20 Ino80 shRNA plasmid               shRNA plasmid


VALIUM20 CG31224 shRNA plasmid             shRNA plasmid

VALIUM10 CG31235 shRNA plasmid             shRNA plasmid
VALIUM10 reversed polarity shRNA plasmid    shRNA plasmid

VALIUM10 couch potato shRNA plasmid         shRNA plasmid

VALIUM10 Brf shRNA plasmid                  shRNA plasmid

VALIUM10 Cenp-C shRNA plasmid               shRNA plasmid

VALIUM10 CG31272 shRNA plasmid              shRNA plasmid

VALIUM1 water witch shRNA plasmid           shRNA plasmid

VALIUM1 water witch shRNA plasmid           shRNA plasmid

VALIUM10 Rab-related protein 4 shRNA plasmid shRNA plasmid

VALIUM10 beat-Vb shRNA plasmid              shRNA plasmid

VALIUM10 CG31302 shRNA plasmid              shRNA plasmid


VALIUM20 Dual oxidase shRNA plasmid         shRNA plasmid


VALIUM20 Dual oxidase shRNA plasmid         shRNA plasmid

VALIUM10 CG31324 shRNA plasmid              shRNA plasmid


                                            shRNA plasmid
VALIUM20 GST-containing FLYWCH zinc-finger protein shRNA plasmid


VALIUM20 Hsp70Bbb shRNA plasmid             shRNA plasmid


VALIUM20 Hsp70Bbb shRNA plasmid             shRNA plasmid


                                           shRNA plasmid
VALIUM20 Heat-shock-protein-70Bb shRNA plasmid


                                           shRNA plasmid
VALIUM20 Heat-shock-protein-70Bb shRNA plasmid

VALIUM10 Atf6 shRNA plasmid                 shRNA plasmid

VALIUM1 sarcomere length short shRNA plasmidshRNA plasmid

VALIUM1 sarcomere length short shRNA plasmidshRNA plasmid
VALIUM1 synaptotagmin shRNA plasmid        shRNA plasmid

VALIUM1 synaptotagmin shRNA plasmid        shRNA plasmid


VALIUM20 ligatin shRNA plasmid             shRNA plasmid

                                            shRNA
VALIUM10 forkhead box, sub-group O shRNA plasmid plasmid

                                            shRNA
VALIUM10 forkhead box, sub-group O shRNA plasmid plasmid


                                            shRNA
VALIUM20 forkhead box, sub-group O shRNA plasmid plasmid


                                            shRNA
VALIUM20 forkhead box, sub-group O shRNA plasmid plasmid


VALIUM20 pch2 shRNA plasmid                shRNA plasmid

VALIUM10 CG31460 shRNA plasmid             shRNA plasmid

VALIUM10 CG31469 shRNA plasmid             shRNA plasmid

VALIUM10 proboscipedia shRNA plasmid       shRNA plasmid

VALIUM10 RNA-binding protein 9 shRNA plasmidshRNA plasmid

VALIUM1 Cdep shRNA plasmid                 shRNA plasmid


VALIUM20 canoe shRNA plasmid               shRNA plasmid

VALIUM1 γ-Tubulin at 23C shRNA plasmid     shRNA plasmid

VALIUM1 spindle E shRNA plasmid            shRNA plasmid


VALIUM20 spindle E shRNA plasmid           shRNA plasmid


VALIUM22 spindle E shRNA plasmid           shRNA plasmid


VALIUM22 His2A:CG31618 shRNA plasmid       shRNA plasmid

VALIUM10 CG3162 shRNA plasmid              shRNA plasmid
                                              shRNA
VALIUM10 defective transmitter release shRNA plasmid plasmid

VALIUM10 senseless-2 shRNA plasmid           shRNA plasmid

VALIUM10 CG31646 shRNA plasmid               shRNA plasmid

VALIUM10 anterior open shRNA plasmid         shRNA plasmid

VALIUM10 CG31665 shRNA plasmid               shRNA plasmid

                                             shRNA shRNA
VALIUM10 Chronologically inappropriate morphogenesisplasmid plasmid

                                             shRNA plasmid
VALIUM1 Chronologically inappropriate morphogenesis shRNA plasmid


                                             shRNA shRNA
VALIUM20 Chronologically inappropriate morphogenesisplasmid plasmid

VALIUM10 CG31670 shRNA plasmid               shRNA plasmid

VALIUM10 tho2 shRNA plasmid                  shRNA plasmid

VALIUM10 CG3168 shRNA plasmid                shRNA plasmid


VALIUM22 Spt3 shRNA plasmid                  shRNA plasmid

VALIUM1 CG31705 shRNA plasmid                shRNA plasmid

                                           s
VALIUM10 trapped in endoderm-1 shRNA plasmidhRNA plasmid


                                           s
VALIUM20 trapped in endoderm-1 shRNA plasmidhRNA plasmid


                                           s
VALIUM20 trapped in endoderm-1 shRNA plasmidhRNA plasmid


VALIUM20 CG31714 shRNA plasmid               shRNA plasmid

VALIUM10 CG31716 shRNA plasmid               shRNA plasmid

VALIUM10 CG31720 shRNA plasmid               shRNA plasmid

VALIUM10 hamlet shRNA plasmid                shRNA plasmid


VALIUM20 hamlet shRNA plasmid                shRNA plasmid
VALIUM20 CG31792 shRNA plasmid               shRNA plasmid

VALIUM10 Paxillin shRNA plasmid              shRNA plasmid


VALIUM20 ia2 shRNA plasmid                   shRNA plasmid

VALIUM10 CG31809 shRNA plasmid               shRNA plasmid

VALIUM1 centaurin gamma 1A shRNA plasmid     shRNA plasmid

VALIUM1 CG31814 shRNA plasmid                shRNA plasmid

VALIUM1 seizure shRNA plasmid                shRNA plasmid

VALIUM1 seizure shRNA plasmid                shRNA plasmid

VALIUM1 Sirt4 shRNA plasmid                  shRNA plasmid


VALIUM20 Sirt4 shRNA plasmid                 shRNA plasmid

VALIUM10 crooked neck shRNA plasmid          shRNA plasmid

VALIUM10 CG31955 shRNA plasmid               shRNA plasmid

VALIUM1 CG31958 shRNA plasmid                shRNA plasmid


VALIUM20 gawky shRNA plasmid                 shRNA plasmid

VALIUM1 CG31999 shRNA plasmid                shRNA plasmid

VALIUM1 CG31999 shRNA plasmid                shRNA plasmid

VALIUM10 CG32000 shRNA plasmid               shRNA plasmid

VALIUM10 Zyx102EF shRNA plasmid              shRNA plasmid


VALIUM20 CG32021 shRNA plasmid               shRNA plasmid

VALIUM1 Fhos shRNA plasmid                   shRNA plasmid

                                              shRNA
VALIUM10 Ras-associated protein 2-like shRNA plasmid plasmid

VALIUM10 dpr10 shRNA plasmid                 shRNA plasmid
VALIUM10 Odorant receptor 2a shRNA plasmid shRNA plasmid

VALIUM10 CG32062 shRNA plasmid             shRNA plasmid


VALIUM20 CG32062 shRNA plasmid             shRNA plasmid

VALIUM1 RhoGAP5A shRNA plasmid             shRNA plasmid

VALIUM1 CG32085 shRNA plasmid              shRNA plasmid

                                            shRNA
VALIUM10 Dynamin related protein 1 shRNA plasmid plasmid

VALIUM10 CG32105 shRNA plasmid             shRNA plasmid


VALIUM20 CG32109 shRNA plasmid             shRNA plasmid

VALIUM10 senseless shRNA plasmid           shRNA plasmid

VALIUM1 ptip shRNA plasmid                 shRNA plasmid


VALIUM22 ptip shRNA plasmid                shRNA plasmid


VALIUM20 CG32138 shRNA plasmid             shRNA plasmid


                                            s
VALIUM20 Myosin binding subunit shRNA plasmidhRNA plasmid

VALIUM10 CG32164 shRNA plasmid             shRNA plasmid

VALIUM10 Limpet shRNA plasmid              shRNA plasmid


VALIUM20 noe shRNA plasmid                 shRNA plasmid


                                            shRNA plasmid
VALIUM20 female sterile (1) K10 shRNA plasmid


                                            shRNA plasmid
VALIUM20 female sterile (1) K10 shRNA plasmid

                                           shRNA plasmid
VALIUM10 Ecdysone-induced protein 74EF shRNA plasmid

VALIUM1 Ccn shRNA plasmid                  shRNA plasmid
VALIUM10 CG32204 shRNA plasmid                shRNA plasmid


VALIUM22 Su(Tpl) shRNA plasmid                shRNA plasmid


VALIUM20 Su(Tpl) shRNA plasmid                shRNA plasmid

VALIUM1 CG32221 shRNA plasmid                 shRNA plasmid

                                             shRNA plasmid
VALIUM1 Guanine nucleotide exchange factor GEF64C shRNA plasmid


VALIUM20 CG32251 shRNA plasmid                shRNA plasmid


VALIUM20 CG3226 shRNA plasmid                 shRNA plasmid


VALIUM20 CG3226 shRNA plasmid                 shRNA plasmid

VALIUM10 CG32264 shRNA plasmid                shRNA plasmid

                                                shRNA plasmid
VALIUM10 Myocardin-related transcription factorshRNA plasmid


VALIUM20 zormin shRNA plasmid                 shRNA plasmid

VALIUM10 discs lost shRNA plasmid             shRNA plasmid

VALIUM10 timeless shRNA plasmid               shRNA plasmid

VALIUM1 CG32343 shRNA plasmid                 shRNA plasmid

VALIUM1 CG32343 shRNA plasmid                 shRNA plasmid

VALIUM1 Enhancer of bithorax shRNA plasmid    shRNA plasmid


VALIUM22 Enhancer of bithorax shRNA plasmid shRNA plasmid

VALIUM10 CG32372 shRNA plasmid                shRNA plasmid

VALIUM10 unc-13-4A shRNA plasmid              shRNA plasmid


VALIUM20 CG3239 shRNA plasmid                 shRNA plasmid
VALIUM20 dikar shRNA plasmid                shRNA plasmid

VALIUM10 Odorant receptor 65a shRNA plasmid shRNA plasmid

VALIUM10 Odorant receptor 65b shRNA plasmid shRNA plasmid

VALIUM10 Odorant receptor 65c shRNA plasmid shRNA plasmid

VALIUM1 male-specific lethal 2 shRNA plasmid shRNA plasmid


VALIUM20 sis of bowl & odd shRNA plasmid    shRNA plasmid


VALIUM20 alan shepard shRNA plasmid         shRNA plasmid

VALIUM10 CG32432 shRNA plasmid              shRNA plasmid

VALIUM1 Polycomb shRNA plasmid              shRNA plasmid


VALIUM20 Polycomb shRNA plasmid             shRNA plasmid


VALIUM20 Polycomb shRNA plasmid             shRNA plasmid

                                            shRNA plasmid
VALIUM10 Secretory Pathway Calcium atpase shRNA plasmid

VALIUM10 dysfusion shRNA plasmid            shRNA plasmid


VALIUM20 modifier of mdg4 shRNA plasmid     shRNA plasmid


VALIUM20 modifier of mdg4 shRNA plasmid     shRNA plasmid

VALIUM10 dunce shRNA plasmid                shRNA plasmid

                                           shRNA plasmid
VALIUM10 Protein phosphatase 19C shRNA plasmid

VALIUM10 CG32506 shRNA plasmid              shRNA plasmid


VALIUM20 CG3253 shRNA plasmid               shRNA plasmid

VALIUM10 CG32532 shRNA plasmid              shRNA plasmid
VALIUM10 giant fibre A shRNA plasmid        shRNA plasmid

                                            shRNA
VALIUM10 CCK-like receptor at 17D3 shRNA plasmid plasmid

VALIUM10 CG32547 shRNA plasmid              shRNA plasmid

VALIUM1 RhoGAPp190 shRNA plasmid            shRNA plasmid

VALIUM10 CG3257 shRNA plasmid               shRNA plasmid

VALIUM10 asense shRNA plasmid               shRNA plasmid

VALIUM10 highwire shRNA plasmid             shRNA plasmid

VALIUM10 dpr8 shRNA plasmid                 shRNA plasmid

VALIUM10 CG32626 shRNA plasmid              shRNA plasmid


                                            shRNA plasmid
VALIUM20 Drosophila Nna1 ortholog shRNA plasmid

VALIUM10 Eb1 shRNA plasmid                  shRNA plasmid

VALIUM10 Tenascin accessory shRNA plasmid   shRNA plasmid

                                            shRNA
VALIUM10 Autophagy-specific gene 8a shRNA plasmid plasmid

VALIUM10 Hyperkinetic shRNA plasmid         shRNA plasmid

VALIUM10 Rab-protein 2 shRNA plasmid        shRNA plasmid


VALIUM20 lethal (1) G0232 shRNA plasmid     shRNA plasmid

VALIUM1 CG3270 shRNA plasmid                shRNA plasmid

VALIUM1 CG3270 shRNA plasmid                shRNA plasmid

VALIUM10 CG32702 shRNA plasmid              shRNA plasmid

VALIUM10 Ionotropic receptor 8a shRNA plasmidshRNA plasmid


VALIUM20 stardust shRNA plasmid             shRNA plasmid


VALIUM20 stardust shRNA plasmid             shRNA plasmid
                                            shRNA plasmid
VALIUM10 Brahma associated protein 170kD shRNA plasmid

VALIUM10 CG32770 shRNA plasmid               shRNA plasmid


VALIUM20 GlcAT-I shRNA plasmid               shRNA plasmid

VALIUM10 CG32778 shRNA plasmid               shRNA plasmid

VALIUM10 CG32792 shRNA plasmid               shRNA plasmid

VALIUM10 CG32809 shRNA plasmid               shRNA plasmid

VALIUM10 CG32810 shRNA plasmid               shRNA plasmid

VALIUM10 CG32843 shRNA plasmid               shRNA plasmid

VALIUM10 VAChT shRNA plasmid                 shRNA plasmid

VALIUM1 CG32850 shRNA plasmid                shRNA plasmid

VALIUM10 CG3294 shRNA plasmid                shRNA plasmid

                                               shRNA plasmid
VALIUM10 nicotinic Acetylcholine Receptor α 34E shRNA plasmid

VALIUM10 Vinculin shRNA plasmid              shRNA plasmid

VALIUM10 CG33017 shRNA plasmid               shRNA plasmid

VALIUM10 Corazonin shRNA plasmid             shRNA plasmid


VALIUM22 pr-set7 shRNA plasmid               shRNA plasmid

VALIUM1 CG33087 shRNA plasmid                shRNA plasmid

VALIUM10 Syndapin shRNA plasmid              shRNA plasmid


VALIUM20 CG33095 shRNA plasmid               shRNA plasmid


VALIUM20 CG42724 shRNA plasmid               shRNA plasmid

                                              plasmid
VALIUM10 NEM-sensitive fusion protein 2 shRNAshRNA plasmid

                                              shRNA plasmid
VALIUM1 multiple ankyrin repeats single KH domain shRNA plasmid
                                              shRNA plasmid
VALIUM20 multiple ankyrin repeats single KH domain shRNA plasmid


VALIUM20 CG33129 shRNA plasmid                shRNA plasmid

VALIUM1 SCAP shRNA plasmid                    shRNA plasmid

                                            shRNA plasmid
VALIUM10 death executioner Bcl-2 homologue shRNA plasmid

                                          shRNA plasmid
VALIUM10 KCNQ potassium channel shRNA plasmid

VALIUM10 CG33143 shRNA plasmid                shRNA plasmid

                                              shRNA plasmid
VALIUM10 Heparan sulfate 3-O sulfotransferase-A shRNA plasmid

                                             shRNA plasmid
VALIUM10 Muscle LIM protein at 60A shRNA plasmid

                                            s
VALIUM10 Gustatory receptor 59e shRNA plasmidhRNA plasmid

VALIUM10 homeobrain shRNA plasmid             shRNA plasmid

VALIUM10 CG33159 shRNA plasmid                shRNA plasmid


                                                shRNA plasmid
VALIUM20 Signal recognition particle receptor beta shRNA plasmid

VALIUM10 multiplexin shRNA plasmid            shRNA plasmid

                                            plasmid
VALIUM10 Dopamine N acetyltransferase shRNA shRNA plasmid

                                             shRNA
VALIUM10 Hormone receptor-like in 46 shRNA plasmid plasmid

                                             shRNA
VALIUM10 Hormone receptor-like in 46 shRNA plasmid plasmid

VALIUM10 salvador shRNA plasmid               shRNA plasmid


VALIUM20 salvador / shar-pei shRNA plasmid    shRNA plasmid

VALIUM10 muscleblind shRNA plasmid            shRNA plasmid

VALIUM10 presenilin enhancer shRNA plasmid    shRNA plasmid

VALIUM10 Rab-protein 1 shRNA plasmid          shRNA plasmid

VALIUM1 CG33205 shRNA plasmid                 shRNA plasmid
                                             shRNA
VALIUM1 Molecule interacting with CasL shRNA plasmidplasmid

VALIUM10 CG33213 shRNA plasmid                 shRNA plasmid

VALIUM1 CG33232 shRNA plasmid                  shRNA plasmid


VALIUM20 CG33253 shRNA plasmid                 shRNA plasmid

VALIUM10 Early gene at 23 shRNA plasmid        shRNA plasmid

VALIUM1 insulin-like peptide 5 shRNA plasmid   shRNA plasmid


VALIUM20 insulin-like peptide 5 shRNA plasmid shRNA plasmid

VALIUM1 CG33275 shRNA plasmid                  shRNA plasmid

VALIUM10 CG33289 shRNA plasmid                 shRNA plasmid

VALIUM10 ebony shRNA plasmid                   shRNA plasmid

VALIUM1 CG3332 shRNA plasmid                   shRNA plasmid

VALIUM10 CheB38a shRNA plasmid                 shRNA plasmid

VALIUM10 CheB38b shRNA plasmid                 shRNA plasmid

VALIUM10 48 related 1 shRNA plasmid            shRNA plasmid

VALIUM10 p53 shRNA plasmid                     shRNA plasmid

                                              shRNA plasmid
VALIUM1 Cardioacceleratory peptide receptor shRNA plasmid


                                           shRNA
VALIUM20 Chemosensory protein B 42a shRNA plasmid plasmid

VALIUM10 pickpocket 25 shRNA plasmid           shRNA plasmid

VALIUM10 CheB42c shRNA plasmid                 shRNA plasmid

VALIUM10 CheB42b shRNA plasmid                 shRNA plasmid

VALIUM10 Kruppel shRNA plasmid                 shRNA plasmid


VALIUM20 Kruppel shRNA plasmid                 shRNA plasmid
VALIUM10 CG33470 shRNA plasmid                shRNA plasmid

VALIUM10 luna shRNA plasmid                   shRNA plasmid


VALIUM20 dpr9 shRNA plasmid                   shRNA plasmid

VALIUM10 bigmax shRNA plasmid                 shRNA plasmid

VALIUM10 pickpocket 13 shRNA plasmid          shRNA plasmid

VALIUM10 NMDA receptor 2 shRNA plasmid        shRNA plasmid

                                            shRNA plasmid
VALIUM10 Dopamine 2-like receptor shRNA plasmid

VALIUM10 fat shRNA plasmid                    shRNA plasmid


VALIUM20 fat shRNA plasmid                    shRNA plasmid

VALIUM10 CG33523 shRNA plasmid                shRNA plasmid

VALIUM10 PNUTS shRNA plasmid                  shRNA plasmid

VALIUM10 IFamide shRNA plasmid                shRNA plasmid

                                            shRNA plasmid
VALIUM1 Vesicular monoamine transporter shRNA plasmid

VALIUM10 CG3353 shRNA plasmid                 shRNA plasmid


                                              shRNA
VALIUM20 Male-specific transcript 77F shRNA plasmid plasmid

VALIUM10 unpaired 3 shRNA plasmid             shRNA plasmid


VALIUM20 unpaired 3 shRNA plasmid             shRNA plasmid

VALIUM10 Rim shRNA plasmid                    shRNA plasmid

VALIUM1 CG3356 shRNA plasmid                  shRNA plasmid

VALIUM10 CG33639 shRNA plasmid                shRNA plasmid

                                               shRNA plasmid
VALIUM10 Calcium activated protein for secretion shRNA plasmid

VALIUM10 CG33673 shRNA plasmid                shRNA plasmid
VALIUM10 Like Sm protein 4 shRNA plasmid     shRNA plasmid

VALIUM10 CG17768 shRNA plasmid               shRNA plasmid

VALIUM10 CG33696 shRNA plasmid               shRNA plasmid

VALIUM10 CG3371 shRNA plasmid                shRNA plasmid


                                              shRNA
VALIUM20 Muscle-specific protein 300 shRNA plasmid plasmid


                                           shRNA plasmid
VALIUM20 Histone H4 replacement shRNA plasmid

VALIUM1 CG33796 shRNA plasmid                shRNA plasmid

VALIUM10 nervy shRNA plasmid                 shRNA plasmid


VALIUM22 His1:CG33864 shRNA plasmid          shRNA plasmid


VALIUM22 His3:CG33866 shRNA plasmid          shRNA plasmid

VALIUM10 gooseberry shRNA plasmid            shRNA plasmid

VALIUM10 Cad88C shRNA plasmid                shRNA plasmid

VALIUM1 CG33936 shRNA plasmid                shRNA plasmid


VALIUM20 Ribosomal protein S9 shRNA plasmid shRNA plasmid

                                               shRNA
VALIUM10 terribly reduced optic lobes shRNA plasmid plasmid

VALIUM1 eyes shut shRNA plasmid              shRNA plasmid

VALIUM1 eyes shut shRNA plasmid              shRNA plasmid

VALIUM1 kayak shRNA plasmid                  shRNA plasmid

VALIUM1 kayak shRNA plasmid                  shRNA plasmid

VALIUM10 kayak shRNA plasmid                 shRNA plasmid


VALIUM20 kayak shRNA plasmid                 shRNA plasmid
VALIUM10 CG33958 shRNA plasmid             shRNA plasmid

VALIUM10 CG33960 shRNA plasmid             shRNA plasmid

VALIUM1 CG33967 shRNA plasmid              shRNA plasmid

VALIUM10 CG3397 shRNA plasmid              shRNA plasmid

VALIUM10 Vsx2 shRNA plasmid                shRNA plasmid

VALIUM1 nuclear fallout shRNA plasmid      shRNA plasmid

VALIUM1 nuclear fallout shRNA plasmid      shRNA plasmid

VALIUM10 nuclear fallout shRNA plasmid     shRNA plasmid

VALIUM10 pickpocket 10 shRNA plasmid       shRNA plasmid

VALIUM10 pickpocket 11 shRNA plasmid       shRNA plasmid

VALIUM10 pickpocket 16 shRNA plasmid       shRNA plasmid

VALIUM10 molting defective shRNA plasmid   shRNA plasmid

VALIUM1 CG34104 shRNA plasmid              shRNA plasmid


VALIUM20 CG34104 shRNA plasmid             shRNA plasmid

VALIUM10 blistered shRNA plasmid           shRNA plasmid

VALIUM1 supernumerary limbs shRNA plasmid shRNA plasmid


VALIUM20 supernumerary limbs shRNA plasmid shRNA plasmid


VALIUM20 supernumerary limbs shRNA plasmid shRNA plasmid


VALIUM20 CG34120 shRNA plasmid             shRNA plasmid

VALIUM10 windpipe shRNA plasmid            shRNA plasmid


VALIUM20 RunxA shRNA plasmid               shRNA plasmid

VALIUM1 Dystrophin shRNA plasmid           shRNA plasmid
VALIUM1 Mov34 shRNA plasmid                shRNA plasmid


VALIUM20 CG34207 shRNA plasmid             shRNA plasmid


VALIUM20 CG34207 shRNA plasmid             shRNA plasmid

VALIUM1 RhoGAP93B shRNA plasmid            shRNA plasmid


VALIUM20 Stromalin shRNA plasmid           shRNA plasmid

VALIUM10 CG34207 shRNA plasmid             shRNA plasmid


VALIUM20 CG34354 shRNA plasmid             shRNA plasmid

VALIUM10 shaking B shRNA plasmid           shRNA plasmid

VALIUM10 shaking B shRNA plasmid           shRNA plasmid

VALIUM10 Shaw-like shRNA plasmid           shRNA plasmid

VALIUM10 Fish-lips shRNA plasmid           shRNA plasmid

VALIUM10 CG34369 shRNA plasmid             shRNA plasmid

VALIUM10 CG34370 shRNA plasmid             shRNA plasmid

VALIUM1 Ect4 shRNA plasmid                 shRNA plasmid

VALIUM1 Rapgap1 shRNA plasmid              shRNA plasmid

VALIUM10 dpr12 shRNA plasmid               shRNA plasmid

VALIUM10 Epac shRNA plasmid                shRNA plasmid

VALIUM10 CG34396 shRNA plasmid             shRNA plasmid

VALIUM10 CG34402 shRNA plasmid             shRNA plasmid

VALIUM10 pangolin shRNA plasmid            shRNA plasmid

                                            s
VALIUM10 Na channel protein 60E shRNA plasmidhRNA plasmid

VALIUM1 Not1 shRNA plasmid                 shRNA plasmid
                                             plasmid
VALIUM10 Neuropeptide-like precursor 1 shRNA shRNA plasmid

VALIUM1 Rab26 shRNA plasmid                 shRNA plasmid

VALIUM10 CG34411 shRNA plasmid              shRNA plasmid

VALIUM10 Ank2 shRNA plasmid                 shRNA plasmid


VALIUM20 Ank2 shRNA plasmid                 shRNA plasmid

VALIUM10 still life shRNA plasmid           shRNA plasmid

VALIUM10 Sno oncogene shRNA plasmid         shRNA plasmid

VALIUM1 CG34422 shRNA plasmid               shRNA plasmid

VALIUM10 pecanex shRNA plasmid              shRNA plasmid

                                            shRNA plasmid
VALIUM10 Histidine decarboxylase shRNA plasmid


VALIUM20 Rpt4 shRNA plasmid                 shRNA plasmid

VALIUM1 Topoisomerase 3β shRNA plasmid      shRNA plasmid

VALIUM1 Topoisomerase 3β shRNA plasmid      shRNA plasmid

VALIUM10 pickpocket shRNA plasmid           shRNA plasmid


                                             shRNA
VALIUM20 Myb-interacting protein 130 shRNA plasmid plasmid

                                           s
VALIUM10 Alcohol dehydrogenase shRNA plasmidhRNA plasmid

VALIUM10 CG3494 shRNA plasmid               shRNA plasmid

VALIUM10 CG3494 shRNA plasmid               shRNA plasmid

VALIUM10 Suppressor of Hairless shRNA plasmidshRNA plasmid

VALIUM10 vasa shRNA plasmid                 shRNA plasmid


VALIUM20 vasa shRNA plasmid                 shRNA plasmid


VALIUM20 vasa shRNA plasmid                 shRNA plasmid
VALIUM20 CG3508 shRNA plasmid                shRNA plasmid


VALIUM20 CG3509 shRNA plasmid                shRNA plasmid


VALIUM20 Cyclin B shRNA plasmid              shRNA plasmid

VALIUM10 CG3523 shRNA plasmid                shRNA plasmid

VALIUM10 CG3530 shRNA plasmid                shRNA plasmid

VALIUM10 unzipped shRNA plasmid              shRNA plasmid


VALIUM20 CG3542 shRNA plasmid                shRNA plasmid


                                             shRNA plasmid
VALIUM20 visceral mesodermal armadillo-repeats shRNA plasmid

                                            shRNA
VALIUM10 Longevity assurance gene 1 shRNA plasmid plasmid

VALIUM10 bifid shRNA plasmid                 shRNA plasmid

                                                factor plasmid
VALIUM10 U2 small nuclear riboprotein auxiliaryshRNA 38 shRNA plasmid

VALIUM1 spaghetti squash shRNA plasmid       shRNA plasmid


VALIUM20 spaghetti squash shRNA plasmid      shRNA plasmid


VALIUM20 spaghetti squash shRNA plasmid      shRNA plasmid


VALIUM20 CG3605 shRNA plasmid                shRNA plasmid


VALIUM20 cabeza shRNA plasmid                shRNA plasmid


VALIUM20 cabeza shRNA plasmid                shRNA plasmid

VALIUM10 bellwether shRNA plasmid            shRNA plasmid

                                            shRNA
VALIUM10 Autophagy-specific gene 9 shRNA plasmid plasmid
VALIUM10 CG3618 shRNA plasmid                shRNA plasmid

VALIUM10 Delta shRNA plasmid                 shRNA plasmid

VALIUM1 no receptor potential A shRNA plasmid shRNA plasmid

VALIUM1 no receptor potential A shRNA plasmid shRNA plasmid

VALIUM10 Distal-less shRNA plasmid           shRNA plasmid


VALIUM20 Cortactin shRNA plasmid             shRNA plasmid


VALIUM20 bicaudal shRNA plasmid              shRNA plasmid

VALIUM10 CG3654 shRNA plasmid                shRNA plasmid


VALIUM20 Jarid2 shRNA plasmid                shRNA plasmid

VALIUM10 Rab-protein 5 shRNA plasmid         shRNA plasmid


VALIUM20 Rab-protein 5 shRNA plasmid         shRNA plasmid

VALIUM10 Fasciclin 2 shRNA plasmid           shRNA plasmid


VALIUM20 Fasciclin 2 shRNA plasmid           shRNA plasmid

VALIUM10 forkhead domain 59A shRNA plasmid shRNA plasmid


VALIUM20 CG3689 shRNA plasmid                shRNA plasmid

VALIUM10 CG3690 shRNA plasmid                shRNA plasmid

VALIUM10 G protein γ30A shRNA plasmid        shRNA plasmid

VALIUM10 CG3703 shRNA plasmid                shRNA plasmid

VALIUM10 astray shRNA plasmid                shRNA plasmid


                                              shRNA plasmid
VALIUM20 RNA polymerase II elongation factor shRNA plasmid
VALIUM20 CG3814 shRNA plasmid                shRNA plasmid

VALIUM10 shotgun shRNA plasmid               shRNA plasmid


VALIUM20 shotgun shRNA plasmid               shRNA plasmid


VALIUM20 shotgun shRNA plasmid               shRNA plasmid

                                           s
VALIUM10 Calcium ATPase at 60A shRNA plasmidhRNA plasmid

VALIUM10 dreadlocks shRNA plasmid            shRNA plasmid


                                           protein 1 shRNA
VALIUM22 Chromodomain-helicase-DNA-bindingshRNA plasmid plasmid

VALIUM1 okra shRNA plasmid                   shRNA plasmid

VALIUM1 okra shRNA plasmid                   shRNA plasmid


VALIUM20 okra shRNA plasmid                  shRNA plasmid


                                            shRNA plasmid
VALIUM20 Metal response element-binding Transcription Factor-1 shRNA plasmid


                                            shRNA plasmid
VALIUM20 Metal response element-binding Transcription Factor-1 shRNA plasmid


VALIUM20 Marcal1 shRNA plasmid               shRNA plasmid

VALIUM10 escargot shRNA plasmid              shRNA plasmid


VALIUM20 escargot shRNA plasmid              shRNA plasmid


VALIUM20 Phosphodiesterase 9 shRNA plasmid shRNA plasmid


VALIUM20 Vha68-2 shRNA plasmid               shRNA plasmid

VALIUM10 cryptochrome shRNA plasmid          shRNA plasmid

VALIUM1 numb shRNA plasmid                   shRNA plasmid
VALIUM10 achaete shRNA plasmid              shRNA plasmid

                                            shRNA plasmid
VALIUM10 N-methyl-D-aspartate receptor-associated protein shRNA plasmid

VALIUM1 CG3803 shRNA plasmid                shRNA plasmid

VALIUM1 CG3803 shRNA plasmid                shRNA plasmid

VALIUM10 CG3814 shRNA plasmid               shRNA plasmid


VALIUM20 CG3814 shRNA plasmid               shRNA plasmid


VALIUM20 Nup214 shRNA plasmid               shRNA plasmid

VALIUM10 CG3822 shRNA plasmid               shRNA plasmid


VALIUM20 CG3825 shRNA plasmid               shRNA plasmid

VALIUM10 scute shRNA plasmid                shRNA plasmid

VALIUM10 vestigial shRNA plasmid            shRNA plasmid

VALIUM10 CG3838 shRNA plasmid               shRNA plasmid

VALIUM10 lethal of scute shRNA plasmid      shRNA plasmid

VALIUM10 NAT1 shRNA plasmid                 shRNA plasmid


VALIUM20 NAT1 shRNA plasmid                 shRNA plasmid

VALIUM10 trithorax-related shRNA plasmid    shRNA plasmid


VALIUM20 trithorax-related shRNA plasmid    shRNA plasmid

VALIUM10 Lasp shRNA plasmid                 shRNA plasmid

VALIUM10 sugarbabe shRNA plasmid            shRNA plasmid

VALIUM10 odd skipped shRNA plasmid          shRNA plasmid

                                           shRNA plasmid
VALIUM1 Octopamine receptor in mushroom bodies shRNA plasmid

                                           shRNA plasmid
VALIUM1 Octopamine receptor in mushroom bodies shRNA plasmid
VALIUM10 gcm2 shRNA plasmid                  shRNA plasmid


VALIUM20 gcm2 shRNA plasmid                  shRNA plasmid


VALIUM20 thioredoxin-2 shRNA plasmid         shRNA plasmid


VALIUM20 thioredoxin-2 shRNA plasmid         shRNA plasmid

                                              shRNA plasmid
VALIUM1 Mitochondrial assembly regulatory factor shRNA plasmid

VALIUM10 chrowded shRNA plasmid              shRNA plasmid

VALIUM10 Six4 shRNA plasmid                  shRNA plasmid


                                             shRNA plasmid
VALIUM20 Multi drug resistance 49 shRNA plasmid

VALIUM1 Posterior sex combs shRNA plasmid    shRNA plasmid


VALIUM22 Posterior sex combs shRNA plasmid shRNA plasmid

                                           shRNA plasmid
VALIUM10 COP9 complex homolog subunit 1 b shRNA plasmid

VALIUM10 CG3891 shRNA plasmid                shRNA plasmid

VALIUM1 polyhomeotic distal shRNA plasmid    shRNA plasmid


VALIUM20 NADPH oxidase shRNA plasmid         shRNA plasmid


VALIUM20 NADPH oxidase shRNA plasmid         shRNA plasmid

VALIUM10 Gliotactin shRNA plasmid            shRNA plasmid

VALIUM1 Suppressor of zeste 2 shRNA plasmid shRNA plasmid


VALIUM20 Suppressor of zeste 2 shRNA plasmid shRNA plasmid

                                               shRNA plasmid
VALIUM10 mitochondrial transcription factor B2 shRNA plasmid


                                            shRNA plasmid
VALIUM20 gamma-tubulin ring protein 84 shRNA plasmid
VALIUM20 CG3919 shRNA plasmid       shRNA plasmid


VALIUM20 Exportin 6 shRNA plasmid   shRNA plasmid

VALIUM1 Chip shRNA plasmid          shRNA plasmid

VALIUM10 deltex shRNA plasmid       shRNA plasmid

VALIUM10 aristaless shRNA plasmid   shRNA plasmid

VALIUM1 Notch shRNA plasmid         shRNA plasmid

VALIUM1 Notch shRNA plasmid         shRNA plasmid

VALIUM1 Notch shRNA plasmid         shRNA plasmid

VALIUM1 Notch shRNA plasmid         shRNA plasmid

VALIUM10 Notch shRNA plasmid        shRNA plasmid

VALIUM10 Notch shRNA plasmid        shRNA plasmid


VALIUM20 Notch shRNA plasmid        shRNA plasmid


VALIUM20 Notch shRNA plasmid        shRNA plasmid


VALIUM21 Notch shRNA plasmid        shRNA plasmid


VALIUM20 Notch shRNA plasmid        shRNA plasmid


VALIUM22 Notch shRNA plasmid        shRNA plasmid

VALIUM10 cheerio shRNA plasmid      shRNA plasmid

VALIUM10 Cyclin E shRNA plasmid     shRNA plasmid


VALIUM20 Cyclin E shRNA plasmid     shRNA plasmid

VALIUM10 CG3940 shRNA plasmid       shRNA plasmid
                                          shRNA plasmid
VALIUM10 NADH:ubiquinone reductase 23kD subunit precursor shRNA plasmid

VALIUM10 zetaCOP shRNA plasmid             shRNA plasmid

VALIUM1 corkscrew shRNA plasmid            shRNA plasmid


VALIUM20 corkscrew shRNA plasmid           shRNA plasmid


VALIUM21 corkscrew shRNA plasmid           shRNA plasmid


VALIUM22 corkscrew shRNA plasmid           shRNA plasmid

VALIUM10 snail shRNA plasmid               shRNA plasmid

VALIUM10 CG3967 shRNA plasmid              shRNA plasmid


VALIUM22 Baldspot shRNA plasmid            shRNA plasmid

VALIUM10 pannier shRNA plasmid             shRNA plasmid


VALIUM20 pannier shRNA plasmid             shRNA plasmid


VALIUM20 pannier shRNA plasmid             shRNA plasmid

VALIUM10 nucleostemin 1 shRNA plasmid      shRNA plasmid

VALIUM10 Synapsin shRNA plasmid            shRNA plasmid

                                           shRNA plasmid
VALIUM10 gamma-soluble NSF attachment protein shRNA plasmid

VALIUM10 serpent shRNA plasmid             shRNA plasmid


VALIUM20 serpent shRNA plasmid             shRNA plasmid

VALIUM10 CG3995 shRNA plasmid              shRNA plasmid


VALIUM20 yorkie shRNA plasmid              shRNA plasmid

VALIUM10 yorkie shRNA plasmid              shRNA plasmid
VALIUM20 Smrter shRNA plasmid                shRNA plasmid

VALIUM10 Smrter shRNA plasmid                shRNA plasmid

VALIUM10 Smrter shRNA plasmid                shRNA plasmid


VALIUM20 Smrter shRNA plasmid                shRNA plasmid


VALIUM20 Nipped-B shRNA plasmid              shRNA plasmid


VALIUM20 Argonaute 3 shRNA plasmid           shRNA plasmid


VALIUM22 Argonaute 3 shRNA plasmid           shRNA plasmid


                                               shRNA plasmid
VALIUM20 Eukaryotic initiation factor 4E shRNA plasmid


VALIUM20 CG40351 shRNA plasmid               shRNA plasmid


VALIUM20 CG4038 shRNA plasmid                shRNA plasmid

                                            shRNA
VALIUM1 Poly-(ADP-ribose) polymerase shRNA plasmid plasmid


                                            plasmid
VALIUM22 Poly-(ADP-ribose) polymerase shRNA shRNA plasmid


VALIUM20 Ppr-Y shRNA plasmid                 shRNA plasmid

VALIUM10 Synapse protein 25 shRNA plasmid    shRNA plasmid


VALIUM20 Mitf shRNA plasmid                  shRNA plasmid


VALIUM20 CG4049 shRNA plasmid                shRNA plasmid

VALIUM10 egalitarian shRNA plasmid           shRNA plasmid

                                               shRNA plasmid
VALIUM10 ftz transcription factor 1 shRNA plasmid
                                               shRNA plasmid
VALIUM20 ftz transcription factor 1 shRNA plasmid


VALIUM20 CG4078 shRNA plasmid                shRNA plasmid


                                               shRNA plasmid
VALIUM20 lethal (2) neighbor of tid shRNA plasmid


                                               shRNA plasmid
VALIUM20 Suppressor of ref(2)P sterility shRNA plasmid


                                               shRNA plasmid
VALIUM20 Suppressor of ref(2)P sterility shRNA plasmid

VALIUM10 latheo shRNA plasmid                shRNA plasmid


                                           shRNA plasmid
VALIUM20 Proteasome 26kD subunit shRNA plasmid


VALIUM20 CG4098 shRNA plasmid                shRNA plasmid


VALIUM20 Pcaf shRNA plasmid                  shRNA plasmid

VALIUM10 Chmp1 shRNA plasmid                 shRNA plasmid


VALIUM20 Chmp1 shRNA plasmid                 shRNA plasmid

VALIUM10 Syntaxin 8 shRNA plasmid            shRNA plasmid

VALIUM10 expanded shRNA plasmid              shRNA plasmid


VALIUM20 expanded shRNA plasmid              shRNA plasmid


                                             shRNA
VALIUM20 nuclear RNA export factor 2 shRNA plasmid plasmid


                                             shRNA
VALIUM20 nuclear RNA export factor 2 shRNA plasmid plasmid

VALIUM10 roughest shRNA plasmid              shRNA plasmid

                                               shRNA plasmid
VALIUM10 nicotinic Acetylcholine Receptor α 30D shRNA plasmid
VALIUM10 CG4133 shRNA plasmid                shRNA plasmid

                                              shRNA
VALIUM10 multiprotein bridging factor 1 shRNA plasmidplasmid


                                            shRNA
VALIUM20 Heat shock protein cognate 3 shRNA plasmidplasmid

                                            shRNA plasmid
VALIUM10 Guanylyl cyclase at 88E shRNA plasmid


VALIUM20 Rpn12 shRNA plasmid                 shRNA plasmid

VALIUM10 non-stop shRNA plasmid              shRNA plasmid


VALIUM22 vasa intronic gene shRNA plasmid    shRNA plasmid


VALIUM22 vasa intronic gene shRNA plasmid    shRNA plasmid

VALIUM10 Septin-2 shRNA plasmid              shRNA plasmid

                                             shRNA plasmid
VALIUM10 Larval serum protein 1 β shRNA plasmid


                                            shRNA
VALIUM20 Mediator complex subunit 15 shRNA plasmid plasmid

VALIUM10 lethal (3) 73Ah shRNA plasmid       shRNA plasmid


VALIUM20 lethal (3) 73Ah shRNA plasmid       shRNA plasmid


VALIUM20 small wing shRNA plasmid            shRNA plasmid


VALIUM20 small wing shRNA plasmid            shRNA plasmid

VALIUM10 Calcineurin B shRNA plasmid         shRNA plasmid

VALIUM10 Rab-protein 14 shRNA plasmid        shRNA plasmid


VALIUM20 Rab-protein 14 shRNA plasmid        shRNA plasmid

VALIUM10 Syntaxin 5 shRNA plasmid            shRNA plasmid

                                               shRNA plasmid
VALIUM10 mitochondrial transcription factor A shRNA plasmid
VALIUM1 CG4221 shRNA plasmid                 shRNA plasmid

VALIUM10 Dbx shRNA plasmid                   shRNA plasmid

VALIUM10 CG42237 shRNA plasmid               shRNA plasmid

VALIUM1 Octβ3R shRNA plasmid                 shRNA plasmid

VALIUM10 epsin-like shRNA plasmid            shRNA plasmid


VALIUM20 Snipper shRNA plasmid               shRNA plasmid

                                            s
VALIUM10 Glutamate receptor IIC shRNA plasmidhRNA plasmid

VALIUM10 CG42260 shRNA plasmid               shRNA plasmid

VALIUM10 CG42271 shRNA plasmid               shRNA plasmid

VALIUM1 RhoGAP18B shRNA plasmid              shRNA plasmid

VALIUM1 Nedd4 shRNA plasmid                  shRNA plasmid

                                            shRNA
VALIUM10 CCK-like receptor at 17D1 shRNA plasmid plasmid

VALIUM10 grainy head shRNA plasmid           shRNA plasmid

                                          shRNA plasmid
VALIUM1 plasma membrane calcium ATPase shRNA plasmid


VALIUM22 app shRNA plasmid                   shRNA plasmid

VALIUM10 CG42321 shRNA plasmid               shRNA plasmid


VALIUM20 CG42327 shRNA plasmid               shRNA plasmid

VALIUM1 C3G shRNA plasmid                    shRNA plasmid

                                              shRNA plasmid
VALIUM10 Calmodulin-binding transcription activator shRNA plasmid

VALIUM10 CG42333 shRNA plasmid               shRNA plasmid

VALIUM10 CG42340 shRNA plasmid               shRNA plasmid

                                            shRNA plasmid
VALIUM10 cAMP-dependent protein kinase R1 shRNA plasmid

                                            shRNA plasmid
VALIUM10 cAMP-dependent protein kinase R1 shRNA plasmid
VALIUM10 bruchpilot shRNA plasmid              shRNA plasmid

VALIUM10 CG42346 shRNA plasmid                 shRNA plasmid

VALIUM10 CG42355 shRNA plasmid                 shRNA plasmid


VALIUM20 CG42358 shRNA plasmid                 shRNA plasmid


VALIUM20 CG42358 shRNA plasmid                 shRNA plasmid

                                             shRNA plasmid
VALIUM1 Chromatin assembly factor 1 subunit shRNA plasmid


VALIUM20 Chromatin assembly factor 1 subunit shRNA plasmid

VALIUM1 RhoGEF3 shRNA plasmid                  shRNA plasmid

VALIUM1 RhoGEF3 shRNA plasmid                  shRNA plasmid


VALIUM20 Dmel\CG42518 shRNA plasmid            shRNA plasmid


                                           shRNA plasmid
VALIUM20 COP9 complex homolog subunit 8 shRNA plasmid

VALIUM1 CG42534 shRNA plasmid                  shRNA plasmid

VALIUM1 CG42534 shRNA plasmid                  shRNA plasmid


VALIUM20 twinstar shRNA plasmid                shRNA plasmid

                                               shRNA plasmid
VALIUM1 Signal-transducer and activator of transcription protein at 92E shRNA plasmid

                                               shRNA plasmid
VALIUM1 Signal-transducer and activator of transcription protein at 92E shRNA plasmid


                                               shRNA plasmid
VALIUM20 Signal-transducer and activator of transcription protein at 92E shRNA plasmid

VALIUM10 CG42575 shRNA plasmid                 shRNA plasmid


VALIUM20 CG42575 shRNA plasmid                 shRNA plasmid

VALIUM10 CG42594 shRNA plasmid                 shRNA plasmid
VALIUM20 alpha-Adaptin shRNA plasmid        shRNA plasmid


VALIUM20 Helicase 89B shRNA plasmid         shRNA plasmid


VALIUM20 Megalin shRNA plasmid              shRNA plasmid

VALIUM10 CG34352 shRNA plasmid              shRNA plasmid

                                             shRNA plasmid
VALIUM10 embryonic lethal abnormal vision shRNA plasmid

VALIUM1 CG18646 shRNA plasmid               shRNA plasmid

                                            shRNA
VALIUM10 Heat shock protein cognate 4 shRNA plasmidplasmid


                                            shRNA
VALIUM20 Heat shock protein cognate 4 shRNA plasmidplasmid


                                             shRNA plasmid
VALIUM20 Regulatory particle non-ATPase 3 shRNA plasmid

                                             shRNA plasmid
VALIUM10 Regulatory particle non-ATPase 3 shRNA plasmid


VALIUM20 Ephexin shRNA plasmid              shRNA plasmid


VALIUM20 CG42669 shRNA plasmid              shRNA plasmid

VALIUM10 CG42669 shRNA plasmid              shRNA plasmid


VALIUM20 CG4267 shRNA plasmid               shRNA plasmid


VALIUM20 pasilla shRNA plasmid              shRNA plasmid

VALIUM1 CG30387 shRNA plasmid               shRNA plasmid

VALIUM1 CG42674 shRNA plasmid               shRNA plasmid


VALIUM20 CG42674 shRNA plasmid              shRNA plasmid

VALIUM1 CoRest shRNA plasmid                shRNA plasmid
VALIUM20 CG42699 shRNA plasmid               shRNA plasmid

VALIUM10 CG42732 shRNA plasmid               shRNA plasmid

VALIUM1 fizzy shRNA plasmid                  shRNA plasmid


VALIUM20 fizzy shRNA plasmid                 shRNA plasmid


                                              shRNA plasmid
VALIUM22 atypical protein kinase C shRNA plasmid


VALIUM20 CG31304 shRNA plasmid               shRNA plasmid

VALIUM1 CG31304 shRNA plasmid                shRNA plasmid

VALIUM10 LSm1 shRNA plasmid                  shRNA plasmid

VALIUM10 CG4282 shRNA plasmid                shRNA plasmid

VALIUM10 CG4288 shRNA plasmid                shRNA plasmid


VALIUM20 CG4294 shRNA plasmid                shRNA plasmid

                                           shRNA plasmid
VALIUM1 Brahma associated protein 60kD shRNA plasmid


                                           shRNA plasmid
VALIUM20 Brahma associated protein 60kD shRNA plasmid


                                           shRNA plasmid
VALIUM20 Brahma associated protein 60kD shRNA plasmid


VALIUM20 CG4313 shRNA plasmid                shRNA plasmid

VALIUM1 raptor shRNA plasmid                 shRNA plasmid

VALIUM1 raptor shRNA plasmid                 shRNA plasmid


VALIUM20 raptor shRNA plasmid                shRNA plasmid

VALIUM10 CG4328 shRNA plasmid                shRNA plasmid
VALIUM20 CG4330 shRNA plasmid                shRNA plasmid


VALIUM20 roughex shRNA plasmid               shRNA plasmid

VALIUM1 CG4338 shRNA plasmid                 shRNA plasmid

VALIUM10 slow border cells shRNA plasmid     shRNA plasmid

                                             shRNA plasmid
VALIUM10 sodium chloride cotransporter 69 shRNA plasmid

                                             shRNA plasmid
VALIUM10 Inwardly rectifying potassium channel 2 shRNA plasmid


VALIUM20 alpha actinin shRNA plasmid         shRNA plasmid

VALIUM10 ultraspiracle shRNA plasmid         shRNA plasmid


VALIUM20 CG4389 shRNA plasmid                shRNA plasmid

VALIUM10 CG4395 shRNA plasmid                shRNA plasmid

VALIUM10 found in neurons shRNA plasmid      shRNA plasmid


                                             shRNA plasmid
VALIUM20 enhanced adult sensory threshold shRNA plasmid

VALIUM10 CG4404 shRNA plasmid                shRNA plasmid

                                              shRNA plasmid
VALIUM10 GDP dissociation inhibitor shRNA plasmid

                                            shRNA
VALIUM10 Autophagy-specific gene 4 shRNA plasmid plasmid


                                              shRNA plasmid
VALIUM20 Peptidoglycan recognition protein LC shRNA plasmid

                                              s
VALIUM1 will decrease acetylation shRNA plasmidhRNA plasmid


                                              shRNA plasmid
VALIUM20 will decrease acetylation shRNA plasmid

VALIUM10 Nup153 shRNA plasmid                shRNA plasmid


VALIUM20 Nup153 shRNA plasmid                shRNA plasmid
VALIUM20 Heat shock protein 27 shRNA plasmidshRNA plasmid


VALIUM20 Heat shock protein 27 shRNA plasmidshRNA plasmid

VALIUM10 Glutamate receptor IB shRNA plasmidshRNA plasmid

VALIUM10 moladietz shRNA plasmid               shRNA plasmid

VALIUM10 no ocelli shRNA plasmid               shRNA plasmid

VALIUM10 smt3 shRNA plasmid                    shRNA plasmid

VALIUM10 bubblegum shRNA plasmid               shRNA plasmid

VALIUM10 Cad86C shRNA plasmid                  shRNA plasmid


VALIUM20 Surfeit 6 shRNA plasmid               shRNA plasmid


VALIUM20 sans fille shRNA plasmid              shRNA plasmid

VALIUM10 argos shRNA plasmid                   shRNA plasmid

VALIUM1 pod1 shRNA plasmid                     shRNA plasmid

                                            plasmid
VALIUM10 FK506-binding protein FKBP59 shRNAshRNA plasmid

VALIUM10 inactive shRNA plasmid                shRNA plasmid

VALIUM1 Bekka shRNA plasmid                    shRNA plasmid

VALIUM10 Ataxin 1 shRNA plasmid                shRNA plasmid

VALIUM10 XNP shRNA plasmid                     shRNA plasmid


VALIUM20 XNP shRNA plasmid                     shRNA plasmid

                                                 shRNA plasmid
VALIUM1 neither inactivation nor afterpotential E shRNA plasmid

                                                 shRNA plasmid
VALIUM1 neither inactivation nor afterpotential E shRNA plasmid

VALIUM10 Arpc3A shRNA plasmid                  shRNA plasmid
VALIUM20 CG4562 shRNA plasmid               shRNA plasmid

VALIUM1 CG4565 shRNA plasmid                shRNA plasmid


VALIUM20 CG4565 shRNA plasmid               shRNA plasmid

VALIUM1 Phospholipase C at 21C shRNA plasmidshRNA plasmid

VALIUM1 Phospholipase C at 21C shRNA plasmidshRNA plasmid


                                           shRNA plasmid
VALIUM20 Phospholipase C at 21C shRNA plasmid


                                           shRNA plasmid
VALIUM20 Phospholipase C at 21C shRNA plasmid

VALIUM10 CG4575 shRNA plasmid               shRNA plasmid


VALIUM20 Thiolase shRNA plasmid             shRNA plasmid

VALIUM10 CG4585 shRNA plasmid               shRNA plasmid

VALIUM10 CG4587 shRNA plasmid               shRNA plasmid

VALIUM10 innexin 2 shRNA plasmid            shRNA plasmid

VALIUM10 innexin 2 shRNA plasmid            shRNA plasmid

VALIUM10 Tetraspanin 86D shRNA plasmid      shRNA plasmid

VALIUM10 CG4596 shRNA plasmid               shRNA plasmid

VALIUM10 Srp54 shRNA plasmid                shRNA plasmid


VALIUM20 branchless shRNA plasmid           shRNA plasmid


                                             shRNA plasmid
VALIUM20 failed axon connections shRNA plasmid

VALIUM10 CG4617 shRNA plasmid               shRNA plasmid

                                              shRNA plasmid
VALIUM10 Charged multivesicular body protein 2b shRNA plasmid

VALIUM10 YL-1 shRNA plasmid                 shRNA plasmid
                                            shRNA plasmid
VALIUM1 Nucleosome remodeling factor - 38kD shRNA plasmid

VALIUM1 SCAR shRNA plasmid                   shRNA plasmid

VALIUM10 hedgehog shRNA plasmid              shRNA plasmid


VALIUM20 hedgehog shRNA plasmid              shRNA plasmid

VALIUM1 hedgehog shRNA plasmid               shRNA plasmid

VALIUM1 hedgehog shRNA plasmid               shRNA plasmid

VALIUM1 Fsn shRNA plasmid                    shRNA plasmid

VALIUM10 Fsn shRNA plasmid                   shRNA plasmid

VALIUM1 DP transcription factor shRNA plasmid shRNA plasmid


VALIUM20 DP transcription factor shRNA plasmidshRNA plasmid

VALIUM10 CG4655 shRNA plasmid                shRNA plasmid

                                           shRNA plasmid
VALIUM10 Ras association family member shRNA plasmid

VALIUM10 CG4670 shRNA plasmid                shRNA plasmid

VALIUM10 CG4681 shRNA plasmid                shRNA plasmid

VALIUM10 nervous wreck shRNA plasmid         shRNA plasmid


VALIUM20 Muscle protein 20 shRNA plasmid     shRNA plasmid

                                           shRNA plasmid
VALIUM1 COP9 complex homolog subunit 1 a shRNA plasmid

                                          shRNA plasmid
VALIUM10 Wnt oncogene analog 4 shRNA plasmid

VALIUM10 Sema-2a shRNA plasmid               shRNA plasmid


VALIUM22 squash shRNA plasmid                shRNA plasmid

                                              shRNA plasmid
VALIUM10 lethal (2) giant discs 1 shRNA plasmid

VALIUM10 knirps shRNA plasmid                shRNA plasmid
VALIUM10 big brain shRNA plasmid              shRNA plasmid


                                            shRNA plasmid
VALIUM20 nuclear pore protein 160 shRNA plasmid


VALIUM20 Ugt86Dc shRNA plasmid                shRNA plasmid


VALIUM20 CG4747 shRNA plasmid                 shRNA plasmid


VALIUM20 RhoGAP92B shRNA plasmid              shRNA plasmid


VALIUM20 CG4769 shRNA plasmid                 shRNA plasmid

                                              shRNA plasmid
VALIUM1 Transport and Golgi organization 14 shRNA plasmid


VALIUM20 CG4785 shRNA plasmid                 shRNA plasmid

VALIUM10 Dicer-1 shRNA plasmid                shRNA plasmid


VALIUM20 Dicer-1 shRNA plasmid                shRNA plasmid

VALIUM10 Calphotin shRNA plasmid              shRNA plasmid

VALIUM10 Pendulin shRNA plasmid               shRNA plasmid


                                               shRNA plasmid
VALIUM20 Translationally controlled tumor protein shRNA plasmid

VALIUM10 pickpocket 28 shRNA plasmid          shRNA plasmid

VALIUM10 abrupt shRNA plasmid                 shRNA plasmid


VALIUM20 abrupt shRNA plasmid                 shRNA plasmid

VALIUM10 Structure specific recognition protein shRNA plasmid

VALIUM10 CG4822 shRNA plasmid                 shRNA plasmid

VALIUM1 centrosomin shRNA plasmid             shRNA plasmid

VALIUM1 Tropomyosin 2 shRNA plasmid           shRNA plasmid
                                              shRNA plasmid
VALIUM10 Palmitoyl-protein Thioesterase 2 shRNA plasmid

VALIUM1 CG4853 shRNA plasmid                 shRNA plasmid

                                             shRNA plasmid
VALIUM1 Matrix metalloproteinase 1 shRNA plasmid

VALIUM10 CG4872 shRNA plasmid                shRNA plasmid


VALIUM20 CG4877 shRNA plasmid                shRNA plasmid


VALIUM20 eIF3-S9 shRNA plasmid               shRNA plasmid


VALIUM20 homolog of RecQ shRNA plasmid       shRNA plasmid

VALIUM10 spalt-related shRNA plasmid         shRNA plasmid

VALIUM1 wingless shRNA plasmid               shRNA plasmid

VALIUM1 wingless shRNA plasmid               shRNA plasmid


VALIUM20 wingless shRNA plasmid              shRNA plasmid


VALIUM20 wingless shRNA plasmid              shRNA plasmid

                                            shRNA plasmid
VALIUM10 Ca2+-channel protein α1 subunit D shRNA plasmid


                                             shRNA shRNA
VALIUM20 Ca[2+]-channel protein alpha[[1]] subunit Dplasmid plasmid


VALIUM20 Ribosomal protein L7 shRNA plasmid shRNA plasmid


                                           shRNA plasmid
VALIUM20 Proteasome 35kD subunit shRNA plasmid

VALIUM10 Syntrophin-like 2 shRNA plasmid     shRNA plasmid

VALIUM1 CG4908 shRNA plasmid                 shRNA plasmid

VALIUM1 CG4908 shRNA plasmid                 shRNA plasmid

                                             shRNA
VALIUM10 Cardioacceleratory peptide shRNA plasmid plasmid
VALIUM1 CG4911 shRNA plasmid                shRNA plasmid

VALIUM10 eEF1delta shRNA plasmid            shRNA plasmid

VALIUM10 ENL/AF9-related shRNA plasmid      shRNA plasmid


VALIUM20 ENL/AF9-related shRNA plasmid      shRNA plasmid

                                            shRNA
VALIUM10 maternal expression at 31B shRNA plasmid plasmid


                                            shRNA
VALIUM20 maternal expression at 31B shRNA plasmid plasmid

VALIUM1 Ribosomal protein LP2 shRNA plasmid shRNA plasmid


VALIUM20 Rab-protein 4 shRNA plasmid        shRNA plasmid


VALIUM20 spalt-adjacent shRNA plasmid       shRNA plasmid


VALIUM20 spalt-adjacent shRNA plasmid       shRNA plasmid

VALIUM1 RhoGAP15B shRNA plasmid             shRNA plasmid

VALIUM10 CG4950 shRNA plasmid               shRNA plasmid

VALIUM10 dachshund shRNA plasmid            shRNA plasmid


VALIUM20 mitoferrin shRNA plasmid           shRNA plasmid


VALIUM20 twine shRNA plasmid                shRNA plasmid

VALIUM10 Wnt6 shRNA plasmid                 shRNA plasmid

VALIUM10 Wnt6 shRNA plasmid                 shRNA plasmid

VALIUM10 Wnt10 shRNA plasmid                shRNA plasmid

                                             shRNA
VALIUM10 division abnormally delayed shRNA plasmid plasmid


                                             shRNA
VALIUM20 division abnormally delayed shRNA plasmid plasmid
VALIUM20 Mes-4 shRNA plasmid                 shRNA plasmid

VALIUM10 kekkon-2 shRNA plasmid              shRNA plasmid


                                          shRNA plasmid
VALIUM20 Minichromosome maintenance 7 shRNA plasmid

VALIUM1 mini spindles shRNA plasmid          shRNA plasmid


VALIUM20 CG5001 shRNA plasmid                shRNA plasmid

VALIUM1 CG5003 shRNA plasmid                 shRNA plasmid

VALIUM10 HLH54F shRNA plasmid                shRNA plasmid

VALIUM10 Vap-33-1 shRNA plasmid              shRNA plasmid

                                             shRNA
VALIUM1 Cytoplasmic linker protein 190 shRNA plasmidplasmid


VALIUM20 FBgn0032225 shRNA plasmid           shRNA plasmid

VALIUM10 CG5027 shRNA plasmid                shRNA plasmid


VALIUM20 dally-like shRNA plasmid            shRNA plasmid


VALIUM20 dally-like shRNA plasmid            shRNA plasmid


VALIUM20 GATAd shRNA plasmid                 shRNA plasmid


VALIUM20 GATAd shRNA plasmid                 shRNA plasmid

VALIUM1 CG5037 shRNA plasmid                 shRNA plasmid

VALIUM1 CG5037 shRNA plasmid                 shRNA plasmid

VALIUM10 CG5053 shRNA plasmid                shRNA plasmid

VALIUM1 bazooka shRNA plasmid                shRNA plasmid

VALIUM1 bazooka shRNA plasmid                shRNA plasmid
                                            shRNA
VALIUM20 Mediator complex subunit 10 shRNA plasmid plasmid

VALIUM10 capicua shRNA plasmid               shRNA plasmid

VALIUM10 crocodile shRNA plasmid             shRNA plasmid


VALIUM20 crocodile shRNA plasmid             shRNA plasmid


VALIUM20 capulet shRNA plasmid               shRNA plasmid

VALIUM10 Syntaxin 7 shRNA plasmid            shRNA plasmid


VALIUM20 Sirt2 shRNA plasmid                 shRNA plasmid

VALIUM1 Sirt2 shRNA plasmid                  shRNA plasmid

VALIUM10 Dorsocross3 shRNA plasmid           shRNA plasmid

VALIUM10 daughterless shRNA plasmid          shRNA plasmid

VALIUM10 daughterless shRNA plasmid          shRNA plasmid

                                              shRNA plasmid
VALIUM1 Phospholipase A2 activator protein shRNA plasmid


VALIUM20 Polycomblike shRNA plasmid          shRNA plasmid

VALIUM1 Polycomblike shRNA plasmid           shRNA plasmid


VALIUM20 Polycomblike shRNA plasmid          shRNA plasmid

VALIUM10 polyA-binding protein shRNA plasmid shRNA plasmid


                                            shRNA
VALIUM20 Mediator complex subunit 28 shRNA plasmid plasmid

VALIUM10 Dorsocross1 shRNA plasmid           shRNA plasmid


                                            shRNA
VALIUM20 Mediator complex subunit 9 shRNA plasmid plasmid

VALIUM1 CG5155 shRNA plasmid                 shRNA plasmid
VALIUM10 CG5160 shRNA plasmid                shRNA plasmid


                                              shRNA plasmid
VALIUM20 Dodeca-satellite-binding protein 1 shRNA plasmid

                                              shRNA plasmid
VALIUM10 Dodeca-satellite-binding protein 1 shRNA plasmid


VALIUM20 CG5174 shRNA plasmid                shRNA plasmid


VALIUM20 CG5174 shRNA plasmid                shRNA plasmid

VALIUM10 kugelkern shRNA plasmid             shRNA plasmid


VALIUM20 CG5181 shRNA plasmid                shRNA plasmid

                                              shRNA plasmid
VALIUM10 scruin like at the midline shRNA plasmid

                                           shRNA plasmid
VALIUM10 Daughters against dpp shRNA plasmid


VALIUM20 Dad shRNA plasmid                   shRNA plasmid


VALIUM20 CHIP shRNA plasmid                  shRNA plasmid


VALIUM20 CHIP shRNA plasmid                  shRNA plasmid

VALIUM1 Sir2 shRNA plasmid                   shRNA plasmid


VALIUM20 Sir2 shRNA plasmid                  shRNA plasmid

VALIUM10 CG5226 shRNA plasmid                shRNA plasmid


VALIUM20 sidekick shRNA plasmid              shRNA plasmid

VALIUM10 chameau shRNA plasmid               shRNA plasmid


VALIUM20 chameau shRNA plasmid               shRNA plasmid

VALIUM10 CG5235 shRNA plasmid                shRNA plasmid
VALIUM20 Ranbp9 shRNA plasmid                 shRNA plasmid


VALIUM20 Ranbp9 shRNA plasmid                 shRNA plasmid

VALIUM10 CG5284 shRNA plasmid                 shRNA plasmid


                                            shRNA plasmid
VALIUM20 Proteasome 26S subunit subunit 4 ATPase shRNA plasmid


VALIUM20 CG5292 shRNA plasmid                 shRNA plasmid


VALIUM20 CG5292 shRNA plasmid                 shRNA plasmid

VALIUM10 brummer shRNA plasmid                shRNA plasmid

VALIUM10 dpr5 shRNA plasmid                   shRNA plasmid

VALIUM1 CG5316 shRNA plasmid                  shRNA plasmid

VALIUM1 CG5316 shRNA plasmid                  shRNA plasmid

VALIUM10 Ced-12 shRNA plasmid                 shRNA plasmid


VALIUM20 CG5337 shRNA plasmid                 shRNA plasmid

VALIUM10 sec6 shRNA plasmid                   shRNA plasmid

                                               shRNA plasmid
VALIUM10 Small ribonucleoprotein particle protein B shRNA plasmid

                                             shRNA
VALIUM1 Arginine methyltransferase 4 shRNA plasmid plasmid


VALIUM20 CG5366 shRNA plasmid                 shRNA plasmid


VALIUM20 CG5366 shRNA plasmid                 shRNA plasmid

VALIUM10 Death caspase-1 shRNA plasmid        shRNA plasmid


VALIUM20 Tcp1-like shRNA plasmid              shRNA plasmid
VALIUM20 Rpn7 shRNA plasmid                   shRNA plasmid


                                             shRNA
VALIUM20 phosphatidylserine receptor shRNA plasmid plasmid

VALIUM10 apontic shRNA plasmid                shRNA plasmid

VALIUM10 Eclosion hormone shRNA plasmid       shRNA plasmid

VALIUM10 retained shRNA plasmid               shRNA plasmid

VALIUM10 Sur-8 shRNA plasmid                  shRNA plasmid

VALIUM10 Mitochondrial Rho shRNA plasmid      shRNA plasmid

VALIUM10 Rox8 shRNA plasmid                   shRNA plasmid


VALIUM20 Rox8 shRNA plasmid                   shRNA plasmid

VALIUM10 robo3 shRNA plasmid                  shRNA plasmid

                                            shRNA
VALIUM10 Autophagy-specific gene 6 shRNA plasmid plasmid


VALIUM20 Kinesin light chain shRNA plasmid    shRNA plasmid


VALIUM20 CG5439 shRNA plasmid                 shRNA plasmid

VALIUM10 delilah shRNA plasmid                shRNA plasmid


VALIUM20 delilah shRNA plasmid                shRNA plasmid


VALIUM20 CG5446 shRNA plasmid                 shRNA plasmid


VALIUM20 CG5451 shRNA plasmid                 shRNA plasmid

                                               shRNA plasmid
VALIUM1 small ribonucleoprotein particle U1 subunit C shRNA plasmid


                                               shRNA shRNA
VALIUM20 small ribonucleoprotein particle U1 subunit Cplasmid plasmid

VALIUM10 Hairless shRNA plasmid               shRNA plasmid
VALIUM10 bunched shRNA plasmid               shRNA plasmid

VALIUM10 scribbled shRNA plasmid             shRNA plasmid


                                            shRNA
VALIUM20 Mediator complex subunit 16 shRNA plasmid plasmid


VALIUM20 leak shRNA plasmid                  shRNA plasmid


VALIUM20 BarH2 shRNA plasmid                 shRNA plasmid

                                            shRNA
VALIUM10 Autophagy-specific gene 7 shRNA plasmid plasmid

VALIUM1 Toll shRNA plasmid                   shRNA plasmid

VALIUM1 Toll shRNA plasmid                   shRNA plasmid

VALIUM10 Histone H2A variant shRNA plasmid shRNA plasmid


VALIUM20 Histone H2A variant shRNA plasmid shRNA plasmid

                                              shRNA plasmid
VALIUM10 lethal (2) tumorous imaginal discs shRNA plasmid

                                              plasmid
VALIUM10 Ubiquitin-specific protease 36 shRNA shRNA plasmid


VALIUM20 scrawny shRNA plasmid               shRNA plasmid


VALIUM20 CG5514 shRNA plasmid                shRNA plasmid


VALIUM20 Prp19 shRNA plasmid                 shRNA plasmid

VALIUM1 CG5522 shRNA plasmid                 shRNA plasmid


VALIUM20 CG5527 shRNA plasmid                shRNA plasmid

VALIUM10 Toll-9 shRNA plasmid                shRNA plasmid


VALIUM20 Toll-9 shRNA plasmid                shRNA plasmid

VALIUM1 BarH1 shRNA plasmid                  shRNA plasmid
VALIUM10 CG5548 shRNA plasmid                shRNA plasmid

VALIUM10 Olig family shRNA plasmid           shRNA plasmid

                                            shRNA
VALIUM10 Mediator complex subunit 19 shRNA plasmid plasmid


                                            shRNA
VALIUM20 Mediator complex subunit 19 shRNA plasmid plasmid

VALIUM10 CG5548 shRNA plasmid                shRNA plasmid

VALIUM10 Synaptotagmin α shRNA plasmid       shRNA plasmid

VALIUM10 CG5567 shRNA plasmid                shRNA plasmid

VALIUM10 scribbler shRNA plasmid             shRNA plasmid

VALIUM10 Ets at 98B shRNA plasmid            shRNA plasmid

VALIUM10 Mig-2-like shRNA plasmid            shRNA plasmid


VALIUM20 CG5589 shRNA plasmid                shRNA plasmid

VALIUM10 CG5591 shRNA plasmid                shRNA plasmid


VALIUM20 kazachoc shRNA plasmid              shRNA plasmid

VALIUM1 Sex combs extra shRNA plasmid        shRNA plasmid

                                               shRNA plasmid
VALIUM10 Myosin alkali light chain 1 shRNA plasmid


VALIUM20 CG5599 shRNA plasmid                shRNA plasmid


VALIUM20 DNA ligase I shRNA plasmid          shRNA plasmid

                                                96Aa plasmid
VALIUM10 nicotinic Acetylcholine Receptor alphashRNA shRNA plasmid

VALIUM10 CG5618 shRNA plasmid                shRNA plasmid

VALIUM10 CG5621 shRNA plasmid                shRNA plasmid

VALIUM10 rab3-GEF shRNA plasmid              shRNA plasmid

VALIUM10 rab3-GEF shRNA plasmid              shRNA plasmid
VALIUM10 CG5629 shRNA plasmid               shRNA plasmid

VALIUM10 nanos shRNA plasmid                shRNA plasmid


VALIUM20 nanos shRNA plasmid                shRNA plasmid


VALIUM20 nanos shRNA plasmid                shRNA plasmid


VALIUM20 Utx shRNA plasmid                  shRNA plasmid

VALIUM10 widerborst shRNA plasmid           shRNA plasmid

VALIUM10 widerborst shRNA plasmid           shRNA plasmid

VALIUM10 CG5644 shRNA plasmid               shRNA plasmid


VALIUM20 CG5646 shRNA plasmid               shRNA plasmid


                                            shRNA
VALIUM20 Protein phosphatase 1 at 87B shRNA plasmidplasmid

VALIUM1 pixie shRNA plasmid                 shRNA plasmid

VALIUM10 ypsilon schachtel shRNA plasmid    shRNA plasmid

VALIUM10 CG5726 shRNA plasmid               shRNA plasmid

VALIUM10 Sarcoglycan beta shRNA plasmid     shRNA plasmid

VALIUM10 ariadne shRNA plasmid              shRNA plasmid

VALIUM10 Semaphorin-5c shRNA plasmid        shRNA plasmid

                                           s
VALIUM10 Na pump alpha subunit shRNA plasmidhRNA plasmid


                                           s
VALIUM20 Na pump alpha subunit shRNA plasmidhRNA plasmid


                                           s
VALIUM20 Na pump alpha subunit shRNA plasmidhRNA plasmid

VALIUM10 Pten shRNA plasmid                 shRNA plasmid

VALIUM10 Pten shRNA plasmid                 shRNA plasmid
VALIUM20 Pten shRNA plasmid                  shRNA plasmid

VALIUM10 X11L shRNA plasmid                  shRNA plasmid

                                            shRNA plasmid
VALIUM10 Adult enhancer factor 1 shRNA plasmid

VALIUM10 Pop2 shRNA plasmid                  shRNA plasmid

                                           shRNA plasmid
VALIUM10 Na/Ca-exchange protein shRNA plasmid

VALIUM10 chico shRNA plasmid                 shRNA plasmid

VALIUM10 rapsynoid shRNA plasmid             shRNA plasmid

VALIUM10 jaguar shRNA plasmid                shRNA plasmid


VALIUM20 RhoBTB shRNA plasmid                shRNA plasmid

VALIUM10 Tenascin major shRNA plasmid        shRNA plasmid


VALIUM20 CG5726 shRNA plasmid                shRNA plasmid

VALIUM10 CG5733 shRNA plasmid                shRNA plasmid

VALIUM10 orb2 shRNA plasmid                  shRNA plasmid

                                           shRNA
VALIUM10 doublesex-Mab related 93B shRNA plasmid plasmid

VALIUM1 lola like shRNA plasmid              shRNA plasmid

VALIUM10 Frequenin 1 shRNA plasmid           shRNA plasmid


VALIUM20 CG5745 shRNA plasmid                shRNA plasmid

VALIUM10 Heat shock factor shRNA plasmid     shRNA plasmid

                                              plasmid
VALIUM1 Transient receptor potential A1 shRNA shRNA plasmid

                                              plasmid
VALIUM1 Transient receptor potential A1 shRNA shRNA plasmid


                                              shRNA plasmid
VALIUM20 Transient receptor potential A1 shRNA plasmid

VALIUM1 staufen shRNA plasmid                shRNA plasmid
VALIUM10 Rab-protein 11 shRNA plasmid        shRNA plasmid


VALIUM20 Mapmodulin shRNA plasmid            shRNA plasmid

                                             shRNA plasmid
VALIUM10 defective proventriculus shRNA plasmid


VALIUM20 CG5807 shRNA plasmid                shRNA plasmid

                                             shRNA
VALIUM10 Neuropeptide Y receptor-like shRNA plasmid plasmid


VALIUM20 chiffon shRNA plasmid               shRNA plasmid

VALIUM10 CG5819 shRNA plasmid                shRNA plasmid


VALIUM20 Gp150 shRNA plasmid                 shRNA plasmid

VALIUM1 CG5830 shRNA plasmid                 shRNA plasmid


VALIUM20 CG5830 shRNA plasmid                shRNA plasmid

VALIUM10 Hsp70Bbb shRNA plasmid              shRNA plasmid

VALIUM10 Splicing factor 1 shRNA plasmid     shRNA plasmid

VALIUM10 HEM-protein shRNA plasmid           shRNA plasmid

                                              shRNA plasmid
VALIUM10 DNA replication-related element factor shRNA plasmid

VALIUM10 mind bomb 1 shRNA plasmid           shRNA plasmid

VALIUM1 nanchung shRNA plasmid               shRNA plasmid

VALIUM1 nanchung shRNA plasmid               shRNA plasmid

VALIUM1 CG5844 shRNA plasmid                 shRNA plasmid

VALIUM1 cactus shRNA plasmid                 shRNA plasmid


VALIUM20 cactus shRNA plasmid                shRNA plasmid

VALIUM10 CG5853 shRNA plasmid                shRNA plasmid
VALIUM20 CG5859 shRNA plasmid          shRNA plasmid


VALIUM20 NELF-A shRNA plasmid          shRNA plasmid

VALIUM10 CG5890 shRNA plasmid          shRNA plasmid

VALIUM10 Dichaete shRNA plasmid        shRNA plasmid


VALIUM20 CG5899 shRNA plasmid          shRNA plasmid

VALIUM10 Frequenin 2 shRNA plasmid     shRNA plasmid

VALIUM10 ETHR shRNA plasmid            shRNA plasmid

VALIUM1 arrow shRNA plasmid            shRNA plasmid

VALIUM1 arrow shRNA plasmid            shRNA plasmid

VALIUM10 Rab-protein 7 shRNA plasmid   shRNA plasmid

VALIUM1 CG5924 shRNA plasmid           shRNA plasmid

VALIUM1 CG5924 shRNA plasmid           shRNA plasmid

VALIUM10 HES-related shRNA plasmid     shRNA plasmid


VALIUM20 CG5931 shRNA plasmid          shRNA plasmid

VALIUM1 CG5931 shRNA plasmid           shRNA plasmid

VALIUM10 Dek shRNA plasmid             shRNA plasmid

VALIUM1 Paramyosin shRNA plasmid       shRNA plasmid

VALIUM1 Paramyosin shRNA plasmid       shRNA plasmid

VALIUM10 Cyclin A shRNA plasmid        shRNA plasmid

VALIUM1 Cyclin A shRNA plasmid         shRNA plasmid

VALIUM1 brahma shRNA plasmid           shRNA plasmid


VALIUM22 brahma shRNA plasmid          shRNA plasmid
VALIUM20 brahma shRNA plasmid                shRNA plasmid

VALIUM10 48 related 2 shRNA plasmid          shRNA plasmid

                                             shRNA plasmid
VALIUM10 lethal (3) malignant brain tumor shRNA plasmid

VALIUM1 CG5961 shRNA plasmid                 shRNA plasmid

VALIUM1 Arrestin 2 shRNA plasmid             shRNA plasmid

VALIUM1 Arrestin 2 shRNA plasmid             shRNA plasmid


VALIUM20 Arrestin 2 shRNA plasmid            shRNA plasmid


VALIUM20 Arrestin 2 shRNA plasmid            shRNA plasmid

VALIUM10 without children shRNA plasmid      shRNA plasmid


VALIUM20 CG5966 shRNA plasmid                shRNA plasmid

VALIUM1 Arc-p20 shRNA plasmid                shRNA plasmid

VALIUM10 spastin shRNA plasmid               shRNA plasmid


VALIUM20 unpaired 2 shRNA plasmid            shRNA plasmid


VALIUM20 unpaired 2 shRNA plasmid            shRNA plasmid

VALIUM10 outstretched shRNA plasmid          shRNA plasmid


VALIUM20 outstretched shRNA plasmid          shRNA plasmid


                                             shRNA
VALIUM20 Negative elongation factor E shRNA plasmid plasmid

VALIUM1 trpγ shRNA plasmid                   shRNA plasmid

VALIUM1 trpγ shRNA plasmid                   shRNA plasmid


VALIUM20 CG6015 shRNA plasmid                shRNA plasmid
                                              shRNA plasmid
VALIUM10 Huntingtin-interacting protein 14 shRNA plasmid

                                              shRNA plasmid
VALIUM1 Huntingtin-interacting protein 14 shRNA plasmid

VALIUM10 CG6024 shRNA plasmid                shRNA plasmid

VALIUM10 Arflike at 72A shRNA plasmid        shRNA plasmid


                                            shRNA plasmid
VALIUM20 ATP synthase, subunit d shRNA plasmid

                                            shRNA plasmid
VALIUM1 downstream of receptor kinase shRNA plasmid

                                            shRNA plasmid
VALIUM10 downstream of receptor kinase shRNA plasmid

VALIUM10 CG6044 shRNA plasmid                shRNA plasmid

                                               shRNA plasmid
VALIUM1 Bicoid interacting protein 1 shRNA plasmid


                                               shRNA
VALIUM22 Bicoid interacting protein 1 shRNA plasmid plasmid


                                              shRNA plasmid
VALIUM20 Elongation factor Tu mitochondrial shRNA plasmid

VALIUM10 Suppressor of fused shRNA plasmid   shRNA plasmid

VALIUM10 Aldolase shRNA plasmid              shRNA plasmid


                                             shRNA
VALIUM20 Myb-interacting protein 120 shRNA plasmid plasmid

VALIUM10 TORC shRNA plasmid                  shRNA plasmid


VALIUM20 CG6066 shRNA plasmid                shRNA plasmid

VALIUM10 sarah shRNA plasmid                 shRNA plasmid

VALIUM10 exo84 shRNA plasmid                 shRNA plasmid

                                              shRNA
VALIUM10 E(spl) region transcript m5 shRNA plasmid plasmid

VALIUM10 Leucine-rich repeat 47 shRNA plasmidshRNA plasmid

                                              shRNA
VALIUM10 E(spl) region transcript m4 shRNA plasmid plasmid

                                             protein B at 17A
VALIUM10 Cyclic-AMP response element binding shRNA plasmid shRNA plasmid
VALIUM10 Lipase 4 shRNA plasmid             shRNA plasmid

VALIUM10 Tip60 shRNA plasmid                shRNA plasmid


VALIUM22 Tip60 shRNA plasmid                shRNA plasmid

VALIUM1 piwi shRNA plasmid                  shRNA plasmid


VALIUM20 piwi shRNA plasmid                 shRNA plasmid


VALIUM20 piwi shRNA plasmid                 shRNA plasmid

VALIUM10 eater shRNA plasmid                shRNA plasmid

VALIUM10 Serrate shRNA plasmid              shRNA plasmid

VALIUM10 spatzle shRNA plasmid              shRNA plasmid

VALIUM1 aubergine shRNA plasmid             shRNA plasmid


VALIUM20 aubergine shRNA plasmid            shRNA plasmid


VALIUM22 aubergine shRNA plasmid            shRNA plasmid


                                             shRNA plasmid
VALIUM20 Protein on ecdysone puffs shRNA plasmid

VALIUM1 Tsc1 shRNA plasmid                  shRNA plasmid

VALIUM1 Tsc1 shRNA plasmid                  shRNA plasmid


VALIUM22 Tsc1 shRNA plasmid                 shRNA plasmid


                                             shRNA plasmid
VALIUM20 Putative Achaete Scute Target 1 shRNA plasmid

VALIUM10 CG6151 shRNA plasmid               shRNA plasmid

VALIUM10 sec10 shRNA plasmid                shRNA plasmid

VALIUM1 PICK1 shRNA plasmid                 shRNA plasmid
VALIUM20 Decapping protein 2 shRNA plasmid shRNA plasmid

VALIUM1 HDAC6 shRNA plasmid                  shRNA plasmid


VALIUM20 HDAC6 shRNA plasmid                 shRNA plasmid

                                             shRNA plasmid
VALIUM10 ventral nervous system defective shRNA plasmid

                                             shRNA plasmid
VALIUM10 Actin-related protein 87C shRNA plasmid

VALIUM1 Grip75 shRNA plasmid                 shRNA plasmid

VALIUM10 CG6178 shRNA plasmid                shRNA plasmid


VALIUM20 Ge-1 shRNA plasmid                  shRNA plasmid

VALIUM10 Angelman syndrome shRNA plasmid shRNA plasmid

                                            shRNA plasmid
VALIUM10 Adenomatous polyposis coli tumor suppressor homolog 2 shRNA plasmid


                                            shRNA plasmid
VALIUM20 Adenomatous polyposis coli tumor suppressor homolog 2 shRNA plasmid

VALIUM10 Fmr1 shRNA plasmid                  shRNA plasmid


VALIUM20 Fmr1 shRNA plasmid                  shRNA plasmid


VALIUM22 Fmr1 shRNA plasmid                  shRNA plasmid

                                           shRNA plasmid
VALIUM10 germ cell-expressed bHLH-PAS shRNA plasmid


VALIUM20 suppressor of sable shRNA plasmid   shRNA plasmid

VALIUM1 β-coatomer protein shRNA plasmid     shRNA plasmid


VALIUM20 beta-coatomer protein shRNA plasmidshRNA plasmid


                                            shRNA plasmid
VALIUM20 FK506-binding protein 1 shRNA plasmid

VALIUM10 twins shRNA plasmid                 shRNA plasmid
VALIUM10 nubbin shRNA plasmid                shRNA plasmid


VALIUM20 CG6272 shRNA plasmid                shRNA plasmid

VALIUM10 CG6272 shRNA plasmid                shRNA plasmid

VALIUM10 CG6276 shRNA plasmid                shRNA plasmid


VALIUM20 CG6277 shRNA plasmid                shRNA plasmid

VALIUM1 Sirt6 shRNA plasmid                  shRNA plasmid


VALIUM20 Sirt6 shRNA plasmid                 shRNA plasmid

                                            shRNA plasmid
VALIUM10 Enhancer of decapping 3 shRNA plasmid

VALIUM10 Rfx shRNA plasmid                   shRNA plasmid

VALIUM10 CG6329 shRNA plasmid                shRNA plasmid

VALIUM10 Ets at 97D shRNA plasmid            shRNA plasmid

VALIUM10 rough shRNA plasmid                 shRNA plasmid

VALIUM10 Ods-site homeobox shRNA plasmid     shRNA plasmid

                                             shRNA plasmid
VALIUM1 Ribonuclear protein at 97D shRNA plasmid

                                             shRNA plasmid
VALIUM1 Ribonuclear protein at 97D shRNA plasmid

VALIUM10 CG6356 shRNA plasmid                shRNA plasmid


VALIUM22 MRG15 shRNA plasmid                 shRNA plasmid


VALIUM20 CG6370 shRNA plasmid                shRNA plasmid

VALIUM10 hugin shRNA plasmid                 shRNA plasmid

VALIUM1 E2F transcription factor shRNA plasmidshRNA plasmid

                                              shRNA plasmid
VALIUM10 E2F transcription factor shRNA plasmid

VALIUM10 crumbs shRNA plasmid                shRNA plasmid
                                           shRNA
VALIUM20 Centrosomal protein 190kD shRNA plasmid plasmid


                                           shRNA
VALIUM20 Centrosomal protein 190kD shRNA plasmid plasmid


                                             shRNA plasmid
VALIUM20 Cysteine string protein shRNA plasmid

VALIUM1 Cysteine string protein shRNA plasmid shRNA plasmid

VALIUM1 Cysteine string protein shRNA plasmid shRNA plasmid


VALIUM20 BRWD3 shRNA plasmid                 shRNA plasmid

                                          shRNA plasmid
VALIUM10 Wnt oncogene analog 5 shRNA plasmid

                                          shRNA plasmid
VALIUM10 Wnt oncogene analog 5 shRNA plasmid


                                          shRNA plasmid
VALIUM20 Wnt oncogene analog 5 shRNA plasmid

VALIUM1 CG6412 shRNA plasmid                 shRNA plasmid


VALIUM20 CG6418 shRNA plasmid                shRNA plasmid


VALIUM20 CG6418 shRNA plasmid                shRNA plasmid

VALIUM10 amontillado shRNA plasmid           shRNA plasmid

VALIUM10 Dromyosuppressin shRNA plasmid      shRNA plasmid

VALIUM10 Cad74A shRNA plasmid                shRNA plasmid

VALIUM10 Sema-1b shRNA plasmid               shRNA plasmid

                                             shRNA plasmid
VALIUM10 Myoinhibiting peptide precursor shRNA plasmid


VALIUM20 CG6459 shRNA plasmid                shRNA plasmid


VALIUM20 spalt major shRNA plasmid           shRNA plasmid
VALIUM20 enhancer of yellow 1 shRNA plasmid shRNA plasmid

                                             shRNA
VALIUM1 Suppressor of variegation 3-9 shRNA plasmid plasmid


                                             plasmid
VALIUM20 Suppressor of variegation 3-9 shRNA shRNA plasmid


                                             plasmid
VALIUM20 Suppressor of variegation 3-9 shRNA shRNA plasmid

VALIUM1 RhoGAP54D shRNA plasmid              shRNA plasmid

VALIUM10 Dicer-2 shRNA plasmid               shRNA plasmid


VALIUM20 Dicer-2 shRNA plasmid               shRNA plasmid

VALIUM10 hairy shRNA plasmid                 shRNA plasmid

VALIUM10 CG6495 shRNA plasmid                shRNA plasmid

                                             shRNA plasmid
VALIUM10 Pigment-dispersing factor shRNA plasmid


VALIUM20 CG6497 shRNA plasmid                shRNA plasmid

VALIUM10 Beadex shRNA plasmid                shRNA plasmid

VALIUM1 Enhancer of zeste shRNA plasmid      shRNA plasmid

VALIUM10 Enhancer of zeste shRNA plasmid     shRNA plasmid


VALIUM20 Enhancer of zeste shRNA plasmid     shRNA plasmid

                                             shRNA plasmid
VALIUM1 Polycystic kidney disease gene-2 shRNA plasmid

                                             shRNA plasmid
VALIUM1 Polycystic kidney disease gene-2 shRNA plasmid

                                             shRNA plasmid
VALIUM10 Tachykinin-like receptor at 86C shRNA plasmid

VALIUM10 slouch shRNA plasmid                shRNA plasmid


VALIUM20 Gemin3 shRNA plasmid                shRNA plasmid

VALIUM10 ladybird early shRNA plasmid        shRNA plasmid
                                           shRNA plasmid
VALIUM1 Brahma associated protein 55kD shRNA plasmid

VALIUM1 CG6550 shRNA plasmid                shRNA plasmid

                                             shRNA
VALIUM1 Arginine methyltransferase 1 shRNA plasmid plasmid

                                             shRNA plasmid
VALIUM1 connector enhancer of ksr shRNA plasmid


                                             shRNA plasmid
VALIUM20 connector enhancer of ksr shRNA plasmid

VALIUM10 CG6560 shRNA plasmid               shRNA plasmid

VALIUM10 synaptojanin shRNA plasmid         shRNA plasmid


VALIUM20 tantalus shRNA plasmid             shRNA plasmid

VALIUM10 Rab-protein 6 shRNA plasmid        shRNA plasmid


VALIUM20 Hsc70Cb shRNA plasmid              shRNA plasmid

VALIUM10 Bicaudal D shRNA plasmid           shRNA plasmid

VALIUM1 CG6608 shRNA plasmid                shRNA plasmid

VALIUM10 CG6610 shRNA plasmid               shRNA plasmid

VALIUM1 Patsas shRNA plasmid                shRNA plasmid


                                            shRNA plasmid
VALIUM20 Soluble NSF attachment protein shRNA plasmid

                                            shRNA plasmid
VALIUM10 Soluble NSF attachment protein shRNA plasmid

VALIUM1 DJ-1α shRNA plasmid                 shRNA plasmid

VALIUM10 porin shRNA plasmid                shRNA plasmid

VALIUM10 dorsal shRNA plasmid               shRNA plasmid


VALIUM20 dorsal shRNA plasmid               shRNA plasmid


VALIUM20 dorsal shRNA plasmid               shRNA plasmid
VALIUM10 klingon shRNA plasmid                 shRNA plasmid

VALIUM1 Argonaute-1 shRNA plasmid              shRNA plasmid


VALIUM20 Argonaute-1 shRNA plasmid             shRNA plasmid

VALIUM10 CG6683 shRNA plasmid                  shRNA plasmid

VALIUM1 CG6686 shRNA plasmid                   shRNA plasmid

VALIUM10 CG6690 shRNA plasmid                  shRNA plasmid


VALIUM20 Cysteine proteinase-1 shRNA plasmidshRNA plasmid

VALIUM10 CG6697 shRNA plasmid                  shRNA plasmid

VALIUM10 NtR shRNA plasmid                     shRNA plasmid

VALIUM1 β'-coatomer protein shRNA plasmid      shRNA plasmid


                                            shRNA plasmid
VALIUM20 beta'-coatomer protein shRNA plasmid

VALIUM1 CG6701 shRNA plasmid                   shRNA plasmid

VALIUM10 CG6701 shRNA plasmid                  shRNA plasmid

VALIUM10 Calbindin 53E shRNA plasmid           shRNA plasmid

                                            shRNA plasmid
VALIUM10 metabotropic GABA-B receptor subtype 2 shRNA plasmid

VALIUM10 CG6707 shRNA plasmid                  shRNA plasmid

VALIUM10 Nitric oxide synthase shRNA plasmid shRNA plasmid


VALIUM20 paired shRNA plasmid                  shRNA plasmid

                                             shRNA
VALIUM1 GTPase-activating protein 1 shRNA plasmid plasmid

VALIUM10 CG6723 shRNA plasmid                  shRNA plasmid

VALIUM1 insulin-like peptide 4 shRNA plasmid   shRNA plasmid


VALIUM20 insulin-like peptide 4 shRNA plasmid shRNA plasmid
VALIUM10 CG6737 shRNA plasmid                shRNA plasmid

VALIUM1 centaurin beta 1A shRNA plasmid      shRNA plasmid

                                             shRNA plasmid
VALIUM10 Inwardly rectifying potassium channel shRNA plasmid

VALIUM10 SH3PX1 shRNA plasmid                shRNA plasmid

VALIUM1 CG6758 shRNA plasmid                 shRNA plasmid

VALIUM10 CG6770 shRNA plasmid                shRNA plasmid


VALIUM20 sec13 shRNA plasmid                 shRNA plasmid

VALIUM1 Ribosomal protein S3 shRNA plasmid shRNA plasmid


VALIUM20 scheggia shRNA plasmid              shRNA plasmid


VALIUM20 CG6791 shRNA plasmid                shRNA plasmid

                                             shRNA plasmid
VALIUM10 Dorsal-related immunity factor shRNA plasmid

                                             shRNA plasmid
VALIUM10 Dorsal-related immunity factor shRNA plasmid

                                               shRNA plasmid
VALIUM10 nicotinic Acetylcholine Receptor beta 96A shRNA plasmid


VALIUM20 CG6805 shRNA plasmid                shRNA plasmid

VALIUM1 CG6808 shRNA plasmid                 shRNA plasmid

VALIUM1 RhoGAP68F shRNA plasmid              shRNA plasmid

VALIUM10 CG6813 shRNA plasmid                shRNA plasmid


                                            shRNA plasmid
VALIUM20 Maternal transcript 89Bb shRNA plasmid

VALIUM10 Neurexin IV shRNA plasmid           shRNA plasmid


VALIUM20 Neurexin IV shRNA plasmid           shRNA plasmid


VALIUM20 Apaf-1-related-killer shRNA plasmid shRNA plasmid
VALIUM10 rhea shRNA plasmid                  shRNA plasmid


VALIUM20 rhea shRNA plasmid                  shRNA plasmid


VALIUM20 rhea shRNA plasmid                  shRNA plasmid

VALIUM1 CG6838 shRNA plasmid                 shRNA plasmid

                                              shRNA plasmid
VALIUM1 Vacuolar protein sorting 4 shRNA plasmid

                                                96Ab plasmid
VALIUM10 nicotinic Acetylcholine Receptor alphashRNA shRNA plasmid

                                             shRNA plasmid
VALIUM10 Mitochondrial carrier homolog 1 shRNA plasmid

VALIUM1 CG6854 shRNA plasmid                 shRNA plasmid

VALIUM10 CTP synthase shRNA plasmid          shRNA plasmid

VALIUM10 CG6860 shRNA plasmid                shRNA plasmid

VALIUM10 loquacious shRNA plasmid            shRNA plasmid


VALIUM20 loquacious shRNA plasmid            shRNA plasmid


VALIUM20 loquacious shRNA plasmid            shRNA plasmid


VALIUM20 loquacious shRNA plasmid            shRNA plasmid


VALIUM20 loquacious shRNA plasmid            shRNA plasmid


VALIUM20 loquacious shRNA plasmid            shRNA plasmid


VALIUM20 loquacious shRNA plasmid            shRNA plasmid


VALIUM20 loquacious shRNA plasmid            shRNA plasmid


VALIUM20 loquacious shRNA plasmid            shRNA plasmid
VALIUM20 Catalase shRNA plasmid               shRNA plasmid

VALIUM10 Catalase shRNA plasmid               shRNA plasmid

VALIUM10 trachealess shRNA plasmid            shRNA plasmid


VALIUM20 trachealess shRNA plasmid            shRNA plasmid


                                            shRNA
VALIUM20 Mediator complex subunit 11 shRNA plasmid plasmid

VALIUM1 taranis shRNA plasmid                 shRNA plasmid

VALIUM10 Tollo shRNA plasmid                  shRNA plasmid


VALIUM20 Ets96B shRNA plasmid                 shRNA plasmid

VALIUM10 Ets96B shRNA plasmid                 shRNA plasmid


                                               shRNA plasmid
VALIUM20 Zinc/iron regulated transporter-related protein 3 shRNA plasmid


VALIUM20 CG6903 shRNA plasmid                 shRNA plasmid

VALIUM10 CG6907 shRNA plasmid                 shRNA plasmid

VALIUM10 48 related 3 shRNA plasmid           shRNA plasmid


VALIUM20 CG6914 shRNA plasmid                 shRNA plasmid

VALIUM1 octopamine receptor 2 shRNA plasmid shRNA plasmid

VALIUM1 octopamine receptor 2 shRNA plasmid shRNA plasmid

VALIUM1 mutagen-sensitive 309 shRNA plasmidshRNA plasmid

VALIUM1 mutagen-sensitive 309 shRNA plasmidshRNA plasmid


VALIUM20 CG6923 shRNA plasmid                 shRNA plasmid

VALIUM10 CG6927 shRNA plasmid                 shRNA plasmid
VALIUM10 methuselah shRNA plasmid             shRNA plasmid


                                            shRNA
VALIUM20 SET domain binding factor shRNA plasmid plasmid

VALIUM1 Lamin shRNA plasmid                   shRNA plasmid


VALIUM20 glorund shRNA plasmid                shRNA plasmid

VALIUM10 Clathrin light chain shRNA plasmid   shRNA plasmid


VALIUM20 Grunge shRNA plasmid                 shRNA plasmid

VALIUM1 gigas shRNA plasmid                   shRNA plasmid

VALIUM10 Cad87A shRNA plasmid                 shRNA plasmid

VALIUM1 CG6984 shRNA plasmid                  shRNA plasmid

VALIUM10 Proctolin receptor shRNA plasmid     shRNA plasmid

VALIUM10 SF2 shRNA plasmid                    shRNA plasmid


VALIUM20 SF2 shRNA plasmid                    shRNA plasmid

                                              shRNA
VALIUM10 Protein disulfide isomerase shRNA plasmid plasmid

VALIUM1 HP1c shRNA plasmid                    shRNA plasmid


VALIUM20 HP1c shRNA plasmid                   shRNA plasmid

                                            s
VALIUM10 Glutamate receptor IIA shRNA plasmidhRNA plasmid

VALIUM10 spineless shRNA plasmid              shRNA plasmid


VALIUM20 spineless shRNA plasmid              shRNA plasmid


VALIUM20 Tudor-SN shRNA plasmid               shRNA plasmid

VALIUM10 nicastrin shRNA plasmid              shRNA plasmid

VALIUM10 Upstream of N-ras shRNA plasmid      shRNA plasmid
VALIUM20 Upstream of N-ras shRNA plasmid    shRNA plasmid


VALIUM20 Upstream of N-ras shRNA plasmid    shRNA plasmid

VALIUM10 sec15 shRNA plasmid                shRNA plasmid


VALIUM20 cap binding protein 80 shRNA plasmidshRNA plasmid

VALIUM10 Cbl shRNA plasmid                  shRNA plasmid

VALIUM10 CG7039 shRNA plasmid               shRNA plasmid


VALIUM20 HP1b shRNA plasmid                 shRNA plasmid

VALIUM10 CG7045 shRNA plasmid               shRNA plasmid

VALIUM10 CG7046 shRNA plasmid               shRNA plasmid

VALIUM10 Neurexin 1 shRNA plasmid           shRNA plasmid


VALIUM20 Neurexin 1 shRNA plasmid           shRNA plasmid

VALIUM10 dalao shRNA plasmid                shRNA plasmid


VALIUM22 dalao shRNA plasmid                shRNA plasmid

VALIUM10 AP-50 shRNA plasmid                shRNA plasmid

VALIUM1 rab3-GAP shRNA plasmid              shRNA plasmid


VALIUM20 Rab-related protein 3 shRNA plasmid shRNA plasmid


VALIUM20 CG7065 shRNA plasmid               shRNA plasmid


VALIUM20 sar1 shRNA plasmid                 shRNA plasmid

VALIUM10 diskette shRNA plasmid             shRNA plasmid
VALIUM20 diskette shRNA plasmid             shRNA plasmid

VALIUM10 Cadherin-N shRNA plasmid           shRNA plasmid

VALIUM10 Proctolin shRNA plasmid            shRNA plasmid

VALIUM1 upheld shRNA plasmid                shRNA plasmid


VALIUM20 upheld shRNA plasmid               shRNA plasmid

VALIUM10 microtubule star shRNA plasmid     shRNA plasmid


VALIUM20 CG7112 shRNA plasmid               shRNA plasmid

VALIUM10 Tehao shRNA plasmid                shRNA plasmid

VALIUM1 RhoGAP16F shRNA plasmid             shRNA plasmid

VALIUM10 exo70 shRNA plasmid                shRNA plasmid


VALIUM20 r2d2 shRNA plasmid                 shRNA plasmid


VALIUM20 DNApol-eta shRNA plasmid           shRNA plasmid

VALIUM1 CG7148 shRNA plasmid                shRNA plasmid

VALIUM10 Syntrophin-like 1 shRNA plasmid    shRNA plasmid

VALIUM10 CG7158 shRNA plasmid               shRNA plasmid

VALIUM10 wings up A shRNA plasmid           shRNA plasmid


VALIUM20 CG7185 shRNA plasmid               shRNA plasmid

VALIUM1 Gustatory receptor 66a shRNA plasmidshRNA plasmid

VALIUM1 Gustatory receptor 66a shRNA plasmidshRNA plasmid

VALIUM10 CG7197 shRNA plasmid               shRNA plasmid

                                            shRNA
VALIUM10 Hormone-receptor-like in 78 shRNA plasmid plasmid
VALIUM20 CG7200 shRNA plasmid                shRNA plasmid

VALIUM1 kelch shRNA plasmid                  shRNA plasmid

VALIUM1 cadmus shRNA plasmid                 shRNA plasmid

                                            s
VALIUM10 Glutamate receptor IIB shRNA plasmidhRNA plasmid


                                           shRNA plasmid
VALIUM20 Glycogen phosphorylase shRNA plasmid


VALIUM20 Helicase at 25E shRNA plasmid       shRNA plasmid


VALIUM20 Cyclin C shRNA plasmid              shRNA plasmid

                                              shRNA plasmid
VALIUM10 allatostatin C receptor 1 shRNA plasmid


VALIUM20 Rrp6 shRNA plasmid                  shRNA plasmid

                                              shRNA
VALIUM10 Kinesin-like protein at 68D shRNA plasmid plasmid

VALIUM10 CG7299 shRNA plasmid                shRNA plasmid

                                               shRNA plasmid
VALIUM10 Mitochondrial Transcription Factor B1 shRNA plasmid


VALIUM20 CG7324 shRNA plasmid                shRNA plasmid

VALIUM10 Sox21a shRNA plasmid                shRNA plasmid

VALIUM1 CG7365 shRNA plasmid                 shRNA plasmid

VALIUM10 CG7369 shRNA plasmid                shRNA plasmid


                                               shRNA plasmid
VALIUM20 barrier to autointegration factor shRNA plasmid

VALIUM10 eagle shRNA plasmid                 shRNA plasmid


VALIUM22 eagle shRNA plasmid                 shRNA plasmid

VALIUM1 Clock shRNA plasmid                  shRNA plasmid
VALIUM1 Clock shRNA plasmid                 shRNA plasmid

                                             shRNA
VALIUM1 Connector of kinase to AP-1 shRNA plasmid plasmid

                                             shRNA
VALIUM10 Connector of kinase to AP-1 shRNA plasmid plasmid


                                             shRNA
VALIUM20 Connector of kinase to AP-1 shRNA plasmid plasmid

                                             shRNA plasmid
VALIUM10 Neuropeptide F-like Receptor 76F shRNA plasmid


VALIUM20 RhoGAP71E shRNA plasmid            shRNA plasmid

VALIUM10 Transportin shRNA plasmid          shRNA plasmid

VALIUM10 Henna shRNA plasmid                shRNA plasmid

                                             shRNA plasmid
VALIUM10 estrogen-related receptor shRNA plasmid

VALIUM10 ora transientless shRNA plasmid    shRNA plasmid

                                             shRNA plasmid
VALIUM10 TAK1-associated Binding Protein2 shRNA plasmid


VALIUM20 CG7420 shRNA plasmid               shRNA plasmid


VALIUM20 Nopp140 shRNA plasmid              shRNA plasmid

VALIUM10 effete shRNA plasmid               shRNA plasmid

VALIUM10 CG7431 shRNA plasmid               shRNA plasmid


VALIUM20 Ribosomal protein L22 shRNA plasmidshRNA plasmid

                                              shRNA
VALIUM10 ADP ribosylation factor 84F shRNA plasmid plasmid


                                          shRNA
VALIUM20 mushroom-body expressed shRNA plasmid plasmid


VALIUM20 Myosin 31DF shRNA plasmid          shRNA plasmid


VALIUM22 CG7442 shRNA plasmid               shRNA plasmid
VALIUM10 Glycine receptor shRNA plasmid     shRNA plasmid


VALIUM22 CG7448 shRNA plasmid               shRNA plasmid

                                             protein A shRNA
VALIUM10 Cyclic-AMP response element binding shRNA plasmid plasmid

                                             protein A shRNA
VALIUM10 Cyclic-AMP response element binding shRNA plasmid plasmid

VALIUM10 Syntaxin 17 shRNA plasmid          shRNA plasmid

VALIUM10 CG7456 shRNA plasmid               shRNA plasmid


VALIUM22 CG7458 shRNA plasmid               shRNA plasmid

VALIUM1 osa shRNA plasmid                   shRNA plasmid

VALIUM1 Rpd3 shRNA plasmid                  shRNA plasmid


VALIUM20 Rpd3 shRNA plasmid                 shRNA plasmid


VALIUM20 Rpd3 shRNA plasmid                 shRNA plasmid


VALIUM20 Actin 79B shRNA plasmid            shRNA plasmid


VALIUM20 eIF4AIII shRNA plasmid             shRNA plasmid


VALIUM20 eIF4AIII shRNA plasmid             shRNA plasmid

VALIUM10 Tyramine receptor shRNA plasmid    shRNA plasmid


                                             shRNA plasmid
VALIUM20 Death related ced-3/Nedd2-like protein shRNA plasmid

VALIUM1 Ribosomal protein LP0 shRNA plasmid shRNA plasmid

VALIUM10 Connectin shRNA plasmid            shRNA plasmid

                                           shRNA plasmid
VALIUM10 Dynein heavy chain 64C shRNA plasmid

VALIUM10 atonal shRNA plasmid               shRNA plasmid
VALIUM1 CG7526 shRNA plasmid                shRNA plasmid

VALIUM1 CG7526 shRNA plasmid                shRNA plasmid

                                           shRNA
VALIUM10 Smt3 activating enzyme 2 shRNA plasmid plasmid

VALIUM10 inx5 shRNA plasmid                 shRNA plasmid


VALIUM20 CG7556 shRNA plasmid               shRNA plasmid


                                             shRNA plasmid
VALIUM20 Actin-related protein 66B shRNA plasmid

VALIUM10 Calpain-A shRNA plasmid            shRNA plasmid

VALIUM1 Rab-protein 3 shRNA plasmid         shRNA plasmid


VALIUM20 Rab-protein 3 shRNA plasmid        shRNA plasmid

VALIUM10 pickpocket 20 shRNA plasmid        shRNA plasmid


VALIUM20 sec71 shRNA plasmid                shRNA plasmid


VALIUM20 Bub3 shRNA plasmid                 shRNA plasmid

                                             shRNA plasmid
VALIUM1 C-terminal Binding Protein shRNA plasmid


                                             shRNA
VALIUM20 C-terminal Binding Protein shRNA plasmid plasmid

VALIUM10 CG7589 shRNA plasmid               shRNA plasmid

                                          shRNA
VALIUM10 ATP synthase-gamma chain shRNA plasmid plasmid


                                           shRNA plasmid
VALIUM20 Proteasome 54kD subunit shRNA plasmid


VALIUM20 Spt5 shRNA plasmid                 shRNA plasmid


VALIUM20 CG7627 shRNA plasmid               shRNA plasmid

VALIUM10 Neurocalcin shRNA plasmid          shRNA plasmid
VALIUM10 target of Poxn shRNA plasmid        shRNA plasmid

VALIUM10 pxt shRNA plasmid                   shRNA plasmid


VALIUM20 pxt shRNA plasmid                   shRNA plasmid


VALIUM20 pxt shRNA plasmid                   shRNA plasmid

VALIUM10 veli shRNA plasmid                  shRNA plasmid

VALIUM10 cropped shRNA plasmid               shRNA plasmid

VALIUM10 Fsh-Tsh-like receptor shRNA plasmid shRNA plasmid

VALIUM10 glass shRNA plasmid                 shRNA plasmid


VALIUM20 CG7692 shRNA plasmid                shRNA plasmid


                                            shRNA plasmid
VALIUM22 TBP-associated factor 5 shRNA plasmid

VALIUM1 CG7707 shRNA plasmid                 shRNA plasmid

VALIUM10 CG7708 shRNA plasmid                shRNA plasmid

                                               shRNA plasmid
VALIUM10 beta amyloid protein precursor-like shRNA plasmid

VALIUM10 Syntaxin 6 shRNA plasmid            shRNA plasmid

VALIUM10 CG7745 shRNA plasmid                shRNA plasmid

VALIUM10 CG7757 shRNA plasmid                shRNA plasmid

VALIUM10 pumpless shRNA plasmid              shRNA plasmid

VALIUM10 cousin of atonal shRNA plasmid      shRNA plasmid

VALIUM10 Kinesin heavy chain shRNA plasmid   shRNA plasmid


VALIUM20 piccolo shRNA plasmid               shRNA plasmid

VALIUM10 single-minded shRNA plasmid         shRNA plasmid
VALIUM20 single-minded shRNA plasmid         shRNA plasmid

VALIUM10 Enhancer of Polycomb shRNA plasmidshRNA plasmid


VALIUM22 Enhancer of Polycomb shRNA plasmidshRNA plasmid

                                              shRNA plasmid
VALIUM10 Cyclic-nucleotide-gated ion channel protein shRNA plasmid


VALIUM20 CG7787 shRNA plasmid                shRNA plasmid


VALIUM20 Ice shRNA plasmid                   shRNA plasmid


VALIUM20 Son of sevenless shRNA plasmid      shRNA plasmid

VALIUM1 Son of sevenless shRNA plasmid       shRNA plasmid

VALIUM1 Son of sevenless shRNA plasmid       shRNA plasmid

VALIUM1 Son of sevenless shRNA plasmid       shRNA plasmid

VALIUM10 CG7800 shRNA plasmid                shRNA plasmid

VALIUM1 zeste shRNA plasmid                  shRNA plasmid

VALIUM10 zeste shRNA plasmid                 shRNA plasmid


VALIUM22 zeste shRNA plasmid                 shRNA plasmid


VALIUM20 Grasp65 shRNA plasmid               shRNA plasmid

VALIUM10 black shRNA plasmid                 shRNA plasmid

VALIUM10 ran-like shRNA plasmid              shRNA plasmid


VALIUM20 CG7830 shRNA plasmid                shRNA plasmid


VALIUM20 CG7830 shRNA plasmid                shRNA plasmid
VALIUM20 lethal (3) L1231 shRNA plasmid      shRNA plasmid

VALIUM10 CG7839 shRNA plasmid                shRNA plasmid


VALIUM20 CG7840 shRNA plasmid                shRNA plasmid


VALIUM20 CG7840 shRNA plasmid                shRNA plasmid

VALIUM10 CG7841 shRNA plasmid                shRNA plasmid


VALIUM20 Ars2 shRNA plasmid                  shRNA plasmid


VALIUM22 Ars2 shRNA plasmid                  shRNA plasmid

VALIUM1 Actin-related protein 8 shRNA plasmid shRNA plasmid

VALIUM10 stripe shRNA plasmid                shRNA plasmid

VALIUM1 puckered shRNA plasmid               shRNA plasmid


VALIUM20 Sarcoglycan alpha shRNA plasmid     shRNA plasmid

                                               shRNA plasmid
VALIUM1 transient receptor potential shRNA plasmid

                                               shRNA plasmid
VALIUM1 transient receptor potential shRNA plasmid


VALIUM22 CG7878 shRNA plasmid                shRNA plasmid


                                           shRNA plasmid
VALIUM20 RNA polymerase II 33kD subunit shRNA plasmid

                                             shRNA plasmid
VALIUM10 Tachykinin-like receptor at 99D shRNA plasmid

VALIUM10 tinman shRNA plasmid                shRNA plasmid

VALIUM10 CG7896 shRNA plasmid                shRNA plasmid

VALIUM10 bagpipe shRNA plasmid               shRNA plasmid

VALIUM10 CG7906 shRNA plasmid                shRNA plasmid
VALIUM10 PP2A-B' shRNA plasmid              shRNA plasmid


VALIUM20 Nucleoplasmin shRNA plasmid        shRNA plasmid

VALIUM10 farinelli shRNA plasmid            shRNA plasmid


VALIUM20 CG7922 shRNA plasmid               shRNA plasmid

VALIUM1 Axin shRNA plasmid                  shRNA plasmid

VALIUM10 moleskin shRNA plasmid             shRNA plasmid


VALIUM20 moleskin shRNA plasmid             shRNA plasmid

VALIUM10 C15 shRNA plasmid                  shRNA plasmid


                                             shRNA plasmid
VALIUM20 Actin-related protein 5 shRNA plasmid

VALIUM10 CG7945 shRNA plasmid               shRNA plasmid

VALIUM1 spindle A shRNA plasmid             shRNA plasmid


VALIUM20 similar shRNA plasmid              shRNA plasmid


VALIUM20 similar shRNA plasmid              shRNA plasmid

VALIUM10 giant shRNA plasmid                shRNA plasmid


VALIUM20 giant shRNA plasmid                shRNA plasmid

VALIUM1 steamer duck shRNA plasmid          shRNA plasmid

VALIUM1 steamer duck shRNA plasmid          shRNA plasmid

VALIUM10 tonalli shRNA plasmid              shRNA plasmid

VALIUM10 Big brother shRNA plasmid          shRNA plasmid

VALIUM1 α-coatomer protein shRNA plasmid    shRNA plasmid

                                             shRNA
VALIUM10 CDP diglyceride synthetase shRNA plasmid plasmid
VALIUM10 RabX5 shRNA plasmid                  shRNA plasmid

                                            shRNA
VALIUM10 Autophagy-specific gene 18 shRNA plasmid plasmid


                                            shRNA
VALIUM20 Mediator complex subunit 24 shRNA plasmid plasmid

                                             shRNA plasmid
VALIUM1 rapamycin-insensitive companion of Tor shRNA plasmid

                                             shRNA plasmid
VALIUM1 rapamycin-insensitive companion of Tor shRNA plasmid

VALIUM10 CG8007 shRNA plasmid                 shRNA plasmid

VALIUM1 Su(z)12 shRNA plasmid                 shRNA plasmid


VALIUM20 Su(z)12 shRNA plasmid                shRNA plasmid


VALIUM20 CG8021 shRNA plasmid                 shRNA plasmid


VALIUM20 CG8034 shRNA plasmid                 shRNA plasmid


VALIUM20 CG8036 shRNA plasmid                 shRNA plasmid


                                           shRNA plasmid
VALIUM20 Vacuolar H[+] ATPase 44kD C subunit shRNA plasmid

                                               shRNA
VALIUM1 Eukaryotic initiation factor 1A shRNA plasmid plasmid

                                               shRNA plasmid
VALIUM10 Eukaryotic initiation factor 1A shRNA plasmid

VALIUM1 CG8067 shRNA plasmid                  shRNA plasmid

VALIUM1 CG8067 shRNA plasmid                  shRNA plasmid


                                             shRNA plasmid
VALIUM20 Suppressor of variegation 2-10 shRNA plasmid

                                             plasmid
VALIUM1 Suppressor of variegation 2-10 shRNA shRNA plasmid

                                             shRNA plasmid
VALIUM10 Suppressor of variegation 2-10 shRNA plasmid


                                             shRNA plasmid
VALIUM20 Suppressor of variegation 2-10 shRNA plasmid
VALIUM10 anachronism shRNA plasmid           shRNA plasmid

                                             shRNA
VALIUM10 tre oncogene-related protein shRNA plasmid plasmid


VALIUM20 Nedd2-like caspase shRNA plasmid    shRNA plasmid

VALIUM10 CG8092 shRNA plasmid                shRNA plasmid

VALIUM10 scab shRNA plasmid                  shRNA plasmid

VALIUM10 Picot shRNA plasmid                 shRNA plasmid


VALIUM20 Mi-2 shRNA plasmid                  shRNA plasmid

VALIUM10 Calpain-B shRNA plasmid             shRNA plasmid

VALIUM10 CG8108 shRNA plasmid                shRNA plasmid


VALIUM20 CG8108 shRNA plasmid                shRNA plasmid

VALIUM10 pebble shRNA plasmid                shRNA plasmid

VALIUM10 mastermind shRNA plasmid            shRNA plasmid


VALIUM20 HP1e shRNA plasmid                  shRNA plasmid

                                            plasmid
VALIUM10 Ecdysone-induced protein 75B shRNAshRNA plasmid

                                            plasmid
VALIUM10 Ecdysone-induced protein 75B shRNAshRNA plasmid


VALIUM20 CG8128 shRNA plasmid                shRNA plasmid

                                              shRNA
VALIUM10 ADP ribosylation factor 51F shRNA plasmid plasmid


VALIUM20 CG8165 shRNA plasmid                shRNA plasmid


VALIUM20 unc-5 shRNA plasmid                 shRNA plasmid

VALIUM1 Insulin-related peptide shRNA plasmid shRNA plasmid
                                             shRNA plasmid
VALIUM20 Insulin-related peptide shRNA plasmid

VALIUM10 double parked shRNA plasmid        shRNA plasmid

VALIUM10 Metchnikowin shRNA plasmid         shRNA plasmid

VALIUM10 Nach shRNA plasmid                 shRNA plasmid

                                            shRNA plasmid
VALIUM10 ATP synthase, subunit b shRNA plasmid


VALIUM20 par-1 shRNA plasmid                shRNA plasmid


VALIUM22 MBD-like shRNA plasmid             shRNA plasmid

VALIUM10 CG8216 shRNA plasmid               shRNA plasmid

VALIUM10 Buffy shRNA plasmid                shRNA plasmid


VALIUM20 peanuts shRNA plasmid              shRNA plasmid


VALIUM20 FBgn0033349 shRNA plasmid          shRNA plasmid

VALIUM10 CG8245 shRNA plasmid               shRNA plasmid

VALIUM10 Pox neuro shRNA plasmid            shRNA plasmid

VALIUM10 G protein γ 1 shRNA plasmid        shRNA plasmid


VALIUM20 Bx42 shRNA plasmid                 shRNA plasmid


VALIUM20 sec31 shRNA plasmid                shRNA plasmid


VALIUM20 Srp9 shRNA plasmid                 shRNA plasmid

VALIUM10 Dynamitin shRNA plasmid            shRNA plasmid

VALIUM1 CG8272 shRNA plasmid                shRNA plasmid


VALIUM20 CG8273 shRNA plasmid               shRNA plasmid
VALIUM20 Megator shRNA plasmid               shRNA plasmid

VALIUM10 Phosphodiesterase 6 shRNA plasmid shRNA plasmid


                                            shRNA
VALIUM20 Elongation factor 1alpha48D shRNA plasmid plasmid

VALIUM10 Rab-protein 8 shRNA plasmid         shRNA plasmid


VALIUM20 CG8289 shRNA plasmid                shRNA plasmid

VALIUM10 CG8290 shRNA plasmid                shRNA plasmid


                                              s
VALIUM20 Inhibitor of apoptosis 2 shRNA plasmidhRNA plasmid


VALIUM20 alpha-Tubulin at 67C shRNA plasmid shRNA plasmid


                                              shRNA plasmid
VALIUM20 Transport and Golgi organization 7 shRNA plasmid

VALIUM1 Neurofibromin 1 shRNA plasmid        shRNA plasmid

VALIUM10 Neurofibromin 1 shRNA plasmid       shRNA plasmid

                                              shRNA
VALIUM10 E(spl) region transcript mδ shRNA plasmid plasmid

VALIUM10 tomboy40 shRNA plasmid              shRNA plasmid

                                              shRNA
VALIUM10 E(spl) region transcript mγ shRNA plasmid plasmid


VALIUM20 sulfateless shRNA plasmid           shRNA plasmid

                                              shRNA
VALIUM10 E(spl) region transcript m3 shRNA plasmid plasmid

VALIUM10 Diuretic hormone shRNA plasmid      shRNA plasmid

VALIUM1 slit shRNA plasmid                   shRNA plasmid

VALIUM1 slit shRNA plasmid                   shRNA plasmid

VALIUM10 CG8359 shRNA plasmid                shRNA plasmid

                                              shRNA
VALIUM10 E(spl) region transcript m7 shRNA plasmid plasmid
                                             shRNA plasmid
VALIUM10 DNA fragmentation factor-related protein 3 shRNA plasmid

VALIUM10 Enhancer of split shRNA plasmid     shRNA plasmid


VALIUM20 CG8368 shRNA plasmid                shRNA plasmid

VALIUM10 apterous shRNA plasmid              shRNA plasmid

VALIUM1 Dopamine transporter shRNA plasmid shRNA plasmid

                                              shRNA
VALIUM10 ADP ribosylation factor 79F shRNA plasmid plasmid


                                            shRNA plasmid
VALIUM20 Proteasome beta1 subunit shRNA plasmid


VALIUM20 CG8397 shRNA plasmid                shRNA plasmid


                                             plasmid
VALIUM20 Suppressor of variegation 205 shRNA shRNA plasmid

VALIUM1 germ cell-less shRNA plasmid         shRNA plasmid


VALIUM20 germ cell-less shRNA plasmid        shRNA plasmid


VALIUM20 germ cell-less shRNA plasmid        shRNA plasmid

VALIUM10 Rho1 shRNA plasmid                  shRNA plasmid


VALIUM20 Rho1 shRNA plasmid                  shRNA plasmid

                                              shRNA plasmid
VALIUM10 Ras which interacts with Calmodulin shRNA plasmid

                                            shRNA plasmid
VALIUM10 Diuretic hormone 44 receptor 1 shRNA plasmid

VALIUM1 Juvenile hormone esterase duplication shRNA plasmid


VALIUM20 lethal (2) NC136 shRNA plasmid      shRNA plasmid


VALIUM20 lethal (2) NC136 shRNA plasmid      shRNA plasmid

                                           shRNA plasmid
VALIUM10 Small ribonucleoprotein Sm D3 shRNA plasmid
                                           shRNA plasmid
VALIUM20 Small ribonucleoprotein Sm D3 shRNA plasmid

VALIUM10 spinster shRNA plasmid               shRNA plasmid

VALIUM10 Rab escort protein shRNA plasmid     shRNA plasmid

VALIUM10 lambik shRNA plasmid                 shRNA plasmid

VALIUM10 Lissencephaly-1 shRNA plasmid        shRNA plasmid

VALIUM10 Glutamate receptor I shRNA plasmid shRNA plasmid

VALIUM10 wnt inhibitor of Dorsal shRNA plasmidshRNA plasmid

VALIUM10 wnt inhibitor of Dorsal shRNA plasmidshRNA plasmid

VALIUM10 HtrA2 shRNA plasmid                  shRNA plasmid


VALIUM20 optic atrophy 1-like shRNA plasmid   shRNA plasmid

VALIUM1 gartenzwerg shRNA plasmid             shRNA plasmid


VALIUM20 kohtalo shRNA plasmid                shRNA plasmid

                                              shRNA
VALIUM10 Helix loop helix protein 106 shRNA plasmid plasmid


                                              shRNA
VALIUM20 Helix loop helix protein 106 shRNA plasmid plasmid

VALIUM10 NK7.1 shRNA plasmid                  shRNA plasmid

VALIUM10 pickpocket 23 shRNA plasmid          shRNA plasmid

VALIUM10 Dystrobrevin-like shRNA plasmid      shRNA plasmid


VALIUM20 Dystrobrevin-like shRNA plasmid      shRNA plasmid

VALIUM10 liquid facets shRNA plasmid          shRNA plasmid

VALIUM10 scalloped shRNA plasmid              shRNA plasmid

VALIUM10 CG8546 shRNA plasmid                 shRNA plasmid

VALIUM10 karyopherin α1 shRNA plasmid         shRNA plasmid
VALIUM20 CG8557 shRNA plasmid                shRNA plasmid

VALIUM10 convoluted shRNA plasmid            shRNA plasmid

VALIUM10 unc-104 shRNA plasmid               shRNA plasmid


                                            shRNA shRNA
VALIUM20 Deformed epidermal autoregulatory factor-1 plasmidplasmid

                                            shRNA plasmid
VALIUM1 suppressor of Hairy wing shRNA plasmid


                                            shRNA plasmid
VALIUM20 suppressor of Hairy wing shRNA plasmid


                                            shRNA plasmid
VALIUM20 suppressor of Hairy wing shRNA plasmid


VALIUM20 akirin shRNA plasmid                shRNA plasmid

VALIUM1 frazzled shRNA plasmid               shRNA plasmid

VALIUM1 frazzled shRNA plasmid               shRNA plasmid

VALIUM10 I[[h]] channel shRNA plasmid        shRNA plasmid


VALIUM22 CTCF shRNA plasmid                  shRNA plasmid

VALIUM10 CG8594 shRNA plasmid                shRNA plasmid

VALIUM10 Toll-7 shRNA plasmid                shRNA plasmid

VALIUM10 lark shRNA plasmid                  shRNA plasmid

VALIUM1 eco shRNA plasmid                    shRNA plasmid


                                             plasmid
VALIUM22 Suppressor of variegation 3-7 shRNA shRNA plasmid


                                           s
VALIUM20 mutagen-sensitive 312 shRNA plasmidhRNA plasmid


                                           s
VALIUM20 mutagen-sensitive 312 shRNA plasmidhRNA plasmid

VALIUM10 Amphiphysin shRNA plasmid           shRNA plasmid
VALIUM1 RhoGEF4 shRNA plasmid                shRNA plasmid

VALIUM1 Cdc27 shRNA plasmid                  shRNA plasmid

VALIUM1 Imitation SWI shRNA plasmid          shRNA plasmid


VALIUM20 Imitation SWI shRNA plasmid         shRNA plasmid


VALIUM22 male-specific lethal 3 shRNA plasmid shRNA plasmid

VALIUM10 CG8632 shRNA plasmid                shRNA plasmid

VALIUM10 Cirl shRNA plasmid                  shRNA plasmid


VALIUM20 Cirl shRNA plasmid                  shRNA plasmid

VALIUM10 regular shRNA plasmid               shRNA plasmid


VALIUM20 Fimbrin shRNA plasmid               shRNA plasmid


VALIUM20 Fimbrin shRNA plasmid               shRNA plasmid

VALIUM1 trithorax shRNA plasmid              shRNA plasmid


VALIUM20 trithorax shRNA plasmid             shRNA plasmid

VALIUM10 nervana 3 shRNA plasmid             shRNA plasmid

VALIUM10 Tetraspanin 39D shRNA plasmid       shRNA plasmid

VALIUM10 dimmed shRNA plasmid                shRNA plasmid

VALIUM10 cryptocephal shRNA plasmid          shRNA plasmid

                                             shRNA
VALIUM10 Hormone receptor-like in 39 shRNA plasmid plasmid


                                             shRNA
VALIUM20 Hormone receptor-like in 39 shRNA plasmid plasmid

VALIUM10 CG8680 shRNA plasmid                shRNA plasmid

VALIUM10 clumsy shRNA plasmid                shRNA plasmid
VALIUM10 deadpan shRNA plasmid                shRNA plasmid

VALIUM10 peanut shRNA plasmid                 shRNA plasmid


VALIUM20 RagC shRNA plasmid                   shRNA plasmid


VALIUM20 coilin shRNA plasmid                 shRNA plasmid

VALIUM10 CG8713 shRNA plasmid                 shRNA plasmid

VALIUM10 saliva shRNA plasmid                 shRNA plasmid


VALIUM20 Nup44A shRNA plasmid                 shRNA plasmid

VALIUM10 cycle shRNA plasmid                  shRNA plasmid


VALIUM20 CG8728 shRNA plasmid                 shRNA plasmid

VALIUM10 drosha shRNA plasmid                 shRNA plasmid


VALIUM20 drosha shRNA plasmid                 shRNA plasmid


VALIUM22 drosha shRNA plasmid                 shRNA plasmid

VALIUM10 lethal (2) 44DEa shRNA plasmid       shRNA plasmid

VALIUM1 CG8734 shRNA plasmid                  shRNA plasmid

                                                shRNA plasmid
VALIUM1 transient receptor potential mucolipin shRNA plasmid

                                                shRNA plasmid
VALIUM1 transient receptor potential mucolipin shRNA plasmid


                                              shRNA plasmid
VALIUM20 small nuclear ribonucleoprotein 70K shRNA plasmid

VALIUM10 CG8765 shRNA plasmid                 shRNA plasmid


VALIUM20 CG8765 shRNA plasmid                 shRNA plasmid

VALIUM1 tafazzin shRNA plasmid                shRNA plasmid
VALIUM1 Tafazzin shRNA plasmid               shRNA plasmid

                                            shRNA
VALIUM10 G protein beta-subunit 76C shRNA plasmid plasmid

VALIUM10 tsunagi shRNA plasmid               shRNA plasmid

VALIUM10 CG8784 shRNA plasmid                shRNA plasmid

VALIUM1 Additional sex combs shRNA plasmid   shRNA plasmid

VALIUM10 CG8795 shRNA plasmid                shRNA plasmid


VALIUM20 CG8798 shRNA plasmid                shRNA plasmid

VALIUM1 CG8801 shRNA plasmid                 shRNA plasmid


VALIUM20 wunen shRNA plasmid                 shRNA plasmid


VALIUM20 wunen shRNA plasmid                 shRNA plasmid


VALIUM20 wunen-2 shRNA plasmid               shRNA plasmid


VALIUM20 wunen-2 shRNA plasmid               shRNA plasmid

VALIUM1 lush shRNA plasmid                   shRNA plasmid


VALIUM20 Sin3A shRNA plasmid                 shRNA plasmid

VALIUM10 lilliputian shRNA plasmid           shRNA plasmid


VALIUM20 lilliputian shRNA plasmid           shRNA plasmid

VALIUM10 achintya shRNA plasmid              shRNA plasmid


VALIUM20 achintya shRNA plasmid              shRNA plasmid

VALIUM10 vismay shRNA plasmid                shRNA plasmid

VALIUM10 fused lobes shRNA plasmid           shRNA plasmid
VALIUM10 sec5 shRNA plasmid                  shRNA plasmid

VALIUM10 Pdsw shRNA plasmid                  shRNA plasmid

VALIUM10 CG8852 shRNA plasmid                shRNA plasmid


VALIUM20 CG8858 shRNA plasmid                shRNA plasmid

VALIUM10 CG8861 shRNA plasmid                shRNA plasmid

                                             shRNA plasmid
VALIUM10 Ral guanine nucleotide exchange factor shRNA plasmid


                                             shRNA plasmid
VALIUM20 Ral guanine nucleotide exchange factor shRNA plasmid

VALIUM1 jetlag shRNA plasmid                 shRNA plasmid

                                            shRNA plasmid
VALIUM10 Synapse-associated protein 47kD shRNA plasmid

                                              shRNA plasmid
VALIUM1 absent, small, or homeotic discs 1 shRNA plasmid


                                              shRNA plasmid
VALIUM20 absent, small, or homeotic discs 1 shRNA plasmid

                                              shRNA plasmid
VALIUM10 absent, small, or homeotic discs 1 shRNA plasmid

                                           shRNA 2 shRNA
VALIUM10 Glyceraldehyde 3 phosphate dehydrogenase plasmid plasmid

VALIUM10 18 wheeler shRNA plasmid            shRNA plasmid

                                           shRNA
VALIUM10 Superoxide dismutase 2 (Mn) shRNA plasmidplasmid


                                           shRNA
VALIUM20 Superoxide dismutase 2 (Mn) shRNA plasmidplasmid


                                           shRNA
VALIUM20 Superoxide dismutase 2 (Mn) shRNA plasmidplasmid

VALIUM10 CG8907 shRNA plasmid                shRNA plasmid

VALIUM1 CG8909 shRNA plasmid                 shRNA plasmid

VALIUM1 CG8909 shRNA plasmid                 shRNA plasmid

                                             shRNA
VALIUM1 P-element somatic inhibitor shRNA plasmid plasmid

                                             shRNA
VALIUM1 P-element somatic inhibitor shRNA plasmid plasmid
                                             shRNA
VALIUM20 P-element somatic inhibitor shRNA plasmid plasmid


VALIUM20 CG8915 shRNA plasmid                shRNA plasmid

VALIUM10 CG8916 shRNA plasmid                shRNA plasmid

VALIUM10 CG8924 shRNA plasmid                shRNA plasmid

VALIUM10 rickets shRNA plasmid               shRNA plasmid

VALIUM10 extradenticle shRNA plasmid         shRNA plasmid

VALIUM10 Arpc3B shRNA plasmid                shRNA plasmid


                                            shRNA
VALIUM20 Heat shock protein cognate 1 shRNA plasmidplasmid

                                             shRNA
VALIUM10 Glutathione S transferase S1 shRNA plasmid plasmid

VALIUM10 nimrod C1 shRNA plasmid             shRNA plasmid

VALIUM10 CG8944 shRNA plasmid                shRNA plasmid


VALIUM20 26-29kD-proteinase shRNA plasmid shRNA plasmid

VALIUM1 Graf shRNA plasmid                   shRNA plasmid

VALIUM10 α actinin 3 shRNA plasmid           shRNA plasmid

VALIUM1 Smg5 shRNA plasmid                   shRNA plasmid

VALIUM1 teflon shRNA plasmid                 shRNA plasmid

VALIUM1 teflon shRNA plasmid                 shRNA plasmid

VALIUM1 CG8963 shRNA plasmid                 shRNA plasmid

VALIUM1 frataxin homolog shRNA plasmid       shRNA plasmid


                                             shRNA subunit
VALIUM20 Ribonucleoside diphosphate reductase small plasmid shRNA plasmid


VALIUM20 Cctgamma shRNA plasmid              shRNA plasmid
VALIUM1 Suppressor of profilin 2 shRNA plasmidshRNA plasmid


VALIUM20 ERp60 shRNA plasmid                  shRNA plasmid

                                           shRNA
VALIUM10 Dromyosuppressin receptor 1 shRNA plasmidplasmid

VALIUM1 tamas shRNA plasmid                   shRNA plasmid

VALIUM1 tamas shRNA plasmid                   shRNA plasmid


                                              shRNA
VALIUM20 Sine oculis-binding protein shRNA plasmid plasmid


VALIUM20 CG8993 shRNA plasmid                 shRNA plasmid

VALIUM10 exuperantia shRNA plasmid            shRNA plasmid

VALIUM1 CG9003 shRNA plasmid                  shRNA plasmid


VALIUM20 CG9005 shRNA plasmid                 shRNA plasmid

VALIUM10 Clathrin heavy chain shRNA plasmid shRNA plasmid

VALIUM10 engrailed shRNA plasmid              shRNA plasmid


VALIUM20 engrailed shRNA plasmid              shRNA plasmid

VALIUM10 dissatisfaction shRNA plasmid        shRNA plasmid

VALIUM10 Myb oncogene-like shRNA plasmid      shRNA plasmid

VALIUM10 Dead-box-1 shRNA plasmid             shRNA plasmid


                                             shRNA plasmid
VALIUM20 Lipid storage droplet-2 shRNA plasmid

VALIUM10 Troponin C at 47D shRNA plasmid      shRNA plasmid


                                               shRNA
VALIUM20 Eukaryotic initiation factor 4a shRNA plasmidplasmid


VALIUM20 infertile crescent shRNA plasmid     shRNA plasmid
VALIUM1 CG9086 shRNA plasmid                   shRNA plasmid

VALIUM10 little imaginal discs shRNA plasmid   shRNA plasmid

VALIUM10 little imaginal discs shRNA plasmid   shRNA plasmid

VALIUM10 Cyclin D shRNA plasmid                shRNA plasmid


VALIUM20 Cyclin D shRNA plasmid                shRNA plasmid

VALIUM1 Rab30 shRNA plasmid                    shRNA plasmid

                                               shRNA plasmid
VALIUM10 Regulator of G-protein signalling 7 shRNA plasmid

VALIUM10 AP-1γ shRNA plasmid                   shRNA plasmid

VALIUM1 myotubularin shRNA plasmid             shRNA plasmid

                                           shRNA plasmid
VALIUM10 Tryptophan hydroxylase shRNA plasmid

                                             shRNA
VALIUM10 Stromal Interaction molecule shRNA plasmid plasmid

VALIUM1 CG9135 shRNA plasmid                   shRNA plasmid

VALIUM10 CG9139 shRNA plasmid                  shRNA plasmid

VALIUM10 CG9140 shRNA plasmid                  shRNA plasmid

VALIUM1 CG9144 shRNA plasmid                   shRNA plasmid

                                          shRNA plasmid
VALIUM10 abnormal chemosensory jump 6 shRNA plasmid


                                            shRNA plasmid
VALIUM20 Protein phosphatase 1 at 13C shRNA plasmid

                                                shRNA plasmid
VALIUM10 mitochondrial acyl carrier protein 1 shRNA plasmid

VALIUM10 CNG channel-like shRNA plasmid        shRNA plasmid


VALIUM20 eIF5 shRNA plasmid                    shRNA plasmid


                                             shRNA plasmid
VALIUM20 Protein tyrosine phosphatase 61F shRNA plasmid


                                               shRNA
VALIUM20 septin interacting protein 2 shRNA plasmid plasmid
                                              shRNA
VALIUM20 Kinesin-like protein at 61F shRNA plasmid plasmid


                                           s
VALIUM20 mutagen-sensitive 209 shRNA plasmidhRNA plasmid

VALIUM10 CG9194 shRNA plasmid                shRNA plasmid

VALIUM10 Glued shRNA plasmid                 shRNA plasmid

VALIUM10 vacuolar peduncle shRNA plasmid     shRNA plasmid


                                         shRNA plasmid
VALIUM20 WD repeat domain 79 homolog shRNA plasmid

VALIUM10 fu2 shRNA plasmid                   shRNA plasmid

VALIUM1 B4 shRNA plasmid                     shRNA plasmid

VALIUM1 burgundy shRNA plasmid               shRNA plasmid

VALIUM1 CG9243 shRNA plasmid                 shRNA plasmid


VALIUM20 Aconitase shRNA plasmid             shRNA plasmid

                                             shRNA
VALIUM10 Phosphatidylinositol synthase shRNA plasmidplasmid

VALIUM1 CG9248 shRNA plasmid                 shRNA plasmid


VALIUM20 deadlock shRNA plasmid              shRNA plasmid

VALIUM10 nervana 2 shRNA plasmid             shRNA plasmid

VALIUM10 Shaker cognate l shRNA plasmid      shRNA plasmid


VALIUM20 CG9267 shRNA plasmid                shRNA plasmid


VALIUM20 CG9270 shRNA plasmid                shRNA plasmid


VALIUM20 Replication protein A2 shRNA plasmidshRNA plasmid


VALIUM20 Ribosomal protein L24 shRNA plasmidshRNA plasmid
VALIUM20 Elongin C shRNA plasmid             shRNA plasmid

                                             shRNA
VALIUM10 Hepatocyte nuclear factor 4 shRNA plasmid plasmid

VALIUM10 myopic shRNA plasmid                shRNA plasmid


VALIUM20 myopic shRNA plasmid                shRNA plasmid


VALIUM20 myopic shRNA plasmid                shRNA plasmid

VALIUM1 CG9316 shRNA plasmid                 shRNA plasmid

VALIUM10 CG9336 shRNA plasmid                shRNA plasmid

VALIUM10 CG9344 shRNA plasmid                shRNA plasmid

VALIUM1 falafel shRNA plasmid                shRNA plasmid


VALIUM20 falafel shRNA plasmid               shRNA plasmid

VALIUM10 falafel shRNA plasmid               shRNA plasmid

VALIUM10 Task7 shRNA plasmid                 shRNA plasmid


VALIUM20 rho-like shRNA plasmid              shRNA plasmid


VALIUM20 rho-like shRNA plasmid              shRNA plasmid

VALIUM10 CG9368 shRNA plasmid                shRNA plasmid

VALIUM10 Ras oncogene at 85D shRNA plasmid shRNA plasmid


VALIUM22 murashka shRNA plasmid              shRNA plasmid


VALIUM22 anti-silencing factor 1 shRNA plasmidshRNA plasmid


VALIUM20 CG9386 shRNA plasmid                shRNA plasmid

VALIUM10 AP-47 shRNA plasmid                 shRNA plasmid
VALIUM10 jing shRNA plasmid                 shRNA plasmid

VALIUM10 mago nashi shRNA plasmid           shRNA plasmid

VALIUM10 CG9411 shRNA plasmid               shRNA plasmid


VALIUM20 rasputin shRNA plasmid             shRNA plasmid

                                            shRNA plasmid
VALIUM10 X box binding protein-1 shRNA plasmid

VALIUM10 CG9418 shRNA plasmid               shRNA plasmid

VALIUM10 karyopherin α3 shRNA plasmid       shRNA plasmid


VALIUM20 CG9425 shRNA plasmid               shRNA plasmid

VALIUM1 CG9426 shRNA plasmid                shRNA plasmid


VALIUM20 Frost shRNA plasmid                shRNA plasmid

VALIUM10 CG9437 shRNA plasmid               shRNA plasmid


VALIUM20 CG9451 shRNA plasmid               shRNA plasmid

                                              shRNA
VALIUM10 Serine protease inhibitor 4 shRNA plasmid plasmid

VALIUM10 CG9454 shRNA plasmid               shRNA plasmid

VALIUM1 Serpin 42Dc shRNA plasmid           shRNA plasmid

VALIUM1 Serpin 42De shRNA plasmid           shRNA plasmid

VALIUM1 FBX011 ortholog shRNA plasmid       shRNA plasmid

VALIUM10 CG9467 shRNA plasmid               shRNA plasmid

VALIUM1 CG9472 shRNA plasmid                shRNA plasmid

VALIUM1 CG9472 shRNA plasmid                shRNA plasmid

VALIUM1 CG9472 shRNA plasmid                shRNA plasmid


                                            shRNA
VALIUM20 Mediator complex subunit 6 shRNA plasmid plasmid
VALIUM10 Synapse protein 24 shRNA plasmid   shRNA plasmid

VALIUM1 α-Tubulin at 85E shRNA plasmid      shRNA plasmid


VALIUM20 hyperplastic discs shRNA plasmid   shRNA plasmid

VALIUM1 Gef26 shRNA plasmid                 shRNA plasmid

VALIUM10 Gef26 shRNA plasmid                shRNA plasmid


VALIUM20 Pez shRNA plasmid                  shRNA plasmid


VALIUM20 Pez shRNA plasmid                  shRNA plasmid

VALIUM1 Sex comb on midleg shRNA plasmid    shRNA plasmid

VALIUM10 pickpocket 7 shRNA plasmid         shRNA plasmid

VALIUM10 pickpocket 14 shRNA plasmid        shRNA plasmid

VALIUM10 rutabaga shRNA plasmid             shRNA plasmid

VALIUM10 epsilonCOP shRNA plasmid           shRNA plasmid


VALIUM20 CG9548 shRNA plasmid               shRNA plasmid


VALIUM20 chickadee shRNA plasmid            shRNA plasmid

VALIUM10 eyes absent shRNA plasmid          shRNA plasmid

VALIUM10 alien shRNA plasmid                shRNA plasmid

VALIUM10 Rab35 shRNA plasmid                shRNA plasmid


VALIUM20 CG9581 shRNA plasmid               shRNA plasmid

VALIUM10 CG9588 shRNA plasmid               shRNA plasmid


VALIUM20 Chd3 shRNA plasmid                 shRNA plasmid
VALIUM20 CG9609 shRNA plasmid              shRNA plasmid

VALIUM10 Pox meso shRNA plasmid            shRNA plasmid

                                            shRNA plasmid
VALIUM10 Coenzyme Q biosynthesis protein 2 shRNA plasmid


VALIUM20 CG9646 shRNA plasmid              shRNA plasmid

VALIUM10 inflated shRNA plasmid            shRNA plasmid

VALIUM1 RhoGEF2 shRNA plasmid              shRNA plasmid


VALIUM20 RhoGEF2 shRNA plasmid             shRNA plasmid

VALIUM10 CG9636 shRNA plasmid              shRNA plasmid

VALIUM10 Task6 shRNA plasmid               shRNA plasmid

VALIUM1 Ada2b shRNA plasmid                shRNA plasmid


VALIUM22 Ada2b shRNA plasmid               shRNA plasmid


VALIUM20 CG9646 shRNA plasmid              shRNA plasmid

VALIUM10 Max shRNA plasmid                 shRNA plasmid

VALIUM10 CG9650 shRNA plasmid              shRNA plasmid

VALIUM1 Dopamine receptor shRNA plasmid    shRNA plasmid

VALIUM10 grain shRNA plasmid               shRNA plasmid


VALIUM20 grain shRNA plasmid               shRNA plasmid


VALIUM20 grain shRNA plasmid               shRNA plasmid


VALIUM20 grain shRNA plasmid               shRNA plasmid

VALIUM10 CG9657 shRNA plasmid              shRNA plasmid
VALIUM10 egghead shRNA plasmid              shRNA plasmid

VALIUM1 CG9667 shRNA plasmid                shRNA plasmid

VALIUM1 falten shRNA plasmid                shRNA plasmid

VALIUM1 domino shRNA plasmid                shRNA plasmid

VALIUM1 Septin 4 shRNA plasmid              shRNA plasmid

VALIUM10 Neurotactin shRNA plasmid          shRNA plasmid

VALIUM10 CG9705 shRNA plasmid               shRNA plasmid


VALIUM20 nudC shRNA plasmid                 shRNA plasmid

VALIUM10 CG9722 shRNA plasmid               shRNA plasmid

VALIUM10 CG9727 shRNA plasmid               shRNA plasmid

VALIUM1 frizzled 2 shRNA plasmid            shRNA plasmid

VALIUM1 frizzled 2 shRNA plasmid            shRNA plasmid

VALIUM10 frizzled 2 shRNA plasmid           shRNA plasmid

                                           shRNA plasmid
VALIUM10 D1 chromosomal protein shRNA plasmid


                                           shRNA plasmid
VALIUM20 D1 chromosomal protein shRNA plasmid

VALIUM10 belle shRNA plasmid                shRNA plasmid


VALIUM22 belle shRNA plasmid                shRNA plasmid


VALIUM22 belle shRNA plasmid                shRNA plasmid


VALIUM20 reptin shRNA plasmid               shRNA plasmid

VALIUM10 Adenosine receptor shRNA plasmid   shRNA plasmid

VALIUM10 pumilio shRNA plasmid              shRNA plasmid

VALIUM1 yurt shRNA plasmid                  shRNA plasmid
VALIUM10 huckebein shRNA plasmid             shRNA plasmid


VALIUM20 CG9769 shRNA plasmid                shRNA plasmid

                                              shRNA
VALIUM10 Dorsal interacting protein 2 shRNA plasmid plasmid

VALIUM1 CG9772 shRNA plasmid                 shRNA plasmid


VALIUM20 CG9772 shRNA plasmid                shRNA plasmid


VALIUM20 CG9773 shRNA plasmid                shRNA plasmid


VALIUM20 CG9775 shRNA plasmid                shRNA plasmid

VALIUM10 Synaptotagmin 14 shRNA plasmid      shRNA plasmid

VALIUM10 hunchback shRNA plasmid             shRNA plasmid


VALIUM20 CG9797 shRNA plasmid                shRNA plasmid


                                           shRNA plasmid
VALIUM20 Chromosome-associated protein shRNA plasmid

VALIUM1 eIF3-S10 shRNA plasmid               shRNA plasmid

VALIUM10 eIF3-S10 shRNA plasmid              shRNA plasmid


VALIUM20 Spargel shRNA plasmid               shRNA plasmid


VALIUM20 Spargel shRNA plasmid               shRNA plasmid

VALIUM10 endophilin B shRNA plasmid          shRNA plasmid

VALIUM1 EfSec shRNA plasmid                  shRNA plasmid

                                            shRNA plasmid
VALIUM10 Protein phosphatase 2B at 14D shRNA plasmid

VALIUM10 hiiragi shRNA plasmid               shRNA plasmid


VALIUM20 hiiragi shRNA plasmid               shRNA plasmid
                                            shRNA plasmid
VALIUM20 Protein tyrosine phosphatase-ERK/Enhancer of Ras1 shRNA plasmid


VALIUM20 Rae1 shRNA plasmid                 shRNA plasmid

VALIUM10 Odorant receptor 23a shRNA plasmid shRNA plasmid

VALIUM10 p16-ARC shRNA plasmid              shRNA plasmid


VALIUM20 decapentaplegic shRNA plasmid      shRNA plasmid

VALIUM1 decapentaplegic shRNA plasmid       shRNA plasmid

VALIUM10 decapentaplegic shRNA plasmid      shRNA plasmid

VALIUM1 decapentaplegic shRNA plasmid       shRNA plasmid

VALIUM1 decapentaplegic shRNA plasmid       shRNA plasmid


VALIUM20 decapentaplegic shRNA plasmid      shRNA plasmid


VALIUM20 decapentaplegic shRNA plasmid      shRNA plasmid


VALIUM20 decapentaplegic shRNA plasmid      shRNA plasmid


VALIUM22 decapentaplegic shRNA plasmid      shRNA plasmid

                                             shRNA plasmid
VALIUM10 Vesicular glutamate transporter shRNA plasmid

                                             shRNA plasmid
VALIUM10 Actin-related protein 14D shRNA plasmid


VALIUM20 paralytic shRNA plasmid            shRNA plasmid

VALIUM1 paralytic shRNA plasmid             shRNA plasmid

VALIUM1 paralytic shRNA plasmid             shRNA plasmid

VALIUM10 disconnected shRNA plasmid         shRNA plasmid

VALIUM10 CG9911 shRNA plasmid               shRNA plasmid
VALIUM20 Cyclophilin 1 shRNA plasmid         shRNA plasmid


VALIUM20 Cyclophilin 1 shRNA plasmid         shRNA plasmid

VALIUM10 CG9918 shRNA plasmid                shRNA plasmid

VALIUM10 CG9934 shRNA plasmid                shRNA plasmid

VALIUM10 CG9935 shRNA plasmid                shRNA plasmid

VALIUM1 Surfeit 1 shRNA plasmid              shRNA plasmid

VALIUM1 Surfeit 1 shRNA plasmid              shRNA plasmid

VALIUM1 partner of paired shRNA plasmid      shRNA plasmid

VALIUM10 maf-S shRNA plasmid                 shRNA plasmid

VALIUM10 snapin shRNA plasmid                shRNA plasmid

VALIUM10 CG9977 shRNA plasmid                shRNA plasmid

                                             shRNA plasmid
VALIUM1 Heterogeneous nuclear ribonucleoprotein at 98DE shRNA plasmid


                                            shRNA plasmid
VALIUM20 Heterogeneous nuclear ribonucleoprotein at 98DE shRNA plasmid


VALIUM20 TH1 shRNA plasmid                   shRNA plasmid

VALIUM1 Rab9 shRNA plasmid                   shRNA plasmid

VALIUM1 huntingtin shRNA plasmid             shRNA plasmid

                                                factor plasmid
VALIUM10 U2 small nuclear riboprotein auxiliaryshRNA 50 shRNA plasmid

                                             plasmid
VALIUM10 Ran GTPase activating protein shRNA shRNA plasmid

                                           shRNA plasmid
VALIUM10 putative noncoding RNA 003:2L shRNA plasmid

VALIUM10 RNA on the X 2 shRNA plasmid        shRNA plasmid

VALIUM1 RNA on the X 2 shRNA plasmid         shRNA plasmid

VALIUM10 swallow pseudogene shRNA plasmid shRNA plasmid
VALIUM1 RNA on the X 1 shRNA plasmid      shRNA plasmid

VALIUM10 RNA on the X 1 shRNA plasmid     shRNA plasmid


VALIUM22 RNA on the X 1 shRNA plasmid     shRNA plasmid

VALIUM10 Uhg3 shRNA plasmid               shRNA plasmid

                                           shRNA plasmid
VALIUM10 putative noncoding RNA 002:3R shRNA plasmid

                                           shRNA plasmid
VALIUM10 putative noncoding RNA 004:X shRNA plasmid

                                           shRNA plasmid
VALIUM10 putative noncoding RNA 016:2R shRNA plasmid

                                           shRNA plasmid
VALIUM10 putative noncoding RNA 014:3L shRNA plasmid

                                           shRNA plasmid
VALIUM10 putative noncoding RNA 017:3R shRNA plasmid

                                           shRNA plasmid
VALIUM10 putative noncoding RNA 008:3L shRNA plasmid

                                           shRNA plasmid
VALIUM10 putative noncoding RNA 011:3L shRNA plasmid

                                           shRNA plasmid
VALIUM10 putative noncoding RNA 015:3L shRNA plasmid


VALIUM22 tre-1 shRNA plasmid              shRNA plasmid
                                                                    Insert
                                                                    Sequence
Additional        Construct                                         Accession
name              BACKBONE Construct insert                         number

free text (e.g.
PPARg C-
ternimal
deletion;
PPARg
deletion          free text (e.g.
domain D)         pCMV)           free text (e.g. PPARg)
                  VALIUM10        Focal Adhesion Kinase             FBgn0020440

                  VALIUM20       Focal Adhesion Kinase              FBgn0020440


                  VALIUM22       Focal Adhesion Kinase              FBgn0020440


                  VALIUM1        foraging                           FBgn0000721

                  VALIUM1        foraging                           FBgn0000721

                  VALIUM22       foraging                           FBgn0000721


                  VALIUM20       Epidermal growth factor receptor   FBgn0003731


                  VALIUM1        Epidermal growth factor receptor   FBgn0003731

                  VALIUM10       Epidermal growth factor receptor   FBgn0003731

                  VALIUM1        Epidermal growth factor receptor   FBgn0003731

                  VALIUM1        Epidermal growth factor receptor   FBgn0003731

                  VALIUM20       Epidermal growth factor receptor   FBgn0003731


                  VALIUM20                                          FBgn0034644

                                 CG10082
VALIUM20                               FBgn0034644

           CG10082
VALIUM22                               FBgn0034644

           CG10082
VALIUM10   CG10177                     FBgn0039083

VALIUM10   Cad96Ca                     FBgn0022800

VALIUM22                               FBgn0040335

           CG10260
VALIUM10   atypical protein kinase C   FBgn0022131

VALIUM22                               FBgn0032811

           CG10268
VALIUM10   PAK-kinase                  FBgn0014001

VALIUM22   PAK-kinase                  FBgn0014001


VALIUM10   cdc2c                       FBgn0004107

VALIUM20   cdc2c                       FBgn0004107


VALIUM22   cdc2c                       FBgn0004107


VALIUM22   Integrin linked kinase      FBgn0028427


VALIUM10   Protein kinase C delta      FBgn0259680

VALIUM20   RPS6-p70-protein kinase     FBgn0015806


VALIUM22   RPS6-p70-protein kinase     FBgn0015806


VALIUM20   Nipped-A                    FBgn0053554


VALIUM22   Cyclin-dependent kinase 8   FBgn0015618
VALIUM22   Bifunctional Phosphopantetheine       FBgn0035632
           adenylyltransferase - Dephospho-CoA
           kinase
VALIUM10   Ecdysone-induced protein 63E          FBgn0005640

VALIUM20   Ecdysone-induced protein 63E          FBgn0005640


VALIUM22   Ecdysone-induced protein 63E          FBgn0005640


VALIUM22   Numb-associated kinase                FBgn0015772


VALIUM22                                         FBgn0032752

           CG10702
VALIUM10                                         FBgn0036368
           CG10738
VALIUM10   wishful thinking                      FBgn0024179

VALIUM22   loki                                  FBgn0019686


VALIUM10   four-jointed                          FBgn0000658

VALIUM20                                         FBgn0034356

           CG10924
VALIUM1    ether a go-go                         FBgn0000535

VALIUM1    ether a go-go                         FBgn0000535

VALIUM10   Autophagy-specific gene 1             FBgn0260945

VALIUM22   Autophagy-specific gene 1             FBgn0260945


VALIUM1    MLF1-adaptor molecule                 FBgn0027497

VALIUM22   MLF1-adaptor molecule                 FBgn0027497


VALIUM10   auxillin                              FBgn0037218

VALIUM22   auxillin                              FBgn0037218
VALIUM10   CG11221                             FBgn0031855

VALIUM10   hippo                               FBgn0034453

VALIUM22                                       FBgn0036337

           CG11255
VALIUM22   pan gu                              FBgn0000826


VALIUM1    Phosphotidylinositol 3 kinase 68D   FBgn0015278

VALIUM22   Phosphotidylinositol 3 kinase 68D   FBgn0015278


VALIUM22                                       FBgn0036187

           CG11660
VALIUM22                                       FBgn0036099

           CG11811
VALIUM22                                       FBgn0039306

           CG11859
VALIUM22                                       FBgn0037804

           CG43143
VALIUM10                                       FBgn0037804
           CG43143
VALIUM22   par-1                               FBgn0002716,FBgn0260934


VALIUM10   tango                               FBgn0015014

VALIUM1    cAMP-dependent protein kinase 2     FBgn0000274

VALIUM1    cAMP-dependent protein kinase 2     FBgn0000274

VALIUM10   CG12069                             FBgn0039796

VALIUM10   warts                               FBgn0011739

VALIUM20   warts                               FBgn0011739


VALIUM22   warts                               FBgn0011739
VALIUM10   Protein kinase 61C            FBgn0020386

VALIUM10   mrityu                        FBgn0035107

VALIUM22   mrityu                        FBgn0035107


VALIUM1    licorne                       FBgn0015763

VALIUM20   polo                          FBgn0003124


VALIUM22   polo                          FBgn0003124


VALIUM20   polychaetoid                  FBgn0003165,FBgn0003177


VALIUM20   Tousled-like kinase           FBgn0086899


VALIUM1    rolled                        FBgn0003256

VALIUM1    rolled                        FBgn0003256

VALIUM20   rolled                        FBgn0003256


VALIUM22   rolled                        FBgn0003256


VALIUM22                                 FBgn0035392

           CG1271
VALIUM22                                 FBgn0025640

           CG13369
VALIUM22                                 FBgn0027507

           CG1344
VALIUM22   cdc2-related-kinase           FBgn0013435


VALIUM22   Ipk2                          FBgn0031267


VALIUM20   TGF-beta activated kinase 1   FBgn0026323
VALIUM20   torso                                  FBgn0003733


VALIUM21   torso                                  FBgn0003733


VALIUM22   torso                                  FBgn0003733


VALIUM1    thickveins                             FBgn0003716

VALIUM1    thickveins                             FBgn0003716

VALIUM22   thickveins                             FBgn0003716


VALIUM22   Bub1 homologue                         FBgn0031696


VALIUM1    Tao-1                                  FBgn0031030

VALIUM22   Tao-1                                  FBgn0031030


VALIUM10   Ret oncogene                           FBgn0011829

VALIUM22   Pak3                                   FBgn0044826


VALIUM10   Calcium/calmodulin-dependent protein   FBgn0016126
           kinase I
VALIUM22   Calcium/calmodulin-dependent protein   FBgn0016126
           kinase I

VALIUM10   Ack                                    FBgn0028484

VALIUM20   Ack                                    FBgn0028484


VALIUM20   Ack                                    FBgn0028484


VALIUM22   Ack                                    FBgn0028484


VALIUM10   CG15072                                FBgn0034376
VALIUM22                                      FBgn0034376

           CG42856
VALIUM10   Eph receptor tyrosine kinase       FBgn0025936

VALIUM22   Eph receptor tyrosine kinase       FBgn0025936


VALIUM1    Casein kinase II β subunit         FBgn0000259

VALIUM20   Casein kinase II beta subunit      FBgn0000259


VALIUM1    Downstream of raf1                 FBgn0010269

VALIUM10   Downstream of raf1                 FBgn0010269

VALIUM20   Downstream of raf1                 FBgn0010269


VALIUM20   Downstream of raf1                 FBgn0010269


VALIUM21   Downstream of raf1                 FBgn0010269


VALIUM22   Downstream of raf1                 FBgn0010269


VALIUM20   Downstream of raf1                 FBgn0010269


VALIUM10   cAMP-dependent protein kinase R2   FBgn0022382

VALIUM1    hopscotch                          FBgn0004864

VALIUM1    hopscotch                          FBgn0004864

VALIUM20   hopscotch                          FBgn0004864


VALIUM22   Gcn2                               FBgn0019990


VALIUM22   Ceramide kinase                    FBgn0037315
VALIUM22   kenny                                    FBgn0041205


VALIUM22   misshapen                                FBgn0010909


VALIUM10   misshapen                                FBgn0010909

VALIUM22   homeodomain interacting protein kinase   FBgn0035142


VALIUM22   Adenylate kinase-1                       FBgn0022709


VALIUM10   grapes                                   FBgn0261278

VALIUM22   grapes                                   FBgn0261278


VALIUM22   KP78b                                    FBgn0026063


VALIUM10   KP78b                                    FBgn0026063

VALIUM10   discs large 1                            FBgn0001624

VALIUM1    discs large 1                            FBgn0001624

VALIUM1    discs large 1                            FBgn0001624

VALIUM20   discs large 1                            FBgn0001624


VALIUM22   discs large 1                            FBgn0001624


VALIUM10   Nek2                                     FBgn0029970

VALIUM22   Nek2                                     FBgn0029970


VALIUM10   SNF4/AMP-activated protein kinase        FBgn0025803
           gamma subunit
VALIUM22   SNF4/AMP-activated protein kinase        FBgn0025803
           gamma subunit

VALIUM1    discs large 1                            FBgn0001624
VALIUM10   Lk6                                    FBgn0017581

VALIUM22   Lk6                                    FBgn0017581


VALIUM10   derailed                               FBgn0015380

VALIUM22                                          FBgn0039924

           CG17471
VALIUM1    Casein kinase II α subunit             FBgn0000258

VALIUM22   Casein kinase II alpha subunit         FBgn0000258


VALIUM10   CG17528                                FBgn0261387

VALIUM22   doughnut on 2                          FBgn0024245


VALIUM10   RPS6-protein kinase-II                 FBgn0011285

VALIUM22   RPS6-protein kinase-II                 FBgn0011285


VALIUM20   TBP-associated factor 1                FBgn0010355


VALIUM22   TBP-associated factor 1                FBgn0010355


VALIUM20   G protein-coupled receptor kinase 2    FBgn0004834


VALIUM22   G protein-coupled receptor kinase 2    FBgn0004834


VALIUM10   Calcium/calmodulin-dependent protein   FBgn0004624
           kinase II
VALIUM22   Calcium/calmodulin-dependent protein   FBgn0004624
           kinase II

VALIUM1    sevenless                              FBgn0003366

VALIUM1    sevenless                              FBgn0003366

VALIUM20   sevenless                              FBgn0003366
VALIUM10   Src homology 2, ankyrin repeat, tyrosine   FBgn0015295
           kinase
VALIUM22   Src homology 2, ankyrin repeat, tyrosine   FBgn0015295
           kinase

VALIUM10   Stretchin-Mlck                             FBgn0013988

VALIUM10   Stretchin-Mlck                             FBgn0013988

VALIUM22   Phosphorylase kinase gamma                 FBgn0011754


VALIUM22   Glycerol kinase                            FBgn0025592


VALIUM1    Insulin-like receptor                      FBgn0013984

VALIUM1    Insulin-like receptor                      FBgn0013984

VALIUM22   Insulin-like receptor                      FBgn0013984


VALIUM10   LIM-kinase1                                FBgn0041203

VALIUM10   LIM-kinase1                                FBgn0041203

VALIUM1    TGF-β activated kinase 1                   FBgn0026323

VALIUM1    TGF-β activated kinase 1                   FBgn0026323

VALIUM22   TGF-beta activated kinase 1                FBgn0026323


VALIUM22   Ady43A                                     FBgn0026602


VALIUM10   mushroom bodies tiny                       FBgn0025743

VALIUM22   mushroom bodies tiny                       FBgn0025743


VALIUM10   Furin 2                                    FBgn0004598

VALIUM10   Dopamine receptor 2                        FBgn0015129

VALIUM22   saxophone                                  FBgn0003317
VALIUM1    sallimus                                FBgn0086906

VALIUM1    sallimus                                FBgn0086906

VALIUM22                                           FBgn0039623

           CG1951
VALIUM10   Protein C kinase 98E                    FBgn0003093

VALIUM22   Protein C kinase 98E                    FBgn0003093


VALIUM20   yata                                    FBgn0260990


VALIUM20   yata                                    FBgn0260990


VALIUM10   Casein kinase Iα                        FBgn0015024

VALIUM22   Casein kinase Ialpha                    FBgn0015024


VALIUM1    discs overgrown                         FBgn0002413

VALIUM10   discs overgrown                         FBgn0002413

VALIUM22   discs overgrown                         FBgn0002413


VALIUM10   Protein kinase related to protein kinase N FBgn0020621

VALIUM22   Protein kinase related to protein kinase N FBgn0020621


VALIUM22   pancreatic eIF-2alpha kinase            FBgn0037327


VALIUM20   abnormal wing discs                     FBgn0000150


VALIUM22   abnormal wing discs                     FBgn0000150


VALIUM22   female sterile (1) homeotic             FBgn0004656
VALIUM20   slipper                    FBgn0030018


VALIUM22   slipper                    FBgn0030018


VALIUM20                              FBgn0030384

           CG2577
VALIUM22   IkappaB kinase-like 2      FBgn0086657


VALIUM1    shaggy                     FBgn0003371

VALIUM1    shaggy                     FBgn0003371

VALIUM22   shaggy                     FBgn0003371


VALIUM1    pole hole                  FBgn0003079

VALIUM1    pole hole                  FBgn0003079

VALIUM22                              FBgn0014930

           CG2846
VALIUM20   kinase suppressor of ras   FBgn0015402


VALIUM22   kinase suppressor of ras   FBgn0015402


VALIUM22   Pi4KIIalpha                FBgn0037339


VALIUM22   Hexokinase A               FBgn0001186


VALIUM1    CG3008                     FBgn0031643

VALIUM22                              FBgn0031643

           CG3008
VALIUM22   Ipk1                       FBgn0050295


VALIUM10   Magi                       FBgn0034590
VALIUM22   Magi                                    FBgn0034590


VALIUM20   Magi                                    FBgn0034590


VALIUM10   SNF1A/AMP-activated protein kinase      FBgn0023169

VALIUM20   SNF1A/AMP-activated protein kinase      FBgn0023169


VALIUM22   SNF1A/AMP-activated protein kinase      FBgn0023169


VALIUM1    aurora                                  FBgn0000147

VALIUM22   aurora                                  FBgn0000147


VALIUM22   MAP kinase activated protein-kinase-2   FBgn0013987


VALIUM10   CG3105                                  FBgn0034950

VALIUM22   Wsck                                    FBgn0046685


VALIUM10                                           FBgn0051183
           CG31183
VALIUM10   Phosphoglycerate kinase                 FBgn0250906

VALIUM20   Phosphoglycerate kinase                 FBgn0250906


VALIUM20   Phosphoglycerate kinase                 FBgn0250906


VALIUM22   Phosphoglycerate kinase                 FBgn0250906


VALIUM10   polychaetoid                            FBgn0003177

VALIUM22   polychaetoid                            FBgn0003177


VALIUM22   Adenylate kinase-2                      FBgn0022708
VALIUM1    Tak1-like 1                               FBgn0046689

VALIUM22                                             FBgn0051431

           CG31431
VALIUM22   twinfilin                                 FBgn0038206


VALIUM20                                             FBgn0260750

           CG31873
VALIUM1    bent                                      FBgn0005666

VALIUM1    bent                                      FBgn0005666

VALIUM22   Arginine kinase                           FBgn0000116


VALIUM10   Arginine kinase                           FBgn0000116

VALIUM10                                             FBgn0034568
           CG3216
VALIUM22   Myt1                                      FBgn0040298


VALIUM22   Sphingosine kinase 2                      FBgn0052484


VALIUM22                                             FBgn0052649,FBgn0052650

           CG32649
VALIUM10   CG32666                                   FBgn0052666

VALIUM22                                             FBgn0052666

           Death-associated protein kinase related
VALIUM20                                             FBgn0052703

           CG32703
VALIUM22   stardust                                  FBgn0243505


VALIUM22   Smg1                                      FBgn0052743


VALIUM1    Smg1                                      FBgn0052743

VALIUM10   CG32944                                   FBgn0052944
VALIUM22   Cyclin-dependent kinase 7             FBgn0015617


VALIUM10   cGMP-dependent protein kinase 21D     FBgn0000442

VALIUM20   Unc-89                                FBgn0053519


VALIUM1    Nipped-A                              FBgn0053554

VALIUM22                                         FBgn0061359

           CG33671
VALIUM22   6-phosphofructo-2-kinase              FBgn0027621


VALIUM1    CG34123                               FBgn0083959

VALIUM1    CG34123                               FBgn0083959

VALIUM22                                         FBgn0083959

           trpm
VALIUM10   retinal degeneration A                FBgn0085373

VALIUM10                                         FBgn0085390
           Diacyl glycerol kinase
VALIUM22   Tousled-like kinase                   FBgn0086899


VALIUM1    Tousled-like kinase                   FBgn0086899

VALIUM10   Tousled-like kinase                   FBgn0086899

VALIUM22                                         FBgn0038463

           CG3534
VALIUM22                                         FBgn0035039

           CG3608
VALIUM22   Cyclin-dependent kinase subunit 30A   FBgn0010314


VALIUM22                                         FBgn0038279

           CG3837
VALIUM10   Derailed 2                            FBgn0033791
VALIUM10   Fak-like tyrosine kinase               FBgn0013955

VALIUM22   Fak-like tyrosine kinase               FBgn0013955


VALIUM22   Phosphofructokinase                    FBgn0003071


VALIUM1    Akt1                                   FBgn0010379

VALIUM20   Akt1                                   FBgn0010379


VALIUM22   Akt1                                   FBgn0010379


VALIUM22   Haspin                                 FBgn0046706


VALIUM22   genghis khan                           FBgn0023081


VALIUM10   G protein-coupled receptor kinase 1    FBgn0260798

VALIUM22   G protein-coupled receptor kinase 1    FBgn0260798


VALIUM1    Inositol 1,4,5-triphosphate kinase 1   FBgn0032147

VALIUM22   Inositol 1,4,5-triphosphate kinase 1   FBgn0032147


VALIUM10   Ste20-like kinase                      FBgn0046692

VALIUM22   Ste20-like kinase                      FBgn0046692


VALIUM10   Abl tyrosine kinase                    FBgn0000017

VALIUM22   Abl tyrosine kinase                    FBgn0000017


VALIUM22                                          FBgn0029736

           CG4041
VALIUM22   Dyrk3                                  FBgn0027101
VALIUM10   Pi3K92E                           FBgn0015279

VALIUM22   immune response deficient 5       FBgn0024222


VALIUM10   minibrain                         FBgn0259168

VALIUM1    minibrain                         FBgn0259168

VALIUM22   minibrain                         FBgn0259168


VALIUM22   C-terminal Src kinase             FBgn0259217


VALIUM22   Darkener of apricot               FBgn0259220


VALIUM10   CG42347                           FBgn0259678

VALIUM10                                     FBgn0259712
           CG42366
VALIUM20                                     FBgn0259712,FBgn0259713

           CG42366
VALIUM22   meiotic 41                        FBgn0004367


VALIUM22   Pitslre                           FBgn0016696


VALIUM10   hemipterous                       FBgn0010303

VALIUM22   hemipterous                       FBgn0010303


VALIUM1    cAMP-dependent protein kinase 1   FBgn0000273

VALIUM1    cAMP-dependent protein kinase 1   FBgn0000273

VALIUM22   cAMP-dependent protein kinase 1   FBgn0000273


VALIUM22   wee                               FBgn0011737


VALIUM22   PTEN-induced putative kinase 1    FBgn0029891
VALIUM1    PTEN-induced putative kinase 1              FBgn0029891

VALIUM1    PTEN-induced putative kinase 1              FBgn0029891

VALIUM22   Sterile20-like kinase                       FBgn0035001


VALIUM22   ire-1                                       FBgn0038736


VALIUM10   CG4629                                      FBgn0031299

VALIUM20   Protein kinase at 92B                       FBgn0014006


VALIUM22   Protein kinase at 92B                       FBgn0014006


VALIUM22   lethal (2) k01209                           FBgn0022029


VALIUM10   CG4839                                      FBgn0032187

VALIUM22   Selenophosphate synthetase 2                FBgn0032224


VALIUM10   Cyclin-dependent kinase 4                   FBgn0016131

VALIUM22   Cyclin-dependent kinase 4                   FBgn0016131


VALIUM10   eag-like K+ channel                         FBgn0011589

VALIUM20   Target of rapamycin                         FBgn0021796


VALIUM20   Target of rapamycin                         FBgn0021796


VALIUM22   Target of rapamycin                         FBgn0021796


VALIUM10   neither inactivation nor afterpotential C   FBgn0002938

VALIUM20                                               FBgn0035957

           CG5144
VALIUM22                                       FBgn0035957

           CG5144
VALIUM1    Germinal centre kinase III          FBgn0086736

VALIUM22   Germinal centre kinase III          FBgn0086736


VALIUM22   Cyclin-dependent kinase 9           FBgn0019949


VALIUM10   bonus                               FBgn0023097

VALIUM10   Inverted repeat-binding protein     FBgn0011774

VALIUM22   Inverted repeat-binding protein     FBgn0011774


VALIUM22                                       FBgn0035950

           CG5288
VALIUM22   nmdyn-D6                            FBgn0030573


VALIUM22   cdc2                                FBgn0004106


VALIUM10   cdc2                                FBgn0004106

VALIUM20   Phosphotidylinositol 3 kinase 59F   FBgn0015277


VALIUM22   Phosphotidylinositol 3 kinase 59F   FBgn0015277


VALIUM10   Cdk5 activator-like protein         FBgn0027491

VALIUM22   tribbles                            FBgn0028978


VALIUM22   deoxyribonucleoside kinase          FBgn0022338


VALIUM10   Mpk2                                FBgn0015765

VALIUM22   Mpk2                                FBgn0015765
VALIUM20   Leucine-rich repeat kinase        FBgn0038816


VALIUM22   Leucine-rich repeat kinase        FBgn0038816


VALIUM22                                     FBgn0036266

           CG5626
VALIUM1    basket                            FBgn0000229

VALIUM1    basket                            FBgn0000229

VALIUM20   Basket                            FBgn0000229


VALIUM22   fumble                            FBgn0011205


VALIUM22                                     FBgn0034299

           CG5757
VALIUM22   pelle                             FBgn0010441


VALIUM10   center divider                    FBgn0004876

VALIUM22   center divider                    FBgn0004876


VALIUM10   AP-2σ                             FBgn0043012

VALIUM22   Dak1                              FBgn0028833


VALIUM10   cAMP-dependent protein kinase 3   FBgn0000489

VALIUM10   CG6218                            FBgn0038321

VALIUM1    Cyclin T                          FBgn0025455

VALIUM20   Cyclin T                          FBgn0025455


VALIUM22   Cyclin T                          FBgn0025455
VALIUM22   JIL-1                                 FBgn0020412


VALIUM10   Ca2+-channel-protein-beta-subunit     FBgn0259822

VALIUM10   NADH:ubiquinone reductase 42kD subunit FBgn0019957
           precursor
VALIUM20   NADH:ubiquinone reductase 42kD subunit FBgn0019957
           precursor

VALIUM20   NADH:ubiquinone reductase 42kD subunit FBgn0019957
           precursor

VALIUM22                                         FBgn0028741

           fab1
VALIUM22                                         FBgn0039179

           CG6364
VALIUM1    ballchen                              FBgn0027889

VALIUM22   ballchen                              FBgn0027889


VALIUM10   CG6498                                FBgn0036511

VALIUM22                                         FBgn0036511

           CG6498
VALIUM1    inactivation no afterpotential C      FBgn0004784

VALIUM1    inactivation no afterpotential C      FBgn0004784

VALIUM20   inactivation no afterpotential C      FBgn0004784


VALIUM20   inactivation no afterpotential C      FBgn0004784


VALIUM10   Signal transducing adaptor molecule   FBgn0027363

VALIUM1    telomere fusion                       FBgn0045035

VALIUM22   telomere fusion                       FBgn0045035


VALIUM1    fused                                 FBgn0001079
VALIUM1    fused                                  FBgn0001079

VALIUM22   fused                                  FBgn0001079


VALIUM10   IplI-aurora-like kinase                FBgn0024227

VALIUM22   IplI-aurora-like kinase                FBgn0024227


VALIUM10   Protein C kinase 53E                   FBgn0003091

VALIUM10   Calcium/calmodulin-dependent protein   FBgn0013759
           kinase
VALIUM20   Calcium/calmodulin-dependent protein   FBgn0013759
           kinase

VALIUM22   Calcium/calmodulin-dependent protein   FBgn0013759
           kinase

VALIUM10   Slowpoke binding protein               FBgn0024290

VALIUM10   abnormal spindle                       FBgn0000140

VALIUM22   abnormal spindle                       FBgn0000140


VALIUM10   gilgamesh                              FBgn0250823

VALIUM22   gilgamesh                              FBgn0250823


VALIUM10   Protein kinase-like 17E                FBgn0004462

VALIUM22   Protein kinase-like 17E                FBgn0004462


VALIUM1    four wheel drive                       FBgn0004373

VALIUM10   four wheel drive                       FBgn0004373

VALIUM22   four wheel drive                       FBgn0004373


VALIUM22                                          FBgn0027587

           CG7028
VALIUM22   Pyruvate kinase             FBgn0003178


VALIUM22   happyhour                   FBgn0034421


VALIUM10   Protein Kinase D            FBgn0038603

VALIUM22                               FBgn0038588

           CG7156
VALIUM22   Sak kinase                  FBgn0026371


VALIUM22                               FBgn0027569

           ceramide transfer protein
VALIUM10   CG7236                      FBgn0031730

VALIUM22                               FBgn0036942

           CG7328
VALIUM20                               FBgn0038258

           CG7362
VALIUM10   p38b                        FBgn0024846

VALIUM22   p38b                        FBgn0024846


VALIUM20                               FBgn0036742

           CG7497
VALIUM10   Src oncogene at 64B         FBgn0003501

VALIUM22   Src oncogene at 64B         FBgn0003501


VALIUM20                               FBgn0037093

           Cdk12
VALIUM22                               FBgn0037093

           Cdk12
VALIUM22                               FBgn0036142

           CG7616
VALIUM22   altered disjunction        FBgn0000063


VALIUM22   frayed                     FBgn0023083


VALIUM10   Mekk1                      FBgn0024329

VALIUM22   greatwall                  FBgn0260399


VALIUM20   greatwall                  FBgn0260399


VALIUM22   Bub1-related kinase        FBgn0025458


VALIUM10   nemo                       FBgn0011817

VALIUM22   nemo                       FBgn0011817


VALIUM10   punt                       FBgn0003169

VALIUM22   punt                       FBgn0003169


VALIUM10   similar                    FBgn0015542

VALIUM22                              FBgn0035266

           CG7995
VALIUM10   lightoid                   FBgn0002567

VALIUM10   Btk family kinase at 29A   FBgn0003502

VALIUM22   Btk family kinase at 29A   FBgn0003502


VALIUM20   alicorn                    FBgn0260972


VALIUM22   alicorn                    FBgn0260972


VALIUM1    CG8173                     FBgn0030864
VALIUM22                                    FBgn0030864

           CG8173
VALIUM22   SRPK                             FBgn0026370


VALIUM10   Cyclin-dependent kinase 5        FBgn0013762

VALIUM22   Cyclin-dependent kinase 5        FBgn0013762


VALIUM10   baboon                           FBgn0011300

VALIUM22   baboon                           FBgn0011300


VALIUM10   Alk                              FBgn0040505

VALIUM20                                    FBgn0033673

           CG8298
VALIUM22                                    FBgn0034141

           CG8311
VALIUM22   nmdyn-D7                         FBgn0028997


VALIUM22   PAPS synthetase                  FBgn0020389


VALIUM22                                    FBgn0033915

           CG8485
VALIUM10   Selenide,water dikinase          FBgn0261270

VALIUM22   Selenide,water dikinase          FBgn0261270


VALIUM10   tricornered                      FBgn0003744

VALIUM22   tricornered                      FBgn0003744


VALIUM22   Diacyl glycerol kinase epsilon   FBgn0020930


VALIUM22                                    FBgn0033244

           CG8726
VALIUM10   cycle                           FBgn0023094

VALIUM10   Guanylyl cyclase at 76C         FBgn0261360

VALIUM22   mos                             FBgn0033773


VALIUM10   wallenda                        FBgn0036896

VALIUM22   wallenda                        FBgn0036896


VALIUM10   Pyruvate dehydrogenase kinase   FBgn0017558

VALIUM22   Pyruvate dehydrogenase kinase   FBgn0017558


VALIUM22   Adenylate kinase 6              FBgn0033754


VALIUM22                                   FBgn0037679

           CG8866
VALIUM20   Fps oncogene analog             FBgn0000723


VALIUM22                                   FBgn0027504

           CG8878
VALIUM10   off-track                       FBgn0004839

VALIUM10   off-track                       FBgn0004839

VALIUM10   varicose                        FBgn0250785

VALIUM22   varicose                        FBgn0250785


VALIUM22   lkb1                            FBgn0038167


VALIUM22   MAP kinase kinase 4             FBgn0024326


VALIUM20   immune response deficient 1     FBgn0260935
VALIUM22   immune response deficient 1            FBgn0260935


VALIUM10   Rho-kinase                             FBgn0026181

VALIUM22   Rho-kinase                             FBgn0026181


VALIUM10                                          FBgn0085386
           CG34357
VALIUM20                                          FBgn0031451

           CG9961
VALIUM10   skittles                               FBgn0016984

VALIUM22   skittles                               FBgn0016984


VALIUM1    CG18854                                FBgn0042174

VALIUM22                                          FBgn0042174

           CR18854
VALIUM10   Allatostatin Receptor 2                FBgn0039595

VALIUM10   fork head                              FBgn0000659

VALIUM20   forkhead                               FBgn0000659


VALIUM10   brother of odd with entrails limited   FBgn0004893

VALIUM10   traffic jam                            FBgn0000964

VALIUM20   traffic jam                            FBgn0000964


VALIUM10   ventral veins lacking                  FBgn0086680

VALIUM10   rhomboid                               FBgn0004635

VALIUM10   MBD-R2                                 FBgn0038016

VALIUM20   rho-type guanine exchange factor       FBgn0015803


VALIUM10   Synaptotagmin IV                       FBgn0028400
VALIUM10   Retinal Homeobox                     FBgn0020617

VALIUM1    G protein αi subunit 65A             FBgn0001104

VALIUM1    Actin 57B                            FBgn0000044

VALIUM10   extra macrochaetae                   FBgn0000575

VALIUM10   spire                                FBgn0003475

VALIUM20                                        FBgn0035720

           CR18854
VALIUM20                                        FBgn0035720

           CG10077
VALIUM10   second mitotic wave missing          FBgn0002044

VALIUM20                                        FBgn0035713

           CG10107
VALIUM10   phyllopod                            FBgn0013725

VALIUM10   pale                                 FBgn0005626

VALIUM1    Lamin C                              FBgn0010397

VALIUM10   zero population growth               FBgn0024177

VALIUM10   transformer 2                        FBgn0003742

VALIUM10                                        FBgn0032798
           CG10132
VALIUM20                                        FBgn0036366

           CG10133
VALIUM10   CG10137                              FBgn0032800

VALIUM10   M-spondin                            FBgn0020269

VALIUM10                                        FBgn0035702
           CG10147
VALIUM10   Proteasome p44.5 subunit             FBgn0028689

VALIUM10   CG10151                              FBgn0033960

VALIUM20   Sprouty-related protein with EVH-1   FBgn0020767
           domain
VALIUM10   Boundary element-associated factor of   FBgn0015602
           32kD
VALIUM20   Ecdysone-inducible gene L3              FBgn0001258


VALIUM20                                           FBgn0035697

           CG10163
VALIUM10   CG10164                                 FBgn0039088

VALIUM1    CG10168                                 FBgn0039087

VALIUM10   Microfibril-associated protein 1        FBgn0035294

VALIUM10   Nuclear transport factor-2-related      FBgn0032680

VALIUM10   Multiple drug resistance 65             FBgn0004513

VALIUM20                                           FBgn0032796

           CG10188
VALIUM1    Muscle LIM protein at 84B               FBgn0014863

VALIUM10   knot                                    FBgn0001319

VALIUM10   Nup98                                   FBgn0039120

VALIUM10   CG10200                                 FBgn0033968

VALIUM10   CG10205                                 FBgn0033970

VALIUM20   Na[+]-dependent inorganic phosphate     FBgn0016684
           cotransporter

VALIUM20   SMC2                                    FBgn0027783


VALIUM1    Topoisomerase 2                         FBgn0003732

VALIUM20   Pcf11                                   FBgn0022063


VALIUM10   katanin 60                              FBgn0040208

VALIUM20   Rpn9                                    FBgn0028691


VALIUM10   Laminin A                               FBgn0002526
VALIUM20   Cyp6a17                   FBgn0015714


VALIUM20                             FBgn0027596

           CG10249
VALIUM10   nautilus                  FBgn0002922

VALIUM10   Lap1                      FBgn0033984

VALIUM10   CG10267                   FBgn0037446

VALIUM20   D19A                      FBgn0022935


VALIUM1    grappa                    FBgn0014963,FBgn0053324

VALIUM1    grappa                    FBgn0014963,FBgn0053324

VALIUM20                             FBgn0014963,FBgn0053324

           grappa
VALIUM10   CG10274                   FBgn0035690

VALIUM1    kon-tiki                  FBgn0032683

VALIUM20   GATAe                     FBgn0038391


VALIUM20   GATAe                     FBgn0038391


VALIUM1    Rm62                      FBgn0003261

VALIUM20   Rm62                      FBgn0003261


VALIUM10   Antennapedia              FBgn0260642

VALIUM20                             FBgn0035688

           CG10289
VALIUM10   Sex combs reduced         FBgn0003339

VALIUM1    bicoid stability factor   FBgn0032679

VALIUM1    bicoid stability factor   FBgn0032679
VALIUM20   bicoid stability factor                   FBgn0032679


VALIUM20   Ribosomal protein S26                     FBgn0004413


VALIUM10   poils au dos                              FBgn0038418

VALIUM10   CG10321                                   FBgn0034643

VALIUM10   abdominal A                               FBgn0000014

VALIUM10   TBPH                                      FBgn0025790

VALIUM20                                             FBgn0032690

           CG10333
VALIUM10   spitz                                     FBgn0005672

VALIUM20   spitz                                     FBgn0005672


VALIUM10   bicoid                                    FBgn0000166

VALIUM10   neuropeptide F                            FBgn0027109

VALIUM20                                             FBgn0034729

           CG10344
VALIUM10   CG10348                                   FBgn0032707

VALIUM20   refractory to sigma P                     FBgn0003231


VALIUM20   refractory to sigma P                     FBgn0003231


VALIUM10   CG10366                                   FBgn0032814

VALIUM10   Inwardly rectifying potassium channel 3   FBgn0032706

VALIUM20   Tat-binding protein-1                     FBgn0028684


VALIUM1    Heterogeneous nuclear ribonucleoprotein   FBgn0004838
           at 27C
VALIUM1    Heterogeneous nuclear ribonucleoprotein   FBgn0004838
           at 27C
VALIUM20   Heterogeneous nuclear ribonucleoprotein   FBgn0004838
           at 27C

VALIUM20   myoblast city                             FBgn0015513


VALIUM20   myoblast city                             FBgn0015513


VALIUM10   wrapper                                   FBgn0025878

VALIUM1    male-specific lethal 1                    FBgn0005617

VALIUM22   male-specific lethal 1                    FBgn0005617


VALIUM20   tosca                                     FBgn0015553


VALIUM10   Ultrabithorax                             FBgn0003944

VALIUM20                                             FBgn0032691

           CG10414
VALIUM10                                             FBgn0036277
           CG10418
VALIUM20                                             FBgn0039296

           CG10420
VALIUM20   bag of marbles                            FBgn0000158


VALIUM20                                             FBgn0036273

           CG10426
VALIUM1    daughter of sevenless                     FBgn0016794

VALIUM10   CG10440                                   FBgn0034636

VALIUM20   Leukocyte-antigen-related-like            FBgn0000464


VALIUM10   zerknullt                                 FBgn0004053

VALIUM20   zerknult 1                                FBgn0004053


VALIUM10   crammer                                   FBgn0034443
VALIUM10                                 FBgn0032815
           CG10462
VALIUM10   CG10465                       FBgn0033017

VALIUM1    CG10478                       FBgn0035657

VALIUM20   zerknult 2                    FBgn0004054


VALIUM20                                 FBgn0035649

           CG10483
VALIUM10   eyegone                       FBgn0000625

VALIUM10   Netrin-B                      FBgn0015774

VALIUM1    parkin                        FBgn0041100

VALIUM20   female sterile (2) ltoPP43    FBgn0004811


VALIUM1    Resistant to dieldrin         FBgn0004244

VALIUM1    Resistant to dieldrin         FBgn0004244

VALIUM1    capping protein alpha         FBgn0034577

VALIUM1    Bre1                          FBgn0086694

VALIUM10   Bre1                          FBgn0086694

VALIUM10                                 FBgn0034570
           CG10543
VALIUM1    G protein β-subunit 13F       FBgn0001105

VALIUM10   Serotonin receptor 2          FBgn0087012

VALIUM10   CG10566                       FBgn0037050

VALIUM20   Mediator complex subunit 31   FBgn0037262


VALIUM10   araucan                       FBgn0015904

VALIUM20   DnaJ-like-1                   FBgn0015657
VALIUM20   DnaJ-like-1                               FBgn0015657


VALIUM10   ripped pocket                             FBgn0022981

VALIUM10   fringe                                    FBgn0011591

VALIUM10   dachs                                     FBgn0086896

VALIUM20   dachs                                     FBgn0086896


VALIUM10   mirror                                    FBgn0014343

VALIUM10   brain-specific homeobox                   FBgn0000529

VALIUM1    Odorant receptor 83b                      FBgn0037324

VALIUM1    Odorant receptor 83b                      FBgn0037324

VALIUM10   Synaptotagmin 12                          FBgn0261085

VALIUM10   Leucokinin receptor                       FBgn0035610

VALIUM10   Inositol 1,4,5,-tris-phosphate receptor   FBgn0010051

VALIUM20                                             FBgn0035608

           CG10630
VALIUM10   CG10631                                   FBgn0032817

VALIUM20   Snf5-related 1                            FBgn0011715


VALIUM1    CG10641                                   FBgn0032731

VALIUM1    lamina ancestor                           FBgn0016031

VALIUM10   CG10654                                   FBgn0036294

VALIUM10   Shaker cognate b                          FBgn0003383

VALIUM10                                             FBgn0039329
           CG10669
VALIUM20                                             FBgn0035588

           CG10672
VALIUM20   Nedd8                                 FBgn0032725


VALIUM20   rhino                                 FBgn0004400


VALIUM22   rhino                                 FBgn0004400


VALIUM10   trailer hitch                         FBgn0041775

VALIUM10   Asparaginyl-tRNA synthetase           FBgn0086443

VALIUM20   lethal (2) 37Cc                       FBgn0002031


VALIUM20   lethal (2) 37Cc                       FBgn0002031


VALIUM1    slowpoke                              FBgn0003429

VALIUM1    slowpoke                              FBgn0003429

VALIUM10   slowpoke                              FBgn0003429

VALIUM10   Dopa decarboxylase                    FBgn0000422

VALIUM10   GRHRII                                FBgn0036278

VALIUM10   Lim3                                  FBgn0002023

VALIUM20   Lim3                                  FBgn0002023


VALIUM1    Moesin                                FBgn0011661

VALIUM10   Moesin                                FBgn0011661

VALIUM20   Moesin                                FBgn0011661


VALIUM10   twin of eyg                           FBgn0036285

VALIUM10   small conductance calcium-activated   FBgn0029761
           potassium channel
VALIUM10   E2F transcription factor 2            FBgn0024371

VALIUM10   nebbish                               FBgn0004374
VALIUM10   brain tumor                                   FBgn0010300

VALIUM20   brain tumor                                   FBgn0010300


VALIUM10   Arrowhead                                     FBgn0013751

VALIUM1    flare                                         FBgn0260049

VALIUM20   barren                                        FBgn0014127


VALIUM20                                                 FBgn0036373

           CG10741
VALIUM10   roadblock                                     FBgn0024196

VALIUM20   small nuclear ribonucleoprotein at 69D        FBgn0016940


VALIUM10   Gbeta5                                        FBgn0030011

VALIUM10   Furin 1                                       FBgn0004509

VALIUM10   Diptericin B                                  FBgn0034407

VALIUM10   diminutive                                    FBgn0000472

VALIUM10   diminutive                                    FBgn0000472

VALIUM10   CG10804                                       FBgn0029663

VALIUM20   Rheb                                          FBgn0041191


VALIUM20   eukaryotic translation initiation factor 4G   FBgn0023213


VALIUM10                                                 FBgn0033830
           CG10814
VALIUM10   SIFamide receptor                             FBgn0038880

VALIUM20   SIFamide receptor                             FBgn0038880


VALIUM10   CG10830                                       FBgn0038839

VALIUM10   Contactin                                     FBgn0037240
VALIUM20   Contactin                     FBgn0037240


VALIUM1    Ryanodine receptor 44F        FBgn0011286

VALIUM1    Ryanodine receptor 44F        FBgn0011286

VALIUM10   Ryanodine receptor 44F        FBgn0011286

VALIUM10   Ryanodine receptor 44F        FBgn0011286

VALIUM10   dynactin-subunit-p25          FBgn0040228

VALIUM20   imaginal discs arrested       FBgn0041147


VALIUM1    CG10855                       FBgn0035461

VALIUM10   CG10858                       FBgn0035458

VALIUM10   Autophagy-specific gene 12    FBgn0036255

VALIUM20                                 FBgn0027552

           CG10863
VALIUM10   CG10864                       FBgn0038621

VALIUM10   oo18 RNA-binding protein      FBgn0004882

VALIUM1    Rhodopsin 3                   FBgn0003249

VALIUM1    Rhodopsin 3                   FBgn0003249

VALIUM1    toutatis                      FBgn0033636

VALIUM10   CG1090                        FBgn0037238

VALIUM10   oskar                         FBgn0003015

VALIUM20                                 FBgn0034308

           CG10915
VALIUM10   Kinesin-like protein at 67A   FBgn0004379

VALIUM20   Proteasome alpha5 subunit     FBgn0016697
VALIUM20   Ribosomal protein S6               FBgn0004922


VALIUM10   dpr14                              FBgn0029974

VALIUM10   CG10949                            FBgn0032858

VALIUM10   Arc-p34                            FBgn0032859

VALIUM1    Rtf1                               FBgn0034722

VALIUM20   Rtf1                               FBgn0034722


VALIUM10   CG10959                            FBgn0030010

VALIUM20                                      FBgn0036316

           CG10960
VALIUM20   TNF-receptor-associated factor 6   FBgn0026318


VALIUM10   sniffer                            FBgn0030026

VALIUM20   Huntingtin interacting protein 1   FBgn0036309


VALIUM10   Protein tyrosine phosphatase 69D   FBgn0014007

VALIUM10   CG10979                            FBgn0037379

VALIUM1    lethal (1) discs degenerate 4      FBgn0001612

VALIUM10   Dynamin associated protein 160     FBgn0023388

VALIUM10                                      FBgn0030521
           CG10992
VALIUM20   Caf1-180                           FBgn0030521


VALIUM20   ryder cup                          FBgn0031142


VALIUM20   Rpn5                               FBgn0028690


VALIUM20                                      FBgn0036318

           CG11009
VALIUM1    no mechanoreceptor potential C     FBgn0016920

VALIUM1    no mechanoreceptor potential C     FBgn0016920

VALIUM10   ADP ribosylation factor 102F       FBgn0013749

VALIUM1    CG11033                            FBgn0037659

VALIUM20                                      FBgn0037659

           CG11033
VALIUM1    CG11044                            FBgn0034484

VALIUM10   shaven                             FBgn0005561

VALIUM1    CG1105                             FBgn0037465

VALIUM1    CG1105                             FBgn0037465

VALIUM10   Neuropeptide-like precursor 2      FBgn0040813

VALIUM10   calsyntenin-1                      FBgn0039928

VALIUM1    Gelsolin                           FBgn0010225

VALIUM10   Activin-beta                       FBgn0024913

VALIUM20                                      FBgn0030530

           Ajuba LIM protein
VALIUM10   Retinoid- and fatty acid-binding   FBgn0087002
           glycoprotein
VALIUM20   Retinoid- and fatty acid-binding   FBgn0087002
           glycoprotein

VALIUM10   scarface                           FBgn0033033

VALIUM10   CG11071                            FBgn0030532

VALIUM1    CG11077                            FBgn0039930

VALIUM10   plexin A                           FBgn0025741

VALIUM20   prickle                            FBgn0003090


VALIUM1    CG11092                            FBgn0027537
VALIUM20                                          FBgn0027537

           CG11092
VALIUM20                                          FBgn0027537

           CG11092
VALIUM10   doublesex                              FBgn0000504

VALIUM20   Mes2                                   FBgn0037207


VALIUM10   CG11105                                FBgn0030281

VALIUM10   retinal degeneration B                 FBgn0003218

VALIUM10   Ssl1                                   FBgn0037202

VALIUM20   alpha-Esterase-7                       FBgn0015575


VALIUM10   sine oculis                            FBgn0003460

VALIUM10   CG11134                                FBgn0030518

VALIUM10   Leucine-rich tendon-specific protein   FBgn0034540

VALIUM10   metabotropic glutamate receptor        FBgn0019985

VALIUM20   metabotropic glutamate receptor        FBgn0019985


VALIUM10                                          FBgn0039936
           CG11148
VALIUM10   Sox102F                                FBgn0039938

VALIUM10   ATP synthase-beta                      FBgn0010217

VALIUM10                                          FBgn0039927
           CG11155
VALIUM10   CG11163                                FBgn0025693

VALIUM10   ubisnap                                FBgn0034913

VALIUM10   CG11180                                FBgn0034528

VALIUM10   cup                                    FBgn0000392

VALIUM10   twin of eyeless                        FBgn0019650
VALIUM20   twin of eyeless                        FBgn0019650


VALIUM10   Hairy/E(spl)-related with YRPW motif   FBgn0027788

VALIUM1    CG11198                                FBgn0033246

VALIUM10   photorepair                            FBgn0003082

VALIUM10   CG11206                                FBgn0034720

VALIUM10   fascetto                               FBgn0030241

VALIUM10   pickpocket 6                           FBgn0034489

VALIUM10   Ptc-related                            FBgn0033068

VALIUM10   Calcineurin B2                         FBgn0015614

VALIUM20   hippo                                  FBgn0034453


VALIUM22   hippo                                  FBgn0034453


VALIUM10                                          FBgn0037120
           CG11247
VALIUM20   maelstrom                              FBgn0016034


VALIUM22   maelstrom                              FBgn0016034


VALIUM10   MICAL-like                             FBgn0036333

VALIUM10   tartan                                 FBgn0010452

VALIUM10   capricious                             FBgn0023095

VALIUM10   CG1129                                 FBgn0037279

VALIUM10   enoki mushroom                         FBgn0034975

VALIUM10                                          FBgn0034889
           CG11293
VALIUM10   CG11294                                FBgn0030058
VALIUM20   polar granule component                    FBgn0016053


VALIUM20   polar granule component                    FBgn0016053


VALIUM10   scratch                                    FBgn0004880

VALIUM1    Sirt7                                      FBgn0039631

VALIUM20   Sirt7                                      FBgn0039631


VALIUM10   CG11317                                    FBgn0039816

VALIUM10   homer                                      FBgn0025777

VALIUM10   Gonadotropin-releasing hormone receptor FBgn0025595

VALIUM10   Thrombospondin                             FBgn0031850

VALIUM10   CG11340                                    FBgn0039840

VALIUM10   nicotinic Acetylcholine Receptor beta 64B FBgn0000038

VALIUM10   Lim1                                       FBgn0026411

VALIUM20   polybromo                                  FBgn0039227


VALIUM10   CG11376                                    FBgn0031216

VALIUM10   cut                                        FBgn0004198

VALIUM20   cut                                        FBgn0004198


VALIUM20   gluon                                      FBgn0015391


VALIUM20                                              FBgn0040366

           CG11398
VALIUM10   A3-3                                       FBgn0028550

VALIUM1    unconventional prefoldin RPB5 interactor   FBgn0035025
VALIUM20                                           FBgn0034231

           Anaphase promoting complex subunit 10
VALIUM10   ruby                                    FBgn0003210

VALIUM20   ruby                                    FBgn0003210


VALIUM1    CG11437                                 FBgn0037165

VALIUM20   lazaro                                  FBgn0037163


VALIUM10   CG11448                                 FBgn0024985

VALIUM10   net                                     FBgn0002931

VALIUM20                                           FBgn0031228

           CG11455
VALIUM10   CG11456                                 FBgn0037031

VALIUM10   neuropeptide F receptor                 FBgn0037408

VALIUM20   Mlh1                                    FBgn0011659


VALIUM10   MstProx                                 FBgn0015770

VALIUM20                                           FBgn0031233

           CG11490
VALIUM20   broad                                   FBgn0000210


VALIUM10   broad                                   FBgn0000210

VALIUM10   BTB-protein-VII                         FBgn0012049

VALIUM10   BTB-protein-VII                         FBgn0012049

VALIUM10   rasp                                    FBgn0024194

VALIUM10   seven up                                FBgn0003651

VALIUM10                                           FBgn0039733
           CG11504
VALIUM1    armitage                                FBgn0041164
VALIUM20   armitage                             FBgn0041164


VALIUM22   armitage                             FBgn0041164


VALIUM10   Protein tyrosine phosphatase 99A     FBgn0004369

VALIUM20   Ribosomal protein L6                 FBgn0039857


VALIUM10   Cyclin G                             FBgn0039858

VALIUM1    Tiggrin                              FBgn0011722

VALIUM10   CG11534                              FBgn0046296

VALIUM10   CG11550                              FBgn0039864

VALIUM10   intermediate neuroblasts defective   FBgn0025776

VALIUM10   Rabphilin                            FBgn0030230

VALIUM10                                        FBgn0036249
           CG11560
VALIUM10   smoothened                           FBgn0003444

VALIUM10                                        FBgn0039882
           CG11576
VALIUM1    armadillo                            FBgn0000117

VALIUM1    armadillo                            FBgn0000117

VALIUM20                                        FBgn0030543

           CG11585
VALIUM10   VhaM9.7-1                            FBgn0028664

VALIUM20                                        FBgn0035488

           CG11593
VALIUM20   Ubiquitin-63E                        FBgn0003943


VALIUM20   steppke                              FBgn0086779


VALIUM10   pou domain motif 3                   FBgn0033288
VALIUM10   Abdominal B                                 FBgn0000015

VALIUM1    CG11658                                     FBgn0036196

VALIUM20   Neural conserved at 73EF                    FBgn0010352


VALIUM10   Ras oncogene at 64B                         FBgn0003206

VALIUM10   7B2                                         FBgn0041707

VALIUM20   maleless                                    FBgn0002774


VALIUM10   CG11696                                     FBgn0030314

VALIUM20   -                                           FBgn0029856


VALIUM10   Adipokinetic hormone-like                   FBgn0004552

VALIUM20   Adipokinetic hormone                        FBgn0004552


VALIUM10   Cyp4g15                                     FBgn0030304

VALIUM10   -                                           FBgn0037777

VALIUM10   CG11723                                     FBgn0031391

VALIUM20   Peroxiredoxin 2540                          FBgn0033518,FBgn0033520


VALIUM10   Hormone receptor-like in 96                 FBgn0015240

VALIUM20   Superoxide dismutase                        FBgn0003462


VALIUM10   Superoxide dismutase                        FBgn0003462

VALIUM10   charlatan                                   FBgn0015371

VALIUM10   Mnf                                         FBgn0036134

VALIUM10   nicotinic acetylcholine receptor beta 21C   FBgn0031261

VALIUM20   Band4.1 inhibitor LRP interactor            FBgn0039282
VALIUM20   Nup358                        FBgn0039302


VALIUM20   Nup358                        FBgn0039302


VALIUM10   Cullin-3                      FBgn0261268

VALIUM1    CG11866                       FBgn0033486

VALIUM20                                 FBgn0039633

           CG11873
VALIUM1    CG11882                       FBgn0039642

VALIUM20   Rpn2                          FBgn0028692


VALIUM10   CG11891                       FBgn0039309

VALIUM10   starry night                  FBgn0024836

VALIUM10   CG11902                       FBgn0028647

VALIUM10   CG11906                       FBgn0034425

VALIUM10   CG11910                       FBgn0039332

VALIUM20                                 FBgn0039274

           CG11920
VALIUM10   forkhead domain 96Cb          FBgn0004898

VALIUM20   katanin p60-like 1            FBgn0037375


VALIUM10   amnesiac                      FBgn0086782

VALIUM20   skpC                          FBgn0026175


VALIUM10   coracle                       FBgn0010434

VALIUM20                                 FBgn0037647

           RagA
VALIUM10   Enhancer of variegation 3-9   FBgn0260243
VALIUM20   Proteasome beta3 subunit                 FBgn0026380


VALIUM20                                            FBgn0037655

           CG11984
VALIUM20                                            FBgn0040534

           CG11985
VALIUM10   neuralized                               FBgn0002932

VALIUM1    hyrax                                    FBgn0037657

VALIUM22   hyrax                                    FBgn0037657


VALIUM10   Relish                                   FBgn0014018

VALIUM20   Relish                                   FBgn0014018


VALIUM10   Adenosine deaminase                      FBgn0037661

VALIUM20                                            FBgn0037312

           CG11999
VALIUM10   APP-like protein interacting protein 1   FBgn0040281

VALIUM20   Proteasome beta7 subunit                 FBgn0250746


VALIUM20   karst                                    FBgn0004167


VALIUM20                                            FBgn0035444

           CG12012
VALIUM10   PHGPx                                    FBgn0035438

VALIUM20   PHGPx                                    FBgn0035438


VALIUM10   RabX6                                    FBgn0035155

VALIUM10   Cdc37                                    FBgn0011573

VALIUM10   Patj                                     FBgn0067864
VALIUM10                                      FBgn0035454
           CG12029
VALIUM20   Mediator complex subunit 14        FBgn0035145


VALIUM10   CG12038                            FBgn0035179

VALIUM10   mushroom body defect               FBgn0002873,FBgn0260482

VALIUM10   pickpocket 21                      FBgn0039675

VALIUM10                                      FBgn0032915
           CG12050
VALIUM10   longitudinals lacking              FBgn0005630

VALIUM10   CG12061                            FBgn0040031

VALIUM20                                      FBgn0030052

           CG12065
VALIUM10   CG12071                            FBgn0039808

VALIUM10   Serotonin receptor 7               FBgn0004573

VALIUM20   Serotonin receptor 7               FBgn0004573


VALIUM10                                      FBgn0035402
           CG12082
VALIUM20                                      FBgn0043458

           CG12084
VALIUM10   poly U binding factor 68kD         FBgn0028577

VALIUM20   poly U binding factor 68kD         FBgn0028577


VALIUM10   Palmitoyl-protein thioesterase 1   FBgn0030057

VALIUM10   Caf1-180                           FBgn0030054

VALIUM20   Caf1-180                           FBgn0030054


VALIUM20   Phospholipase D                    FBgn0033075


VALIUM10   Sepiapterin reductase              FBgn0014032
VALIUM10   multi sex combs                    FBgn0260789

VALIUM20   multi sex combs                    FBgn0260771,FBgn0260789


VALIUM20                                      FBgn0033473

           CG12128
VALIUM20   c12.1                              FBgn0040235


VALIUM20   Lysyl-tRNA synthetase              FBgn0027084


VALIUM10   Tetraspanin 42Ej                   FBgn0033132

VALIUM20   NELF-B                             FBgn0027553


VALIUM22   Hira                               FBgn0022786


VALIUM10   CG12155                            FBgn0029957

VALIUM10   Rab39                              FBgn0029959

VALIUM10   Translocase of outer membrane 40   FBgn0016041

VALIUM20                                      FBgn0260462

           CG12163
VALIUM20                                      FBgn0260462

           CG12163
VALIUM22   Inner centromere protein           FBgn0260991


VALIUM10   Na[+]/H[+] hydrogen exchanger 1    FBgn0026787

VALIUM20   Ring and YY1 Binding Protein       FBgn0034763


VALIUM10   dpr20                              FBgn0035170

VALIUM20                                      FBgn0037970

           CG12201
VALIUM10   miple                              FBgn0027111
VALIUM10   pebbled                       FBgn0003053

VALIUM20   pebbled                       FBgn0003053


VALIUM20   pebbled                       FBgn0003053


VALIUM10   CG12219                       FBgn0043796

VALIUM10   Dorsal switch protein 1       FBgn0011764

VALIUM20   Spt6                          FBgn0028982


VALIUM20   carnation                     FBgn0000257


VALIUM10   G protein α 73B               FBgn0010223

VALIUM10                                 FBgn0029822
           CG12236
VALIUM20   enhancer of yellow 3          FBgn0087008


VALIUM10   CG12239                       FBgn0029810

VALIUM20                                 FBgn0038304

           CG12241
VALIUM22   licorne                       FBgn0015763


VALIUM1    glial cells missing           FBgn0014179

VALIUM1    glial cells missing           FBgn0014179

VALIUM10   glial cells missing           FBgn0014179

VALIUM20   miranda                       FBgn0021776


VALIUM20                                 FBgn0035026

           Fcp1
VALIUM20   Mediator complex subunit 25   FBgn0038760
VALIUM20                                     FBgn0035811

           CG12262
VALIUM20                                     FBgn0035811

           CG12262
VALIUM20                                     FBgn0032393

           CG12264
VALIUM10   Aos1                              FBgn0029512

VALIUM20   thread                            FBgn0260635


VALIUM10   POU domain protein 2              FBgn0004394

VALIUM10                                     FBgn0039419
           CG12290
VALIUM10   straightjacket                    FBgn0261041

VALIUM10   klumpfuss                         FBgn0013469

VALIUM20   BG4                               FBgn0038928


VALIUM10   subito                            FBgn0003545

VALIUM20                                     FBgn0032295

           CG12299
VALIUM10   CG12301                           FBgn0036514

VALIUM22   zucchini                          FBgn0261266


VALIUM22   zucchini                          FBgn0261266


VALIUM10   temperature-induced paralytic E   FBgn0003710

VALIUM20   Proteasome beta5 subunit          FBgn0029134


VALIUM20   Ribosomal protein S15Ab           FBgn0033555


VALIUM10                                     FBgn0035137
           CG1233
VALIUM10   Autophagy-specific gene 8b                 FBgn0038539

VALIUM20                                              FBgn0027499

           windei
VALIUM10   CG12344                                    FBgn0033558

VALIUM10   Choline acetyltransferase                  FBgn0000303,FBgn0015323

VALIUM1    Shaker                                     FBgn0003380

VALIUM20   cap binding protein 20                     FBgn0022943


VALIUM1    Ulp1                                       FBgn0027603

VALIUM20   piRNA methyltransferase                    FBgn0033686


VALIUM22   piRNA methyltransferase                    FBgn0033686


VALIUM10   Lachesin                                   FBgn0010238

VALIUM10   CG12370                                    FBgn0033744

VALIUM1    spt4                                       FBgn0028683

VALIUM20   spt4                                       FBgn0028683


VALIUM10   defective in the avoidance of repellents   FBgn0015582

VALIUM10                                              FBgn0033581
           CG12391
VALIUM1    CG12393                                    FBgn0031768

VALIUM1    CG12393                                    FBgn0031768

VALIUM20                                              FBgn0031768

           CG12393
VALIUM20                                              FBgn0031768

           CG12393
VALIUM1    Mothers against dpp                        FBgn0011648

VALIUM1    Mothers against dpp                        FBgn0011648
VALIUM1    CG12402                                 FBgn0038202

VALIUM10   Autophagy-specific gene 2               FBgn0044452

VALIUM10   nicotinic Acetylcholine Receptor alpha 80B FBgn0037212

VALIUM20   Heat shock protein 83                   FBgn0001233


VALIUM20   Heat shock protein 83                   FBgn0001233


VALIUM10   CG12432                                 FBgn0030843

VALIUM1    raw                                     FBgn0003209

VALIUM20                                           FBgn0035357

           MEP-1
VALIUM20   Mediator complex subunit 27             FBgn0037359


VALIUM10   CG12455                                 FBgn0028859

VALIUM10   stoned B                                FBgn0016975

VALIUM20   sec23                                   FBgn0037357


VALIUM10   Arc1                                    FBgn0033926

VALIUM10   Cdc42                                   FBgn0010341

VALIUM1    Β Adaptin                               FBgn0010380

VALIUM10   Beta Adaptin                            FBgn0010380

VALIUM10   no mechanoreceptor potential B          FBgn0016919

VALIUM10   CG12594                                 FBgn0037941

VALIUM10   Adenosine deaminase acting on RNA       FBgn0026086

VALIUM10   CG33967                                 FBgn0053967

VALIUM1    CG12602                                 FBgn0032373

VALIUM10   CG12605                                 FBgn0035481
VALIUM10   labial                                    FBgn0002522

VALIUM10   CG12645                                   FBgn0030181

VALIUM10   buttonhead                                FBgn0000233

VALIUM10                                             FBgn0040929
           CG12659
VALIUM10   olf413                                    FBgn0037153

VALIUM10   Checkpoint suppressor homologue           FBgn0029504

VALIUM1    CG12736                                   FBgn0033184

VALIUM20   Calmodulin-binding protein related to a   FBgn0025864
           Rab3 GDP/GTP exchange protein

VALIUM20   ovarian tumor                             FBgn0003023


VALIUM1    Heterogeneous nuclear ribonucleoprotein   FBgn0004237
           at 87F
VALIUM1    Heterogeneous nuclear ribonucleoprotein   FBgn0004237
           at 87F
VALIUM20   lethal (3) malignant blood neoplasm       FBgn0002440


VALIUM20   Eaf6                                      FBgn0035624


VALIUM20   Eaf6                                      FBgn0035624


VALIUM1    CG12765                                   FBgn0033813

VALIUM10   Dorsal interacting protein 3              FBgn0040465

VALIUM10                                             FBgn0037206
           CG12768
VALIUM10   CG12769                                   FBgn0033252

VALIUM10   CG12783                                   FBgn0038448

VALIUM10   scavenger receptor acting in neural tissue FBgn0025697
           and majority of rhodopsin is absent

VALIUM20   la costa                                  FBgn0028583
VALIUM10   CG12796                         FBgn0029909

VALIUM10   nervous fingers 2               FBgn0041105

VALIUM20   Fancl                           FBgn0037781


VALIUM20   slender lobes                   FBgn0037810


VALIUM10   CG12858                         FBgn0033958

VALIUM1    Su(var)2-HP2                    FBgn0026427

VALIUM10   Su(var)2-HP2                    FBgn0026427

VALIUM20   ALG-2 interacting protein X     FBgn0086346


VALIUM10   barentsz                        FBgn0045862

VALIUM20                                   FBgn0039540

           CG12879
VALIUM20   mitochondrial carnitine         FBgn0027842
           palmitoyltransferase I

VALIUM20   mitochondrial carnitine         FBgn0027842
           palmitoyltransferase I

VALIUM10   CG12942                         FBgn0033569

VALIUM10   salivary gland-expressed bHLH   FBgn0037672

VALIUM10   CG1299                          FBgn0035501

VALIUM10   Neuropeptide-like precursor 3   FBgn0042201

VALIUM20                                   FBgn0032050

           CG13096
VALIUM10   taiman                          FBgn0041092

VALIUM20   taiman                          FBgn0041092


VALIUM10   CG13114                         FBgn0032127
VALIUM10   CG13120                          FBgn0032142

VALIUM10   CG13121                          FBgn0032145

VALIUM10                                    FBgn0032150
           CG13096
VALIUM10   CG13139                          FBgn0032230

VALIUM22   cutoff                           FBgn0260932


VALIUM22   cutoff                           FBgn0260932


VALIUM10                                    FBgn0033627
           CG13204
VALIUM10   Odorant receptor 47b             FBgn0026385

VALIUM10   no mechanoreceptor potential A   FBgn0016047

VALIUM1                                     FBgn0033609
           fbl6
VALIUM10   Zn finger homeodomain 1          FBgn0004606

VALIUM10   CG13229                          FBgn0033579

VALIUM20                                    FBgn0028903

           CG13243
VALIUM10   CG13248                          FBgn0036984

VALIUM10   CG13253                          FBgn0037015

VALIUM10                                    FBgn0261068
           LSm7
VALIUM10   CAS/CSE1 segregation protein     FBgn0022213

VALIUM1    CG13298                          FBgn0035692

VALIUM10   putative noncoding RNA 013:4     FBgn0041005

VALIUM10   Mnt                              FBgn0023215

VALIUM1    Insulin-like peptide 7           FBgn0044046

VALIUM20   Insulin-like peptide 7           FBgn0044046
VALIUM1    tumbleweed                    FBgn0086356

VALIUM1    tumbleweed                    FBgn0086356

VALIUM1    tumbleweed                    FBgn0086356

VALIUM10   tumbleweed                    FBgn0086356

VALIUM20                                 FBgn0033890

           CG13350
VALIUM20   Suv4-20                       FBgn0025639


VALIUM20   pepsinogen-like               FBgn0011822


VALIUM20   pepsinogen-like               FBgn0011822


VALIUM1    embargoed                     FBgn0020497

VALIUM20   embargoed                     FBgn0020497


VALIUM10   A kinase anchor protein 200   FBgn0027932

VALIUM20   Ribosomal protein S13         FBgn0010265


VALIUM1    Chrac-14                      FBgn0043002

VALIUM20   Rpt1                          FBgn0028687


VALIUM10   bursicon                      FBgn0038901

VALIUM20   Argonaute 2                   FBgn0087035


VALIUM10   HGTX                          FBgn0040318

VALIUM10   Leucokinin                    FBgn0028418

VALIUM1    dj-1β                         FBgn0039802

VALIUM1    roundabout                    FBgn0005631
VALIUM1    roundabout                    FBgn0005631

VALIUM10   CG13532                       FBgn0034788

VALIUM20                                 FBgn0040660

           CG13551
VALIUM10   CG13568                       FBgn0034965

VALIUM1    spaghetti                     FBgn0015544

VALIUM10   CG13575                       FBgn0034996

VALIUM10   CG13579                       FBgn0035010

VALIUM10   ion transport peptide         FBgn0035023

VALIUM10                                 FBgn0039137
           CG13604
VALIUM10   CG13624                       FBgn0039209

VALIUM10   Syntaxin 18                   FBgn0039212

VALIUM10   Allatostatin                  FBgn0015591

VALIUM10   Nicotinamide mononucleotide   FBgn0039254
           adenylytransferase
VALIUM10   distal antenna-related        FBgn0039283

VALIUM10   Cad96Cb                       FBgn0039294

VALIUM1    Prothoracicotropic hormone    FBgn0013323

VALIUM20                                 FBgn0031254

           CG13692
VALIUM10   sickle                        FBgn0036786

VALIUM10   allatostatin C receptor 2     FBgn0036789

VALIUM1    yolkless                      FBgn0004649

VALIUM20                                 FBgn0035555

           CG13720
VALIUM10   teashirt                      FBgn0003866
VALIUM20                                 FBgn0033354

           CG13745
VALIUM10   PDF receptor                  FBgn0260753

VALIUM1    CG13762                       FBgn0040333

VALIUM1    CG13762                       FBgn0040333

VALIUM20   CG13762                       FBgn0040333


VALIUM20   CG13762                       FBgn0040333


VALIUM1    CG13766                       FBgn0031834

VALIUM10   neuroligin                    FBgn0031866

VALIUM10   milton                        FBgn0022201

VALIUM1    Menin 1                       FBgn0031885

VALIUM22   Menin 1                       FBgn0031885


VALIUM10   CG13779                       FBgn0040954

VALIUM10   tailless                      FBgn0003720

VALIUM10   CG13784                       FBgn0031897

VALIUM10   Dromyosuppressin receptor 2   FBgn0035329

VALIUM20   Ribosomal protein LP0-like    FBgn0033485


VALIUM10   Defensin                      FBgn0010385

VALIUM10   mob as tumor suppressor       FBgn0038965

VALIUM20   mob as tumor suppressor       FBgn0038965


VALIUM20                                 FBgn0035165

           CG13887
VALIUM20                                    FBgn0035165

           CG13887
VALIUM10   CG13894                          FBgn0035157

VALIUM10   CG13897                          FBgn0035160

VALIUM20                                    FBgn0035162

           CG13900
VALIUM20                                    FBgn0035166

           CG13902
VALIUM10   nervous fingers 1                FBgn0028999

VALIUM10   CG13908                          FBgn0035178

VALIUM10   small optic lobes                FBgn0003464

VALIUM20   multiple wing hairs              FBgn0260963


VALIUM10   CG13928                          FBgn0035246

VALIUM1    Gustatory receptor 21a           FBgn0041250

VALIUM1    Gustatory receptor 21a           FBgn0041250

VALIUM10   string                           FBgn0003525

VALIUM20   string                           FBgn0003525


VALIUM10   short neuropeptide F precursor   FBgn0032840

VALIUM10   brain washing                    FBgn0045064

VALIUM10   CG13995                          FBgn0031770

VALIUM20                                    FBgn0040949

           CG13998
VALIUM10   CG14014                          FBgn0031718

VALIUM20                                    FBgn0031698

           CG14023
VALIUM10   vrille                           FBgn0016076
VALIUM10   Septin-1                              FBgn0011710

VALIUM20                                         FBgn0250847

           CG14034
VALIUM10   quick-to-court                        FBgn0028572

VALIUM1    ran                                   FBgn0020255

VALIUM10   SP555                                 FBgn0260470

VALIUM20   Protostome-specific GEF               FBgn0040387


VALIUM1    Ilp6                                  FBgn0044047

VALIUM20   Ilp6                                  FBgn0044047


VALIUM10   CG14050                               FBgn0040392

VALIUM20   U2A                                   FBgn0033210


VALIUM10   Collapsin Response Mediator Protein   FBgn0023023

VALIUM20   SoxNeuro Co-Factor                    FBgn0036349


VALIUM10   CG14119                               FBgn0036322

VALIUM20   RhoGAP19D                             FBgn0031118


VALIUM20                                         FBgn0036178

           CG14137
VALIUM10   bobby sox                             FBgn0024251

VALIUM1    Odorant receptor 67d                  FBgn0036080

VALIUM10   CG1416                                FBgn0032961

VALIUM1    insulin-like peptide 3                FBgn0044050

VALIUM20   insulin-like peptide 3                FBgn0044050
VALIUM1    Ilp1                                   FBgn0044051

VALIUM20   Ilp1                                   FBgn0044051


VALIUM10   CG14186                                FBgn0036935

VALIUM20   Ubiquilin                              FBgn0031057


VALIUM20   Ubiquilin                              FBgn0031057


VALIUM1    domeless                               FBgn0043903

VALIUM1    domeless                               FBgn0043903

VALIUM10   domeless                               FBgn0043903

VALIUM20   domeless                               FBgn0043903


VALIUM10   Merlin                                 FBgn0086384

VALIUM20   Merlin                                 FBgn0086384


VALIUM10   CG14239                                FBgn0039424

VALIUM10   misato                                 FBgn0020272

VALIUM10   CG14274                                FBgn0032023

VALIUM10   Myocyte enhancing factor 2             FBgn0011656

VALIUM10   endophilin A                           FBgn0038659

VALIUM20   by S6                                  FBgn0010292


VALIUM1    fruitless                              FBgn0004652

VALIUM10   CG14313                                FBgn0038579

VALIUM10   beaten path IIa                        FBgn0038498

VALIUM1    sarcoplasmic calcium-binding protein   FBgn0026144
VALIUM10   hattifattener                        FBgn0031349

VALIUM10   Odorant receptor 88a                 FBgn0038203

VALIUM20                                        FBgn0038148

           CG14377
VALIUM10   CG14419                              FBgn0029639

VALIUM1    CG14420                              FBgn0029643

VALIUM20                                        FBgn0029850

           CG14446
VALIUM10   Glutamate receptor binding protein   FBgn0029830

VALIUM20   purity of essence                    FBgn0011230


VALIUM10   innexin 3                            FBgn0028373

VALIUM10   swi2                                 FBgn0034262

VALIUM20                                        FBgn0039655

           CG14507
VALIUM10   CG14509                              FBgn0039647

VALIUM10   APC-like                             FBgn0015589

VALIUM20   APC-like                             FBgn0015589


VALIUM20   Klp10A                               FBgn0030268


VALIUM10   TweedleE                             FBgn0031957

VALIUM10   E(spl) region transcript mβ          FBgn0002733

VALIUM10   Calcineurin A1                       FBgn0010015

VALIUM22                                        FBgn0037142

           CG14562
VALIUM20                                        FBgn0037139

           CG14563
VALIUM10   capa receptor                           FBgn0037100

VALIUM20                                           FBgn0260469

           CR14578
VALIUM20                                           FBgn0062442

           CG1458
VALIUM10   CG14593                                 FBgn0033058

VALIUM10   Alkaline phosphatase 4                  FBgn0016123

VALIUM20   Alkaline phosphatase 4                  FBgn0016123


VALIUM10   touch insensitive larva B               FBgn0014395

VALIUM10   eyeless                                 FBgn0005558

VALIUM20   eyeless                                 FBgn0005558


VALIUM10   CG14647                                 FBgn0037244

VALIUM10   CG14655                                 FBgn0037275

VALIUM10   CG14667                                 FBgn0037317

VALIUM10   Syntaxin 16                             FBgn0031106

VALIUM1    CG14681/Skeletor                        FBgn0020517,FBgn0037820

VALIUM10                                           FBgn0037829
           CG14691
VALIUM10   Guanylyl cyclase beta-subunit at 100B   FBgn0013973

VALIUM10   CG14710                                 FBgn0037920

VALIUM1    CG14711                                 FBgn0037922

VALIUM10   Histamine-gated chloride channel subunit FBgn0037950
           1
VALIUM10   Cytochrome c oxidase subunit Va          FBgn0019624

VALIUM10   Tachykinin                              FBgn0037976

VALIUM1    CG14749                                 FBgn0033316
VALIUM10   Vacuolar protein sorting 25          FBgn0022027

VALIUM1    CG14757                              FBgn0033274

VALIUM10   CG14762                              FBgn0033250

VALIUM1    CG14782                              FBgn0025381

VALIUM10   Rab27                                FBgn0025382

VALIUM20                                        FBgn0024988

           CG42666
VALIUM10   Sarcoglycan δ                        FBgn0025391

VALIUM1    δ-coatomer protein                   FBgn0028969

VALIUM20   Phosphoglycerate mutase 5            FBgn0023517


VALIUM20   Microtubule-associated protein 205   FBgn0002645


VALIUM10   flightless I                         FBgn0000709

VALIUM10   kurtz                                FBgn0040206

VALIUM20   kurtz                                FBgn0040206


VALIUM10   COP9 complex homolog subunit 5       FBgn0027053

VALIUM10   Guanylyl cyclase at 89Da             FBgn0038435

VALIUM10   Guanylyl cyclase at 89Db             FBgn0038436

VALIUM10   CG42342                              FBgn0259244

VALIUM1    CG14891                              FBgn0038445

VALIUM10   Cad89D                               FBgn0038439

VALIUM10   Allatostatin C                       FBgn0032336

VALIUM1    CG14937                              FBgn0032377

VALIUM20                                        FBgn0032378

           Cyclin Y
VALIUM10   Phosphodiesterase 1c            FBgn0259225

VALIUM1    extra sexcombs                  FBgn0000588

VALIUM20   extra sexcombs                  FBgn0000588


VALIUM20                                   FBgn0032402

           CG14945
VALIUM20                                   FBgn0032402

           CG14945
VALIUM10   dpr18                           FBgn0030723

VALIUM10   CG14962                         FBgn0035407

VALIUM10                                   FBgn0035407
           CG14962
VALIUM20                                   FBgn0035415

           CG14966
VALIUM10   Fermitin 1                      FBgn0035498

VALIUM10   Glutamic acid decarboxylase 1   FBgn0004516

VALIUM10   furrowed                        FBgn0001083

VALIUM10   uncoordinated                   FBgn0003950

VALIUM1    archipelago                     FBgn0041171

VALIUM20   archipelago                     FBgn0041171


VALIUM1    CG15011                         FBgn0035518

VALIUM1    Cip4                            FBgn0035533

VALIUM10   CG15021                         FBgn0035544

VALIUM20                                   FBgn0035547

           CG15022
VALIUM10                                   FBgn0031100
           CG1504
VALIUM10   Ac3                             FBgn0023416
VALIUM10   CG15073                               FBgn0034379

VALIUM20   lethal (2) 08717                      FBgn0010651


VALIUM1    CG15097                               FBgn0034396

VALIUM1    Topoisomerase I-interacting protein   FBgn0034410

VALIUM1    another B-box affiliate               FBgn0034412

VALIUM1    enabled                               FBgn0000578

VALIUM10   Serotonin receptor 1B                 FBgn0004572

VALIUM20   Serotonin receptor 1B                 FBgn0004572


VALIUM20                                         FBgn0034417

           CG15117
VALIUM20   Myb-interacting protein 40            FBgn0034430


VALIUM10   Cullin-2                              FBgn0032956

VALIUM10   beat-IIIc                             FBgn0032629

VALIUM10   beethoven                             FBgn0023096

VALIUM10   narrow abdomen                        FBgn0002917

VALIUM1    CG15177                               FBgn0037461

VALIUM20   Proteasome alpha7 subunit             FBgn0023175


VALIUM10   WASp                                  FBgn0024273

VALIUM20   Cyclin K                              FBgn0025674


VALIUM10   cacophony                             FBgn0005563

VALIUM10                                         FBgn0030331
           CG15221
VALIUM10   CG15236                               FBgn0033108
VALIUM10   CG15270                                  FBgn0028879

VALIUM10   metabotropic GABA-B receptor subtype 1 FBgn0260446

VALIUM10   gamma-coatomer protein                   FBgn0028968

VALIUM10   wing blister                             FBgn0004002

VALIUM10                                            FBgn0030183
           CG15309
VALIUM10   nejire                                   FBgn0015624

VALIUM1    nejire                                   FBgn0015624,FBgn0030150

VALIUM10   Neuropeptide-like precursor 4            FBgn0040717

VALIUM20                                            FBgn0030077

           CG15365
VALIUM20   eyes shut                                FBgn0031414


VALIUM20   eyes shut                                FBgn0031414


VALIUM1    tropomodulin                             FBgn0082582

VALIUM20                                            FBgn0031542

           CG15414
VALIUM10   Spindly                                  FBgn0031549

VALIUM20   cappuccino                               FBgn0000256


VALIUM10   CG15423                                  FBgn0031580

VALIUM10   Tyramine β hydroxylase                   FBgn0010329

VALIUM1    modifier of rpr and grim, ubiquitously   FBgn0027609
           expressed
VALIUM20                                            FBgn0025684

           CG15438
VALIUM10   cathD                                    FBgn0029093

VALIUM10   doublesex-Mab related 99B                FBgn0039683
VALIUM10                                       FBgn0039712
           CG15514
VALIUM10   capability                          FBgn0039722

VALIUM10   CG15522                             FBgn0039723

VALIUM10   headcase                            FBgn0010113

VALIUM10   CG15537                             FBgn0039770

VALIUM10   CG15553                             FBgn0039817

VALIUM10   CG15555                             FBgn0039839

VALIUM10   Odorant receptor 83c                FBgn0037399

VALIUM10   myospheroid                         FBgn0004657

VALIUM20   myospheroid                         FBgn0004657


VALIUM1    CG15609                             FBgn0034180

VALIUM1    CG15611                             FBgn0034194

VALIUM10   hoepel2                             FBgn0031649

VALIUM10   Ionotropic receptor 25a             FBgn0031634

VALIUM20                                       FBgn0031632

           CG15628
VALIUM10   CG15651                             FBgn0034567

VALIUM10                                       FBgn0034602
           CG15658
VALIUM10   Misexpression suppressor of KSR 2   FBgn0043070

VALIUM20   Ribosomal protein S30               FBgn0038834


VALIUM22   krimper                             FBgn0034098


VALIUM22   krimper                             FBgn0034098


VALIUM10   CG15710                             FBgn0034120
VALIUM10                                            FBgn0030466
           CG15744
VALIUM10   CG15765                                  FBgn0029814

VALIUM1    Trehalose-sensitivity                    FBgn0003747

VALIUM1    Trehalose-sensitivity                    FBgn0003747

VALIUM20                                            FBgn0029766

           CG15784
VALIUM10   ric8a                                    FBgn0028292

VALIUM10   Ras opposite                             FBgn0004574

VALIUM1    piefke                                   FBgn0035405

VALIUM10   piefke                                   FBgn0035405

VALIUM10   CG15817                                  FBgn0028476

VALIUM1    CG1583                                   FBgn0030013

VALIUM1    Adh transcription factor 1               FBgn0000054

VALIUM10   Adh transcription factor 1               FBgn0000054

VALIUM10   Sarcoplasmic calcium-binding protein 1   FBgn0020908

VALIUM1    painless                                 FBgn0060296

VALIUM1    painless                                 FBgn0060296

VALIUM1    Ravus                                    FBgn0038128

VALIUM10   CG15890                                  FBgn0030576

VALIUM10   Ca-α1T                                   FBgn0029846

VALIUM10                                            FBgn0033186
           CG1602
VALIUM10   CG1603                                   FBgn0033185

VALIUM10   az2                                      FBgn0025185

VALIUM10   Open rectifier K+ channel 1              FBgn0017561

VALIUM1    comatose                                 FBgn0000346
VALIUM1    comatose                            FBgn0000346

VALIUM10   CG1621                              FBgn0033182

VALIUM20   thioredoxin peroxidase 1            FBgn0040309


VALIUM20   thioredoxin peroxidase 1            FBgn0040309


VALIUM10   Neuroglian                          FBgn0002968

VALIUM20                                       FBgn0030030

           CG1636
VALIUM20                                       FBgn0030245

           CG1637
VALIUM20   lethal (1) 10Bb                     FBgn0001491


VALIUM10   sisterless A                        FBgn0003411

VALIUM10   Autophagy-specific gene 5           FBgn0029943

VALIUM10   unplugged                           FBgn0015561

VALIUM1    Ankyrin                             FBgn0011747

VALIUM10   CG1663                              FBgn0033449

VALIUM10   small bristles                      FBgn0003321

VALIUM20   small bristles                      FBgn0003321


VALIUM10   Helicase                            FBgn0001565

VALIUM1    CG1667                              FBgn0033453

VALIUM10   Pheromone-binding protein-related   FBgn0011280
           protein 2
VALIUM20   Spatzle-Processing Enzyme           FBgn0039102


VALIUM10   Serotonin receptor 1A               FBgn0004168
VALIUM20   Serotonin receptor 1A       FBgn0004168


VALIUM10   transformer                 FBgn0003741

VALIUM10   survival motor neuron       FBgn0036641

VALIUM10   survival motor neuron       FBgn0036641

VALIUM1                                FBgn0033539
           Git
VALIUM10   sloppy paired 1             FBgn0003430

VALIUM20   sloppy paired 1             FBgn0003430


VALIUM10                               FBgn0260480
           CG32295
VALIUM10   pasilla                     FBgn0026188

VALIUM10   Tyramine receptor II        FBgn0038541

VALIUM10                               FBgn0003715
           CG16778
VALIUM20                               FBgn0003715

           CG16778
VALIUM10   Developmental embryonic B   FBgn0000426

VALIUM1    CG16793                     FBgn0036712

VALIUM1    CG16793                     FBgn0036712

VALIUM10   alphaPS4                    FBgn0034005

VALIUM10                               FBgn0028482
           CG16857
VALIUM10   CG16868                     FBgn0034498

VALIUM10   CG1688                      FBgn0027589

VALIUM10   lozenge                     FBgn0002576

VALIUM10   CG16899                     FBgn0037735

VALIUM1    squid                       FBgn0086897

VALIUM1    squid                       FBgn0086897
VALIUM10   Hr4                                    FBgn0023546

VALIUM10   Epidermal growth factor receptor pathway FBgn0035060
           substrate clone 15
VALIUM20   Epidermal growth factor receptor pathway FBgn0035060
           substrate clone 15

VALIUM20   Epidermal growth factor receptor pathway FBgn0035060
           substrate clone 15

VALIUM20                                          FBgn0038464

           CG16941
VALIUM1    stress-sensitive B                     FBgn0003360

VALIUM1    stress-sensitive B                     FBgn0003360

VALIUM1    dim γ-tubulin 2                        FBgn0032390

VALIUM10   Scm-related gene containing four mbt   FBgn0032475
           domains
VALIUM20   Scm-related gene containing four mbt   FBgn0032475
           domains

VALIUM20   Roc1a                                  FBgn0025638


VALIUM10   skpA                                   FBgn0025637

VALIUM20   skpA                                   FBgn0025637


VALIUM20   skpA                                   FBgn0025637


VALIUM20   dawdle                                 FBgn0031461


VALIUM1    Roc1b                                  FBgn0040291

VALIUM20                                          FBgn0033122

           CG17002
VALIUM20   GXIVsPLA2                              FBgn0036545


VALIUM10   klarsicht                              FBgn0001316
VALIUM10   Methoprene-tolerant             FBgn0002723

VALIUM10   Rab-protein 10                  FBgn0015789

VALIUM10   inx6                            FBgn0027107

VALIUM20   mars                            FBgn0033845


VALIUM10   pointed                         FBgn0003118

VALIUM10   Vha100-1                        FBgn0028671

VALIUM20   Host cell factor                FBgn0039904


VALIUM10   clockwork orange                FBgn0259938

VALIUM10   clockwork orange                FBgn0259938

VALIUM20                                   FBgn0032281

           CG17107
VALIUM10   homothorax                      FBgn0001235

VALIUM20   homothorax                      FBgn0001235


VALIUM20   Enhancer of bithorax            FBgn0000541


VALIUM10   Porin2                          FBgn0069354

VALIUM10   CG17139                         FBgn0260454

VALIUM1    pyrexia                         FBgn0035113

VALIUM20   Suppressor of variegation 3-3   FBgn0260397


VALIUM20   Suppressor of variegation 3-3   FBgn0260397


VALIUM10   CG17153                         FBgn0036248

VALIUM10   capping protein beta            FBgn0011570

VALIUM1    Set2                            FBgn0030486
VALIUM20   Set2                                   FBgn0030486


VALIUM10   CG40146                                FBgn0039941

VALIUM10   (A+T)-stretch binding protein          FBgn0039946

VALIUM10   CG17181                                FBgn0035144

VALIUM10   CG17186                                FBgn0038741

VALIUM10   Phosphoglyceromutase                   FBgn0014869

VALIUM10   CG17219                                FBgn0031494

VALIUM10   prospero                               FBgn0004595

VALIUM20   locomotion defects                     FBgn0020278


VALIUM10   plexin B                               FBgn0025740

VALIUM10   n-synaptobrevin                        FBgn0013342

VALIUM20   discs large 1                          FBgn0001624


VALIUM20   discs large 1                          FBgn0001624


VALIUM20   discs large 1                          FBgn0001624


VALIUM10                                          FBgn0030205
           no circadian temperature entrainment
VALIUM10   CG17257                                FBgn0031495

VALIUM20   Sox box protein 14                     FBgn0005612,FBgn0050178


VALIUM20                                          FBgn0027493

           CG17273
VALIUM1    Tim8                                   FBgn0027359

VALIUM10   Protein phosphatase 2A at 29B          FBgn0260439
VALIUM20                                         FBgn0032030

           CG17293
VALIUM10                                         FBgn0260793
           2mit
VALIUM10   CG1732                                FBgn0039915

VALIUM10   CG17321                               FBgn0032719

VALIUM10                                         FBgn0028895
           CG17328
VALIUM20                                         FBgn0032596

           CG17331
VALIUM10   lin-28                                FBgn0035626

VALIUM10   Ligand-gated chloride channel homolog 3 FBgn0010240

VALIUM20   TBP-associated factor 12              FBgn0011290


VALIUM10   CG17359                               FBgn0036396

VALIUM10   jing interacting gene regulatory 1    FBgn0039350

VALIUM20                                         FBgn0033934

           CG17385
VALIUM10                                         FBgn0033934
           CG17385
VALIUM10   CG17386                               FBgn0033936

VALIUM10   O/E-associated zinc finger protein    FBgn0033939

VALIUM10   Nuclear transport factor-2            FBgn0031145

VALIUM20   will die slowly                       FBgn0040066


VALIUM1    chaoptic                              FBgn0000313

VALIUM1    chaoptic                              FBgn0000313

VALIUM20   RhoGAP102A                            FBgn0259216


VALIUM20   Ribosomal protein L5                  FBgn0064225
VALIUM20                                 FBgn0040011

           CG17494
VALIUM10   Rab21                         FBgn0039966

VALIUM10   Qm                            FBgn0024733

VALIUM10   CG1756                        FBgn0030303

VALIUM20   gamma-Tubulin at 37C          FBgn0010097


VALIUM10                                 FBgn0032763
           CG17568
VALIUM10   scabrous                      FBgn0003326

VALIUM10   Usf                           FBgn0029711

VALIUM10   CG17593                       FBgn0031544

VALIUM10   scarecrow                     FBgn0028993

VALIUM20   scarecrow                     FBgn0028993


VALIUM20   RhoGAP1A                      FBgn0025836


VALIUM10   beta[nu] integrin             FBgn0010395

VALIUM10   CG17646                       FBgn0031362

VALIUM10   Ecdysone receptor             FBgn0000546

VALIUM10   Enolase                       FBgn0000579

VALIUM10   CG17664                       FBgn0034883

VALIUM1    CG17665                       FBgn0039997

VALIUM10                                 FBgn0036312
           CG42709
VALIUM10   Accessory gland peptide 70A   FBgn0003034

VALIUM1    concertina                    FBgn0000384

VALIUM10   diaphanous                    FBgn0011202
VALIUM20   diaphanous                             FBgn0011202


VALIUM22   DISCO Interacting Protein 1            FBgn0024807


VALIUM22   DISCO Interacting Protein 1            FBgn0024807


VALIUM1    frizzled                               FBgn0001085

VALIUM1    frizzled                               FBgn0001085

VALIUM10   HDAC4                                  FBgn0041210

VALIUM20   HDAC4                                  FBgn0041210


VALIUM10   Nipped-B                               FBgn0026401

VALIUM10   multiple edematous wings               FBgn0004456

VALIUM20                                          FBgn0260794

           CG42574
VALIUM10   CG17739                                FBgn0033710

VALIUM1    pleiohomeotic                          FBgn0002521

VALIUM22   pleiohomeotic                          FBgn0002521


VALIUM20                                          FBgn0035425

           CG17746
VALIUM10   Medea                                  FBgn0011655

VALIUM1    G protein α49B                         FBgn0004435

VALIUM20   G protein α49B                         FBgn0004435


VALIUM20   G protein α49B                         FBgn0004435


VALIUM10   tomosyn                                FBgn0030412

VALIUM10   Down syndrome cell adhesion molecule   FBgn0033159
VALIUM10   CG17803                                 FBgn0038547

VALIUM10                                           FBgn0038548
           CG17806
VALIUM10   Ubiquitin activating enzyme 1           FBgn0023143

VALIUM20                                           FBgn0261113

           Xrp1
VALIUM20                                           FBgn0028480

           CG17841
VALIUM10   CG17843                                 FBgn0038919

VALIUM1    14-3-3ζ                                 FBgn0004907

VALIUM10   14-3-3zeta                              FBgn0004907

VALIUM10   PAR-domain protein 1                    FBgn0016694

VALIUM10   cap-n-collar                            FBgn0000338

VALIUM20   cap-n-collar                            FBgn0000338


VALIUM10   Acetylcholine esterase                  FBgn0000024

VALIUM10   CG17912                                 FBgn0032600

VALIUM10   CG1792                                  FBgn0039860

VALIUM10   HMG protein Z                           FBgn0010228

VALIUM10   CG17922                                 FBgn0034656

VALIUM1    Accessory gland-specific peptide 95EF   FBgn0002863

VALIUM10   Myosin heavy chain                      FBgn0086783

VALIUM10   Mediator complex subunit 26             FBgn0039923

VALIUM1    Matrix metalloproteinase 2              FBgn0033438

VALIUM10   dachsous                                FBgn0000497

VALIUM20   dachsous                                FBgn0000497
VALIUM10   commissureless                    FBgn0010105

VALIUM20   alpha Catenin                     FBgn0010215


VALIUM1    High mobility group protein D     FBgn0004362

VALIUM20   Z600                              FBgn0004052


VALIUM1    raspberry                         FBgn0003204

VALIUM1    raspberry                         FBgn0003204

VALIUM20   partner of drosha                 FBgn0039861


VALIUM10   partner of drosha                 FBgn0039861

VALIUM10   short wing                        FBgn0003654

VALIUM10   Ecdysone-induced protein 78C      FBgn0004865

VALIUM10   Ecdysone-induced protein 78C      FBgn0004865

VALIUM10   SoxNeuro                          FBgn0029123

VALIUM20   light                             FBgn0002566


VALIUM10   KaiRIA                            FBgn0028422

VALIUM10   short stop                        FBgn0013733

VALIUM10   Drosulfakinin                     FBgn0000500

VALIUM20   Thiolester containing protein I   FBgn0041183


VALIUM20   mRNA-capping-enzyme               FBgn0030556


VALIUM10   shibire                           FBgn0003392

VALIUM10   Ecdysis triggering hormone        FBgn0028738

VALIUM10   Immune induced molecule 2         FBgn0025583
VALIUM10   CG18110                             FBgn0039677

VALIUM20   formin 3                            FBgn0053556


VALIUM10   Hand                                FBgn0032209

VALIUM10   nimrod C2                           FBgn0028939

VALIUM20                                       FBgn0035239

           CG17841
VALIUM20   Rpn11                               FBgn0028694


VALIUM1    deflated                            FBgn0036038

VALIUM10   deflated                            FBgn0036038

VALIUM20                                       FBgn0036035

           CG18178
VALIUM10   trio                                FBgn0024277

VALIUM10   bifocal                             FBgn0014133

VALIUM10   Toll-4                              FBgn0032095

VALIUM10                                       FBgn0037553
           CG18249
VALIUM20   Microtubule-associated protein 60   FBgn0010342


VALIUM20   Muscle-specific protein 300         FBgn0260952


VALIUM20                                       FBgn0030956

           CG18259
VALIUM20                                       FBgn0030012

           CG18262
VALIUM10                                       FBgn0036725
           CG18265
VALIUM20                                       FBgn0037263

           CG18271
VALIUM20                                          FBgn0037263

           CG18271
VALIUM10                                          FBgn0033836
           CG18278
VALIUM10   Immune induced molecule 10             FBgn0033835

VALIUM22   dre4                                   FBgn0002183


VALIUM10   igloo                                  FBgn0013467

VALIUM10   pickpocket 19                          FBgn0039679

VALIUM10   DopEcR                                 FBgn0035538

VALIUM10   bendless                               FBgn0000173

VALIUM10                                          FBgn0032979
           CG1832
VALIUM10   CG1832                                 FBgn0032979

VALIUM20   cyclope                                FBgn0015031


VALIUM20   COP9 complex homolog subunit 3         FBgn0027055


VALIUM10   trp-like                               FBgn0005614

VALIUM20   Sex lethal                             FBgn0003659,FBgn0029933


VALIUM1    dishevelled                            FBgn0000499

VALIUM1    dishevelled                            FBgn0000499

VALIUM10   Mlx interactor                         FBgn0032940

VALIUM1    myoglianin                             FBgn0026199

VALIUM1    myoglianin                             FBgn0026199

VALIUM1    F box and leucine-rich-repeat gene 4   FBgn0030555

VALIUM20   Transport and Golgi organization 6     FBgn0032728
VALIUM10   Sema-1a                                 FBgn0011259

VALIUM10   CAP                                     FBgn0033504

VALIUM1    polyhomeotic proximal                   FBgn0004861

VALIUM22   polyhomeotic proximal                   FBgn0004861


VALIUM20   polyhomeotic proximal                   FBgn0004861


VALIUM20                                           FBgn0033458

           CG18446
VALIUM10   CG1845                                  FBgn0033155

VALIUM10   Optix                                   FBgn0025360

VALIUM10   CG18476                                 FBgn0037931

VALIUM10                                           FBgn0028518
           CG18480
VALIUM10   runt                                    FBgn0003300

VALIUM20   split ends                              FBgn0016977


VALIUM10   Odorant receptor 43a                    FBgn0026389

VALIUM10   tramtrack                               FBgn0003870

VALIUM20                                           FBgn0031962

           Small ribonucleoprotein particle protein SmE
VALIUM20                                              FBgn0260444

           CG18616
VALIUM10                                           FBgn0032202
           CG18619
VALIUM10   Ephrin                                  FBgn0040324

VALIUM10   Hormone receptor-like in 38             FBgn0014859

VALIUM10   Hormone receptor-like in 38             FBgn0014859

VALIUM1    Netrin-A                                FBgn0015773
VALIUM1    Netrin-A                                FBgn0015773

VALIUM10   Nckx30C                                 FBgn0028704

VALIUM20   Not1                                    FBgn0085436


VALIUM10   lin-19-like                             FBgn0015509

VALIUM20   Mediator complex subunit 20             FBgn0013531


VALIUM10   Ku80                                    FBgn0041627

VALIUM10   Presenilin                              FBgn0019947

VALIUM10   Not1                                    FBgn0085436

VALIUM10   Odorant receptor 19a                    FBgn0041626

VALIUM1    ATP7                                    FBgn0030343

VALIUM1    CG1890                                  FBgn0039869

VALIUM10   saxophone                               FBgn0003317

VALIUM10   Drop                                    FBgn0000492

VALIUM10   Rab40                                   FBgn0030391

VALIUM20   maverick                                FBgn0039914


VALIUM1    alphabet                                FBgn0086361

VALIUM1    CG1908                                  FBgn0030274

VALIUM10   CG1909                                  FBgn0039911

VALIUM1    CAP-D2 condensin subunit                FBgn0039680

VALIUM1    CAP-D2 condensin subunit                FBgn0039680

VALIUM10   Guanylyl cyclase alpha-subunit at 99B   FBgn0013972

VALIUM1    α-Tubulin at 84B                        FBgn0003884

VALIUM10   Wnt oncogene analog 2                   FBgn0004360
VALIUM10   Wnt oncogene analog 2              FBgn0004360

VALIUM1    sprouty                            FBgn0014388

VALIUM1    sprouty                            FBgn0014388

VALIUM10   onecut                             FBgn0028996

VALIUM22   Ecdysone-inducible gene E2         FBgn0001254


VALIUM10   Roughened                          FBgn0004636

VALIUM1    ATP-dependent chromatin assembly   FBgn0027620
           factor large subunit
VALIUM22   ATP-dependent chromatin assembly   FBgn0027620
           factor large subunit

VALIUM10                                      FBgn0039909
           CG1970
VALIUM20   RhoGAP100F                         FBgn0039883


VALIUM1    discs lost                         FBgn0024510,FBgn0250789

VALIUM10   Thd1                               FBgn0026869

VALIUM20   Sorbitol dehydrogenase 1           FBgn0024289


VALIUM1    CG2010                             FBgn0039667

VALIUM10                                      FBgn0250839
           CG2016
VALIUM20                                      FBgn0037391

           CG2017
VALIUM10   dispatched                         FBgn0029088

VALIUM10                                      FBgn0035271
           CG2021
VALIUM20   Ribosomal protein S15Aa            FBgn0010198


VALIUM20   COP9 complex homolog subunit 7     FBgn0028836


VALIUM10   hikaru genki                       FBgn0010114
VALIUM20   Larval cuticle protein 4             FBgn0002535


VALIUM20   fushi tarazu                         FBgn0001077


VALIUM10   modulo                               FBgn0002780

VALIUM10   CG2052                               FBgn0039905

VALIUM20                                        FBgn0033205

           CG2064
VALIUM20                                        FBgn0033204

           CG2065
VALIUM20   Myd88                                FBgn0033402


VALIUM1    castor                               FBgn0004878

VALIUM10   castor                               FBgn0004878

VALIUM20   polypeptide GalNAc transferase 6     FBgn0035375


VALIUM10   Rab23                                FBgn0037364

VALIUM10   Fmrf Receptor                        FBgn0035385

VALIUM10   CG2116                               FBgn0030003

VALIUM1    cubitus interruptus                  FBgn0004859

VALIUM1    cubitus interruptus                  FBgn0004859

VALIUM1    cubitus interruptus                  FBgn0004859

VALIUM10   cubitus interruptus                  FBgn0004859

VALIUM1    Hdac3                                FBgn0025825

VALIUM20   Histone deacetylase 3                FBgn0025825


VALIUM10   dilute class unconventional myosin   FBgn0261397
VALIUM20   Thioredoxin reductase-1                   FBgn0020653


VALIUM20   Protein-L-isoaspartate (D-aspartate) O-   FBgn0086768
           methyltransferase

VALIUM20                                             FBgn0033264

           Nucleoporin 50
VALIUM20   Pabp2                                     FBgn0005648


VALIUM10   Triose phosphate isomerase                FBgn0086355

VALIUM20   Rs1                                       FBgn0021995


VALIUM1    Myosin light chain 2                      FBgn0002773

VALIUM1    Myosin light chain 2                      FBgn0002773

VALIUM20                                             FBgn0030243

           CG2186
VALIUM10   Deformed                                  FBgn0000439

VALIUM20   Amalgam                                   FBgn0000071


VALIUM10   CG2199                                    FBgn0035213

VALIUM10   CG2202                                    FBgn0030240

VALIUM10   G protein oalpha 47A                      FBgn0001122

VALIUM20   G protein oalpha 47A                      FBgn0001122


VALIUM10   swiss cheese                              FBgn0003656

VALIUM20   lethal (1) G0289                          FBgn0028331


VALIUM20   lethal (1) G0289                          FBgn0028331


VALIUM10   CG2225                                    FBgn0032957
VALIUM20   MTA1-like                                   FBgn0027951


VALIUM1    CG2247                                      FBgn0030320

VALIUM10   Rac1                                        FBgn0010333

VALIUM1    Upf2                                        FBgn0029992

VALIUM10   Smad on X                                   FBgn0025800

VALIUM1    Jun-related antigen                         FBgn0001291

VALIUM20   NADH:ubiquinone reductase 75kD subunit FBgn0017566
           precursor

VALIUM10   NADH:ubiquinone reductase 75kD subunit FBgn0017566
           precursor
VALIUM20   NADH:ubiquinone reductase 75kD subunit FBgn0017566
           precursor

VALIUM10   Obp44a                                      FBgn0033268

VALIUM10   nicotinic Acetylcholine Receptor alpha 7E   FBgn0015519

VALIUM10   even skipped                                FBgn0000606

VALIUM20   TER94                                       FBgn0261014


VALIUM10   TER94                                       FBgn0261014

VALIUM10   FMRFamide-related                           FBgn0000715

VALIUM10   pipsqueak                                   FBgn0004399

VALIUM10   late bloomer                                FBgn0016032

VALIUM10   Nuclear factor I                            FBgn0042696

VALIUM10   Syt7                                        FBgn0039900

VALIUM10   patched                                     FBgn0003892

VALIUM20                                               FBgn0035205

           CG2469
VALIUM1    brunelleschi                                FBgn0032872
VALIUM1    cdc23                         FBgn0032863

VALIUM10   like-AP180                    FBgn0086372

VALIUM1    Female sterile (2) Ketel      FBgn0000986

VALIUM10   Female sterile (2) Ketel      FBgn0000986

VALIUM10   CG2641                        FBgn0037518

VALIUM1    period                        FBgn0003068

VALIUM1    period                        FBgn0003068

VALIUM10   Helix loop helix protein 3B   FBgn0011276

VALIUM20   Helix loop helix protein 3B   FBgn0011276


VALIUM1    CG2658                        FBgn0024992

VALIUM1    CG2658                        FBgn0024992

VALIUM1    lethal (2) giant larvae       FBgn0002121

VALIUM1    lethal (2) giant larvae       FBgn0002121

VALIUM10   Minute (2) 21AB               FBgn0005278

VALIUM10   CG2678                        FBgn0014931

VALIUM10   goliath                       FBgn0004919

VALIUM10   d4                            FBgn0033015

VALIUM10   gooseberry-neuro              FBgn0001147

VALIUM22   female sterile (1) Yb         FBgn0000928


VALIUM22   female sterile (1) Yb         FBgn0000928


VALIUM1    deformed wings                FBgn0000520

VALIUM1    cramped                       FBgn0000376,FBgn0000520

VALIUM1    Syntaxin 4                    FBgn0024980
VALIUM1    Syntaxin 4                           FBgn0024980

VALIUM20   Hsp70/Hsp90 organizing protein homolog FBgn0024352


VALIUM20   Hsp70/Hsp90 organizing protein homolog FBgn0024352


VALIUM10   CG2747                               FBgn0037541

VALIUM10   white                                FBgn0003996

VALIUM1    white                                FBgn0003996

VALIUM1    white                                FBgn0003996

VALIUM10   white                                FBgn0003996

VALIUM20   white                                FBgn0003996


VALIUM20   white                                FBgn0003996


VALIUM20   white                                FBgn0003996


VALIUM20   white                                FBgn0003996


VALIUM21   white                                FBgn0003996


VALIUM22   white                                FBgn0003996


VALIUM10   u-shaped                             FBgn0003963

VALIUM20   u-shaped                             FBgn0003963


VALIUM10                                        FBgn0031266
           CG2807
VALIUM20                                        FBgn0031266

           CG2807
VALIUM10   PvuII-PstI homology 13               FBgn0023489
VALIUM10   Shaker cognate w                       FBgn0003386

VALIUM20   hoepel1                                FBgn0041150


VALIUM10   G protein salpha 60A                   FBgn0001123

VALIUM10   Transportin-Serine/Arginine rich       FBgn0031456

VALIUM10   Ras-related protein                    FBgn0015286

VALIUM22   TBP-associated factor 10               FBgn0028398


VALIUM1    Poly(ADP-ribose) glycohydrolase        FBgn0023216

VALIUM10   Allatostatin Receptor                  FBgn0028961

VALIUM10   CG2875                                 FBgn0029672

VALIUM20   RabX2                                  FBgn0030200


VALIUM10   Protein phosphatase 4 regulatory subunit FBgn0030208
           2-related protein
VALIUM10   CG2893                                   FBgn0040030

VALIUM10   NMDA receptor 1                        FBgn0010399

VALIUM10   Hepatocyte growth factor regulated     FBgn0031450
           tyrosine kinase substrate
VALIUM10   Hepatocyte growth factor regulated
           tyrosine kinase substrate
VALIUM20   Hepatocyte growth factor regulated     FBgn0031450
           tyrosine kinase substrate

VALIUM20   Hepatocyte growth factor regulated     FBgn0031450
           tyrosine kinase substrate

VALIUM20   spenito                                FBgn0027548


VALIUM10   yin                                    FBgn0015565

VALIUM1    Sep5                                   FBgn0026361

VALIUM20   Origin recognition complex subunit 4   FBgn0023181
VALIUM10   extra bases             FBgn0250753

VALIUM20   noisette                FBgn0014366


VALIUM20                           FBgn0037344

           CG2926
VALIUM10   Bteb2                   FBgn0025679

VALIUM20   sloppy paired 2         FBgn0004567


VALIUM20                           FBgn0037530

           CG2943
VALIUM10   cinnamon                FBgn0000316

VALIUM10   cinnamon                FBgn0000316

VALIUM20   cinnamon                FBgn0000316


VALIUM20   CG2947                  FBgn0029676


VALIUM20   CG2947                  FBgn0029676


VALIUM10   twist                   FBgn0003900

VALIUM10   CG2962                  FBgn0030186

VALIUM10   innexin 7               FBgn0027106

VALIUM10   Troponin C at 41C       FBgn0013348

VALIUM20                           FBgn0029704

           CG2982
VALIUM1    alpha-catenin related   FBgn0029105

VALIUM10   empty spiracles         FBgn0000576

VALIUM1    G9a                     FBgn0040372

VALIUM10   G9a                     FBgn0040372
VALIUM20   G9a                                      FBgn0040372


VALIUM20   Ribosomal protein S28b                   FBgn0030136


VALIUM10   unc-13                                   FBgn0025726

VALIUM10   gemini                                   FBgn0050011

VALIUM10   CG30020                                  FBgn0050020

VALIUM1    CG30022                                  FBgn0050022

VALIUM1    CG30022                                  FBgn0050022

VALIUM10   CG30044                                  FBgn0050044

VALIUM10   CG30046                                  FBgn0050046

VALIUM10                                            FBgn0260475
           CG30059
VALIUM10                                            FBgn0050060
           CG30060
VALIUM20   Odorant-binding protein 50a              FBgn0050067


VALIUM1    Z band alternatively spliced PDZ-motif   FBgn0083919
           protein 52
VALIUM10   CG30089                                  FBgn0050089

VALIUM1    CG3009                                   FBgn0029720

VALIUM1    jitterbug                                FBgn0028371

VALIUM10   CG30106                                  FBgn0050106

VALIUM1    CG30158                                  FBgn0050158

VALIUM10   CG30172                                  FBgn0050172

VALIUM1    lesswright                               FBgn0010602

VALIUM10   CG30203                                  FBgn0050203

VALIUM10   metabotropic GABA-B receptor subtype 3 FBgn0031275

VALIUM1    males absent on the first                FBgn0014340
VALIUM20   males absent on the first              FBgn0014340


VALIUM20   pyd3                                   FBgn0037513


VALIUM10   Inositol polyphosphate 1-phosphatase   FBgn0016672

VALIUM10   orange                                 FBgn0003008

VALIUM20   Mediator complex subunit 22            FBgn0040339


VALIUM10   CG30340                                FBgn0050340

VALIUM20                                          FBgn0050345

           CG30345
VALIUM10   carmine                                FBgn0000330

VALIUM20                                          FBgn0050356


           CG30356
VALIUM20                                          FBgn0050356

           CG30356
VALIUM20   mangetout                              FBgn0050361


VALIUM1    CG30372                                FBgn0050372

VALIUM10   CG30379                                FBgn0050379

VALIUM10   CG30382                                FBgn0050382

VALIUM10   optic ganglion reduced                 FBgn0004646

VALIUM10   CG30414                                FBgn0050414

VALIUM10   Activating transcription factor-2      FBgn0050420

VALIUM1    eggless                                FBgn0086908

VALIUM20   eggless                                FBgn0086908
VALIUM20   eggless                          FBgn0086908


VALIUM1    CG30440                          FBgn0050440

VALIUM10   Tyrosine decarboxylase 1         FBgn0259977

VALIUM10   Tyrosine decarboxylase 2         FBgn0050446

VALIUM1    CG30456                          FBgn0050456

VALIUM1    CG30466                          FBgn0050466

VALIUM10   Prosap                           FBgn0040752

VALIUM20                                    FBgn0027604,FBgn0050492

           CG30494
VALIUM10   boca                             FBgn0004132

VALIUM10   Helix loop helix protein 4C      FBgn0011277

VALIUM10   Sox box protein 14               FBgn0005612

VALIUM10   halfway                          FBgn0001189

VALIUM10   hephaestus                       FBgn0011224

VALIUM10   Cad99C                           FBgn0039709

VALIUM10   Cad99C                           FBgn0039709

VALIUM1    sanpodo                          FBgn0260440

VALIUM20   prolyl-4-hydroxylase-alpha EFB   FBgn0039776


VALIUM20   prolyl-4-hydroxylase-alpha EFB   FBgn0039776


VALIUM10   CG31044                          FBgn0051044

VALIUM10   tau                              FBgn0051057

VALIUM10   CG31065                          FBgn0051065

VALIUM1    LpR2                             FBgn0051092
VALIUM10   LpR1                     FBgn0066101

VALIUM10   Lgr3                     FBgn0039354

VALIUM10   CG31103                  FBgn0051103

VALIUM10   CG31105                  FBgn0051105

VALIUM10   CG31106                  FBgn0051106

VALIUM10   5PtaseI                  FBgn0259178

VALIUM10   RabX4                    FBgn0051118

VALIUM20   Histone deacetylase X    FBgn0051119


VALIUM10   Syntaxin 1A              FBgn0013343

VALIUM20   twin                     FBgn0011725


VALIUM20   twin                     FBgn0011725


VALIUM1    erect wing               FBgn0005427

VALIUM1    erect wing               FBgn0005427

VALIUM10   rumi                     FBgn0086253

VALIUM20                            FBgn0051156

           CG31156
VALIUM20                            FBgn0051156

           CG31156
VALIUM1    14-3-3ε                  FBgn0020238

VALIUM10   Glutamate receptor IIE   FBgn0051201

VALIUM20   Ino80                    FBgn0086613


VALIUM20                            FBgn0051224

           CG31224
VALIUM10   CG31235                  FBgn0051235
VALIUM10   reversed polarity                   FBgn0011701

VALIUM10   couch potato                        FBgn0000363

VALIUM10   Brf                                 FBgn0038499

VALIUM10   Cenp-C                              FBgn0086697

VALIUM10   CG31272                             FBgn0051272

VALIUM1                                        FBgn0260005
           water witch
VALIUM1                                        FBgn0260005
           water witch
VALIUM10   Rab-related protein 4               FBgn0015794

VALIUM10   beat-Vb                             FBgn0038092

VALIUM10   CG31302                             FBgn0051302

VALIUM20   Dual oxidase                        FBgn0031464


VALIUM20   Dual oxidase                        FBgn0031464


VALIUM10   CG31324                             FBgn0051324

VALIUM20   GST-containing FLYWCH zinc-finger   FBgn0250732
           protein

VALIUM20   Hsp70Bbb                            FBgn0051354


VALIUM20   Hsp70Bbb                            FBgn0051354


VALIUM20   Heat-shock-protein-70Bb             FBgn0013278


VALIUM20   Heat-shock-protein-70Bb             FBgn0013278


VALIUM10   Atf6                                FBgn0033010

VALIUM1    sarcomere length short              FBgn0051374

VALIUM1    sarcomere length short              FBgn0051374
VALIUM1    synaptotagmin               FBgn0004242

VALIUM1    synaptotagmin               FBgn0004242

VALIUM20   ligatin                     FBgn0041588


VALIUM10   forkhead box, sub-group O   FBgn0038197

VALIUM10   forkhead box, sub-group O   FBgn0038197

VALIUM20   forkhead box, sub-group O   FBgn0038197


VALIUM20   forkhead box, sub-group O   FBgn0038197


VALIUM20                               FBgn0051453

           pch2
VALIUM10   CG31460                     FBgn0051460

VALIUM10   CG31469                     FBgn0051469

VALIUM10   proboscipedia               FBgn0051481

VALIUM10   RNA-binding protein 9       FBgn0010263

VALIUM1    Cdep                        FBgn0051536

VALIUM20   canoe                       FBgn0259212


VALIUM1    γ-Tubulin at 23C            FBgn0260639

VALIUM1    spindle E                   FBgn0003483

VALIUM20   spindle E                   FBgn0003483


VALIUM22   spindle E                   FBgn0003483


VALIUM22   His2A:CG31618               FBgn0051618


VALIUM10   CG3162                      FBgn0034834
VALIUM10   defective transmitter release   FBgn0023090

VALIUM10   senseless-2                     FBgn0051632

VALIUM10   CG31646                         FBgn0051646

VALIUM10   anterior open                   FBgn0000097

VALIUM10   CG31665                         FBgn0051665

VALIUM10   Chronologically inappropriate   FBgn0086758
           morphogenesis
VALIUM1    Chronologically inappropriate   FBgn0086758
           morphogenesis
VALIUM20   Chronologically inappropriate   FBgn0086758
           morphogenesis

VALIUM10   CG31670                         FBgn0031375

VALIUM10   tho2                            FBgn0031390

VALIUM10   CG3168                          FBgn0029896

VALIUM22   Spt3                            FBgn0037981


VALIUM1    CG31705                         FBgn0028490

VALIUM10   trapped in endoderm-1           FBgn0046687

VALIUM20   trapped in endoderm-1           FBgn0046687


VALIUM20   trapped in endoderm-1           FBgn0046687


VALIUM20                                   FBgn0032180

           CG31714
VALIUM10   CG31716                         FBgn0051716

VALIUM10   CG31720                         FBgn0051720

VALIUM10   hamlet                          FBgn0045852

VALIUM20   hamlet                          FBgn0045852
VALIUM20                                   FBgn0051792,FBgn0051793

           CG31792
VALIUM10   Paxillin                        FBgn0041789

VALIUM20   ia2                             FBgn0031294


VALIUM10   CG31809                         FBgn0051809

VALIUM1    centaurin gamma 1A              FBgn0028509

VALIUM1    CG31814                         FBgn0051814

VALIUM1    seizure                         FBgn0003353

VALIUM1    seizure                         FBgn0003353

VALIUM1    Sirt4                           FBgn0029783

VALIUM20   Sirt4                           FBgn0029783


VALIUM10   crooked neck                    FBgn0000377

VALIUM10                                   FBgn0051955
           CG31955
VALIUM1    CG31958                         FBgn0051958

VALIUM20   gawky                           FBgn0051992


VALIUM1    CG31999                         FBgn0051999

VALIUM1    CG31999                         FBgn0051999

VALIUM10                                   FBgn0052000
           CG32000
VALIUM10   Zyx102EF                        FBgn0011642

VALIUM20                                   FBgn0052021

           CG32021
VALIUM1                                    FBgn0261259
           Fhos
VALIUM10   Ras-associated protein 2-like   FBgn0025806

VALIUM10   dpr10                           FBgn0052057
VALIUM10   Odorant receptor 2a             FBgn0023523

VALIUM10   CG32062                         FBgn0052062

VALIUM20   CG32062                         FBgn0052062


VALIUM1    RhoGAP5A                        FBgn0029778

VALIUM1    CG32085                         FBgn0052085

VALIUM10   Dynamin related protein 1       FBgn0026479

VALIUM10                                   FBgn0052105
           CG32105
VALIUM20                                   FBgn0052109

           CG32109
VALIUM10   senseless                       FBgn0002573

VALIUM1                                    FBgn0052133
           ptip
VALIUM22                                   FBgn0052133

           ptip
VALIUM20                                   FBgn0052138

           CG32138
VALIUM20   Myosin binding subunit          FBgn0005536


VALIUM10   CG32164                         FBgn0042177

VALIUM10   Limpet                          FBgn0036672

VALIUM20   noe                             FBgn0026197


VALIUM20   female sterile (1) K10          FBgn0000810


VALIUM20   female sterile (1) K10          FBgn0000810


VALIUM10   Ecdysone-induced protein 74EF   FBgn0000567

VALIUM1    Ccn                             FBgn0052183
VALIUM10   CG32204                                  FBgn0052204

VALIUM22   Su(Tpl)                                  FBgn0014037


VALIUM20   Su(Tpl)                                  FBgn0014037


VALIUM1    CG32221                                  FBgn0052221

VALIUM1    Guanine nucleotide exchange factor       FBgn0035574
           GEF64C
VALIUM20                                            FBgn0052251

           CG32251
VALIUM20                                            FBgn0029882

           CG3226
VALIUM20                                            FBgn0029882

           CG3226
VALIUM10   CG32264                                  FBgn0052264

VALIUM10   Myocardin-related transcription factor   FBgn0052296

VALIUM20   zormin                                   FBgn0052311


VALIUM10   discs lost                               FBgn0024510

VALIUM10   timeless                                 FBgn0014396

VALIUM1    CG32343                                  FBgn0052343

VALIUM1    CG32343                                  FBgn0052343

VALIUM1    Enhancer of bithorax                     FBgn0000541

VALIUM22   Enhancer of bithorax                     FBgn0000541


VALIUM10                                            FBgn0052372
           CG32372
VALIUM10   unc-13-4A                                FBgn0035756

VALIUM20                                            FBgn0029769

           CG3239
VALIUM20   dikar                              FBgn0052393,FBgn0052394


VALIUM10   Odorant receptor 65a               FBgn0041625

VALIUM10   Odorant receptor 65b               FBgn0041624

VALIUM10   Odorant receptor 65c               FBgn0041623

VALIUM1    male-specific lethal 2             FBgn0005616

VALIUM20   sis of bowl & odd                  FBgn0004892


VALIUM20   alan shepard                       FBgn0052423


VALIUM10   CG32432                            FBgn0052432

VALIUM1    Polycomb                           FBgn0003042

VALIUM20   Polycomb                           FBgn0003042


VALIUM20   Polycomb                           FBgn0003042


VALIUM10   Secretory Pathway Calcium atpase   FBgn0052451

VALIUM10   dysfusion                          FBgn0039411

VALIUM20   modifier of mdg4                   FBgn0002781


VALIUM20   modifier of mdg4                   FBgn0002781


VALIUM10   dunce                              FBgn0000479

VALIUM10   Protein phosphatase 19C            FBgn0023177

VALIUM10   CG32506                            FBgn0052506

VALIUM20                                      FBgn0041706

           CG3253
VALIUM10   CG32532                            FBgn0052532
VALIUM10   giant fibre A                FBgn0086778

VALIUM10   CCK-like receptor at 17D3    FBgn0030954

VALIUM10   CG32547                      FBgn0052547

VALIUM1    RhoGAPp190                   FBgn0026375

VALIUM10   CG3257                       FBgn0034978

VALIUM10   asense                       FBgn0000137

VALIUM10   highwire                     FBgn0030600

VALIUM10   dpr8                         FBgn0052600

VALIUM10   CG32626                      FBgn0052626

VALIUM20                                FBgn0052627,FBgn0052628

           Drosophila Nna1 ortholog
VALIUM10   Eb1                          FBgn0027066

VALIUM10   Tenascin accessory           FBgn0259240

VALIUM10   Autophagy-specific gene 8a   FBgn0052672

VALIUM10   Hyperkinetic                 FBgn0001203

VALIUM10   Rab-protein 2                FBgn0014009

VALIUM20   lethal (1) G0232             FBgn0028341


VALIUM1    CG3270                       FBgn0033093

VALIUM1    CG3270                       FBgn0033093

VALIUM10   CG32702                      FBgn0052702

VALIUM10   Ionotropic receptor 8a       FBgn0052704

VALIUM20   stardust                     FBgn0243505


VALIUM20   stardust                     FBgn0243505
VALIUM10   Brahma associated protein 170kD          FBgn0042085

VALIUM10   CG32770                                  FBgn0260971

VALIUM20   GlcAT-I                                  FBgn0066114


VALIUM10   CG32778                                  FBgn0052778

VALIUM10   CG32792                                  FBgn0052792

VALIUM10   CG32809                                  FBgn0023531

VALIUM10   CG32810                                  FBgn0025394

VALIUM10   CG32843                                  FBgn0052843

VALIUM10   VAChT                                    FBgn0015323

VALIUM1    CG32850                                  FBgn0052850

VALIUM10   CG3294                                   FBgn0031628

VALIUM10   nicotinic Acetylcholine Receptor α 34E   FBgn0028875

VALIUM10   Vinculin                                 FBgn0004397

VALIUM10                                            FBgn0053017
           CG33017
VALIUM10   Corazonin                                FBgn0013767

VALIUM22   pr-set7                                  FBgn0011474


VALIUM1    CG33087                                  FBgn0053087

VALIUM10   Syndapin                                 FBgn0053094

VALIUM20                                            FBgn0053095,FBgn0053096

           CG33095
VALIUM20                                            FBgn0051367,FBgn0053097

           CG42724
VALIUM10   NEM-sensitive fusion protein 2           FBgn0013998

VALIUM1    multiple ankyrin repeats single KH       FBgn0043884
           domain
VALIUM20   multiple ankyrin repeats single KH          FBgn0043884
           domain

VALIUM20                                               FBgn0053129

           CG33129
VALIUM1    SCAP                                        FBgn0033052

VALIUM10   death executioner Bcl-2 homologue           FBgn0029131

VALIUM10   KCNQ potassium channel                      FBgn0033494

VALIUM10   CG33143                                     FBgn0053143

VALIUM10   Heparan sulfate 3-O sulfotransferase-A      FBgn0053147

VALIUM10   Muscle LIM protein at 60A                   FBgn0259209

VALIUM10   Gustatory receptor 59e                      FBgn0041233

VALIUM10   homeobrain                                  FBgn0008636

VALIUM10   CG33159                                     FBgn0053159

VALIUM20   Signal recognition particle receptor beta   FBgn0011509


VALIUM10                                               FBgn0260660
           multiplexin
VALIUM10   Dopamine N acetyltransferase                FBgn0019643

VALIUM10   Hormone receptor-like in 46                 FBgn0000448

VALIUM10   Hormone receptor-like in 46                 FBgn0000448

VALIUM10   salvador                                    FBgn0053193

VALIUM20   salvador / shar-pei                         FBgn0053193


VALIUM10   muscleblind                                 FBgn0053197

VALIUM10   presenilin enhancer                         FBgn0053198

VALIUM10   Rab-protein 1                               FBgn0016700

VALIUM1    CG33205                                     FBgn0053205
VALIUM1    Molecule interacting with CasL        FBgn0053208

VALIUM10   CG33213                               FBgn0053213

VALIUM1    CG33232                               FBgn0035347

VALIUM20                                         FBgn0030992

           CG33253
VALIUM10   Early gene at 23                      FBgn0020445

VALIUM1    insulin-like peptide 5                FBgn0044048

VALIUM20   insulin-like peptide 5                FBgn0044048


VALIUM1    CG33275                               FBgn0035802

VALIUM10   CG33289                               FBgn0053289

VALIUM10   ebony                                 FBgn0000527

VALIUM1    CG3332                                FBgn0031514

VALIUM10   CheB38a                               FBgn0067312

VALIUM10   CheB38b                               FBgn0067311

VALIUM10   48 related 1                          FBgn0037475

VALIUM10   p53                                   FBgn0039044

VALIUM1    Cardioacceleratory peptide receptor   FBgn0039396

VALIUM20   Chemosensory protein B 42a            FBgn0053348


VALIUM10   pickpocket 25                         FBgn0053349

VALIUM10   CheB42c                               FBgn0066292

VALIUM10   CheB42b                               FBgn0066293

VALIUM10   Kruppel                               FBgn0001325

VALIUM20   Kruppel                               FBgn0001325
VALIUM10                                             FBgn0053470
           CG33470
VALIUM10   luna                                      FBgn0040765

VALIUM20   dpr9                                      FBgn0038282


VALIUM10   bigmax                                    FBgn0039509

VALIUM10   pickpocket 13                             FBgn0053508

VALIUM10   NMDA receptor 2                           FBgn0053513

VALIUM10   Dopamine 2-like receptor                  FBgn0053517

VALIUM10   fat                                       FBgn0001075

VALIUM20   fat                                       FBgn0001075


VALIUM10   CG33523                                   FBgn0053523

VALIUM10   PNUTS                                     FBgn0053526

VALIUM10   IFamide                                   FBgn0053527

VALIUM1    Vesicular monoamine transporter           FBgn0260964

VALIUM10   CG3353                                    FBgn0038869

VALIUM20   Male-specific transcript 77F              FBgn0086915


VALIUM10   unpaired 3                                FBgn0053542

VALIUM20   unpaired 3                                FBgn0053542


VALIUM10   Rim                                       FBgn0053547

VALIUM1    CG3356                                    FBgn0034989

VALIUM10   CG33639                                   FBgn0053639

VALIUM10   Calcium activated protein for secretion   FBgn0053653

VALIUM10   CG33673                                   FBgn0053673
VALIUM10   Like Sm protein 4              FBgn0067622

VALIUM10                                  FBgn0032240
           CG17768
VALIUM10   CG33696                        FBgn0053696

VALIUM10   CG3371                         FBgn0035153

VALIUM20   Muscle-specific protein 300    FBgn0260952


VALIUM20   Histone H4 replacement         FBgn0013981


VALIUM1    CG33796                        FBgn0053796

VALIUM10   nervy                          FBgn0005636

VALIUM22   His1:CG33864                   FBgn0053864


VALIUM22   His3:CG33866                   FBgn0053866


VALIUM10   gooseberry                     FBgn0001148

VALIUM10   Cad88C                         FBgn0038247

VALIUM1    CG33936                        FBgn0053936

VALIUM20   Ribosomal protein S9           FBgn0010408


VALIUM10   terribly reduced optic lobes   FBgn0001402

VALIUM1    eyes shut                      FBgn0031414

VALIUM1    eyes shut                      FBgn0031414

VALIUM1    kayak                          FBgn0001297

VALIUM1    kayak                          FBgn0001297

VALIUM10   kayak                          FBgn0001297

VALIUM20   kayak                          FBgn0001297
VALIUM10   CG33958               FBgn0053958

VALIUM10                         FBgn0053960
           CG33960
VALIUM1    CG33967               FBgn0053967

VALIUM10   CG3397                FBgn0037975

VALIUM10   Vsx2                  FBgn0053980

VALIUM1    nuclear fallout       FBgn0013718

VALIUM1    nuclear fallout       FBgn0013718

VALIUM10   nuclear fallout       FBgn0013718

VALIUM10   pickpocket 10         FBgn0065110

VALIUM10   pickpocket 11         FBgn0065109

VALIUM10   pickpocket 16         FBgn0065108

VALIUM10   molting defective     FBgn0083077

VALIUM1    CG34104               FBgn0083940

VALIUM20                         FBgn0083940

           CG34104
VALIUM10   blistered             FBgn0004101

VALIUM1    supernumerary limbs   FBgn0023423

VALIUM20   supernumerary limbs   FBgn0023423


VALIUM20   supernumerary limbs   FBgn0023423


VALIUM20                         FBgn0083956

           CG34120
VALIUM10   windpipe              FBgn0034718

VALIUM20                         FBgn0083981

           RunxA
VALIUM1    Dystrophin            FBgn0260003
VALIUM1    Mov34                    FBgn0002787

VALIUM20                            FBgn0085236

           CG34207
VALIUM20                            FBgn0085236

           CG34207
VALIUM1    RhoGAP93B                FBgn0038853

VALIUM20   Stromalin                FBgn0020616


VALIUM10                            FBgn0085383
           CG34207
VALIUM20                            FBgn0085383

           CG34354
VALIUM10   shaking B                FBgn0085387

VALIUM10   shaking B                FBgn0085387

VALIUM10                            FBgn0085395
           Shaw-like
VALIUM10   Fish-lips                FBgn0085397

VALIUM10                            FBgn0085398
           CG34369
VALIUM10                            FBgn0085399
           CG34370
VALIUM1    Ect4                     FBgn0085402

VALIUM1    Rapgap1                  FBgn0085403

VALIUM10   dpr12                    FBgn0085414

VALIUM10   Epac                     FBgn0085421

VALIUM10                            FBgn0085425
           CG34396
VALIUM10                            FBgn0085431
           CG34402
VALIUM10   pangolin                 FBgn0085432

VALIUM10   Na channel protein 60E   FBgn0085434

VALIUM1    Not1                     FBgn0085436
VALIUM10   Neuropeptide-like precursor 1   FBgn0035092

VALIUM1    Rab26                           FBgn0086913

VALIUM10                                   FBgn0085440
           CG34411
VALIUM10   Ank2                            FBgn0085445

VALIUM20   Ank2                            FBgn0085445


VALIUM10   still life                      FBgn0085447

VALIUM10   Sno oncogene                    FBgn0085450

VALIUM1                                    FBgn0085451
           CG34422
VALIUM10   pecanex                         FBgn0003048

VALIUM10   Histidine decarboxylase         FBgn0005619

VALIUM20   Rpt4                            FBgn0028685


VALIUM1    Topoisomerase 3β                FBgn0026015

VALIUM1    Topoisomerase 3β                FBgn0026015

VALIUM10   pickpocket                      FBgn0020258

VALIUM20   Myb-interacting protein 130     FBgn0023509


VALIUM10   Alcohol dehydrogenase           FBgn0000055

VALIUM10                                   FBgn0035008
           CG3494
VALIUM10   CG3494                          FBgn0035008

VALIUM10   Suppressor of Hairless          FBgn0004837

VALIUM10   vasa                            FBgn0003970

VALIUM20   vasa                            FBgn0003970


VALIUM20   vasa                            FBgn0003970
VALIUM20                                            FBgn0038251

           CG3508
VALIUM20                                            FBgn0038252

           CG3509
VALIUM20   Cyclin B                                 FBgn0000405


VALIUM10                                            FBgn0027571
           CG3523
VALIUM10   CG3530                                   FBgn0028497

VALIUM10   unzipped                                 FBgn0004055

VALIUM20                                            FBgn0031492

           CG3542
VALIUM20   visceral mesodermal armadillo-repeats    FBgn0022960


VALIUM10   Longevity assurance gene 1               FBgn0040918

VALIUM10   bifid                                    FBgn0000179

VALIUM10   U2 small nuclear riboprotein auxiliary   FBgn0017457
           factor 38
VALIUM1    spaghetti squash                         FBgn0003514

VALIUM20   spaghetti squash                         FBgn0003514


VALIUM20   spaghetti squash                         FBgn0003514


VALIUM20                                            FBgn0031493

           CG3605
VALIUM20   cabeza                                   FBgn0011571


VALIUM20   cabeza                                   FBgn0011571


VALIUM10   bellwether                               FBgn0011211

VALIUM10   Autophagy-specific gene 9                FBgn0034110
VALIUM10   CG3618                                FBgn0037028

VALIUM10   Delta                                 FBgn0000463

VALIUM1    no receptor potential A               FBgn0004625

VALIUM1    no receptor potential A               FBgn0004625

VALIUM10   Distal-less                           FBgn0000157

VALIUM20   Cortactin                             FBgn0025865


VALIUM20   bicaudal                              FBgn0000181


VALIUM10   CG3654                                FBgn0036004

VALIUM20                                         FBgn0036004

           Jarid2
VALIUM10   Rab-protein 5                         FBgn0014010

VALIUM20   Rab-protein 5                         FBgn0014010


VALIUM10   Fasciclin 2                           FBgn0000635

VALIUM20   Fasciclin 2                           FBgn0000635


VALIUM10   forkhead domain 59A                   FBgn0004896

VALIUM20                                         FBgn0035987

           CG3689
VALIUM10   CG3690                                FBgn0040350

VALIUM10   G protein γ30A                        FBgn0028433

VALIUM10   CG3703                                FBgn0040348

VALIUM10   astray                                FBgn0023129

VALIUM20   RNA polymerase II elongation factor   FBgn0010422
VALIUM20                                       FBgn0040344

           CG3814
VALIUM10   shotgun                             FBgn0003391

VALIUM20   shotgun                             FBgn0003391


VALIUM20   shotgun                             FBgn0003391


VALIUM10   Calcium ATPase at 60A               FBgn0004551

VALIUM10   dreadlocks                          FBgn0010583

VALIUM22   Chromodomain-helicase-DNA-binding   FBgn0250786
           protein 1

VALIUM1    okra                                FBgn0002989

VALIUM1    okra                                FBgn0002989

VALIUM20   okra                                FBgn0002989


VALIUM20   Metal response element-binding      FBgn0040305
           Transcription Factor-1

VALIUM20   Metal response element-binding      FBgn0040305
           Transcription Factor-1

VALIUM20   Marcal1                             FBgn0031655


VALIUM10   escargot                            FBgn0001981

VALIUM20   escargot                            FBgn0001981


VALIUM20   Phosphodiesterase 9                 FBgn0259171


VALIUM20   Vha68-2                             FBgn0020367


VALIUM10   cryptochrome                        FBgn0025680

VALIUM1    numb                                FBgn0002973
VALIUM10   achaete                                FBgn0000022

VALIUM10   N-methyl-D-aspartate receptor-associated FBgn0013305
           protein
VALIUM1    CG3803                                   FBgn0034938

VALIUM1    CG3803                                 FBgn0034938

VALIUM10   CG3814                                 FBgn0025692

VALIUM20                                          FBgn0025692

           CG3814
VALIUM20   Nup214                                 FBgn0010660


VALIUM10   CG3822                                 FBgn0038837

VALIUM20                                          FBgn0034948

           CG3825
VALIUM10   scute                                  FBgn0004170

VALIUM10   vestigial                              FBgn0003975

VALIUM10                                          FBgn0032130
           CG3838
VALIUM10   lethal of scute                        FBgn0002561

VALIUM10   NAT1                                   FBgn0010488

VALIUM20   NAT1                                   FBgn0010488


VALIUM10   trithorax-related                      FBgn0023518

VALIUM20   trithorax-related                      FBgn0023518


VALIUM10   Lasp                                   FBgn0063485

VALIUM10   sugarbabe                              FBgn0033782

VALIUM10   odd skipped                            FBgn0002985

VALIUM1    Octopamine receptor in mushroom bodies FBgn0024944

VALIUM1    Octopamine receptor in mushroom bodies FBgn0024944
VALIUM10   gcm2                                       FBgn0019809

VALIUM20   gcm2                                       FBgn0019809


VALIUM20   thioredoxin-2                              FBgn0040070


VALIUM20   thioredoxin-2                              FBgn0040070


VALIUM1    Mitochondrial assembly regulatory factor   FBgn0029870

VALIUM10   chrowded                                   FBgn0015372

VALIUM10   Six4                                       FBgn0027364

VALIUM20   Multi drug resistance 49                   FBgn0004512


VALIUM1    Posterior sex combs                        FBgn0005624

VALIUM22   Posterior sex combs                        FBgn0005624


VALIUM10   COP9 complex homolog subunit 1 b           FBgn0027057

VALIUM10   CG3891                                     FBgn0035993

VALIUM1    polyhomeotic distal                        FBgn0004860

VALIUM20   NADPH oxidase                              FBgn0085428


VALIUM20   NADPH oxidase                              FBgn0085428


VALIUM10   Gliotactin                                 FBgn0001987

VALIUM1    Suppressor of zeste 2                      FBgn0008654

VALIUM20   Suppressor of zeste 2                      FBgn0008654


VALIUM10   mitochondrial transcription factor B2      FBgn0037778

VALIUM20   gamma-tubulin ring protein 84              FBgn0026430
VALIUM20                FBgn0036423

           CG3919
VALIUM20   Exportin 6   FBgn0001337


VALIUM1    Chip         FBgn0013764

VALIUM10   deltex       FBgn0000524

VALIUM10   aristaless   FBgn0000061

VALIUM1    Notch        FBgn0004647

VALIUM1    Notch        FBgn0004647

VALIUM1    Notch        FBgn0004647

VALIUM1    Notch        FBgn0004647

VALIUM10   Notch        FBgn0004647

VALIUM10   Notch        FBgn0004647

VALIUM20   Notch        FBgn0004647


VALIUM20   Notch        FBgn0004647


VALIUM21   Notch        FBgn0004647


VALIUM20   Notch


VALIUM22   Notch        FBgn0004647


VALIUM10   cheerio      FBgn0014141

VALIUM10   Cyclin E     FBgn0010382

VALIUM20   Cyclin E     FBgn0010382


VALIUM10                FBgn0037788
           CG3940
VALIUM10   NADH:ubiquinone reductase 23kD subunit FBgn0017567
           precursor
VALIUM10   zetaCOP                                FBgn0040512

VALIUM1    corkscrew                              FBgn0000382

VALIUM20   corkscrew                              FBgn0000382


VALIUM21   corkscrew                              FBgn0000382


VALIUM22   corkscrew                              FBgn0000382


VALIUM10   snail                                  FBgn0003448

VALIUM10   CG3967                                 FBgn0035989

VALIUM22   Baldspot                               FBgn0260960


VALIUM10   pannier                                FBgn0003117

VALIUM20   pannier                                FBgn0003117


VALIUM20   pannier                                FBgn0003117


VALIUM10   nucleostemin 1                         FBgn0038473

VALIUM10   Synapsin                               FBgn0004575

VALIUM10   gamma-soluble NSF attachment protein   FBgn0028552

VALIUM10   serpent                                FBgn0003507

VALIUM20   serpent                                FBgn0003507


VALIUM10   CG3995                                 FBgn0038472

VALIUM20   yorkie                                 FBgn0034970


VALIUM10   yorkie                                 FBgn0034970
VALIUM20   Smrter                            FBgn0024308


VALIUM10   Smrter                            FBgn0024308

VALIUM10   Smrter                            FBgn0024308

VALIUM20   Smrter                            FBgn0024308


VALIUM20   Nipped-B                          FBgn0026401


VALIUM20   Argonaute 3                       FBgn0250816


VALIUM22   Argonaute 3                       FBgn0250816


VALIUM20   Eukaryotic initiation factor 4E   FBgn0015218


VALIUM20                                     FBgn0040022

           CG40351
VALIUM20                                     FBgn0011824

           CG4038
VALIUM1    Poly-(ADP-ribose) polymerase      FBgn0010247

VALIUM22   Poly-(ADP-ribose) polymerase      FBgn0010247


VALIUM20   Ppr-Y                             FBgn0046697


VALIUM10   Synapse protein 25                FBgn0011288

VALIUM20   Mitf                              FBgn0067895


VALIUM20                                     FBgn0034976

           CG4049
VALIUM10   egalitarian                       FBgn0000562

VALIUM10   ftz transcription factor 1        FBgn0001078
VALIUM20   ftz transcription factor 1               FBgn0001078


VALIUM20                                            FBgn0029798

           CG4078
VALIUM20   lethal (2) neighbor of tid               FBgn0011297


VALIUM20   Suppressor of ref(2)P sterility          FBgn0004465


VALIUM20   Suppressor of ref(2)P sterility          FBgn0004465


VALIUM10   latheo                                   FBgn0005654

VALIUM20   Proteasome 26kD subunit                  FBgn0002284


VALIUM20                                            FBgn0036648

           CG4098
VALIUM20   Pcaf                                     FBgn0020388


VALIUM10   Chmp1                                    FBgn0036805

VALIUM20   Chmp1                                    FBgn0036805


VALIUM10   Syntaxin 8                               FBgn0036643

VALIUM10   expanded                                 FBgn0004583

VALIUM20   expanded                                 FBgn0004583


VALIUM20   nuclear RNA export factor 2              FBgn0036640


VALIUM20   nuclear RNA export factor 2              FBgn0036640


VALIUM10   roughest                                 FBgn0003285

VALIUM10   nicotinic Acetylcholine Receptor α 30D   FBgn0032151
VALIUM10   CG4133                                 FBgn0031257

VALIUM10   multiprotein bridging factor 1         FBgn0026208

VALIUM20   Heat shock protein cognate 3           FBgn0001218


VALIUM10   Guanylyl cyclase at 88E                FBgn0038295

VALIUM20   Rpn12                                  FBgn0028693


VALIUM10   non-stop                               FBgn0013717

VALIUM22   vasa intronic gene                     FBgn0024183


VALIUM22   vasa intronic gene                     FBgn0024183


VALIUM10   Septin-2                               FBgn0014029

VALIUM10   Larval serum protein 1 β               FBgn0002563

VALIUM20   Mediator complex subunit 15            FBgn0027592


VALIUM10   lethal (3) 73Ah                        FBgn0002283

VALIUM20   lethal (3) 73Ah                        FBgn0002283


VALIUM20   small wing                             FBgn0003416


VALIUM20   small wing                             FBgn0003416


VALIUM10   Calcineurin B                          FBgn0010014

VALIUM10   Rab-protein 14                         FBgn0015791

VALIUM20   Rab-protein 14                         FBgn0015791


VALIUM10   Syntaxin 5                             FBgn0011708

VALIUM10   mitochondrial transcription factor A   FBgn0038805
VALIUM1    CG4221                                  FBgn0038385

VALIUM10   Dbx                                     FBgn0250756

VALIUM10                                           FBgn0250862
           CG42237
VALIUM1    Octβ3R                                  FBgn0250910

VALIUM10   epsin-like                              FBgn0261279

VALIUM20                                           FBgn0259142

           Snipper
VALIUM10   Glutamate receptor IIC                  FBgn0046113

VALIUM10   CG42260                                 FBgn0259145

VALIUM10   CG42271                                 FBgn0259166

VALIUM1    RhoGAP18B                               FBgn0259169

VALIUM1    Nedd4                                   FBgn0259174

VALIUM10   CCK-like receptor at 17D1               FBgn0259231

VALIUM10   grainy head                             FBgn0259211

VALIUM1    plasma membrane calcium ATPase          FBgn0259214

VALIUM22   app                                     FBgn0260941


VALIUM10                                           FBgn0259221
           CG42321
VALIUM20                                           FBgn0259227

           CG42327
VALIUM1    C3G                                     FBgn0259228

VALIUM10   Calmodulin-binding transcription activator FBgn0259234

VALIUM10   CG42333                                 FBgn0261090

VALIUM10   CG42340                                 FBgn0259242

VALIUM10   cAMP-dependent protein kinase R1        FBgn0259243

VALIUM10   cAMP-dependent protein kinase R1        FBgn0259243
VALIUM10   bruchpilot                            FBgn0259246

VALIUM10                                         FBgn0259677
           CG42346
VALIUM10                                         FBgn0259701
           CG42355
VALIUM20                                         FBgn0259704,FBgn0259705

           CG42358
VALIUM20                                         FBgn0259704, FBgn0259705

           CG42358
VALIUM1    Chromatin assembly factor 1 subunit   FBgn0015610

VALIUM20   Chromatin assembly factor 1 subunit   FBgn0015610


VALIUM1                                          FBgn0259743
           RhoGEF3
VALIUM1                                          FBgn0259743
           RhoGEF3
VALIUM20                                         FBgn0260392,FBgn0260401

           Dmel\CG42518
VALIUM20   COP9 complex homolog subunit 8        FBgn0028835,FBgn0260439


VALIUM1    CG42534                               FBgn0260487

VALIUM1    CG42534                               FBgn0260487

VALIUM20   twinstar                              FBgn0011726


VALIUM1    Signal-transducer and activator of    FBgn0016917
           transcription protein at 92E
VALIUM1    Signal-transducer and activator of    FBgn0016917
           transcription protein at 92E
VALIUM20   Signal-transducer and activator of    FBgn0016917
           transcription protein at 92E

VALIUM10   CG42575                               FBgn0260795

VALIUM20   CG42575                               FBgn0260795


VALIUM10                                         FBgn0260971
           CG42594
VALIUM20   alpha-Adaptin                      FBgn0015567


VALIUM20   Helicase 89B                       FBgn0022787


VALIUM20                                      FBgn0261260

           Megalin
VALIUM10   CG34352                            FBgn0261260

VALIUM10   embryonic lethal abnormal vision   FBgn0260400

VALIUM1    CG18646                            FBgn0261388

VALIUM10   Heat shock protein cognate 4       FBgn0001219

VALIUM20   Heat shock protein cognate 4       FBgn0001219


VALIUM20   Regulatory particle non-ATPase 3   FBgn0261396


VALIUM10   Regulatory particle non-ATPase 3   FBgn0261396

VALIUM20   Ephexin                            FBgn0027593


VALIUM20                                      FBgn0052306

           CG42669
VALIUM10                                      FBgn0053231
           CG42669
VALIUM20                                      FBgn0031405

           CG4267
VALIUM20   pasilla                            FBgn0026188


VALIUM1    CG30387                            FBgn0050387

VALIUM1                                       FBgn0259679
           CG42674
VALIUM20                                      FBgn0259679

           CG42674
VALIUM1    CoRest                             FBgn0053525
VALIUM20                                    FBgn0029808

           CG42699
VALIUM10                                    FBgn0085392
           CG42732
VALIUM1    fizzy                            FBgn0001086

VALIUM20   fizzy                            FBgn0001086


VALIUM22   atypical protein kinase C        FBgn0022131


VALIUM20   CG31304                          FBgn0051304


VALIUM1    CG31304                          FBgn0051304

VALIUM10                                    FBgn0261067
           LSm1
VALIUM10   CG4282                           FBgn0034114

VALIUM10   CG4288                           FBgn0038799

VALIUM20                                    FBgn0034742

           CG4294
VALIUM1    Brahma associated protein 60kD   FBgn0025463

VALIUM20   Brahma associated protein 60kD   FBgn0025463


VALIUM20   Brahma associated protein 60kD   FBgn0025463


VALIUM20                                    FBgn0025632

           CG4313
VALIUM1    raptor                           FBgn0029840

VALIUM1    raptor                           FBgn0029840

VALIUM20   raptor                           FBgn0029840


VALIUM10   CG4328                           FBgn0036274
VALIUM20                                             FBgn0030452

           CG4330
VALIUM20   roughex                                   FBgn0003302


VALIUM1    CG4338                                    FBgn0038313

VALIUM10   slow border cells                         FBgn0005638

VALIUM10   sodium chloride cotransporter 69          FBgn0036279

VALIUM10   Inwardly rectifying potassium channel 2   FBgn0039081

VALIUM20   alpha actinin                             FBgn0000667


VALIUM10   ultraspiracle                             FBgn0003964

VALIUM20                                             FBgn0028479

           CG4389
VALIUM10   CG4395                                    FBgn0030437

VALIUM10   found in neurons                          FBgn0086675

VALIUM20   enhanced adult sensory threshold          FBgn0010110


VALIUM10                                             FBgn0030432
           CG4404
VALIUM10   GDP dissociation inhibitor                FBgn0004868

VALIUM10   Autophagy-specific gene 4                 FBgn0031298

VALIUM20   Peptidoglycan recognition protein LC      FBgn0035976


VALIUM1    will decrease acetylation                 FBgn0039067

VALIUM20   will decrease acetylation                 FBgn0039067


VALIUM10   Nup153                                    FBgn0061200

VALIUM20   Nup153                                    FBgn0061200
VALIUM20   Heat shock protein 27                       FBgn0001226


VALIUM20   Heat shock protein 27                       FBgn0001226


VALIUM10   Glutamate receptor IB                       FBgn0028431

VALIUM10   moladietz                                   FBgn0086711

VALIUM10   no ocelli                                   FBgn0005771

VALIUM10   smt3                                        FBgn0026170

VALIUM10   bubblegum                                   FBgn0027348

VALIUM10   Cad86C                                      FBgn0261053

VALIUM20   Surfeit 6                                   FBgn0038746


VALIUM20   sans fille                                  FBgn0003449


VALIUM10   argos                                       FBgn0004569

VALIUM1    pod1                                        FBgn0029903

VALIUM10   FK506-binding protein FKBP59                FBgn0029174

VALIUM10   inactive                                    FBgn0086693

VALIUM1    Bekka                                       FBgn0010520

VALIUM10   Ataxin 1                                    FBgn0029907

VALIUM10   XNP                                         FBgn0039338

VALIUM20   XNP                                         FBgn0039338


VALIUM1    neither inactivation nor afterpotential E   FBgn0002940

VALIUM1    neither inactivation nor afterpotential E   FBgn0002940

VALIUM10   Arpc3A                                      FBgn0038369
VALIUM20                                            FBgn0038740

           CG4562
VALIUM1    CG4565                                   FBgn0037841

VALIUM20                                            FBgn0037841

           CG4565
VALIUM1    Phospholipase C at 21C                   FBgn0004611

VALIUM1    Phospholipase C at 21C                   FBgn0004611

VALIUM20   Phospholipase C at 21C                   FBgn0004611


VALIUM20   Phospholipase C at 21C                   FBgn0004611


VALIUM10                                            FBgn0029920
           CG4575
VALIUM20   Thiolase                                 FBgn0025352


VALIUM10                                            FBgn0025335
           CG4585
VALIUM10   CG4587                                   FBgn0028863

VALIUM10   innexin 2                                FBgn0027108

VALIUM10   innexin 2                                FBgn0027108

VALIUM10   Tetraspanin 86D                          FBgn0037848

VALIUM10   CG4596                                   FBgn0037849

VALIUM10   Srp54                                    FBgn0024285

VALIUM20   branchless                               FBgn0014135


VALIUM20   failed axon connections                  FBgn0014163


VALIUM10   CG4617                                   FBgn0029936

VALIUM10   Charged multivesicular body protein 2b   FBgn0035589

VALIUM10   YL-1                                     FBgn0032321
VALIUM1    Nucleosome remodeling factor - 38kD   FBgn0016687

VALIUM1    SCAR                                  FBgn0041781

VALIUM10   hedgehog                              FBgn0004644

VALIUM20   hedgehog                              FBgn0004644


VALIUM1    hedgehog                              FBgn0004644

VALIUM1    hedgehog                              FBgn0004644

VALIUM1                                          FBgn0043010
           Fsn
VALIUM10                                         FBgn0043010
           Fsn
VALIUM1    DP transcription factor               FBgn0011763

VALIUM20   DP transcription factor               FBgn0011763


VALIUM10   CG4655                                FBgn0261053

VALIUM10   Ras association family member         FBgn0039055

VALIUM10   CG4670                                FBgn0033814

VALIUM10   CG4681                                FBgn0069913

VALIUM10   nervous wreck                         FBgn0035966

VALIUM20   Muscle protein 20                     FBgn0002789


VALIUM1    COP9 complex homolog subunit 1 a      FBgn0028838

VALIUM10   Wnt oncogene analog 4                 FBgn0010453

VALIUM10   Sema-2a                               FBgn0011260

VALIUM22   squash                                FBgn0002652


VALIUM10   lethal (2) giant discs 1              FBgn0250747

VALIUM10   knirps                                FBgn0001320
VALIUM10   big brain                                  FBgn0000180

VALIUM20   nuclear pore protein 160                   FBgn0260937


VALIUM20   Ugt86Dc                                    FBgn0040257


VALIUM20                                              FBgn0043456

           CG4747
VALIUM20   RhoGAP92B                                  FBgn0038747


VALIUM20                                              FBgn0035600

           CG4769
VALIUM1    Transport and Golgi organization 14        FBgn0031312

VALIUM20                                              FBgn0031314

           CG4785
VALIUM10   Dicer-1                                    FBgn0039016

VALIUM20   Dicer-1                                    FBgn0039016


VALIUM10   Calphotin                                  FBgn0010218

VALIUM10   Pendulin                                   FBgn0011823

VALIUM20   Translationally controlled tumor protein   FBgn0037874


VALIUM10   pickpocket 28                              FBgn0030795

VALIUM10   abrupt                                     FBgn0259750

VALIUM20   abrupt                                     FBgn0259750


VALIUM10   Structure specific recognition protein     FBgn0010278

VALIUM10   CG4822                                     FBgn0031220

VALIUM1    centrosomin                                FBgn0013765

VALIUM1    Tropomyosin 2                              FBgn0004117
VALIUM10   Palmitoyl-protein Thioesterase 2    FBgn0032358

VALIUM1    CG4853                              FBgn0034230

VALIUM1    Matrix metalloproteinase 1          FBgn0035049

VALIUM10   CG4872                              FBgn0030799

VALIUM20                                       FBgn0036624

           CG4877
VALIUM20   eIF3-S9                             FBgn0034237


VALIUM20   homolog of RecQ                     FBgn0027375


VALIUM10   spalt-related                       FBgn0000287

VALIUM1    wingless                            FBgn0004009

VALIUM1    wingless                            FBgn0004009

VALIUM20   wingless                            FBgn0004009


VALIUM20   wingless                            FBgn0004009


VALIUM10   Ca2+-channel protein α1 subunit D   FBgn0001991

VALIUM20   Ca[2+]-channel protein alpha[[1]]   FBgn0001991
           subunit D

VALIUM20   Ribosomal protein L7                FBgn0005593


VALIUM20   Proteasome 35kD subunit             FBgn0250843


VALIUM10   Syntrophin-like 2                   FBgn0034135

VALIUM1    CG4908                              FBgn0032195

VALIUM1    CG4908                              FBgn0032195

VALIUM10   Cardioacceleratory peptide          FBgn0039007
VALIUM1    CG4911                        FBgn0035959

VALIUM10   eEF1delta                     FBgn0032198

VALIUM10   ENL/AF9-related               FBgn0026441

VALIUM20   ENL/AF9-related               FBgn0026441


VALIUM10   maternal expression at 31B    FBgn0004419

VALIUM20   maternal expression at 31B    FBgn0004419


VALIUM1    Ribosomal protein LP2         FBgn0003274

VALIUM20   Rab-protein 4                 FBgn0016701


VALIUM20   spalt-adjacent                FBgn0003313


VALIUM20   spalt-adjacent                FBgn0003313


VALIUM1    RhoGAP15B                     FBgn0030808

VALIUM10                                 FBgn0036587
           CG4950
VALIUM10   dachshund                     FBgn0005677

VALIUM20   mitoferrin                    FBgn0039561


VALIUM20   twine                         FBgn0002673


VALIUM10   Wnt6                          FBgn0031902

VALIUM10   Wnt6                          FBgn0031902

VALIUM10   Wnt10                         FBgn0031903

VALIUM10   division abnormally delayed   FBgn0011577

VALIUM20   division abnormally delayed   FBgn0011577
VALIUM20   Mes-4                            FBgn0039559


VALIUM10   kekkon-2                         FBgn0015400

VALIUM20   Minichromosome maintenance 7     FBgn0020633


VALIUM1    mini spindles                    FBgn0027948

VALIUM20                                    FBgn0031322

           CG5001
VALIUM1    CG5003                           FBgn0039554

VALIUM10   HLH54F                           FBgn0022740

VALIUM10   Vap-33-1                         FBgn0029687

VALIUM1    Cytoplasmic linker protein 190   FBgn0020503

VALIUM20   FBgn0032225                      FBgn0032225


VALIUM10   CG5027                           FBgn0036579

VALIUM20   dally-like                       FBgn0041604


VALIUM20   dally-like                       FBgn0041604


VALIUM20   GATAd                            FBgn0032223


VALIUM20   GATAd                            FBgn0032223


VALIUM1    CG5037                           FBgn0032222

VALIUM1    CG5037                           FBgn0032222

VALIUM10   CG5053                           FBgn0039352

VALIUM1    bazooka                          FBgn0000163

VALIUM1    bazooka                          FBgn0000163
VALIUM20   Mediator complex subunit 10          FBgn0036581


VALIUM10   capicua                              FBgn0028386

VALIUM10   crocodile                            FBgn0014143

VALIUM20   crocodile                            FBgn0014143


VALIUM20   capulet                              FBgn0028388


VALIUM10   Syntaxin 7                           FBgn0086377

VALIUM20   Sirt2                                FBgn0038788


VALIUM1    Sirt2                                FBgn0038788

VALIUM10   Dorsocross3                          FBgn0035954

VALIUM10   daughterless                         FBgn0000413

VALIUM10   daughterless                         FBgn0000413

VALIUM1    Phospholipase A2 activator protein   FBgn0024314

VALIUM20   Polycomblike                         FBgn0003044


VALIUM1    Polycomblike                         FBgn0003044

VALIUM20   Polycomblike                         FBgn0003044


VALIUM10   polyA-binding protein                FBgn0003031

VALIUM20   Mediator complex subunit 28          FBgn0039337


VALIUM10   Dorsocross1                          FBgn0028789

VALIUM20   Mediator complex subunit 9           FBgn0260392,FBgn0260401


VALIUM1    CG5155                               FBgn0031905
VALIUM10   CG5160                               FBgn0031906

VALIUM20   Dodeca-satellite-binding protein 1   FBgn0027835


VALIUM10   Dodeca-satellite-binding protein 1   FBgn0027835

VALIUM20                                        FBgn0034345

           CG5174
VALIUM20                                        FBgn0034345

           CG5174
VALIUM10   kugelkern                            FBgn0038476

VALIUM20                                        FBgn0031909

           CG5181
VALIUM10   scruin like at the midline           FBgn0026173

VALIUM10   Daughters against dpp                FBgn0020493

VALIUM20   Dad                                  FBgn0020493


VALIUM20   CHIP                                 FBgn0027052


VALIUM20   CHIP                                 FBgn0027052


VALIUM1    Sir2                                 FBgn0024291

VALIUM20   Sir2                                 FBgn0024291


VALIUM10   CG5226                               FBgn0034355

VALIUM20   sidekick                             FBgn0021764


VALIUM10   chameau                              FBgn0028387

VALIUM20   chameau                              FBgn0028387


VALIUM10   CG5235                               FBgn0036565
VALIUM20   Ranbp9                                  FBgn0037894


VALIUM20   Ranbp9                                  FBgn0037894


VALIUM10   CG5284                                  FBgn0036566

VALIUM20   Proteasome 26S subunit subunit 4 ATPase FBgn0015282


VALIUM20                                           FBgn0038491

           CG5292
VALIUM20                                           FBgn0038491

           CG5292
VALIUM10   brummer                                 FBgn0036449

VALIUM10   dpr5                                    FBgn0037908

VALIUM1    CG5316                                  FBgn0038704

VALIUM1    CG5316                                  FBgn0038704

VALIUM10   Ced-12                                  FBgn0032409

VALIUM20                                           FBgn0032249

           CG5337
VALIUM10   sec6                                    FBgn0034367

VALIUM10   Small ribonucleoprotein particle protein B FBgn0010083

VALIUM1    Arginine methyltransferase 4            FBgn0037770

VALIUM20                                           FBgn0027568

           CG5366
VALIUM20                                           FBgn0027568

           CG5366
VALIUM10   Death caspase-1                         FBgn0010501

VALIUM20   Tcp1-like                               FBgn0003676
VALIUM20   Rpn7                                  FBgn0028688


VALIUM20   phosphatidylserine receptor           FBgn0038948


VALIUM10   apontic                               FBgn0015903

VALIUM10   Eclosion hormone                      FBgn0000564

VALIUM10   retained                              FBgn0004795

VALIUM10   Sur-8                                 FBgn0038504

VALIUM10   Mitochondrial Rho                     FBgn0039140

VALIUM10   Rox8                                  FBgn0005649

VALIUM20   Rox8                                  FBgn0005649


VALIUM10   robo3                                 FBgn0041097

VALIUM10   Autophagy-specific gene 6             FBgn0010709

VALIUM20   Kinesin light chain                   FBgn0010235


VALIUM20                                         FBgn0032476

           CG5439
VALIUM10   delilah                               FBgn0008649

VALIUM20   delilah                               FBgn0008649


VALIUM20                                         FBgn0032429

           CG5446
VALIUM20                                         FBgn0038666

           CG5451
VALIUM1    small ribonucleoprotein particle U1   FBgn0038667
           subunit C
VALIUM20   small ribonucleoprotein particle U1   FBgn0038667
           subunit C

VALIUM10   Hairless                              FBgn0001169
VALIUM10   bunched                              FBgn0259176

VALIUM10   scribbled                            FBgn0261263

VALIUM20   Mediator complex subunit 16          FBgn0034707


VALIUM20   leak                                 FBgn0002543


VALIUM20   BarH2                                FBgn0004854


VALIUM10   Autophagy-specific gene 7            FBgn0034366

VALIUM1    Toll                                 FBgn0003717

VALIUM1    Toll                                 FBgn0003717

VALIUM10   Histone H2A variant                  FBgn0001197

VALIUM20   Histone H2A variant                  FBgn0001197


VALIUM10   lethal (2) tumorous imaginal discs   FBgn0002174

VALIUM10   Ubiquitin-specific protease 36       FBgn0260936

VALIUM20   scrawny                              FBgn0260936


VALIUM20                                        FBgn0039560

           CG5514
VALIUM20   Prp19                                FBgn0261119


VALIUM1    CG5522                               FBgn0034158

VALIUM20                                        FBgn0039564

           CG5527
VALIUM10   Toll-9                               FBgn0036978

VALIUM20   Toll-9                               FBgn0036978


VALIUM1    BarH1                                FBgn0011758
VALIUM10                                            FBgn0030603
           CG5548
VALIUM10   Olig family                              FBgn0032651

VALIUM10   Mediator complex subunit 19              FBgn0036761

VALIUM20   Mediator complex subunit 19              FBgn0036761


VALIUM10                                            FBgn0030605
           CG5548
VALIUM10   Synaptotagmin α                          FBgn0261089

VALIUM10                                            FBgn0036760
           CG5567
VALIUM10   scribbler                                FBgn0010575

VALIUM10   Ets at 98B                               FBgn0005659

VALIUM10   Mig-2-like                               FBgn0039532

VALIUM20                                            FBgn0036754

           CG5589
VALIUM10   CG5591                                   FBgn0034926

VALIUM20                                            FBgn0025698

           kazachoc
VALIUM1    Sex combs extra                          FBgn0003330

VALIUM10   Myosin alkali light chain 1              FBgn0002772

VALIUM20                                            FBgn0030612

           CG5599
VALIUM20                                            FBgn0034922

           DNA ligase I
VALIUM10   nicotinic Acetylcholine Receptor alpha   FBgn0000036
           96Aa
VALIUM10   CG5618                                   FBgn0036975

VALIUM10   CG5621                                   FBgn0038840

VALIUM10   rab3-GEF                                 FBgn0030613

VALIUM10   rab3-GEF                                 FBgn0030613
VALIUM10   CG5629                         FBgn0261285

VALIUM10   nanos                          FBgn0002962

VALIUM20   nanos                          FBgn0002962


VALIUM20   nanos                          FBgn0002962


VALIUM20                                  FBgn0260749

           Utx
VALIUM10   widerborst                     FBgn0027492

VALIUM10   widerborst                     FBgn0027492

VALIUM10   CG5644                         FBgn0035948

VALIUM20                                  FBgn0039525

           CG5646
VALIUM20   Protein phosphatase 1 at 87B   FBgn0004103


VALIUM1    pixie                          FBgn0086706

VALIUM10   ypsilon schachtel              FBgn0022959

VALIUM10                                  FBgn0037083
           CG5726
VALIUM10   Sarcoglycan beta               FBgn0038042

VALIUM10   ariadne                        FBgn0017418

VALIUM10   Semaphorin-5c                  FBgn0250876

VALIUM10   Na pump alpha subunit          FBgn0002921

VALIUM20   Na pump alpha subunit          FBgn0002921


VALIUM20   Na pump alpha subunit          FBgn0002921


VALIUM10   Pten                           FBgn0026379

VALIUM10   Pten                           FBgn0026379
VALIUM20   Pten                              FBgn0026379


VALIUM10   X11L                              FBgn0026313

VALIUM10   Adult enhancer factor 1           FBgn0005694

VALIUM10   Pop2                              FBgn0036239

VALIUM10   Na/Ca-exchange protein            FBgn0013995

VALIUM10   chico                             FBgn0024248

VALIUM10   rapsynoid                         FBgn0040080

VALIUM10   jaguar                            FBgn0011225

VALIUM20   RhoBTB                            FBgn0036980


VALIUM10   Tenascin major                    FBgn0004449

VALIUM20                                     FBgn0034313

           CG5726
VALIUM10   CG5733                            FBgn0034310

VALIUM10   orb2                              FBgn0035938

VALIUM10   doublesex-Mab related 93B         FBgn0038851

VALIUM1    lola like                         FBgn0022238

VALIUM10   Frequenin 1                       FBgn0030897

VALIUM20                                     FBgn0038855

           CG5745
VALIUM10   Heat shock factor                 FBgn0001222

VALIUM1    Transient receptor potential A1   FBgn0035934

VALIUM1    Transient receptor potential A1   FBgn0035934

VALIUM20   Transient receptor potential A1   FBgn0035934


VALIUM1    staufen                           FBgn0003520
VALIUM10   Rab-protein 11                           FBgn0015790

VALIUM20   Mapmodulin                               FBgn0034282


VALIUM10   defective proventriculus                 FBgn0020307

VALIUM20                                            FBgn0027539

           CG5807
VALIUM10   Neuropeptide Y receptor-like             FBgn0004842

VALIUM20   chiffon                                  FBgn0000307


VALIUM10                                            FBgn0034717
           CG5819
VALIUM20   Gp150                                    FBgn0013272


VALIUM1    CG5830                                   FBgn0036556

VALIUM20                                            FBgn0036556

           CG5830
VALIUM10   Hsp70Bbb                                 FBgn0051354

VALIUM10   Splicing factor 1                        FBgn0025571

VALIUM10   HEM-protein                              FBgn0011771

VALIUM10   DNA replication-related element factor   FBgn0015664

VALIUM10   mind bomb 1                              FBgn0036558

VALIUM1    nanchung                                 FBgn0036414

VALIUM1    nanchung                                 FBgn0036414

VALIUM1    CG5844                                   FBgn0038049

VALIUM1    cactus                                   FBgn0000250

VALIUM20   cactus                                   FBgn0000250


VALIUM10   CG5853                                   FBgn0032167
VALIUM20                   FBgn0025830

           CG5859
VALIUM20   NELF-A          FBgn0038872


VALIUM10   CG5890          FBgn0039380

VALIUM10   Dichaete        FBgn0000411

VALIUM20                   FBgn0032157

           CG5899
VALIUM10   Frequenin 2     FBgn0083228

VALIUM10   ETHR            FBgn0038874

VALIUM1    arrow           FBgn0000119

VALIUM1    arrow           FBgn0000119

VALIUM10   Rab-protein 7   FBgn0015795

VALIUM1    CG5924          FBgn0032154

VALIUM1    CG5924          FBgn0032154

VALIUM10   HES-related     FBgn0030899

VALIUM20                   FBgn0036548

           CG5931
VALIUM1    CG5931          FBgn0036548

VALIUM10   Dek             FBgn0026533

VALIUM1    Paramyosin      FBgn0003149

VALIUM1    Paramyosin      FBgn0003149

VALIUM10   Cyclin A        FBgn0000404

VALIUM1    Cyclin A        FBgn0000404

VALIUM1    brahma          FBgn0000212

VALIUM22   brahma          FBgn0000212
VALIUM20   brahma                             FBgn0000212


VALIUM10   48 related 2                       FBgn0038402

VALIUM10   lethal (3) malignant brain tumor   FBgn0002441

VALIUM1    CG5961                             FBgn0038056

VALIUM1    Arrestin 2                         FBgn0000121

VALIUM1    Arrestin 2                         FBgn0000121

VALIUM20   Arrestin 2                         FBgn0000121


VALIUM20   Arrestin 2                         FBgn0000121


VALIUM10   without children                   FBgn0010328

VALIUM20                                      FBgn0029831

           CG5966
VALIUM1    Arc-p20                            FBgn0031781

VALIUM10   spastin                            FBgn0039141

VALIUM20   unpaired 2                         FBgn0030904


VALIUM20   unpaired 2                         FBgn0030904


VALIUM10   outstretched                       FBgn0004956

VALIUM20   outstretched                       FBgn0004956


VALIUM20   Negative elongation factor E       FBgn0017430


VALIUM1    trpγ                               FBgn0032593

VALIUM1    trpγ                               FBgn0032593

VALIUM20                                      FBgn0038927

           CG6015
VALIUM10   Huntingtin-interacting protein 14     FBgn0259824

VALIUM1    Huntingtin-interacting protein 14     FBgn0259824

VALIUM10   CG6024                                FBgn0036202

VALIUM10   Arflike at 72A                        FBgn0000115

VALIUM20   ATP synthase, subunit d               FBgn0016120


VALIUM1    downstream of receptor kinase         FBgn0004638

VALIUM10   downstream of receptor kinase         FBgn0004638

VALIUM10   CG6044                                FBgn0034725

VALIUM1    Bicoid interacting protein 1          FBgn0024491

VALIUM22   Bicoid interacting protein 1          FBgn0024491


VALIUM20   Elongation factor Tu mitochondrial    FBgn0024556


VALIUM10   Suppressor of fused                   FBgn0005355

VALIUM10   Aldolase                              FBgn0000064

VALIUM20   Myb-interacting protein 120           FBgn0033846


VALIUM10   TORC                                  FBgn0036746

VALIUM20                                         FBgn0039488

           CG6066
VALIUM10   sarah                                 FBgn0086370

VALIUM10   exo84                                 FBgn0260946

VALIUM10   E(spl) region transcript m5           FBgn0002631

VALIUM10   Leucine-rich repeat 47                FBgn0010398

VALIUM10   E(spl) region transcript m4           FBgn0002629

VALIUM10   Cyclic-AMP response element binding   FBgn0014467
           protein B at 17A
VALIUM10   Lipase 4                          FBgn0032264

VALIUM10   Tip60                             FBgn0026080

VALIUM22   Tip60                             FBgn0026080


VALIUM1    piwi                              FBgn0004872

VALIUM20   piwi                              FBgn0004872


VALIUM20   piwi                              FBgn0004872


VALIUM10   eater                             FBgn0243514

VALIUM10   Serrate                           FBgn0004197

VALIUM10   spatzle                           FBgn0003495

VALIUM1    aubergine                         FBgn0000146

VALIUM20   aubergine                         FBgn0000146


VALIUM22   aubergine                         FBgn0000146


VALIUM20   Protein on ecdysone puffs         FBgn0004401


VALIUM1    Tsc1                              FBgn0026317

VALIUM1    Tsc1                              FBgn0026317

VALIUM22   Tsc1                              FBgn0026317


VALIUM20   Putative Achaete Scute Target 1   FBgn0016693


VALIUM10   CG6151                            FBgn0036533

VALIUM10   sec10                             FBgn0027103

VALIUM1    PICK1                             FBgn0032447
VALIUM20   Decapping protein 2                FBgn0036534


VALIUM1    HDAC6                              FBgn0026428

VALIUM20   HDAC6                              FBgn0026428


VALIUM10   ventral nervous system defective   FBgn0003986

VALIUM10   Actin-related protein 87C          FBgn0011745

VALIUM1    Grip75                             FBgn0026431

VALIUM10                                      FBgn0039156
           CG6178
VALIUM20                                      FBgn0032340

           Ge-1
VALIUM10   Angelman syndrome                  FBgn0061469

VALIUM10   Adenomatous polyposis coli tumor   FBgn0026598
           suppressor homolog 2
VALIUM20   Adenomatous polyposis coli tumor   FBgn0026598
           suppressor homolog 2

VALIUM10   Fmr1                               FBgn0028734

VALIUM20   Fmr1                               FBgn0028734


VALIUM22   Fmr1                               FBgn0028734


VALIUM10   germ cell-expressed bHLH-PAS       FBgn0030627

VALIUM20   suppressor of sable                FBgn0003575


VALIUM1    β-coatomer protein                 FBgn0008635

VALIUM20   beta-coatomer protein              FBgn0008635


VALIUM20   FK506-binding protein 1            FBgn0013269


VALIUM10   twins                              FBgn0004889
VALIUM10   nubbin                       FBgn0085424

VALIUM20                                FBgn0036126

           CG6272
VALIUM10                                FBgn0036126
           CG6272
VALIUM10   CG6276                       FBgn0038316

VALIUM20                                FBgn0039475

           CG6277
VALIUM1    Sirt6                        FBgn0037802

VALIUM20   Sirt6                        FBgn0037802


VALIUM10   Enhancer of decapping 3      FBgn0036735

VALIUM10   Rfx                          FBgn0020379

VALIUM10   CG6329                       FBgn0033872

VALIUM10   Ets at 97D                   FBgn0004510

VALIUM10   rough                        FBgn0003267

VALIUM10   Ods-site homeobox            FBgn0026058

VALIUM1    Ribonuclear protein at 97D   FBgn0004903

VALIUM1    Ribonuclear protein at 97D   FBgn0004903

VALIUM10   CG6356                       FBgn0039178

VALIUM22   MRG15                        FBgn0027378


VALIUM20                                FBgn0034277

           CG6370
VALIUM10   hugin                        FBgn0028374

VALIUM1    E2F transcription factor     FBgn0011766

VALIUM10   E2F transcription factor     FBgn0011766

VALIUM10   crumbs                       FBgn0259685
VALIUM20   Centrosomal protein 190kD         FBgn0000283


VALIUM20   Centrosomal protein 190kD         FBgn0000283


VALIUM20   Cysteine string protein           FBgn0004179


VALIUM1    Cysteine string protein           FBgn0004179

VALIUM1    Cysteine string protein           FBgn0004179

VALIUM20   BRWD3                             FBgn0011785


VALIUM10   Wnt oncogene analog 5             FBgn0010194

VALIUM10   Wnt oncogene analog 5             FBgn0010194

VALIUM20   Wnt oncogene analog 5             FBgn0010194


VALIUM1    CG6412                            FBgn0032646

VALIUM20                                     FBgn0036104

           CG6418
VALIUM20                                     FBgn0036104

           CG6418
VALIUM10   amontillado                       FBgn0023179

VALIUM10   Dromyosuppressin                  FBgn0011581

VALIUM10   Cad74A                            FBgn0036715

VALIUM10   Sema-1b                           FBgn0016059

VALIUM10   Myoinhibiting peptide precursor   FBgn0036713

VALIUM20                                     FBgn0034259

           CG6459
VALIUM20   spalt major                       FBgn0004579
VALIUM20   enhancer of yellow 1               FBgn0000617


VALIUM1    Suppressor of variegation 3-9      FBgn0003600

VALIUM20   Suppressor of variegation 3-9      FBgn0003600


VALIUM20   Suppressor of variegation 3-9      FBgn0003600


VALIUM1    RhoGAP54D                          FBgn0034249

VALIUM10   Dicer-2                            FBgn0034246

VALIUM20   Dicer-2                            FBgn0034246


VALIUM10   hairy                              FBgn0001168

VALIUM10   CG6495                             FBgn0027550

VALIUM10   Pigment-dispersing factor          FBgn0023178

VALIUM20                                      FBgn0036704

           CG6497
VALIUM10   Beadex                             FBgn0000242

VALIUM1    Enhancer of zeste                  FBgn0000629

VALIUM10   Enhancer of zeste                  FBgn0000629

VALIUM20   Enhancer of zeste                  FBgn0000629


VALIUM1    Polycystic kidney disease gene-2   FBgn0041195

VALIUM1    Polycystic kidney disease gene-2   FBgn0041195

VALIUM10   Tachykinin-like receptor at 86C    FBgn0004841

VALIUM10   slouch                             FBgn0002941

VALIUM20   Gemin3                             FBgn0011802


VALIUM10   ladybird early                     FBgn0011278
VALIUM1    Brahma associated protein 55kD   FBgn0025716

VALIUM1    CG6550                           FBgn0034214

VALIUM1    Arginine methyltransferase 1     FBgn0037834

VALIUM1    connector enhancer of ksr        FBgn0021818

VALIUM20   connector enhancer of ksr        FBgn0021818


VALIUM10   CG6560                           FBgn0038916

VALIUM10   synaptojanin                     FBgn0034691

VALIUM20   tantalus                         FBgn0028980


VALIUM10   Rab-protein 6                    FBgn0015797

VALIUM20   Hsc70Cb                          FBgn0026418


VALIUM10   Bicaudal D                       FBgn0000183

VALIUM1    CG6608                           FBgn0037852

VALIUM10                                    FBgn0035675
           CG6610
VALIUM1    Patsas                           FBgn0029137

VALIUM20   Soluble NSF attachment protein   FBgn0250791


VALIUM10   Soluble NSF attachment protein   FBgn0250791

VALIUM1    DJ-1α                            FBgn0033885

VALIUM10   porin                            FBgn0004363

VALIUM10   dorsal                           FBgn0260632

VALIUM20   dorsal                           FBgn0260632


VALIUM20   dorsal                           FBgn0260632
VALIUM10   klingon                              FBgn0017590

VALIUM1    Argonaute-1                          FBgn0026611

VALIUM20   Argonaute-1                          FBgn0026611


VALIUM10   CG6683                               FBgn0035902

VALIUM1    CG6686                               FBgn0032388

VALIUM10   CG6690                               FBgn0038918

VALIUM20   Cysteine proteinase-1                FBgn0013770


VALIUM10   CG6697                               FBgn0027526

VALIUM10   NtR                                  FBgn0029147

VALIUM1    β'-coatomer protein                  FBgn0025724

VALIUM20   beta'-coatomer protein               FBgn0025724


VALIUM1    CG6701                               FBgn0033889

VALIUM10   CG6701                               FBgn0033889

VALIUM10   Calbindin 53E                        FBgn0004580

VALIUM10   metabotropic GABA-B receptor subtype 2 FBgn0027575

VALIUM10   CG6707                               FBgn0036058

VALIUM10   Nitric oxide synthase                FBgn0011676

VALIUM20   paired                               FBgn0003145


VALIUM1    GTPase-activating protein 1          FBgn0004390

VALIUM10   CG6723                               FBgn0037895

VALIUM1    insulin-like peptide 4               FBgn0044049

VALIUM20   insulin-like peptide 4               FBgn0044049
VALIUM10   CG6737                                  FBgn0032294

VALIUM1    centaurin beta 1A                       FBgn0039056

VALIUM10   Inwardly rectifying potassium channel   FBgn0039061

VALIUM10   SH3PX1                                  FBgn0040475

VALIUM1    CG6758                                  FBgn0034704

VALIUM10   CG6770                                  FBgn0032400

VALIUM20   sec13                                   FBgn0024509


VALIUM1    Ribosomal protein S3                    FBgn0002622

VALIUM20                                           FBgn0037912,FBgn0037913

           scheggia
VALIUM20                                           FBgn0037918

           CG6791
VALIUM10   Dorsal-related immunity factor          FBgn0011274

VALIUM10   Dorsal-related immunity factor          FBgn0011274

VALIUM10   nicotinic Acetylcholine Receptor beta 96A FBgn0004118

VALIUM20                                           FBgn0034179

           CG6805
VALIUM1    CG6808                                  FBgn0037921

VALIUM1    RhoGAP68F                               FBgn0036257

VALIUM10   CG6813                                  FBgn0037923

VALIUM20   Maternal transcript 89Bb                FBgn0020407


VALIUM10   Neurexin IV                             FBgn0013997

VALIUM20   Neurexin IV                             FBgn0013997


VALIUM20   Apaf-1-related-killer                   FBgn0024252
VALIUM10   rhea                                     FBgn0260442

VALIUM20   rhea                                     FBgn0260442


VALIUM20   rhea                                     FBgn0260442


VALIUM1    CG6838                                   FBgn0037182

VALIUM1    Vacuolar protein sorting 4               FBgn0027605

VALIUM10   nicotinic Acetylcholine Receptor alpha   FBgn0000039
           96Ab
VALIUM10   Mitochondrial carrier homolog 1          FBgn0027786

VALIUM1    CG6854                                   FBgn0036478

VALIUM10                                            FBgn0036478
           CTP synthase
VALIUM10                                            FBgn0032633
           CG6860
VALIUM10   loquacious                               FBgn0032515

VALIUM20   loquacious                               FBgn0032515


VALIUM20   loquacious                               FBgn0032515


VALIUM20   loquacious                               FBgn0032515


VALIUM20   loquacious                               FBgn0032515


VALIUM20   loquacious                               FBgn0032515


VALIUM20   loquacious                               FBgn0032515


VALIUM20   loquacious                               FBgn0032515


VALIUM20   loquacious                               FBgn0032515
VALIUM20   Catalase                                  FBgn0000261


VALIUM10   Catalase                                  FBgn0000261

VALIUM10   trachealess                               FBgn0003749

VALIUM20   trachealess                               FBgn0003749


VALIUM20   Mediator complex subunit 11               FBgn0036811


VALIUM1    taranis                                   FBgn0040071

VALIUM10   Tollo                                     FBgn0029114

VALIUM20   Ets96B                                    FBgn0039225


VALIUM10   Ets96B                                    FBgn0039225

VALIUM20   Zinc/iron regulated transporter-related   FBgn0038412
           protein 3

VALIUM20                                             FBgn0029737

           CG6903
VALIUM10   CG6907                                    FBgn0031711

VALIUM10   48 related 3                              FBgn0037937

VALIUM20                                             FBgn0037172

           CG6914
VALIUM1    octopamine receptor 2                     FBgn0038980

VALIUM1    octopamine receptor 2                     FBgn0038980

VALIUM1    mutagen-sensitive 309                     FBgn0002906

VALIUM1    mutagen-sensitive 309                     FBgn0002906

VALIUM20                                             FBgn0037944

           CG6923
VALIUM10   CG6927                                    FBgn0029733
VALIUM10   methuselah                    FBgn0023000

VALIUM20   SET domain binding factor     FBgn0025802


VALIUM1    Lamin                         FBgn0002525

VALIUM20   glorund                       FBgn0259139


VALIUM10   Clathrin light chain          FBgn0024814

VALIUM20   Grunge                        FBgn0010825


VALIUM1    gigas                         FBgn0005198

VALIUM10   Cad87A                        FBgn0037963

VALIUM1    CG6984                        FBgn0034191

VALIUM10   Proctolin receptor            FBgn0029723

VALIUM10   SF2                           FBgn0040284

VALIUM20   SF2                           FBgn0040284


VALIUM10   Protein disulfide isomerase   FBgn0014002

VALIUM1    HP1c                          FBgn0039019

VALIUM20   HP1c                          FBgn0039019


VALIUM10   Glutamate receptor IIA        FBgn0004620

VALIUM10   spineless                     FBgn0003513

VALIUM20   spineless                     FBgn0003513


VALIUM20   Tudor-SN                      FBgn0035121


VALIUM10   nicastrin                     FBgn0039234

VALIUM10   Upstream of N-ras             FBgn0035895
VALIUM20   Upstream of N-ras        FBgn0035895


VALIUM20   Upstream of N-ras        FBgn0035895


VALIUM10   sec15                    FBgn0038856

VALIUM20   cap binding protein 80   FBgn0022942


VALIUM10   Cbl                      FBgn0020224

VALIUM10   CG7039                   FBgn0030088

VALIUM20   HP1b                     FBgn0030082


VALIUM10   CG7045                   FBgn0038978

VALIUM10   CG7046                   FBgn0038979

VALIUM10   Neurexin 1               FBgn0038975

VALIUM20   Neurexin 1               FBgn0038975


VALIUM10   dalao                    FBgn0030093

VALIUM22   dalao                    FBgn0030093


VALIUM10   AP-50                    FBgn0024832

VALIUM1    rab3-GAP                 FBgn0027505

VALIUM20   Rab-related protein 3    FBgn0015793


VALIUM20                            FBgn0030091

           CG7065
VALIUM20   sar1                     FBgn0038947


VALIUM10   diskette                 FBgn0030891
VALIUM20   diskette                      FBgn0030891


VALIUM10   Cadherin-N                    FBgn0015609

VALIUM10   Proctolin                     FBgn0045038

VALIUM1    upheld                        FBgn0004169

VALIUM20   upheld                        FBgn0004169


VALIUM10   microtubule star              FBgn0004177

VALIUM20                                 FBgn0035879

           CG7112
VALIUM10   Tehao                         FBgn0026760

VALIUM1    RhoGAP16F                     FBgn0030893

VALIUM10   exo70                         FBgn0035892

VALIUM20   r2d2                          FBgn0031951


VALIUM20   DNApol-eta                    FBgn0037141


VALIUM1    CG7148                        FBgn0046301

VALIUM10   Syntrophin-like 1             FBgn0037130

VALIUM10                                 FBgn0037116
           CG7158
VALIUM10   wings up A                    FBgn0004028

VALIUM20                                 FBgn0035872

           CG7185
VALIUM1    Gustatory receptor 66a        FBgn0035870

VALIUM1    Gustatory receptor 66a        FBgn0035870

VALIUM10   CG7197                        FBgn0035866

VALIUM10   Hormone-receptor-like in 78   FBgn0015239
VALIUM20                                           FBgn0032671

           CG7200
VALIUM1    kelch                                   FBgn0001301

VALIUM1    cadmus                                  FBgn0038574

VALIUM10   Glutamate receptor IIB                  FBgn0020429

VALIUM20   Glycogen phosphorylase                  FBgn0004507


VALIUM20   Helicase at 25E                         FBgn0014189


VALIUM20   Cyclin C                                FBgn0004597


VALIUM10   allatostatin C receptor 1               FBgn0036790

VALIUM20   Rrp6                                    FBgn0038269


VALIUM10   Kinesin-like protein at 68D             FBgn0004381

VALIUM10   CG7299                                  FBgn0032282

VALIUM10   Mitochondrial Transcription Factor B1   FBgn0261381

VALIUM20                                           FBgn0037074

           CG7324
VALIUM10   Sox21a                                  FBgn0036411

VALIUM1    CG7365                                  FBgn0036939

VALIUM10   CG7369                                  FBgn0037188

VALIUM20   barrier to autointegration factor       FBgn0031977


VALIUM10   eagle                                   FBgn0000560

VALIUM22   eagle                                   FBgn0000560


VALIUM1    Clock                                   FBgn0023076
VALIUM1    Clock                              FBgn0023076

VALIUM1    Connector of kinase to AP-1        FBgn0044323

VALIUM10   Connector of kinase to AP-1        FBgn0044323

VALIUM20   Connector of kinase to AP-1        FBgn0044323


VALIUM10   Neuropeptide F-like Receptor 76F   FBgn0036934

VALIUM20   RhoGAP71E                          FBgn0036518


VALIUM10   Transportin                        FBgn0024921

VALIUM10   Henna                              FBgn0001208

VALIUM10   estrogen-related receptor          FBgn0035849

VALIUM10   ora transientless                  FBgn0003011

VALIUM10   TAK1-associated Binding Protein2   FBgn0086358

VALIUM20                                      FBgn0031344

           CG7420
VALIUM20   Nopp140                            FBgn0037137


VALIUM10   effete                             FBgn0011217

VALIUM10   CG7431                             FBgn0038542

VALIUM20   Ribosomal protein L22              FBgn0015288


VALIUM10   ADP ribosylation factor 84F        FBgn0004908

VALIUM20   mushroom-body expressed            FBgn0014362


VALIUM20   Myosin 31DF                        FBgn0086347


VALIUM22                                      FBgn0037140

           CG7442
VALIUM10   Glycine receptor                         FBgn0001134

VALIUM22                                            FBgn0037143

           CG7448
VALIUM10   Cyclic-AMP response element binding      FBgn0004396
           protein A
VALIUM10   Cyclic-AMP response element binding      FBgn0004396
           protein A
VALIUM10   Syntaxin 17                              FBgn0035540

VALIUM10   CG7456                                   FBgn0032258

VALIUM22                                            FBgn0037144

           CG7458
VALIUM1    osa                                      FBgn0003013

VALIUM1    Rpd3                                     FBgn0015805

VALIUM20   Rpd3                                     FBgn0015805


VALIUM20   Rpd3                                     FBgn0015805


VALIUM20   Actin 79B                                FBgn0000045


VALIUM20   eIF4AIII                                 FBgn0037573


VALIUM20   eIF4AIII                                 FBgn0037573


VALIUM10   Tyramine receptor                        FBgn0004514

VALIUM20   Death related ced-3/Nedd2-like protein   FBgn0020381


VALIUM1    Ribosomal protein LP0                    FBgn0000100

VALIUM10   Connectin                                FBgn0005775

VALIUM10   Dynein heavy chain 64C                   FBgn0010349

VALIUM10   atonal                                   FBgn0010433
VALIUM1    CG7526                       FBgn0035798

VALIUM1    CG7526                       FBgn0035798

VALIUM10   Smt3 activating enzyme 2     FBgn0029113

VALIUM10   inx5                         FBgn0030989

VALIUM20                                FBgn0030990

           CG7556
VALIUM20   Actin-related protein 66B    FBgn0011744


VALIUM10   Calpain-A                    FBgn0012051

VALIUM1    Rab-protein 3                FBgn0005586

VALIUM20   Rab-protein 3                FBgn0005586


VALIUM10   pickpocket 20                FBgn0039676

VALIUM20   sec71                        FBgn0028538


VALIUM20   Bub3                         FBgn0025457


VALIUM1    C-terminal Binding Protein   FBgn0020496

VALIUM20   C-terminal Binding Protein   FBgn0020496


VALIUM10   CG7589                       FBgn0036727

VALIUM10   ATP synthase-gamma chain     FBgn0020235

VALIUM20   Proteasome 54kD subunit      FBgn0015283


VALIUM20   Spt5                         FBgn0040273


VALIUM20                                FBgn0032026

           CG7627
VALIUM10   Neurocalcin                  FBgn0013303
VALIUM10   target of Poxn                        FBgn0015550

VALIUM10   pxt                                   FBgn0038538

VALIUM20   pxt                                   FBgn0038538


VALIUM20   pxt                                   FBgn0038538


VALIUM10   veli                                  FBgn0039269

VALIUM10   cropped                               FBgn0001994

VALIUM10   Fsh-Tsh-like receptor                 FBgn0016650

VALIUM10   glass                                 FBgn0004618

VALIUM20                                         FBgn0036714

           CG7692
VALIUM22   TBP-associated factor 5               FBgn0010356


VALIUM1    CG7707                                FBgn0036703

VALIUM10   CG7708                                FBgn0038641

VALIUM10   beta amyloid protein precursor-like   FBgn0000108

VALIUM10   Syntaxin 6                            FBgn0037084

VALIUM10   CG7745                                FBgn0033616

VALIUM10   CG7757                                FBgn0036915

VALIUM10   pumpless                              FBgn0027945

VALIUM10   cousin of atonal                      FBgn0024249

VALIUM10   Kinesin heavy chain                   FBgn0001308

VALIUM20   piccolo                               FBgn0260962


VALIUM10   single-minded                         FBgn0004666
VALIUM20   single-minded                         FBgn0004666


VALIUM10   Enhancer of Polycomb                  FBgn0000581

VALIUM22   Enhancer of Polycomb                  FBgn0000581


VALIUM10   Cyclic-nucleotide-gated ion channel   FBgn0014462
           protein
VALIUM20                                         FBgn0032020

           CG7787
VALIUM20   Ice                                   FBgn0019972


VALIUM20   Son of sevenless                      FBgn0001965


VALIUM1    Son of sevenless                      FBgn0001965

VALIUM1    Son of sevenless                      FBgn0001965

VALIUM1    Son of sevenless                      FBgn0001965

VALIUM10                                         FBgn0037552
           CG7800
VALIUM1    zeste                                 FBgn0004050

VALIUM10   zeste                                 FBgn0004050

VALIUM22   zeste                                 FBgn0004050


VALIUM20   Grasp65                               FBgn0036919


VALIUM10   black                                 FBgn0000153

VALIUM10   ran-like                              FBgn0036497

VALIUM20                                         FBgn0032015

           CG7830
VALIUM20                                         FBgn0032015

           CG7830
VALIUM20   lethal (3) L1231                  FBgn0086686


VALIUM10   CG7839                            FBgn0036124

VALIUM20                                     FBgn0032014

           CG7840
VALIUM20                                     FBgn0032014

           CG7840
VALIUM10   CG7841                            FBgn0036502

VALIUM20                                     FBgn0033062

           Ars2
VALIUM22                                     FBgn0033062

           Ars2
VALIUM1    Actin-related protein 8           FBgn0030877

VALIUM10   stripe                            FBgn0003499

VALIUM1    puckered                          FBgn0243512

VALIUM20   Sarcoglycan alpha                 FBgn0032013


VALIUM1    transient receptor potential      FBgn0003861

VALIUM1    transient receptor potential      FBgn0003861

VALIUM22                                     FBgn0037549

           CG7878
VALIUM20   RNA polymerase II 33kD subunit    FBgn0026373


VALIUM10   Tachykinin-like receptor at 99D   FBgn0004622

VALIUM10   tinman                            FBgn0004110

VALIUM10                                     FBgn0039728
           CG7896
VALIUM10   bagpipe                           FBgn0004862

VALIUM10   CG7906                            FBgn0036417
VALIUM10   PP2A-B'                      FBgn0042693

VALIUM20   Nucleoplasmin                FBgn0016685


VALIUM10   farinelli                    FBgn0028379

VALIUM20                                FBgn0038889

           CG7922
VALIUM1    Axin                         FBgn0026597

VALIUM10   moleskin                     FBgn0026252

VALIUM20   moleskin                     FBgn0026252


VALIUM10   C15                          FBgn0004863

VALIUM20   Actin-related protein 5      FBgn0038576


VALIUM10   CG7945                       FBgn0036505

VALIUM1    spindle A                    FBgn0003479

VALIUM20   similar                      FBgn0015542


VALIUM20   similar                      FBgn0015542


VALIUM10   giant                        FBgn0001150

VALIUM20   giant                        FBgn0001150


VALIUM1    steamer duck                 FBgn0020249

VALIUM1    steamer duck                 FBgn0020249

VALIUM10   tonalli                      FBgn0026160

VALIUM10   Big brother                  FBgn0013753

VALIUM1    α-coatomer protein           FBgn0025725

VALIUM10   CDP diglyceride synthetase   FBgn0010350
VALIUM10   RabX5                                    FBgn0035255

VALIUM10   Autophagy-specific gene 18               FBgn0035850

VALIUM20   Mediator complex subunit 24              FBgn0035851


VALIUM1    rapamycin-insensitive companion of Tor   FBgn0031006

VALIUM1    rapamycin-insensitive companion of Tor   FBgn0031006

VALIUM10   CG8007                                   FBgn0037600

VALIUM1    Su(z)12                                  FBgn0020887

VALIUM20   Su(z)12                                  FBgn0020887


VALIUM20                                            FBgn0037602

           CG8021
VALIUM20                                            FBgn0031011

           CG8034
VALIUM20                                            FBgn0037607

           CG8036
VALIUM20   Vacuolar H[+] ATPase 44kD C subunit      FBgn0020611


VALIUM1    Eukaryotic initiation factor 1A          FBgn0026250

VALIUM10   Eukaryotic initiation factor 1A          FBgn0026250

VALIUM1    CG8067                                   FBgn0033891

VALIUM1    CG8067                                   FBgn0033891

VALIUM20   Suppressor of variegation 2-10           FBgn0003612


VALIUM1    Suppressor of variegation 2-10           FBgn0003612

VALIUM10   Suppressor of variegation 2-10           FBgn0003612

VALIUM20   Suppressor of variegation 2-10           FBgn0003612
VALIUM10   anachronism                    FBgn0011746

VALIUM10   tre oncogene-related protein   FBgn0020620

VALIUM20   Nedd2-like caspase             FBgn0026404


VALIUM10   CG8092                         FBgn0033998

VALIUM10   scab                           FBgn0003328

VALIUM10   Picot                          FBgn0024315

VALIUM20   Mi-2                           FBgn0013591


VALIUM10   Calpain-B                      FBgn0025866

VALIUM10   CG8108                         FBgn0027567

VALIUM20                                  FBgn0027567

           CG8108
VALIUM10   pebble                         FBgn0003041

VALIUM10   mastermind                     FBgn0002643

VALIUM20   HP1e                           FBgn0037675


VALIUM10   Ecdysone-induced protein 75B   FBgn0000568

VALIUM10   Ecdysone-induced protein 75B   FBgn0000568

VALIUM20                                  FBgn0030668

           CG8128
VALIUM10   ADP ribosylation factor 51F    FBgn0013750

VALIUM20                                  FBgn0037703

           CG8165
VALIUM20   unc-5                          FBgn0034013


VALIUM1    Insulin-related peptide        FBgn0036046
VALIUM20   Insulin-related peptide   FBgn0036046


VALIUM10   double parked             FBgn0000996

VALIUM10   Metchnikowin              FBgn0014865

VALIUM10   Nach                      FBgn0024319

VALIUM10   ATP synthase, subunit b   FBgn0019644

VALIUM20   par-1                     FBgn0260934


VALIUM22   MBD-like                  FBgn0027950


VALIUM10   CG8216                    FBgn0033358

VALIUM10   Buffy                     FBgn0040491

VALIUM20   peanuts                   FBgn0086895


VALIUM20   FBgn0033349               FBgn0033349


VALIUM10   CG8245                    FBgn0033031

VALIUM10   Pox neuro                 FBgn0003130

VALIUM10   G protein γ 1             FBgn0004921

VALIUM20   Bx42                      FBgn0004856


VALIUM20   sec31                     FBgn0033339


VALIUM20   Srp9                      FBgn0035827


VALIUM10   Dynamitin                 FBgn0021825

VALIUM1    CG8272                    FBgn0033337

VALIUM20                             FBgn0037716

           CG8273
VALIUM20   Megator                              FBgn0013756


VALIUM10   Phosphodiesterase 6                  FBgn0038237

VALIUM20   Elongation factor 1alpha48D          FBgn0000556


VALIUM10   Rab-protein 8                        FBgn0015796

VALIUM20                                        FBgn0030854

           CG8289
VALIUM10   CG8290                               FBgn0026573

VALIUM20   Inhibitor of apoptosis 2             FBgn0015247


VALIUM20   alpha-Tubulin at 67C                 FBgn0087040


VALIUM20   Transport and Golgi organization 7   FBgn0033902


VALIUM1    Neurofibromin 1                      FBgn0015269

VALIUM10   Neurofibromin 1                      FBgn0015269

VALIUM10   E(spl) region transcript mδ          FBgn0002734

VALIUM10   tomboy40                             FBgn0033074

VALIUM10   E(spl) region transcript mγ          FBgn0002735

VALIUM20   sulfateless                          FBgn0020251,FBgn0052396


VALIUM10   E(spl) region transcript m3          FBgn0002609

VALIUM10   Diuretic hormone                     FBgn0012344

VALIUM1    slit                                 FBgn0003425

VALIUM1    slit                                 FBgn0003425

VALIUM10   CG8359                               FBgn0037634

VALIUM10   E(spl) region transcript m7          FBgn0002633
VALIUM10   DNA fragmentation factor-related protein FBgn0028407
           3
VALIUM10   Enhancer of split                        FBgn0000591

VALIUM20                                           FBgn0035707

           CG8368
VALIUM10   apterous                                FBgn0000099

VALIUM1    Dopamine transporter                    FBgn0034136

VALIUM10   ADP ribosylation factor 79F             FBgn0010348

VALIUM20   Proteasome beta1 subunit                FBgn0010590


VALIUM20                                           FBgn0034066

           CG8397
VALIUM20   Suppressor of variegation 205           FBgn0003607


VALIUM1    germ cell-less                          FBgn0005695

VALIUM20   germ cell-less                          FBgn0005695


VALIUM20   germ cell-less                          FBgn0005695


VALIUM10   Rho1                                    FBgn0014020

VALIUM20   Rho1                                    FBgn0014020


VALIUM10   Ras which interacts with Calmodulin     FBgn0017549

VALIUM10   Diuretic hormone 44 receptor 1          FBgn0033932

VALIUM1    Juvenile hormone esterase duplication   FBgn0034076

VALIUM20   lethal (2) NC136                        FBgn0033029


VALIUM20   lethal (2) NC136                        FBgn0033029


VALIUM10   Small ribonucleoprotein Sm D3           FBgn0023167
VALIUM20   Small ribonucleoprotein Sm D3   FBgn0023167


VALIUM10   spinster                        FBgn0086676

VALIUM10   Rab escort protein              FBgn0026378

VALIUM10   lambik                          FBgn0034083

VALIUM10   Lissencephaly-1                 FBgn0015754

VALIUM10   Glutamate receptor I            FBgn0004619

VALIUM10   wnt inhibitor of Dorsal         FBgn0038134

VALIUM10   wnt inhibitor of Dorsal         FBgn0038134

VALIUM10   HtrA2                           FBgn0038233

VALIUM20   optic atrophy 1-like            FBgn0261276


VALIUM1    gartenzwerg                     FBgn0033714

VALIUM20   kohtalo                         FBgn0001324


VALIUM10   Helix loop helix protein 106    FBgn0261283

VALIUM20   Helix loop helix protein 106    FBgn0261283


VALIUM10   NK7.1                           FBgn0024321

VALIUM10   pickpocket 23                   FBgn0030844

VALIUM10   Dystrobrevin-like               FBgn0033739

VALIUM20   Dystrobrevin-like               FBgn0033739


VALIUM10   liquid facets                   FBgn0028582

VALIUM10   scalloped                       FBgn0003345

VALIUM10   CG8546                          FBgn0035785

VALIUM10   karyopherin α1                  FBgn0024889
VALIUM20                                           FBgn0030842

           CG8557
VALIUM10   convoluted                              FBgn0261269

VALIUM10   unc-104                                 FBgn0034155

VALIUM20   Deformed epidermal autoregulatory factor- FBgn0013799
           1

VALIUM1    suppressor of Hairy wing                FBgn0003567

VALIUM20   suppressor of Hairy wing                FBgn0003567


VALIUM20   suppressor of Hairy wing                FBgn0003567


VALIUM20   akirin                                  FBgn0082598


VALIUM1    frazzled                                FBgn0011592

VALIUM1    frazzled                                FBgn0011592

VALIUM10   I[[h]] channel                          FBgn0028428

VALIUM22   CTCF                                    FBgn0035769


VALIUM10   CG8594                                  FBgn0033755

VALIUM10   Toll-7                                  FBgn0034476

VALIUM10   lark                                    FBgn0011640

VALIUM1    eco                                     FBgn0035766

VALIUM22   Suppressor of variegation 3-7           FBgn0003598


VALIUM20   mutagen-sensitive 312                   FBgn0002909


VALIUM20   mutagen-sensitive 312                   FBgn0002909


VALIUM10   Amphiphysin                             FBgn0027356
VALIUM1    RhoGEF4                       FBgn0035761

VALIUM1    Cdc27                         FBgn0012058

VALIUM1    Imitation SWI                 FBgn0011604

VALIUM20   Imitation SWI                 FBgn0011604


VALIUM22   male-specific lethal 3        FBgn0002775


VALIUM10                                 FBgn0033762
           CG8632
VALIUM10   Cirl                          FBgn0033313

VALIUM20   Cirl                          FBgn0033313


VALIUM10   regular                       FBgn0033310

VALIUM20   Fimbrin                       FBgn0024238


VALIUM20   Fimbrin                       FBgn0024238


VALIUM1    trithorax                     FBgn0003862

VALIUM20   trithorax                     FBgn0003862


VALIUM10   nervana 3                     FBgn0032946

VALIUM10   Tetraspanin 39D               FBgn0032943

VALIUM10   dimmed                        FBgn0023091

VALIUM10   cryptocephal                  FBgn0000370

VALIUM10   Hormone receptor-like in 39   FBgn0261239

VALIUM20   Hormone receptor-like in 39   FBgn0261239


VALIUM10                                 FBgn0031684
           CG8680
VALIUM10   clumsy                        FBgn0026255
VALIUM10   deadpan                                  FBgn0010109

VALIUM10   peanut                                   FBgn0013726

VALIUM20                                            FBgn0033272

           RagC
VALIUM20   coilin                                   FBgn0033265


VALIUM10   CG8713                                   FBgn0033257

VALIUM10   saliva                                   FBgn0025469

VALIUM20   Nup44A                                   FBgn0033247


VALIUM10   cycle                                    FBgn0023094

VALIUM20                                            FBgn0033235

           CG8728
VALIUM10   drosha                                   FBgn0026722

VALIUM20   drosha                                   FBgn0026722


VALIUM22   drosha                                   FBgn0026722


VALIUM10   lethal (2) 44DEa                         FBgn0010609

VALIUM1    CG8734                                   FBgn0033315

VALIUM1    transient receptor potential mucolipin   FBgn0036904

VALIUM1    transient receptor potential mucolipin   FBgn0036904

VALIUM20   small nuclear ribonucleoprotein 70K      FBgn0016978


VALIUM10   CG8765                                   FBgn0036900

VALIUM20                                            FBgn0036900

           CG8765
VALIUM1    tafazzin                                 FBgn0026619
VALIUM1    Tafazzin                     FBgn0026619

VALIUM10   G protein beta-subunit 76C   FBgn0004623

VALIUM10   tsunagi                      FBgn0033378

VALIUM10   CG8784                       FBgn0038140

VALIUM1    Additional sex combs         FBgn0000142

VALIUM10   CG8795                       FBgn0038139

VALIUM20                                FBgn0036892

           CG8798
VALIUM1    CG8801                       FBgn0028473

VALIUM20   wunen                        FBgn0016078


VALIUM20   wunen                        FBgn0016078


VALIUM20   wunen-2                      FBgn0041087


VALIUM20   wunen-2                      FBgn0041087


VALIUM1    lush                         FBgn0020277

VALIUM20   Sin3A                        FBgn0022764


VALIUM10   lilliputian                  FBgn0041111

VALIUM20   lilliputian                  FBgn0041111


VALIUM10   achintya                     FBgn0033749

VALIUM20   achintya                     FBgn0033749


VALIUM10   vismay                       FBgn0033748

VALIUM10   fused lobes                  FBgn0045063
VALIUM10   sec5                                     FBgn0031537

VALIUM10   Pdsw                                     FBgn0021967

VALIUM10                                            FBgn0031548
           CG8852
VALIUM20                                            FBgn0033698

           CG8858
VALIUM10   CG8861                                   FBgn0037676

VALIUM10   Ral guanine nucleotide exchange factor   FBgn0026376

VALIUM20   Ral guanine nucleotide exchange factor   FBgn0026376


VALIUM1    jetlag                                   FBgn0031652

VALIUM10   Synapse-associated protein 47kD          FBgn0013334

VALIUM1    absent, small, or homeotic discs 1       FBgn0005386

VALIUM20   absent, small, or homeotic discs 1       FBgn0005386


VALIUM10   absent, small, or homeotic discs 1       FBgn0005386

VALIUM10   Glyceraldehyde 3 phosphate               FBgn0001092
           dehydrogenase 2
VALIUM10   18 wheeler                               FBgn0004364

VALIUM10   Superoxide dismutase 2 (Mn)              FBgn0010213

VALIUM20   Superoxide dismutase 2 (Mn)              FBgn0010213


VALIUM20   Superoxide dismutase 2 (Mn)              FBgn0010213


VALIUM10   CG8907                                   FBgn0038466

VALIUM1    CG8909                                   FBgn0030706

VALIUM1    CG8909                                   FBgn0030706

VALIUM1    P-element somatic inhibitor              FBgn0014870

VALIUM1    P-element somatic inhibitor              FBgn0014870
VALIUM20   P-element somatic inhibitor            FBgn0014870


VALIUM20                                          FBgn0030833

           CG8915
VALIUM10   CG8916                                 FBgn0030707

VALIUM10   CG8924                                 FBgn0030710

VALIUM10   rickets                                FBgn0003255

VALIUM10   extradenticle                          FBgn0000611

VALIUM10   Arpc3B                                 FBgn0065032

VALIUM20   Heat shock protein cognate 1           FBgn0001216


VALIUM10   Glutathione S transferase S1           FBgn0010226

VALIUM10   nimrod C1                              FBgn0259896

VALIUM10                                          FBgn0030680
           CG8944
VALIUM20   26-29kD-proteinase                     FBgn0250848


VALIUM1    Graf                                   FBgn0030685

VALIUM10   α actinin 3                            FBgn0015008

VALIUM1    Smg5                                   FBgn0019890

VALIUM1    teflon                                 FBgn0086350

VALIUM1    teflon                                 FBgn0086350

VALIUM1    CG8963                                 FBgn0034181

VALIUM1    frataxin homolog                       FBgn0030092

VALIUM20   Ribonucleoside diphosphate reductase   FBgn0011704
           small subunit

VALIUM20   Cctgamma                               FBgn0015019
VALIUM1    Suppressor of profilin 2          FBgn0001961

VALIUM20   ERp60                             FBgn0033663


VALIUM10   Dromyosuppressin receptor 1       FBgn0035331

VALIUM1    tamas                             FBgn0004406

VALIUM1    tamas                             FBgn0004406

VALIUM20   Sine oculis-binding protein       FBgn0033654


VALIUM20                                     FBgn0035334

           CG8993
VALIUM10   exuperantia                       FBgn0000615

VALIUM1    CG9003                            FBgn0033639

VALIUM20                                     FBgn0033638

           CG9005
VALIUM10   Clathrin heavy chain              FBgn0000319

VALIUM10   engrailed                         FBgn0000577

VALIUM20   engrailed                         FBgn0000577


VALIUM10   dissatisfaction                   FBgn0015381

VALIUM10   Myb oncogene-like                 FBgn0002914

VALIUM10   Dead-box-1                        FBgn0015075

VALIUM20   Lipid storage droplet-2           FBgn0030608


VALIUM10   Troponin C at 47D                 FBgn0010423

VALIUM20   Eukaryotic initiation factor 4a   FBgn0001942


VALIUM20   infertile crescent                FBgn0001941
VALIUM1    CG9086                                 FBgn0030809

VALIUM10   little imaginal discs                  FBgn0031759

VALIUM10   little imaginal discs                  FBgn0031759

VALIUM10   Cyclin D                               FBgn0010315

VALIUM20   Cyclin D                               FBgn0010315


VALIUM1    Rab30                                  FBgn0031882

VALIUM10   Regulator of G-protein signalling 7    FBgn0024941

VALIUM10   AP-1γ                                  FBgn0030089

VALIUM1    myotubularin                           FBgn0025742

VALIUM10   Tryptophan hydroxylase                 FBgn0035187

VALIUM10   Stromal Interaction molecule           FBgn0053180

VALIUM1    CG9135                                 FBgn0031769

VALIUM10   CG9139                                 FBgn0035202

VALIUM10                                          FBgn0031771
           CG9140
VALIUM1    CG9144                                 FBgn0031773

VALIUM10   abnormal chemosensory jump 6           FBgn0000028

VALIUM20   Protein phosphatase 1 at 13C           FBgn0003132


VALIUM10   mitochondrial acyl carrier protein 1   FBgn0011361

VALIUM10   CNG channel-like                       FBgn0029090

VALIUM20   eIF5                                   FBgn0030719


VALIUM20   Protein tyrosine phosphatase 61F       FBgn0003138


VALIUM20   septin interacting protein 2           FBgn0031878
VALIUM20   Kinesin-like protein at 61F     FBgn0004378


VALIUM20   mutagen-sensitive 209           FBgn0005655


VALIUM10   CG9194                          FBgn0035192

VALIUM10   Glued                           FBgn0001108

VALIUM10   vacuolar peduncle               FBgn0003969

VALIUM20   WD repeat domain 79 homolog     FBgn0031782


VALIUM10   fu2                             FBgn0029173

VALIUM1    B4                              FBgn0023407

VALIUM1    burgundy                        FBgn0000239

VALIUM1    CG9243                          FBgn0032926

VALIUM20   Aconitase                       FBgn0010100


VALIUM10   Phosphatidylinositol synthase   FBgn0030670

VALIUM1    CG9248                          FBgn0032923

VALIUM20   deadlock                        FBgn0086251


VALIUM10   nervana 2                       FBgn0015777

VALIUM10   Shaker cognate l                FBgn0005564

VALIUM20                                   FBgn0032524

           CG9267
VALIUM20                                   FBgn0032908

           CG9270
VALIUM20   Replication protein A2          FBgn0032906


VALIUM20   Ribosomal protein L24           FBgn0032518
VALIUM20   Elongin C                     FBgn0023211


VALIUM10   Hepatocyte nuclear factor 4   FBgn0004914

VALIUM10   myopic                        FBgn0036448

VALIUM20   myopic                        FBgn0036448


VALIUM20   myopic                        FBgn0036448


VALIUM1    CG9316                        FBgn0032878

VALIUM10                                 FBgn0032897
           CG9336
VALIUM10                                 FBgn0034564
           CG9344
VALIUM1    falafel                       FBgn0024555

VALIUM20   falafel                       FBgn0024555


VALIUM10   falafel                       FBgn0024555

VALIUM10   Task7                         FBgn0037690

VALIUM20   rho-like                      FBgn0014380


VALIUM20   rho-like                      FBgn0014380


VALIUM10   CG9368                        FBgn0036890

VALIUM10   Ras oncogene at 85D           FBgn0003205

VALIUM22   murashka                      FBgn0037705


VALIUM22   anti-silencing factor 1       FBgn0029094


VALIUM20                                 FBgn0037708

           CG9386
VALIUM10   AP-47                         FBgn0024833
VALIUM10   jing                          FBgn0086655

VALIUM10   mago nashi                    FBgn0002736

VALIUM10   CG9411                        FBgn0030569

VALIUM20   rasputin                      FBgn0015778


VALIUM10   X box binding protein-1       FBgn0021872

VALIUM10   CG9418                        FBgn0026582

VALIUM10   karyopherin α3                FBgn0027338

VALIUM20                                 FBgn0036451

           CG9425
VALIUM1    CG9426                        FBgn0032485

VALIUM20   Frost                         FBgn0037724


VALIUM10   CG9437                        FBgn0034599

VALIUM20                                 FBgn0036876

           CG9451
VALIUM10   Serine protease inhibitor 4   FBgn0028985

VALIUM10   CG9454                        FBgn0033112

VALIUM1                                  FBgn0033113
           Serpin 42Dc
VALIUM1                                  FBgn0033115
           Serpin 42De
VALIUM1    FBX011 ortholog               FBgn0037760

VALIUM10   CG9467                        FBgn0037758

VALIUM1    CG9472                        FBgn0036874

VALIUM1    CG9472                        FBgn0036874

VALIUM1                                  FBgn0036874
           CG9472
VALIUM20   Mediator complex subunit 6    FBgn0024330
VALIUM10   Synapse protein 24   FBgn0028401

VALIUM1    α-Tubulin at 85E     FBgn0003886

VALIUM20   hyperplastic discs   FBgn0002431


VALIUM1    Gef26                FBgn0021873

VALIUM10   Gef26                FBgn0021873

VALIUM20   Pez                  FBgn0031799


VALIUM20   Pez                  FBgn0031799


VALIUM1    Sex comb on midleg   FBgn0003334

VALIUM10   pickpocket 7         FBgn0031802

VALIUM10   pickpocket 14        FBgn0031803

VALIUM10   rutabaga             FBgn0003301

VALIUM10   epsilonCOP           FBgn0027496

VALIUM20                        FBgn0031822

           CG9548
VALIUM20   chickadee            FBgn0000308


VALIUM10   eyes absent          FBgn0000320

VALIUM10   alien                FBgn0013746

VALIUM10   Rab35                FBgn0031090

VALIUM20                        FBgn0031093

           CG9581
VALIUM10                        FBgn0038166
           CG9588
VALIUM20   Chd3                 FBgn0023395
VALIUM20                                       FBgn0030787

           CG9609
VALIUM10   Pox meso                            FBgn0003129

VALIUM10   Coenzyme Q biosynthesis protein 2   FBgn0037574

VALIUM20                                       FBgn0260939

           CG9646
VALIUM10   inflated                            FBgn0001250

VALIUM1    RhoGEF2                             FBgn0023172

VALIUM20   RhoGEF2                             FBgn0023172


VALIUM10   CG9636                              FBgn0037556

VALIUM10   Task6                               FBgn0038165

VALIUM1    Ada2b                               FBgn0037555

VALIUM22   Ada2b                               FBgn0037555


VALIUM20                                       FBgn0034184

           CG9646
VALIUM10   Max                                 FBgn0017578

VALIUM10   CG9650                              FBgn0029939

VALIUM1    Dopamine receptor                   FBgn0011582

VALIUM10   grain                               FBgn0001138

VALIUM20   grain                               FBgn0001138


VALIUM20   grain                               FBgn0001138


VALIUM20   grain                               FBgn0001138


VALIUM10   CG9657                              FBgn0029950
VALIUM10   egghead                  FBgn0001404

VALIUM1    CG9667                   FBgn0037550

VALIUM1    falten                   FBgn0028380

VALIUM1    domino                   FBgn0020306

VALIUM1    Septin 4                 FBgn0259923

VALIUM10   Neurotactin              FBgn0004108

VALIUM10                            FBgn0036661
           CG9705
VALIUM20   nudC                     FBgn0021768


VALIUM10   CG9722                   FBgn0038209

VALIUM10   CG9727                   FBgn0037445

VALIUM1    frizzled 2               FBgn0016797

VALIUM1    frizzled 2               FBgn0016797

VALIUM10   frizzled 2               FBgn0016797

VALIUM10   D1 chromosomal protein   FBgn0000412

VALIUM20   D1 chromosomal protein   FBgn0000412


VALIUM10   belle                    FBgn0000171

VALIUM22   belle                    FBgn0000171


VALIUM22   belle                    FBgn0000171


VALIUM20   reptin                   FBgn0040075


VALIUM10   Adenosine receptor       FBgn0039747

VALIUM10   pumilio                  FBgn0003165

VALIUM1    yurt                     FBgn0004049
VALIUM10   huckebein                       FBgn0001204

VALIUM20                                   FBgn0037270

           CG9769
VALIUM10   Dorsal interacting protein 2    FBgn0040466

VALIUM1    CG9772                          FBgn0037236

VALIUM20                                   FBgn0037236

           CG9772
VALIUM20                                   FBgn0037609

           CG9773
VALIUM20                                   FBgn0037261

           CG9775
VALIUM10   Synaptotagmin 14                FBgn0261086

VALIUM10   hunchback                       FBgn0001180

VALIUM20                                   FBgn0037621

           CG9797
VALIUM20   Chromosome-associated protein   FBgn0015615


VALIUM1    eIF3-S10                        FBgn0037249

VALIUM10   eIF3-S10                        FBgn0037249

VALIUM20   Spargel                         FBgn0037248


VALIUM20   Spargel                         FBgn0037248


VALIUM10   endophilin B                    FBgn0034433

VALIUM1    EfSec                           FBgn0034627

VALIUM10   Protein phosphatase 2B at 14D   FBgn0011826

VALIUM10   hiiragi                         FBgn0015949

VALIUM20   hiiragi                         FBgn0015949
VALIUM20   Protein tyrosine phosphatase-     FBgn0016641
           ERK/Enhancer of Ras1

VALIUM20   Rae1                              FBgn0034646


VALIUM10   Odorant receptor 23a              FBgn0026395

VALIUM10   p16-ARC                           FBgn0031437

VALIUM20   decapentaplegic                   FBgn0000490


VALIUM1    decapentaplegic                   FBgn0000490

VALIUM10   decapentaplegic                   FBgn0000490

VALIUM1    decapentaplegic                   FBgn0000490

VALIUM1    decapentaplegic                   FBgn0000490

VALIUM20   decapentaplegic                   FBgn0000490


VALIUM20   decapentaplegic                   FBgn0000490


VALIUM20   decapentaplegic                   FBgn0000490


VALIUM22   decapentaplegic                   FBgn0000490


VALIUM10   Vesicular glutamate transporter   FBgn0031424

VALIUM10   Actin-related protein 14D         FBgn0011742

VALIUM20   paralytic                         FBgn0260993


VALIUM1    paralytic                         FBgn0260993

VALIUM1    paralytic                         FBgn0260993

VALIUM10   disconnected                      FBgn0000459

VALIUM10   CG9911                            FBgn0030734
VALIUM20   Cyclophilin 1                             FBgn0004432


VALIUM20   Cyclophilin 1                             FBgn0004432


VALIUM10   CG9918                                    FBgn0038201

VALIUM10   CG9934                                    FBgn0032467

VALIUM10   CG9935                                    FBgn0039916

VALIUM1    Surfeit 1                                 FBgn0029117

VALIUM1    Surfeit 1                                 FBgn0029117

VALIUM1    partner of paired                         FBgn0020257

VALIUM10   maf-S                                     FBgn0034534

VALIUM10   snapin                                    FBgn0031455

VALIUM10                                             FBgn0035371
           CG9977
VALIUM1    Heterogeneous nuclear ribonucleoprotein   FBgn0001215
           at 98DE
VALIUM20   Heterogeneous nuclear ribonucleoprotein   FBgn0001215
           at 98DE

VALIUM20   TH1                                       FBgn0010416


VALIUM1    Rab9                                      FBgn0032782

VALIUM1    huntingtin                                FBgn0027655

VALIUM10   U2 small nuclear riboprotein auxiliary    FBgn0005411
           factor 50
VALIUM10   Ran GTPase activating protein             FBgn0003346

VALIUM10   putative noncoding RNA 003:2L             FBgn0047133

VALIUM10   RNA on the X 2                            FBgn0019660

VALIUM1    RNA on the X 2                            FBgn0019660

VALIUM10   swallow pseudogene                        FBgn0003655,FBgn0016974
VALIUM1    RNA on the X 1                  FBgn0019661

VALIUM10   RNA on the X 1                  FBgn0019661

VALIUM22   RNA on the X 1                  FBgn0019661


VALIUM10   Uhg3                            FBgn0259936

VALIUM10   putative noncoding RNA 002:3R   FBgn0063127

VALIUM10   putative noncoding RNA 004:X    FBgn0047095

VALIUM10   putative noncoding RNA 016:2R   FBgn0062961

VALIUM10   putative noncoding RNA 014:3L   FBgn0046272

VALIUM10   putative noncoding RNA 017:3R   FBgn0046756

VALIUM10   putative noncoding RNA 008:3L   FBgn0047000

VALIUM10   putative noncoding RNA 011:3L   FBgn0083068

VALIUM10   putative noncoding RNA 015:3L   FBgn0063083

VALIUM22   tre-1                           FBgn0085056
INSERT            GENE OR
Derives           INSERT
from              ENTREZ GENE Gene Symbol    INSERT
Organism          ID          (For Insert)   SIZE




free text (e.g.   free text (e.g.            free text (e.g.
Human)            5468)                      657 bp)

Drosophila                          Fak56D


Drosophila                          Fak56D


Drosophila                          Fak56D

Drosophila                          for

Drosophila                          for


Drosophila                          for


Drosophila                          Egfr

Drosophila                          Egfr

Drosophila                          Egfr

Drosophila                          Egfr

Drosophila                          Egfr


Drosophila                          Egfr


Drosophila
Drosophila


Drosophila

Drosophila

Drosophila


Drosophila

Drosophila   aPKC


Drosophila

Drosophila   Pak


Drosophila   Pak

Drosophila


Drosophila


Drosophila


Drosophila

Drosophila


Drosophila


Drosophila


Drosophila


Drosophila
Drosophila

Drosophila


Drosophila


Drosophila


Drosophila


Drosophila

Drosophila

Drosophila


Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila


Drosophila

Drosophila


Drosophila
Drosophila

Drosophila


Drosophila


Drosophila

Drosophila


Drosophila


Drosophila


Drosophila


Drosophila


Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila


Drosophila
Drosophila

Drosophila


Drosophila

Drosophila


Drosophila


Drosophila


Drosophila


Drosophila

Drosophila

Drosophila


Drosophila


Drosophila


Drosophila


Drosophila


Drosophila


Drosophila


Drosophila


Drosophila
Drosophila


Drosophila


Drosophila

Drosophila

Drosophila


Drosophila


Drosophila

Drosophila


Drosophila

Drosophila


Drosophila

Drosophila


Drosophila

Drosophila


Drosophila


Drosophila


Drosophila

Drosophila
Drosophila

Drosophila


Drosophila

Drosophila


Drosophila

Drosophila

Drosophila


Drosophila


Drosophila


Drosophila


Drosophila


Drosophila

Drosophila

Drosophila

Drosophila


Drosophila


Drosophila


Drosophila
Drosophila


Drosophila

Drosophila


Drosophila


Drosophila

Drosophila


Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila


Drosophila

Drosophila


Drosophila

Drosophila


Drosophila

Drosophila
Drosophila


Drosophila

Drosophila


Drosophila

Drosophila


Drosophila

Drosophila


Drosophila

Drosophila


Drosophila


Drosophila


Drosophila


Drosophila


Drosophila

Drosophila


Drosophila

Drosophila

Drosophila


Drosophila
Drosophila


Drosophila

Drosophila

Drosophila


Drosophila


Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila


Drosophila

Drosophila


Drosophila

Drosophila

Drosophila


Drosophila
Drosophila

Drosophila


Drosophila

Drosophila


Drosophila


Drosophila


Drosophila

Drosophila


Drosophila

Drosophila

Drosophila


Drosophila

Drosophila


Drosophila


Drosophila


Drosophila


Drosophila


Drosophila
Drosophila


Drosophila


Drosophila


Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila


Drosophila


Drosophila


Drosophila


Drosophila


Drosophila

Drosophila


Drosophila


Drosophila

Drosophila
Drosophila


Drosophila

Drosophila


Drosophila


Drosophila

Drosophila


Drosophila


Drosophila

Drosophila


Drosophila

Drosophila

Drosophila


Drosophila


Drosophila


Drosophila

Drosophila


Drosophila


Drosophila
Drosophila


Drosophila


Drosophila


Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila


Drosophila


Drosophila


Drosophila

Drosophila


Drosophila   Drak


Drosophila


Drosophila


Drosophila

Drosophila

Drosophila
Drosophila

Drosophila


Drosophila

Drosophila


Drosophila


Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila   Dgk


Drosophila

Drosophila

Drosophila


Drosophila


Drosophila


Drosophila


Drosophila

Drosophila
Drosophila


Drosophila


Drosophila

Drosophila


Drosophila


Drosophila


Drosophila


Drosophila

Drosophila


Drosophila

Drosophila


Drosophila

Drosophila


Drosophila

Drosophila


Drosophila


Drosophila


Drosophila
Drosophila


Drosophila

Drosophila

Drosophila


Drosophila


Drosophila


Drosophila

Drosophila

Drosophila


Drosophila


Drosophila


Drosophila

Drosophila


Drosophila

Drosophila

Drosophila


Drosophila


Drosophila


Drosophila
Drosophila

Drosophila


Drosophila


Drosophila

Drosophila


Drosophila


Drosophila


Drosophila

Drosophila


Drosophila

Drosophila


Drosophila

Drosophila


Drosophila


Drosophila


Drosophila

Drosophila


Drosophila
Drosophila

Drosophila


Drosophila


Drosophila

Drosophila

Drosophila


Drosophila


Drosophila


Drosophila


Drosophila

Drosophila


Drosophila


Drosophila

Drosophila


Drosophila


Drosophila

Drosophila


Drosophila
Drosophila


Drosophila


Drosophila

Drosophila

Drosophila


Drosophila


Drosophila


Drosophila


Drosophila

Drosophila


Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila


Drosophila


Drosophila
Drosophila

Drosophila

Drosophila


Drosophila


Drosophila


Drosophila


Drosophila

Drosophila


Drosophila

Drosophila


Drosophila

Drosophila

Drosophila


Drosophila


Drosophila

Drosophila

Drosophila


Drosophila

Drosophila
Drosophila


Drosophila

Drosophila


Drosophila

Drosophila

Drosophila


Drosophila


Drosophila

Drosophila

Drosophila


Drosophila

Drosophila


Drosophila

Drosophila


Drosophila

Drosophila

Drosophila


Drosophila


Drosophila
Drosophila


Drosophila

Drosophila


Drosophila


Drosophila


Drosophila   cert

Drosophila


Drosophila


Drosophila

Drosophila


Drosophila


Drosophila

Drosophila


Drosophila


Drosophila


Drosophila


Drosophila
Drosophila


Drosophila

Drosophila


Drosophila


Drosophila


Drosophila

Drosophila


Drosophila

Drosophila


Drosophila

Drosophila


Drosophila

Drosophila

Drosophila


Drosophila


Drosophila


Drosophila

Drosophila
Drosophila


Drosophila

Drosophila


Drosophila

Drosophila


Drosophila

Drosophila


Drosophila


Drosophila


Drosophila


Drosophila


Drosophila

Drosophila


Drosophila

Drosophila


Drosophila


Drosophila


Drosophila
Drosophila

Drosophila


Drosophila

Drosophila


Drosophila

Drosophila


Drosophila


Drosophila


Drosophila


Drosophila


Drosophila

Drosophila

Drosophila

Drosophila


Drosophila


Drosophila


Drosophila


Drosophila
Drosophila

Drosophila


Drosophila

Drosophila


Drosophila

Drosophila


Drosophila

Drosophila


Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila
Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila


Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila
Drosophila


Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila


Drosophila

Drosophila


Drosophila

Drosophila


Drosophila

Drosophila
Drosophila


Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila   gpp

Drosophila   gpp


Drosophila   gpp

Drosophila

Drosophila


Drosophila


Drosophila

Drosophila


Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila
Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila


Drosophila

Drosophila

Drosophila


Drosophila

Drosophila


Drosophila


Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila
Drosophila


Drosophila


Drosophila

Drosophila

Drosophila


Drosophila


Drosophila

Drosophila


Drosophila

Drosophila


Drosophila


Drosophila


Drosophila

Drosophila

Drosophila


Drosophila

Drosophila


Drosophila

Drosophila
Drosophila

Drosophila

Drosophila


Drosophila


Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila


Drosophila
Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila
Drosophila


Drosophila


Drosophila

Drosophila

Drosophila


Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila
Drosophila


Drosophila

Drosophila

Drosophila


Drosophila


Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila


Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila
Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila


Drosophila
Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila


Drosophila


Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila


Drosophila


Drosophila


Drosophila
Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila   jub

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila
Drosophila


Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila
Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila


Drosophila

Drosophila


Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila
Drosophila


Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila


Drosophila


Drosophila


Drosophila

Drosophila

Drosophila
Drosophila   Apc10

Drosophila


Drosophila

Drosophila


Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila


Drosophila

Drosophila


Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila
Drosophila


Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila


Drosophila


Drosophila


Drosophila

Drosophila
Drosophila

Drosophila


Drosophila

Drosophila

Drosophila


Drosophila

Drosophila


Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila
Drosophila


Drosophila

Drosophila

Drosophila


Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila


Drosophila

Drosophila


Drosophila

Drosophila


Drosophila

Drosophila
Drosophila


Drosophila


Drosophila

Drosophila

Drosophila


Drosophila

Drosophila


Drosophila

Drosophila


Drosophila

Drosophila


Drosophila


Drosophila


Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila
Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila


Drosophila

Drosophila


Drosophila

Drosophila


Drosophila

Drosophila

Drosophila


Drosophila


Drosophila

Drosophila
Drosophila


Drosophila


Drosophila


Drosophila


Drosophila

Drosophila


Drosophila


Drosophila

Drosophila

Drosophila

Drosophila


Drosophila


Drosophila


Drosophila

Drosophila


Drosophila

Drosophila


Drosophila

Drosophila
Drosophila


Drosophila


Drosophila

Drosophila

Drosophila


Drosophila


Drosophila

Drosophila

Drosophila


Drosophila

Drosophila


Drosophila


Drosophila

Drosophila

Drosophila

Drosophila


Drosophila


Drosophila


Drosophila
Drosophila


Drosophila


Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila


Drosophila

Drosophila


Drosophila


Drosophila

Drosophila


Drosophila


Drosophila

Drosophila
Drosophila


Drosophila   wde

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila


Drosophila


Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila


Drosophila

Drosophila

Drosophila
Drosophila

Drosophila

Drosophila


Drosophila


Drosophila

Drosophila

Drosophila


Drosophila


Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila
Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila


Drosophila

Drosophila

Drosophila


Drosophila


Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila


Drosophila
Drosophila

Drosophila


Drosophila


Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila


Drosophila


Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila


Drosophila

Drosophila
Drosophila

Drosophila

Drosophila

Drosophila


Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila
Drosophila

Drosophila

Drosophila

Drosophila


Drosophila


Drosophila


Drosophila


Drosophila

Drosophila


Drosophila

Drosophila


Drosophila

Drosophila


Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila
Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila
Drosophila

Drosophila

Drosophila

Drosophila


Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila


Drosophila


Drosophila
Drosophila

Drosophila

Drosophila


Drosophila


Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila


Drosophila

Drosophila
Drosophila


Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila


Drosophila

Drosophila


Drosophila

Drosophila


Drosophila

Drosophila


Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila
Drosophila


Drosophila

Drosophila


Drosophila


Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila
Drosophila

Drosophila


Drosophila

Drosophila

Drosophila


Drosophila

Drosophila


Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila


Drosophila


Drosophila

Drosophila

Drosophila

Drosophila


Drosophila


Drosophila
Drosophila


Drosophila


Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila
Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila


Drosophila


Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila   CycY
Drosophila

Drosophila


Drosophila


Drosophila


Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila
Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila


Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila
Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila


Drosophila


Drosophila

Drosophila


Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila
Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila


Drosophila


Drosophila


Drosophila

Drosophila
Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila
Drosophila

Drosophila


Drosophila


Drosophila

Drosophila


Drosophila


Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila
Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila
Drosophila

Drosophila


Drosophila


Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila


Drosophila

Drosophila


Drosophila


Drosophila


Drosophila

Drosophila


Drosophila


Drosophila

Drosophila
Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila


Drosophila

Drosophila


Drosophila


Drosophila

Drosophila

Drosophila

Drosophila


Drosophila


Drosophila

Drosophila

Drosophila

Drosophila
Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila


Drosophila


Drosophila


Drosophila

Drosophila   nocte

Drosophila


Drosophila


Drosophila

Drosophila

Drosophila
Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila


Drosophila


Drosophila
Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila
Drosophila


Drosophila


Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila


Drosophila


Drosophila

Drosophila

Drosophila


Drosophila


Drosophila

Drosophila

Drosophila
Drosophila

Drosophila

Drosophila


Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila
Drosophila


Drosophila

Drosophila


Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila


Drosophila


Drosophila

Drosophila

Drosophila

Drosophila
Drosophila


Drosophila

Drosophila

Drosophila


Drosophila


Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila


Drosophila


Drosophila


Drosophila

Drosophila


Drosophila
Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila


Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila
Drosophila

Drosophila

Drosophila


Drosophila


Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila


Drosophila   SmE


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila
Drosophila

Drosophila


Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila
Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila


Drosophila

Drosophila


Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila


Drosophila


Drosophila

Drosophila
Drosophila


Drosophila

Drosophila

Drosophila


Drosophila


Drosophila


Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila
Drosophila


Drosophila


Drosophila   Nup50


Drosophila

Drosophila


Drosophila

Drosophila

Drosophila


Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila


Drosophila


Drosophila

Drosophila
Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila
Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila


Drosophila

Drosophila

Drosophila

Drosophila
Drosophila


Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila


Drosophila


Drosophila


Drosophila


Drosophila


Drosophila

Drosophila


Drosophila

Drosophila


Drosophila

Drosophila
Drosophila


Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila


Drosophila


Drosophila

Drosophila

Drosophila


Drosophila
Drosophila


Drosophila


Drosophila

Drosophila


Drosophila


Drosophila

Drosophila

Drosophila


Drosophila


Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila
Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila
Drosophila


Drosophila

Drosophila

Drosophila


Drosophila

Drosophila


Drosophila

Drosophila




Drosophila


Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila
Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila
Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila


Drosophila


Drosophila

Drosophila

Drosophila

Drosophila


Drosophila


Drosophila

Drosophila

Drosophila


Drosophila


Drosophila

Drosophila
Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila   wtrw

Drosophila   wtrw

Drosophila

Drosophila

Drosophila


Drosophila


Drosophila

Drosophila


Drosophila


Drosophila


Drosophila


Drosophila


Drosophila

Drosophila

Drosophila

Drosophila
Drosophila

Drosophila


Drosophila

Drosophila

Drosophila


Drosophila


Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila


Drosophila


Drosophila


Drosophila

Drosophila
Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila


Drosophila


Drosophila


Drosophila

Drosophila

Drosophila

Drosophila


Drosophila
Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila
Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila


Drosophila


Drosophila


Drosophila

Drosophila

Drosophila


Drosophila


Drosophila


Drosophila

Drosophila

Drosophila
Drosophila


Drosophila


Drosophila

Drosophila

Drosophila


Drosophila


Drosophila


Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila


Drosophila
Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila


Drosophila

Drosophila

Drosophila


Drosophila


Drosophila

Drosophila

Drosophila


Drosophila


Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila
Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila   NnaD

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila


Drosophila
Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila


Drosophila


Drosophila

Drosophila

Drosophila
Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila   mp

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila
Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila
Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila
Drosophila

Drosophila

Drosophila

Drosophila


Drosophila


Drosophila

Drosophila

Drosophila


Drosophila


Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila
Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila


Drosophila


Drosophila


Drosophila

Drosophila


Drosophila

Drosophila
Drosophila


Drosophila


Drosophila

Drosophila


Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila   Shawl

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila
Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila


Drosophila
Drosophila


Drosophila


Drosophila

Drosophila

Drosophila

Drosophila


Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila


Drosophila


Drosophila


Drosophila


Drosophila

Drosophila

Drosophila
Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila


Drosophila

Drosophila


Drosophila

Drosophila


Drosophila

Drosophila


Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila
Drosophila

Drosophila


Drosophila


Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila


Drosophila


Drosophila


Drosophila


Drosophila

Drosophila


Drosophila


Drosophila


Drosophila

Drosophila

Drosophila
Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila


Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila
Drosophila


Drosophila


Drosophila


Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila


Drosophila


Drosophila

Drosophila

Drosophila


Drosophila

Drosophila


Drosophila
Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila


Drosophila


Drosophila


Drosophila


Drosophila

Drosophila

Drosophila


Drosophila

Drosophila
Drosophila

Drosophila

Drosophila


Drosophila


Drosophila


Drosophila

Drosophila

Drosophila


Drosophila

Drosophila


Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila


Drosophila

Drosophila
Drosophila

Drosophila

Drosophila


Drosophila


Drosophila


Drosophila


Drosophila


Drosophila


Drosophila


Drosophila

Drosophila


Drosophila


Drosophila

Drosophila


Drosophila


Drosophila

Drosophila

Drosophila
Drosophila


Drosophila


Drosophila


Drosophila


Drosophila

Drosophila


Drosophila


Drosophila


Drosophila

Drosophila


Drosophila

Drosophila

Drosophila


Drosophila


Drosophila


Drosophila

Drosophila

Drosophila
Drosophila

Drosophila


Drosophila

Drosophila


Drosophila

Drosophila


Drosophila


Drosophila

Drosophila

Drosophila


Drosophila

Drosophila


Drosophila


Drosophila


Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila
Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila   Snp

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila
Drosophila

Drosophila

Drosophila


Drosophila


Drosophila

Drosophila


Drosophila

Drosophila

Drosophila


Drosophila


Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila


Drosophila

Drosophila


Drosophila

Drosophila
Drosophila


Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila


Drosophila

Drosophila


Drosophila


Drosophila

Drosophila


Drosophila


Drosophila

Drosophila

Drosophila


Drosophila

Drosophila
Drosophila

Drosophila

Drosophila


Drosophila


Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila


Drosophila


Drosophila


Drosophila

Drosophila

Drosophila


Drosophila

Drosophila
Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila


Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila


Drosophila

Drosophila


Drosophila
Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila
Drosophila

Drosophila


Drosophila

Drosophila

Drosophila


Drosophila


Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila


Drosophila

Drosophila

Drosophila

Drosophila
Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila
Drosophila


Drosophila


Drosophila


Drosophila


Drosophila


Drosophila

Drosophila


Drosophila

Drosophila


Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila
Drosophila

Drosophila

Drosophila

Drosophila


Drosophila


Drosophila


Drosophila

Drosophila

Drosophila

Drosophila


Drosophila


Drosophila

Drosophila


Drosophila


Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila
Drosophila

Drosophila

Drosophila


Drosophila

Drosophila


Drosophila

Drosophila


Drosophila


Drosophila


Drosophila

Drosophila

Drosophila

Drosophila


Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila
Drosophila

Drosophila


Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila


Drosophila


Drosophila


Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila
Drosophila

Drosophila

Drosophila


Drosophila


Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila


Drosophila

Drosophila


Drosophila

Drosophila


Drosophila

Drosophila
Drosophila


Drosophila

Drosophila


Drosophila


Drosophila

Drosophila


Drosophila

Drosophila

Drosophila


Drosophila


Drosophila


Drosophila

Drosophila


Drosophila

Drosophila


Drosophila

Drosophila


Drosophila

Drosophila
Drosophila


Drosophila

Drosophila


Drosophila


Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila


Drosophila


Drosophila

Drosophila


Drosophila
Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila


Drosophila


Drosophila

Drosophila


Drosophila


Drosophila


Drosophila

Drosophila


Drosophila

Drosophila
Drosophila

Drosophila


Drosophila


Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila


Drosophila


Drosophila


Drosophila

Drosophila


Drosophila

Drosophila


Drosophila

Drosophila
Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila


Drosophila   kcc

Drosophila

Drosophila


Drosophila


Drosophila   DNA-ligI

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila
Drosophila

Drosophila


Drosophila


Drosophila


Drosophila

Drosophila

Drosophila

Drosophila


Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila


Drosophila

Drosophila

Drosophila
Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila
Drosophila


Drosophila

Drosophila


Drosophila

Drosophila


Drosophila

Drosophila


Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila
Drosophila


Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila
Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila


Drosophila

Drosophila


Drosophila

Drosophila

Drosophila


Drosophila


Drosophila

Drosophila


Drosophila


Drosophila

Drosophila

Drosophila


Drosophila
Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila


Drosophila

Drosophila

Drosophila


Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila
Drosophila

Drosophila


Drosophila

Drosophila


Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila


Drosophila


Drosophila

Drosophila

Drosophila


Drosophila


Drosophila

Drosophila

Drosophila

Drosophila
Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila


Drosophila

Drosophila


Drosophila


Drosophila

Drosophila


Drosophila

Drosophila


Drosophila


Drosophila

Drosophila
Drosophila


Drosophila

Drosophila

Drosophila


Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila
Drosophila


Drosophila


Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila


Drosophila

Drosophila


Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila


Drosophila
Drosophila

Drosophila


Drosophila


Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila
Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila


Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila


Drosophila
Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila


Drosophila
Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila


Drosophila   sea


Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila


Drosophila


Drosophila
Drosophila


Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila   CTPsyn

Drosophila

Drosophila


Drosophila


Drosophila


Drosophila


Drosophila


Drosophila


Drosophila


Drosophila


Drosophila
Drosophila

Drosophila

Drosophila


Drosophila


Drosophila

Drosophila

Drosophila


Drosophila

Drosophila


Drosophila


Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila
Drosophila


Drosophila

Drosophila


Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila


Drosophila


Drosophila

Drosophila

Drosophila
Drosophila


Drosophila

Drosophila


Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila


Drosophila

Drosophila

Drosophila


Drosophila


Drosophila


Drosophila

Drosophila
Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila


Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila
Drosophila

Drosophila

Drosophila

Drosophila


Drosophila


Drosophila


Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila


Drosophila

Drosophila
Drosophila

Drosophila

Drosophila


Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila


Drosophila

Drosophila

Drosophila


Drosophila

Drosophila


Drosophila


Drosophila


Drosophila
Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila


Drosophila


Drosophila


Drosophila


Drosophila


Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila
Drosophila

Drosophila

Drosophila

Drosophila


Drosophila


Drosophila

Drosophila

Drosophila


Drosophila

Drosophila


Drosophila


Drosophila

Drosophila


Drosophila

Drosophila

Drosophila


Drosophila


Drosophila


Drosophila

Drosophila
Drosophila

Drosophila


Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila
Drosophila

Drosophila


Drosophila

Drosophila


Drosophila


Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila


Drosophila

Drosophila

Drosophila


Drosophila


Drosophila
Drosophila

Drosophila


Drosophila


Drosophila

Drosophila


Drosophila


Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila


Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila
Drosophila


Drosophila

Drosophila


Drosophila

Drosophila

Drosophila


Drosophila

Drosophila


Drosophila

Drosophila

Drosophila


Drosophila


Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila
Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila


Drosophila


Drosophila


Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila


Drosophila
Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila


Drosophila

Drosophila


Drosophila


Drosophila

Drosophila
Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila


Drosophila

Drosophila

Drosophila


Drosophila


Drosophila

Drosophila

Drosophila

Drosophila


Drosophila


Drosophila


Drosophila

Drosophila

Drosophila


Drosophila
Drosophila

Drosophila


Drosophila

Drosophila


Drosophila

Drosophila


Drosophila


Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila
Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila


Drosophila


Drosophila


Drosophila

Drosophila


Drosophila


Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila


Drosophila


Drosophila

Drosophila
Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila


Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila
Drosophila

Drosophila

Drosophila


Drosophila

Drosophila


Drosophila


Drosophila


Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila


Drosophila


Drosophila

Drosophila
Drosophila

Drosophila

Drosophila


Drosophila


Drosophila

Drosophila

Drosophila


Drosophila

Drosophila


Drosophila


Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila
Drosophila

Drosophila


Drosophila


Drosophila

Drosophila

Drosophila


Drosophila

Drosophila


Drosophila

Drosophila


Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila


Drosophila

Drosophila
Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila


Drosophila


Drosophila


Drosophila


Drosophila

Drosophila


Drosophila

Drosophila


Drosophila

Drosophila


Drosophila

Drosophila

Drosophila
Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila
Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila


Drosophila
Drosophila


Drosophila

Drosophila

Drosophila

Drosophila


Drosophila


Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila


Drosophila


Drosophila
Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila


Drosophila


Drosophila


Drosophila
Drosophila


Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila


Drosophila


Drosophila


Drosophila


Drosophila
Drosophila

Drosophila

Drosophila


Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila


Drosophila


Drosophila

Drosophila

Drosophila


Drosophila


Drosophila


Drosophila

Drosophila
Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila


Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila   Spn42Dc

Drosophila   Spn42De

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila
Drosophila

Drosophila


Drosophila

Drosophila

Drosophila


Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila


Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila


Drosophila
Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila


Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila


Drosophila


Drosophila

Drosophila
Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila

Drosophila


Drosophila


Drosophila


Drosophila

Drosophila

Drosophila

Drosophila
Drosophila


Drosophila

Drosophila

Drosophila


Drosophila


Drosophila


Drosophila

Drosophila

Drosophila


Drosophila


Drosophila

Drosophila

Drosophila


Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila
Drosophila


Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila


Drosophila


Drosophila


Drosophila

Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila
Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila
Drosophila

Drosophila


Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila

Drosophila


Drosophila
INSERT Resource DESCRIPTION




free text (mutations, deletions, fusionsm, etc., e.g. Deletion of the C-terminal D domain of
PPARg
Hairpin ID: TR00781P.1; FWD Oligo: AAGAATTCCGCTGAGAGTATTGCTGACCT, RVS Oligo:
AGTCTAGAATCGGCATTTCTTTGGTCAC
Hairpin ID: SH00065.N; FWD Oligo:
ctagcagtTCGAACGAAGATAGCGCAAAAtagttatattcaagcataTTTTGCGCTATCTTCGTTCGAgcg, RVS
Oligo: aattcgcTCGAACGAAGATAGCGCAAAAtatgcttgaatataactaTTTTGCGCTATCTTCGTTCGAactg
Hairpin ID: SH01408.N2; FWD Oligo:
ctagcagtAAGAAACAAGTTGTTCGTCAAtagttatattcaagcataTTGACGAACAACTTGTTTCTTgcg, RVS Oligo:
aattcgcAAGAAACAAGTTGTTCGTCAAtatgcttgaatataactaTTGACGAACAACTTGTTTCTTactg
Hairpin ID: TR00307A.1; FWD Oligo: GTCTAGATGACTATCCTCCCGATCCTG, RVS Oligo:
AGAATTCAAGGCAACCCGATTTGTATG
Hairpin ID: TR00614A.1; FWD Oligo: GTCTAGACGGGACATTAACCTCACAGA, RVS Oligo:
AGAATTCATCCTCGTTCATTGAGCAGC
Hairpin ID: SH01194.N2; FWD Oligo:
ctagcagtTTCCTAGACGATGCTCTCTAAtagttatattcaagcataTTAGAGAGCATCGTCTAGGAAgcg, RVS
Oligo: aattcgcTTCCTAGACGATGCTCTCTAAtatgcttgaatataactaTTAGAGAGCATCGTCTAGGAAactg
Hairpin ID: SH00004.O; FWD Oligo:
ctagcagtTTAGAGCCGATCTTGTCCCGGtagttatattcaagcataCCGGGACAAGATCGGCTCTAAgcg, RVS
Oligo: aattcgcTTAGAGCCGATCTTGTCCCGGtatgcttgaatataactaCCGGGACAAGATCGGCTCTAAactg
Hairpin ID: TR00039A.2; FWD Oligo: AAGAATTCCTATGCAAGTTGCGCATTGT, RVS Oligo:
AGTCTAGAGGAGTCTGCACCAGGACATT
Hairpin ID: TR00039P.1; FWD Oligo: CACCCTATGCAAGTTGCGCATTGT, RVS Oligo:
GGAGTCTGCACCAGGACATT
Hairpin ID: TR00039A.1; FWD Oligo: GTCTAGACTATGCAAGTTGCGCATTGTT, RVS Oligo:
AGAATTCGGAGTCTGCACCAGGACATT
Hairpin ID: TR00040A.1; FWD Oligo: GTCTAGAACAAGAGCAGGGATCGCTAA, RVS Oligo:
AGAATTCGGCAGTTATCTTGCTGCTCC
Hairpin ID: SH00003.O; FWD Oligo:
ctagcagtTTGACAATGCGCAACTTGCATtagttatattcaagcataATGCAAGTTGCGCATTGTCAAgcg, RVS
Oligo: aattcgcTTGACAATGCGCAACTTGCATtatgcttgaatataactaATGCAAGTTGCGCATTGTCAAactg
Hairpin ID: SH00874.N; FWD Oligo:
ctagcagtACGCAAGTTCAGATTACGAAAtagttatattcaagcataTTTCGTAATCTGAACTTGCGTgcg, RVS
Oligo: aattcgcACGCAAGTTCAGATTACGAAAtatgcttgaatataactaTTTCGTAATCTGAACTTGCGTactg
Hairpin ID: SH00875.N; FWD Oligo:
ctagcagtCTGGACAACACCAATAAGCAAtagttatattcaagcataTTGCTTATTGGTGTTGTCCAGgcg, RVS
Oligo: aattcgcCTGGACAACACCAATAAGCAAtatgcttgaatataactaTTGCTTATTGGTGTTGTCCAGactg
Hairpin ID: SH01413.N2; FWD Oligo:
ctagcagtCCGGATTATCCGAGCAGATAAtagttatattcaagcataTTATCTGCTCGGATAATCCGGgcg, RVS
Oligo: aattcgcCCGGATTATCCGAGCAGATAAtatgcttgaatataactaTTATCTGCTCGGATAATCCGGactg
Hairpin ID: TR01946P.1; FWD Oligo: CACCGAATTCATCTCTCGAGCCCACTTCAA, RVS Oligo:
TATAGGTATCTCCGCGGTCG
Hairpin ID: TR01947P.1; FWD Oligo: CACCGAATTCCTGTCACCGATGGCTCCTAT, RVS Oligo:
GTTATCGGCGTCAGTTTGGT
Hairpin ID: SH01555.N2; FWD Oligo:
ctagcagtCCCGTTCTCAAGAGTAGCAAAtagttatattcaagcataTTTGCTACTCTTGAGAACGGGgcg, RVS
Oligo: aattcgcCCCGTTCTCAAGAGTAGCAAAtatgcttgaatataactaTTTGCTACTCTTGAGAACGGGactg
Hairpin ID: TR01949P.1; FWD Oligo: CACCGAATTCAGGGTTTCAAGTGCATCCAG, RVS Oligo:
CGCACAAACTCGATGACAAA
Hairpin ID: SH01631.N2; FWD Oligo:
ctagcagtATGCAATACACTAGACAAGAAtagttatattcaagcataTTCTTGTCTAGTGTATTGCATgcg, RVS Oligo:
aattcgcATGCAATACACTAGACAAGAAtatgcttgaatataactaTTCTTGTCTAGTGTATTGCATactg
Hairpin ID: TR01951P.1; FWD Oligo: CACCGAATTCCCAACGCCAAGAAGAAAAAG, RVS Oligo:
ATAACCTGGTTGGCGTGAAG
Hairpin ID: SH01221.N2; FWD Oligo:
ctagcagtCACGACGACGCTGGACAAGAAtagttatattcaagcataTTCTTGTCCAGCGTCGTCGTGgcg, RVS
Oligo: aattcgcCACGACGACGCTGGACAAGAAtatgcttgaatataactaTTCTTGTCCAGCGTCGTCGTGactg
Hairpin ID: TR00189P.1; FWD Oligo: GTCTAGATGTGGCCCTCAAAAAGATTC, RVS Oligo:
AGAATTCGGAGTAGAATTTCGTGCCCA
Hairpin ID: SH00143.N; FWD Oligo:
ctagcagtATCGATCTCAAGGATTGTTTAtagttatattcaagcataTAAACAATCCTTGAGATCGATgcg, RVS Oligo:
aattcgcATCGATCTCAAGGATTGTTTAtatgcttgaatataactaTAAACAATCCTTGAGATCGATactg
Hairpin ID: SH01185.N2; FWD Oligo:
ctagcagtAAGAAGCTGATGGATAAGAAAtagttatattcaagcataTTTCTTATCCATCAGCTTCTTgcg, RVS Oligo:
aattcgcAAGAAGCTGATGGATAAGAAAtatgcttgaatataactaTTTCTTATCCATCAGCTTCTTactg
Hairpin ID: SH01566.N2; FWD Oligo:
ctagcagtAAAGAACGATGTGGTAGCTAAtagttatattcaagcataTTAGCTACCACATCGTTCTTTgcg, RVS
Oligo: aattcgcAAAGAACGATGTGGTAGCTAAtatgcttgaatataactaTTAGCTACCACATCGTTCTTTactg
Hairpin ID: TR01954P.1; FWD Oligo: CACCGAATTCGGGGATCATATCGAATGTGG, RVS Oligo:
AAGAATTTGGCCACAAAACG
Hairpin ID: SH00071.N; FWD Oligo:
ctagcagtCACCTAGATACTACAGTTAGAtagttatattcaagcataTCTAACTGTAGTATCTAGGTGgcg, RVS
Oligo: aattcgcCACCTAGATACTACAGTTAGAtatgcttgaatataactaTCTAACTGTAGTATCTAGGTGactg
Hairpin ID: SH01543.N2; FWD Oligo:
ctagcagtACGGAGAAGATGATTGTGCTAtagttatattcaagcataTAGCACAATCATCTTCTCCGTgcg, RVS
Oligo: aattcgcACGGAGAAGATGATTGTGCTAtatgcttgaatataactaTAGCACAATCATCTTCTCCGTactg
Hairpin ID: SH00449.N; FWD Oligo:
ctagcagtACGATCGATTGTTATATATAAtagttatattcaagcataTTATATATAACAATCGATCGTgcg, RVS Oligo:
aattcgcACGATCGATTGTTATATATAAtatgcttgaatataactaTTATATATAACAATCGATCGTactg
Hairpin ID: SH01410.N2; FWD Oligo:
ctagcagtCAAGGTGTTCCTGTTGATCGAtagttatattcaagcataTCGATCAACAGGAACACCTTGgcg, RVS
Oligo: aattcgcCAAGGTGTTCCTGTTGATCGAtatgcttgaatataactaTCGATCAACAGGAACACCTTGactg
Hairpin ID: SH01589.N2; FWD Oligo:
ctagcagtCAAGCAGTTGCAAGCACTCAAtagttatattcaagcataTTGAGTGCTTGCAACTGCTTGgcg, RVS
Oligo: aattcgcCAAGCAGTTGCAAGCACTCAAtatgcttgaatataactaTTGAGTGCTTGCAACTGCTTGactg
Hairpin ID: TR03630P.1; FWD Oligo: AAGAATTCTCAACCTATCGCATCATCCA, RVS Oligo:
AGTCTAGACAGTCGAACATTCGCGTAGA
Hairpin ID: SH00784.N; FWD Oligo:
ctagcagtAAGGATACTCAGTTTAGTCAAtagttatattcaagcataTTGACTAAACTGAGTATCCTTgcg, RVS Oligo:
aattcgcAAGGATACTCAGTTTAGTCAAtatgcttgaatataactaTTGACTAAACTGAGTATCCTTactg
Hairpin ID: SH01567.N2; FWD Oligo:
ctagcagtTCAGCTGGACAAGATATTCAAtagttatattcaagcataTTGAATATCTTGTCCAGCTGAgcg, RVS
Oligo: aattcgcTCAGCTGGACAAGATATTCAAtatgcttgaatataactaTTGAATATCTTGTCCAGCTGAactg
Hairpin ID: SH01608.N2; FWD Oligo:
ctagcagtTTCGACAAGATACGACAGAGAtagttatattcaagcataTCTCTGTCGTATCTTGTCGAAgcg, RVS
Oligo: aattcgcTTCGACAAGATACGACAGAGAtatgcttgaatataactaTCTCTGTCGTATCTTGTCGAAactg
Hairpin ID: SH01618.N2; FWD Oligo:
ctagcagtACGGACGAACGAACTATACAAtagttatattcaagcataTTGTATAGTTCGTTCGTCCGTgcg, RVS
Oligo: aattcgcACGGACGAACGAACTATACAAtatgcttgaatataactaTTGTATAGTTCGTTCGTCCGTactg
Hairpin ID: TR03144P.1; FWD Oligo: AAGAATTCAAGAAGACCGATGCACTGCT, RVS Oligo:
AGTCTAGAGCAATGAATCTTCAGGGGAA
Hairpin ID: TR01960P.1; FWD Oligo: CACCGAATTCAGCCAGTCGGAATGTACCAG, RVS Oligo:
CTGATGATGCTCTTCGGGAT
Hairpin ID: SH01168.N2; FWD Oligo:
ctagcagtCAGGATGCGAATCCTAAAGAAtagttatattcaagcataTTCTTTAGGATTCGCATCCTGgcg, RVS
Oligo: aattcgcCAGGATGCGAATCCTAAAGAAtatgcttgaatataactaTTCTTTAGGATTCGCATCCTGactg
Hairpin ID: TR01600P.1; FWD Oligo: AAGAATTCTAAAGCAGGAGGAGCACGTT, RVS Oligo:
AGTCTAGACGTCAACAAAGTCATGTGGG
Hairpin ID: SH00155.N; FWD Oligo:
ctagcagtCTGGATGAAGTTCGATAACAAtagttatattcaagcataTTGTTATCGAACTTCATCCAGgcg, RVS
Oligo: aattcgcCTGGATGAAGTTCGATAACAAtatgcttgaatataactaTTGTTATCGAACTTCATCCAGactg
Hairpin ID: TR00666A.1; FWD Oligo: GTCTAGAGGAAGTGGAGGCACTGTTGT, RVS Oligo:
AGAATTCCCTGGCGATGAAATGGTTAT
Hairpin ID: TR00667A.1; FWD Oligo: GTCTAGACAGAGGATGTTTCCCTGCTC, RVS Oligo:
AGAATTCCATGGTGAAATATAGGGCCG
Hairpin ID: TR01961P.1; FWD Oligo: CACCGAATTCGTCCTGTGCGACAGTGAGAA, RVS Oligo:
ACCAGAGGCAGAACGCATAC
Hairpin ID: SH01244.N2; FWD Oligo:
ctagcagtACCGATGAGAATGCTTAGTTAtagttatattcaagcataTAACTAAGCATTCTCATCGGTgcg, RVS
Oligo: aattcgcACCGATGAGAATGCTTAGTTAtatgcttgaatataactaTAACTAAGCATTCTCATCGGTactg
Hairpin ID: TR00565A.1; FWD Oligo: GTCTAGAGACAAGATGAACCGCCAACT, RVS Oligo:
AGAATTCAATAAAAACAATACGCGCCG
Hairpin ID: SH01249.N2; FWD Oligo:
ctagcagtTAGCGACATGTCTTAGAGAAAtagttatattcaagcataTTTCTCTAAGACATGTCGCTAgcg, RVS
Oligo: aattcgcTAGCGACATGTCTTAGAGAAAtatgcttgaatataactaTTTCTCTAAGACATGTCGCTAactg
Hairpin ID: TR01967P.1; FWD Oligo: CACCGAATTCAACGCCAATTACATGCTTCC, RVS Oligo:
GTACGTCGACTCGAATCCGT
Hairpin ID: SH01569.N2; FWD Oligo:
ctagcagtTAGGATCTATATGGAGGTTTAtagttatattcaagcataTAAACCTCCATATAGATCCTAgcg, RVS Oligo:
aattcgcTAGGATCTATATGGAGGTTTAtatgcttgaatataactaTAAACCTCCATATAGATCCTAactg
Hairpin ID: TR02461P.1; FWD Oligo: AAGAATTCGATCAAGAACGAACGCTTCC, RVS Oligo:
AGTCTAGAGTAGGTGGACATCATCCGCT
Hairpin ID: TR01590P.1; FWD Oligo: AAGAATTCGTCAGCTCACGGACACAATG, RVS Oligo:
AGTCTAGATGTGTTGTTGCATTCCGTTT
Hairpin ID: SH01225.N2; FWD Oligo:
ctagcagtTAGAGCAATATTCGAATTTAAtagttatattcaagcataTTAAATTCGAATATTGCTCTAgcg, RVS Oligo:
aattcgcTAGAGCAATATTCGAATTTAAtatgcttgaatataactaTTAAATTCGAATATTGCTCTAactg
Hairpin ID: SH01184.N2; FWD Oligo:
ctagcagtTAGGCTAGCTTAAGCGATAAAtagttatattcaagcataTTTATCGCTTAAGCTAGCCTAgcg, RVS
Oligo: aattcgcTAGGCTAGCTTAAGCGATAAAtatgcttgaatataactaTTTATCGCTTAAGCTAGCCTAactg
Hairpin ID: TR00567A.1; FWD Oligo: GTCTAGAAGAAGTACGGCTCCGGGTAT, RVS Oligo:
AGAATTCGCAGCTCCTCGCTGTTTAGT
Hairpin ID: SH01603.N2; FWD Oligo:
ctagcagtCAACGATTTGATCGACCTCAAtagttatattcaagcataTTGAGGTCGATCAAATCGTTGgcg, RVS
Oligo: aattcgcCAACGATTTGATCGACCTCAAtatgcttgaatataactaTTGAGGTCGATCAAATCGTTGactg
Hairpin ID: SH01570.N2; FWD Oligo:
ctagcagtCAGGATAACGACAACGATGAAtagttatattcaagcataTTCATCGTTGTCGTTATCCTGgcg, RVS
Oligo: aattcgcCAGGATAACGACAACGATGAAtatgcttgaatataactaTTCATCGTTGTCGTTATCCTGactg
Hairpin ID: SH01190.N2; FWD Oligo:
ctagcagtCAGCAGAATATTGTTAGTAAAtagttatattcaagcataTTTACTAACAATATTCTGCTGgcg, RVS Oligo:
aattcgcCAGCAGAATATTGTTAGTAAAtatgcttgaatataactaTTTACTAACAATATTCTGCTGactg
Hairpin ID: SH01628.N2b; FWD Oligo:
ctagcagtAACGAAGTCATTTATAGCGAAtagttatattcaagcataTTCGCTATAAATGACTTCGTTgcg, RVS Oligo:
aattcgcAACGAAGTCATTTATAGCGAAtatgcttgaatataactaTTCGCTATAAATGACTTCGTTactg
Hairpin ID: SH01438.N2; FWD Oligo:
ctagcagtTAGCTCGTTTGTGATCAGCAAtagttatattcaagcataTTGCTGATCACAAACGAGCTAgcg, RVS
Oligo: aattcgcTAGCTCGTTTGTGATCAGCAAtatgcttgaatataactaTTGCTGATCACAAACGAGCTAactg
Hairpin ID: TR01978P.1; FWD Oligo: CACCGAATTCTGGGTTGTCGAATGTGTTTG, RVS Oligo:
GGAAAGCAGGACATCCAATC
Hairpin ID: SH01235.N2b; FWD Oligo:
ctagcagtTAGTTAAATTGTTCCAAGTAAtagttatattcaagcataTTACTTGGAACAATTTAACTAgcg, RVS Oligo:
aattcgcTAGTTAAATTGTTCCAAGTAAtatgcttgaatataactaTTACTTGGAACAATTTAACTAactg
Hairpin ID: TR00953P.1; FWD Oligo: AGTCTAGAACATCACGGAACTCTCGGAC, RVS Oligo:
AAGAATTCTGGTGACCCTCCTTTTTCAC
Hairpin ID: TR00613A.1; FWD Oligo: GTCTAGACTCCCTTTGCCATTCACAAT, RVS Oligo:
AGAATTCCAATCACGATAGCACCCCTT
Hairpin ID: TR00612A.1; FWD Oligo: GTCTAGATTATGAGCCAGCACACTTCG, RVS Oligo:
AGAATTCTGCGATGGTAACTGAACAGC
Hairpin ID: TR01985P.1; FWD Oligo: CACCGAATTCACACGGTCAACCTGATAGCC, RVS Oligo:
ACGCAGAGCTCCACTGAAAT
Hairpin ID: TR01591P.1; FWD Oligo: AAGAATTCTGGAAATCGAACCTTTCTGG, RVS Oligo:
AGTCTAGATCGTGGGGCTAAACAATTTC
Hairpin ID: SH00083.N; FWD Oligo:
ctagcagtAAGCTAGCAATGTTAGACCAAtagttatattcaagcataTTGGTCTAACATTGCTAGCTTgcg, RVS
Oligo: aattcgcAAGCTAGCAATGTTAGACCAAtatgcttgaatataactaTTGGTCTAACATTGCTAGCTTactg
Hairpin ID: SH01585.N2; FWD Oligo:
ctagcagtCTGGTGCTCAAAGCAAAGCAAtagttatattcaagcataTTGCTTTGCTTTGAGCACCAGgcg, RVS
Oligo: aattcgcCTGGTGCTCAAAGCAAAGCAAtatgcttgaatataactaTTGCTTTGCTTTGAGCACCAGactg
Hairpin ID: TR00350P.1; FWD Oligo: GTCTAGAAAAGGCGTTACAACCGTCAC, RVS Oligo:
AGAATTCTGGACCTGAAGTCCTCATCC
Hairpin ID: TR01751P.1; FWD Oligo: CACCGAATTCGCGGTCTGAAGAAGATACGC, RVS Oligo:
CTGTGATGCTCTGGCAGTGT
Hairpin ID: SH01220.N2; FWD Oligo:
ctagcagtAACGAAGGAGCGCGACAACAAtagttatattcaagcataTTGTTGTCGCGCTCCTTCGTTgcg, RVS
Oligo: aattcgcAACGAAGGAGCGCGACAACAAtatgcttgaatataactaTTGTTGTCGCGCTCCTTCGTTactg
Hairpin ID: TR00561A.1; FWD Oligo: GTCTAGAACACGGACATCTCGGAGTTC, RVS Oligo:
AGAATTCCAATGCTTTGCTTGCTTCTG
Hairpin ID: SH00482.N; FWD Oligo:
ctagcagtCTGGAGAAGATGTTCACATAAtagttatattcaagcataTTATGTGAACATCTTCTCCAGgcg, RVS
Oligo: aattcgcCTGGAGAAGATGTTCACATAAtatgcttgaatataactaTTATGTGAACATCTTCTCCAGactg
Hairpin ID: SH01165.N2; FWD Oligo:
ctagcagtCCGAATGTTAGTTTAACGTAAtagttatattcaagcataTTACGTTAAACTAACATTCGGgcg, RVS Oligo:
aattcgcCCGAATGTTAGTTTAACGTAAtatgcttgaatataactaTTACGTTAAACTAACATTCGGactg
Hairpin ID: SH00499.N; FWD Oligo:
ctagcagtAAGGAGATGAATGCAAATGAAtagttatattcaagcataTTCATTTGCATTCATCTCCTTgcg, RVS Oligo:
aattcgcAAGGAGATGAATGCAAATGAAtatgcttgaatataactaTTCATTTGCATTCATCTCCTTactg
Hairpin ID: SH00597.N; FWD Oligo:
ctagcagtCAGCGACAACAAGAAGATCAAtagttatattcaagcataTTGATCTTCTTGTTGTCGCTGgcg, RVS
Oligo: aattcgcCAGCGACAACAAGAAGATCAAtatgcttgaatataactaTTGATCTTCTTGTTGTCGCTGactg
Hairpin ID: TR00038A.1; FWD Oligo: GTCTAGATTCTCGAGATGCCCTGAAGT, RVS Oligo:
AGAATTCTCGATCTTTAATATTCCGCGA
Hairpin ID: TR00037A.1; FWD Oligo: GTCTAGATTTACGCCGTCGATTTTGAT, RVS Oligo:
AGAATTCACAACCATGCCATAAGCTCC
Hairpin ID: SH00522.N; FWD Oligo:
ctagcagtTTCGAGCGGATCAGTAGTTAAtagttatattcaagcataTTAACTACTGATCCGCTCGAAgcg, RVS
Oligo: aattcgcTTCGAGCGGATCAGTAGTTAAtatgcttgaatataactaTTAACTACTGATCCGCTCGAAactg
Hairpin ID: SH01576.N2; FWD Oligo:
ctagcagtATGAGAGATGTTTATATTGTAtagttatattcaagcataTACAATATAAACATCTCTCATgcg, RVS Oligo:
aattcgcATGAGAGATGTTTATATTGTAtatgcttgaatataactaTACAATATAAACATCTCTCATactg
Hairpin ID: SH01441.N2; FWD Oligo:
ctagcagtCGCGATGTGAACGATCTCAAAtagttatattcaagcataTTTGAGATCGTTCACATCGCGgcg, RVS
Oligo: aattcgcCGCGATGTGAACGATCTCAAAtatgcttgaatataactaTTTGAGATCGTTCACATCGCGactg
Hairpin ID: SH01632.N2; FWD Oligo:
ctagcagtACCCACAAGAGACTAGTGCAAtagttatattcaagcataTTGCACTAGTCTCTTGTGGGTgcg, RVS
Oligo: aattcgcACCCACAAGAGACTAGTGCAAtatgcttgaatataactaTTGCACTAGTCTCTTGTGGGTactg
Hairpin ID: SH01581.N2; FWD Oligo:
ctagcagtATGGACTATGTTCGTCTCTTAtagttatattcaagcataTAAGAGACGAACATAGTCCATgcg, RVS
Oligo: aattcgcATGGACTATGTTCGTCTCTTAtatgcttgaatataactaTAAGAGACGAACATAGTCCATactg
Hairpin ID: SH01435.N2; FWD Oligo:
ctagcagtCCGCGAGATCATGATCCTAAAtagttatattcaagcataTTTAGGATCATGATCTCGCGGgcg, RVS
Oligo: aattcgcCCGCGAGATCATGATCCTAAAtatgcttgaatataactaTTTAGGATCATGATCTCGCGGactg
Hairpin ID: SH01554.N2; FWD Oligo:
ctagcagtCTGGACCAGACTACTGGACTAtagttatattcaagcataTAGTCCAGTAGTCTGGTCCAGgcg, RVS
Oligo: aattcgcCTGGACCAGACTACTGGACTAtatgcttgaatataactaTAGTCCAGTAGTCTGGTCCAGactg
Hairpin ID: SH00591.N; FWD Oligo:
ctagcagtTAGGCTAGTACTCTACTTTAAtagttatattcaagcataTTAAAGTAGAGTACTAGCCTAgcg, RVS Oligo:
aattcgcTAGGCTAGTACTCTACTTTAAtatgcttgaatataactaTTAAAGTAGAGTACTAGCCTAactg
Hairpin ID: SH00073.N; FWD Oligo:
ctagcagtTCGCATAGAGGATATCAACAAtagttatattcaagcataTTGTTGATATCCTCTATGCGAgcg, RVS
Oligo: aattcgcTCGCATAGAGGATATCAACAAtatgcttgaatataactaTTGTTGATATCCTCTATGCGAactg
Hairpin ID: SH00073.Vp; FWD Oligo:
ctagcagtTCGCATAGAGGATATCAACAAtagttatattcaagcataTTGTTGATATCCTCTATGCGAgcg, RVS
Oligo: aattcgcTCGCATAGAGGATATCAACAAtatgcttgaatataactaTTGTTGATATCCTCTATGCGAactg
Hairpin ID: SH00073.N2; FWD Oligo:
ctagcagtTCGCATAGAGGATATCAACAAtagttatattcaagcataTTGTTGATATCCTCTATGCGAgcg, RVS
Oligo: aattcgcTCGCATAGAGGATATCAACAAtatgcttgaatataactaTTGTTGATATCCTCTATGCGAactg
Hairpin ID: TR00699A.1; FWD Oligo: GTCTAGACATCGCGATATCAAGAGCAA, RVS Oligo:
AGAATTCGGTGGCGAGTACATCATCCT
Hairpin ID: TR00700A.1; FWD Oligo: GTCTAGACGATGTGCCCATTAAGATTG, RVS Oligo:
AGAATTCCGTACAAAAGCTGGCACAAA
Hairpin ID: SH01224.N2; FWD Oligo:
ctagcagtTAAGCTAGAGTTAGATGACTAtagttatattcaagcataTAGTCATCTAACTCTAGCTTAgcg, RVS Oligo:
aattcgcTAAGCTAGAGTTAGATGACTAtatgcttgaatataactaTAGTCATCTAACTCTAGCTTAactg
Hairpin ID: SH01575.N2; FWD Oligo:
ctagcagtCCGGTCAATAAGACCTTACAAtagttatattcaagcataTTGTAAGGTCTTATTGACCGGgcg, RVS
Oligo: aattcgcCCGGTCAATAAGACCTTACAAtatgcttgaatataactaTTGTAAGGTCTTATTGACCGGactg
Hairpin ID: TR00180A.1; FWD Oligo: GTCTAGACCTATGCAGATGAGGAGGGA, RVS Oligo:
AGAATTCACCTCCGATCGAGTTTCCTT
Hairpin ID: SH01171.N2; FWD Oligo:
ctagcagtCACGAGAAGCATACTAAAGAAtagttatattcaagcataTTCTTTAGTATGCTTCTCGTGgcg, RVS
Oligo: aattcgcCACGAGAAGCATACTAAAGAAtatgcttgaatataactaTTCTTTAGTATGCTTCTCGTGactg
Hairpin ID: TR01957P.1; FWD Oligo: CACCGAATTCCCTGTGTACCCGAATCTCGT, RVS Oligo:
TTCGAACCTGAAGCCACTCT
Hairpin ID: SH01557.N2b; FWD Oligo:
ctagcagtCACCAAGTGGTTCAAGAAGAAtagttatattcaagcataTTCTTCTTGAACCACTTGGTGgcg, RVS
Oligo: aattcgcCACCAAGTGGTTCAAGAAGAAtatgcttgaatataactaTTCTTCTTGAACCACTTGGTGactg
Hairpin ID: TR01883P.1; FWD Oligo: CACCGAATTCCAAGCCTACTACGCCGCTAC, RVS Oligo:
AAGAGATGAAACGGTGCAGG
Hairpin ID: SH01583.N2; FWD Oligo:
ctagcagtAACAATTGTTCTAGTCTAGTAtagttatattcaagcataTACTAGACTAGAACAATTGTTgcg, RVS Oligo:
aattcgcAACAATTGTTCTAGTCTAGTAtatgcttgaatataactaTACTAGACTAGAACAATTGTTactg
Hairpin ID: TR00783P.1; FWD Oligo: AAGAATTCGCCTATCTGGAACAGAAGCG, RVS Oligo:
AGTCTAGAGAGAGCAGCAAAAGTGGGTC
Hairpin ID: SH00992.N; FWD Oligo:
ctagcagtCAGCAAGGATATGGTGTATAAtagttatattcaagcataTTATACACCATATCCTTGCTGgcg, RVS
Oligo: aattcgcCAGCAAGGATATGGTGTATAAtatgcttgaatataactaTTATACACCATATCCTTGCTGactg
Hairpin ID: SH00993.N; FWD Oligo:
ctagcagtACGACTGTACAATTTGTTCTAtagttatattcaagcataTAGAACAAATTGTACAGTCGTgcg, RVS Oligo:
aattcgcACGACTGTACAATTTGTTCTAtatgcttgaatataactaTAGAACAAATTGTACAGTCGTactg
Hairpin ID: SH01595.N2; FWD Oligo:
ctagcagtAACGACGATGTTTCCGCATTAtagttatattcaagcataTAATGCGGAAACATCGTCGTTgcg, RVS
Oligo: aattcgcAACGACGATGTTTCCGCATTAtatgcttgaatataactaTAATGCGGAAACATCGTCGTTactg
Hairpin ID: TR02339P.1; FWD Oligo: AAGAATTCGCGAGCAGCTAATACGGAAC, RVS Oligo:
AGTCTAGATATTTCTCCAGATCCACGGC
Hairpin ID: SH01620.N2; FWD Oligo:
ctagcagtCCGCGAGATAGCGATCCTTAAtagttatattcaagcataTTAAGGATCGCTATCTCGCGGgcg, RVS
Oligo: aattcgcCCGCGAGATAGCGATCCTTAAtatgcttgaatataactaTTAAGGATCGCTATCTCGCGGactg
Hairpin ID: TR02009P.1; FWD Oligo: CACCGAATTCTGCCGTGTTATAGTCCACCA, RVS Oligo:
TCCCATTCTAGATCGGCATC
Hairpin ID: SH01619.N2; FWD Oligo:
ctagcagtAAGGTCGAATTAGATGCTATAtagttatattcaagcataTATAGCATCTAATTCGACCTTgcg, RVS Oligo:
aattcgcAAGGTCGAATTAGATGCTATAtatgcttgaatataactaTATAGCATCTAATTCGACCTTactg
Hairpin ID: TR00570A.1; FWD Oligo: GTCTAGAGGACTTCGTGGCAATGAGTT, RVS Oligo:
AGAATTCGCATGTGTGGAAATCCAGTG
Hairpin ID: SH00305.N; FWD Oligo:
ctagcagtTACAGGATAAATTCAATTTAAtagttatattcaagcataTTAAATTGAATTTATCCTGTAgcg, RVS Oligo:
aattcgcTACAGGATAAATTCAATTTAAtatgcttgaatataactaTTAAATTGAATTTATCCTGTAactg
Hairpin ID: TR00297A.1; FWD Oligo: GTCTAGATTCCTCAGCCAGAAGGAGAA, RVS Oligo:
AGAATTCGAGACGCCGAAATCACAGA
Hairpin ID: TR00297P.1; FWD Oligo: AAGAATTCTTCCTCAGCCAGAAGGAGAA, RVS Oligo:
AGTCTAGAGAGACGCCGAAATCACAGAT
Hairpin ID: SH00085.N; FWD Oligo:
ctagcagtGCGAGATCAAGATCTGTGATTtagttatattcaagcataAATCACAGATCTTGATCTCGCgcg, RVS
Oligo: aattcgcGCGAGATCAAGATCTGTGATTtatgcttgaatataactaAATCACAGATCTTGATCTCGCactg
Hairpin ID: SH00333.N; FWD Oligo:
ctagcagtCTGGATTATATTGTAAACGAAtagttatattcaagcataTTCGTTTACAATATAATCCAGgcg, RVS Oligo:
aattcgcCTGGATTATATTGTAAACGAAtatgcttgaatataactaTTCGTTTACAATATAATCCAGactg
Hairpin ID: SH00085.Vp; FWD Oligo:
ctagcagtGCGAGATCAAGATCTGTGATTtagttatattcaagcataAATCACAGATCTTGATCTCGCgcg, RVS
Oligo: aattcgcGCGAGATCAAGATCTGTGATTtatgcttgaatataactaAATCACAGATCTTGATCTCGCactg
Hairpin ID: SH00085.N2; FWD Oligo:
ctagcagtGCGAGATCAAGATCTGTGATTtagttatattcaagcataAATCACAGATCTTGATCTCGCgcg, RVS
Oligo: aattcgcGCGAGATCAAGATCTGTGATTtatgcttgaatataactaAATCACAGATCTTGATCTCGCactg
Hairpin ID: SH00085.Nb; FWD Oligo:
ctagcagtGCGAGATCAAGATCTGTGATTtagttatattcaagcataAATCACAGATCTTGATCTCGCgcg, RVS
Oligo: aattcgcGCGAGATCAAGATCTGTGATTtatgcttgaatataactaAATCACAGATCTTGATCTCGCactg
Hairpin ID: TR02015P.1; FWD Oligo: CACCGAATTCCTCTCACACGGATCAAAGCA, RVS Oligo:
GATCCATGGCCCAAAGTAGA
Hairpin ID: TR00704A.1; FWD Oligo: GTCTAGACGACGATGGCATGATGTTTA, RVS Oligo:
ACAATTGATAGCCGGGATCGCTAATTT
Hairpin ID: TR00703A.1; FWD Oligo: GTCTAGAAAAGTTGGCGCTTGCTAAAA, RVS Oligo:
AGAATTCGTTGAACACACGGATTGTGC
Hairpin ID: SH00709.N; FWD Oligo:
ctagcagtTCCGAACATAGTCAAGTTCAAtagttatattcaagcataTTGAACTTGACTATGTTCGGAgcg, RVS
Oligo: aattcgcTCCGAACATAGTCAAGTTCAAtatgcttgaatataactaTTGAACTTGACTATGTTCGGAactg
Hairpin ID: SH01399.N2; FWD Oligo:
ctagcagtCAGGTTGTTCTCTTTACGCAAtagttatattcaagcataTTGCGTAAAGAGAACAACCTGgcg, RVS
Oligo: aattcgcCAGGTTGTTCTCTTTACGCAAtatgcttgaatataactaTTGCGTAAAGAGAACAACCTGactg
Hairpin ID: SH01571.N2; FWD Oligo:
ctagcagtTAGCTCTAGCGACAATGTTTAtagttatattcaagcataTAAACATTGTCGCTAGAGCTAgcg, RVS
Oligo: aattcgcTAGCTCTAGCGACAATGTTTAtatgcttgaatataactaTAAACATTGTCGCTAGAGCTAactg
Hairpin ID: SH01556.N2; FWD Oligo:
ctagcagtTGCGATGTCCGATCTGTTCAAtagttatattcaagcataTTGAACAGATCGGACATCGCAgcg, RVS
Oligo: aattcgcTGCGATGTCCGATCTGTTCAAtatgcttgaatataactaTTGAACAGATCGGACATCGCAactg
Hairpin ID: SH01210.N2; FWD Oligo:
ctagcagtCAGATTCAGATTCATTTCAAAtagttatattcaagcataTTTGAAATGAATCTGAATCTGgcg, RVS Oligo:
aattcgcCAGATTCAGATTCATTTCAAAtatgcttgaatataactaTTTGAAATGAATCTGAATCTGactg
Hairpin ID: TR02660P.1; FWD Oligo: AAGAATTCGCAAATGGAGGTGCTAGAGG, RVS Oligo:
AGTCTAGAGGAATGATTGCACCCTGAGT
Hairpin ID: SH01623.N2; FWD Oligo:
ctagcagtAAGCATATTCTTGTAAATATAtagttatattcaagcataTATATTTACAAGAATATGCTTgcg, RVS Oligo:
aattcgcAAGCATATTCTTGTAAATATAtatgcttgaatataactaTATATTTACAAGAATATGCTTactg
Hairpin ID: SH01430.N2; FWD Oligo:
ctagcagtCAGCAGCGACGTGTATATCTAtagttatattcaagcataTAGATATACACGTCGCTGCTGgcg, RVS
Oligo: aattcgcCAGCAGCGACGTGTATATCTAtatgcttgaatataactaTAGATATACACGTCGCTGCTGactg
Hairpin ID: TR02023P.1; FWD Oligo: CACCGAATTCGCAGACTCCTTGGAGCAAAC, RVS Oligo:
GAATCGGGTCATTCTCCTCA
Hairpin ID: SH01169.N2; FWD Oligo:
ctagcagtACGATGGGATGACACTATCAAtagttatattcaagcataTTGATAGTGTCATCCCATCGTgcg, RVS
Oligo: aattcgcACGATGGGATGACACTATCAAtatgcttgaatataactaTTGATAGTGTCATCCCATCGTactg
Hairpin ID: SH01443.N2; FWD Oligo:
ctagcagtTCGATTGAGTTTGCTGTCGAAtagttatattcaagcataTTCGACAGCAAACTCAATCGAgcg, RVS
Oligo: aattcgcTCGATTGAGTTTGCTGTCGAAtatgcttgaatataactaTTCGACAGCAAACTCAATCGAactg
Hairpin ID: TR02024P.1; FWD Oligo: CACCGAATTCACCACGTTTGAACCAAAAGC, RVS Oligo:
TTCGACAGCAAACTCAATCG
Hairpin ID: TR00031P.1; FWD Oligo: CACCGAATGGCGATGATAGCTGGT, RVS Oligo:
ATTGAGAAGCCCAGTCCCTT
Hairpin ID: TR00031A.1; FWD Oligo: GTCTAGAGAATGGCGATGATAGCTGGT, RVS Oligo:
AGAATTCATTGAGAAGCCCAGTCCCTT
Hairpin ID: TR00032A.1; FWD Oligo: GTCTAGACGGATCTAGCGGAAAGTCAG, RVS Oligo:
AGAATTCCAACGCGACAACAAATTCAA
Hairpin ID: SH00014.O; FWD Oligo:
ctagcagtTGAATGTCCTCGTATAACCAGtagttatattcaagcataCTGGTTATACGAGGACATTCAgcg, RVS
Oligo: aattcgcTGAATGTCCTCGTATAACCAGtatgcttgaatataactaCTGGTTATACGAGGACATTCAactg
Hairpin ID: SH01611.N2; FWD Oligo:
ctagcagtCACCTCCATCTACATCACCAAtagttatattcaagcataTTGGTGATGTAGATGGAGGTGgcg, RVS
Oligo: aattcgcCACCTCCATCTACATCACCAAtatgcttgaatataactaTTGGTGATGTAGATGGAGGTGactg
Hairpin ID: TR04254P.1; FWD Oligo: AAGAATTCGACGAGATCAGAGCTTTGCC, RVS Oligo:
AGTCTAGACATCTTCCTCTTCGTCCTCG
Hairpin ID: SH01592.N2; FWD Oligo:
ctagcagtTTGGTTGTTTGGTATACGAGAtagttatattcaagcataTCTCGTATACCAAACAACCAAgcg, RVS
Oligo: aattcgcTTGGTTGTTTGGTATACGAGAtatgcttgaatataactaTCTCGTATACCAAACAACCAAactg
Hairpin ID: TR02025P.1; FWD Oligo: CACCGAATTCCGAATCGCTCTACACGATCA, RVS Oligo:
AAGGACACTTCTACGGGGCT
Hairpin ID: SH01217.N2; FWD Oligo:
ctagcagtTACAGCTGTTACAGATACAAAtagttatattcaagcataTTTGTATCTGTAACAGCTGTAgcg, RVS Oligo:
aattcgcTACAGCTGTTACAGATACAAAtatgcttgaatataactaTTTGTATCTGTAACAGCTGTAactg
Hairpin ID: TR00031A.2; FWD Oligo: AAGAATTCGAATGGCGATGATAGCTGGT, RVS Oligo:
AGTCTAGAATTGAGAAGCCCAGTCCCTT
Hairpin ID: TR02026P.1; FWD Oligo: CACCGAATTCACAAGCTGACTGGCGAGATT, RVS Oligo:
CTTAATCCCCGAACCCAAAT
Hairpin ID: SH01167.N2; FWD Oligo:
ctagcagtCAAGCTGACAATCTAAAGCTAtagttatattcaagcataTAGCTTTAGATTGTCAGCTTGgcg, RVS
Oligo: aattcgcCAAGCTGACAATCTAAAGCTAtatgcttgaatataactaTAGCTTTAGATTGTCAGCTTGactg
Hairpin ID: TR02459P.1; FWD Oligo: AAGAATTCGACTACGCCTTGAACTTCGC, RVS Oligo:
AGTCTAGATTAGGGTAACCAGGCCACTG
Hairpin ID: SH01621.N2; FWD Oligo:
ctagcagtTTGCAGGGAGATAATATACTAtagttatattcaagcataTAGTATATTATCTCCCTGCAAgcg, RVS Oligo:
aattcgcTTGCAGGGAGATAATATACTAtatgcttgaatataactaTAGTATATTATCTCCCTGCAAactg
Hairpin ID: TR00569A.1; FWD Oligo: GTCTAGACGTAAATTAGGCCGTGGAAA, RVS Oligo:
AGAATTCCATCGACGCCAACATACAAC
Hairpin ID: SH01174.N2; FWD Oligo:
ctagcagtTCGCGTGTACACAGATGTCAAtagttatattcaagcataTTGACATCTGTGTACACGCGAgcg, RVS
Oligo: aattcgcTCGCGTGTACACAGATGTCAAtatgcttgaatataactaTTGACATCTGTGTACACGCGAactg
Hairpin ID: TR02029P.1; FWD Oligo: CACCGAATTCATCTGCCGCTGAGCAATAGT, RVS Oligo:
CCTTAAATGGCTCCGAATCA
Hairpin ID: SH01635.N2; FWD Oligo:
ctagcagtCACGCGCTATGTCTAGGACAAtagttatattcaagcataTTGTCCTAGACATAGCGCGTGgcg, RVS
Oligo: aattcgcCACGCGCTATGTCTAGGACAAtatgcttgaatataactaTTGTCCTAGACATAGCGCGTGactg
Hairpin ID: TR00455P.1; FWD Oligo: GTCTAGAAAAAGATCGCGTAAGGAGCA, RVS Oligo:
AGAATTCAAGAGAGCACGTAGCAGGGA
Hairpin ID: SH01402.N2; FWD Oligo:
ctagcagtCTGGGTGAGATTAGAACGAAAtagttatattcaagcataTTTCGTTCTAATCTCACCCAGgcg, RVS
Oligo: aattcgcCTGGGTGAGATTAGAACGAAAtatgcttgaatataactaTTTCGTTCTAATCTCACCCAGactg
Hairpin ID: SH00589.N; FWD Oligo:
ctagcagtCTGCTGGACGACGATGACCAAtagttatattcaagcataTTGGTCATCGTCGTCCAGCAGgcg, RVS
Oligo: aattcgcCTGCTGGACGACGATGACCAAtatgcttgaatataactaTTGGTCATCGTCGTCCAGCAGactg
Hairpin ID: SH01587.N2; FWD Oligo:
ctagcagtCAGATTTGGTATGATATGCTAtagttatattcaagcataTAGCATATCATACCAAATCTGgcg, RVS Oligo:
aattcgcCAGATTTGGTATGATATGCTAtatgcttgaatataactaTAGCATATCATACCAAATCTGactg
Hairpin ID: SH00367.N; FWD Oligo:
ctagcagtCAGCAGCGACATCAATCACAAtagttatattcaagcataTTGTGATTGATGTCGCTGCTGgcg, RVS
Oligo: aattcgcCAGCAGCGACATCAATCACAAtatgcttgaatataactaTTGTGATTGATGTCGCTGCTGactg
Hairpin ID: SH01547.N2; FWD Oligo:
ctagcagtCAGCTGTTAGCTAAATCGATAtagttatattcaagcataTATCGATTTAGCTAACAGCTGgcg, RVS
Oligo: aattcgcCAGCTGTTAGCTAAATCGATAtatgcttgaatataactaTATCGATTTAGCTAACAGCTGactg
Hairpin ID: TR01886P.1; FWD Oligo: CACCGAATTCGCAAAGTCCGCTTATTCTCG, RVS Oligo:
AATTCTTTGGCTCCCCTCAT
Hairpin ID: SH01615.N2; FWD Oligo:
ctagcagtTCGGACAATTACGACATCAAAtagttatattcaagcataTTTGATGTCGTAATTGTCCGAgcg, RVS
Oligo: aattcgcTCGGACAATTACGACATCAAAtatgcttgaatataactaTTTGATGTCGTAATTGTCCGAactg
Hairpin ID: TR00604A.1; FWD Oligo: GTCTAGAACAGGCGCAATCTCTGATCT, RVS Oligo:
AGAATTCTAGTTGTGTGCCTGGAGCAG
Hairpin ID: TR00605A.1; FWD Oligo: GTCTAGAGGGTTATTCCAATGACCGTG, RVS Oligo:
AGAATTCACTCTGATTGAGGCGCAACT
Hairpin ID: SH00039.O; FWD Oligo:
ctagcagtACATCGTAGACACACAGCTTGtagttatattcaagcataCAAGCTGTGTGTCTACGATGTgcg, RVS
Oligo: aattcgcACATCGTAGACACACAGCTTGtatgcttgaatataactaCAAGCTGTGTGTCTACGATGTactg
Hairpin ID: TR02064P.1; FWD Oligo: CCAAAAGACTGAAGCCGAAG, RVS Oligo:
AAGTGAATTCTCCTGTTTGTTGCTGTGCTC
Hairpin ID: SH01238.N2; FWD Oligo:
ctagcagtTCGGACGAGGATATACTGAAAtagttatattcaagcataTTTCAGTATATCCTCGTCCGAgcg, RVS
Oligo: aattcgcTCGGACGAGGATATACTGAAAtatgcttgaatataactaTTTCAGTATATCCTCGTCCGAactg
Hairpin ID: TR02038P.1; FWD Oligo: CACCGAATTCCATTGCCATGGGAGTACTGA, RVS Oligo:
CTTGGACTCACACAAGAGCG
Hairpin ID: TR02037P.1; FWD Oligo: CACCGAATTCCTCTTTGAGGGTCAATCCCA, RVS Oligo:
ATTTGTACTCGCCGTTGTCC
Hairpin ID: SH01572.N2; FWD Oligo:
ctagcagtCTGGAAGCAACCAGACAAGAAtagttatattcaagcataTTCTTGTCTGGTTGCTTCCAGgcg, RVS
Oligo: aattcgcCTGGAAGCAACCAGACAAGAAtatgcttgaatataactaTTCTTGTCTGGTTGCTTCCAGactg
Hairpin ID: SH01411.N2; FWD Oligo:
ctagcagtCTGCTCGAGCTCAGAGTTCTAtagttatattcaagcataTAGAACTCTGAGCTCGAGCAGgcg, RVS
Oligo: aattcgcCTGCTCGAGCTCAGAGTTCTAtatgcttgaatataactaTAGAACTCTGAGCTCGAGCAGactg
Hairpin ID: TR00693A.1; FWD Oligo: GTCTAGACAGATCCTTTAGCAGGCGAC, RVS Oligo:
AGAATTCCAATTCCTTGGCAAACACCT
Hairpin ID: TR00326A.1; FWD Oligo: GTCTAGAGGAACAGCCGTTCTCAATGT, RVS Oligo:
AGAATTCTTGCTACCACCTCCGTAACC
Hairpin ID: SH01442.N2; FWD Oligo:
ctagcagtTACGATGATCGTAAAGTTCAAtagttatattcaagcataTTGAACTTTACGATCATCGTAgcg, RVS Oligo:
aattcgcTACGATGATCGTAAAGTTCAAtatgcttgaatataactaTTGAACTTTACGATCATCGTAactg
Hairpin ID: TR02039P.1; FWD Oligo: CACCGAATTCATACAGTGAAACCGGGCAAG, RVS Oligo:
GCGGATGGTGGACAACTACT
Hairpin ID: TR02039P.1hm; FWD Oligo: CACCGAATTCATACAGTGAAACCGGGCAAG, RVS Oligo:
GCGGATGGTGGACAACTACT
Hairpin ID: TR00717A.1; FWD Oligo: GACTAGTTCGATATAAACTCGTGCCCC, RVS Oligo:
AGAATTCTCATTGCTGGCTAACTGTGC
Hairpin ID: TR00460A.1; FWD Oligo: GTCTAGAAGTACGCTTCACGCCAACTT, RVS Oligo:
AGAATTCCCTTGTCAGCTTCCTCGAAC
Hairpin ID: SH01253.N2; FWD Oligo:
ctagcagtATCGATGACGGTCTTGTTAAAtagttatattcaagcataTTTAACAAGACCGTCATCGATgcg, RVS
Oligo: aattcgcATCGATGACGGTCTTGTTAAAtatgcttgaatataactaTTTAACAAGACCGTCATCGATactg
Hairpin ID: SH01409.N2; FWD Oligo:
ctagcagtAAGCACCAAAGTAGACTCTTAtagttatattcaagcataTAAGAGTCTACTTTGGTGCTTgcg, RVS
Oligo: aattcgcAAGCACCAAAGTAGACTCTTAtatgcttgaatataactaTAAGAGTCTACTTTGGTGCTTactg
Hairpin ID: TR02655P.1; FWD Oligo: AAGAATTCGGAGCTGCTATTCAACGAGG, RVS Oligo:
AGTCTAGACATCTCGATGACCATGATGC
Hairpin ID: SH01182.N2; FWD Oligo:
ctagcagtACGCTAAGAGCTAATGTTAAAtagttatattcaagcataTTTAACATTAGCTCTTAGCGTgcg, RVS Oligo:
aattcgcACGCTAAGAGCTAATGTTAAAtatgcttgaatataactaTTTAACATTAGCTCTTAGCGTactg
Hairpin ID: TR02042P.1; FWD Oligo: CACCGAATTCTCGCATACTGCTCACCTCAC, RVS Oligo:
AATGTAGCTGTTGCCGGTTC
Hairpin ID: TR01926P.1; FWD Oligo: CACCGAATTCCAGCACTGAGTTGCAATGGT, RVS Oligo:
GAAGTAGTTGGTGGCCGTGT
Hairpin ID: SH01222.N2; FWD Oligo:
ctagcagtTAGGTATATTATTCAAAGCTAtagttatattcaagcataTAGCTTTGAATAATATACCTAgcg, RVS Oligo:
aattcgcTAGGTATATTATTCAAAGCTAtatgcttgaatataactaTAGCTTTGAATAATATACCTAactg
Hairpin ID: TR00060A.1; FWD Oligo: GTCTAGAGATCTGGCTACGAGCAGGAC, RVS Oligo:
AGAATTCCTCCGAAAGCCTTCACAAAG
Hairpin ID: TR00061A.1; FWD Oligo: GTCTAGATGGGAGATCCCAATCTGAAG, RVS Oligo:
AGAATTCACGCCGTTGATAAACCACTC
Hairpin ID: SH01579.N2; FWD Oligo:
ctagcagtCAGGATGGACATGATAAACAAtagttatattcaagcataTTGTTTATCATGTCCATCCTGgcg, RVS
Oligo: aattcgcCAGGATGGACATGATAAACAAtatgcttgaatataactaTTGTTTATCATGTCCATCCTGactg
Hairpin ID: TR00184P.1; FWD Oligo: AAGAATTCAACTTCGATGCGGAGTTCAC, RVS Oligo:
AGTCTAGATTCGACAATTGGCACTGGTA
Hairpin ID: SH01423.N2; FWD Oligo:
ctagcagtCACGTTAGTTGTACATAAGAAtagttatattcaagcataTTCTTATGTACAACTAACGTGgcg, RVS Oligo:
aattcgcCACGTTAGTTGTACATAAGAAtatgcttgaatataactaTTCTTATGTACAACTAACGTGactg
Hairpin ID: SH00965.N; FWD Oligo:
ctagcagtTAGCTAGTAAATTACTTCAAAtagttatattcaagcataTTTGAAGTAATTTACTAGCTAgcg, RVS Oligo:
aattcgcTAGCTAGTAAATTACTTCAAAtatgcttgaatataactaTTTGAAGTAATTTACTAGCTAactg
Hairpin ID: SH01789.N; FWD Oligo:
ctagcagtCACGAGCAGTGTTACCTCAATtagttatattcaagcataATTGAGGTAACACTGCTCGTGgcg, RVS
Oligo: aattcgcCACGAGCAGTGTTACCTCAATtatgcttgaatataactaATTGAGGTAACACTGCTCGTGactg
Hairpin ID: TR02048P.1; FWD Oligo: GAACGCGTCCAACTGTTTTT, RVS Oligo:
AAGTGAATTCATGTACTCCAAGCGTCCGAT
Hairpin ID: SH01172.N2; FWD Oligo:
ctagcagtACCGAAATTATTGCAAATCAAtagttatattcaagcataTTGATTTGCAATAATTTCGGTgcg, RVS Oligo:
aattcgcACCGAAATTATTGCAAATCAAtatgcttgaatataactaTTGATTTGCAATAATTTCGGTactg
Hairpin ID: TR00290A.1; FWD Oligo: GTCTAGAAGAAACGGAGGACAAGAGCA, RVS Oligo:
AGAATTCTCATGATCGGTTCTGCATGT
Hairpin ID: TR00290P.1; FWD Oligo: AAGAATTCAGAAACGGAGGACAAGAGCA, RVS Oligo:
AGTCTAGATCATGATCGGTTCTGCATGT
Hairpin ID: SH01163.N2; FWD Oligo:
ctagcagtCTCGATTGTGGTGCTGTGCAAtagttatattcaagcataTTGCACAGCACCACAATCGAGgcg, RVS
Oligo: aattcgcCTCGATTGTGGTGCTGTGCAAtatgcttgaatataactaTTGCACAGCACCACAATCGAGactg
Hairpin ID: TR00443P.1; FWD Oligo: GTCTAGAGAGGAGTTCACGTCGGAGAA, RVS Oligo:
AGAATTCCAAATGCTTGCTTTTCCACA
Hairpin ID: SH01584.N2; FWD Oligo:
ctagcagtTAGATGAGAAGTGTATGTCTAtagttatattcaagcataTAGACATACACTTCTCATCTAgcg, RVS Oligo:
aattcgcTAGATGAGAAGTGTATGTCTAtatgcttgaatataactaTAGACATACACTTCTCATCTAactg
Hairpin ID: SH01208.N2; FWD Oligo:
ctagcagtCAGAATCACAATAACAACCAAtagttatattcaagcataTTGGTTGTTATTGTGATTCTGgcg, RVS Oligo:
aattcgcCAGAATCACAATAACAACCAAtatgcttgaatataactaTTGGTTGTTATTGTGATTCTGactg
Hairpin ID: SH00848.N; FWD Oligo:
ctagcagtCAGATTGATTCTTCTAAAGAAtagttatattcaagcataTTCTTTAGAAGAATCAATCTGgcg, RVS Oligo:
aattcgcCAGATTGATTCTTCTAAAGAAtatgcttgaatataactaTTCTTTAGAAGAATCAATCTGactg
Hairpin ID: SH01161.N2; FWD Oligo:
ctagcagtTACGAATAGACGGCTACTTTAtagttatattcaagcataTAAAGTAGCCGTCTATTCGTAgcg, RVS
Oligo: aattcgcTACGAATAGACGGCTACTTTAtatgcttgaatataactaTAAAGTAGCCGTCTATTCGTAactg
Hairpin ID: SH01214.N2; FWD Oligo:
ctagcagtTACGATGTTCAACAATTGCTAtagttatattcaagcataTAGCAATTGTTGAACATCGTAgcg, RVS Oligo:
aattcgcTACGATGTTCAACAATTGCTAtatgcttgaatataactaTAGCAATTGTTGAACATCGTAactg
Hairpin ID: SH00558.N; FWD Oligo:
ctagcagtACCACCCGATGTACTAGTCAAtagttatattcaagcataTTGACTAGTACATCGGGTGGTgcg, RVS
Oligo: aattcgcACCACCCGATGTACTAGTCAAtatgcttgaatataactaTTGACTAGTACATCGGGTGGTactg
Hairpin ID: SH01230.N2; FWD Oligo:
ctagcagtCAGGATCAAGGATAGATCAAAtagttatattcaagcataTTTGATCTATCCTTGATCCTGgcg, RVS
Oligo: aattcgcCAGGATCAAGGATAGATCAAAtatgcttgaatataactaTTTGATCTATCCTTGATCCTGactg
Hairpin ID: SH00210.N; FWD Oligo:
ctagcagtCGAGTTCACAATGTACTTAAAtagttatattcaagcataTTTAAGTACATTGTGAACTCGgcg, RVS Oligo:
aattcgcCGAGTTCACAATGTACTTAAAtatgcttgaatataactaTTTAAGTACATTGTGAACTCGactg
Hairpin ID: SH01625.N2; FWD Oligo:
ctagcagtCACAATAACTCTACTATTGAAtagttatattcaagcataTTCAATAGTAGAGTTATTGTGgcg, RVS Oligo:
aattcgcCACAATAACTCTACTATTGAAtatgcttgaatataactaTTCAATAGTAGAGTTATTGTGactg
Hairpin ID: TR00684A.1; FWD Oligo: GTCTAGAAGCTCTCAATACAGCCCAGC, RVS Oligo:
AGAATTCTATAGCGCCAGTTGCTGTTG
Hairpin ID: TR00685A.1; FWD Oligo: GTCTAGACCAATATGCCAAAACCAAGC, RVS Oligo:
AGAATTCAGTTTGGATTCATTTCGCGT
Hairpin ID: SH01202.N2; FWD Oligo:
ctagcagtTCCAAACTACACGGAATTCAAtagttatattcaagcataTTGAATTCCGTGTAGTTTGGAgcg, RVS
Oligo: aattcgcTCCAAACTACACGGAATTCAAtatgcttgaatataactaTTGAATTCCGTGTAGTTTGGAactg
Hairpin ID: TR00694A.1; FWD Oligo: GTCTAGATTTTGCACGAGGATCTTTCC, RVS Oligo:
AGAATTCGCAGCATGTTCTCCAGCATA
Hairpin ID: TR00349A.1; FWD Oligo: GTCTAGACTCAAATCCTGCAGCAACAA, RVS Oligo:
AGAATTCTATTGAAGCGGACAGCAGTG
Hairpin ID: SH01610.N2; FWD Oligo:
ctagcagtCTGGGTCAGATTGCAAGGAAAtagttatattcaagcataTTTCCTTGCAATCTGACCCAGgcg, RVS
Oligo: aattcgcCTGGGTCAGATTGCAAGGAAAtatgcttgaatataactaTTTCCTTGCAATCTGACCCAGactg
Hairpin ID: SH00398.N; FWD Oligo:
ctagcagtCTGCGGCGAGTTCACATTCAAtagttatattcaagcataTTGAATGTGAACTCGCCGCAGgcg, RVS
Oligo: aattcgcCTGCGGCGAGTTCACATTCAAtatgcttgaatataactaTTGAATGTGAACTCGCCGCAGactg
Hairpin ID: SH01582.N2; FWD Oligo:
ctagcagtATGGTCAAGTGTATATAGTAAtagttatattcaagcataTTACTATATACACTTGACCATgcg, RVS Oligo:
aattcgcATGGTCAAGTGTATATAGTAAtatgcttgaatataactaTTACTATATACACTTGACCATactg
Hairpin ID: SH01565.N2; FWD Oligo:
ctagcagtATGGTCATATTCAATAATTAAtagttatattcaagcataTTAATTATTGAATATGACCATgcg, RVS Oligo:
aattcgcATGGTCATATTCAATAATTAAtatgcttgaatataactaTTAATTATTGAATATGACCATactg
Hairpin ID: SH01191.N2; FWD Oligo:
ctagcagtCCGAATGTCTGTCCAACTTTAtagttatattcaagcataTAAAGTTGGACAGACATTCGGgcg, RVS
Oligo: aattcgcCCGAATGTCTGTCCAACTTTAtatgcttgaatataactaTAAAGTTGGACAGACATTCGGactg
Hairpin ID: TR00244A.1; FWD Oligo: GTCTAGAAACAGATAGCACCCGTTTGG, RVS Oligo:
AGAATTCTTATCATCTCGCCCTCCTTG
Hairpin ID: SH01580.N2; FWD Oligo:
ctagcagtCAGGATAATAACGATAACAAAtagttatattcaagcataTTTGTTATCGTTATTATCCTGgcg, RVS Oligo:
aattcgcCAGGATAATAACGATAACAAAtatgcttgaatataactaTTTGTTATCGTTATTATCCTGactg
Hairpin ID: SH01434.N2; FWD Oligo:
ctagcagtAAGACGATAGATTCTGGATAAtagttatattcaagcataTTATCCAGAATCTATCGTCTTgcg, RVS Oligo:
aattcgcAAGACGATAGATTCTGGATAAtatgcttgaatataactaTTATCCAGAATCTATCGTCTTactg
Hairpin ID: TR02069P.1; FWD Oligo: GCGTCGCGTTATTTTGTTTT, RVS Oligo:
AAGTGAATTCAACTGAGAGTTGCAGTGGCA
Hairpin ID: SH01594.N2; FWD Oligo:
ctagcagtCACGCAGACAAGCGAAACAAAtagttatattcaagcataTTTGTTTCGCTTGTCTGCGTGgcg, RVS
Oligo: aattcgcCACGCAGACAAGCGAAACAAAtatgcttgaatataactaTTTGTTTCGCTTGTCTGCGTGactg
Hairpin ID: SH00636.N; FWD Oligo:
ctagcagtTCAGTTGTGTTGACAAGTGTAtagttatattcaagcataTACACTTGTCAACACAACTGAgcg, RVS
Oligo: aattcgcTCAGTTGTGTTGACAAGTGTAtatgcttgaatataactaTACACTTGTCAACACAACTGAactg
Hairpin ID: TR01901P.1; FWD Oligo: CACCGAATTCCCTAGCAGCACCATACCCAT, RVS Oligo:
TCATCCTTAGCGAGCCAGTT
Hairpin ID: SH00565.N; FWD Oligo:
ctagcagtCTGCTACTAGACGACGAACAAtagttatattcaagcataTTGTTCGTCGTCTAGTAGCAGgcg, RVS
Oligo: aattcgcCTGCTACTAGACGACGAACAAtatgcttgaatataactaTTGTTCGTCGTCTAGTAGCAGactg
Hairpin ID: SH01201.N2; FWD Oligo:
ctagcagtTACGCTGTTTCGCAAGATCAAtagttatattcaagcataTTGATCTTGCGAAACAGCGTAgcg, RVS
Oligo: aattcgcTACGCTGTTTCGCAAGATCAAtatgcttgaatataactaTTGATCTTGCGAAACAGCGTAactg
Hairpin ID: TR00206A.1; FWD Oligo: GTCTAGATGCTCTTTAAGCGCCAGATT, RVS Oligo:
AGAATTCCACACCCAGGCTCCATAGAT
Hairpin ID: SH01200.N2; FWD Oligo:
ctagcagtCCGCTTCACAATTCAAACGAAtagttatattcaagcataTTCGTTTGAATTGTGAAGCGGgcg, RVS
Oligo: aattcgcCCGCTTCACAATTCAAACGAAtatgcttgaatataactaTTCGTTTGAATTGTGAAGCGGactg
Hairpin ID: SH01176.N2; FWD Oligo:
ctagcagtACGATAAATACTACTATACTAtagttatattcaagcataTAGTATAGTAGTATTTATCGTgcg, RVS Oligo:
aattcgcACGATAAATACTACTATACTAtatgcttgaatataactaTAGTATAGTAGTATTTATCGTactg
Hairpin ID: TR02084P.1; FWD Oligo: CACCGAATTCAGGTGATCAACCCGAACAAG, RVS Oligo:
GTGACAATGCTGACACCCAC
Hairpin ID: SH01422.N2; FWD Oligo:
ctagcagtTACCAGCGATTTCAAGCTAAAtagttatattcaagcataTTTAGCTTGAAATCGCTGGTAgcg, RVS
Oligo: aattcgcTACCAGCGATTTCAAGCTAAAtatgcttgaatataactaTTTAGCTTGAAATCGCTGGTAactg
Hairpin ID: TR04520P.1; FWD Oligo: AAGAATTCATGGAGTCCAATGGTGAAGC, RVS Oligo:
AGTCTAGACGCCGTATCCAGATAGTGGT
Hairpin ID: TR02318P.1; FWD Oligo: CACCGAATTCAATCCCTTCCTGGCAATTCT, RVS Oligo:
TTGGGGAACTCAAAGACACC
Hairpin ID: SH00095.N; FWD Oligo:
ctagcagtGCGACAAGTTCGCCGAGAACGtagttatattcaagcataCGTTCTCGGCGAACTTGTCGCgcg, RVS
Oligo: aattcgcGCGACAAGTTCGCCGAGAACGtatgcttgaatataactaCGTTCTCGGCGAACTTGTCGCactg
Hairpin ID: SH00096.N; FWD Oligo:
ctagcagtAGGTCAACGAGATGATCATCGtagttatattcaagcataCGATGATCATCTCGTTGACCTgcg, RVS
Oligo: aattcgcAGGTCAACGAGATGATCATCGtatgcttgaatataactaCGATGATCATCTCGTTGACCTactg
Hairpin ID: SH01170.N2; FWD Oligo:
ctagcagtAAGCACAAACCACGACGTTAAtagttatattcaagcataTTAACGTCGTGGTTTGTGCTTgcg, RVS
Oligo: aattcgcAAGCACAAACCACGACGTTAAtatgcttgaatataactaTTAACGTCGTGGTTTGTGCTTactg
Hairpin ID: TR04608P.1; FWD Oligo: AAGAATTCGAGTAATCTTACGCCGCGAG, RVS Oligo:
AGTCTAGACACCACCTCGTCGTATTCCT
Hairpin ID: SH01251.N2; FWD Oligo:
ctagcagtCACGGTGCAATTGGTGGTCAAtagttatattcaagcataTTGACCACCAATTGCACCGTGgcg, RVS
Oligo: aattcgcCACGGTGCAATTGGTGGTCAAtatgcttgaatataactaTTGACCACCAATTGCACCGTGactg
Hairpin ID: SH01179.N2; FWD Oligo:
ctagcagtAAGCATATCACAAGCAGACAAtagttatattcaagcataTTGTCTGCTTGTGATATGCTTgcg, RVS
Oligo: aattcgcAAGCATATCACAAGCAGACAAtatgcttgaatataactaTTGTCTGCTTGTGATATGCTTactg
Hairpin ID: TR00579A.1; FWD Oligo: GTCTAGAGTAAGATCCGATTGCCCAGA, RVS Oligo:
AGAATTCTATTTTCTTGACCGCCCGTA
Hairpin ID: SH01428.N2; FWD Oligo:
ctagcagtAAGATCGATGTGGCTACAATAtagttatattcaagcataTATTGTAGCCACATCGATCTTgcg, RVS
Oligo: aattcgcAAGATCGATGTGGCTACAATAtatgcttgaatataactaTATTGTAGCCACATCGATCTTactg
Hairpin ID: SH01237.N2; FWD Oligo:
ctagcagtCGCGACTACGACAAGCTTATAtagttatattcaagcataTATAAGCTTGTCGTAGTCGCGgcg, RVS
Oligo: aattcgcCGCGACTACGACAAGCTTATAtatgcttgaatataactaTATAAGCTTGTCGTAGTCGCGactg
Hairpin ID: SH00962.N; FWD Oligo:
ctagcagtAAGGACGTCGACTATGTGAAAtagttatattcaagcataTTTCACATAGTCGACGTCCTTgcg, RVS
Oligo: aattcgcAAGGACGTCGACTATGTGAAAtatgcttgaatataactaTTTCACATAGTCGACGTCCTTactg
Hairpin ID: TR00070A.1; FWD Oligo: GTCTAGAAGCATCAAAATTCGAACCCA, RVS Oligo:
AGAATTCTCCATCAAACGTGGTGGTTA
Hairpin ID: TR00071A.1; FWD Oligo: GTCTAGAGCGGTGTTTCAAGTACAGCA, RVS Oligo:
AGAATTCCGGCATTCGTTGTACATTTG
Hairpin ID: SH01173.N2; FWD Oligo:
ctagcagtTGGCTTCAAGAAGACCGACAAtagttatattcaagcataTTGTCGGTCTTCTTGAAGCCAgcg, RVS
Oligo: aattcgcTGGCTTCAAGAAGACCGACAAtatgcttgaatataactaTTGTCGGTCTTCTTGAAGCCAactg
Hairpin ID: TR02311P.1; FWD Oligo: CACCGAATTCAACTGGAGGAGGGTTATGCC, RVS Oligo:
TCCATCTCCTTGTACTGGGC
Hairpin ID: TR04521P.1; FWD Oligo: AAGAATTCCTGAATCGCATGGAGCAGTA, RVS Oligo:
AGTCTAGATTTATGGCGGAGATTGAAGG
Hairpin ID: SH01577.N2; FWD Oligo:
ctagcagtTACGACCGACTGTACATGCAAtagttatattcaagcataTTGCATGTACAGTCGGTCGTAgcg, RVS
Oligo: aattcgcTACGACCGACTGTACATGCAAtatgcttgaatataactaTTGCATGTACAGTCGGTCGTAactg
Hairpin ID: SH01223.N2; FWD Oligo:
ctagcagtTCGAGTGCTTGTGCTGTTGAAtagttatattcaagcataTTCAACAGCACAAGCACTCGAgcg, RVS
Oligo: aattcgcTCGAGTGCTTGTGCTGTTGAAtatgcttgaatataactaTTCAACAGCACAAGCACTCGAactg
Hairpin ID: SH01633.N2b; FWD Oligo:
ctagcagtCTGCAAGATTACATATGTTAAtagttatattcaagcataTTAACATATGTAATCTTGCAGgcg, RVS Oligo:
aattcgcCTGCAAGATTACATATGTTAAtatgcttgaatataactaTTAACATATGTAATCTTGCAGactg
Hairpin ID: TR02108P.1; FWD Oligo: CACCGAATTCCGGTGTGTGTTCAATCGTTC, RVS Oligo:
CACACAAACGTTTCGCCTAA
Hairpin ID: SH01550.N2; FWD Oligo:
ctagcagtAACGAATGTTGTGTTAGACTAtagttatattcaagcataTAGTCTAACACAACATTCGTTgcg, RVS Oligo:
aattcgcAACGAATGTTGTGTTAGACTAtatgcttgaatataactaTAGTCTAACACAACATTCGTTactg
Hairpin ID: SH00222.N; FWD Oligo:
ctagcagtCAGGCACAGTCTCAAGGTAAAtagttatattcaagcataTTTACCTTGAGACTGTGCCTGgcg, RVS
Oligo: aattcgcCAGGCACAGTCTCAAGGTAAAtatgcttgaatataactaTTTACCTTGAGACTGTGCCTGactg
Hairpin ID: SH01622.N2; FWD Oligo:
ctagcagtAAGGCCAGAATCGATATGATAtagttatattcaagcataTATCATATCGATTCTGGCCTTgcg, RVS
Oligo: aattcgcAAGGCCAGAATCGATATGATAtatgcttgaatataactaTATCATATCGATTCTGGCCTTactg
Hairpin ID: SH01427.N2; FWD Oligo:
ctagcagtCACAGACTTGTTCTACAACAAtagttatattcaagcataTTGTTGTAGAACAAGTCTGTGgcg, RVS
Oligo: aattcgcCACAGACTTGTTCTACAACAAtatgcttgaatataactaTTGTTGTAGAACAAGTCTGTGactg
Hairpin ID: TR00562A.1; FWD Oligo: GTCTAGAGCCGAGATCCAGATAGCAAC, RVS Oligo:
AGAATTCAAATCCGTGTCCGTCAGTCT
Hairpin ID: TR02073P.1; FWD Oligo: CACCGAATTCACAACATCAGTGACCATCGC, RVS Oligo:
ACAGTTGAGGTGGTCTTCGG
Hairpin ID: SH01227.N2; FWD Oligo:
ctagcagtAAGGATAACAAGATTATATTAtagttatattcaagcataTAATATAATCTTGTTATCCTTgcg, RVS Oligo:
aattcgcAAGGATAACAAGATTATATTAtatgcttgaatataactaTAATATAATCTTGTTATCCTTactg
Hairpin ID: TR02116P.1; FWD Oligo: CACCGAATTCCAGGATCGCGTGGATATCTT, RVS Oligo:
ACGTCTTAGAGCTCGTTCCG
Hairpin ID: SH00606.N; FWD Oligo:
ctagcagtCCGGTGTTCACTCAGAAGATAtagttatattcaagcataTATCTTCTGAGTGAACACCGGgcg, RVS
Oligo: aattcgcCCGGTGTTCACTCAGAAGATAtatgcttgaatataactaTATCTTCTGAGTGAACACCGGactg
Hairpin ID: TR00571A.1; FWD Oligo: GTCTAGAGGAAAATCACTGGATGCGAT, RVS Oligo:
AGAATTCTGCGTGAACTCCTAGCATTG
Hairpin ID: SH01248.N2; FWD Oligo:
ctagcagtCACGGAGATCATCAAGAACAAtagttatattcaagcataTTGTTCTTGATGATCTCCGTGgcg, RVS
Oligo: aattcgcCACGGAGATCATCAAGAACAAtatgcttgaatataactaTTGTTCTTGATGATCTCCGTGactg
Hairpin ID: SH01634.N2; FWD Oligo:
ctagcagtCAGCTTCATGAAGGTGTACAAtagttatattcaagcataTTGTACACCTTCATGAAGCTGgcg, RVS
Oligo: aattcgcCAGCTTCATGAAGGTGTACAAtatgcttgaatataactaTTGTACACCTTCATGAAGCTGactg
Hairpin ID: TR00648A.1; FWD Oligo: GTCTAGAACGCCAAGGTTATGAACAGC, RVS Oligo:
AGAATTCCTACAGGGATGAGCGAGGAG
Hairpin ID: TR00649A.1; FWD Oligo: GTCTAGATTTCGCATACAGGAAAAGCC, RVS Oligo:
AGAATTCGCCGCCCATTAGTTTATTGA
Hairpin ID: SH01419.N2; FWD Oligo:
ctagcagtCAGCAGACAAGCGATTCTCTAtagttatattcaagcataTAGAGAATCGCTTGTCTGCTGgcg, RVS
Oligo: aattcgcCAGCAGACAAGCGATTCTCTAtatgcttgaatataactaTAGAGAATCGCTTGTCTGCTGactg
Hairpin ID: TR02681P.1; FWD Oligo: AAGAATTCCAACAAGGCACTGATGCTGT, RVS Oligo:
AGTCTAGAGAGAAGGCTGCAAAGGAGC
Hairpin ID: TR02630P.1; FWD Oligo: AAGAATTCAGAACCCGCACAAATTCAAC, RVS Oligo:
AGTCTAGACTGGTTCTTGTGGGTCACCT
Hairpin ID: SH01178.N2; FWD Oligo:
ctagcagtCAGCAACAGACTTCCAATCAAtagttatattcaagcataTTGATTGGAAGTCTGTTGCTGgcg, RVS
Oligo: aattcgcCAGCAACAGACTTCCAATCAAtatgcttgaatataactaTTGATTGGAAGTCTGTTGCTGactg
Hairpin ID: TR00533A.1; FWD Oligo: GTCTAGAGCTACGAAACCGTGATGGAT, RVS Oligo:
AGAATTCTGTCCCCTATTCTCTGCGTC
Hairpin ID: TR00533P.1; FWD Oligo: GTCTAGAGCTACGAAACCGTGATGGAT, RVS Oligo:
AGAATTCTGTCCCCTATTCTCTGCGTC
Hairpin ID: SH01405.N2; FWD Oligo:
ctagcagtCAAGGACAGCGAGGAAATCTAtagttatattcaagcataTAGATTTCCTCGCTGTCCTTGgcg, RVS
Oligo: aattcgcCAAGGACAGCGAGGAAATCTAtatgcttgaatataactaTAGATTTCCTCGCTGTCCTTGactg
Hairpin ID: SH01637.N2; FWD Oligo:
ctagcagtTCGGATATTTCCCGACTTCAAtagttatattcaagcataTTGAAGTCGGGAAATATCCGAgcg, RVS
Oligo: aattcgcTCGGATATTTCCCGACTTCAAtatgcttgaatataactaTTGAAGTCGGGAAATATCCGAactg
Hairpin ID: SH01192.N2; FWD Oligo:
ctagcagtCACGATGAGCAAGGACATTTAtagttatattcaagcataTAAATGTCCTTGCTCATCGTGgcg, RVS
Oligo: aattcgcCACGATGAGCAAGGACATTTAtatgcttgaatataactaTAAATGTCCTTGCTCATCGTGactg
Hairpin ID: SH01444.N2; FWD Oligo:
ctagcagtCAGAGTCGACGTCATGTGATAtagttatattcaagcataTATCACATGACGTCGACTCTGgcg, RVS
Oligo: aattcgcCAGAGTCGACGTCATGTGATAtatgcttgaatataactaTATCACATGACGTCGACTCTGactg
Hairpin ID: TR02071P.1; FWD Oligo: GGCGCAAAACCAATTACACT, RVS Oligo:
AAGTGAATTCGTTGGGTGGACCTCAGTTGT
Hairpin ID: TR00782P.1; FWD Oligo: AAGAATTCTAAACCCTCGGAGGACATTG, RVS Oligo:
AGTCTAGAGTAGCAGCGCTTATCGATCC
Hairpin ID: SH01614.N2; FWD Oligo:
ctagcagtCACGAGATATCAGATGATGAAtagttatattcaagcataTTCATCATCTGATATCTCGTGgcg, RVS
Oligo: aattcgcCACGAGATATCAGATGATGAAtatgcttgaatataactaTTCATCATCTGATATCTCGTGactg
Hairpin ID: SH01231.N2; FWD Oligo:
ctagcagtACGAAAGTATTTCATAATCTAtagttatattcaagcataTAGATTATGAAATACTTTCGTgcg, RVS Oligo:
aattcgcACGAAAGTATTTCATAATCTAtatgcttgaatataactaTAGATTATGAAATACTTTCGTactg
Hairpin ID: TR00202A.1; FWD Oligo: GTCTAGAGCTACTTCGTGCTCCACTCC, RVS Oligo:
AGAATTCTTTCTTAACGCCGCTGCTAT
Hairpin ID: SH00075.N; FWD Oligo:
ctagcagtATCGGACTTCCTGCTCAACAAtagttatattcaagcataTTGTTGAGCAGGAAGTCCGATgcg, RVS
Oligo: aattcgcATCGGACTTCCTGCTCAACAAtatgcttgaatataactaTTGTTGAGCAGGAAGTCCGATactg
Hairpin ID: SH01239.N2; FWD Oligo:
ctagcagtCAAGTTATATATAATGTTAAAtagttatattcaagcataTTTAACATTATATATAACTTGgcg, RVS Oligo:
aattcgcCAAGTTATATATAATGTTAAAtatgcttgaatataactaTTTAACATTATATATAACTTGactg
Hairpin ID: SH01426.N2; FWD Oligo:
ctagcagtTAGCAGCTATATAGAAATAAAtagttatattcaagcataTTTATTTCTATATAGCTGCTAgcg, RVS Oligo:
aattcgcTAGCAGCTATATAGAAATAAAtatgcttgaatataactaTTTATTTCTATATAGCTGCTAactg
Hairpin ID: SH01630.N2b; FWD Oligo:
ctagcagtAAGAGTCTTAAAGAACTTCAAtagttatattcaagcataTTGAAGTTCTTTAAGACTCTTgcg, RVS Oligo:
aattcgcAAGAGTCTTAAAGAACTTCAAtatgcttgaatataactaTTGAAGTTCTTTAAGACTCTTactg
Hairpin ID: TR01937P.1; FWD Oligo: CACCGAATTCAACGTTGCATTGTGTACCGA, RVS Oligo:
TGCCAATCAATTCCACAGAA
Hairpin ID: SH01421.N2; FWD Oligo:
ctagcagtATGGACCAAGTAGAAGATATAtagttatattcaagcataTATATCTTCTACTTGGTCCATgcg, RVS Oligo:
aattcgcATGGACCAAGTAGAAGATATAtatgcttgaatataactaTATATCTTCTACTTGGTCCATactg
Hairpin ID: TR00241A.1; FWD Oligo: GTCTAGAAGAGCCGCTAGACCACGTAA, RVS Oligo:
AGAATTCTGTTGTCGATGCAGGAGAAG
Hairpin ID: SH01599.N2; FWD Oligo:
ctagcagtACGATTAGTATTGATCAACAAtagttatattcaagcataTTGTTGATCAATACTAATCGTgcg, RVS Oligo:
aattcgcACGATTAGTATTGATCAACAAtatgcttgaatataactaTTGTTGATCAATACTAATCGTactg
Hairpin ID: TR02132P.1; FWD Oligo: CACCGAATTCATGGATCAGCCAATGGAAAA, RVS Oligo:
CGCAACAAGTAATTCCGATG
Hairpin ID: SH01412.N2; FWD Oligo:
ctagcagtTCGGAATTACTTGTTGCGAAAtagttatattcaagcataTTTCGCAACAAGTAATTCCGAgcg, RVS
Oligo: aattcgcTCGGAATTACTTGTTGCGAAAtatgcttgaatataactaTTTCGCAACAAGTAATTCCGAactg
Hairpin ID: TR00187P.1; FWD Oligo: GTCTAGACTTACCAAACTAGCGCTGCC, RVS Oligo:
AGAATTCTTGTGTCGGCAAACTTCTTG
Hairpin ID: SH01558.N2; FWD Oligo:
ctagcagtCACAACGATGTTAGCAACATAtagttatattcaagcataTATGTTGCTAACATCGTTGTGgcg, RVS
Oligo: aattcgcCACAACGATGTTAGCAACATAtatgcttgaatataactaTATGTTGCTAACATCGTTGTGactg
Hairpin ID: SH01624.N2; FWD Oligo:
ctagcagtCTGGAGAGCTGTTTAAGTGTAtagttatattcaagcataTACACTTAAACAGCTCTCCAGgcg, RVS
Oligo: aattcgcCTGGAGAGCTGTTTAAGTGTAtatgcttgaatataactaTACACTTAAACAGCTCTCCAGactg
Hairpin ID: SH01415.N2b; FWD Oligo:
ctagcagtACGACGATAAATTAAATTATAtagttatattcaagcataTATAATTTAATTTATCGTCGTgcg, RVS Oligo:
aattcgcACGACGATAAATTAAATTATAtatgcttgaatataactaTATAATTTAATTTATCGTCGTactg
Hairpin ID: TR02134P.1; FWD Oligo: CACCGAATTCATCAAAGAGGCCTGCGAGTA, RVS Oligo:
GTGAGCGAGAAGGGAGTGTC
Hairpin ID: SH01400.N2; FWD Oligo:
ctagcagtAAGAAAGAGTGTGACTACAAAtagttatattcaagcataTTTGTAGTCACACTCTTTCTTgcg, RVS Oligo:
aattcgcAAGAAAGAGTGTGACTACAAAtatgcttgaatataactaTTTGTAGTCACACTCTTTCTTactg
Hairpin ID: TR00026P.1; FWD Oligo: GTCTAGATGACAAGTGCGCGTACAAAC, RVS Oligo:
AGAATTCTGTTGGTTTTGCGCTGATTA
Hairpin ID: TR00026A.1; FWD Oligo: GTCTAGATGACAAGTGCGCGTACAAAC, RVS Oligo:
AGAATTCTGTTGGTTTTGCGCTGATTA
Hairpin ID: SH01206.N2; FWD Oligo:
ctagcagtCTCGGACTATCTGAAGTTCAAtagttatattcaagcataTTGAACTTCAGATAGTCCGAGgcg, RVS
Oligo: aattcgcCTCGGACTATCTGAAGTTCAAtatgcttgaatataactaTTGAACTTCAGATAGTCCGAGactg
Hairpin ID: SH01241.N2; FWD Oligo:
ctagcagtCAGGTGCGAGGTCAAACTGAAtagttatattcaagcataTTCAGTTTGACCTCGCACCTGgcg, RVS
Oligo: aattcgcCAGGTGCGAGGTCAAACTGAAtatgcttgaatataactaTTCAGTTTGACCTCGCACCTGactg
Hairpin ID: SH01233.N2; FWD Oligo:
ctagcagtTAGAGTAGACCAGCAACTTTAtagttatattcaagcataTAAAGTTGCTGGTCTACTCTAgcg, RVS
Oligo: aattcgcTAGAGTAGACCAGCAACTTTAtatgcttgaatataactaTAAAGTTGCTGGTCTACTCTAactg
Hairpin ID: TR02030P.1; FWD Oligo: CACCGAATTCAAGAACTGGATGCCACGAAG, RVS Oligo:
TTAATAGGGCTGGTCATCCG
Hairpin ID: TR02094P.1; FWD Oligo: CACCGAATTCTGGAGGATATGCTGGCCTAC, RVS Oligo:
GCGGTTCAGGTAGATGTCGT
Hairpin ID: SH00240.N; FWD Oligo:
ctagcagtTCCGAATATAGTCAAGCTGAAtagttatattcaagcataTTCAGCTTGACTATATTCGGAgcg, RVS
Oligo: aattcgcTCCGAATATAGTCAAGCTGAAtatgcttgaatataactaTTCAGCTTGACTATATTCGGAactg
Hairpin ID: SH01424.N2b; FWD Oligo:
ctagcagtACGGCTCAATATAACAACAAAtagttatattcaagcataTTTGTTGTTATATTGAGCCGTgcg, RVS Oligo:
aattcgcACGGCTCAATATAACAACAAAtatgcttgaatataactaTTTGTTGTTATATTGAGCCGTactg
Hairpin ID: SH01193.N2; FWD Oligo:
ctagcagtTACGATTACGATTAATTGTTAtagttatattcaagcataTAACAATTAATCGTAATCGTAgcg, RVS Oligo:
aattcgcTACGATTACGATTAATTGTTAtatgcttgaatataactaTAACAATTAATCGTAATCGTAactg
Hairpin ID: TR02141P.1; FWD Oligo: CACCGAATTCGCAGTCGGATTATGGAGGAA, RVS Oligo:
AGCAATAGCGGTGACTGTCC
Hairpin ID: SH01560.N2; FWD Oligo:
ctagcagtACGGCGAGGGTTACAACTTTAtagttatattcaagcataTAAAGTTGTAACCCTCGCCGTgcg, RVS
Oligo: aattcgcACGGCGAGGGTTACAACTTTAtatgcttgaatataactaTAAAGTTGTAACCCTCGCCGTactg
Hairpin ID: TR00611A.1; FWD Oligo: GTCTAGAATCATAGTTCCACATCCGGC, RVS Oligo:
AGAATTCGCTTCAGCTTGACCACCTTC
Hairpin ID: TR00442A.1; FWD Oligo: GTCTAGAGCTACCTCAAGGTGACGGAC, RVS Oligo:
AGAATTCAGCAAACTCCTTGGCACACT
Hairpin ID: SH01234.N2; FWD Oligo:
ctagcagtCACGAGCAATTTCGATGACTAtagttatattcaagcataTAGTCATCGAAATTGCTCGTGgcg, RVS
Oligo: aattcgcCACGAGCAATTTCGATGACTAtatgcttgaatataactaTAGTCATCGAAATTGCTCGTGactg
Hairpin ID: SH01236.N2; FWD Oligo:
ctagcagtCAGCAGCTGGACAGTAAGATAtagttatattcaagcataTATCTTACTGTCCAGCTGCTGgcg, RVS
Oligo: aattcgcCAGCAGCTGGACAGTAAGATAtatgcttgaatataactaTATCTTACTGTCCAGCTGCTGactg
Hairpin ID: SH01195.N2; FWD Oligo:
ctagcagtCAGCAGCTGTTTGGTTATAAAtagttatattcaagcataTTTATAACCAAACAGCTGCTGgcg, RVS
Oligo: aattcgcCAGCAGCTGTTTGGTTATAAAtatgcttgaatataactaTTTATAACCAAACAGCTGCTGactg
Hairpin ID: TR01661A.1; FWD Oligo: AGTCTAGAGCCATGTACAAGGAGACGGT, RVS Oligo:
AAGAATTCATTGAGTACGGCAAACGGAC
Hairpin ID: TR00578A.1; FWD Oligo: GTCTAGAACCAGCAGCAGTGGAATCTT, RVS Oligo:
AGAATTCTGGGTACTCCAGCTATTCGG
Hairpin ID: SH01252.N2; FWD Oligo:
ctagcagtCTGGATGAAAGTGAGGTGTTAtagttatattcaagcataTAACACCTCACTTTCATCCAGgcg, RVS
Oligo: aattcgcCTGGATGAAAGTGAGGTGTTAtatgcttgaatataactaTAACACCTCACTTTCATCCAGactg
Hairpin ID: SH01546.N2; FWD Oligo:
ctagcagtAAGCATCATTATCACGAGCTAtagttatattcaagcataTAGCTCGTGATAATGATGCTTgcg, RVS
Oligo: aattcgcAAGCATCATTATCACGAGCTAtatgcttgaatataactaTAGCTCGTGATAATGATGCTTactg
Hairpin ID: TR02147P.1; FWD Oligo: CACCGAATTCGCCTGAAGAAGAAGGTCACG, RVS Oligo:
GACACACCCAGTTTGCCTTT
Hairpin ID: SH00479.N; FWD Oligo:
ctagcagtTTGGATGTTCGCATTGGATAAtagttatattcaagcataTTATCCAATGCGAACATCCAAgcg, RVS
Oligo: aattcgcTTGGATGTTCGCATTGGATAAtatgcttgaatataactaTTATCCAATGCGAACATCCAAactg
Hairpin ID: SH01617.N2; FWD Oligo:
ctagcagtTTGGAAGCGACTATCAACGAAtagttatattcaagcataTTCGTTGATAGTCGCTTCCAAgcg, RVS
Oligo: aattcgcTTGGAAGCGACTATCAACGAAtatgcttgaatataactaTTCGTTGATAGTCGCTTCCAAactg
Hairpin ID: SH01601.N2; FWD Oligo:
ctagcagtAACCATCAAGTTTCTAATGTAtagttatattcaagcataTACATTAGAAACTTGATGGTTgcg, RVS Oligo:
aattcgcAACCATCAAGTTTCTAATGTAtatgcttgaatataactaTACATTAGAAACTTGATGGTTactg
Hairpin ID: TR02154P.1; FWD Oligo: CACCGAATTCAATGCACATGTCGATGTCGT, RVS Oligo:
GGTGCTGGCGGTATGTTAAT
Hairpin ID: SH01626.N2; FWD Oligo:
ctagcagtAAGGACTATTTGCTTATTCAAtagttatattcaagcataTTGAATAAGCAAATAGTCCTTgcg, RVS Oligo:
aattcgcAAGGACTATTTGCTTATTCAAtatgcttgaatataactaTTGAATAAGCAAATAGTCCTTactg
Hairpin ID: TR00179P.1; FWD Oligo: GTCTAGATTTCCTACGACCTCCACCTG, RVS Oligo:
AGAATTCTCACATTTCGATTTGGAGGG
Hairpin ID: SH01629.N2; FWD Oligo:
ctagcagtTTGTTTGTAGTCGTAAGTTAAtagttatattcaagcataTTAACTTACGACTACAAACAAgcg, RVS Oligo:
aattcgcTTGTTTGTAGTCGTAAGTTAAtatgcttgaatataactaTTAACTTACGACTACAAACAAactg
Hairpin ID: TR01825P.1; FWD Oligo: CACCGAATTCGTATCAGCAGCAGTTTGCCA, RVS Oligo:
CTTGCTGGAGGGAACTTGAG
Hairpin ID: SH01056.N; FWD Oligo:
ctagcagtCACCGCTGAGTTGCTAGTTAAtagttatattcaagcataTTAACTAGCAACTCAGCGGTGgcg, RVS
Oligo: aattcgcCACCGCTGAGTTGCTAGTTAAtatgcttgaatataactaTTAACTAGCAACTCAGCGGTGactg
Hairpin ID: SH01057.N; FWD Oligo:
ctagcagtAAGGACTATATGTACCTTCTAtagttatattcaagcataTAGAAGGTACATATAGTCCTTgcg, RVS Oligo:
aattcgcAAGGACTATATGTACCTTCTAtatgcttgaatataactaTAGAAGGTACATATAGTCCTTactg
Hairpin ID: SH01588.N2; FWD Oligo:
ctagcagtTGCGACAGATATCAACGAGAAtagttatattcaagcataTTCTCGTTGATATCTGTCGCAgcg, RVS
Oligo: aattcgcTGCGACAGATATCAACGAGAAtatgcttgaatataactaTTCTCGTTGATATCTGTCGCAactg
Hairpin ID: TR02160P.1; FWD Oligo: CACCGAATTCGAGAGGAGCACATCGCCTAC, RVS Oligo:
TTCGGCATTTTTCTCCAAAC
Hairpin ID: SH00251.N; FWD Oligo:
ctagcagtCAGGATGGGACTAACCGAATAtagttatattcaagcataTATTCGGTTAGTCCCATCCTGgcg, RVS
Oligo: aattcgcCAGGATGGGACTAACCGAATAtatgcttgaatataactaTATTCGGTTAGTCCCATCCTGactg
Hairpin ID: SH01436.N2; FWD Oligo:
ctagcagtCAAAGTCAGCTTAGTTGTAAAtagttatattcaagcataTTTACAACTAAGCTGACTTTGgcg, RVS Oligo:
aattcgcCAAAGTCAGCTTAGTTGTAAAtatgcttgaatataactaTTTACAACTAAGCTGACTTTGactg
Hairpin ID: TR00256A.1; FWD Oligo: GTCTAGACTTCCTCATCCCCAAGAACA, RVS Oligo:
AGAATTCAGTGTGTGGTCTGCATCAGC
Hairpin ID: SH01600.N2; FWD Oligo:
ctagcagtAGCGATGTACATGTATTTCAAtagttatattcaagcataTTGAAATACATGTACATCGCTgcg, RVS Oligo:
aattcgcAGCGATGTACATGTATTTCAAtatgcttgaatataactaTTGAAATACATGTACATCGCTactg
Hairpin ID: SH01376.N2; FWD Oligo:
ctagcagtCACGATGTCCCTGATGGAGAAtagttatattcaagcataTTCTCCATCAGGGACATCGTGgcg, RVS
Oligo: aattcgcCACGATGTCCCTGATGGAGAAtatgcttgaatataactaTTCTCCATCAGGGACATCGTGactg
Hairpin ID: TR02161P.1; FWD Oligo: CACCGAATTCAGCCAGAAGTCGAAGGTGAA, RVS Oligo:
TTGCTCAGACTCAGCGAAGA
Hairpin ID: TR02365P.1; FWD Oligo: AACAATTGATCCGGACGGCCTTTATATC, RVS Oligo:
AGTCTAGAAAACTCGAACTCCTTGCCCT
Hairpin ID: SH01552.N2; FWD Oligo:
ctagcagtTCCCGAAGTTAGCTACATCAAtagttatattcaagcataTTGATGTAGCTAACTTCGGGAgcg, RVS
Oligo: aattcgcTCCCGAAGTTAGCTACATCAAtatgcttgaatataactaTTGATGTAGCTAACTTCGGGAactg
Hairpin ID: SH01403.N2; FWD Oligo:
ctagcagtAAGCGCGATTACTATGCTCAAtagttatattcaagcataTTGAGCATAGTAATCGCGCTTgcg, RVS
Oligo: aattcgcAAGCGCGATTACTATGCTCAAtatgcttgaatataactaTTGAGCATAGTAATCGCGCTTactg
Hairpin ID: SH01398.N2; FWD Oligo:
ctagcagtCTAGACTAGAATGTTGTCATAtagttatattcaagcataTATGACAACATTCTAGTCTAGgcg, RVS Oligo:
aattcgcCTAGACTAGAATGTTGTCATAtatgcttgaatataactaTATGACAACATTCTAGTCTAGactg
Hairpin ID: SH01180.N2; FWD Oligo:
ctagcagtATCGATGGACCTCAAGAAATAtagttatattcaagcataTATTTCTTGAGGTCCATCGATgcg, RVS
Oligo: aattcgcATCGATGGACCTCAAGAAATAtatgcttgaatataactaTATTTCTTGAGGTCCATCGATactg
Hairpin ID: TR02366P.1; FWD Oligo: AACAATTGGTTTTGATGGAGGAGAACCG, RVS Oligo:
AGTCTAGAGAATAGCGGCTTTCTCGTTG
Hairpin ID: SH00474.N; FWD Oligo:
ctagcagtTCGGTTCAGCTGAGTTGTTTAtagttatattcaagcataTAAACAACTCAGCTGAACCGAgcg, RVS
Oligo: aattcgcTCGGTTCAGCTGAGTTGTTTAtatgcttgaatataactaTAAACAACTCAGCTGAACCGAactg
Hairpin ID: SH01425.N2; FWD Oligo:
ctagcagtAAGACTGAGAAGTTCCAGAAAtagttatattcaagcataTTTCTGGAACTTCTCAGTCTTgcg, RVS
Oligo: aattcgcAAGACTGAGAAGTTCCAGAAAtatgcttgaatataactaTTTCTGGAACTTCTCAGTCTTactg
Hairpin ID: TR02164P.1; FWD Oligo: CACCGAATTCGAGAACAAGAAGTCCGCCTG, RVS Oligo:
AGCTGGATGTTGCGATTCTT
Hairpin ID: SH01593.N2; FWD Oligo:
ctagcagtCCGATTCGATTCGTTCAAGAAtagttatattcaagcataTTCTTGAACGAATCGAATCGGgcg, RVS
Oligo: aattcgcCCGATTCGATTCGTTCAAGAAtatgcttgaatataactaTTCTTGAACGAATCGAATCGGactg
Hairpin ID: SH01166.N2; FWD Oligo:
ctagcagtTTGCTGCTGTGCTGTACCTAAtagttatattcaagcataTTAGGTACAGCACAGCAGCAAgcg, RVS
Oligo: aattcgcTTGCTGCTGTGCTGTACCTAAtatgcttgaatataactaTTAGGTACAGCACAGCAGCAAactg
Hairpin ID: TR02168P.1; FWD Oligo: CACCGAATTCTACCAGACGAACCCTCTTCC, RVS Oligo:
GATGGTGGGGGCTTAAAGTT
Hairpin ID: SH01401.N2; FWD Oligo:
ctagcagtAAGGATGTAAAGTGAACACAAtagttatattcaagcataTTGTGTTCACTTTACATCCTTgcg, RVS Oligo:
aattcgcAAGGATGTAAAGTGAACACAAtatgcttgaatataactaTTGTGTTCACTTTACATCCTTactg
Hairpin ID: SH00411.N; FWD Oligo:
ctagcagtTTGGATGTTTCAAATAACAAAtagttatattcaagcataTTTGTTATTTGAAACATCCAAgcg, RVS Oligo:
aattcgcTTGGATGTTTCAAATAACAAAtatgcttgaatataactaTTTGTTATTTGAAACATCCAAactg
Hairpin ID: SH01432.N2; FWD Oligo:
ctagcagtACGGCTGAATATGTCATACAAtagttatattcaagcataTTGTATGACATATTCAGCCGTgcg, RVS
Oligo: aattcgcACGGCTGAATATGTCATACAAtatgcttgaatataactaTTGTATGACATATTCAGCCGTactg
Hairpin ID: SH01433.N2; FWD Oligo:
ctagcagtATCGAAGAACCTGCTAGTAAAtagttatattcaagcataTTTACTAGCAGGTTCTTCGATgcg, RVS
Oligo: aattcgcATCGAAGAACCTGCTAGTAAAtatgcttgaatataactaTTTACTAGCAGGTTCTTCGATactg
Hairpin ID: TR00713A.1; FWD Oligo: GTCTAGACGAAAGTGCCGCAGATAGTT, RVS Oligo:
AGAATTCCCTATATGCTCGCTTGGCAT
Hairpin ID: TR00714A.1; FWD Oligo: GTCTAGACGCAAAGGAACTTGGAAGAG, RVS Oligo:
AGAATTCTTGGCTGTAACCGTTGCATA
Hairpin ID: SH00845.N; FWD Oligo:
ctagcagtCCGCAGATAGTTGATTCTTAAtagttatattcaagcataTTAAGAATCAACTATCTGCGGgcg, RVS
Oligo: aattcgcCCGCAGATAGTTGATTCTTAAtatgcttgaatataactaTTAAGAATCAACTATCTGCGGactg
Hairpin ID: SH01573.N2; FWD Oligo:
ctagcagtAACCCTCACCAAGCTGGTCTAtagttatattcaagcataTAGACCAGCTTGGTGAGGGTTgcg, RVS
Oligo: aattcgcAACCCTCACCAAGCTGGTCTAtatgcttgaatataactaTAGACCAGCTTGGTGAGGGTTactg
Hairpin ID: SH01219.N2; FWD Oligo:
ctagcagtTACACGAATGTTTGTTATAAAtagttatattcaagcataTTTATAACAAACATTCGTGTAgcg, RVS Oligo:
aattcgcTACACGAATGTTTGTTATAAAtatgcttgaatataactaTTTATAACAAACATTCGTGTAactg
Hairpin ID: SH01574.N2; FWD Oligo:
ctagcagtAAGACTTATTGTTATGCTTAAtagttatattcaagcataTTAAGCATAACAATAAGTCTTgcg, RVS Oligo:
aattcgcAAGACTTATTGTTATGCTTAAtatgcttgaatataactaTTAAGCATAACAATAAGTCTTactg
Hairpin ID: TR02387P.1; FWD Oligo: AAGAATTCACAAATCGTGCCCGTCTAAC, RVS Oligo:
AGTCTAGACTCCATTGGTCGATGTTGTG
Hairpin ID: SH01245.N2; FWD Oligo:
ctagcagtAAGGTTTAATTTGTAAGTAAAtagttatattcaagcataTTTACTTACAAATTAAACCTTgcg, RVS Oligo:
aattcgcAAGGTTTAATTTGTAAGTAAAtatgcttgaatataactaTTTACTTACAAATTAAACCTTactg
Hairpin ID: TR02185P.1; FWD Oligo: CACCGAATTCCGACGAGAAGCAGAAACTGA, RVS Oligo:
AGAAGATTCGATAGGCGGGT
Hairpin ID: SH01211.N2; FWD Oligo:
ctagcagtCCGGTTATGTGTGTAGTGCTAtagttatattcaagcataTAGCACTACACACATAACCGGgcg, RVS
Oligo: aattcgcCCGGTTATGTGTGTAGTGCTAtatgcttgaatataactaTAGCACTACACACATAACCGGactg
Hairpin ID: TR00351P.1; FWD Oligo: GTCTAGAATCACGATGGGGATACCAAA, RVS Oligo:
AGAATTCCTAGTTTTGGGGACTGCTCG
Hairpin ID: TR02451P.1; FWD Oligo: AAGAATTCCTGTTACGCCAAGTTCGACA, RVS Oligo:
AGTCTAGAGCGGATTTCGTCAAAGGATA
Hairpin ID: TR00289A.1; FWD Oligo: GTCTAGACTAACGCCAACCAAAAAGGA, RVS Oligo:
AGAATTCCCAAACTGGTCATCGGAGTT
Hairpin ID: SH00839.N; FWD Oligo:
ctagcagtCTGGTTCTACTATGTGGACAAtagttatattcaagcataTTGTCCACATAGTAGAACCAGgcg, RVS
Oligo: aattcgcCTGGTTCTACTATGTGGACAAtatgcttgaatataactaTTGTCCACATAGTAGAACCAGactg
Hairpin ID: SH01228.N2; FWD Oligo:
ctagcagtTCCGATTGTAGTATAGTTGTTtagttatattcaagcataAACAACTATACTACAATCGGAgcg, RVS Oligo:
aattcgcTCCGATTGTAGTATAGTTGTTtatgcttgaatataactaAACAACTATACTACAATCGGAactg
Hairpin ID: SH01563.N2; FWD Oligo:
ctagcagtAAGCATAGTTATGTTAACCAAtagttatattcaagcataTTGGTTAACATAACTATGCTTgcg, RVS Oligo:
aattcgcAAGCATAGTTATGTTAACCAAtatgcttgaatataactaTTGGTTAACATAACTATGCTTactg
Hairpin ID: TR01893P.1; FWD Oligo: AACAATTGTACTCACAACCGTCATCCGA, RVS Oligo:
AGTCTAGAGCTACCTCGAGATGGCTCC
Hairpin ID: TR04643P.1; FWD Oligo: AAGAATTCCTGCGCTATTCGCAGTACAT, RVS Oligo:
AGTCTAGACAAGTAGGCATCGCTGAACA
Hairpin ID: SH01024.N; FWD Oligo:
ctagcagtTCCGTACAAGACGAAGAAGTAtagttatattcaagcataTACTTCTTCGTCTTGTACGGAgcg, RVS
Oligo: aattcgcTCCGTACAAGACGAAGAAGTAtatgcttgaatataactaTACTTCTTCGTCTTGTACGGAactg
Hairpin ID: SH01025.N; FWD Oligo:
ctagcagtTTGCTATGCTTTCGAGTTGAAtagttatattcaagcataTTCAACTCGAAAGCATAGCAAgcg, RVS
Oligo: aattcgcTTGCTATGCTTTCGAGTTGAAtatgcttgaatataactaTTCAACTCGAAAGCATAGCAAactg
Hairpin ID: SH01414.N2; FWD Oligo:
ctagcagtCTGCAGATTCTTCTAAAGTTAtagttatattcaagcataTAACTTTAGAAGAATCTGCAGgcg, RVS Oligo:
aattcgcCTGCAGATTCTTCTAAAGTTAtatgcttgaatataactaTAACTTTAGAAGAATCTGCAGactg
Hairpin ID: SH01612.N2; FWD Oligo:
ctagcagtCAGCTGTTGCGTGAAGTAGAAtagttatattcaagcataTTCTACTTCACGCAACAGCTGgcg, RVS
Oligo: aattcgcCAGCTGTTGCGTGAAGTAGAAtatgcttgaatataactaTTCTACTTCACGCAACAGCTGactg
Hairpin ID: TR00768A.1; FWD Oligo: GTCTAGAATGGCAATGGTCCTCTGTTC, RVS Oligo:
AGAATTCCCAGATGAGCATCCCTTGAT
Hairpin ID: SH01188.N2; FWD Oligo:
ctagcagtCAAGAAGACCTATGAGTTTAAtagttatattcaagcataTTAAACTCATAGGTCTTCTTGgcg, RVS Oligo:
aattcgcCAAGAAGACCTATGAGTTTAAtatgcttgaatataactaTTAAACTCATAGGTCTTCTTGactg
Hairpin ID: TR02197P.1; FWD Oligo: CACCGAATTCGCTCCGTTACCAGTACAGCC, RVS Oligo:
TAAATTGGAGCTACCAGGCG
Hairpin ID: SH01605.N2; FWD Oligo:
ctagcagtCACGATGATGATACCAGTTATtagttatattcaagcataATAACTGGTATCATCATCGTGgcg, RVS
Oligo: aattcgcCACGATGATGATACCAGTTATtatgcttgaatataactaATAACTGGTATCATCATCGTGactg
Hairpin ID: TR00601A.1; FWD Oligo: GTCTAGAGATACCAACGGGTTTAGCGA, RVS Oligo:
AGAATTCATGACATCCTTTCGCAGGAC
Hairpin ID: TR00600A.1; FWD Oligo: GTCTAGAAGATCACTGGCGAAGCAAAT, RVS Oligo:
AGAATTCCAGGCGTGATGCACATTTAG
Hairpin ID: SH00036.O; FWD Oligo:
ctagcagtTTCATTCGGACGACGATCGTGtagttatattcaagcataCACGATCGTCGTCCGAATGAAgcg, RVS
Oligo: aattcgcTTCATTCGGACGACGATCGTGtatgcttgaatataactaCACGATCGTCGTCCGAATGAAactg
Hairpin ID: SH00035.O; FWD Oligo:
ctagcagtTTTCTGAATGGTCTTGGTCTTtagttatattcaagcataAAGACCAAGACCATTCAGAAAgcg, RVS
Oligo: aattcgcTTTCTGAATGGTCTTGGTCTTtatgcttgaatataactaAAGACCAAGACCATTCAGAAAactg
Hairpin ID: TR02198P.1; FWD Oligo: CACCGAATTCCTGTGGAGATCGACGAGTCA, RVS Oligo:
GAGATGGAGCAGAAGTGGGA
Hairpin ID: TR00545A.1; FWD Oligo: GTCTAGACTTGGAGACGAAAAAGGCTG, RVS Oligo:
AGAATTCATTCGTTGCGCTTTAGCATT
Hairpin ID: SH01439.N2; FWD Oligo:
ctagcagtCAAGATGCGAGTGGTAGTCAAtagttatattcaagcataTTGACTACCACTCGCATCTTGgcg, RVS
Oligo: aattcgcCAAGATGCGAGTGGTAGTCAAtatgcttgaatataactaTTGACTACCACTCGCATCTTGactg
Hairpin ID: TR00711A.1; FWD Oligo: GTCTAGAGTGGGATAGCTGCGATGAAT, RVS Oligo:
AGAATTCGTTAGCTCCGGAATGCTACG
Hairpin ID: TR00429A.1; FWD Oligo: GTCTAGAAGCTGTTGTGTCACCCCTTC, RVS Oligo:
AGAATTCGAGCGACTATTGGCTTAGCG
Hairpin ID: SH01568.N2; FWD Oligo:
ctagcagtTAGTTTGTATATCGAAATATAtagttatattcaagcataTATATTTCGATATACAAACTAgcg, RVS Oligo:
aattcgcTAGTTTGTATATCGAAATATAtatgcttgaatataactaTATATTTCGATATACAAACTAactg
Hairpin ID: TR00541P.1; FWD Oligo: GTCTAGACCAGGAGCCGATCAAGAATA, RVS Oligo:
AGAATTCATTCGCCACTTGGTAGGTGT
Hairpin ID: SH01207.N2; FWD Oligo:
ctagcagtCACGGAGAGCACCTACAGCAAtagttatattcaagcataTTGCTGTAGGTGCTCTCCGTGgcg, RVS
Oligo: aattcgcCACGGAGAGCACCTACAGCAAtatgcttgaatataactaTTGCTGTAGGTGCTCTCCGTGactg
Hairpin ID: TR02202P.1; FWD Oligo: CACCGAATTCCCAAGAAGAAGACTCGCACC, RVS Oligo:
TACAACTCCTCGCTGCCTTT
Hairpin ID: TR00188P.1; FWD Oligo: AAGAATTCTACCAAGGCACAAGCAACAG, RVS Oligo:
AGTCTAGATACTAACTCGTTCGACGCCC
Hairpin ID: SH00659.N; FWD Oligo:
ctagcagtAAAGTGTGTGTTAAACGACAAtagttatattcaagcataTTGTCGTTTAACACACACTTTgcg, RVS Oligo:
aattcgcAAAGTGTGTGTTAAACGACAAtatgcttgaatataactaTTGTCGTTTAACACACACTTTactg
Hairpin ID: SH01564.N2; FWD Oligo:
ctagcagtATGGAGTTAGACAAATCGAAAtagttatattcaagcataTTTCGATTTGTCTAACTCCATgcg, RVS Oligo:
aattcgcATGGAGTTAGACAAATCGAAAtatgcttgaatataactaTTTCGATTTGTCTAACTCCATactg
Hairpin ID: TR02207P.1; FWD Oligo: CACCGAATTCCGAGCTCGGAGCAAGATAAC, RVS Oligo:
TCCATGAGTATTTCCCTGGC
Hairpin ID: TR02481P.1; FWD Oligo: AAGAATTCGTGAGAAGACGCTTTCCCTG, RVS Oligo:
AGTCTAGAGCTGAAGTCTGGCTGTTTCC
Hairpin ID: SH01232.N2; FWD Oligo:
ctagcagtCAGCTGCTAGTTATATTCAAAtagttatattcaagcataTTTGAATATAACTAGCAGCTGgcg, RVS Oligo:
aattcgcCAGCTGCTAGTTATATTCAAAtatgcttgaatataactaTTTGAATATAACTAGCAGCTGactg
Hairpin ID: TR02378P.1; FWD Oligo: AAGAATTCAAATCCCTAACTGGAACGGC, RVS Oligo:
AGTCTAGACCTCGTCGGTGTATCCCTTA
Hairpin ID: SH01213.N2; FWD Oligo:
ctagcagtTCCGGAAGAGTTTGCGACATAtagttatattcaagcataTATGTCGCAAACTCTTCCGGAgcg, RVS
Oligo: aattcgcTCCGGAAGAGTTTGCGACATAtatgcttgaatataactaTATGTCGCAAACTCTTCCGGAactg
Hairpin ID: TR02542P.1; FWD Oligo: AAGAATTCCCGTATCTACGAGGACAGGC, RVS Oligo:
AGTCTAGATGGCATTCGAAATGCAATAA
Hairpin ID: SH01246.N2; FWD Oligo:
ctagcagtCAACGGCGAGTTGTTCTCAAAtagttatattcaagcataTTTGAGAACAACTCGCCGTTGgcg, RVS
Oligo: aattcgcCAACGGCGAGTTGTTCTCAAAtatgcttgaatataactaTTTGAGAACAACTCGCCGTTGactg
Hairpin ID: TR00310A.1; FWD Oligo: GTCTAGAAGTCCTCAGCTTTATCGGCA, RVS Oligo:
AGAATTCCTAGGAGCACAGTGGCATCA
Hairpin ID: TR00310P.1; FWD Oligo: AAGAATTCAGTCCTCAGCTTTATCGGCA, RVS Oligo:
AGTCTAGACTAGGAGCACAGTGGCATCA
Hairpin ID: SH01559.N2; FWD Oligo:
ctagcagtACGGTTATCAATACTACACTAtagttatattcaagcataTAGTGTAGTATTGATAACCGTgcg, RVS Oligo:
aattcgcACGGTTATCAATACTACACTAtatgcttgaatataactaTAGTGTAGTATTGATAACCGTactg
Hairpin ID: SH01609.N2; FWD Oligo:
ctagcagtCAGAACTTACCCGACGATCAAtagttatattcaagcataTTGATCGTCGGGTAAGTTCTGgcg, RVS
Oligo: aattcgcCAGAACTTACCCGACGATCAAtatgcttgaatataactaTTGATCGTCGGGTAAGTTCTGactg
Hairpin ID: SH01162.N2; FWD Oligo:
ctagcagtCGCGTTGATTACTGTTAATAAtagttatattcaagcataTTATTAACAGTAATCAACGCGgcg, RVS Oligo:
aattcgcCGCGTTGATTACTGTTAATAAtatgcttgaatataactaTTATTAACAGTAATCAACGCGactg
Hairpin ID: SH01607.N2; FWD Oligo:
ctagcagtAAGAGTAAGAGTGTCAATCAAtagttatattcaagcataTTGATTGACACTCTTACTCTTgcg, RVS Oligo:
aattcgcAAGAGTAAGAGTGTCAATCAAtatgcttgaatataactaTTGATTGACACTCTTACTCTTactg
Hairpin ID: TR02225P.1; FWD Oligo: CACCGAATTCCCAAGGAGCGAGACAACTTC, RVS Oligo:
GCTTTACTGCCTTGTCCAGC
Hairpin ID: SH01586.N2; FWD Oligo:
ctagcagtAAGGAGCAAACGAACAACGAAtagttatattcaagcataTTCGTTGTTCGTTTGCTCCTTgcg, RVS
Oligo: aattcgcAAGGAGCAAACGAACAACGAAtatgcttgaatataactaTTCGTTGTTCGTTTGCTCCTTactg
Hairpin ID: SH01406.N2; FWD Oligo:
ctagcagtAAGGCTAGCTATGTTATCCAAtagttatattcaagcataTTGGATAACATAGCTAGCCTTgcg, RVS
Oligo: aattcgcAAGGCTAGCTATGTTATCCAAtatgcttgaatataactaTTGGATAACATAGCTAGCCTTactg
Hairpin ID: SH01591.N2; FWD Oligo:
ctagcagtCCGATTCGATGTTGTGGTGAAtagttatattcaagcataTTCACCACAACATCGAATCGGgcg, RVS
Oligo: aattcgcCCGATTCGATGTTGTGGTGAAtatgcttgaatataactaTTCACCACAACATCGAATCGGactg
Hairpin ID: TR02231P.1; FWD Oligo: CACCGAATTCGGTCAGGTGAAGCTGTGTGA, RVS Oligo:
TCCTTGTCCAGGCACTTCTT
Hairpin ID: SH01416.N2; FWD Oligo:
ctagcagtCAGAACGACCTCATTAATGAAtagttatattcaagcataTTCATTAATGAGGTCGTTCTGgcg, RVS
Oligo: aattcgcCAGAACGACCTCATTAATGAAtatgcttgaatataactaTTCATTAATGAGGTCGTTCTGactg
Hairpin ID: SH00271.N; FWD Oligo:
ctagcagtCAGGGTGTAGCTGCTGATTTAtagttatattcaagcataTAAATCAGCAGCTACACCCTGgcg, RVS
Oligo: aattcgcCAGGGTGTAGCTGCTGATTTAtatgcttgaatataactaTAAATCAGCAGCTACACCCTGactg
Hairpin ID: TR02233P.1; FWD Oligo: CACCGAATTCCAGCTGAACCTCATCATGGA, RVS Oligo:
GGATTACTGCTCTTTGGGCA
Hairpin ID: SH01542.N2; FWD Oligo:
ctagcagtCAGCGGATTAATAACATTATAtagttatattcaagcataTATAATGTTATTAATCCGCTGgcg, RVS Oligo:
aattcgcCAGCGGATTAATAACATTATAtatgcttgaatataactaTATAATGTTATTAATCCGCTGactg
Hairpin ID: SH00688.Nb; FWD Oligo:
ctagcagtCAGACCCTTTATCTACCACAAtagttatattcaagcataTTGTGGTAGATAAAGGGTCTGgcg, RVS
Oligo: aattcgcCAGACCCTTTATCTACCACAAtatgcttgaatataactaTTGTGGTAGATAAAGGGTCTGactg
Hairpin ID: TR02717P.1; FWD Oligo: AAGAATTCGTCGGTGGTTGAAATTGCTG, RVS Oligo:
AGTCTAGACAGGCAACACATATTTGGCA
Hairpin ID: SH01186.N2; FWD Oligo:
ctagcagtAAAGCTCAAGATCAAGAGTTAtagttatattcaagcataTAACTCTTGATCTTGAGCTTTgcg, RVS Oligo:
aattcgcAAAGCTCAAGATCAAGAGTTAtatgcttgaatataactaTAACTCTTGATCTTGAGCTTTactg
Hairpin ID: SH00274.N; FWD Oligo:
ctagcagtCAAGATAATCATGTAAAGAAAtagttatattcaagcataTTTCTTTACATGATTATCTTGgcg, RVS Oligo:
aattcgcCAAGATAATCATGTAAAGAAAtatgcttgaatataactaTTTCTTTACATGATTATCTTGactg
Hairpin ID: SH01216.N2; FWD Oligo:
ctagcagtAAGGTGTAAATTATAAATGAAtagttatattcaagcataTTCATTTATAATTTACACCTTgcg, RVS Oligo:
aattcgcAAGGTGTAAATTATAAATGAAtatgcttgaatataactaTTCATTTATAATTTACACCTTactg
Hairpin ID: SH01420.N2; FWD Oligo:
ctagcagtTGCGATTTGTACGATCCTTAAtagttatattcaagcataTTAAGGATCGTACAAATCGCAgcg, RVS
Oligo: aattcgcTGCGATTTGTACGATCCTTAAtatgcttgaatataactaTTAAGGATCGTACAAATCGCAactg
Hairpin ID: SH01602.N2; FWD Oligo:
ctagcagtTAGTGAAATGTCAAAGGTCAAtagttatattcaagcataTTGACCTTTGACATTTCACTAgcg, RVS Oligo:
aattcgcTAGTGAAATGTCAAAGGTCAAtatgcttgaatataactaTTGACCTTTGACATTTCACTAactg
Hairpin ID: SH01196.N2; FWD Oligo:
ctagcagtTAGACTAGAACTAACTGTATAtagttatattcaagcataTATACAGTTAGTTCTAGTCTAgcg, RVS Oligo:
aattcgcTAGACTAGAACTAACTGTATAtatgcttgaatataactaTATACAGTTAGTTCTAGTCTAactg
Hairpin ID: TR04135P.1; FWD Oligo: AAGAATTCACAAGGTGCATATAAGGGCG, RVS Oligo:
AGTCTAGAAAATCGCCCAGTTTTAGGCT
Hairpin ID: SH01175.N2; FWD Oligo:
ctagcagtCAAGTCAGAGATGATCAACAAtagttatattcaagcataTTGTTGATCATCTCTGACTTGgcg, RVS
Oligo: aattcgcCAAGTCAGAGATGATCAACAAtatgcttgaatataactaTTGTTGATCATCTCTGACTTGactg
Hairpin ID: SH00963.N; FWD Oligo:
ctagcagtAAGACGAGCGATAGCAAGATAtagttatattcaagcataTATCTTGCTATCGCTCGTCTTgcg, RVS
Oligo: aattcgcAAGACGAGCGATAGCAAGATAtatgcttgaatataactaTATCTTGCTATCGCTCGTCTTactg
Hairpin ID: SH01604.N2; FWD Oligo:
ctagcagtTACGAGCGTCGTCTAGAACAAtagttatattcaagcataTTGTTCTAGACGACGCTCGTAgcg, RVS
Oligo: aattcgcTACGAGCGTCGTCTAGAACAAtatgcttgaatataactaTTGTTCTAGACGACGCTCGTAactg
Hairpin ID: TR02070P.1; FWD Oligo: TCAACACCATTTCTCCCACA, RVS Oligo:
AAGTGAATTCGACAACTCCGAATGCTCCAT
Hairpin ID: SH01199.N2; FWD Oligo:
ctagcagtAACCAGCAAGTTGAAAGCAAAtagttatattcaagcataTTTGCTTTCAACTTGCTGGTTgcg, RVS
Oligo: aattcgcAACCAGCAAGTTGAAAGCAAAtatgcttgaatataactaTTTGCTTTCAACTTGCTGGTTactg
Hairpin ID: TR02249P.1; FWD Oligo: CACCGAATTCTGAGAAGCACATGGACAAGC, RVS Oligo:
AAAGTCACACCGTGACACCA
Hairpin ID: SH01189.N2; FWD Oligo:
ctagcagtCTCACCGAGACTTCAAGTCTAtagttatattcaagcataTAGACTTGAAGTCTCGGTGAGgcg, RVS
Oligo: aattcgcCTCACCGAGACTTCAAGTCTAtatgcttgaatataactaTAGACTTGAAGTCTCGGTGAGactg
Hairpin ID: TR00946P.1; FWD Oligo: AGTCTAGACATACCTCCACGTCTTCGGT, RVS Oligo:
AAGAATTCGTCGCTAAACTCGAAGCCAC
Hairpin ID: SH01218.N2; FWD Oligo:
ctagcagtCACCACGGATGTAGAGCGAAAtagttatattcaagcataTTTCGCTCTACATCCGTGGTGgcg, RVS
Oligo: aattcgcCACCACGGATGTAGAGCGAAAtatgcttgaatataactaTTTCGCTCTACATCCGTGGTGactg
Hairpin ID: TR01476P.1; FWD Oligo: AGTCTAGAGACATCCGCCAAGGAGAATA, RVS Oligo:
AAGAATTCGCAACTAGGGCAATGATGGT
Hairpin ID: TR02068P.1; FWD Oligo: GATTTCATTGAGGAGGCCAA, RVS Oligo:
AAGTGAATTCTCGCTCTTAGAGGAGAAGCG
Hairpin ID: SH01198.N2; FWD Oligo:
ctagcagtAACGCGTTAACTGTTAGACAAtagttatattcaagcataTTGTCTAACAGTTAACGCGTTgcg, RVS
Oligo: aattcgcAACGCGTTAACTGTTAGACAAtatgcttgaatataactaTTGTCTAACAGTTAACGCGTTactg
Hairpin ID: SH00110.N; FWD Oligo:
ctagcagtCAGCGACTGGATCTCAGTTAAtagttatattcaagcataTTAACTGAGATCCAGTCGCTGgcg, RVS
Oligo: aattcgcCAGCGACTGGATCTCAGTTAAtatgcttgaatataactaTTAACTGAGATCCAGTCGCTGactg
Hairpin ID: SH01204.N2; FWD Oligo:
ctagcagtCAGCGAGAACGTGACCAACTAtagttatattcaagcataTAGTTGGTCACGTTCTCGCTGgcg, RVS
Oligo: aattcgcCAGCGAGAACGTGACCAACTAtatgcttgaatataactaTAGTTGGTCACGTTCTCGCTGactg
Hairpin ID: TR00154A.1; FWD Oligo: GTCTAGACAAGAACATTGCGCTTAGCA, RVS Oligo:
AGAATTCGTGAACAATTCGCTCGTTGA
Hairpin ID: SH01177.N2; FWD Oligo:
ctagcagtTAGAGTTTGAGTGCTCTACAAtagttatattcaagcataTTGTAGAGCACTCAAACTCTAgcg, RVS
Oligo: aattcgcTAGAGTTTGAGTGCTCTACAAtatgcttgaatataactaTTGTAGAGCACTCAAACTCTAactg
Hairpin ID: SH01197.N2; FWD Oligo:
ctagcagtTACGACGTTGTCATCAAGTTAtagttatattcaagcataTAACTTGATGACAACGTCGTAgcg, RVS
Oligo: aattcgcTACGACGTTGTCATCAAGTTAtatgcttgaatataactaTAACTTGATGACAACGTCGTAactg
Hairpin ID: TR02255P.1; FWD Oligo: CACCGAATTCTCATAGACGTCCTGCACTCG, RVS Oligo:
AGCTGACTCCACGAGGTGAT
Hairpin ID: SH01613.N2; FWD Oligo:
ctagcagtTTCGATTATAGTATAAGATAAtagttatattcaagcataTTATCTTATACTATAATCGAAgcg, RVS Oligo:
aattcgcTTCGATTATAGTATAAGATAAtatgcttgaatataactaTTATCTTATACTATAATCGAAactg
Hairpin ID: TR01903P.1; FWD Oligo: CACCGAATTCATGCTGAACATGTCGCTGAG, RVS Oligo:
CTCAATGCTGGGATCAGGTT
Hairpin ID: SH01561.N2; FWD Oligo:
ctagcagtTTCGATGTAAGCTAAGAGTAAtagttatattcaagcataTTACTCTTAGCTTACATCGAAgcg, RVS Oligo:
aattcgcTTCGATGTAAGCTAAGAGTAAtatgcttgaatataactaTTACTCTTAGCTTACATCGAAactg
Hairpin ID: TR02256P.1; FWD Oligo: CACCGAATTCGGCCACACAATACGAGGACT, RVS Oligo:
CTCCTTCAAAGTTTCCGTGC
Hairpin ID: SH00286.N; FWD Oligo:
ctagcagtCAGCTGTTTCGTGCTCCTTAAtagttatattcaagcataTTAAGGAGCACGAAACAGCTGgcg, RVS
Oligo: aattcgcCAGCTGTTTCGTGCTCCTTAAtatgcttgaatataactaTTAAGGAGCACGAAACAGCTGactg
Hairpin ID: SH01548.N2; FWD Oligo:
ctagcagtCTCGGTGTATTTATATATAAAtagttatattcaagcataTTTATATATAAATACACCGAGgcg, RVS Oligo:
aattcgcCTCGGTGTATTTATATATAAAtatgcttgaatataactaTTTATATATAAATACACCGAGactg
Hairpin ID: SH01636.N2; FWD Oligo:
ctagcagtAAGAATGTGTATTCAAGAATAtagttatattcaagcataTATTCTTGAATACACATTCTTgcg, RVS Oligo:
aattcgcAAGAATGTGTATTCAAGAATAtatgcttgaatataactaTATTCTTGAATACACATTCTTactg
Hairpin ID: SH01606.N2b; FWD Oligo:
ctagcagtCCGGAGCTTTATCCCAGCGAAtagttatattcaagcataTTCGCTGGGATAAAGCTCCGGgcg, RVS
Oligo: aattcgcCCGGAGCTTTATCCCAGCGAAtatgcttgaatataactaTTCGCTGGGATAAAGCTCCGGactg
Hairpin ID: SH01551.N2; FWD Oligo:
ctagcagtAAGGATCATGTTGATAAGCATtagttatattcaagcataATGCTTATCAACATGATCCTTgcg, RVS Oligo:
aattcgcAAGGATCATGTTGATAAGCATtatgcttgaatataactaATGCTTATCAACATGATCCTTactg
Hairpin ID: TR02701P.1; FWD Oligo: AAGAATTCGAGGCTTTAAGGACTCCGCT, RVS Oligo:
AGTCTAGATTTTTCTGATGTGCAGCCAG
Hairpin ID: SH01164.N2; FWD Oligo:
ctagcagtTTGGACGTCTCTACTGCAATAtagttatattcaagcataTATTGCAGTAGAGACGTCCAAgcg, RVS
Oligo: aattcgcTTGGACGTCTCTACTGCAATAtatgcttgaatataactaTATTGCAGTAGAGACGTCCAAactg
Hairpin ID: TR00194P.1; FWD Oligo: AAGAATTCACACACAAGCCCCAAATAGG, RVS Oligo:
AGTCTAGATCTTCACCACCCACTGATGA
Hairpin ID: SH01203.N2; FWD Oligo:
ctagcagtCAGCAGCGAAATACCCATAAAtagttatattcaagcataTTTATGGGTATTTCGCTGCTGgcg, RVS
Oligo: aattcgcCAGCAGCGAAATACCCATAAAtatgcttgaatataactaTTTATGGGTATTTCGCTGCTGactg
Hairpin ID: SH01616.N2; FWD Oligo:
ctagcagtCACGAAGACGATTCATGTGTAtagttatattcaagcataTACACATGAATCGTCTTCGTGgcg, RVS
Oligo: aattcgcCACGAAGACGATTCATGTGTAtatgcttgaatataactaTACACATGAATCGTCTTCGTGactg
Hairpin ID: SH01597.N2; FWD Oligo:
ctagcagtCCCGACAAGTTTATCGACGAAtagttatattcaagcataTTCGTCGATAAACTTGTCGGGgcg, RVS
Oligo: aattcgcCCCGACAAGTTTATCGACGAAtatgcttgaatataactaTTCGTCGATAAACTTGTCGGGactg
Hairpin ID: TR00889P.1; FWD Oligo: AAGAATTCAAGACCGACGTTCCACAGAG, RVS Oligo:
AGTCTAGAATGAACAGGAACTTGCCCTC
Hairpin ID: TR02641P.1; FWD Oligo: AAGAATTCGCCGAGATACTGCCTTTTTG, RVS Oligo:
AGTCTAGATCCCTGGAGGCTATACGTTG
Hairpin ID: SH01549.N2; FWD Oligo:
ctagcagtCCGGACAACTATCATCAACTAtagttatattcaagcataTAGTTGATGATAGTTGTCCGGgcg, RVS
Oligo: aattcgcCCGGACAACTATCATCAACTAtatgcttgaatataactaTAGTTGATGATAGTTGTCCGGactg
Hairpin ID: TR02269P.1; FWD Oligo: CACCGAATTCCGAGATCAGCACCAAGATGA, RVS Oligo:
GCCGCTTAATCAGATCTTGC
Hairpin ID: SH01407.N2b; FWD Oligo:
ctagcagtCCCGAAGTTGGAGTTGTCCAAtagttatattcaagcataTTGGACAACTCCAACTTCGGGgcg, RVS
Oligo: aattcgcCCCGAAGTTGGAGTTGTCCAAtatgcttgaatataactaTTGGACAACTCCAACTTCGGGactg
Hairpin ID: TR02529P.1; FWD Oligo: AAGAATTCTGTGATCTGTCGGATGTGGT, RVS Oligo:
AGTCTAGAAATGTCGCCATGGAAATAGC
Hairpin ID: SH01226.N2; FWD Oligo:
ctagcagtAACAAAGTTGTTGAAGATAAAtagttatattcaagcataTTTATCTTCAACAACTTTGTTgcg, RVS Oligo:
aattcgcAACAAAGTTGTTGAAGATAAAtatgcttgaatataactaTTTATCTTCAACAACTTTGTTactg
Hairpin ID: SH01431.N2b; FWD Oligo:
ctagcagtCAGCTCCGGTTCTTAAGTATAtagttatattcaagcataTATACTTAAGAACCGGAGCTGgcg, RVS
Oligo: aattcgcCAGCTCCGGTTCTTAAGTATAtatgcttgaatataactaTATACTTAAGAACCGGAGCTGactg
Hairpin ID: SH01404.N2; FWD Oligo:
ctagcagtCAGCTATGCGACCGTGTACAAtagttatattcaagcataTTGTACACGGTCGCATAGCTGgcg, RVS
Oligo: aattcgcCAGCTATGCGACCGTGTACAAtatgcttgaatataactaTTGTACACGGTCGCATAGCTGactg
Hairpin ID: SH00356.N; FWD Oligo:
ctagcagtCCCGACGAACAGAAGCGTAAAtagttatattcaagcataTTTACGCTTCTGTTCGTCGGGgcg, RVS
Oligo: aattcgcCCCGACGAACAGAAGCGTAAAtatgcttgaatataactaTTTACGCTTCTGTTCGTCGGGactg
Hairpin ID: SH01242.N2; FWD Oligo:
ctagcagtAGGGAAGATGTTGTTGAATTAtagttatattcaagcataTAATTCAACAACATCTTCCCTgcg, RVS Oligo:
aattcgcAGGGAAGATGTTGTTGAATTAtatgcttgaatataactaTAATTCAACAACATCTTCCCTactg
Hairpin ID: TR02067P.1hm; FWD Oligo: CACCGAATTCACCCGACCATGTAGAAGTGG, RVS Oligo:
ACCAACTGGACATCCTCTCG
Hairpin ID: TR02067P.1; FWD Oligo: CACCGAATTCACCCGACCATGTAGAAGTGG, RVS Oligo:
ACCAACTGGACATCCTCTCG
Hairpin ID: TR04606P.1; FWD Oligo: AAGAATTCGGACTTCGATGAGACGTTCC, RVS Oligo:
AGTCTAGACTGAATTGTAAACGGAGGGC
Hairpin ID: SH01437.N2; FWD Oligo:
ctagcagtCACGTTGGCGATGTCATCCTAtagttatattcaagcataTAGGATGACATCGCCAACGTGgcg, RVS
Oligo: aattcgcCACGTTGGCGATGTCATCCTAtatgcttgaatataactaTAGGATGACATCGCCAACGTGactg
Hairpin ID: SH01158.N2; FWD Oligo:
ctagcagtCACGGTTACTTCAAACAGCTAtagttatattcaagcataTAGCTGTTTGAAGTAACCGTGgcg, RVS
Oligo: aattcgcCACGGTTACTTCAAACAGCTAtatgcttgaatataactaTAGCTGTTTGAAGTAACCGTGactg
Hairpin ID: SH01229.N2; FWD Oligo:
ctagcagtAAGATGCAAGTCATAAATTAAtagttatattcaagcataTTAATTTATGACTTGCATCTTgcg, RVS Oligo:
aattcgcAAGATGCAAGTCATAAATTAAtatgcttgaatataactaTTAATTTATGACTTGCATCTTactg
Hairpin ID: SH00964.N; FWD Oligo:
ctagcagtTCGATGTGCAGTGCAAGATTAtagttatattcaagcataTAATCTTGCACTGCACATCGAgcg, RVS
Oligo: aattcgcTCGATGTGCAGTGCAAGATTAtatgcttgaatataactaTAATCTTGCACTGCACATCGAactg
Hairpin ID: SH01429.N2; FWD Oligo:
ctagcagtCAGGCAGTACTCAGTCTGTTAtagttatattcaagcataTAACAGACTGAGTACTGCCTGgcg, RVS
Oligo: aattcgcCAGGCAGTACTCAGTCTGTTAtatgcttgaatataactaTAACAGACTGAGTACTGCCTGactg
Hairpin ID: TR02686P.1; FWD Oligo: AAGAATTCGTGGGCATTTTCCTCTACGA, RVS Oligo:
AGTCTAGATACGTAAAGCCGATGAAGGG
Hairpin ID: SH01545.N2; FWD Oligo:
ctagcagtAACGTTGTTCGTAGTTTGTAAtagttatattcaagcataTTACAAACTACGAACAACGTTgcg, RVS Oligo:
aattcgcAACGTTGTTCGTAGTTTGTAAtatgcttgaatataactaTTACAAACTACGAACAACGTTactg
Hairpin ID: TR04535P.1; FWD Oligo: AAGAATTCAAATTACTCGAGCTGCCCAA, RVS Oligo:
AGTCTAGACCACAGGACGACGGTCTTAT
Hairpin ID: SH00300.N; FWD Oligo:
ctagcagtTCCGAGTTGGTCAACGACATAtagttatattcaagcataTATGTCGTTGACCAACTCGGAgcg, RVS
Oligo: aattcgcTCCGAGTTGGTCAACGACATAtatgcttgaatataactaTATGTCGTTGACCAACTCGGAactg
Hairpin ID: TR00185P.1; FWD Oligo: AAGAATTCCAAAAACTTTTGCCCGGTTA, RVS Oligo:
AGTCTAGAGTTCTTCGCGTTTCTCCTTG
Hairpin ID: SH01212.N2; FWD Oligo:
ctagcagtCCGGACGACGATGCTCCGGAAtagttatattcaagcataTTCCGGAGCATCGTCGTCCGGgcg, RVS
Oligo: aattcgcCCGGACGACGATGCTCCGGAAtatgcttgaatataactaTTCCGGAGCATCGTCGTCCGGactg
Hairpin ID: TR00240A.1; FWD Oligo: GTCTAGATTGCAGCTAAACCGAAGACC, RVS Oligo:
AGAATTCGCTTGCTTCTTTATCGGCAC
Hairpin ID: SH01418.N2; FWD Oligo:
ctagcagtCAGTTAGTAAATTGACTAATAtagttatattcaagcataTATTAGTCAATTTACTAACTGgcg, RVS Oligo:
aattcgcCAGTTAGTAAATTGACTAATAtatgcttgaatataactaTATTAGTCAATTTACTAACTGactg
Hairpin ID: TR01906P.1; FWD Oligo: CACCGAATTCAGCGAAAAAGAGCCCAAAAT, RVS Oligo:
TACACCATGTAATCGGTGGC
Hairpin ID: TR01254P.1; FWD Oligo: AGTCTAGAAGCCGCCATACAGCTACATC, RVS Oligo:
AAGAATTCCGCTGCACTCAGGACATTTA
Hairpin ID: SH01848.N; FWD Oligo:
ctagcagtACGGTGTGTGTTTACAAACAAtagttatattcaagcataTTGTTTGTAAACACACACCGTgcg, RVS
Oligo: aattcgcACGGTGTGTGTTTACAAACAAtatgcttgaatataactaTTGTTTGTAAACACACACCGTactg
Hairpin ID: TR01292P.1; FWD Oligo: AGTCTAGATGCACCACAAGAGCTTGAAC, RVS Oligo:
AAGAATTCGCTGAACCCTGTTCTTCTCG
Hairpin ID: TR00982P.1; FWD Oligo: AGTCTAGACAGGAGTTTGATCTGCACCA, RVS Oligo:
AAGAATTCGTAAGTCTGAGCCGGACAGC
Hairpin ID: SH01062.Nb; FWD Oligo:
ctagcagtAAGCGCGAGGATCACAGTCCAtagttatattcaagcataTGGACTGTGATCCTCGCGCTTgcg, RVS
Oligo: aattcgcAAGCGCGAGGATCACAGTCCAtatgcttgaatataactaTGGACTGTGATCCTCGCGCTTactg
Hairpin ID: TR01123P.1; FWD Oligo: AGTCTAGAATCTCAATCGGCATCGAATC, RVS Oligo:
AAGAATTCATGCTCATTCCACTCGAACC
Hairpin ID: TR00451P.1; FWD Oligo: GTCTAGAGTCCCCAGGTGTCGTACATT, RVS Oligo:
AGAATTCAAAAGCAAAAGCCAAACGAA
Hairpin ID: TR01472P.1; FWD Oligo: AGTCTAGAGCGCCATATGGATCAAAAAC, RVS Oligo:
AAGAATTCAGCTGCCTTGTTTGCATCTT
Hairpin ID: SH00545.N; FWD Oligo:
ctagcagtCCAGATCAAACTGCAGATCAAtagttatattcaagcataTTGATCTGCAGTTTGATCTGGgcg, RVS
Oligo: aattcgcCCAGATCAAACTGCAGATCAAtatgcttgaatataactaTTGATCTGCAGTTTGATCTGGactg
Hairpin ID: TR01943P.1; FWD Oligo: CACCGAATTCCAAGTACAGCGAGGAGGGAG, RVS Oligo:
TGAGGATGACAAAGTGCAGC
Hairpin ID: TR02690P.1; FWD Oligo: AAGAATTCGCTGCCTTCGAGTTTATTGC, RVS Oligo:
AGTCTAGACGAAGATGTGCTGGAATGTG
Hairpin ID: TR01531A.1; FWD Oligo: AGTCTAGACCTGAACAAGCGAAAAGACC, RVS Oligo:
AAGAATTCGGATTTCTGGATGTGGTGCT
Hairpin ID: TR00077A.1; FWD Oligo: GTCTAGACAGTTGCCTAGCACCAACAC, RVS Oligo:
AGAATTCTAGACCCCATCCGCTCTATC
Hairpin ID: TR00902P.1; FWD Oligo: AGTCTAGACAGTCAAAACTCCACTCGCA, RVS Oligo:
AAGAATTCAATCGTAATGCAGGAAACGG
Hairpin ID: TR02715P.1; FWD Oligo: AAGAATTCAGACAGCGGCTCATCAAAGT, RVS Oligo:
AGTCTAGACAATCTTGTCGTGCCTGACT
Hairpin ID: SH00918.N; FWD Oligo:
ctagcagtCAGAAAGATCATGCAGCAGATtagttatattcaagcataATCTGCTGCATGATCTTTCTGgcg, RVS
Oligo: aattcgcCAGAAAGATCATGCAGCAGATtatgcttgaatataactaATCTGCTGCATGATCTTTCTGactg
Hairpin ID: SH00919.N; FWD Oligo:
ctagcagtCTCGGCGGAGAACGAGACCAAtagttatattcaagcataTTGGTCTCGTTCTCCGCCGAGgcg, RVS
Oligo: aattcgcCTCGGCGGAGAACGAGACCAAtatgcttgaatataactaTTGGTCTCGTTCTCCGCCGAGactg
Hairpin ID: TR04549P.1; FWD Oligo: AAGAATTCGAACGAACGCGAGAAAACTC, RVS Oligo:
AGTCTAGATGACATCATGAGGGACGTGT
Hairpin ID: SH00145.N; FWD Oligo:
ctagcagtTACATCGGTTATTCAATTCTAtagttatattcaagcataTAGAATTGAATAACCGATGTAgcg, RVS Oligo:
aattcgcTACATCGGTTATTCAATTCTAtatgcttgaatataactaTAGAATTGAATAACCGATGTAactg
Hairpin ID: TR02672P.1; FWD Oligo: AAGAATTCCTGATCAACTGGCACTCCCT, RVS Oligo:
AGTCTAGACATCCTTAACCAGTCGCTCC
Hairpin ID: TR01684P.1; FWD Oligo: CACCGAATTCTCTCACCGAGGACGAGATTT, RVS Oligo:
CCAGGTCTTGACCTCCACAT
Hairpin ID: TR00505A.1; FWD Oligo: GTCTAGAACAACCAGTACATCGCCTCC, RVS Oligo:
AGAATTCATCTCCTCGGTTCCCTTGTT
Hairpin ID: TR01944P.1; FWD Oligo: CACCGAATTCAATACGCCATCATGTACGCA, RVS Oligo:
TGACTAGTACGCGCAAATGG
Hairpin ID: TR01945P.1; FWD Oligo: CACCGAATTCGCTGCTCCGGAATAGAAGTG, RVS Oligo:
GAACTGTTCGCCAACCAAAT
Hairpin ID: TR02551P.1; FWD Oligo: AAGAATTCATCATCATTTCTGTGCCGTG, RVS Oligo:
AGTCTAGAGTCCAAGTCCGCGTTTAGAA
Hairpin ID: SH00822.N; FWD Oligo:
ctagcagtCTGGTACGATCTGGACTACGAtagttatattcaagcataTCGTAGTCCAGATCGTACCAGgcg, RVS
Oligo: aattcgcCTGGTACGATCTGGACTACGAtatgcttgaatataactaTCGTAGTCCAGATCGTACCAGactg
Hairpin ID: TR02431P.1; FWD Oligo: AAGAATTCCATCTGCTCGATTGCACACT, RVS Oligo:
AGTCTAGACATTACTGGAGCTGGCCATT
Hairpin ID: TR02661P.1; FWD Oligo: AAGAATTCTGAGGCAAAAGTGTTTGTCG, RVS Oligo:
AGTCTAGACATCTCCACGTGATTGTGCT
Hairpin ID: TR01297P.1; FWD Oligo: AGTCTAGACCGGAATGTTCTATGCGATT, RVS Oligo:
AAGAATTCCACAAGCGGTCTGCTGATTA
Hairpin ID: TR02687P.1; FWD Oligo: AAGAATTCAACAGGAGAAGCGCACATTT, RVS Oligo:
AGTCTAGACCCAACATGATTTTGCACAG
Hairpin ID: TR02466P.1; FWD Oligo: AAGAATTCGCCTGAAGTCCAGTGCTAGG, RVS Oligo:
AGTCTAGACGCACTCCTTGTCCTTCTTC
Hairpin ID: SH00575.N; FWD Oligo:
ctagcagtCAGGAAGGATTATGTATCTAAtagttatattcaagcataTTAGATACATAATCCTTCCTGgcg, RVS Oligo:
aattcgcCAGGAAGGATTATGTATCTAAtatgcttgaatataactaTTAGATACATAATCCTTCCTGactg
Hairpin ID: TR00479P.1; FWD Oligo: GTCTAGAGGAGGAGTACGAGCAGAACG, RVS Oligo:
AGAATTCACGCTGATTTGCCCATTTAC
Hairpin ID: SH00098.N; FWD Oligo:
ctagcagtACGAGGTGATCAAGCTAAAGGtagttatattcaagcataCCTTTAGCTTGATCACCTCGTgcg, RVS
Oligo: aattcgcACGAGGTGATCAAGCTAAAGGtatgcttgaatataactaCCTTTAGCTTGATCACCTCGTactg
Hairpin ID: SH00686.N; FWD Oligo:
ctagcagtAAGGCGAGACGTCCTGAGAAAtagttatattcaagcataTTTCTCAGGACGTCTCGCCTTgcg, RVS
Oligo: aattcgcAAGGCGAGACGTCCTGAGAAAtatgcttgaatataactaTTTCTCAGGACGTCTCGCCTTactg
Hairpin ID: TR02414P.1; FWD Oligo: AAGAATTCATTCGACTGAACGTGGAACC, RVS Oligo:
AGTCTAGATTCTGCTGGTCCAATTTTCC
Hairpin ID: TR00220A.1; FWD Oligo: GTCTAGACTTCTCAATGGGCCAGGATA, RVS Oligo:
AGAATTCATGGGAAGTATCCCGATTCC
Hairpin ID: TR04613P.1; FWD Oligo: AACAATTGCGAGGAGAGCGTCAAGAAAG, RVS Oligo:
AGTCTAGATCATCCAGGTAGAAGGCACC
Hairpin ID: TR02346P.1; FWD Oligo: AAGAATTCCATTGGCAAGGAATTTGTCC, RVS Oligo:
AGTCTAGATGCCGTGCTGTTGTTATCAT
Hairpin ID: TR02656P.1; FWD Oligo: AACAATTGCGAACTTCTTCCGCACTTTC, RVS Oligo:
AGTCTAGACATAAAAGGGCCAACTTCCA
Hairpin ID: SH00146.N; FWD Oligo:
ctagcagtCACGAGACAGACAATGGATTAtagttatattcaagcataTAATCCATTGTCTGTCTCGTGgcg, RVS
Oligo: aattcgcCACGAGACAGACAATGGATTAtatgcttgaatataactaTAATCCATTGTCTGTCTCGTGactg
Hairpin ID: TR00093A.1; FWD Oligo: GTCTAGACCCGATCGTGATGTGTACTG, RVS Oligo:
AGAATTCGGCAATCCGAGCAGTAGAAG
Hairpin ID: TR01141P.1; FWD Oligo: AGTCTAGAAGCCTGAGCTTCAATCCCTT, RVS Oligo:
AAGAATTCTGCCCGTTCTTAACTTTTGG
Hairpin ID: TR04311P.1; FWD Oligo: AAGAATTCCGGCTATGAAGGAGTTCGAG, RVS Oligo:
AGTCTAGAGGTGTGGCACCAAAAAGAGT
Hairpin ID: TR02552P.1; FWD Oligo: AAGAATTCCTTCACCTACGCCTCACACA, RVS Oligo:
AGTCTAGAGTCACCTTCTGGTTGCCACT
Hairpin ID: TR02553P.1; FWD Oligo: AAGAATTCAGCAACTGAACTTGGACGCT, RVS Oligo:
AGTCTAGATTAGACATGGGTTTATTGCGG
Hairpin ID: SH01639.N; FWD Oligo:
ctagcagtCAGCAAGTTTGTCAGTGCTTAtagttatattcaagcataTAAGCACTGACAAACTTGCTGgcg, RVS
Oligo: aattcgcCAGCAAGTTTGTCAGTGCTTAtatgcttgaatataactaTAAGCACTGACAAACTTGCTGactg
Hairpin ID: SH00559.N; FWD Oligo:
ctagcagtCAAGAACAAGTTCCTCATCAAtagttatattcaagcataTTGATGAGGAACTTGTTCTTGgcg, RVS
Oligo: aattcgcCAAGAACAAGTTCCTCATCAAtatgcttgaatataactaTTGATGAGGAACTTGTTCTTGactg
Hairpin ID: TR00755A.1; FWD Oligo: GTCTAGACACAGCGACAGAAGCATCAT, RVS Oligo:
AGAATTCTTCTTGTATTCCCTCGTGGC
Hairpin ID: SH00465.N; FWD Oligo:
ctagcagtACGCGAGATTCTAGTTGTCAAtagttatattcaagcataTTGACAACTAGAATCTCGCGTgcg, RVS
Oligo: aattcgcACGCGAGATTCTAGTTGTCAAtatgcttgaatataactaTTGACAACTAGAATCTCGCGTactg
Hairpin ID: TR02408P.1; FWD Oligo: AAGAATTCATCCATCTGCCTGGTTCAAG, RVS Oligo:
AGTCTAGAGTGGTTGTTGGGCTGAAACT
Hairpin ID: SH01640.N; FWD Oligo:
ctagcagtCTGGAATGAGCTGACCATCAAtagttatattcaagcataTTGATGGTCAGCTCATTCCAGgcg, RVS
Oligo: aattcgcCTGGAATGAGCTGACCATCAAtatgcttgaatataactaTTGATGGTCAGCTCATTCCAGactg
Hairpin ID: TR02383P.1; FWD Oligo: AAGAATTCAAGGAACTCGAGAAGGCACA, RVS Oligo:
AGTCTAGACGTCACCGTTGGGTAGTTCT
Hairpin ID: SH00684.N; FWD Oligo:
ctagcagtCAGTCTGATAGAGATGTATAAtagttatattcaagcataTTATACATCTCTATCAGACTGgcg, RVS Oligo:
aattcgcCAGTCTGATAGAGATGTATAAtatgcttgaatataactaTTATACATCTCTATCAGACTGactg
Hairpin ID: SH00147.N; FWD Oligo:
ctagcagtCAGCTAGTGACTAAGATTTAAtagttatattcaagcataTTAAATCTTAGTCACTAGCTGgcg, RVS Oligo:
aattcgcCAGCTAGTGACTAAGATTTAAtatgcttgaatataactaTTAAATCTTAGTCACTAGCTGactg
Hairpin ID: TR00931P.1; FWD Oligo: AGTCTAGAGCAGGAGTACCACAATGGCT, RVS Oligo:
AAGAATTCGGTGACGCTCTTCTTTTTGC
Hairpin ID: TR01948P.1; FWD Oligo: CACCGAATTCAGTTGTCGGCGAGTTGAAGT, RVS Oligo:
TCGCCACACTTAGCACACTC
Hairpin ID: TR01299P.1; FWD Oligo: AGTCTAGAAACATGGCCTACCAGTTTCG, RVS Oligo:
AAGAATTCACGTCGCAGATATAGCCACC
Hairpin ID: SH00319.N; FWD Oligo:
ctagcagtCTGGATCAGATTGTAGGTTTAtagttatattcaagcataTAAACCTACAATCTGATCCAGgcg, RVS
Oligo: aattcgcCTGGATCAGATTGTAGGTTTAtatgcttgaatataactaTAAACCTACAATCTGATCCAGactg
Hairpin ID: TR00724A.1; FWD Oligo: GTCTAGAAACAACCATCAGAGGGATCG, RVS Oligo:
AGAATTCATCGCAGCCTTCCTAGTCAA
Hairpin ID: TR00725A.1; FWD Oligo: GTCTAGACAAGTGCCTATGTGCCTCAA, RVS Oligo:
AGAATTCGCGATCTCCTTTAGCACCAG
Hairpin ID: SH00366.N; FWD Oligo:
ctagcagtCAGGAAGAATTCGATACAGAAtagttatattcaagcataTTCTGTATCGAATTCTTCCTGgcg, RVS
Oligo: aattcgcCAGGAAGAATTCGATACAGAAtatgcttgaatataactaTTCTGTATCGAATTCTTCCTGactg
Hairpin ID: TR01301P.1; FWD Oligo: AGTCTAGAGCTATTGAGACCTACCGCCA, RVS Oligo:
AAGAATTCTGAGCCTTTGCGAATCTTTT
Hairpin ID: TR00148A.1; FWD Oligo: GTCTAGAGTTATTTTCTTCAACGGCGG, RVS Oligo:
AGAATTCTGCAGTAGGACTGATCGCAG
Hairpin ID: SH01741.N; FWD Oligo:
ctagcagtTCGAATATGTACTACGATGTAtagttatattcaagcataTACATCGTAGTACATATTCGAgcg, RVS Oligo:
aattcgcTCGAATATGTACTACGATGTAtatgcttgaatataactaTACATCGTAGTACATATTCGAactg
Hairpin ID: SH01742.N; FWD Oligo:
ctagcagtCAGATTGATAGGAGAAGTGAAtagttatattcaagcataTTCACTTCTCCTATCAATCTGgcg, RVS
Oligo: aattcgcCAGATTGATAGGAGAAGTGAAtatgcttgaatataactaTTCACTTCTCCTATCAATCTGactg
Hairpin ID: TR00474A.1; FWD Oligo: GTCTAGAATCCAGGACTTCTCCGAGGT, RVS Oligo:
ACAATTGATCAATAAGACGTCCGGGTG
Hairpin ID: SH00523.N; FWD Oligo:
ctagcagtCAGGAGATTTCAGTAGCTAAAtagttatattcaagcataTTTAGCTACTGAAATCTCCTGgcg, RVS
Oligo: aattcgcCAGGAGATTTCAGTAGCTAAAtatgcttgaatataactaTTTAGCTACTGAAATCTCCTGactg
Hairpin ID: TR01950P.1; FWD Oligo: CACCGAATTCAGAGGAACAGCAAAGCGAAA, RVS Oligo:
ATTCGCGTTCTGGCTGTAGT
Hairpin ID: SH01744.N; FWD Oligo:
ctagcagtCCGGTCATACCTGATCTAATAtagttatattcaagcataTATTAGATCAGGTATGACCGGgcg, RVS
Oligo: aattcgcCCGGTCATACCTGATCTAATAtatgcttgaatataactaTATTAGATCAGGTATGACCGGactg
Hairpin ID: TR02698P.1; FWD Oligo: AAGAATTCTCGAATGCAACTTGTTCTGC, RVS Oligo:
AGTCTAGATCATACTGGAAGGACCCTCG
Hairpin ID: TR01639A.1; FWD Oligo: AGTCTAGAAGCTGGCTTGCCGTCTAATA, RVS Oligo:
AAGAATTCCTTCTCCTTGGGCTGTTCTG
Hairpin ID: TR01638A.1; FWD Oligo: AGTCTAGATTGACCAATGGCGTAATCAA, RVS Oligo:
AAGAATTCGCACCTACAACATCGGGAGT
Hairpin ID: SH01641.N; FWD Oligo:
ctagcagtCCCGATGTTGTAGGTGCAATAtagttatattcaagcataTATTGCACCTACAACATCGGGgcg, RVS
Oligo: aattcgcCCCGATGTTGTAGGTGCAATAtatgcttgaatataactaTATTGCACCTACAACATCGGGactg
Hairpin ID: SH00535.N; FWD Oligo:
ctagcagtAAGATAAGCAGACGAAATATAtagttatattcaagcataTATATTTCGTCTGCTTATCTTgcg, RVS Oligo:
aattcgcAAGATAAGCAGACGAAATATAtatgcttgaatataactaTATATTTCGTCTGCTTATCTTactg
Hairpin ID: TR01303P.1; FWD Oligo: AGTCTAGAAACCCAGACAAAGCCACAAC, RVS Oligo:
AAGAATTCAATTCACGCTTACAGGTGGG
Hairpin ID: TR01305P.1; FWD Oligo: AGTCTAGAGAGCCAAGCGAAGTAACCAC, RVS Oligo:
AAGAATTCGAAGTTCTTTCGGCAGTTGG
Hairpin ID: TR02477P.1; FWD Oligo: AAGAATTCGTAGAGTCTCTGGGCCAACG, RVS Oligo:
AGTCTAGATACTTGCGCAATTGTTTTGC
Hairpin ID: TR04614P.1; FWD Oligo: AAGAATTCAGAGCAGCGGATCTCAAAAC, RVS Oligo:
AGTCTAGATCCTCTAAAATGAGGCTGCG
Hairpin ID: SH00148.N; FWD Oligo:
ctagcagtTCCGAGAAAGGTCAAGAGAAAtagttatattcaagcataTTTCTCTTGACCTTTCTCGGAgcg, RVS
Oligo: aattcgcTCCGAGAAAGGTCAAGAGAAAtatgcttgaatataactaTTTCTCTTGACCTTTCTCGGAactg
Hairpin ID: TR02714P.1; FWD Oligo: AAGAATTCCCTTCTATTTGCGCTTCGAG, RVS Oligo:
AGTCTAGATCTGGCTTTAAAACCCCCTT
Hairpin ID: SH01830.N; FWD Oligo:
ctagcagtTTGCGAGAGATTTAAGAAGAAtagttatattcaagcataTTCTTCTTAAATCTCTCGCAAgcg, RVS Oligo:
aattcgcTTGCGAGAGATTTAAGAAGAAtatgcttgaatataactaTTCTTCTTAAATCTCTCGCAAactg
Hairpin ID: TR02884P.1; FWD Oligo: AAGAATTCCGAACCAATATCAATGCACG, RVS Oligo:
AGTCTAGACCGAAATGTGGGACGATAAC
Hairpin ID: TR01685P.1; FWD Oligo: CACCGAATTCAGTCCGACGAACAATTGCAT, RVS Oligo:
TGCCATGGTCGTCTAAAATG
Hairpin ID: SH00149.N; FWD Oligo:
ctagcagtCTGGTTAAATGTTAGTCTTAAtagttatattcaagcataTTAAGACTAACATTTAACCAGgcg, RVS Oligo:
aattcgcCTGGTTAAATGTTAGTCTTAAtatgcttgaatataactaTTAAGACTAACATTTAACCAGactg
Hairpin ID: TR01307P.1; FWD Oligo: AGTCTAGACATGACCAAGAACTTGCCCT, RVS Oligo:
AAGAATTCATTTGCATTTGTAGGGCTGC
Hairpin ID: SH00720.N; FWD Oligo:
ctagcagtAAGAAGGTTAACACTGATCAAtagttatattcaagcataTTGATCAGTGTTAACCTTCTTgcg, RVS Oligo:
aattcgcAAGAAGGTTAACACTGATCAAtatgcttgaatataactaTTGATCAGTGTTAACCTTCTTactg
Hairpin ID: SH00982.N; FWD Oligo:
ctagcagtAAGCGTCAGCATCGATATATAtagttatattcaagcataTATATATCGATGCTGACGCTTgcg, RVS
Oligo: aattcgcAAGCGTCAGCATCGATATATAtatgcttgaatataactaTATATATCGATGCTGACGCTTactg
Hairpin ID: TR01308P.1; FWD Oligo: AGTCTAGAGCAGGAAAGCGTAGATCAGG, RVS Oligo:
AAGAATTCAGGTGCATGTACTGCTCGTG
Hairpin ID: TR01731P.1; FWD Oligo: CACCGAATTCGGTCAATGCGTCCGATTACT, RVS Oligo:
TGAAGTCACCGTGCGAGTAG
Hairpin ID: SH00594.N; FWD Oligo:
ctagcagtAAGATCAAGGACAACACCGAAtagttatattcaagcataTTCGGTGTTGTCCTTGATCTTgcg, RVS
Oligo: aattcgcAAGATCAAGGACAACACCGAAtatgcttgaatataactaTTCGGTGTTGTCCTTGATCTTactg
Hairpin ID: TR00673A.1; FWD Oligo: GTCTAGAACGAGAGGGGCAAACTTTTT, RVS Oligo:
AGAATTCGCGGGACTTCTTCTTCTCCT
Hairpin ID: TR00674A.1; FWD Oligo: GTCTAGACTGACATGTACTCGCGTGCT, RVS Oligo:
AGAATTCAGAGTGCTGATGTTTCGCCT
Hairpin ID: SH00857.N; FWD Oligo:
ctagcagtCAGATCAGTTGTTGAAATTAAtagttatattcaagcataTTAATTTCAACAACTGATCTGgcg, RVS Oligo:
aattcgcCAGATCAGTTGTTGAAATTAAtatgcttgaatataactaTTAATTTCAACAACTGATCTGactg
Hairpin ID: SH00420.N; FWD Oligo:
ctagcagtTAGGTGTTTGATTACGTTTAAtagttatattcaagcataTTAAACGTAATCAAACACCTAgcg, RVS Oligo:
aattcgcTAGGTGTTTGATTACGTTTAAtatgcttgaatataactaTTAAACGTAATCAAACACCTAactg
Hairpin ID: SH00949.N; FWD Oligo:
ctagcagtCAAGTACTAATTAATGTTGTAtagttatattcaagcataTACAACATTAATTAGTACTTGgcg, RVS Oligo:
aattcgcCAAGTACTAATTAATGTTGTAtatgcttgaatataactaTACAACATTAATTAGTACTTGactg
Hairpin ID: TR02740P.1; FWD Oligo: AAGAATTCCCCATCTTGAGTGCATTGTG, RVS Oligo:
AGTCTAGATCGTGAGCTCTGTCCAGTTG
Hairpin ID: TR00524A.1; FWD Oligo: GTCTAGAGGATTCAATTCGACTGCCAT, RVS Oligo:
AGAATTCAACGGCCTGCTTTAATTCCT
Hairpin ID: SH01353.N2; FWD Oligo:
ctagcagtTCGCTTAGTTAGATTGGTTAAtagttatattcaagcataTTAACCAATCTAACTAAGCGAgcg, RVS Oligo:
aattcgcTCGCTTAGTTAGATTGGTTAAtatgcttgaatataactaTTAACCAATCTAACTAAGCGAactg
Hairpin ID: SH00792.N; FWD Oligo:
ctagcagtCAGGCACATGTTTATCTACAAtagttatattcaagcataTTGTAGATAAACATGTGCCTGgcg, RVS
Oligo: aattcgcCAGGCACATGTTTATCTACAAtatgcttgaatataactaTTGTAGATAAACATGTGCCTGactg
Hairpin ID: TR01120P.1; FWD Oligo: AGTCTAGAGAAATGACGCGGAGACAGAT, RVS Oligo:
AAGAATTCCAGAATTTTGCTCGCATTCA
Hairpin ID: SH00814.N; FWD Oligo:
ctagcagtCCGAGTGGATTTGTCAGACAAtagttatattcaagcataTTGTCTGACAAATCCACTCGGgcg, RVS
Oligo: aattcgcCCGAGTGGATTTGTCAGACAAtatgcttgaatataactaTTGTCTGACAAATCCACTCGGactg
Hairpin ID: TR04615P.1; FWD Oligo: AAGAATTCTCCTTCTTCAAGTCGCTGGT, RVS Oligo:
AGACTAGTCGGGGATTCCTCTTATTGGT
Hairpin ID: SH00150.N; FWD Oligo:
ctagcagtAAGCAATGACCTAATGTTTAAtagttatattcaagcataTTAAACATTAGGTCATTGCTTgcg, RVS Oligo:
aattcgcAAGCAATGACCTAATGTTTAAtatgcttgaatataactaTTAAACATTAGGTCATTGCTTactg
Hairpin ID: SH00093.N; FWD Oligo:
ctagcagtGCGCATGGAGAGATTGCTAATtagttatattcaagcataATTAGCAATCTCTCCATGCGCgcg, RVS
Oligo: aattcgcGCGCATGGAGAGATTGCTAATtatgcttgaatataactaATTAGCAATCTCTCCATGCGCactg
Hairpin ID: SH00151.Nb; FWD Oligo:
ctagcagtTCGGATATCGAAGTAACGATAtagttatattcaagcataTATCGTTACTTCGATATCCGAgcg, RVS
Oligo: aattcgcTCGGATATCGAAGTAACGATAtatgcttgaatataactaTATCGTTACTTCGATATCCGAactg
Hairpin ID: TR00294A.1; FWD Oligo: GTCTAGACCCACCAGCAGCCTTACTAC, RVS Oligo:
AGAATTCGCTGCACCCAGTTTATTGGT
Hairpin ID: TR01732P.1; FWD Oligo: CACCGAATTCGCGTTCCAATGTGATAGGCT, RVS Oligo:
AAACAAAATCAGTGCTGGGC
Hairpin ID: SH00653.N; FWD Oligo:
ctagcagtATGGAGAAGGATGTCAATCAAtagttatattcaagcataTTGATTGACATCCTTCTCCATgcg, RVS
Oligo: aattcgcATGGAGAAGGATGTCAATCAAtatgcttgaatataactaTTGATTGACATCCTTCTCCATactg
Hairpin ID: TR01125P.1; FWD Oligo: AGTCTAGAAGCCAGCCAGAAAATGAAGA, RVS Oligo:
AAGAATTCAGACGGTTGCTTAGCTCCAA
Hairpin ID: SH01868.N; FWD Oligo:
ctagcagtCCGACGAATGAAGTTCAAGAAtagttatattcaagcataTTCTTGAACTTCATTCGTCGGgcg, RVS
Oligo: aattcgcCCGACGAATGAAGTTCAAGAAtatgcttgaatataactaTTCTTGAACTTCATTCGTCGGactg
Hairpin ID: TR01723P.1; FWD Oligo: CACCGAATTCTTGTGACTCAGTGCGAAACC, RVS Oligo:
TTTATTTGGGGGTGGTTGAA
Hairpin ID: TR01310P.1; FWD Oligo: AGTCTAGAACTGTCGGTTCCATGGGTAA, RVS Oligo:
AAGAATTCGTTAGTCAGATGCGCACGAA
Hairpin ID: TR01733P.1; FWD Oligo: CACCGAATTCCGATGGGTCGTTTCCATATC, RVS Oligo:
CGAATCAGTCAGCACTTCCA
Hairpin ID: TR00555A.1; FWD Oligo: GTCTAGACAGCTGAGATCATTCAGGCA, RVS Oligo:
AGAATTCCAACGTGGTGATTGTCAAGG
Hairpin ID: SH01869.N; FWD Oligo:
ctagcagtCAGTCGAGCGAAGATCTTCAAtagttatattcaagcataTTGAAGATCTTCGCTCGACTGgcg, RVS
Oligo: aattcgcCAGTCGAGCGAAGATCTTCAAtatgcttgaatataactaTTGAAGATCTTCGCTCGACTGactg
Hairpin ID: SH01642.N; FWD Oligo:
ctagcagtCCGCAGATACCGCGACACAAAtagttatattcaagcataTTTGTGTCGCGGTATCTGCGGgcg, RVS
Oligo: aattcgcCCGCAGATACCGCGACACAAAtatgcttgaatataactaTTTGTGTCGCGGTATCTGCGGactg
Hairpin ID: TR01081P.1; FWD Oligo: AGTCTAGAGTGTCTGCACTAATGCCACC, RVS Oligo:
AAGAATTCCCTGAACTTGGGCTCATCAT
Hairpin ID: TR01953P.1; FWD Oligo: CACCGAATTCGCGGCATTAACCGATCTAAA, RVS Oligo:
GGCATTTGCATTTTTCACCT
Hairpin ID: TR00575A.1; FWD Oligo: GTCTAGAATACCGTGTTGGTTTTCCCC, RVS Oligo:
AGAATTCACGGTGTACTCGCAGGAGTT
Hairpin ID: SH00357.N; FWD Oligo:
ctagcagtATGATGGACGACAACTACTTAtagttatattcaagcataTAAGTAGTTGTCGTCCATCATgcg, RVS
Oligo: aattcgcATGATGGACGACAACTACTTAtatgcttgaatataactaTAAGTAGTTGTCGTCCATCATactg
Hairpin ID: TR00628A.1; FWD Oligo: GTCTAGAGGCTACATGGCAAAACGAAT, RVS Oligo:
ACAATTGATTCACCGTATTCTCCAGCG
Hairpin ID: TR00629A.1; FWD Oligo: GTCTAGAAACAAGCGGAGAAGTACGGA, RVS Oligo:
AGAATTCTGCACTGTATGGATCCGTTT
Hairpin ID: TR01498A.1; FWD Oligo: AGTCTAGACCCATTAATTGCGGAGAAAA, RVS Oligo:
AAGAATTCATGATGGCGTTATGATCGGT
Hairpin ID: TR00769A.1; FWD Oligo: GTCTAGAGAAACCAGCTTCAAACGAGC, RVS Oligo:
AGAATTCCTCCTGCTTGATTTCTTCGC
Hairpin ID: TR01955P.1; FWD Oligo: CACCGAATTCGGACATCAAGGTGCTGGAAT, RVS Oligo:
AGCCAGCTGAAGCCAGACTA
Hairpin ID: TR01312P.1; FWD Oligo: AGTCTAGAAATAATCCACCACAACCGGA, RVS Oligo:
AAGAATTCATGTGAAGTAGGACGAGCCG
Hairpin ID: TR01532A.1; FWD Oligo: AGTCTAGAAACTGATCGTTTGGGACTCG, RVS Oligo:
AAGAATTCGTTGTCGTGCGAATACATGG
Hairpin ID: TR01907P.1; FWD Oligo: CACCGAATTCAGGCATGGTGTTGCAATGTA, RVS Oligo:
AGGATATTACCCAGGCCACC
Hairpin ID: TR02427P.1; FWD Oligo: AAGAATTCCAGTGCTGCAAAGTGACGAT, RVS Oligo:
AGTCTAGAGGTCTGCTCCGTGTCCTTTA
Hairpin ID: SH01720.N; FWD Oligo:
ctagcagtCTGCAAGTTCATAGACGACCAtagttatattcaagcataTGGTCGTCTATGAACTTGCAGgcg, RVS
Oligo: aattcgcCTGCAAGTTCATAGACGACCAtatgcttgaatataactaTGGTCGTCTATGAACTTGCAGactg
Hairpin ID: TR01047P.1; FWD Oligo: AGTCTAGAAATCGCACAGATGACGATGA, RVS Oligo:
AAGAATTCGATCTTCGGCTTGGTAGCTG
Hairpin ID: SH00858.N; FWD Oligo:
ctagcagtAAGCGAAGAAGAACAATTGAAtagttatattcaagcataTTCAATTGTTCTTCTTCGCTTgcg, RVS Oligo:
aattcgcAAGCGAAGAAGAACAATTGAAtatgcttgaatataactaTTCAATTGTTCTTCTTCGCTTactg
Hairpin ID: SH00859.N; FWD Oligo:
ctagcagtTACCAATTCTATTATGTTATAtagttatattcaagcataTATAACATAATAGAATTGGTAgcg, RVS Oligo:
aattcgcTACCAATTCTATTATGTTATAtatgcttgaatataactaTATAACATAATAGAATTGGTAactg
Hairpin ID: TR01734P.1; FWD Oligo: CACCGAATTCACAGCCAGTTCAGCGAAGAT, RVS Oligo:
TTAAATCCCTGCACAGGTCC
Hairpin ID: TR01956P.1; FWD Oligo: CACCGAATTCGTTCCTCTAACCGTGGTGGA, RVS Oligo:
CGCTATAGGGAAGCACTTGG
Hairpin ID: TR01601P.1; FWD Oligo: AAGAATTCCCGGGTCATGAAGATGAACT, RVS Oligo:
AGTCTAGATTGATTGGCACTTGTGGGTA
Hairpin ID: SH01792.N; FWD Oligo:
ctagcagtTAGGTTGTAGCTTCAATTACAtagttatattcaagcataTGTAATTGAAGCTACAACCTAgcg, RVS Oligo:
aattcgcTAGGTTGTAGCTTCAATTACAtatgcttgaatataactaTGTAATTGAAGCTACAACCTAactg
Hairpin ID: TR01093P.1; FWD Oligo: AGTCTAGAAATATCCAGCAACTCCACCG, RVS Oligo:
AAGAATTCAAATTTTTGTTTTTGGGGGC
Hairpin ID: TR01054P.1; FWD Oligo: AGTCTAGAACGGAGATCAGATTTCGCAG, RVS Oligo:
AAGAATTCGACAGGTATCGCTGTCCCTC
Hairpin ID: TR00615A.1; FWD Oligo: GTCTAGAGTCGGATGCTCGTTACCATT, RVS Oligo:
AGAATTCGAGTTGGGCCTGTAGGTGTC
Hairpin ID: TR00616A.1; FWD Oligo: GTCTAGAGGGCATCTACAGCTCGAAAG, RVS Oligo:
AGAATTCACACGATCTGGACGAAGGTC
Hairpin ID: TR01958P.1; FWD Oligo: CACCGAATTCCAACGGAGCAGATACCCAGT, RVS Oligo:
GTCCAAAGGACCAAGTTCCA
Hairpin ID: TR01908P.1; FWD Oligo: CACCGAATTCAGGACCTTTTCGATGCACAC, RVS Oligo:
AAAGTGGTTGCCACAAGGAC
Hairpin ID: TR01909P.1; FWD Oligo: CACCGAATTCTCAACGTTCTGAACTCGTCG, RVS Oligo:
AGGCCAGAGTCCTTGCTACA
Hairpin ID: SH00152.N; FWD Oligo:
ctagcagtCTGGTACAAACCAGAATAATAtagttatattcaagcataTATTATTCTGGTTTGTACCAGgcg, RVS Oligo:
aattcgcCTGGTACAAACCAGAATAATAtatgcttgaatataactaTATTATTCTGGTTTGTACCAGactg
Hairpin ID: TR01467P.1; FWD Oligo: AGTCTAGACGCAATGAAGAACGAAGTGA, RVS Oligo:
AAGAATTCGCTTTTGATGTCCTTGGGAA
Hairpin ID: SH00566.N; FWD Oligo:
ctagcagtCAGCAATGTGTCACTAATGTAtagttatattcaagcataTACATTAGTGACACATTGCTGgcg, RVS
Oligo: aattcgcCAGCAATGTGTCACTAATGTAtatgcttgaatataactaTACATTAGTGACACATTGCTGactg
Hairpin ID: TR00151A.1; FWD Oligo: GTCTAGACGACAAAAGCTTACGTGCAA, RVS Oligo:
AGAATTCTCTGGTTACGGGAGAACTCG
Hairpin ID: TR00746A.1; FWD Oligo: GTCTAGACCACCTAGAAACCGTTGGAA, RVS Oligo:
AGAATTCTGACCAGATCATTCTGCTGC
Hairpin ID: TR01314P.1; FWD Oligo: AGTCTAGAGACCGTATACCTGCGTCCAT, RVS Oligo:
AAGAATTCATCCATCGCTTTGTGTTTCC
Hairpin ID: TR01735P.1; FWD Oligo: CACCGAATTCGATCCATGTCCTCCATACCG, RVS Oligo:
TCCTCGTGAACGTTCTCCTT
Hairpin ID: TR01316P.1; FWD Oligo: AGTCTAGATGGCCACAGTGGTGAAGATA, RVS Oligo:
AAGAATTCATCACTGTCCGTATCCGAGC
Hairpin ID: SH00683.N; FWD Oligo:
ctagcagtTAGCAAGTTTGGCAAGCTCAAtagttatattcaagcataTTGAGCTTGCCAAACTTGCTAgcg, RVS
Oligo: aattcgcTAGCAAGTTTGGCAAGCTCAAtatgcttgaatataactaTTGAGCTTGCCAAACTTGCTAactg
Hairpin ID: SH00446.N; FWD Oligo:
ctagcagtGAGGAGGTGATTCAATCCTAAtagttatattcaagcataTTAGGATTGAATCACCTCCTCgcg, RVS
Oligo: aattcgcGAGGAGGTGATTCAATCCTAAtatgcttgaatataactaTTAGGATTGAATCACCTCCTCactg
Hairpin ID: SH00512.N; FWD Oligo:
ctagcagtCACCGAGTTGTGTTTATACTAtagttatattcaagcataTAGTATAAACACAACTCGGTGgcg, RVS
Oligo: aattcgcCACCGAGTTGTGTTTATACTAtatgcttgaatataactaTAGTATAAACACAACTCGGTGactg
Hairpin ID: SH01278.N2; FWD Oligo:
ctagcagtTACCAGATGAATGACGATCTAtagttatattcaagcataTAGATCGTCATTCATCTGGTAgcg, RVS
Oligo: aattcgcTACCAGATGAATGACGATCTAtatgcttgaatataactaTAGATCGTCATTCATCTGGTAactg
Hairpin ID: TR04467P.1; FWD Oligo: AAGAATTCGTTCATTTTCGACGGGTAGG, RVS Oligo:
AGTCTAGACCCCGCTCATCTTGAACTAC
Hairpin ID: TR02520P.1; FWD Oligo: AAGAATTCGCTAAACGATCAGCTCTGCC, RVS Oligo:
AGTCTAGACGATCAAGCAGATCATCGAA
Hairpin ID: SH00403.N; FWD Oligo:
ctagcagtCCGACTGACTGGAGAATACTAtagttatattcaagcataTAGTATTCTCCAGTCAGTCGGgcg, RVS
Oligo: aattcgcCCGACTGACTGGAGAATACTAtatgcttgaatataactaTAGTATTCTCCAGTCAGTCGGactg
Hairpin ID: SH00975.N; FWD Oligo:
ctagcagtCCGTTAAGTTGTAACTACCTAtagttatattcaagcataTAGGTAGTTACAACTTAACGGgcg, RVS
Oligo: aattcgcCCGTTAAGTTGTAACTACCTAtatgcttgaatataactaTAGGTAGTTACAACTTAACGGactg
Hairpin ID: TR00664A.1; FWD Oligo: GTCTAGAAGCTAAACGAAGGCAGAGCA, RVS Oligo:
AGAATTCTGGCAGTTGAACGATGGATA
Hairpin ID: TR00665A.1; FWD Oligo: GTCTAGAATGAAGTACGACTCGACGGG, RVS Oligo:
AGAATTCAGGTCATCGCCTTGATGTTC
Hairpin ID: TR01736P.1; FWD Oligo: CACCGAATTCAGCTAAACGAAGGCAGAGCA, RVS Oligo:
TGGCAGTTGAACGATGGATA
Hairpin ID: TR01686P.1; FWD Oligo: CACCGAATTCAGTGAAGCCTGGCTACCTGA, RVS Oligo:
CACGGAACGGAGCTTTACTC
Hairpin ID: TR01910P.1; FWD Oligo: CACCGAATTCAAATGATGCAATGCTGGTGA, RVS Oligo:
GGTGCTTCATGGCGACTATT
Hairpin ID: TR01091P.1; FWD Oligo: AGTCTAGATCGACTTCAGCAACATGAGC, RVS Oligo:
AAGAATTCGGCCTAACCAATGTTGTGCT
Hairpin ID: SH00854.N; FWD Oligo:
ctagcagtCACCGACAAATTCCTCGACAAtagttatattcaagcataTTGTCGAGGAATTTGTCGGTGgcg, RVS
Oligo: aattcgcCACCGACAAATTCCTCGACAAtatgcttgaatataactaTTGTCGAGGAATTTGTCGGTGactg
Hairpin ID: TR01535A.1; FWD Oligo: AGTCTAGATTCCGTGCCAAATTCTATCC, RVS Oligo:
AAGAATTCAAATGTTGCGAATCTCGGAC
Hairpin ID: TR01535P.1; FWD Oligo: AGTCTAGATTCCGTGCCAAATTCTATCC, RVS Oligo:
AAGAATTCAAATGTTGCGAATCTCGGAC
Hairpin ID: SH00779.N; FWD Oligo:
ctagcagtCAGCAAGAGCAGATAATAATAtagttatattcaagcataTATTATTATCTGCTCTTGCTGgcg, RVS Oligo:
aattcgcCAGCAAGAGCAGATAATAATAtatgcttgaatataactaTATTATTATCTGCTCTTGCTGactg
Hairpin ID: TR01118P.1; FWD Oligo: AGTCTAGAAAAAACCGTCGGTGAAACAC, RVS Oligo:
AAGAATTCGAAGCGGGACAACTCCAGTA
Hairpin ID: TR01881P.1; FWD Oligo: CACCGAATTCAGAGGAAAGCCCTCTTCGAG, RVS Oligo:
GCGAGACCATGAAGACCAAT
Hairpin ID: TR01268P.1; FWD Oligo: AGTCTAGACGCACGAAGAATAGAGGGAG, RVS Oligo:
AACAATTGCTTCTGTGTGAGCAGGACCA
Hairpin ID: TR04252P.1; FWD Oligo: AAGAATTCTCATCCGGTAGATTTCCAGC, RVS Oligo:
AGTCTAGATCAAGATAACAGTGCGCAGG
Hairpin ID: TR02924P.1; FWD Oligo: AAGAATTCACGGATCATTGTGGTGGAAT, RVS Oligo:
AGTCTAGACTTTCCGGACTCACATCCAT
Hairpin ID: SH01831.N; FWD Oligo:
ctagcagtCTGTGTCAAGGTGTTCAACTAtagttatattcaagcataTAGTTGAACACCTTGACACAGgcg, RVS
Oligo: aattcgcCTGTGTCAAGGTGTTCAACTAtatgcttgaatataactaTAGTTGAACACCTTGACACAGactg
Hairpin ID: TR01048P.1; FWD Oligo: AGTCTAGAGCGAGAAGCGCTCAGAGTAT, RVS Oligo:
AAGAATTCTGGCGGTTGTTAATCCAAGT
Hairpin ID: TR01564A.1; FWD Oligo: AGTCTAGACAGACAGCACCCAACTGCTA, RVS Oligo:
AAGAATTCTAGACAAAGTCACCCCAGGC
Hairpin ID: SH00123.N; FWD Oligo:
ctagcagtACGAAGCATTGTTCTGATTTAtagttatattcaagcataTAAATCAGAACAATGCTTCGTgcg, RVS Oligo:
aattcgcACGAAGCATTGTTCTGATTTAtatgcttgaatataactaTAAATCAGAACAATGCTTCGTactg
Hairpin ID: SH01745.N; FWD Oligo:
ctagcagtATGGATAAATGTGTATGACAAtagttatattcaagcataTTGTCATACACATTTATCCATgcg, RVS Oligo:
aattcgcATGGATAAATGTGTATGACAAtatgcttgaatataactaTTGTCATACACATTTATCCATactg
Hairpin ID: TR02685P.1; FWD Oligo: AAGAATTCTCATTGAACTGCAGGTAGCG, RVS Oligo:
AGTCTAGAACCATGCCATTTAGTCGGTT
Hairpin ID: SH00568.N; FWD Oligo:
ctagcagtTTCGATAAATATAGAATATAAtagttatattcaagcataTTATATTCTATATTTATCGAAgcg, RVS Oligo:
aattcgcTTCGATAAATATAGAATATAAtatgcttgaatataactaTTATATTCTATATTTATCGAAactg
Hairpin ID: TR02503P.1; FWD Oligo: AAGAATTCTTTTCGGATTGATTTTTCGC, RVS Oligo:
AGTCTAGAAGCACGACATGTAGCTGGTG
Hairpin ID: TR01959P.1; FWD Oligo: CACCGAATTCCAAAGCCTCGTACGATGTGA, RVS Oligo:
GCTGCACTTCTCCGAGTACC
Hairpin ID: TR04616P.1; FWD Oligo: AAGAATTCGATCCCCGAGAGATTGTGAA, RVS Oligo:
AGTCTAGAGGTATACACTCCACCGGCTC
Hairpin ID: TR00895P.1; FWD Oligo: CAAAGTGACGCATAGCTCCA, RVS Oligo:
AAGTGAATTCGGTTATCCTAGCCCTACGCC
Hairpin ID: TR00896P.1; FWD Oligo: CGATCGCAGACGACAGATAA, RVS Oligo:
AAGTGAATTCGATCCTTGCCGGTATTCTGA
Hairpin ID: TR02429P.1; FWD Oligo: AAGAATTCCATCCGGCAAGATCGTCTAT, RVS Oligo:
AGTCTAGAATTCCGTTTGAAGATCGCAG
Hairpin ID: SH00511.N; FWD Oligo:
ctagcagtCAGGTTTAAGTTAGTACGTTTtagttatattcaagcataAAACGTACTAACTTAAACCTGgcg, RVS Oligo:
aattcgcCAGGTTTAAGTTAGTACGTTTtatgcttgaatataactaAAACGTACTAACTTAAACCTGactg
Hairpin ID: SH00734.N; FWD Oligo:
ctagcagtCAGCAAGAAAGTGTTGGTTTAtagttatattcaagcataTAAACCAACACTTTCTTGCTGgcg, RVS
Oligo: aattcgcCAGCAAGAAAGTGTTGGTTTAtatgcttgaatataactaTAAACCAACACTTTCTTGCTGactg
Hairpin ID: TR03162P.1; FWD Oligo: AAGAATTCGGACCAGAGGGTCCTGTGTA, RVS Oligo:
AGTCTAGAAGGGCATATCCGTGTGTAGC
Hairpin ID: TR01911P.1; FWD Oligo: CACCGAATTCCTGAAGCAGATGACAAAGCG, RVS Oligo:
GAACTCCTCCTGCGAGATGT
Hairpin ID: SH00662.N; FWD Oligo:
ctagcagtTACGATGTATTGCTCAACAAAtagttatattcaagcataTTTGTTGAGCAATACATCGTAgcg, RVS Oligo:
aattcgcTACGATGTATTGCTCAACAAAtatgcttgaatataactaTTTGTTGAGCAATACATCGTAactg
Hairpin ID: TR01737P.1; FWD Oligo: CACCGAATTCGAAAGGAAAGCAACAGCAGC, RVS Oligo:
GGTCAGCTTAAAGTGCTCCG
Hairpin ID: TR04605P.1; FWD Oligo: AAGAATTCTACTCTCCGCGATACAACCC, RVS Oligo:
AGTCTAGATCGTCCATGGAAAAGGAGTC
Hairpin ID: SH00638.N; FWD Oligo:
ctagcagtCAGATACTTACTACTTTGTTAtagttatattcaagcataTAACAAAGTAGTAAGTATCTGgcg, RVS Oligo:
aattcgcCAGATACTTACTACTTTGTTAtatgcttgaatataactaTAACAAAGTAGTAAGTATCTGactg
Hairpin ID: TR00063A.2; FWD Oligo: GTCTAGAAGGGACCCGAAAGTCCTAGA, RVS Oligo:
AGAATTCGCTACCGCGCACTTTTACTC
Hairpin ID: TR00064A.1; FWD Oligo: GTCTAGAGACCAGCCCATTTTTGAGAA, RVS Oligo:
AGAATTCAAGGTTATGTTGCGGGTGAG
Hairpin ID: TR00065P.1; FWD Oligo: AAGAATTCTCATGCAAAAAGTGTCGCTC, RVS Oligo:
AGTCTAGACGCATCAGTTCCTCCTCTTC
Hairpin ID: TR00063P.1; FWD Oligo: GTCTAGAAGGGACCCGAAAGTCCTAGA, RVS Oligo:
AGAATTCGCTACCGCGCACTTTTACTC
Hairpin ID: TR04617P.1; FWD Oligo: AAGAATTCACAATTCAGCAAGGGAATCG, RVS Oligo:
AGTCTAGATGGAATTGGTAGACACCACG
Hairpin ID: SH01643.N; FWD Oligo:
ctagcagtTACCGTGTTGATATTGCTCAAtagttatattcaagcataTTGAGCAATATCAACACGGTAgcg, RVS
Oligo: aattcgcTACCGTGTTGATATTGCTCAAtatgcttgaatataactaTTGAGCAATATCAACACGGTAactg
Hairpin ID: TR00813A.1; FWD Oligo: GTCTAGAAGAAGAGCACCCAGGAGACA, RVS Oligo:
AGAATTCTAGCGTCCGATAGACAGGCT
Hairpin ID: TR01738P.1; FWD Oligo: CACCGAATTCATGTCTCGCATTGTGACAGC, RVS Oligo:
AACTTCAAGCAATTGGCAGG
Hairpin ID: TR02344P.1; FWD Oligo: AAGAATTCTTGTATCCTTCTGAACGCCA, RVS Oligo:
AGTCTAGACACGCCTGATTCTTGCAGTA
Hairpin ID: SH00153.N; FWD Oligo:
ctagcagtAACGGTCAAGATGTCCAGCAAtagttatattcaagcataTTGCTGGACATCTTGACCGTTgcg, RVS
Oligo: aattcgcAACGGTCAAGATGTCCAGCAAtatgcttgaatataactaTTGCTGGACATCTTGACCGTTactg
Hairpin ID: TR01739P.1; FWD Oligo: CACCGAATTCAAAAAGGTCATTGTGCCGTC, RVS Oligo:
GGTGTCCTCCATGCAAAGTT
Hairpin ID: TR01724P.1; FWD Oligo: CACCGAATTCTGCAGGTTCAGCAACAACAT, RVS Oligo:
GTGGTTATAATGCCGCCAAC
Hairpin ID: TR00591A.1; FWD Oligo: GTCTAGAATGGAGTCCGGTAACGTGTC, RVS Oligo:
AGAATTCGGAGCCAATGATTCCAAAGA
Hairpin ID: TR00592A.1; FWD Oligo: GTCTAGAGGATCAGGCCAAGAAGATGA, RVS Oligo:
AGAATTCAGTTCGTTGCCGTTTCAGTT
Hairpin ID: TR00547A.1; FWD Oligo: GTCTAGACGTGCGTCAGATCTTCGATA, RVS Oligo:
AGAATTCCTGTGCTTCTCGACCCTCTC
Hairpin ID: TR01740P.1; FWD Oligo: CACCGAATTCTCAGGAAAACATGGGCTACC, RVS Oligo:
TATTACGTTGACGTGCGAGC
Hairpin ID: TR01725P.1; FWD Oligo: CACCGAATTCACGCCAACGATTTTAACCAG, RVS Oligo:
CTGAAAGCAATCAAATCGCA
Hairpin ID: SH00154.N; FWD Oligo:
ctagcagtAAGAATTAGAATGATAGTATAtagttatattcaagcataTATACTATCATTCTAATTCTTgcg, RVS Oligo:
aattcgcAAGAATTAGAATGATAGTATAtatgcttgaatataactaTATACTATCATTCTAATTCTTactg
Hairpin ID: TR02337P.1; FWD Oligo: AAGAATTCTGTCTCACGCCCATCTACAG, RVS Oligo:
AGTCTAGATGAGCTCATCGAGACATTGG
Hairpin ID: SH00495.N; FWD Oligo:
ctagcagtAGAGTTCTACATGTTCACCAAtagttatattcaagcataTTGGTGAACATGTAGAACTCTgcg, RVS
Oligo: aattcgcAGAGTTCTACATGTTCACCAAtatgcttgaatataactaTTGGTGAACATGTAGAACTCTactg
Hairpin ID: SH00538.N; FWD Oligo:
ctagcagtAACGCGATAAATGGTATAGAAtagttatattcaagcataTTCTATACCATTTATCGCGTTgcg, RVS Oligo:
aattcgcAACGCGATAAATGGTATAGAAtatgcttgaatataactaTTCTATACCATTTATCGCGTTactg
Hairpin ID: TR02634P.1; FWD Oligo: AAGAATTCTCCTCCTATATCACCTGGCG, RVS Oligo:
AGTCTAGAAGTCGAAAATGCAATCCTGG
Hairpin ID: TR01145P.1; FWD Oligo: AGTCTAGAGCCGGATCGTTCAGAATAAA, RVS Oligo:
AAGAATTCCCTGCTCCATGTCCACTTTT
Hairpin ID: TR01618P.1; FWD Oligo: AGTCTAGAACGCTGTGAGCAAGGAAAAT, RVS Oligo:
AACAATTGTATATGACGTTGACTGCCGC
Hairpin ID: TR00221A.1; FWD Oligo: GTCTAGAATTGAGCAGCGCGAGATTAT, RVS Oligo:
AGAATTCTCTTGTCGTCCGTCTTGTTG
Hairpin ID: SH00544.N; FWD Oligo:
ctagcagtAAGGACGAAGATGACATGCAAtagttatattcaagcataTTGCATGTCATCTTCGTCCTTgcg, RVS
Oligo: aattcgcAAGGACGAAGATGACATGCAAtatgcttgaatataactaTTGCATGTCATCTTCGTCCTTactg
Hairpin ID: TR01318P.1; FWD Oligo: AGTCTAGACGGCGAGATCTTCTACGAAC, RVS Oligo:
AAGAATTCCGGTTGATAGTCTTGCGGAT
Hairpin ID: SH01644.N; FWD Oligo:
ctagcagtCAAGACGTTTGTGAACTTGAAtagttatattcaagcataTTCAAGTTCACAAACGTCTTGgcg, RVS
Oligo: aattcgcCAAGACGTTTGTGAACTTGAAtatgcttgaatataactaTTCAAGTTCACAAACGTCTTGactg
Hairpin ID: SH00599.N; FWD Oligo:
ctagcagtTAGCAATGAGATGACGACCAAtagttatattcaagcataTTGGTCGTCATCTCATTGCTAgcg, RVS
Oligo: aattcgcTAGCAATGAGATGACGACCAAtatgcttgaatataactaTTGGTCGTCATCTCATTGCTAactg
Hairpin ID: TR02709P.1; FWD Oligo: AAGAATTCAAGGCCTCAATGTGCTCTTC, RVS Oligo:
AGTCTAGAAACCGCTGTCATCGTTTACC
Hairpin ID: SH00156.N; FWD Oligo:
ctagcagtTTCGATGATGTGGTTAAACAAtagttatattcaagcataTTGTTTAACCACATCATCGAAgcg, RVS Oligo:
aattcgcTTCGATGATGTGGTTAAACAAtatgcttgaatataactaTTGTTTAACCACATCATCGAAactg
Hairpin ID: TR02676P.1; FWD Oligo: AAGAATTCTTCGAAGAATCGATGAACCC, RVS Oligo:
AGTCTAGAACCTTGTGGGGGTATGTGAA
Hairpin ID: TR01320P.1; FWD Oligo: AGTCTAGAGCACACAGTGTCATTGGACC, RVS Oligo:
AAGAATTCTCTTCTTTTATCGCGGCTGT
Hairpin ID: TR01474A.1; FWD Oligo: AGTCTAGAGCAGCAAGCCACAGTTATGA, RVS Oligo:
AAGAATTCATCACCGCCCTTCTTTACCT
Hairpin ID: TR01742P.1; FWD Oligo: CACCGAATTCGCTCCAGCTGTGGACTTAGG, RVS Oligo:
TGGTACCTGTCCACCACTCA
Hairpin ID: TR03201P.1; FWD Oligo: AAGAATTCTACACCGTCGATTATGCCAA, RVS Oligo:
AGTCTAGATTGCGAATCGGAATGAAAAT
Hairpin ID: SH00794.N; FWD Oligo:
ctagcagtCTGACGTTTGTAGTTAATGTAtagttatattcaagcataTACATTAACTACAAACGTCAGgcg, RVS Oligo:
aattcgcCTGACGTTTGTAGTTAATGTAtatgcttgaatataactaTACATTAACTACAAACGTCAGactg
Hairpin ID: SH00500.N; FWD Oligo:
ctagcagtCCAGATGTCTGTAGCATTTAAtagttatattcaagcataTTAAATGCTACAGACATCTGGgcg, RVS
Oligo: aattcgcCCAGATGTCTGTAGCATTTAAtatgcttgaatataactaTTAAATGCTACAGACATCTGGactg
Hairpin ID: SH01645.N; FWD Oligo:
ctagcagtAAGCTGAAGTTCTACTATCTAtagttatattcaagcataTAGATAGTAGAACTTCAGCTTgcg, RVS Oligo:
aattcgcAAGCTGAAGTTCTACTATCTAtatgcttgaatataactaTAGATAGTAGAACTTCAGCTTactg
Hairpin ID: SH00764.N; FWD Oligo:
ctagcagtCCGAATGATCTTCAATAGCAAtagttatattcaagcataTTGCTATTGAAGATCATTCGGgcg, RVS
Oligo: aattcgcCCGAATGATCTTCAATAGCAAtatgcttgaatataactaTTGCTATTGAAGATCATTCGGactg
Hairpin ID: TR00018A.1; FWD Oligo: GTCTAGATACACCTGCCAAATCACCAA, RVS Oligo:
AGAATTCTCACCAGATGCGTAAATCCA
Hairpin ID: TR00019A.3; FWD Oligo: GTCTAGATCACATGTCAGTGGTCGGTT, RVS Oligo:
AGAATTCGGGCTTGTTGTTGTGGTTCT
Hairpin ID: TR01964P.1; FWD Oligo: CACCGAATTCATGCTGCTGGAAAAACGACT, RVS Oligo:
TCCTTCATAAAGACCGTGCC
Hairpin ID: TR00795A.1; FWD Oligo: GTCTAGAGTTCTCTCTGGCAAACAGGC, RVS Oligo:
AGAATTCTTGCTGATCCTTGCAGTGAC
Hairpin ID: SH00815.N; FWD Oligo:
ctagcagtCAGAAACGAGCTGCAACTATAtagttatattcaagcataTATAGTTGCAGCTCGTTTCTGgcg, RVS
Oligo: aattcgcCAGAAACGAGCTGCAACTATAtatgcttgaatataactaTATAGTTGCAGCTCGTTTCTGactg
Hairpin ID: TR00802A.1; FWD Oligo: GTCTAGAGCTGCGAAGAGAAGACGAGT, RVS Oligo:
AGAATTCCCAGCCTTTTGCATAACCTC
Hairpin ID: TR01965P.1; FWD Oligo: CACCGAATTCAGATCCACCTGGAAATCGTG, RVS Oligo:
GATGTTGGGAATCGTGCTCT
Hairpin ID: TR01652A.1; FWD Oligo: AGTCTAGACGTACGGCCACCTACTCAAT, RVS Oligo:
AAGAATTCGCAAAGCCGATAAAAATTGC
Hairpin ID: TR01651A.1; FWD Oligo: AGTCTAGACTCTGAGACGGAACTACCGC, RVS Oligo:
AAGAATTCCCATTTGTTGCGTAAACGTG
Hairpin ID: TR02666P.1; FWD Oligo: AACAATTGTCAGAGTTCCGCAGCAGTTA, RVS Oligo:
AGTCTAGAGCTGGTGCCTGAAGAAATGT
Hairpin ID: TR01966P.1; FWD Oligo: CACCGAATTCCGATTTTTCATCGCAACCTT, RVS Oligo:
ATGTCCTCTGCCGTCAAAAC
Hairpin ID: TR01534A.1; FWD Oligo: AGTCTAGACTAAAGAAGAGCGGTGGTCG, RVS Oligo:
AAGAATTCGAGGCCAAAGATGAGCTGTC
Hairpin ID: TR02406P.1; FWD Oligo: AAGAATTCAGTATCAAGGTTTGTGGCGG, RVS Oligo:
AGTCTAGAAAGGGGACACCAGTAGGCTT
Hairpin ID: SH00157.N; FWD Oligo:
ctagcagtTCCGTTAATCCTAACTATATAtagttatattcaagcataTATATAGTTAGGATTAACGGAgcg, RVS Oligo:
aattcgcTCCGTTAATCCTAACTATATAtatgcttgaatataactaTATATAGTTAGGATTAACGGAactg
Hairpin ID: TR04468P.1; FWD Oligo: AAGAATTCTGAATCAACAGATCGCAAGC, RVS Oligo:
AGTCTAGATAACTTCTGCAGTGCCATCG
Hairpin ID: SH00509.N; FWD Oligo:
ctagcagtAAGGTTCAAATTCTTGATAAAtagttatattcaagcataTTTATCAAGAATTTGAACCTTgcg, RVS Oligo:
aattcgcAAGGTTCAAATTCTTGATAAAtatgcttgaatataactaTTTATCAAGAATTTGAACCTTactg
Hairpin ID: TR02696P.1; FWD Oligo: AAGAATTCGCTAACGGAGGATGGGTACA, RVS Oligo:
AGTCTAGAGAAAGATCTGAGGCGACAGC
Hairpin ID: TR01322P.1; FWD Oligo: AGTCTAGATCGGGCAGTGTTATTGTTGA, RVS Oligo:
AAGAATTCATTTTGCTCCTTGTGCTTGG
Hairpin ID: TR01653A.1; FWD Oligo: AGTCTAGAAGAAATCGTTGGACGAATGG, RVS Oligo:
AAGAATTCCCGTATTACTTATGCGGGGA
Hairpin ID: TR04462P.1; FWD Oligo: AAGAATTCACCTCCTCCTCTCCGACATT, RVS Oligo:
AGTCTAGAGAGCTTGGTGAGTCTTTGCC
Hairpin ID: SH00478.N; FWD Oligo:
ctagcagtCTCGCAGATACCCGACGACAAtagttatattcaagcataTTGTCGTCGGGTATCTGCGAGgcg, RVS
Oligo: aattcgcCTCGCAGATACCCGACGACAAtatgcttgaatataactaTTGTCGTCGGGTATCTGCGAGactg
Hairpin ID: TR00556A.1; FWD Oligo: GTCTAGACAGAAGTGGCGTTGCATCTA, RVS Oligo:
AGAATTCTATGGTACACGCTGGGGATT
Hairpin ID: SH01016.N; FWD Oligo:
ctagcagtACGAGTGTGTGACGAACATAAtagttatattcaagcataTTATGTTCGTCACACACTCGTgcg, RVS
Oligo: aattcgcACGAGTGTGTGACGAACATAAtatgcttgaatataactaTTATGTTCGTCACACACTCGTactg
Hairpin ID: SH01017.N; FWD Oligo:
ctagcagtTAGGGACAACTTGATGGTAAAtagttatattcaagcataTTTACCATCAAGTTGTCCCTAgcg, RVS
Oligo: aattcgcTAGGGACAACTTGATGGTAAAtatgcttgaatataactaTTTACCATCAAGTTGTCCCTAactg
Hairpin ID: TR01431P.1; FWD Oligo: AGTCTAGACCCCAGTGAATTAAACAGCAA, RVS Oligo:
AAGAATTCATGGTGATGACTCAGGAGGG
Hairpin ID: SH00427.N; FWD Oligo:
ctagcagtATCGATGGTGACGACTACGAAtagttatattcaagcataTTCGTAGTCGTCACCATCGATgcg, RVS
Oligo: aattcgcATCGATGGTGACGACTACGAAtatgcttgaatataactaTTCGTAGTCGTCACCATCGATactg
Hairpin ID: TR01968P.1; FWD Oligo: CACCGAATTCGCCACTGGAACAACACTCAA, RVS Oligo:
GACTTGCTCTTGGCCTTCTG
Hairpin ID: TR02682P.1; FWD Oligo: AAGAATTCGGACCCTCTAGTGCAGCATC, RVS Oligo:
AGTCTAGATGGGGACATCGGCTATATTC
Hairpin ID: TR02718P.1; FWD Oligo: AAGAATTCGTCATTATCATGGGCTCGCT, RVS Oligo:
AGTCTAGAGCCGTAACATTCCCTGACAT
Hairpin ID: SH01646.N; FWD Oligo:
ctagcagtTCCCTACAGCGAGAAGATCAAtagttatattcaagcataTTGATCTTCTCGCTGTAGGGAgcg, RVS
Oligo: aattcgcTCCCTACAGCGAGAAGATCAAtatgcttgaatataactaTTGATCTTCTCGCTGTAGGGAactg
Hairpin ID: TR01116P.1; FWD Oligo: AGTCTAGACGTCGCTCGCTTAGTAATCC, RVS Oligo:
AAGAATTCCTTTGTTTGGGTTTGTGCCT
Hairpin ID: TR02533P.1; FWD Oligo: AAGAATTCATCTACATAGCACCGTCGGG, RVS Oligo:
AGTCTAGAGTTTTGGCCTTCTCCCAGTT
Hairpin ID: TR03231P.1; FWD Oligo: AAGAATTCTCAGTCTGCGACAACTGGAC, RVS Oligo:
AGTCTAGACAGTCACAGGACAGGGGATT
Hairpin ID: TR01912P.1; FWD Oligo: CACCGAATTCTACTTGGTGGGCTATTTCCG, RVS Oligo:
ACGGATTGGAAAGTGTCTGG
Hairpin ID: SH00642.N; FWD Oligo:
ctagcagtCAGGACGAGAGCTAAGTTATAtagttatattcaagcataTATAACTTAGCTCTCGTCCTGgcg, RVS
Oligo: aattcgcCAGGACGAGAGCTAAGTTATAtatgcttgaatataactaTATAACTTAGCTCTCGTCCTGactg
Hairpin ID: TR03233P.1; FWD Oligo: AAGAATTCCCACACCGCATTAGAGGAAT, RVS Oligo:
AGTCTAGAAATGGACATTGCCCAACAAT
Hairpin ID: TR01025P.1; FWD Oligo: AGTCTAGAAACCCCCAACATCAAAATCA, RVS Oligo:
AAGAATTCTTCTCGTACGTTGGGGACTC
Hairpin ID: TR02347P.1; FWD Oligo: AAGAATTCCACTGGAATCAAAGTCGTCG, RVS Oligo:
AGTCTAGATTTGCCCATATACGAGAGCC
Hairpin ID: TR01743P.1; FWD Oligo: CACCGAATTCAATTTCTAATGCCTTGCCCC, RVS Oligo:
ATTATTGCCACCTTCGTCCA
Hairpin ID: TR02535P.1; FWD Oligo: AAGAATTCTTTCCCGGGTTACTTTGATG, RVS Oligo:
AGTCTAGAAATCAGATGCTAAATGGGCG
Hairpin ID: TR01969P.1; FWD Oligo: CACCGAATTCTCTACGAAACCCAGGAGGTG, RVS Oligo:
GCTGCACATCTCCTCCAGAT
Hairpin ID: TR02508P.1; FWD Oligo: AAGAATTCGCAAGAAGGCAACTGAGGAC, RVS Oligo:
AGTCTAGATGGTTGCTCGCTAGTCCTTT
Hairpin ID: TR01970P.1; FWD Oligo: CACCGAATTCGGAGATGGAGAGGCGTTGTA, RVS Oligo:
GAGGTGCGCCAAATATTCAT
Hairpin ID: TR01119P.1; FWD Oligo: AGTCTAGAATTTGCGTGGGAAATACGAG, RVS Oligo:
AAGAATTCGTCCGATTGCGCTGTAACTT
Hairpin ID: SH00699.N; FWD Oligo:
ctagcagtCACGTCTTCAGTGATCGTCAAtagttatattcaagcataTTGACGATCACTGAAGACGTGgcg, RVS
Oligo: aattcgcCACGTCTTCAGTGATCGTCAAtatgcttgaatataactaTTGACGATCACTGAAGACGTGactg
Hairpin ID: TR00912P.1; FWD Oligo: AGTCTAGACTCGCTTAGCTATGATCCGC, RVS Oligo:
AAGAATTCGCGATTCAGTTACGGCACTT
Hairpin ID: TR00222A.1; FWD Oligo: GTCTAGAGGCAACTGGACGTGGTCTAT, RVS Oligo:
AGAATTCCATGACCTCGCAGAGTCGTA
Hairpin ID: TR01971P.1; FWD Oligo: CACCGAATTCCCAAATTCCTGAATGCCACT, RVS Oligo:
GCTGACCAGTCCACGGTATT
Hairpin ID: TR02444P.1; FWD Oligo: AAGAATTCCGCGACTTCATACGCAACTA, RVS Oligo:
AGTCTAGATGGTACATGTTCTGGCTGGA
Hairpin ID: TR03680P.1; FWD Oligo: AAGAATTCAACATGTCGACCCTTTCCAG, RVS Oligo:
AGTCTAGATCGTCATAGCTGACACCCTG
Hairpin ID: TR01744P.1; FWD Oligo: CACCGAATTCGGTGATCGCTGGATTTGATT, RVS Oligo:
CAGCAGCCTCAGTCACGTAG
Hairpin ID: TR04469P.1; FWD Oligo: AAGAATTCAGTCCAGGAGCAAGTGGAGA, RVS Oligo:
AGTCTAGAACCATTGCCTGGAGTGAAAC
Hairpin ID: TR01972P.1; FWD Oligo: CACCGAATTCAACTGGACCTGGACAATTCG, RVS Oligo:
AGTGACAATCGAAGGATGCC
Hairpin ID: SH00079.N; FWD Oligo:
ctagcagtTACGACTGTGTGGCAGACATAtagttatattcaagcataTATGTCTGCCACACAGTCGTAgcg, RVS
Oligo: aattcgcTACGACTGTGTGGCAGACATAtatgcttgaatataactaTATGTCTGCCACACAGTCGTAactg
Hairpin ID: SH01243.N2; FWD Oligo:
ctagcagtTCGAGTGCGAATAAAGAACAAtagttatattcaagcataTTGTTCTTTATTCGCACTCGAgcg, RVS
Oligo: aattcgcTCGAGTGCGAATAAAGAACAAtatgcttgaatataactaTTGTTCTTTATTCGCACTCGAactg
Hairpin ID: TR01324P.1; FWD Oligo: AGTCTAGAGCGCACCTAAAGAACCACAT, RVS Oligo:
AAGAATTCCTATGGCACACTCGCATTTG
Hairpin ID: SH00414.N; FWD Oligo:
ctagcagtCCGAAGCTTGTTCGCTTTCTAtagttatattcaagcataTAGAAAGCGAACAAGCTTCGGgcg, RVS
Oligo: aattcgcCCGAAGCTTGTTCGCTTTCTAtatgcttgaatataactaTAGAAAGCGAACAAGCTTCGGactg
Hairpin ID: SH01277.N2; FWD Oligo:
ctagcagtTGGGTTTATGATGTTCGTAAAtagttatattcaagcataTTTACGAACATCATAAACCCAgcg, RVS Oligo:
aattcgcTGGGTTTATGATGTTCGTAAAtatgcttgaatataactaTTTACGAACATCATAAACCCAactg
Hairpin ID: TR04150P.1; FWD Oligo: AAGAATTCCCACATTCCAGCCCTACACT, RVS Oligo:
AGTCTAGAAGCTGAGTGTGCAACAATGC
Hairpin ID: TR04551P.1; FWD Oligo: AAGAATTCCCTTCTGCGACGAGGACTAC, RVS Oligo:
AGTCTAGAGCTTGAAGTGCTCTTGGGTC
Hairpin ID: TR01973P.1; FWD Oligo: CACCGAATTCGCCGAACTAGAGTACCGCAC, RVS Oligo:
GGTGCTCCAGGTTTGTGTTT
Hairpin ID: TR02473P.1; FWD Oligo: AAGAATTCGGAGCTTAAAGTCGAAGCCA, RVS Oligo:
AGTCTAGACGTCATTTCAGGGAACACCT
Hairpin ID: TR03641P.1; FWD Oligo: AAGAATTCATAAGGCCGTCGTTCAAATG, RVS Oligo:
AGTCTAGAAGTAGCCAACCAAATGGCAC
Hairpin ID: TR02554P.1; FWD Oligo: AAGAATTCGGAAAACAGGCGACATTCAT, RVS Oligo:
AGTCTAGAAGGAGGCTCCAAGTGGGTAT
Hairpin ID: TR02555P.1; FWD Oligo: AAGAATTCAGGCCACGGATCAGGATAAG, RVS Oligo:
AGTCTAGATGGGAGAAATCGATACAGGC
Hairpin ID: SH00908.N; FWD Oligo:
ctagcagtCTCGATGGCATCCTACGACAAtagttatattcaagcataTTGTCGTAGGATGCCATCGAGgcg, RVS
Oligo: aattcgcCTCGATGGCATCCTACGACAAtatgcttgaatataactaTTGTCGTAGGATGCCATCGAGactg
Hairpin ID: SH00909.N; FWD Oligo:
ctagcagtTGCATAGTTTCTTGAAGTCAAtagttatattcaagcataTTGACTTCAAGAAACTATGCAgcg, RVS Oligo:
aattcgcTGCATAGTTTCTTGAAGTCAAtatgcttgaatataactaTTGACTTCAAGAAACTATGCAactg
Hairpin ID: TR01419P.1; FWD Oligo: AGTCTAGACACGACAGCAATAGCGAGAG, RVS Oligo:
AAGAATTCGCTGCCTAATGCGAATTTCT
Hairpin ID: TR00551A.1; FWD Oligo: GTCTAGACTAACCTGGAGCTCCGACAG, RVS Oligo:
AGAATTCCGTTCTCTGTGCTGGAATCA
Hairpin ID: SH00810.N; FWD Oligo:
ctagcagtATGGTCGAAGAGTTAAGACTAtagttatattcaagcataTAGTCTTAACTCTTCGACCATgcg, RVS
Oligo: aattcgcATGGTCGAAGAGTTAAGACTAtatgcttgaatataactaTAGTCTTAACTCTTCGACCATactg
Hairpin ID: TR02377P.1; FWD Oligo: AAGAATTCAAATATGTGAAGAGGCCCCC, RVS Oligo:
AGTCTAGATCTCCTTCGATGTTGACGTG
Hairpin ID: TR01974P.1; FWD Oligo: CACCGAATTCATGCAGAACGACAACACAGC, RVS Oligo:
TCCATTCGTCTACATTGGCA
Hairpin ID: TR01913P.1; FWD Oligo: CACCGAATTCTCGTGTGTGCCGTTAAGAAG, RVS Oligo:
ATCTCCATTGGCATCAGGAG
Hairpin ID: TR00779P.1; FWD Oligo: GTCTAGATGTCTGTGATCCACGACTCC, RVS Oligo:
AGAATTCTGCTGAAGCACAAGATGTCC
Hairpin ID: TR01746P.1; FWD Oligo: CACCGAATTCCGTGGTCCACAACAAAGATG, RVS Oligo:
TGCTTGTCGAAACTCACTGG
Hairpin ID: TR01914P.1; FWD Oligo: CACCGAATTCTGGAGTCTTCCTGCAAATCC, RVS Oligo:
CTTTTGGGAGTTGTGTGGCT
Hairpin ID: TR01090P.1; FWD Oligo: AGTCTAGATGTCGCAACGATTTCTTCAG, RVS Oligo:
AAGAATTCCGGAATCGTCATGGGTATTT
Hairpin ID: SH00483.N; FWD Oligo:
ctagcagtATGGTCGACGATATACTTCAAtagttatattcaagcataTTGAAGTATATCGTCGACCATgcg, RVS
Oligo: aattcgcATGGTCGACGATATACTTCAAtatgcttgaatataactaTTGAAGTATATCGTCGACCATactg
Hairpin ID: TR01592P.1; FWD Oligo: AAGAATTCTCCAACGCTGTGGACTACTG, RVS Oligo:
AGTCTAGACCTCGACGCAAGGTGATATT
Hairpin ID: TR02629P.1; FWD Oligo: AAGAATTCTCTTGAGGAGAACAAGGATGC, RVS Oligo:
AGTCTAGACGGTGTTGCTGGTATTGTTG
Hairpin ID: SH00649.N; FWD Oligo:
ctagcagtAAGGAAGTGAACACACTCAAAtagttatattcaagcataTTTGAGTGTGTTCACTTCCTTgcg, RVS
Oligo: aattcgcAAGGAAGTGAACACACTCAAAtatgcttgaatataactaTTTGAGTGTGTTCACTTCCTTactg
Hairpin ID: SH00364.N; FWD Oligo:
ctagcagtCTGGTATGTGACGATCTAGAAtagttatattcaagcataTTCTAGATCGTCACATACCAGgcg, RVS
Oligo: aattcgcCTGGTATGTGACGATCTAGAAtatgcttgaatataactaTTCTAGATCGTCACATACCAGactg
Hairpin ID: SH00158.N; FWD Oligo:
ctagcagtCAGTGTGGTATTGACCATCTAtagttatattcaagcataTAGATGGTCAATACCACACTGgcg, RVS
Oligo: aattcgcCAGTGTGGTATTGACCATCTAtatgcttgaatataactaTAGATGGTCAATACCACACTGactg
Hairpin ID: TR00961P.1; FWD Oligo: AGTCTAGAGACAGCGAAACCAAGTCACA, RVS Oligo:
AAGAATTCGTAGCCATTGGGCAGTTGTT
Hairpin ID: TR00223A.1; FWD Oligo: GTCTAGACACATTCCGGCTCCATAACT, RVS Oligo:
AGAATTCGTTTTGTTAAGGGCTCGCTG
Hairpin ID: SH00159.N; FWD Oligo:
ctagcagtTACGAACATCAGTCAGATTTAtagttatattcaagcataTAAATCTGACTGATGTTCGTAgcg, RVS Oligo:
aattcgcTACGAACATCAGTCAGATTTAtatgcttgaatataactaTAAATCTGACTGATGTTCGTAactg
Hairpin ID: TR02679P.1; FWD Oligo: AAGAATTCGTTGAGGCAAACGAAACCAT, RVS Oligo:
AGTCTAGATTGGACAGCAGATGAACCAG
Hairpin ID: SH00783.N; FWD Oligo:
ctagcagtAAGCATGATGATCTCAAGCAAtagttatattcaagcataTTGCTTGAGATCATCATGCTTgcg, RVS
Oligo: aattcgcAAGCATGATGATCTCAAGCAAtatgcttgaatataactaTTGCTTGAGATCATCATGCTTactg
Hairpin ID: TR00224A.1; FWD Oligo: GTCTAGACTGCAGTGATACCAGCCTGA, RVS Oligo:
AGAATTCCAATCTGGCCTGGGAATAAA
Hairpin ID: SH00406.N; FWD Oligo:
ctagcagtTAGCTACTTGTTTGTTTGTAAtagttatattcaagcataTTACAAACAAACAAGTAGCTAgcg, RVS Oligo:
aattcgcTAGCTACTTGTTTGTTTGTAAtatgcttgaatataactaTTACAAACAAACAAGTAGCTAactg
Hairpin ID: TR02490P.1; FWD Oligo: AAGAATTCTCCACTCACAAGCACAAAGC, RVS Oligo:
AGTCTAGACACCCTGGTACGCTTTGAAT
Hairpin ID: TR00933P.1; FWD Oligo: AGTCTAGAGCCCAACAGTTGCATACCTT, RVS Oligo:
AAGAATTCACCCGAAGAACGGAGAGTTT
Hairpin ID: SH00160.N; FWD Oligo:
ctagcagtTTGGTTAGTTTCACATTGTAAtagttatattcaagcataTTACAATGTGAAACTAACCAAgcg, RVS Oligo:
aattcgcTTGGTTAGTTTCACATTGTAAtatgcttgaatataactaTTACAATGTGAAACTAACCAAactg
Hairpin ID: TR01326P.1; FWD Oligo: AGTCTAGAAAGGAATGCCCCTTCAAGTT, RVS Oligo:
AAGAATTCCTTTTTGCCACACACATTGC
Hairpin ID: TR01915P.1; FWD Oligo: CACCGAATTCCCCGTACTGCATTGAGGACT, RVS Oligo:
TGAGTTCGCCTTTGGAGAGT
Hairpin ID: SH00435.N; FWD Oligo:
ctagcagtTCAGATGCTGCTGTTCATCAAtagttatattcaagcataTTGATGAACAGCAGCATCTGAgcg, RVS
Oligo: aattcgcTCAGATGCTGCTGTTCATCAAtatgcttgaatataactaTTGATGAACAGCAGCATCTGAactg
Hairpin ID: TR04552P.1; FWD Oligo: AAGAATTCGTCGATTGCAGAGGAGAAGG, RVS Oligo:
AGTCTAGATCGTCCTTATGGGTAAACGC
Hairpin ID: SH00161.N; FWD Oligo:
ctagcagtCAGTGTTAGCTTAGACTATAAtagttatattcaagcataTTATAGTCTAAGCTAACACTGgcg, RVS Oligo:
aattcgcCAGTGTTAGCTTAGACTATAAtatgcttgaatataactaTTATAGTCTAAGCTAACACTGactg
Hairpin ID: SH00063.N; FWD Oligo:
ctagcagtCCGCTCAACACGCACACCCAAtagttatattcaagcataTTGGGTGTGCGTGTTGAGCGGgcg, RVS
Oligo: aattcgcCCGCTCAACACGCACACCCAAtatgcttgaatataactaTTGGGTGTGCGTGTTGAGCGGactg
Hairpin ID: TR01975P.1; FWD Oligo: CACCGAATTCGCTGCAGGATGTCAACTTCA, RVS Oligo:
CTTAAAGGCGTGGGAGGTCT
Hairpin ID: TR01129P.1hm; FWD Oligo: AGTCTAGACATGCAGATACCACCACAGG, RVS Oligo:
AAGAATTCGCCACCGTTACGAAGTTGTT
Hairpin ID: TR01129P.1; FWD Oligo: AGTCTAGACATGCAGATACCACCACAGG, RVS Oligo:
AAGAATTCGCCACCGTTACGAAGTTGTT
Hairpin ID: TR04470P.1; FWD Oligo: AAGAATTCATGACAGCAACGATGAGCTG, RVS Oligo:
AGTCTAGAGTACATGGCGTAGCCCAGAT
Hairpin ID: TR00385P.1; FWD Oligo: GTCTAGAGGCAGTACCAGATTGCCAAC, RVS Oligo:
AGAATTCCTTCAGCTTCTCCACCTGCT
Hairpin ID: TR01147P.1; FWD Oligo: AGTCTAGAAGCCTCAACGAACAGGAAGA, RVS Oligo:
AAGAATTCGTTGGCCACGTACTCTCCAT
Hairpin ID: TR00478A.1; FWD Oligo: GTCTAGATAAATCGTTTCATCACCGCA, RVS Oligo:
AGAATTCCAACAAATCTGCGCTTGGTA
Hairpin ID: SH00116.N; FWD Oligo:
ctagcagtTACGAGAGTCTCGACAAGAAAtagttatattcaagcataTTTCTTGTCGAGACTCTCGTAgcg, RVS
Oligo: aattcgcTACGAGAGTCTCGACAAGAAAtatgcttgaatataactaTTTCTTGTCGAGACTCTCGTAactg
Hairpin ID: SH01272.N2b; FWD Oligo:
ctagcagtAACCAAATTGTTGTACAATTAtagttatattcaagcataTAATTGTACAACAATTTGGTTgcg, RVS Oligo:
aattcgcAACCAAATTGTTGTACAATTAtatgcttgaatataactaTAATTGTACAACAATTTGGTTactg
Hairpin ID: TR02065P.1; FWD Oligo: CACTGGCACATACATCGTCC, RVS Oligo:
AAGTGAATTCACTATGAAGTCCCGCAGTCG
Hairpin ID: SH01647.N; FWD Oligo:
ctagcagtCCCGACCAAGACGTTCGTGAAtagttatattcaagcataTTCACGAACGTCTTGGTCGGGgcg, RVS
Oligo: aattcgcCCCGACCAAGACGTTCGTGAAtatgcttgaatataactaTTCACGAACGTCTTGGTCGGGactg
Hairpin ID: TR00288P.1; FWD Oligo: AAGAATTCAGCAGTAGAGCAGCAGGGTC, RVS Oligo:
AGTCTAGAGCCGCAAATAAATCGAAAAA
Hairpin ID: TR00117A.1; FWD Oligo: GTCTAGAGCGTTGAGGAGTTGGAGAAG, RVS Oligo:
AGAATTCGCCAGCTTGAAGAAGTGGTC
Hairpin ID: TR02509P.1; FWD Oligo: AAGAATTCACCTGTTACACGCCTCATCC, RVS Oligo:
AGTCTAGAGAGTTCTGCACCACACTCCA
Hairpin ID: TR02556P.1; FWD Oligo: AACAATTGTGAAAAACACTTCCTTGGGG, RVS Oligo:
AGTCTAGAAGTTTCCCTCAATCCCGAAT
Hairpin ID: TR02650P.1; FWD Oligo: AAGAATTCTCCCTTTACCATCCATACGC, RVS Oligo:
AGTCTAGACTGGAATCGGCATAATCGTT
Hairpin ID: TR01976P.1; FWD Oligo: CACCGAATTCATTAAAAGCTGGCTGGAGCA, RVS Oligo:
GGCATATCGTACTTGGGCAG
Hairpin ID: TR01276P.1; FWD Oligo: AGTCTAGAATGTTTTTCATACACGCCCC, RVS Oligo:
AAGAATTCCTCCTCCTCCAAAGAAGCCT
Hairpin ID: TR01977P.1; FWD Oligo: CACCGAATTCTAAGGATGGAACACTTCGCC, RVS Oligo:
AGCAGAGCACAGACTCCCAT
Hairpin ID: TR03331P.1; FWD Oligo: AAGAATTCCTGCTCTACACTGCCATCCA, RVS Oligo:
AGTCTAGACCCCACATAGGCTAGAACCA
Hairpin ID: TR00680A.1; FWD Oligo: GTCTAGATCACAAATGCTAAAGCACGC, RVS Oligo:
AGAATTCCCTGGTTACCATAGGCCAGA
Hairpin ID: TR00681A.1; FWD Oligo: GTCTAGAGAAAGTGCTCTCCGTTTGCT, RVS Oligo:
AGAATTCCGTGATGGTGGATGCAATAG
Hairpin ID: SH00162.N; FWD Oligo:
ctagcagtCAGCTCCAGTTGCATCATATAtagttatattcaagcataTATATGATGCAACTGGAGCTGgcg, RVS
Oligo: aattcgcCAGCTCCAGTTGCATCATATAtatgcttgaatataactaTATATGATGCAACTGGAGCTGactg
Hairpin ID: TR01747P.1; FWD Oligo: CACCGAATTCGCTATTTGGCGCAACTGAAT, RVS Oligo:
TTTGGGTGGAATACATGGCT
Hairpin ID: SH00163.N; FWD Oligo:
ctagcagtCTCAATCTTTGTGATACTTTAtagttatattcaagcataTAAAGTATCACAAAGATTGAGgcg, RVS Oligo:
aattcgcCTCAATCTTTGTGATACTTTAtatgcttgaatataactaTAAAGTATCACAAAGATTGAGactg
Hairpin ID: SH00604.N; FWD Oligo:
ctagcagtTAAGGCTAAGATCCAAGACAAtagttatattcaagcataTTGTCTTGGATCTTAGCCTTAgcg, RVS
Oligo: aattcgcTAAGGCTAAGATCCAAGACAAtatgcttgaatataactaTTGTCTTGGATCTTAGCCTTAactg
Hairpin ID: SH00579.N; FWD Oligo:
ctagcagtCACAGCGCTACTGTCAACTAAtagttatattcaagcataTTAGTTGACAGTAGCGCTGTGgcg, RVS
Oligo: aattcgcCACAGCGCTACTGTCAACTAAtatgcttgaatataactaTTAGTTGACAGTAGCGCTGTGactg
Hairpin ID: TR01056P.1; FWD Oligo: AGTCTAGAAATGAATCTCAGCCAGCACC, RVS Oligo:
AAGAATTCCTGCTAAGTACGTTGGCCGT
Hairpin ID: TR01038P.1; FWD Oligo: AGTCTAGACCACCTGAACCTTAGCCTGA, RVS Oligo:
AAGAATTCAAACTGCATTTGCATCAACG
Hairpin ID: TR00829A.1; FWD Oligo: GTCTAGAACGATGATTACCAGTTCGCC, RVS Oligo:
AGAATTCAAACCACGTCCTTAACCGTG
Hairpin ID: SH00725.N; FWD Oligo:
ctagcagtTAGGAGGAGGATATCACTATAtagttatattcaagcataTATAGTGATATCCTCCTCCTAgcg, RVS
Oligo: aattcgcTAGGAGGAGGATATCACTATAtatgcttgaatataactaTATAGTGATATCCTCCTCCTAactg
Hairpin ID: TR00361P.1; FWD Oligo: GTCTAGACAGTAACCGCACAAAACGTG, RVS Oligo:
AGAATTCTGCCGTGGGTGTAATACAGA
Hairpin ID: TR02405P.1; FWD Oligo: AAGAATTCAGGTGGGCTATTACGACGTG, RVS Oligo:
AGTCTAGAGATATCCGGCCTTCTTAGCC
Hairpin ID: SH00434.N; FWD Oligo:
ctagcagtTCCGAATAGATTCACGAGTTAtagttatattcaagcataTAACTCGTGAATCTATTCGGAgcg, RVS
Oligo: aattcgcTCCGAATAGATTCACGAGTTAtatgcttgaatataactaTAACTCGTGAATCTATTCGGAactg
Hairpin ID: TR01331P.1; FWD Oligo: AGTCTAGAGACACCAAGTACCGATGCCT, RVS Oligo:
AAGAATTCATAAATCCCGACCAGGGAAC
Hairpin ID: SH00310.N; FWD Oligo:
ctagcagtCAAAGCCAAGATACAGGACAAtagttatattcaagcataTTGTCCTGTATCTTGGCTTTGgcg, RVS
Oligo: aattcgcCAAAGCCAAGATACAGGACAAtatgcttgaatataactaTTGTCCTGTATCTTGGCTTTGactg
Hairpin ID: TR01687P.1; FWD Oligo: CACCGAATTCAATCCCAAGAGCGAAGTCCT, RVS Oligo:
GCTTGCAGTCCAGAAAGAGC
Hairpin ID: SH00717.N; FWD Oligo:
ctagcagtACAGCTCTTTCTGGACTGCAAtagttatattcaagcataTTGCAGTCCAGAAAGAGCTGTgcg, RVS
Oligo: aattcgcACAGCTCTTTCTGGACTGCAAtatgcttgaatataactaTTGCAGTCCAGAAAGAGCTGTactg
Hairpin ID: TR02400P.1; FWD Oligo: AAGAATTCAGAAAACGCAGGACAAATCG, RVS Oligo:
AGTCTAGACTCCACATCCAGGTCATCCT
Hairpin ID: TR04536P.1; FWD Oligo: AAGAATTCCAAGTTCGTGGACAAGCTCA, RVS Oligo:
AGTCTAGATGGCTTGAGTTAGCATCGTG
Hairpin ID: TR01149P.1; FWD Oligo: AGTCTAGAGCCACTCAGCTGGAGAAATC, RVS Oligo:
AAGAATTCTCCAGATGACATCCCAATGA
Hairpin ID: SH00936.N; FWD Oligo:
ctagcagtACCGATGAGGAGGCTCATAAAtagttatattcaagcataTTTATGAGCCTCCTCATCGGTgcg, RVS
Oligo: aattcgcACCGATGAGGAGGCTCATAAAtatgcttgaatataactaTTTATGAGCCTCCTCATCGGTactg
Hairpin ID: TR01459P.1; FWD Oligo: AGTCTAGATGGATCTGCAGTACCACTCG, RVS Oligo:
AAGAATTCTCCACGGGATCATAAAGAGC
Hairpin ID: SH00934.N; FWD Oligo:
ctagcagtCAAGGTCTAAGCGATAATCTAtagttatattcaagcataTAGATTATCGCTTAGACCTTGgcg, RVS
Oligo: aattcgcCAAGGTCTAAGCGATAATCTAtatgcttgaatataactaTAGATTATCGCTTAGACCTTGactg
Hairpin ID: TR02710P.1; FWD Oligo: AAGAATTCGTTCGGTGACAACACCAATG, RVS Oligo:
AGTCTAGAATTGAACCTCAAAGGTTGCG
Hairpin ID: TR01405P.1; FWD Oligo: AGTCTAGAGTGCACATCCAGAAGCGTTA, RVS Oligo:
AAGAATTCGTGAAGGGGCAATACCACAC
Hairpin ID: TR01258P.1; FWD Oligo: AGTCTAGACCAGCAACAGCATTCAGAGA, RVS Oligo:
AAGAATTCTACTTCGAATCGGGTTTTCG
Hairpin ID: TR01875P.1; FWD Oligo: CACCGAATTCCTTTGAAGTCCAGCGAGGTC, RVS Oligo:
GCGAAGTACATGAGGAAGGC
Hairpin ID: SH00164.N; FWD Oligo:
ctagcagtATGGTACAATAAGTTACTTAAtagttatattcaagcataTTAAGTAACTTATTGTACCATgcg, RVS Oligo:
aattcgcATGGTACAATAAGTTACTTAAtatgcttgaatataactaTTAAGTAACTTATTGTACCATactg
Hairpin ID: SH01048.N; FWD Oligo:
ctagcagtCAGGATGTTAATATACGCATAtagttatattcaagcataTATGCGTATATTAACATCCTGgcg, RVS Oligo:
aattcgcCAGGATGTTAATATACGCATAtatgcttgaatataactaTATGCGTATATTAACATCCTGactg
Hairpin ID: SH01049.N; FWD Oligo:
ctagcagtCCGGATGTTCATAACAATTCAtagttatattcaagcataTGAATTGTTATGAACATCCGGgcg, RVS
Oligo: aattcgcCCGGATGTTCATAACAATTCAtatgcttgaatataactaTGAATTGTTATGAACATCCGGactg
Hairpin ID: TR03744P.1; FWD Oligo: AAGAATTCAACAACGCTGGCGTTTACAT, RVS Oligo:
AGTCTAGATTGCCACCCTTTTTCAGTTT
Hairpin ID: TR00817A.1; FWD Oligo: GTCTAGAGTTCTGGCGTTCGAAGAGTC, RVS Oligo:
AGAATTCTCGCTGATGATTGCCATAAA
Hairpin ID: SH00165.N; FWD Oligo:
ctagcagtCCGATTATAGATCAAAGCAAAtagttatattcaagcataTTTGCTTTGATCTATAATCGGgcg, RVS Oligo:
aattcgcCCGATTATAGATCAAAGCAAAtatgcttgaatataactaTTTGCTTTGATCTATAATCGGactg
Hairpin ID: TR00086A.1; FWD Oligo: AAGGTGGAGCTGTTCATTGG, RVS Oligo:
CCTTTTCCAGCAAGGCAATA
Hairpin ID: SH00531.N; FWD Oligo:
ctagcagtATGCTGTTTGTCATTATCTAAtagttatattcaagcataTTAGATAATGACAAACAGCATgcg, RVS Oligo:
aattcgcATGCTGTTTGTCATTATCTAAtatgcttgaatataactaTTAGATAATGACAAACAGCATactg
Hairpin ID: TR01979P.1; FWD Oligo: CACCGAATTCGGAGAATTACAGAGTGGCCG, RVS Oligo:
TGGCATTTATGGGATGTCCT
Hairpin ID: TR01980P.1; FWD Oligo: CACCGAATTCCTGAGAAAGGCCCTCAAGTG, RVS Oligo:
GCAGAAAGGCATTTAGGCTG
Hairpin ID: TR01332P.1; FWD Oligo: AGTCTAGAACATAAAACCACCAGGAGCG, RVS Oligo:
AAGAATTCGGAGTCTTCGCTGTACTCGG
Hairpin ID: TR01334P.1; FWD Oligo: AGTCTAGATGAAACCACCAAGGTGACAA, RVS Oligo:
AAGAATTCTGATGCATTTCCCACTCGTA
Hairpin ID: TR02494P.1; FWD Oligo: AAGAATTCTGCAGCCAGTATTTACGCAG, RVS Oligo:
AGTCTAGATCGCAGTTCCAGTTGTTCTG
Hairpin ID: SH00166.N; FWD Oligo:
ctagcagtCAGATTCTCACTGAAGCTGTAtagttatattcaagcataTACAGCTTCAGTGAGAATCTGgcg, RVS
Oligo: aattcgcCAGATTCTCACTGAAGCTGTAtatgcttgaatataactaTACAGCTTCAGTGAGAATCTGactg
Hairpin ID: TR01253P.1; FWD Oligo: AGTCTAGAGGCCTTCGATATGTTCGAGA, RVS Oligo:
AAGAATTCTGAATGGCAAATTAAACGGC
Hairpin ID: SH00167.N; FWD Oligo:
ctagcagtCCCGATCACAATTATTTGTAAtagttatattcaagcataTTACAAATAATTGTGATCGGGgcg, RVS Oligo:
aattcgcCCCGATCACAATTATTTGTAAtatgcttgaatataactaTTACAAATAATTGTGATCGGGactg
Hairpin ID: TR01688P.1; FWD Oligo: CACCGAATTCAACGGCAGATTTGGTCATTC, RVS Oligo:
GGAGCAGCCTTTTGAATCTG
Hairpin ID: SH00557.N; FWD Oligo:
ctagcagtCCCACCTTGTTCGAAATCATAtagttatattcaagcataTATGATTTCGAACAAGGTGGGgcg, RVS
Oligo: aattcgcCCCACCTTGTTCGAAATCATAtatgcttgaatataactaTATGATTTCGAACAAGGTGGGactg
Hairpin ID: TR04627P.1; FWD Oligo: AAGAATTCGGTATCCAAGTTCTTCCGCA, RVS Oligo:
AGTCTAGAGATGTAGAAATGGTGGCGCT
Hairpin ID: SH00168.Nb; FWD Oligo:
ctagcagtCTCGGAGGCTACGCTAGTCAAtagttatattcaagcataTTGACTAGCGTAGCCTCCGAGgcg, RVS
Oligo: aattcgcCTCGGAGGCTACGCTAGTCAAtatgcttgaatataactaTTGACTAGCGTAGCCTCCGAGactg
Hairpin ID: TR01337P.1; FWD Oligo: AGTCTAGATTCACTGGAAAGCAGTGTCG, RVS Oligo:
AAGAATTCCGATGGTTTGCTTCTTGGTT
Hairpin ID: SH00492.N; FWD Oligo:
ctagcagtCACCATGTCGATTCTAGCCTAtagttatattcaagcataTAGGCTAGAATCGACATGGTGgcg, RVS
Oligo: aattcgcCACCATGTCGATTCTAGCCTAtatgcttgaatataactaTAGGCTAGAATCGACATGGTGactg
Hairpin ID: SH00169.N; FWD Oligo:
ctagcagtCTGGCCAAGAGTGATAATGTAtagttatattcaagcataTACATTATCACTCTTGGCCAGgcg, RVS
Oligo: aattcgcCTGGCCAAGAGTGATAATGTAtatgcttgaatataactaTACATTATCACTCTTGGCCAGactg
Hairpin ID: SH00170.N; FWD Oligo:
ctagcagtTTCGAGTGGCTAACAAATCAAtagttatattcaagcataTTGATTTGTTAGCCACTCGAAgcg, RVS
Oligo: aattcgcTTCGAGTGGCTAACAAATCAAtatgcttgaatataactaTTGATTTGTTAGCCACTCGAAactg
Hairpin ID: TR01981P.1; FWD Oligo: CACCGAATTCGTGGCTAGCGTAGAACAGGC, RVS Oligo:
TTGCTGATGCTCACTTCACC
Hairpin ID: TR00226A.1; FWD Oligo: GTCTAGAGCGAACGACCATTAAAAGGA, RVS Oligo:
AGAATTCGTGCTCCCGGTAGGTTGTTA
Hairpin ID: SH01355.N2; FWD Oligo:
ctagcagtAACGACGCAAATAGTATGTTAtagttatattcaagcataTAACATACTATTTGCGTCGTTgcg, RVS Oligo:
aattcgcAACGACGCAAATAGTATGTTAtatgcttgaatataactaTAACATACTATTTGCGTCGTTactg
Hairpin ID: TR04618P.1; FWD Oligo: AAGAATTCAATCAATAACCGCAAGTCGG, RVS Oligo:
AGTCTAGATTGTGCTCGATAAGTTTGCG
Hairpin ID: SH00507.N; FWD Oligo:
ctagcagtCACAGCATGATCAGACTATAAtagttatattcaagcataTTATAGTCTGATCATGCTGTGgcg, RVS
Oligo: aattcgcCACAGCATGATCAGACTATAAtatgcttgaatataactaTTATAGTCTGATCATGCTGTGactg
Hairpin ID: TR01876P.1; FWD Oligo: CACCGAATTCGCTCCTATTCTTGCACAGGC, RVS Oligo:
ATGTCTGCGTAGTTCCCCAC
Hairpin ID: SH00766.N; FWD Oligo:
ctagcagtCTGCAGTTTCATACTACTATTtagttatattcaagcataAATAGTAGTATGAAACTGCAGgcg, RVS Oligo:
aattcgcCTGCAGTTTCATACTACTATTtatgcttgaatataactaAATAGTAGTATGAAACTGCAGactg
Hairpin ID: TR01982P.1; FWD Oligo: CACCGAATTCTTGAAACCGCTTATCCCATC, RVS Oligo:
CCCAACTGACCCAACTGACT
Hairpin ID: SH00493.N; FWD Oligo:
ctagcagtTAGCATGTTGAACAACTACAAtagttatattcaagcataTTGTAGTTGTTCAACATGCTAgcg, RVS Oligo:
aattcgcTAGCATGTTGAACAACTACAAtatgcttgaatataactaTTGTAGTTGTTCAACATGCTAactg
Hairpin ID: SH00721.N; FWD Oligo:
ctagcagtCAGCGAGCAGTTGCAATACAAtagttatattcaagcataTTGTATTGCAACTGCTCGCTGgcg, RVS
Oligo: aattcgcCAGCGAGCAGTTGCAATACAAtatgcttgaatataactaTTGTATTGCAACTGCTCGCTGactg
Hairpin ID: SH01748.N; FWD Oligo:
ctagcagtGAGCTACGAAGAAGTCATGAAtagttatattcaagcataTTCATGACTTCTTCGTAGCTCgcg, RVS
Oligo: aattcgcGAGCTACGAAGAAGTCATGAAtatgcttgaatataactaTTCATGACTTCTTCGTAGCTCactg
Hairpin ID: TR02329P.1; FWD Oligo: CACCGAATTCCCTGGAAAAGTACAAGGGCA, RVS Oligo:
ATCTGTGGCCAGACGGTTAC
Hairpin ID: SH00932.N; FWD Oligo:
ctagcagtCACCAAGTTTCTGGTGAACAAtagttatattcaagcataTTGTTCACCAGAAACTTGGTGgcg, RVS
Oligo: aattcgcCACCAAGTTTCTGGTGAACAAtatgcttgaatataactaTTGTTCACCAGAAACTTGGTGactg
Hairpin ID: TR01983P.1; FWD Oligo: CACCGAATTCTCCTGGTCTTTGCTTTGGAC, RVS Oligo:
ACTCAATGTTCCCCAACTGC
Hairpin ID: TR02541P.1; FWD Oligo: AAGAATTCCCCAAACATAGACACGCCTT, RVS Oligo:
AGTCTAGACTGGCAGAGCTTCTCGTTCT
Hairpin ID: TR01984P.1; FWD Oligo: CACCGAATTCCAGAGCCAGAACTCCAAAGG, RVS Oligo:
GCATCCTTCTTCAGCTCCAC
Hairpin ID: TR02464P.1; FWD Oligo: AAGAATTCGCCACTTGCCCAAGAATAAA, RVS Oligo:
AGTCTAGACCAGCACTTTTTGGTGGTTT
Hairpin ID: SH01721.N; FWD Oligo:
ctagcagtCAGGCACAAGATTTATGTCAAtagttatattcaagcataTTGACATAAATCTTGTGCCTGgcg, RVS
Oligo: aattcgcCAGGCACAAGATTTATGTCAAtatgcttgaatataactaTTGACATAAATCTTGTGCCTGactg
Hairpin ID: TR02439P.1; FWD Oligo: AAGAATTCCGAGCACGTCTATGTGGAGA, RVS Oligo:
AGTCTAGAACGCCAATTGATCTACCGTC
Hairpin ID: TR02397P.1; FWD Oligo: AAGAATTCACGTTCAGTCTGTGTGCGTC, RVS Oligo:
AGTCTAGAGCCGCGTTCTTAGCAATTAG
Hairpin ID: TR01748P.1; FWD Oligo: CACCGAATTCTCTGCTGACCACCAGCATAG, RVS Oligo:
AAGACAAAACACAATCCGGC
Hairpin ID: TR03439P.1; FWD Oligo: AAGAATTCTGGACATTTTGCCGTTACAA, RVS Oligo:
AGTCTAGATCGGATTCAAACGTAGTCCC
Hairpin ID: TR01413P.1; FWD Oligo: AGTCTAGAACTCGTCCGTGTTACAAGCC, RVS Oligo:
AAGAATTCCTTTACCACAACTCCGGCAT
Hairpin ID: TR01749P.1; FWD Oligo: CACCGAATTCCTGGTGGGCCATCAAATATC, RVS Oligo:
GTCTTGCCCATCACAAACCT
Hairpin ID: SH01986.N; FWD Oligo:
ctagcagtCAAGGAGATTAAGGTGGTCAAtagttatattcaagcataTTGACCACCTTAATCTCCTTGgcg, RVS
Oligo: aattcgcCAAGGAGATTAAGGTGGTCAAtatgcttgaatataactaTTGACCACCTTAATCTCCTTGactg
Hairpin ID: TR01338P.1; FWD Oligo: AGTCTAGAAGCATAGATCCCCGTGTCAG, RVS Oligo:
AAGAATTCGTTTGCCATTGGAATGGAGT
Hairpin ID: TR01916P.1; FWD Oligo: CACCGAATTCCGGGTCTTGAAATCAATCGT, RVS Oligo:
GCACTTTTCCATTCATGCCT
Hairpin ID: SH00665.N; FWD Oligo:
ctagcagtTAGGCCGATAGTCGAAAGAAAtagttatattcaagcataTTTCTTTCGACTATCGGCCTAgcg, RVS
Oligo: aattcgcTAGGCCGATAGTCGAAAGAAAtatgcttgaatataactaTTTCTTTCGACTATCGGCCTAactg
Hairpin ID: TR01986P.1; FWD Oligo: CACCGAATTCACGCAAGCATTTATCCAAGG, RVS Oligo:
GGCAGCTTCTTATCCAGGTG
Hairpin ID: SH01649.N; FWD Oligo:
ctagcagtCACGCTGTTCTACATTGTCAAtagttatattcaagcataTTGACAATGTAGAACAGCGTGgcg, RVS
Oligo: aattcgcCACGCTGTTCTACATTGTCAAtatgcttgaatataactaTTGACAATGTAGAACAGCGTGactg
Hairpin ID: TR01987P.1; FWD Oligo: CACCGAATTCAATTCGTGTGGCCTTCACTC, RVS Oligo:
AGAGATTCATGCTGGCGATT
Hairpin ID: SH00498.N; FWD Oligo:
ctagcagtCCGGATTATACAATACGATTAtagttatattcaagcataTAATCGTATTGTATAATCCGGgcg, RVS Oligo:
aattcgcCCGGATTATACAATACGATTAtatgcttgaatataactaTAATCGTATTGTATAATCCGGactg
Hairpin ID: TR01988P.1; FWD Oligo: CACCGAATTCTTTGCAAAAATTGCACTCCA, RVS Oligo:
CACAGGGCTTTTCGGTTAAG
Hairpin ID: TR02951P.1; FWD Oligo: AAGAATTCGCAGAGGATTCCAAACCAAA, RVS Oligo:
AGTCTAGATGTTCAGGCGAGTCTCCTTT
Hairpin ID: SH00795.N; FWD Oligo:
ctagcagtCTCGAAGACGTTCCTGATCAAtagttatattcaagcataTTGATCAGGAACGTCTTCGAGgcg, RVS
Oligo: aattcgcCTCGAAGACGTTCCTGATCAAtatgcttgaatataactaTTGATCAGGAACGTCTTCGAGactg
Hairpin ID: SH00480.N; FWD Oligo:
ctagcagtCACAAGTTTATTAAAGTGATAtagttatattcaagcataTATCACTTTAATAAACTTGTGgcg, RVS Oligo:
aattcgcCACAAGTTTATTAAAGTGATAtatgcttgaatataactaTATCACTTTAATAAACTTGTGactg
Hairpin ID: TR04619P.1; FWD Oligo: AAGAATTCCAGGTAAAAGCCAAAGCGAG, RVS Oligo:
AGTCTAGATAGCGCTGTAGGAAGTCGGT
Hairpin ID: TR00858P.1; FWD Oligo: AGTCTAGAAGAAGGATCCCTCGTTCGAT, RVS Oligo:
AAGAATTCTACCCACTCGTTGTTCACCA
Hairpin ID: SH00958.N; FWD Oligo:
ctagcagtACCGATTGTAATCAAACCAAAtagttatattcaagcataTTTGGTTTGATTACAATCGGTgcg, RVS Oligo:
aattcgcACCGATTGTAATCAAACCAAAtatgcttgaatataactaTTTGGTTTGATTACAATCGGTactg
Hairpin ID: SH00171.N; FWD Oligo:
ctagcagtTTGGTTGACAAGGCAATAGAAtagttatattcaagcataTTCTATTGCCTTGTCAACCAAgcg, RVS
Oligo: aattcgcTTGGTTGACAAGGCAATAGAAtatgcttgaatataactaTTCTATTGCCTTGTCAACCAAactg
Hairpin ID: SH00134.N; FWD Oligo:
ctagcagtCAAGAAGTTCATGGACAAGTAtagttatattcaagcataTACTTGTCCATGAACTTCTTGgcg, RVS
Oligo: aattcgcCAAGAAGTTCATGGACAAGTAtatgcttgaatataactaTACTTGTCCATGAACTTCTTGactg
Hairpin ID: SH00741.N; FWD Oligo:
ctagcagtCCCAGTTGCTAAGTTATTCAAtagttatattcaagcataTTGAATAACTTAGCAACTGGGgcg, RVS
Oligo: aattcgcCCCAGTTGCTAAGTTATTCAAtatgcttgaatataactaTTGAATAACTTAGCAACTGGGactg
Hairpin ID: TR02727P.1; FWD Oligo: AAGAATTCGTAAACAATGCCCTGCCCTA, RVS Oligo:
AGTCTAGACAGGCCACTGCAAATTAGGT
Hairpin ID: SH00447.N; FWD Oligo:
ctagcagtACGATCGATTCTAGTACACAAtagttatattcaagcataTTGTGTACTAGAATCGATCGTgcg, RVS
Oligo: aattcgcACGATCGATTCTAGTACACAAtatgcttgaatataactaTTGTGTACTAGAATCGATCGTactg
Hairpin ID: SH01356.N2; FWD Oligo:
ctagcagtAAGATAATACCTATAAGTAAAtagttatattcaagcataTTTACTTATAGGTATTATCTTgcg, RVS Oligo:
aattcgcAAGATAATACCTATAAGTAAAtatgcttgaatataactaTTTACTTATAGGTATTATCTTactg
Hairpin ID: TR01151P.1; FWD Oligo: AGTCTAGATTGTGAAGCACGAACTGGAC, RVS Oligo:
AAGAATTCGGCGTGGTAGTCACGGTAGT
Hairpin ID: TR01989P.1; FWD Oligo: CACCGAATTCTACTACCGGAACTCGGTTGG, RVS Oligo:
AACATGATGACTTTTCCGGC
Hairpin ID: TR01750P.1; FWD Oligo: CACCGAATTCCCAACTGGCAAATCTTTGGT, RVS Oligo:
TCGATTAACAACGGACGACA
Hairpin ID: SH01028.N; FWD Oligo:
ctagcagtATGGTTGGTTGGATCAAGAAAtagttatattcaagcataTTTCTTGATCCAACCAACCATgcg, RVS
Oligo: aattcgcATGGTTGGTTGGATCAAGAAAtatgcttgaatataactaTTTCTTGATCCAACCAACCATactg
Hairpin ID: SH01029.N; FWD Oligo:
ctagcagtTGCGAATGCTATGCAGTTCTAtagttatattcaagcataTAGAACTGCATAGCATTCGCAgcg, RVS
Oligo: aattcgcTGCGAATGCTATGCAGTTCTAtatgcttgaatataactaTAGAACTGCATAGCATTCGCAactg
Hairpin ID: SH01357.N2b; FWD Oligo:
ctagcagtCTGCTTCAGAGTCCAGTGAAAtagttatattcaagcataTTTCACTGGACTCTGAAGCAGgcg, RVS
Oligo: aattcgcCTGCTTCAGAGTCCAGTGAAAtatgcttgaatataactaTTTCACTGGACTCTGAAGCAGactg
Hairpin ID: TR04270P.1; FWD Oligo: AAGAATTCAACATCAAGCAACACCACCA, RVS Oligo:
AGTCTAGATTGTGCAGATTGTAACCGGA
Hairpin ID: SH00691.N; FWD Oligo:
ctagcagtCACGACAACACGGATAGTTAAtagttatattcaagcataTTAACTATCCGTGTTGTCGTGgcg, RVS
Oligo: aattcgcCACGACAACACGGATAGTTAAtatgcttgaatataactaTTAACTATCCGTGTTGTCGTGactg
Hairpin ID: TR02417P.1; FWD Oligo: AAGAATTCATTTCGACCAAGTCGGTGTC, RVS Oligo:
AGTCTAGACTTGCAGCTGGTTCATTCAA
Hairpin ID: SH00172.N; FWD Oligo:
ctagcagtCCGACTGTTTCCGAAAGACTAtagttatattcaagcataTAGTCTTTCGGAAACAGTCGGgcg, RVS
Oligo: aattcgcCCGACTGTTTCCGAAAGACTAtatgcttgaatataactaTAGTCTTTCGGAAACAGTCGGactg
Hairpin ID: TR02379P.1; FWD Oligo: AAGAATTCAAATCGGAATGAAACCCAAA, RVS Oligo:
AGTCTAGATTCTCCTCGACTTCGTCGTT
Hairpin ID: TR02452P.1; FWD Oligo: AAGAATTCCTTTGAGCAGTCCGTGAACA, RVS Oligo:
AGTCTAGAGGTAGACAATGGCTCGCTTC
Hairpin ID: SH01002.N; FWD Oligo:
ctagcagtCAGGCTCAAGCTATAGAGCAAtagttatattcaagcataTTGCTCTATAGCTTGAGCCTGgcg, RVS
Oligo: aattcgcCAGGCTCAAGCTATAGAGCAAtatgcttgaatataactaTTGCTCTATAGCTTGAGCCTGactg
Hairpin ID: SH01003.N; FWD Oligo:
ctagcagtCCCGCTGTTGTTCACCACCAAtagttatattcaagcataTTGGTGGTGAACAACAGCGGGgcg, RVS
Oligo: aattcgcCCCGCTGTTGTTCACCACCAAtatgcttgaatataactaTTGGTGGTGAACAACAGCGGGactg
Hairpin ID: TR01339P.1; FWD Oligo: AGTCTAGAGATCTGTCGCCTGTGTCTGA, RVS Oligo:
AAGAATTCAAACTTATTCGCCGTTGTGG
Hairpin ID: TR01020P.1; FWD Oligo: AGTCTAGATCTCCGTATGAGCGGTGTAA, RVS Oligo:
AAGAATTCGGTTCGCAGACAGTTGAGTG
Hairpin ID: SH00577.N; FWD Oligo:
ctagcagtTCCGATAGTAGCGAAGAAGAAtagttatattcaagcataTTCTTCTTCGCTACTATCGGAgcg, RVS
Oligo: aattcgcTCCGATAGTAGCGAAGAAGAAtatgcttgaatataactaTTCTTCTTCGCTACTATCGGAactg
Hairpin ID: SH01650.N; FWD Oligo:
ctagcagtCTCGATGTAAATGTAATTAAAtagttatattcaagcataTTTAATTACATTTACATCGAGgcg, RVS Oligo:
aattcgcCTCGATGTAAATGTAATTAAAtatgcttgaatataactaTTTAATTACATTTACATCGAGactg
Hairpin ID: TR01899P.1; FWD Oligo: CACCGAATTCCAAAGGGATCAGCGGAATAA, RVS Oligo:
GAGGACAGCCCTCCCTTAAC
Hairpin ID: TR01341P.1; FWD Oligo: AGTCTAGAATTCGTATTCGTGTGTGCGA, RVS Oligo:
AAGAATTCTCCACGAAGTCATCGTTCAG
Hairpin ID: SH00337.N; FWD Oligo:
ctagcagtCAGCAGCAGATACCAAAGTTAtagttatattcaagcataTAACTTTGGTATCTGCTGCTGgcg, RVS
Oligo: aattcgcCAGCAGCAGATACCAAAGTTAtatgcttgaatataactaTAACTTTGGTATCTGCTGCTGactg
Hairpin ID: TR02422P.1; FWD Oligo: AAGAATTCCACCAATGATGAGACAACGG, RVS Oligo:
AGTCTAGAGACCCTCCAATCGATCTTCA
Hairpin ID: SH00173.N; FWD Oligo:
ctagcagtCAGCTTCCTACTACAGCTCAAtagttatattcaagcataTTGAGCTGTAGTAGGAAGCTGgcg, RVS
Oligo: aattcgcCAGCTTCCTACTACAGCTCAAtatgcttgaatataactaTTGAGCTGTAGTAGGAAGCTGactg
Hairpin ID: SH01181.N2; FWD Oligo:
ctagcagtAAGAAAGTGTTTATAATTATAtagttatattcaagcataTATAATTATAAACACTTTCTTgcg, RVS Oligo:
aattcgcAAGAAAGTGTTTATAATTATAtatgcttgaatataactaTATAATTATAAACACTTTCTTactg
Hairpin ID: TR00029A.1; FWD Oligo: GTCTAGACGTCGCTCCAGAGAAAAGTT, RVS Oligo:
AGAATTCTCTCAGATGCACACTGGCTC
Hairpin ID: TR00030A.1; FWD Oligo: GTCTAGAACTCACCTCTCTCAGCGCAT, RVS Oligo:
AGAATTCGGTTGCTTCGTCGTAGATGAG
Hairpin ID: TR00029P.1; FWD Oligo: GTCTAGACGTCGCTCCAGAGAAAAGTT, RVS Oligo:
AGAATTCTCTCAGATGCACACTGGCTC
Hairpin ID: SH00432.N; FWD Oligo:
ctagcagtAAGATCCGATTCGAAATATAAtagttatattcaagcataTTATATTTCGAATCGGATCTTgcg, RVS Oligo:
aattcgcAAGATCCGATTCGAAATATAAtatgcttgaatataactaTTATATTTCGAATCGGATCTTactg
Hairpin ID: SH00174.N; FWD Oligo:
ctagcagtTAGCTGTTAATATGTACTTTAtagttatattcaagcataTAAAGTACATATTAACAGCTAgcg, RVS Oligo:
aattcgcTAGCTGTTAATATGTACTTTAtatgcttgaatataactaTAAAGTACATATTAACAGCTAactg
Hairpin ID: SH00424.N; FWD Oligo:
ctagcagtCAAGATGCCGGTGTTGTTCAAtagttatattcaagcataTTGAACAACACCGGCATCTTGgcg, RVS
Oligo: aattcgcCAAGATGCCGGTGTTGTTCAAtatgcttgaatataactaTTGAACAACACCGGCATCTTGactg
Hairpin ID: SH00898.N; FWD Oligo:
ctagcagtTAGCAAGGCGACCTAGTTAAAtagttatattcaagcataTTTAACTAGGTCGCCTTGCTAgcg, RVS
Oligo: aattcgcTAGCAAGGCGACCTAGTTAAAtatgcttgaatataactaTTTAACTAGGTCGCCTTGCTAactg
Hairpin ID: SH00899.N; FWD Oligo:
ctagcagtCCGATTAATAAAGTACAATAAtagttatattcaagcataTTATTGTACTTTATTAATCGGgcg, RVS Oligo:
aattcgcCCGATTAATAAAGTACAATAAtatgcttgaatataactaTTATTGTACTTTATTAATCGGactg
Hairpin ID: SH00751.N; FWD Oligo:
ctagcagtGAGATGGACTACGACAAGAAAtagttatattcaagcataTTTCTTGTCGTAGTCCATCTCgcg, RVS
Oligo: aattcgcGAGATGGACTACGACAAGAAAtatgcttgaatataactaTTTCTTGTCGTAGTCCATCTCactg
Hairpin ID: TR04537P.1; FWD Oligo: AAGAATTCGTGAAGCTGCTGGATGACAA, RVS Oligo:
AGTCTAGAAACATCGAAATCAAGCCAGG
Hairpin ID: SH00680.N; FWD Oligo:
ctagcagtCACCCAAGTCCTCAAATTCAAtagttatattcaagcataTTGAATTTGAGGACTTGGGTGgcg, RVS
Oligo: aattcgcCACCCAAGTCCTCAAATTCAAtatgcttgaatataactaTTGAATTTGAGGACTTGGGTGactg
Hairpin ID: TR01108P.1; FWD Oligo: AGTCTAGATCTGAGCTGGAAAACGAGGT, RVS Oligo:
AAGAATTCCTGGGCGTATTTGGAGTCAT
Hairpin ID: TR03500P.1; FWD Oligo: AAGAATTCCTTCTTCAAGTGCAATGCCA, RVS Oligo:
AGTCTAGAGCGTACACCACTCCGAAAAT
Hairpin ID: TR01752P.1; FWD Oligo: CACCGAATTCGCAACATACGCGAACTGAAA, RVS Oligo:
GCATAGACCTGCGACCAAAT
Hairpin ID: TR02433P.1; FWD Oligo: AAGAATTCCCCATGAATCCGATGAGTCT, RVS Oligo:
AGTCTAGAAGCCTAGGTGTGGAACATGG
Hairpin ID: SH00125.N; FWD Oligo:
ctagcagtATAGTTGAAGATAGCAATGTAtagttatattcaagcataTACATTGCTATCTTCAACTATgcg, RVS Oligo:
aattcgcATAGTTGAAGATAGCAATGTAtatgcttgaatataactaTACATTGCTATCTTCAACTATactg
Hairpin ID: TR04550P.1; FWD Oligo: AAGAATTCTTACCAGGACACCGTCTTCC, RVS Oligo:
AGTCTAGAGCCCGACCGATTGTACTTTA
Hairpin ID: SH00175.N; FWD Oligo:
ctagcagtCAGTGATATAATAGTAGTCTAtagttatattcaagcataTAGACTACTATTATATCACTGgcg, RVS Oligo:
aattcgcCAGTGATATAATAGTAGTCTAtatgcttgaatataactaTAGACTACTATTATATCACTGactg
Hairpin ID: TR02471P.1; FWD Oligo: AAGAATTCGGAAAAGAGTCGAGTGCAGG, RVS Oligo:
AGTCTAGATGCCTTGGCTTCTTTCTGAT
Hairpin ID: SH01258.N2; FWD Oligo:
ctagcagtCACGAACTTGATGCACAACAAtagttatattcaagcataTTGTTGTGCATCAAGTTCGTGgcg, RVS
Oligo: aattcgcCACGAACTTGATGCACAACAAtatgcttgaatataactaTTGTTGTGCATCAAGTTCGTGactg
Hairpin ID: SH01259.N2; FWD Oligo:
ctagcagtCAGCTTGATCTTCACACACAAtagttatattcaagcataTTGTGTGTGAAGATCAAGCTGgcg, RVS
Oligo: aattcgcCAGCTTGATCTTCACACACAAtatgcttgaatataactaTTGTGTGTGAAGATCAAGCTGactg
Hairpin ID: TR01753P.1; FWD Oligo: CACCGAATTCGGAATAGCCAACCAAAGCAA, RVS Oligo:
CTTAATCCCCTCCAGCTTCC
Hairpin ID: SH00494.N; FWD Oligo:
ctagcagtAACGTTGGGCTTCAAGTTCAAtagttatattcaagcataTTGAACTTGAAGCCCAACGTTgcg, RVS
Oligo: aattcgcAACGTTGGGCTTCAAGTTCAAtatgcttgaatataactaTTGAACTTGAAGCCCAACGTTactg
Hairpin ID: SH01651.N; FWD Oligo:
ctagcagtCCGCTTCGATGCGCCCATCAAtagttatattcaagcataTTGATGGGCGCATCGAAGCGGgcg, RVS
Oligo: aattcgcCCGCTTCGATGCGCCCATCAAtatgcttgaatataactaTTGATGGGCGCATCGAAGCGGactg
Hairpin ID: TR01343P.1; FWD Oligo: AGTCTAGATGAGACACTTGCGCTTATGG, RVS Oligo:
AAGAATTCTGCGGATATAAATCTTCGGC
Hairpin ID: TR02349P.1; FWD Oligo: AAGAATTCAAGCGTATCAATCTGCGTCC, RVS Oligo:
AGTCTAGATCTGCTTCTGGTTAGCTGGC
Hairpin ID: SH00176.N; FWD Oligo:
ctagcagtCAGAGCGAAGAGTCAATACAAtagttatattcaagcataTTGTATTGACTCTTCGCTCTGgcg, RVS
Oligo: aattcgcCAGAGCGAAGAGTCAATACAAtatgcttgaatataactaTTGTATTGACTCTTCGCTCTGactg
Hairpin ID: TR01754P.1; FWD Oligo: CACCGAATTCAGCCAGCAAGACGTCAAAGT, RVS Oligo:
TGTTTTGCGATTGAGGCATA
Hairpin ID: TR01877P.1; FWD Oligo: CACCGAATTCATCGCCATGTGGTGGTTATT, RVS Oligo:
GGTCTTGTCAAACCAGCGAT
Hairpin ID: TR00668A.1; FWD Oligo: GTCTAGACTCGAAGAGCAGCCAGACTT, RVS Oligo:
AGAATTCGCAGTCAAGACGAAGAAGGG
Hairpin ID: SH00141.N; FWD Oligo:
ctagcagtCCGCGACTCGTGTACACTTTAtagttatattcaagcataTAAAGTGTACACGAGTCGCGGgcg, RVS
Oligo: aattcgcCCGCGACTCGTGTACACTTTAtatgcttgaatataactaTAAAGTGTACACGAGTCGCGGactg
Hairpin ID: TR00510A.1; FWD Oligo: GTCTAGACTGAACAGGCATTCGAGACA, RVS Oligo:
AGAATTCGACAACCTGGTGGAATTGCT
Hairpin ID: SH00475.N; FWD Oligo:
ctagcagtACGATACTTAAGACTAGTTTAtagttatattcaagcataTAAACTAGTCTTAAGTATCGTgcg, RVS Oligo:
aattcgcACGATACTTAAGACTAGTTTAtatgcttgaatataactaTAAACTAGTCTTAAGTATCGTactg
Hairpin ID: SH01280.N2; FWD Oligo:
ctagcagtAAGATACGATACTTAAGACTAtagttatattcaagcataTAGTCTTAAGTATCGTATCTTgcg, RVS Oligo:
aattcgcAAGATACGATACTTAAGACTAtatgcttgaatataactaTAGTCTTAAGTATCGTATCTTactg
Hairpin ID: TR04039P.1; FWD Oligo: AAGAATTCGCTCTGCAGTACGACATGGA, RVS Oligo:
AGTCTAGAAACTGGATGTGGGTTGGTGT
Hairpin ID: TR02557P.1; FWD Oligo: AAGAATTCCATTGGACTGCCCGTAATCT, RVS Oligo:
AGTCTAGAATCCAGGCTATCGACCAGTG
Hairpin ID: TR00548A.1; FWD Oligo: GTCTAGACTGGAAGCAGAACGATGACA, RVS Oligo:
AGAATTCAGCTACTTGTCGGAGGCAAA
Hairpin ID: SH00840.N; FWD Oligo:
ctagcagtCGGGACAGAAGTCAACGATAAtagttatattcaagcataTTATCGTTGACTTCTGTCCCGgcg, RVS
Oligo: aattcgcCGGGACAGAAGTCAACGATAAtatgcttgaatataactaTTATCGTTGACTTCTGTCCCGactg
Hairpin ID: TR02487P.1; FWD Oligo: AAGAATTCTCAACTTTGACACTCGACGC, RVS Oligo:
AGTCTAGAACTATTGTCAACCGCAACCC
Hairpin ID: TR01345P.1; FWD Oligo: AGTCTAGACAATGAAGGTTGCCAGGAAT, RVS Oligo:
AAGAATTCCTTTCTTGCGCTCCCTAATG
Hairpin ID: TR00718A.1; FWD Oligo: GTCTAGATAAGAGACGAAAGGCGGAAA, RVS Oligo:
AGAATTCATCTCTTGCAACTGGCGTTT
Hairpin ID: TR00719A.1; FWD Oligo: GTCTAGAAAATCCATTCAACAGACCCG, RVS Oligo:
AGAATTCACATTGGCTTTTTGTCGGAG
Hairpin ID: RichCG12393-1; FWD Oligo:
ctagcagtTACCTGTTCATCACAATAATAtagttatattcaagcataTATTATTGTGATGAACAGGTAgcg, RVS Oligo:
aattcgcTACCTGTTCATCACAATAATAtatgcttgaatataactaTATTATTGTGATGAACAGGTAactg
Hairpin ID: RichCG12393-2; FWD Oligo:
ctagcagtCTGCTTCGAGATCGCCTTCAAtagttatattcaagcataTTGAAGGCGATCTCGAAGCAGgcg, RVS
Oligo: aattcgcCTGCTTCGAGATCGCCTTCAAtatgcttgaatataactaTTGAAGGCGATCTCGAAGCAGactg
Hairpin ID: TR00697A.1; FWD Oligo: GTCTAGAAAGCAGAAGGAGGTGTGCAT, RVS Oligo:
ACAATTGCGATCACGGAGTTGTTGTTG
Hairpin ID: TR00698A.1; FWD Oligo: GTCTAGATGATGAGTGCGTGTGAGTGA, RVS Oligo:
ACAATTGTGAATTCGTTGATCCAAGGC
Hairpin ID: TR00792A.1; FWD Oligo: GTCTAGACATGGAGAAAGGGAAGGTGA, RVS Oligo:
AGAATTCGTTGCACCTTGTTCTCCGTT
Hairpin ID: TR02342P.1; FWD Oligo: AAGAATTCCTCCGAAGTGCTTGATGTGA, RVS Oligo:
AGTCTAGAGCCGGACTTCTCTGTGTAGC
Hairpin ID: TR01917P.1; FWD Oligo: CACCGAATTCACCGTGCATGGGAATATCAT, RVS Oligo:
GGCCATGAACCTGACAACTT
Hairpin ID: SH01020.N; FWD Oligo:
ctagcagtCCGATCGATGATAAACATAAAtagttatattcaagcataTTTATGTTTATCATCGATCGGgcg, RVS Oligo:
aattcgcCCGATCGATGATAAACATAAAtatgcttgaatataactaTTTATGTTTATCATCGATCGGactg
Hairpin ID: SH01021.N; FWD Oligo:
ctagcagtCAAGATCAAGGAGATTGTTAAtagttatattcaagcataTTAACAATCTCCTTGATCTTGgcg, RVS Oligo:
aattcgcCAAGATCAAGGAGATTGTTAAtatgcttgaatataactaTTAACAATCTCCTTGATCTTGactg
Hairpin ID: TR02536P.1; FWD Oligo: AAGAATTCACTTGGACAGCGGTTTTAGC, RVS Oligo:
AGTCTAGAAGCCCGTATCATTGATGCTC
Hairpin ID: TR00363A.1; FWD Oligo: GTCTAGAAAGAATATTTCGCGCACGTC, RVS Oligo:
AGAATTCACAACTTCCGCCCAGATAGA
Hairpin ID: SH00673.N; FWD Oligo:
ctagcagtTCCGACGATGCTGTTCTGATAtagttatattcaagcataTATCAGAACAGCATCGTCGGAgcg, RVS
Oligo: aattcgcTCCGACGATGCTGTTCTGATAtatgcttgaatataactaTATCAGAACAGCATCGTCGGAactg
Hairpin ID: SH01722.N; FWD Oligo:
ctagcagtCACCATCGTAACAATAAGTAAtagttatattcaagcataTTACTTATTGTTACGATGGTGgcg, RVS Oligo:
aattcgcCACCATCGTAACAATAAGTAAtatgcttgaatataactaTTACTTATTGTTACGATGGTGactg
Hairpin ID: TR01755P.1; FWD Oligo: CACCGAATTCCAGAAGATCACCAAGTCGCA, RVS Oligo:
TAATTCTGCCGGAACACCTC
Hairpin ID: TR01991P.1; FWD Oligo: CACCGAATTCCTTTCCGACCCAGATTTTGA, RVS Oligo:
CGCTAGGTTCTCCGCTATTG
Hairpin ID: SH00552.N; FWD Oligo:
ctagcagtCCCGACCTACCGCCTATTCAAtagttatattcaagcataTTGAATAGGCGGTAGGTCGGGgcg, RVS
Oligo: aattcgcCCCGACCTACCGCCTATTCAAtatgcttgaatataactaTTGAATAGGCGGTAGGTCGGGactg
Hairpin ID: TR01992P.1; FWD Oligo: CACCGAATTCGAAATCCACAAATCCACGCT, RVS Oligo:
GGACCAGGATCAGACGAAAA
Hairpin ID: TR01993P.1; FWD Oligo: CACCGAATTCCTTCCTTGTCTGCTTTTCGG, RVS Oligo:
GGGAAGGAGTCATTGCGATA
Hairpin ID: TR00209A.1; FWD Oligo: GTCTAGAAGGACGAGGATCCGTATGTG, RVS Oligo:
AGAATTCTCGTGCTTGAGAATGTCTGG
Hairpin ID: TR00209P.1; FWD Oligo: AAGAATTCAGGACGAGGATCCGTATGTG, RVS Oligo:
AGTCTAGATCGTGCTTGAGAATGTCTGG
Hairpin ID: TR02664P.1; FWD Oligo: AAGAATTCTACAATCTGGGCCTAGTGGC, RVS Oligo:
AGTCTAGAGGCCGAGGTACTGTTTGGTA
Hairpin ID: TR02558P.1; FWD Oligo: AAGAATTCGGAAAATTTCACAAAGCGGA, RVS Oligo:
AGTCTAGAGATTTTGCGATGTTTTGCAT
Hairpin ID: TR02504P.1; FWD Oligo: AAGAATTCCTAACAATGTCGTGCTCGGA, RVS Oligo:
AGTCTAGAGGGCAAGTTTGCCATTAGAA
Hairpin ID: TR00272P.1; FWD Oligo: GTCTAGAATGAAGTACAATGCGGGAGC, RVS Oligo:
AGAATTCGACTTGTGCCAGCTCCTTTC
Hairpin ID: TR00227A.1; FWD Oligo: GTCTAGAAAGAAAGTCTGCACGGGCTA, RVS Oligo:
AGAATTCTGTGATGCAGGCGTAAAGAG
Hairpin ID: TR01347P.1; FWD Oligo: AGTCTAGAACGAACCCTTTTTAACCGCT, RVS Oligo:
AAGAATTCGGAGGTGTGTTCCTGTCCAT
Hairpin ID: TR01086P.1; FWD Oligo: AGTCTAGAACCGAAACTACCTGCCAGTG, RVS Oligo:
AAGAATTCTTAAGCTGCAACGTATTGGC
Hairpin ID: TR02521P.1; FWD Oligo: AAGAATTCCATCGCATGTTGTTCCAAGA, RVS Oligo:
AGTCTAGATCCACCCTGGACCTTAGATG
Hairpin ID: TR02547P.1; FWD Oligo: AAGAATTCATCAGGAGCGCCTCTATCAG, RVS Oligo:
AGTCTAGATTCTTGTGCTTGCTGAGGTG
Hairpin ID: TR01273P.1; FWD Oligo: AGTCTAGAATAACGATGCCTTTGGATGC, RVS Oligo:
AAGAATTCAGCAGCGCTCTAATTGCCTA
Hairpin ID: TR01994P.1; FWD Oligo: CACCGAATTCTCCCTCGCAGGATTATATGC, RVS Oligo:
CAGCGTTATGTGCTGCAAGT
Hairpin ID: TR01247P.1; FWD Oligo: AGTCTAGAAAACCATTGCGAGGATTACG, RVS Oligo:
AAGAATTCATTTCGTTTTGCGATTGGTC
Hairpin ID: TR01554A.1; FWD Oligo: AGTCTAGAGCACCTTCTTCTGGCAAAAC, RVS Oligo:
AAGAATTCCGGAATATCTGGATGTCGCT
Hairpin ID: SH00311.N; FWD Oligo:
ctagcagtCCCGACAACCTCTATAGTCTAtagttatattcaagcataTAGACTATAGAGGTTGTCGGGgcg, RVS
Oligo: aattcgcCCCGACAACCTCTATAGTCTAtatgcttgaatataactaTAGACTATAGAGGTTGTCGGGactg
Hairpin ID: SH00091.N; FWD Oligo:
ctagcagtGCAGAACAACACTGATCAACAtagttatattcaagcataTGTTGATCAGTGTTGTTCTGCgcg, RVS
Oligo: aattcgcGCAGAACAACACTGATCAACAtatgcttgaatataactaTGTTGATCAGTGTTGTTCTGCactg
Hairpin ID: TR00678A.1; FWD Oligo: GTCTAGAGATGAAGGATCCCAAGACGA, RVS Oligo:
AGAATTCTGCTTGGCAATAGCCTTCTT
Hairpin ID: TR00679A.1; FWD Oligo: GTCTAGATATGCGTCAAGCAAAACAGC, RVS Oligo:
AGAATTCATTCGCATTTCAGGAGTTGG
Hairpin ID: SH00695.N; FWD Oligo:
ctagcagtCAAGTACATACTGGACTACAAtagttatattcaagcataTTGTAGTCCAGTATGTACTTGgcg, RVS
Oligo: aattcgcCAAGTACATACTGGACTACAAtatgcttgaatataactaTTGTAGTCCAGTATGTACTTGactg
Hairpin ID: SH01008.N; FWD Oligo:
ctagcagtAAGCGAATGTAGATTTACAAAtagttatattcaagcataTTTGTAAATCTACATTCGCTTgcg, RVS Oligo:
aattcgcAAGCGAATGTAGATTTACAAAtatgcttgaatataactaTTTGTAAATCTACATTCGCTTactg
Hairpin ID: SH01009.N; FWD Oligo:
ctagcagtCAAGCGGAATCGCAAGTTCAAtagttatattcaagcataTTGAACTTGCGATTCCGCTTGgcg, RVS
Oligo: aattcgcCAAGCGGAATCGCAAGTTCAAtatgcttgaatataactaTTGAACTTGCGATTCCGCTTGactg
Hairpin ID: TR00809A.1; FWD Oligo: GTCTAGACTCCAGACTGGTGGCTTCTC, RVS Oligo:
AGAATTCAGATGGTTGGAAGTTGGCAC
Hairpin ID: TR01181P.1; FWD Oligo: AGTCTAGACCAACGGAGAAGTGACCATT, RVS Oligo:
AAGAATTCTGGACACATATCGCCTCAAA
Hairpin ID: TR01152P.1; FWD Oligo: AGTCTAGACAGCCCGAACCAAAGAGTAG, RVS Oligo:
AAGAATTCGATGATGAGTTTTTGGGCGT
Hairpin ID: TR01349P.1; FWD Oligo: AGTCTAGAAGTTCAACTCGCACCTGCTC, RVS Oligo:
AAGAATTCTGATTCTGCCATCTCGACTG
Hairpin ID: TR01995P.1; FWD Oligo: AAGAATTCACTGGCTTTGCCATGATCTC, RVS Oligo:
AGTCTAGACGAACATAACCATGCAAACG

Hairpin ID: TR02694P.1; FWD Oligo: AAGAATTCCAGTTAAGCGCTCCCTTGTC, RVS Oligo:
AGTCTAGAGTGGTCCGCCTGAGAATTTA
Hairpin ID: SH00408.N; FWD Oligo:
ctagcagtTCGGCTATTCCGGGTTCATAAtagttatattcaagcataTTATGAACCCGGAATAGCCGAgcg, RVS
Oligo: aattcgcTCGGCTATTCCGGGTTCATAAtatgcttgaatataactaTTATGAACCCGGAATAGCCGAactg
Hairpin ID: TR02559P.1; FWD Oligo: AAGAATTCAAGAGCGTCCAGATTGTGGT, RVS Oligo:
AGTCTAGACCTTCGGTTTGATCTCCTGA
Hairpin ID: TR04263P.1; FWD Oligo: AAGAATTCGGCTTTTAACGTGGTCGAAA, RVS Oligo:
AGTCTAGACAAGGATAAATGCCATCGCT
Hairpin ID: SH00788.N; FWD Oligo:
ctagcagtCCGAATGTTCGACTTGTGCTAtagttatattcaagcataTAGCACAAGTCGAACATTCGGgcg, RVS
Oligo: aattcgcCCGAATGTTCGACTTGTGCTAtatgcttgaatataactaTAGCACAAGTCGAACATTCGGactg
Hairpin ID: SH00769.N; FWD Oligo:
ctagcagtATCGATGTTACCGAGGTTATAtagttatattcaagcataTATAACCTCGGTAACATCGATgcg, RVS
Oligo: aattcgcATCGATGTTACCGAGGTTATAtatgcttgaatataactaTATAACCTCGGTAACATCGATactg
Hairpin ID: TR02560P.1; FWD Oligo: AAGAATTCCCATTCGTGGAGTTCCTGTC, RVS Oligo:
AGTCTAGAAGATGGGCGTCACATAGTCC
Hairpin ID: TR00762A.1; FWD Oligo: GTCTAGAAGCAGCTATACGGAAAGCCA, RVS Oligo:
AGAATTCTCTTCCACTACCATTTCGGC
Hairpin ID: TR00873P.1; FWD Oligo: AGTCTAGACTGCAATTGGAGCAAGTTGA, RVS Oligo:
AAGAATTCAAGAGGACCACCCACAACAG
Hairpin ID: SH00660.N; FWD Oligo:
ctagcagtTCGGTTAGCGAACTTCAGATAtagttatattcaagcataTATCTGAAGTTCGCTAACCGAgcg, RVS
Oligo: aattcgcTCGGTTAGCGAACTTCAGATAtatgcttgaatataactaTATCTGAAGTTCGCTAACCGAactg
Hairpin ID: TR02935P.1; FWD Oligo: AAGAATTCAGACAGTGAGGCCCAGAAGA, RVS Oligo:
AGTCTAGAGTGGCTTTCTTTCGTTGAGC
Hairpin ID: SH00821.N; FWD Oligo:
ctagcagtCTGGTGCAAGAGATTCGACAAtagttatattcaagcataTTGTCGAATCTCTTGCACCAGgcg, RVS
Oligo: aattcgcCTGGTGCAAGAGATTCGACAAtatgcttgaatataactaTTGTCGAATCTCTTGCACCAGactg
Hairpin ID: SH00101.N; FWD Oligo:
ctagcagtAGATGCTCATCTACTACAAGGtagttatattcaagcataCCTTGTAGTAGATGAGCATCTgcg, RVS
Oligo: aattcgcAGATGCTCATCTACTACAAGGtatgcttgaatataactaCCTTGTAGTAGATGAGCATCTactg
Hairpin ID: SH00102.N; FWD Oligo:
ctagcagtGATGTTTCTCAATCAATTAGTtagttatattcaagcataACTAATTGATTGAGAAACATCgcg, RVS Oligo:
aattcgcGATGTTTCTCAATCAATTAGTtatgcttgaatataactaACTAATTGATTGAGAAACATCactg
Hairpin ID: TR01350P.1; FWD Oligo: AGTCTAGAAACAAACGGATAAACCAGCG, RVS Oligo:
AAGAATTCCGTTTAAGCTCTCCAGTGGG
Hairpin ID: TR00939P.1; FWD Oligo: AGTCTAGAGCATATGCGCCAACTCATC, RVS Oligo:
AAGAATTCTTGGCTTGGATATGGGTAGC
Hairpin ID: TR01996P.1; FWD Oligo: CACCGAATTCGACATGGCCATCCTGTACCT, RVS Oligo:
TTGCACAAGTTTTCTGCTGG
Hairpin ID: TR02561P.1; FWD Oligo: AAGAATTCCATTGTGGCACCTGGAATCT, RVS Oligo:
AGTCTAGATCATTGCTGAATTTGCTTGC
Hairpin ID: SH00177.N; FWD Oligo:
ctagcagtAAGAAGGTTCCTGCAGCTAAAtagttatattcaagcataTTTAGCTGCAGGAACCTTCTTgcg, RVS
Oligo: aattcgcAAGAAGGTTCCTGCAGCTAAAtatgcttgaatataactaTTTAGCTGCAGGAACCTTCTTactg
Hairpin ID: TR04604P.1; FWD Oligo: AAGAATTCACTTTGAGGCACTCGAGCAT, RVS Oligo:
AGTCTAGAGCTTCTCTTCGCAGTTGGAC
Hairpin ID: SH00772.N; FWD Oligo:
ctagcagtCAGACACAAGCTCTAGTTAAAtagttatattcaagcataTTTAACTAGAGCTTGTGTCTGgcg, RVS
Oligo: aattcgcCAGACACAAGCTCTAGTTAAAtatgcttgaatataactaTTTAACTAGAGCTTGTGTCTGactg
Hairpin ID: TR02522P.1; FWD Oligo: AAGAATTCCACGTATTCAGCTTCAGCCA, RVS Oligo:
AGTCTAGAAACGTGGACGATGGCTTATC
Hairpin ID: TR01756P.1; FWD Oligo: CACCGAATTCGGTGCTGGCTCAGTTCTACC, RVS Oligo:
ACTGAATGGTGGCGTAGTCC
Hairpin ID: TR01757P.1; FWD Oligo: CACCGAATTCGTTCCGAGAGTTTCTGCGTC, RVS Oligo:
GGCGTCCATTGATTTTGTTT
Hairpin ID: TR01352P.1; FWD Oligo: AGTCTAGACCAACCAAGATTCGCTGATT, RVS Oligo:
AAGAATTCGTAATCCAGCAGTGCCACCT
Hairpin ID: TR02539P.1; FWD Oligo: AAGAATTCATCAACGAGGGCACAGAATC, RVS Oligo:
AGTCTAGATAGCCGAGTTAAGGGCACTG
Hairpin ID: SH01260.N2; FWD Oligo:
ctagcagtTTGAATGGTAATCGAGTTCTAtagttatattcaagcataTAGAACTCGATTACCATTCAAgcg, RVS Oligo:
aattcgcTTGAATGGTAATCGAGTTCTAtatgcttgaatataactaTAGAACTCGATTACCATTCAAactg
Hairpin ID: SH01261.N2; FWD Oligo:
ctagcagtCCGGATGATGCTGGACGATCAtagttatattcaagcataTGATCGTCCAGCATCATCCGGgcg, RVS
Oligo: aattcgcCCGGATGATGCTGGACGATCAtatgcttgaatataactaTGATCGTCCAGCATCATCCGGactg
Hairpin ID: TR01154P.1; FWD Oligo: AGTCTAGACCAACAGAGAACTTGACGCA, RVS Oligo:
AAGAATTCCGAATACGCTTAAACCTGGC
Hairpin ID: TR01997P.1; FWD Oligo: CACCGAATTCGCGACGAGATCGATGAACTT, RVS Oligo:
CATGTCCCCCAGTTTCCTTA
Hairpin ID: TR02409P.1; FWD Oligo: AAGAATTCATCGCTATCCGGAGCCTTAT, RVS Oligo:
AGTCTAGACGATCGTTACCTACCGGAAA
Hairpin ID: TR00793A.1; FWD Oligo: GTCTAGAGAAACGGCTATGGAAGTGGA, RVS Oligo:
AGAATTCTCTTGTTGTCGCTGATTTCG
Hairpin ID: TR01127P.1; FWD Oligo: AGTCTAGAGAATTGAGCTGAGAAAGCCG, RVS Oligo:
AAGAATTCTGAGTATTCCGCAGCACTTG
Hairpin ID: TR02562P.1; FWD Oligo: AAGAATTCAAGAGACCGGCAATCAAATG, RVS Oligo:
AGTCTAGAAATCGTATGCAGGATCTGGG
Hairpin ID: SH00178.N; FWD Oligo:
ctagcagtAAGGGATAGCTTAATTCTTAAtagttatattcaagcataTTAAGAATTAAGCTATCCCTTgcg, RVS Oligo:
aattcgcAAGGGATAGCTTAATTCTTAAtatgcttgaatataactaTTAAGAATTAAGCTATCCCTTactg
Hairpin ID: TR02563P.1; FWD Oligo: AAGAATTCATACCCCGACGTCTTAGCCT, RVS Oligo:
AGTCTAGAGCCGGATTGATCTCACTGAT
Hairpin ID: TR02564P.1; FWD Oligo: AAGAATTCCAACAGGGCGCAATAAAAAT, RVS Oligo:
AGTCTAGAGGATCCCACAGCATAAGTCC
Hairpin ID: TR04471P.1; FWD Oligo: AAGAATTCCCGGCATTTACCAAAAACAG, RVS Oligo:
AGTCTAGACAGCCACAAAACCTTGGACT
Hairpin ID: TR00553P.1; FWD Oligo: GTCTAGATATTAAGCGGAATTGGGCAG, RVS Oligo:
AGAATTCGCAAATCTTGGGAGTTGAGC
Hairpin ID: TR00228A.1; FWD Oligo: GTCTAGAAGGACATTTTCGATGCCAAG, RVS Oligo:
AGAATTCTGATTGCAAACAGTCGGAAC
Hairpin ID: TR04460P.1; FWD Oligo: AAGAATTCCCATTGAACTCGAGCATTGA, RVS Oligo:
AGTCTAGAGAATATTGAGGGTGCGTCGT
Hairpin ID: TR00930P.1; FWD Oligo: AGTCTAGAATGAGGAGTAACATTGGCGG, RVS Oligo:
AAGAATTCGGAATGATTTGCTGATCGGT
Hairpin ID: TR00842A.1; FWD Oligo: GTCTAGAGCGGAGCTGTACTCCTGTTC, RVS Oligo:
AGAATTCTCAGTAGTGATTGCGTCGCT
Hairpin ID: SH00716.N; FWD Oligo:
ctagcagtAGGCTTGGATCAAGAAGACAAtagttatattcaagcataTTGTCTTCTTGATCCAAGCCTgcg, RVS
Oligo: aattcgcAGGCTTGGATCAAGAAGACAAtatgcttgaatataactaTTGTCTTCTTGATCCAAGCCTactg
Hairpin ID: TR00051A.2; FWD Oligo: AAGAATTCTTGGCCTCTATCGATTGTCC, RVS Oligo:
AGTCTAGACTGGGTGAAAACTTCCGTGT
Hairpin ID: TR00050A.1; FWD Oligo: GTCTAGAAATCTGAACAACGAGACCCG, RVS Oligo:
AGAATTCCAATTACAGGCAGCGACTCA
Hairpin ID: TR00051A.1; FWD Oligo: GTCTAGATTGGCCTCTATCGATTGTCC, RVS Oligo:
AGAATTCCTGGGTGAAAACTTCCGTGT
Hairpin ID: TR00051P.1; FWD Oligo: CACCTTGGCCTCTATCGATTGTCC, RVS Oligo:
CTGGGTGAAAACTTCCGTGT
Hairpin ID: SH00756.N; FWD Oligo:
ctagcagtCGCGATGTTGGTGAACATAAAtagttatattcaagcataTTTATGTTCACCAACATCGCGgcg, RVS
Oligo: aattcgcCGCGATGTTGGTGAACATAAAtatgcttgaatataactaTTTATGTTCACCAACATCGCGactg
Hairpin ID: SH00830.N; FWD Oligo:
ctagcagtACGGCTAAGAATAGAGTTAAAtagttatattcaagcataTTTAACTCTATTCTTAGCCGTgcg, RVS Oligo:
aattcgcACGGCTAAGAATAGAGTTAAAtatgcttgaatataactaTTTAACTCTATTCTTAGCCGTactg
Hairpin ID: SH00466.N; FWD Oligo:
ctagcagtTCAGATTTCTCAATTGTTTAAtagttatattcaagcataTTAAACAATTGAGAAATCTGAgcg, RVS Oligo:
aattcgcTCAGATTTCTCAATTGTTTAAtatgcttgaatataactaTTAAACAATTGAGAAATCTGAactg
Hairpin ID: SH00978.N; FWD Oligo:
ctagcagtCTACCCGGATCTAATAATCAAtagttatattcaagcataTTGATTATTAGATCCGGGTAGgcg, RVS
Oligo: aattcgcCTACCCGGATCTAATAATCAAtatgcttgaatataactaTTGATTATTAGATCCGGGTAGactg
Hairpin ID: TR00773A.1; FWD Oligo: GTCTAGACCACATTCTAAAGCGCGAAT, RVS Oligo:
AGAATTCTGAACCATCGTGTCCTTGAA
Hairpin ID: SH01652.N; FWD Oligo:
ctagcagtATGGTTCAGTTGGAACAGATAtagttatattcaagcataTATCTGTTCCAACTGAACCATgcg, RVS
Oligo: aattcgcATGGTTCAGTTGGAACAGATAtatgcttgaatataactaTATCTGTTCCAACTGAACCATactg
Hairpin ID: TR04514P.1; FWD Oligo: AAGAATTCCAGCACCTTCCACAGTTGAG, RVS Oligo:
AGTCTAGATTGCTGTCCCTTCTCGATCT
Hairpin ID: SH00533.N; FWD Oligo:
ctagcagtTCGCTAGTTGGTAGTTTGTTTtagttatattcaagcataAAACAAACTACCAACTAGCGAgcg, RVS
Oligo: aattcgcTCGCTAGTTGGTAGTTTGTTTtatgcttgaatataactaAAACAAACTACCAACTAGCGAactg
Hairpin ID: TR00753A.1; FWD Oligo: GTCTAGAGCCCACCAAGTAAAAGCAGA, RVS Oligo:
AGAATTCTATTCGTAATCACTCGGGGG
Hairpin ID: SH00541.N; FWD Oligo:
ctagcagtCAAGAAGGTTATCAAGAGCTAtagttatattcaagcataTAGCTCTTGATAACCTTCTTGgcg, RVS
Oligo: aattcgcCAAGAAGGTTATCAAGAGCTAtatgcttgaatataactaTAGCTCTTGATAACCTTCTTGactg
Hairpin ID: TR01690P.1; FWD Oligo: CACCGAATTCGATCCTGCTCTACTGCGTCC, RVS Oligo:
GCCGGAAGTGATTGTTGAGT
Hairpin ID: SH00107.N; FWD Oligo:
ctagcagtAACGACATCGAACAAGTTCAAtagttatattcaagcataTTGAACTTGTTCGATGTCGTTgcg, RVS
Oligo: aattcgcAACGACATCGAACAAGTTCAAtatgcttgaatataactaTTGAACTTGTTCGATGTCGTTactg
Hairpin ID: TR02663P.1; FWD Oligo: AACAATTGACGAACACAATTCCAGTCCC, RVS Oligo:
AGACTAGTTGTTCGTAGTCGTGGTGGAG
Hairpin ID: TR01691P.1; FWD Oligo: CACCGAATTCTTTCTGAACAGGATCCCGAG, RVS Oligo:
GAAAAACGATGGGAGTGGAA
Hairpin ID: TR00577A.1; FWD Oligo: GTCTAGATTGCCTCGGATAAGTTCGAT, RVS Oligo:
AGAATTCTGTTGTTTGCATGAGTTGCTC
Hairpin ID: TR00633A.1; FWD Oligo: GTCTAGATCCATGCACCACAGAAATGT, RVS Oligo:
AGAATTCAACAACTCCCCACAAGTTCG
Hairpin ID: TR00632A.1; FWD Oligo: GTCTAGACAACTACCTTGCATGGCCTC, RVS Oligo:
AGAATTCGCTTCCTTGGATGATGCTGT
Hairpin ID: TR02565P.1; FWD Oligo: AAGAATTCTCATGTCCATCGCATCCTTA, RVS Oligo:
AGTCTAGAACGAAGGCGGTTGGTTTAAT
Hairpin ID: SH01653.N; FWD Oligo:
ctagcagtCTACTCAAGAATCAAACAGAAtagttatattcaagcataTTCTGTTTGATTCTTGAGTAGgcg, RVS Oligo:
aattcgcCTACTCAAGAATCAAACAGAAtatgcttgaatataactaTTCTGTTTGATTCTTGAGTAGactg
Hairpin ID: TR01863P.1; FWD Oligo: CACCGAATTCATAAAACGCAACGCTTGGAC, RVS Oligo:
AAATACTCCCGCATCATTGC
Hairpin ID: TR00568A.1; FWD Oligo: GTCTAGAGATCTTGCCAATCGAGAAGC, RVS Oligo:
AGAATTCAGTCTGAACCTTGGGGACCT
Hairpin ID: TR01864P.1; FWD Oligo: CACCGAATTCGATCATGCGGCTTTATGGAT, RVS Oligo:
AAATGGTGAACACCTCCTGC
Hairpin ID: TR02566P.1; FWD Oligo: AAGAATTCACGAGTTGGTCGGAAAATCA, RVS Oligo:
AGTCTAGAGATCGAAGGACTGAAAAGCG
Hairpin ID: TR01692P.1; FWD Oligo: CACCGAATTCTCATTTCCATTCATTGCTGC, RVS Oligo:
GGATGCTTATCGCTGGTTGT
Hairpin ID: TR04515P.1; FWD Oligo: AAGAATTCACTGGACACTTGTTCCCGTC, RVS Oligo:
AGTCTAGATCCATCGGTTTGCATCATAA
Hairpin ID: TR00965P.1; FWD Oligo: AGTCTAGACCAGAACGCTCGATCCTAAG, RVS Oligo:
AAGAATTCCTCTTTGCCCTTGCTACTGG
Hairpin ID: TR01758P.1; FWD Oligo: CACCGAATTCTGGTCAGCTATTTGCACAGC, RVS Oligo:
CGTTCTTTTCGATCTGCTCC
Hairpin ID: TR01693P.1; FWD Oligo: CACCGAATTCGTGCCCATAGCATCACAATG, RVS Oligo:
GAGCTCCTAGTCAAATGGCG
Hairpin ID: TR01998P.1; FWD Oligo: CACCGAATTCACAGATGTGCCATGGTCAAG, RVS Oligo:
GGAGCTCACCTCATTAGGCA
Hairpin ID: TR02426P.1; FWD Oligo: AAGAATTCCAGGTGGACCCAGCTACAAT, RVS Oligo:
AGTCTAGAAATCGATTGGAATGGCTGAC
Hairpin ID: TR01952P.1; FWD Oligo: CACCGAATTCCAAAGTTCCAGCGAGAGTCC, RVS Oligo:
GAATTTACGGGATCGGGAAT
Hairpin ID: TR00843A.1; FWD Oligo: GTCTAGAAAGGTTTGGACGAGATGGTG, RVS Oligo:
AGAATTCTGATCCTTGTTCATCCACGA
Hairpin ID: SH00180.N; FWD Oligo:
ctagcagtTCGAGGATGTCAAGAAGCTGAtagttatattcaagcataTCAGCTTCTTGACATCCTCGAgcg, RVS
Oligo: aattcgcTCGAGGATGTCAAGAAGCTGAtatgcttgaatataactaTCAGCTTCTTGACATCCTCGAactg
Hairpin ID: TR02705P.1; FWD Oligo: AAGAATTCCTTTGAAGGACCTCCGTCTG, RVS Oligo:
AGTCTAGATCACATTTGCGCTTATCCAA
Hairpin ID: TR01918P.1; FWD Oligo: CACCGAATTCTGTGGTGATGAGGTTCTCCA, RVS Oligo:
AAATGAAGGTGGAGTCGGTG
Hairpin ID: TR01587A.1; FWD Oligo: AGTCTAGACAATTTGGGCAATGTGAGTG, RVS Oligo:
AAGAATTCTATTGCTCTTGTGCGTCCAG
Hairpin ID: SH00181.N; FWD Oligo:
ctagcagtCAGGAGCTTAAGAGAAGTAAAtagttatattcaagcataTTTACTTCTCTTAAGCTCCTGgcg, RVS
Oligo: aattcgcCAGGAGCTTAAGAGAAGTAAAtatgcttgaatataactaTTTACTTCTCTTAAGCTCCTGactg
Hairpin ID: TR01999P.1; FWD Oligo: CACCGAATTCTCTGTAGGTACCCGGAAACG, RVS Oligo:
AATGTTATGCCTCGCTTTGG
Hairpin ID: SH00786.N; FWD Oligo:
ctagcagtCAGCTGGAAGCTGAAGATGAAtagttatattcaagcataTTCATCTTCAGCTTCCAGCTGgcg, RVS
Oligo: aattcgcCAGCTGGAAGCTGAAGATGAAtatgcttgaatataactaTTCATCTTCAGCTTCCAGCTGactg
Hairpin ID: TR02000P.1; FWD Oligo: CACCGAATTCTGTCGAACATTCTCGACTGC, RVS Oligo:
GTAATTGACAAAAAGCGCCG
Hairpin ID: TR00008A.2; FWD Oligo: GTCTAGATTCAAGACGATGCTGGTGAG, RVS Oligo:
AGAATTCCACCAGAGTGGACTCGATGA
Hairpin ID: TR00007A.1; FWD Oligo: GTCTAGAGCCAGCATGATGAAGAAGGT, RVS Oligo:
AGAATTCATGATGACGAAGGCCAAGAC
Hairpin ID: SH00021.O; FWD Oligo:
ctagcagtTCGATGAACTCCATCTTGCTGtagttatattcaagcataCAGCAAGATGGAGTTCATCGAgcg, RVS
Oligo: aattcgcTCGATGAACTCCATCTTGCTGtatgcttgaatataactaCAGCAAGATGGAGTTCATCGAactg
Hairpin ID: SH00022.O; FWD Oligo:
ctagcagtTTGACTAACTTGTTAAAGTTGtagttatattcaagcataCAACTTTAACAAGTTAGTCAAgcg, RVS Oligo:
aattcgcTTGACTAACTTGTTAAAGTTGtatgcttgaatataactaCAACTTTAACAAGTTAGTCAAactg
Hairpin ID: TR00807A.1; FWD Oligo: GTCTAGATCGTGGAGCAGATCAAGATG, RVS Oligo:
AGAATTCCCGATTTGAGGTTAGGTCCA
Hairpin ID: TR00346P.1; FWD Oligo: GTCTAGAAGAACTGGAATAGTGCGCGT, RVS Oligo:
AGAATTCGCTATACTCCCCGAACACGA
Hairpin ID: TR02448P.1; FWD Oligo: AAGAATTCCTGCAACATGAGCAGATCGT, RVS Oligo:
AGTCTAGAACACGCTACCTCCCATTGTC
Hairpin ID: TR01552A.1; FWD Oligo: AGTCTAGAATCGATTGCTCAAATACCGC, RVS Oligo:
AAGAATTCTTATTGCCTTCCATTGCCTC
Hairpin ID: SH01358.N2; FWD Oligo:
ctagcagtTAGGTCCCAGGTGGTCATCAAtagttatattcaagcataTTGATGACCACCTGGGACCTAgcg, RVS
Oligo: aattcgcTAGGTCCCAGGTGGTCATCAAtatgcttgaatataactaTTGATGACCACCTGGGACCTAactg
Hairpin ID: TR02351P.1; FWD Oligo: AAGAATTCACGCGAATAGCGTCAAAAAC, RVS Oligo:
AGTCTAGAAAGTCGTCCTCCACGTTGTC
Hairpin ID: TR01463P.1; FWD Oligo: AGTCTAGACTTCCGTAAGTCACCACCGT, RVS Oligo:
AAGAATTCGGCTCGACTCCTGGATATGA
Hairpin ID: TR02352P.1; FWD Oligo: AAGAATTCACAGTTTTTCCGCAAACTCG, RVS Oligo:
AGTCTAGACCAGGCACACGTACAGAGAG
Hairpin ID: TR01919P.1; FWD Oligo: CACCGAATTCCTGGGCGATACCAAGTGATT, RVS Oligo:
TCGGTCTGCTTCTCCTTCTC
Hairpin ID: SH00182.N; FWD Oligo:
ctagcagtCAGGCTGATAGCGCAATGGAAtagttatattcaagcataTTCCATTGCGCTATCAGCCTGgcg, RVS
Oligo: aattcgcCAGGCTGATAGCGCAATGGAAtatgcttgaatataactaTTCCATTGCGCTATCAGCCTGactg
Hairpin ID: TR04620P.1; FWD Oligo: GAATTCTTCTCGTGGCTATCGCTTTT, RVS Oligo:
TCTAGACTTTGAACCCCTTGGCAAT
Hairpin ID: TR01604P.1; FWD Oligo: AGTCTAGATGACACGACACAGAAGAGCC, RVS Oligo:
AAGAATTCATCTTGGAGGGAAACAGGGT
Hairpin ID: SH00705.N; FWD Oligo:
ctagcagtCAGCAAGACCTTCAAGCCCAAtagttatattcaagcataTTGGGCTTGAAGGTCTTGCTGgcg, RVS
Oligo: aattcgcCAGCAAGACCTTCAAGCCCAAtatgcttgaatataactaTTGGGCTTGAAGGTCTTGCTGactg
Hairpin ID: SH00986.N; FWD Oligo:
ctagcagtAAAGATTATAACGATTTCAAAtagttatattcaagcataTTTGAAATCGTTATAATCTTTgcg, RVS Oligo:
aattcgcAAAGATTATAACGATTTCAAAtatgcttgaatataactaTTTGAAATCGTTATAATCTTTactg
Hairpin ID: SH00987.N; FWD Oligo:
ctagcagtCCGGCGCAGTGACTACATAAAtagttatattcaagcataTTTATGTAGTCACTGCGCCGGgcg, RVS
Oligo: aattcgcCCGGCGCAGTGACTACATAAAtatgcttgaatataactaTTTATGTAGTCACTGCGCCGGactg
Hairpin ID: TR01469P.1; FWD Oligo: AGTCTAGAAATTTCATCCTCATCCGCAG, RVS Oligo:
AAGAATTCTCCGTGGGTAATGCTACCTC
Hairpin ID: TR02567P.1; FWD Oligo: AACAATTGACCAAATGGAAAAATCTGCG, RVS Oligo:
AGTCTAGAACTGGCCAGGGAGATGTTCT
Hairpin ID: SH00183.N; FWD Oligo:
ctagcagtCTCGACAAATTGCACAACCTAtagttatattcaagcataTAGGTTGTGCAATTTGTCGAGgcg, RVS
Oligo: aattcgcCTCGACAAATTGCACAACCTAtatgcttgaatataactaTAGGTTGTGCAATTTGTCGAGactg
Hairpin ID: SH00823.N; FWD Oligo:
ctagcagtCTCGACAAGGATGGAGCAGTAtagttatattcaagcataTACTGCTCCATCCTTGTCGAGgcg, RVS
Oligo: aattcgcCTCGACAAGGATGGAGCAGTAtatgcttgaatataactaTACTGCTCCATCCTTGTCGAGactg
Hairpin ID: TR02543P.1; FWD Oligo: AAGAATTCGGGAGAGCTATGACGACGAG, RVS Oligo:
AGTCTAGAAGGCCAAGTTAGCAGGACAA
Hairpin ID: TR02568P.1; FWD Oligo: AAGAATTCTACGGACATATCCACGACGA, RVS Oligo:
AGTCTAGACCTTTCGAACTCTGACGCTC
Hairpin ID: TR02711P.1; FWD Oligo: AAGAATTCGCTCCAAGCTGAAAAGCATC, RVS Oligo:
AGTCTAGATAGGTATAGCGCCCGATGAG
Hairpin ID: SH00184.N; FWD Oligo:
ctagcagtCAAGCGGATCCAACAGCTCAAtagttatattcaagcataTTGAGCTGTTGGATCCGCTTGgcg, RVS
Oligo: aattcgcCAAGCGGATCCAACAGCTCAAtatgcttgaatataactaTTGAGCTGTTGGATCCGCTTGactg
Hairpin ID: TR02569P.1; FWD Oligo: AAGAATTCTCAACCAACCAAAGTCACCA, RVS Oligo:
AGTCTAGAGGTGCACTTGACCAGGTTCT
Hairpin ID: TR00619A.1; FWD Oligo: GTCTAGAATCTGAGCCACATGATGCAG, RVS Oligo:
AGAATTCCATGAACGAGATGTTGGTCG
Hairpin ID: TR00431A.1; FWD Oligo: GTCTAGATGCTTTTCCAGATAATGGGC, RVS Oligo:
AGAATTCAGGTTGATGGCGATGCTTAG
Hairpin ID: TR02719P.1; FWD Oligo: AAGAATTCGCAGGGGAAAGGATTCTACC, RVS Oligo:
AGTCTAGACCGAAAGGCTGAACAAGAAG
Hairpin ID: SH00580.N; FWD Oligo:
ctagcagtCAGTTCGAGTAGCATCAACAAtagttatattcaagcataTTGTTGATGCTACTCGAACTGgcg, RVS
Oligo: aattcgcCAGTTCGAGTAGCATCAACAAtatgcttgaatataactaTTGTTGATGCTACTCGAACTGactg
Hairpin ID: TR01694P.1; FWD Oligo: CACCGAATTCAATGCGCAGGTAAAACAAGG, RVS Oligo:
GTAATACAGCTTTCGGGGGC
Hairpin ID: TR02447P.1; FWD Oligo: AAGAATTCCTCTGCGCAACACCATCTAA, RVS Oligo:
AGTCTAGATTGTCTCTTTGGGAAAGCGT
Hairpin ID: TR02001P.1; FWD Oligo: CACCGAATTCAGAGTACGGACCAGGACACG, RVS Oligo:
GAGCAGAGGGTCAGAACGAG
Hairpin ID: SH01654.N; FWD Oligo:
ctagcagtCTGGACCGCCACAATGGTGAAtagttatattcaagcataTTCACCATTGTGGCGGTCCAGgcg, RVS
Oligo: aattcgcCTGGACCGCCACAATGGTGAAtatgcttgaatataactaTTCACCATTGTGGCGGTCCAGactg
Hairpin ID: TR02570P.1; FWD Oligo: AAGAATTCGCACCCAAGTCTTCTGCTTC, RVS Oligo:
AGTCTAGAGTAGATGGATCGCACCGACT
Hairpin ID: SH00749.N; FWD Oligo:
ctagcagtCACGATGATCTCATCAAGAAAtagttatattcaagcataTTTCTTGATGAGATCATCGTGgcg, RVS
Oligo: aattcgcCACGATGATCTCATCAAGAAAtatgcttgaatataactaTTTCTTGATGAGATCATCGTGactg
Hairpin ID: TR00986P.1; FWD Oligo: AGTCTAGAGATCAAATGCTCAAGTCGCA, RVS Oligo:
AAGAATTCAATTCTTTTGGGCTGACCCT
Hairpin ID: TR02353P.1; FWD Oligo: AAGAATTCAAGGAACACCAACCATCAGC, RVS Oligo:
AGTCTAGACGAGTAGCCTGCTAAACCGA
Hairpin ID: SH00185.N; FWD Oligo:
ctagcagtAACGATGATATTATAGATAAAtagttatattcaagcataTTTATCTATAATATCATCGTTgcg, RVS Oligo:
aattcgcAACGATGATATTATAGATAAAtatgcttgaatataactaTTTATCTATAATATCATCGTTactg
Hairpin ID: TR02677P.1; FWD Oligo: AAGAATTCGGAGATGCAGAGCTCCTACG, RVS Oligo:
AGTCTAGACAAATCCTCCAGCTGCTTCT
Hairpin ID: TR00360A.2; FWD Oligo: GACTAGTGGCAAGAGGGAATGAAGGAT, RVS Oligo:
AGAATTCCCGTCTCGCTCGTTTCTAAC
Hairpin ID: TR02713P.1; FWD Oligo: AAGAATTCCCAACAGCCCCTACTAACCA, RVS Oligo:
AGTCTAGAGGACGACAACCCTCCTGTTA
Hairpin ID: SH00186.N; FWD Oligo:
ctagcagtCAGCTGCACGAGGTCAATTTAtagttatattcaagcataTAAATTGACCTCGTGCAGCTGgcg, RVS
Oligo: aattcgcCAGCTGCACGAGGTCAATTTAtatgcttgaatataactaTAAATTGACCTCGTGCAGCTGactg
Hairpin ID: TR00841A.1; FWD Oligo: GTCTAGAATGGTTCTCAAAGTGCCGAC, RVS Oligo:
AGAATTCTGCAAGAGCTCCCTGTAGGT
Hairpin ID: SH00715.N; FWD Oligo:
ctagcagtCAGCGATGTGATACAGAAGATtagttatattcaagcataATCTTCTGTATCACATCGCTGgcg, RVS
Oligo: aattcgcCAGCGATGTGATACAGAAGATtatgcttgaatataactaATCTTCTGTATCACATCGCTGactg
Hairpin ID: TR01278P.1; FWD Oligo: AGTCTAGAATGGTGACGTTGAATGGTGA, RVS Oligo:
AAGAATTCCCTCAAAGTGACCCATGTCC
Hairpin ID: SH00603.N; FWD Oligo:
ctagcagtTACCATCGACTTGTCCGACAAtagttatattcaagcataTTGTCGGACAAGTCGATGGTAgcg, RVS
Oligo: aattcgcTACCATCGACTTGTCCGACAAtatgcttgaatataactaTTGTCGGACAAGTCGATGGTAactg
Hairpin ID: TR04516P.1; FWD Oligo: AAGAATTCGAACTTGTGCGTGCGTTAAA, RVS Oligo:
AGTCTAGACTCATGTTTGTTGGGCAGAA
Hairpin ID: SH00563.N; FWD Oligo:
ctagcagtTCGCTAGTGTTTAGGTTGTAAtagttatattcaagcataTTACAACCTAAACACTAGCGAgcg, RVS
Oligo: aattcgcTCGCTAGTGTTTAGGTTGTAAtatgcttgaatataactaTTACAACCTAAACACTAGCGAactg
Hairpin ID: TR02354P.1; FWD Oligo: AAGAATTCCCGTATCCTGGTCCTGTTTC, RVS Oligo:
AGTCTAGAGCCCATTGGCAGGATTATTA
Hairpin ID: SH00516.N; FWD Oligo:
ctagcagtCACGAACATTGTGGAGACAAAtagttatattcaagcataTTTGTCTCCACAATGTTCGTGgcg, RVS
Oligo: aattcgcCACGAACATTGTGGAGACAAAtatgcttgaatataactaTTTGTCTCCACAATGTTCGTGactg
Hairpin ID: SH00187.N; FWD Oligo:
ctagcagtCTGCCACAGCCTACTACAGAAtagttatattcaagcataTTCTGTAGTAGGCTGTGGCAGgcg, RVS
Oligo: aattcgcCTGCCACAGCCTACTACAGAAtatgcttgaatataactaTTCTGTAGTAGGCTGTGGCAGactg
Hairpin ID: TR01007P.1; FWD Oligo: AAGAATTCATCCGCACAACTGTGCATTA, RVS Oligo:
AGTCTAGAGCCCGAAAAAGGAGAAACTT
Hairpin ID: TR00617A.1; FWD Oligo: GTCTAGAGCTAAATGCTTGGAGAAGCG, RVS Oligo:
AGAATTCTACAGCTGATGCCAGACCAA
Hairpin ID: TR02571P.1; FWD Oligo: AAGAATTCGCTCAAGTGGTCTGGAAAGC, RVS Oligo:
AGTCTAGAAGAGAGTGCGAACGTCCAGT
Hairpin ID: TR00838A.1; FWD Oligo: GTCTAGAGAGGTGTCAGGACAGGAGGA, RVS Oligo:
AGAATTCTGGCAGCACAATATCTCAGC
Hairpin ID: SH00712.N; FWD Oligo:
ctagcagtTAGTTCGGTTCAGATGCTCAAtagttatattcaagcataTTGAGCATCTGAACCGAACTAgcg, RVS
Oligo: aattcgcTAGTTCGGTTCAGATGCTCAAtatgcttgaatataactaTTGAGCATCTGAACCGAACTAactg
Hairpin ID: TR00836A.1; FWD Oligo: GTCTAGAACAACGGTGCAGCAGTACAT, RVS Oligo:
AGAATTCGTAGCTGCAGGTCTTGACGC
Hairpin ID: SH00710.N; FWD Oligo:
ctagcagtCAGCACAACGGTGCAGCAGTAtagttatattcaagcataTACTGCTGCACCGTTGTGCTGgcg, RVS
Oligo: aattcgcCAGCACAACGGTGCAGCAGTAtatgcttgaatataactaTACTGCTGCACCGTTGTGCTGactg
Hairpin ID: TR02572P.1; FWD Oligo: AAGAATTCATTATGATCGGACTGACGCC, RVS Oligo:
AGTCTAGAGTAAAAGTGCCGCAACGATT
Hairpin ID: SH01038.N; FWD Oligo:
ctagcagtAACGATATCTACTGTAAGTTAtagttatattcaagcataTAACTTACAGTAGATATCGTTgcg, RVS Oligo:
aattcgcAACGATATCTACTGTAAGTTAtatgcttgaatataactaTAACTTACAGTAGATATCGTTactg
Hairpin ID: SH01039.N; FWD Oligo:
ctagcagtACGATATCTACTGTAAGTTAAtagttatattcaagcataTTAACTTACAGTAGATATCGTgcg, RVS Oligo:
aattcgcACGATATCTACTGTAAGTTAAtatgcttgaatataactaTTAACTTACAGTAGATATCGTactg
Hairpin ID: TR00706A.2; FWD Oligo: AAGAATTCCATCACTTCACCACGTCACC, RVS Oligo:
AGTCTAGACTTACGCGGAATGTATCGGT
Hairpin ID: TR00706A.1; FWD Oligo: GTCTAGACATCACTTCACCACGTCACC, RVS Oligo:
AGAATTCCTTACGCGGAATGTATCGGT
Hairpin ID: TR00706P.1; FWD Oligo: CACCCATCACTTCACCACGTCACC, RVS Oligo:
CTTACGCGGAATGTATCGGT
Hairpin ID: SH00708.N; FWD Oligo:
ctagcagtCAGTGTCAAGATGCTGATGTAtagttatattcaagcataTACATCAGCATCTTGACACTGgcg, RVS
Oligo: aattcgcCAGTGTCAAGATGCTGATGTAtatgcttgaatataactaTACATCAGCATCTTGACACTGactg
Hairpin ID: TR01597P.1; FWD Oligo: AAGAATTCAAGTCCTCCACGGATAGCCT, RVS Oligo:
AGTCTAGAGTATTTATTTTCGCCGGCCT
Hairpin ID: SH00426.N; FWD Oligo:
ctagcagtTACGATGAGCGCGATAAGCTAtagttatattcaagcataTAGCTTATCGCGCTCATCGTAgcg, RVS
Oligo: aattcgcTACGATGAGCGCGATAAGCTAtatgcttgaatataactaTAGCTTATCGCGCTCATCGTAactg
Hairpin ID: TR01759P.1; FWD Oligo: CACCGAATTCATTTGGCCGCTGTTATATGC, RVS Oligo:
AAGAATCCCTCAAGATCGCA
Hairpin ID: TR02438P.1; FWD Oligo: AAGAATTCCGACCTCAATCGTACCACCT, RVS Oligo:
AGTCTAGAGCAGAACTCCTCGTTGAAGG
Hairpin ID: TR02573P.1; FWD Oligo: AAGAATTCAAAACAAGCGAAGGAAGGGT, RVS Oligo:
AGTCTAGAAAGCGAACTTTTCCGTGTGT
Hairpin ID: TR01187P.1; FWD Oligo: AGTCTAGACCTGGGGACAATTTATACGG, RVS Oligo:
AAGAATTCAACTTGCGCTTGTTGAAGGT
Hairpin ID: TR02002P.1; FWD Oligo: CACCGAATTCGATCAACAAGGCCAACCAGT, RVS Oligo:
TGGCTCCAAAAAGTTCTGCT
Hairpin ID: SH00133.N; FWD Oligo:
ctagcagtCAGCGATACAAGAACGATATAtagttatattcaagcataTATATCGTTCTTGTATCGCTGgcg, RVS
Oligo: aattcgcCAGCGATACAAGAACGATATAtatgcttgaatataactaTATATCGTTCTTGTATCGCTGactg
Hairpin ID: TR00308A.1; FWD Oligo: GTCTAGAAACACTGACCAAGGAGCGAT, RVS Oligo:
AGAATTCGTGTAATTACTCGGCCCACG
Hairpin ID: TR02574P.1; FWD Oligo: AAGAATTCTCAATCATTGCCCGACCTAC, RVS Oligo:
AGTCTAGAGCTGACGTTGTTCTTCCACA
Hairpin ID: TR02384P.1; FWD Oligo: AAGAATTCAAGGGACGTTTATGAGTGCG, RVS Oligo:
AGTCTAGAGCACTGTCTGTTTCTTGGCA
Hairpin ID: TR00743A.1; FWD Oligo: GTCTAGAGCTCTTCTTCCGTTGTCTGG, RVS Oligo:
AGAATTCGGACAAGTGTTGCCGAAAAT
Hairpin ID: TR04553P.1; FWD Oligo: AAGAATTCACAACTCCACGATTTCCGAG, RVS Oligo:
AGTCTAGAAGGAAGGCCAGGCTCTTTAG
Hairpin ID: TR02003P.1; FWD Oligo: CACCGAATTCACATCCTGCCAACCAGAATC, RVS Oligo:
AGAAGCTGCTGCCTCTGAAC
Hairpin ID: SH00188.N; FWD Oligo:
ctagcagtCACCTACTCCGCACCATCATAtagttatattcaagcataTATGATGGTGCGGAGTAGGTGgcg, RVS
Oligo: aattcgcCACCTACTCCGCACCATCATAtatgcttgaatataactaTATGATGGTGCGGAGTAGGTGactg
Hairpin ID: TR02575P.1; FWD Oligo: AAGAATTCTACGACCACCACTCCAAAGC, RVS Oligo:
AGTCTAGACAGTTCCGATAGTGCCGATT
Hairpin ID: TR00231A.1; FWD Oligo: GTCTAGACAGATTCCGTGGGTCAATCT, RVS Oligo:
AGAATTCCAAGGTAGTGGATGGGGCTA
Hairpin ID: SH00851.N; FWD Oligo:
ctagcagtCACGAACAAGATGATGAGATAtagttatattcaagcataTATCTCATCATCTTGTTCGTGgcg, RVS
Oligo: aattcgcCACGAACAAGATGATGAGATAtatgcttgaatataactaTATCTCATCATCTTGTTCGTGactg
Hairpin ID: TR00433P.1; FWD Oligo: GTCTAGAAGAGCTTTCCCGTTCTCCTC, RVS Oligo:
AGAATTCCAAGCAGAATGTCCCCTGAT
Hairpin ID: SH00481.N; FWD Oligo:
ctagcagtCACGATCTGCTTACTGCTCTAtagttatattcaagcataTAGAGCAGTAAGCAGATCGTGgcg, RVS
Oligo: aattcgcCACGATCTGCTTACTGCTCTAtatgcttgaatataactaTAGAGCAGTAAGCAGATCGTGactg
Hairpin ID: TR02004P.1; FWD Oligo: CACCGAATTCGATCTTGCACTTCCTGAGCC, RVS Oligo:
CAATGACGAACTGCACCTGT
Hairpin ID: TR04554P.1; FWD Oligo: AAGAATTCGGAGGACACTTACTGGCTGC, RVS Oligo:
AGTCTAGAATCCAAGGAACTCGACCGTA
Hairpin ID: SH00189.N; FWD Oligo:
ctagcagtTCGGCTGTACTCCATGATCAAtagttatattcaagcataTTGATCATGGAGTACAGCCGAgcg, RVS
Oligo: aattcgcTCGGCTGTACTCCATGATCAAtatgcttgaatataactaTTGATCATGGAGTACAGCCGAactg
Hairpin ID: TR02577P.1; FWD Oligo: AAGAATTCAATTTCTTTGCCGTGAATGC, RVS Oligo:
AGTCTAGAAAGATGGTTCGGTTCTCACG
Hairpin ID: TR02841P.1; FWD Oligo: AAGAATTCCTGCTTGACCAGATCGTTGA, RVS Oligo:
AGTCTAGACCAGAGCTGTCACTGTTCCA
Hairpin ID: SH00114.N; FWD Oligo:
ctagcagtCAGGATAGTATGGATCACAAAtagttatattcaagcataTTTGTGATCCATACTATCCTGgcg, RVS
Oligo: aattcgcCAGGATAGTATGGATCACAAAtatgcttgaatataactaTTTGTGATCCATACTATCCTGactg
Hairpin ID: SH00395.N; FWD Oligo:
ctagcagtTCGGTGGAGAATAGAGATATAtagttatattcaagcataTATATCTCTATTCTCCACCGAgcg, RVS
Oligo: aattcgcTCGGTGGAGAATAGAGATATAtatgcttgaatataactaTATATCTCTATTCTCCACCGAactg
Hairpin ID: TR02523P.1; FWD Oligo: AAGAATTCCCCGAATACCGATTTGCTTA, RVS Oligo:
AGTCTAGATGTTGCATTTCGAGTGCTTC
Hairpin ID: TR00923P.1; FWD Oligo: AGTCTAGAGCTGTACCCGGAGTGAGTGT, RVS Oligo:
AAGAATTCGTTGGACGCCCACTAAATGT
Hairpin ID: TR01760P.1; FWD Oligo: CACCGAATTCAAAACGAGCAGGACGACTGT, RVS Oligo:
TATGCACCTGCAATCGAAAG
Hairpin ID: SH01282.N2; FWD Oligo:
ctagcagtCAGGATTTACCTCTACGAATAtagttatattcaagcataTATTCGTAGAGGTAAATCCTGgcg, RVS
Oligo: aattcgcCAGGATTTACCTCTACGAATAtatgcttgaatataactaTATTCGTAGAGGTAAATCCTGactg
Hairpin ID: SH00632.N; FWD Oligo:
ctagcagtCTCCATGTTGTTGGTTCGGTTtagttatattcaagcataAACCGAACCAACAACATGGAGgcg, RVS
Oligo: aattcgcCTCCATGTTGTTGGTTCGGTTtatgcttgaatataactaAACCGAACCAACAACATGGAGactg
Hairpin ID: TR01920P.1; FWD Oligo: CACCGAATTCCATGGATTTGGAGAGGAGGA, RVS Oligo:
ATCTCTCCATGGAAAATGCG
Hairpin ID: SH00678.N; FWD Oligo:
ctagcagtAACGGGAGCGATAAACTACAAtagttatattcaagcataTTGTAGTTTATCGCTCCCGTTgcg, RVS
Oligo: aattcgcAACGGGAGCGATAAACTACAAtatgcttgaatataactaTTGTAGTTTATCGCTCCCGTTactg
Hairpin ID: SH01751.N; FWD Oligo:
ctagcagtACCAATTGTCATCAAGAAGTAtagttatattcaagcataTACTTCTTGATGACAATTGGTgcg, RVS Oligo:
aattcgcACCAATTGTCATCAAGAAGTAtatgcttgaatataactaTACTTCTTGATGACAATTGGTactg
Hairpin ID: TR01865P.1; FWD Oligo: CACCGAATTCCATCATCGACATAAGCACGG, RVS Oligo:
GCACGGTGACAATGTACGTC
Hairpin ID: TR02479P.1; FWD Oligo: AAGAATTCGTCGATATTGCCCGTCAGTT, RVS Oligo:
AGTCTAGAACAAAGCCGTTGGACTCATC
Hairpin ID: SH00658.N; FWD Oligo:
ctagcagtAAGGAGGACTCCTACCAGAAAtagttatattcaagcataTTTCTGGTAGGAGTCCTCCTTgcg, RVS
Oligo: aattcgcAAGGAGGACTCCTACCAGAAAtatgcttgaatataactaTTTCTGGTAGGAGTCCTCCTTactg
Hairpin ID: TR02725P.1; FWD Oligo: AAGAATTCCCACAGCTGAACAGTTTGGA, RVS Oligo:
AGTCTAGACAAGTAATGGTCGGCCTCAT
Hairpin ID: TR01078P.1; FWD Oligo: AGTCTAGACCGAGCTTTAACCACTCAGC, RVS Oligo:
AAGAATTCAGATACAGCCGGTGAAATCG
Hairpin ID: SH00846.N; FWD Oligo:
ctagcagtCACATTGTCTACTAATGTCAAtagttatattcaagcataTTGACATTAGTAGACAATGTGgcg, RVS Oligo:
aattcgcCACATTGTCTACTAATGTCAAtatgcttgaatataactaTTGACATTAGTAGACAATGTGactg
Hairpin ID: TR01761P.1; FWD Oligo: CACCGAATTCGGGGAAGAACGGGAAGATAA, RVS Oligo:
CAAGCGAAAAGATTCCGAAG
Hairpin ID: TR01356P.1; FWD Oligo: AGTCTAGAACGACTCGCATACTCAGCCT, RVS Oligo:
AAGAATTCTTGATTAGATCGCCTTTGGG
Hairpin ID: TR01358P.1; FWD Oligo: AGTCTAGACGTTGAGCTTAGTTCCGAGC, RVS Oligo:
AAGAATTCCACTGGAACCTGCGGTTAAT
Hairpin ID: TR01762P.1; FWD Oligo: CACCGAATTCTAAGCTGGATGAACTGGGCT, RVS Oligo:
TCGAAGGAGTCGACGAAGTT
Hairpin ID: TR00506A.1; FWD Oligo: GTCTAGACCTAGCCAGCTTTGGAGATG, RVS Oligo:
AGAATTCACGATGACAATGTTGTCGGA
Hairpin ID: TR02005P.1; FWD Oligo: CACCGAATTCCCCTGCTCTCCTATTTGCTG, RVS Oligo:
TGAAATGGCCAAGTAGGGAC
Hairpin ID: TR02642P.1; FWD Oligo: AAGAATTCTAAGCGAAAACCGGAAGAGA, RVS Oligo:
AGTCTAGACAGGCCGTTCCGAATAGTAA
Hairpin ID: TR01359P.1; FWD Oligo: AGTCTAGAAATGTGGTTCAACTTTCGCC, RVS Oligo:
AAGAATTCAAGTTCCTCGTCCCCGTACT
Hairpin ID: TR00232A.1; FWD Oligo: GTCTAGAGTGCCGAATAGCACCGATAG, RVS Oligo:
AGAATTCCGCTCGTTTGTGTGTGTTCT
Hairpin ID: TR01763P.1; FWD Oligo: CACCGAATTCCAAGTTCATTCTCAAGCGCA, RVS Oligo:
CCTCGTTAATGGAGTCCAGG
Hairpin ID: TR02332P.1; FWD Oligo: AAGAATTCAGGAGTTCGACAAGCGCTAC, RVS Oligo:
AGTCTAGACATGTTCATCCGCACCATAC
Hairpin ID: TR01695P.1; FWD Oligo: CACCGAATTCGACACCTCGGAGGGTAACTG, RVS Oligo:
AGAGCTGCACGCTTGTAGTG
Hairpin ID: TR00557A.1; FWD Oligo: GTCTAGAAAAAGCTGGAGGAGCAACAA, RVS Oligo:
AGAATTCTTGCTGCATATGGCAGTCTC
Hairpin ID: TR02006P.1; FWD Oligo: CACCGAATTCCACGAAGAAACCAGACAGCA, RVS Oligo:
TCTCGATCAGCTCACACCTG
Hairpin ID: TR00104A.1; FWD Oligo: GTCTAGACAATGGATATTTCGGGTTGG, RVS Oligo:
AGAATTCTTGACGTGCTCCTTCAACAG
Hairpin ID: TR02578P.1; FWD Oligo: AACAATTGCAGTCACGACAGTGACGCTT, RVS Oligo:
AGTCTAGACTGTTGTGGATGGTCAGGTG
Hairpin ID: TR01539A.1; FWD Oligo: AGTCTAGAGCGCCTATTATCGTCATGGT, RVS Oligo:
AAGAATTCACGCACTTGTTGATGTGAGC
Hairpin ID: TR02007P.1; FWD Oligo: CACCGAATTCCCATTCTTAAAGTTGCCCGA, RVS Oligo:
GAAGGAATCTGCGATTCAGC
Hairpin ID: SH00190.N; FWD Oligo:
ctagcagtAAGCGTATATTTATAGATAAAtagttatattcaagcataTTTATCTATAAATATACGCTTgcg, RVS Oligo:
aattcgcAAGCGTATATTTATAGATAAAtatgcttgaatataactaTTTATCTATAAATATACGCTTactg
Hairpin ID: TR02325P.1; FWD Oligo: CACCGAATTCACCCTGCTGCTACTGCTGAT, RVS Oligo:
GCTCGGAACTTGACGTCTTC
Hairpin ID: TR00292A.1; FWD Oligo: GTCTAGATACGATTCACGCAAGCATGT, RVS Oligo:
AGAATTCAAGCTGTCTGCGCCATAAAT
Hairpin ID: SH00191.N; FWD Oligo:
ctagcagtCAGGCGGAGTTTACTGGGAAAtagttatattcaagcataTTTCCCAGTAAACTCCGCCTGgcg, RVS
Oligo: aattcgcCAGGCGGAGTTTACTGGGAAAtatgcttgaatataactaTTTCCCAGTAAACTCCGCCTGactg
Hairpin ID: SH00415.N; FWD Oligo:
ctagcagtACCAAGTGTTCTGTTATTTAAtagttatattcaagcataTTAAATAACAGAACACTTGGTgcg, RVS Oligo:
aattcgcACCAAGTGTTCTGTTATTTAAtatgcttgaatataactaTTAAATAACAGAACACTTGGTactg
Hairpin ID: TR00306P.1; FWD Oligo: AAGAATTCGAATCTGTCGCGGAATCAAT, RVS Oligo:
AGTCTAGACCGCGTCGTAAACGTATTTT
Hairpin ID: TR03976P.1; FWD Oligo: AAGAATTCGGCAGCTAAAGCATGAGGAC, RVS Oligo:
AGTCTAGAGTTTCAGCGCCTTTTAGACG
Hairpin ID: SH00397.N; FWD Oligo:
ctagcagtAAGGAATAGATCGAACTATTAtagttatattcaagcataTAATAGTTCGATCTATTCCTTgcg, RVS Oligo:
aattcgcAAGGAATAGATCGAACTATTAtatgcttgaatataactaTAATAGTTCGATCTATTCCTTactg
Hairpin ID: TR02440P.1; FWD Oligo: AAGAATTCCGAGTACATGACCGCCTACA, RVS Oligo:
AGTCTAGAAGCTGCCCAGTGTGTTTACC
Hairpin ID: TR03834P.1; FWD Oligo: AAGAATTCTGCTGGTGAGAAGATCGTTG, RVS Oligo:
AGTCTAGACCCTTCAAAAGGATGGACCT
Hairpin ID: TR03835P.1; FWD Oligo: AAGAATTCCTGCCTATGTCCTGGAGAGC, RVS Oligo:
AGTCTAGAGCGTTCTCCGCACTAAACTC
Hairpin ID: TR02579P.1; FWD Oligo: AAGAATTCCCCGAGTGCAAAGCAATAAT, RVS Oligo:
AGTCTAGAGGATTTTGTGTGCTTGCGTA
Hairpin ID: TR00790A.1; FWD Oligo: GTCTAGAACCAACATATCCTTGAGGCG, RVS Oligo:
AGAATTCGCAGCACGTTATTCACATGG
Hairpin ID: TR02008P.1; FWD Oligo: CACCGAATTCCAAGCCCAATACACCGAACT, RVS Oligo:
CCTTTTGTCGTGCCTCTAGC
Hairpin ID: TR01696P.1; FWD Oligo: CACCGAATTCCAGCGCCTATTTGAGGAGTC, RVS Oligo:
GCACACACATTGAGGAATGC
Hairpin ID: TR00794A.1; FWD Oligo: GTCTAGATAGTGCACATGCTCTGGGAG, RVS Oligo:
AGAATTCTCAAATTTGCGTAGTCGCAG
Hairpin ID: SH01655.N; FWD Oligo:
ctagcagtTGCGATCATCACGCTAGTCTAtagttatattcaagcataTAGACTAGCGTGATGATCGCAgcg, RVS
Oligo: aattcgcTGCGATCATCACGCTAGTCTAtatgcttgaatataactaTAGACTAGCGTGATGATCGCAactg
Hairpin ID: TR02423P.1; FWD Oligo: AAGAATTCCAGAAAGTGGAGGGCTTGAG, RVS Oligo:
AGTCTAGACGCTTTGAGCGTTCAAGTTT
Hairpin ID: TR00501A.1; FWD Oligo: GTCTAGACTACAGCTTTTGCTTTCGGG, RVS Oligo:
AGAATTCCTTCACCTGCTCGAAGCTCT
Hairpin ID: SH00347.N; FWD Oligo:
ctagcagtTAGCATTAAGATATAGAATTAtagttatattcaagcataTAATTCTATATCTTAATGCTAgcg, RVS Oligo:
aattcgcTAGCATTAAGATATAGAATTAtatgcttgaatataactaTAATTCTATATCTTAATGCTAactg
Hairpin ID: SH00902.N; FWD Oligo:
ctagcagtTAGAAGATGAATCCTTCTAAAtagttatattcaagcataTTTAGAAGGATTCATCTTCTAgcg, RVS Oligo:
aattcgcTAGAAGATGAATCCTTCTAAAtatgcttgaatataactaTTTAGAAGGATTCATCTTCTAactg
Hairpin ID: SH00903.N; FWD Oligo:
ctagcagtTTCGAGACTTTGTCTACGAAAtagttatattcaagcataTTTCGTAGACAAAGTCTCGAAgcg, RVS
Oligo: aattcgcTTCGAGACTTTGTCTACGAAAtatgcttgaatataactaTTTCGTAGACAAAGTCTCGAAactg
Hairpin ID: TR02502P.1; FWD Oligo: AAGAATTCTTGCCTGAAAACCGAAAATC, RVS Oligo:
AGTCTAGAAATATTTTGCTATCCCCGCC
Hairpin ID: TR01362P.1; FWD Oligo: AGTCTAGAATACCGTAGCAAGGCAATCG, RVS Oligo:
AAGAATTCGATTCGTGATGCACCAAATG
Hairpin ID: TR01361P.1; FWD Oligo: AGTCTAGACCACATGGAAAAGGCTGAAT, RVS Oligo:
AAGAATTCCCTGTTCCTCTGGGAAATCA
Hairpin ID: SH01656.N; FWD Oligo:
ctagcagtCAAGATAATAATGATAACCAAtagttatattcaagcataTTGGTTATCATTATTATCTTGgcg, RVS Oligo:
aattcgcCAAGATAATAATGATAACCAAtatgcttgaatataactaTTGGTTATCATTATTATCTTGactg
Hairpin ID: TR02327P.1; FWD Oligo: CACCGAATTCAGTGTTCGTCGGTGTGTTGA, RVS Oligo:
CCGTTTTTGCAACCAAGTTT
Hairpin ID: TR02404P.1; FWD Oligo: AAGAATTCAGGCGGATGTGGACTTTATG, RVS Oligo:
AGTCTAGACTTGTGGATTCTCCTCTCGC
Hairpin ID: TR02478P.1; FWD Oligo: AAGAATTCGTCGACTGTGGTCGTCCTCT, RVS Oligo:
AGTCTAGACATGGAACGTGTTGAACGTC
Hairpin ID: TR02728P.1; FWD Oligo: AAGAATTCTCACACTGTCGGTCTTCTGC, RVS Oligo:
AGTCTAGAGACCAGCTTTCAAAAGTCGC
Hairpin ID: TR00200A.1; FWD Oligo: GTCTAGATATGGAAAGAGGATGCCCAG, RVS Oligo:
AGAATTCAGTCAGGATGACCACCGTTC
Hairpin ID: SH00105.N; FWD Oligo:
ctagcagtTCCGATGACAATACACTTAAAtagttatattcaagcataTTTAAGTGTATTGTCATCGGAgcg, RVS Oligo:
aattcgcTCCGATGACAATACACTTAAAtatgcttgaatataactaTTTAAGTGTATTGTCATCGGAactg
Hairpin ID: TR00163A.1; FWD Oligo: GTCTAGACTGTCTCATTTGCATCGGAA, RVS Oligo:
AGAATTCCTGACACGTCCACTGCTTGT
Hairpin ID: TR00583A.1; FWD Oligo: GTCTAGAAGCATACCCATGAGTGAGGG, RVS Oligo:
AGAATTCCGTTGCGGTGCTTACAATTA
Hairpin ID: TR02580P.1; FWD Oligo: AAGAATTCCTGATTTTGCAACGAAGACG, RVS Oligo:
AGTCTAGACTATGCCCGAATCCTCAATG
Hairpin ID: SH00850.N; FWD Oligo:
ctagcagtTAGGATAATCAACCACCGAAAtagttatattcaagcataTTTCGGTGGTTGATTATCCTAgcg, RVS
Oligo: aattcgcTAGGATAATCAACCACCGAAAtatgcttgaatataactaTTTCGGTGGTTGATTATCCTAactg
Hairpin ID: TR04555P.1; FWD Oligo: AAGAATTCGACCAAGAACAACTTCCCGA, RVS Oligo:
AGTCTAGACACCTCCTTGAGGTCCATGT
Hairpin ID: TR02501P.1; FWD Oligo: AAGAATTCTTGAGAGTCCAAATCCCACC, RVS Oligo:
AGTCTAGAAGAAACCAACACAACGACCC
Hairpin ID: TR01363P.1; FWD Oligo: AGTCTAGAATTTCCCAACCAATCCCTTC, RVS Oligo:
AAGAATTCCTACGATGCGTGTGCTGATT
Hairpin ID: SH00402.N; FWD Oligo:
ctagcagtAAGACCTACGGTCAGAATCAAtagttatattcaagcataTTGATTCTGACCGTAGGTCTTgcg, RVS
Oligo: aattcgcAAGACCTACGGTCAGAATCAAtatgcttgaatataactaTTGATTCTGACCGTAGGTCTTactg
Hairpin ID: TR01525A.1; FWD Oligo: AGTCTAGACAGTCTCTTCGCCATTCACA, RVS Oligo:
AAGAATTCTGCCATCATTACCACCAATG
Hairpin ID: TR00475A.1; FWD Oligo: GTCTAGACGACCAGTGTGATTGTGACC, RVS Oligo:
AGAATTCGACCAGCTTCCAGTTCTTGC
Hairpin ID: TR00160A.1; FWD Oligo: GTCTAGAAGAAGACCCAAAGATCCGGT, RVS Oligo:
AGAATTCGGACTTGGTATTGGTGGTGC
Hairpin ID: TR00142A.1; FWD Oligo: GTCTAGAGCCTCTGTGATGGTGTACGA, RVS Oligo:
AGAATTCTTGTTCTGACGCAGTATGGC
Hairpin ID: TR01921P.1; FWD Oligo: CACCGAATTCCAGGCGAAGGAGTAAAGGTG, RVS Oligo:
AAGTTCTTTGGACCCAGCCT
Hairpin ID: SH00664.N; FWD Oligo:
ctagcagtATCGAAGATAGTGATCGGTTAtagttatattcaagcataTAACCGATCACTATCTTCGATgcg, RVS
Oligo: aattcgcATCGAAGATAGTGATCGGTTAtatgcttgaatataactaTAACCGATCACTATCTTCGATactg
Hairpin ID: SH00760.N; FWD Oligo:
ctagcagtCTGGATGTCTACCGACTGAAAtagttatattcaagcataTTTCAGTCGGTAGACATCCAGgcg, RVS
Oligo: aattcgcCTGGATGTCTACCGACTGAAAtatgcttgaatataactaTTTCAGTCGGTAGACATCCAGactg
Hairpin ID: SH00431.N; FWD Oligo:
ctagcagtCAGGAGAGTGCTCTACAAGAAtagttatattcaagcataTTCTTGTAGAGCACTCTCCTGgcg, RVS
Oligo: aattcgcCAGGAGAGTGCTCTACAAGAAtatgcttgaatataactaTTCTTGTAGAGCACTCTCCTGactg
Hairpin ID: TR04472P.1; FWD Oligo: AAGAATTCCGAGGCTAACAAGTTGCTCC, RVS Oligo:
AGTCTAGAGCTTTTGATCGATCTCTGCC
Hairpin ID: TR02544P.1; FWD Oligo: AAGAATTCCGATTTACACAACTCGAGCG, RVS Oligo:
AGACTAGTCTCGTTGCACCTCCAGTACA
Hairpin ID: TR02401P.1; FWD Oligo: AAGAATTCAGAATCATGCGGTGATCCTC, RVS Oligo:
AGTCTAGATGCAGTTGCTGCAAAATAGG
Hairpin ID: TR01764P.1; FWD Oligo: CACCGAATTCATGGTTTCGAGGATATTGCG, RVS Oligo:
CGTAGAACACATCCCTCGGT
Hairpin ID: TR00095A.1; FWD Oligo: GTCTAGACTGGCCATCACCAAGGATAC, RVS Oligo:
AGAATTCCCTATTTTGCGTCCGGATTA
Hairpin ID: SH00491.N; FWD Oligo:
ctagcagtAAGGACGAAGACAGCGACAATtagttatattcaagcataATTGTCGCTGTCTTCGTCCTTgcg, RVS
Oligo: aattcgcAAGGACGAAGACAGCGACAATtatgcttgaatataactaATTGTCGCTGTCTTCGTCCTTactg
Hairpin ID: TR02010P.1; FWD Oligo: CACCGAATTCACCATAGAGACGCGTAACCG, RVS Oligo:
CCTGCCTTCACGAAGAACTC
Hairpin ID: SH01772.N; FWD Oligo:
ctagcagtTTGGCTAAAGGTTTAACACAAtagttatattcaagcataTTGTGTTAAACCTTTAGCCAAgcg, RVS Oligo:
aattcgcTTGGCTAAAGGTTTAACACAAtatgcttgaatataactaTTGTGTTAAACCTTTAGCCAAactg
Hairpin ID: TR01884P.1; FWD Oligo: CACCGAATTCCCATTGGGTGGTTAATTTGC, RVS Oligo:
TTTCAATGAGTTCACGACGC
Hairpin ID: TR02011P.1; FWD Oligo: CACCGAATTCGAGGAGAACCTGTCGGAGAA, RVS Oligo:
GAACTCACCGCACAAACTGA
Hairpin ID: TR02581P.1; FWD Oligo: AAGAATTCTGAATTGCATGTCACGGTCT, RVS Oligo:
AGTCTAGACAAACTGATCCCACCGAACT
Hairpin ID: TR02582P.1; FWD Oligo: AAGAATTCCCCACCTTCAAATCCACATC, RVS Oligo:
AGTCTAGAAATTGCTCGGTTTTCACTGG
Hairpin ID: TR01922P.1; FWD Oligo: CACCGAATTCACGTCCAGAGCTTGAGCATT, RVS Oligo:
CGCAGGACTCGAATCTTTTC
Hairpin ID: TR03726P.1; FWD Oligo: AAGAATTCTACGCATTGCCTGTAAGCTG, RVS Oligo:
AGTCTAGACGTGGAGATCTGCTTCATCA
Hairpin ID: TR02733P.1; FWD Oligo: AAGAATTCCTTCGTTGGGTTACTTGGGA, RVS Oligo:
AGTCTAGATCGTAAATCCGCTTGAATCC
Hairpin ID: TR04621P.1; FWD Oligo: AAGAATTCGCGAGTTCACCACACAAAAA, RVS Oligo:
AGTCTAGATGCAACGCAAAATGGTAAAA
Hairpin ID: TR00345P.1; FWD Oligo: GTCTAGACCAGCACCACTCTCTGTCAA, RVS Oligo:
AGAATTCGTCCTGCATGGTCGTAGGAT
Hairpin ID: TR00234A.1; FWD Oligo: GTCTAGAAAGCATCAAGAGGAGCAGGA, RVS Oligo:
AGAATTCGCGATGCTTGCACTTAATGA
Hairpin ID: TR02667P.1; FWD Oligo: AAGAATTCTGTTCAAGCTGCTGGTTGTC, RVS Oligo:
AGTCTAGAATCCTCCGGAGTAGGCGTAT
Hairpin ID: SH00644.N; FWD Oligo:
ctagcagtAAGTTCCAGAATATACGACAAtagttatattcaagcataTTGTCGTATATTCTGGAACTTgcg, RVS Oligo:
aattcgcAAGTTCCAGAATATACGACAAtatgcttgaatataactaTTGTCGTATATTCTGGAACTTactg
Hairpin ID: SH00030.O; FWD Oligo:
ctagcagtTCGGGTACACAATAGCACGTGtagttatattcaagcataCACGTGCTATTGTGTACCCGAgcg, RVS
Oligo: aattcgcTCGGGTACACAATAGCACGTGtatgcttgaatataactaCACGTGCTATTGTGTACCCGAactg
Hairpin ID: SH00029.O; FWD Oligo:
ctagcagtTTAATCTCGACGGAAACGCCTtagttatattcaagcataAGGCGTTTCCGTCGAGATTAAgcg, RVS
Oligo: aattcgcTTAATCTCGACGGAAACGCCTtatgcttgaatataactaAGGCGTTTCCGTCGAGATTAAactg
Hairpin ID: TR00056A.2; FWD Oligo: GTCTAGAGGCCATCTGACCAGGAACTA, RVS Oligo:
AGAATTCGTGAAATATCGCCCCGTCTA
Hairpin ID: SH01657.N; FWD Oligo:
ctagcagtAACGAGTTTCTTCGATCGCTAtagttatattcaagcataTAGCGATCGAAGAAACTCGTTgcg, RVS
Oligo: aattcgcAACGAGTTTCTTCGATCGCTAtatgcttgaatataactaTAGCGATCGAAGAAACTCGTTactg
Hairpin ID: TR04473P.1; FWD Oligo: AAGAATTCTGAAAACGAAGAAACGGGTC, RVS Oligo:
AGTCTAGAATTTTCCTTGGTGGTTTCCC
Hairpin ID: SH00139.N; FWD Oligo:
ctagcagtCTCGACGAAAGTGTCCGATAAtagttatattcaagcataTTATCGGACACTTTCGTCGAGgcg, RVS
Oligo: aattcgcCTCGACGAAAGTGTCCGATAAtatgcttgaatataactaTTATCGGACACTTTCGTCGAGactg
Hairpin ID: TR02519P.1; FWD Oligo: AAGAATTCGGTGGAAGGCCAATTGTAGA, RVS Oligo:
AGTCTAGATGCTGAACGATGATGACCTC
Hairpin ID: TR01697P.1; FWD Oligo: CACCGAATTCTTATGCCAGTGATGCTGCTC, RVS Oligo:
ATGGAGTCGCAAATCCAAAG
Hairpin ID: TR00800A.1; FWD Oligo: GTCTAGAAATGGAGCCACAGGATCAAC, RVS Oligo:
AGAATTCCCGTACAGCCGATACCAGTT
Hairpin ID: SH00192.N; FWD Oligo:
ctagcagtTCGATTCATTCTATATATTAAtagttatattcaagcataTTAATATATAGAATGAATCGAgcg, RVS Oligo:
aattcgcTCGATTCATTCTATATATTAAtatgcttgaatataactaTTAATATATAGAATGAATCGAactg
Hairpin ID: TR02961P.1; FWD Oligo: AAGAATTCTTTAGCCACCAGAGAAGCGT, RVS Oligo:
AGTCTAGAGTGCCGTTCTTGGTGTAGGT
Hairpin ID: TR01429P.1; FWD Oligo: AGTCTAGACAATGGCAATGAATCCGAC, RVS Oligo:
AAGAATTCTGTGGTGATATGGCAGGAAG
Hairpin ID: TR01279P.1; FWD Oligo: AGTCTAGACTGCAGGAACCCTTCTACGA, RVS Oligo:
AAGAATTCATTTCTATGCCCTTCCCTCG
Hairpin ID: TR01698P.1; FWD Oligo: CACCGAATTCAAACATATTCGCCAAGCCAG, RVS Oligo:
TTCAGAGTGTCAAAAGGGGG
Hairpin ID: TR02583P.1; FWD Oligo: AAGAATTCCCCACACTTGTAGCCCACTT, RVS Oligo:
AGTCTAGATCTGGCGAATGTGGTACTTG
Hairpin ID: TR04576P.1; FWD Oligo: AACAATTGTGACCAGTTCCAGTTCCTCC, RVS Oligo:
AGTCTAGAAGAGTAACAAATGCGGCAGG
Hairpin ID: TR02584P.1; FWD Oligo: AACAATTGTGAAGCACTACGATGCGAAC, RVS Oligo:
AGTCTAGAGTAGTTGACTTTCGGCTGGG
Hairpin ID: TR01866P.1; FWD Oligo: CACCGAATTCAATTGTGATGATCCCCCAAA, RVS Oligo:
AAATCCTCTGGCAATGTTGG
Hairpin ID: TR01765P.1; FWD Oligo: CACCGAATTCCGCAGCTTTAAAGGATTTGC, RVS Oligo:
GCGAAGGGCATTGTCTATGT
Hairpin ID: TR02012P.1; FWD Oligo: CACCGAATTCGCTTTCGCGAACTATCCAAG, RVS Oligo:
TGTTCTCAAGCGGTAGACCC
Hairpin ID: TR00780P.1; FWD Oligo: AAGAATTCACACTAGCTGTCGAGCGGAT, RVS Oligo:
AGTCTAGAACATCTGGCACTGGACACAA
Hairpin ID: SH00067.N; FWD Oligo:
ctagcagtTCCGGTCATGGTACCTGCGAAtagttatattcaagcataTTCGCAGGTACCATGACCGGAgcg, RVS
Oligo: aattcgcTCCGGTCATGGTACCTGCGAAtatgcttgaatataactaTTCGCAGGTACCATGACCGGAactg
Hairpin ID: TR01559A.1; FWD Oligo: AGTCTAGACTGCATCCGGTGGTTCTAGT, RVS Oligo:
AAGAATTCCTGTTGTTCAACGAGCCAGA
Hairpin ID: TR01523A.1; FWD Oligo: AGTCTAGACCAAGGTGTTCCTGTTCGAT, RVS Oligo:
AAGAATTCGGACATGGTTGTTGCATTGA
Hairpin ID: TR02645P.1; FWD Oligo: AAGAATTCTGGATTTCTGACTGTGCAGC, RVS Oligo:
AGTCTAGAAGGCTAGAGTCGTCACCGAA
Hairpin ID: TR01766P.1; FWD Oligo: CACCGAATTCGCTGCCTTCTTGACCGTATC, RVS Oligo:
CACCTGCAAATCACAGTTGG
Hairpin ID: SH01658.N; FWD Oligo:
ctagcagtATGGAACAGAGCTATGCACAAtagttatattcaagcataTTGTGCATAGCTCTGTTCCATgcg, RVS
Oligo: aattcgcATGGAACAGAGCTATGCACAAtatgcttgaatataactaTTGTGCATAGCTCTGTTCCATactg
Hairpin ID: TR02585P.1; FWD Oligo: AAGAATTCCGGGGTAGGAAATCGGTATT, RVS Oligo:
AGTCTAGAGATGCCTTCAGATCCTGCTC
Hairpin ID: TR04556P.1; FWD Oligo: AAGAATTCGTTTCAGCGATACACGGACA, RVS Oligo:
AGTCTAGACAGGCTGTCGATCCTGAAGT
Hairpin ID: TR02657P.1; FWD Oligo: AAGAATTCAAAGTCGGTGATTGGTTTCG, RVS Oligo:
AGACTAGTGGATCTAGACGGCCATTGAA
Hairpin ID: SH00537.N; FWD Oligo:
ctagcagtCAGATTGATATGATTGTTCATtagttatattcaagcataATGAACAATCATATCAATCTGgcg, RVS Oligo:
aattcgcCAGATTGATATGATTGTTCATtatgcttgaatataactaATGAACAATCATATCAATCTGactg
Hairpin ID: SH01264.N2; FWD Oligo:
ctagcagtCTGGACGATTGGAAATATATAtagttatattcaagcataTATATATTTCCAATCGTCCAGgcg, RVS Oligo:
aattcgcCTGGACGATTGGAAATATATAtatgcttgaatataactaTATATATTTCCAATCGTCCAGactg
Hairpin ID: SH01265.N2; FWD Oligo:
ctagcagtCAGGTTTACAAGCGATCGAAAtagttatattcaagcataTTTCGATCGCTTGTAAACCTGgcg, RVS
Oligo: aattcgcCAGGTTTACAAGCGATCGAAAtatgcttgaatataactaTTTCGATCGCTTGTAAACCTGactg
Hairpin ID: TR01365P.1; FWD Oligo: AGTCTAGAAAGTGCTGGCAACTGGATTT, RVS Oligo:
AAGAATTCCTCCAAATGGGTGCGATACT
Hairpin ID: TR04557P.1; FWD Oligo: AAGAATTCGAGCAGTACAGCACGCTGAG, RVS Oligo:
AGTCTAGAATGCTTCTCGAACACTGGCT
Hairpin ID: TR02586P.1; FWD Oligo: AAGAATTCCCTTGGTGGCAGATACTGGT, RVS Oligo:
AGTCTAGAGCAGCAGATCGATGTCGTTA
Hairpin ID: TR00620A.1; FWD Oligo: GTCTAGAGTTCAGGGCAAGATGTGGTT, RVS Oligo:
AGAATTCAACTACCAGCAGCACGAAGG
Hairpin ID: TR00621A.1; FWD Oligo: GTCTAGATGGAATCCTATTTGCTTGGC, RVS Oligo:
AGAATTCTGATATCCTTTGAGCGGGAC
Hairpin ID: SH01752.N; FWD Oligo:
ctagcagtCACCCAGAAGCTTCTATTCTAtagttatattcaagcataTAGAATAGAAGCTTCTGGGTGgcg, RVS
Oligo: aattcgcCACCCAGAAGCTTCTATTCTAtatgcttgaatataactaTAGAATAGAAGCTTCTGGGTGactg
Hairpin ID: TR04622P.1; FWD Oligo: AAGAATTCGACAGTTTCCGCACAGACAA, RVS Oligo:
AGTCTAGAGTACTCCAACGCACAGGGAT
Hairpin ID: TR02013P.1; FWD Oligo: CACCGAATTCAGGGCGAAAAGATCAAGGAT, RVS Oligo:
ATCTCGGACATACTCACGCC
Hairpin ID: TR00488A.1; FWD Oligo: GTCTAGAATTCCAGTCGGTCATTGGAG, RVS Oligo:
AGAATTCTGACAGCCTTCGCACTTATG
Hairpin ID: TR01133P.1; FWD Oligo: AGTCTAGACGGTTATCATCGAGGGCTTA, RVS Oligo:
AAGAATTCGTCTCCGTAATTGGCCTTCA
Hairpin ID: TR02014P.1; FWD Oligo: CACCGAATTCCGCACTTTTTGCACAACCTA, RVS Oligo:
TGCAATTAAGCACGCACATT
Hairpin ID: TR01487A.1; FWD Oligo: AGTCTAGATGTGAACACGCTCGTTTTGT, RVS Oligo:
AAGAATTCATGCCATCGATCCACATTTT
Hairpin ID: TR00199A.1; FWD Oligo: GTCTAGACATGGTAGTCACGGACATGC, RVS Oligo:
AGAATTCTAAATCACCGATCATGGGGT
Hairpin ID: TR00199P.1; FWD Oligo: AAGAATTCCATGGTAGTCACGGACATGC, RVS Oligo:
AGTCTAGATAAATCACCGATCATGGGGT
Hairpin ID: TR01885P.1; FWD Oligo: CACCGAATTCCTGGGATAACCGTGTCGATT, RVS Oligo:
GCTGGATGATTATCGGCTGT
Hairpin ID: TR00015A.1; FWD Oligo: GTCTAGAATCCAGCTTCGACAAGGAGA, RVS Oligo:
AGAATTCCTCACTGCAAGACCGTTCAA
Hairpin ID: TR00016A.1; FWD Oligo: GTCTAGAGCACCATGTGCTGAGAAAGA, RVS Oligo:
AGAATTCCCTTAAGCAGTCGCTCCAAC
Hairpin ID: TR00761A.1; FWD Oligo: GTCTAGATGCTGAAATATCCTCGACCC, RVS Oligo:
AGAATTCGTGAGTCGGTCTCCGAAGTG
Hairpin ID: TR02587P.1; FWD Oligo: AAGAATTCCGACTTTTTCGACAAGGAGC, RVS Oligo:
AGTCTAGAAACTTGGTGGCTATCGAACG
Hairpin ID: TR01767P.1; FWD Oligo: CACCGAATTCAATGCATTCCAACGAAGAGC, RVS Oligo:
AACTGGACGAGCTGGATGAC
Hairpin ID: TR01156P.1; FWD Oligo: AGTCTAGAATATCGGCAAGACCCACAAG, RVS Oligo:
AAGAATTCTTCTCTGCATCCACAGCATC
Hairpin ID: TR01158P.1; FWD Oligo: AGTCTAGAGTACCTCTGCTCGTTCTGCC, RVS Oligo:
AAGAATTCTAAAAATGTCCCTCAAGGCG
Hairpin ID: TR01143P.1; FWD Oligo: AGTCTAGACGTACGAAAGTCATCGCTCA, RVS Oligo:
AAGAATTCAAAACACTTGCCGCAGAACT
Hairpin ID: TR01768P.1; FWD Oligo: CACCGAATTCGGAAGATGCGGCTCTCTATG, RVS Oligo:
TGCGCAAATAGGATTGACTG
Hairpin ID: TR00638A.1; FWD Oligo: GTCTAGATAAGGACGGGCGATGAATAG, RVS Oligo:
AGAATTCCAATGCCCAAAGGCAAATAC
Hairpin ID: TR00639A.1; FWD Oligo: GTCTAGAAACGACGATGTGGACAACAA, RVS Oligo:
AGAATTCCACGAACGGAAAGTCTGACA
Hairpin ID: TR01160P.1; FWD Oligo: AGTCTAGAGACCAAGACCAAGGCGAATA, RVS Oligo:
AAGAATTCGCAGGCCGGAATACTGATTA
Hairpin ID: SH00941.N; FWD Oligo:
ctagcagtACCAATACATATACTACATTAtagttatattcaagcataTAATGTAGTATATGTATTGGTgcg, RVS Oligo:
aattcgcACCAATACATATACTACATTAtatgcttgaatataactaTAATGTAGTATATGTATTGGTactg
Hairpin ID: SH00942.N; FWD Oligo:
ctagcagtCTGGATCAACACGCCAAGGAAtagttatattcaagcataTTCCTTGGCGTGTTGATCCAGgcg, RVS
Oligo: aattcgcCTGGATCAACACGCCAAGGAAtatgcttgaatataactaTTCCTTGGCGTGTTGATCCAGactg
Hairpin ID: TR02388P.1; FWD Oligo: AAGAATTCACAATGGTAAGCCCATCGAG, RVS Oligo:
AGTCTAGATCCTTCCACCAATCGATCTC
Hairpin ID: SH00193.N; FWD Oligo:
ctagcagtCTGCCTGTTCCTGCACTTCTAtagttatattcaagcataTAGAAGTGCAGGAACAGGCAGgcg, RVS
Oligo: aattcgcCTGCCTGTTCCTGCACTTCTAtatgcttgaatataactaTAGAAGTGCAGGAACAGGCAGactg
Hairpin ID: SH00194.N; FWD Oligo:
ctagcagtCTGCGTTACTGTGCAACAACAtagttatattcaagcataTGTTGTTGCACAGTAACGCAGgcg, RVS
Oligo: aattcgcCTGCGTTACTGTGCAACAACAtatgcttgaatataactaTGTTGTTGCACAGTAACGCAGactg
Hairpin ID: SH00399.N; FWD Oligo:
ctagcagtAACCGATTATGTAAACGACAAtagttatattcaagcataTTGTCGTTTACATAATCGGTTgcg, RVS Oligo:
aattcgcAACCGATTATGTAAACGACAAtatgcttgaatataactaTTGTCGTTTACATAATCGGTTactg
Hairpin ID: TR00948P.1; FWD Oligo: AGTCTAGACCATGGAACGGAGTCATCTT, RVS Oligo:
AAGAATTCGCTTGGCCTTCTTGATCTTG
Hairpin ID: TR02341P.1; FWD Oligo: AAGAATTCACGAGATCGTGGGCATTAAG, RVS Oligo:
AGTCTAGAGGAGAAGTGAATGGTGAGGC
Hairpin ID: TR02729P.1; FWD Oligo: AAGAATTCACATGCCTTGGAGAAACAGC, RVS Oligo:
AGTCTAGAGTCCATCTCGCCGTTGTAGT
Hairpin ID: TR01478A.1; FWD Oligo: AGTCTAGATTCGCCTACCAGCTCTTCAT, RVS Oligo:
AAGAATTCAGCGCAGACAGACCATTCTT
Hairpin ID: TR01366P.1; FWD Oligo: AGTCTAGACAAGTCTGGTTTGAGCGACA, RVS Oligo:
AAGAATTCGCGGACAACATAGTTTCGGT
Hairpin ID: TR04474P.1; FWD Oligo: AAGAATTCAACATCCGTCCAGTTTCTGC, RVS Oligo:
AGTCTAGACAACGTTGTTGTTGTACCGC
Hairpin ID: SH00550.N; FWD Oligo:
ctagcagtTAGGTTCAGGAAGTCGAGAAAtagttatattcaagcataTTTCTCGACTTCCTGAACCTAgcg, RVS
Oligo: aattcgcTAGGTTCAGGAAGTCGAGAAAtatgcttgaatataactaTTTCTCGACTTCCTGAACCTAactg
Hairpin ID: TR02412P.1; FWD Oligo: AAGAATTCATGCCCGAGTACATAGTGCC, RVS Oligo:
AGTCTAGAACCTGGGTTTGTCAATCTGC
Hairpin ID: TR00107A.1; FWD Oligo: GTCTAGATCTTGGCTGATCTGCTCCTT, RVS Oligo:
AGAATTCAATCGATGTTTGAGCCCATC
Hairpin ID: TR02671P.1; FWD Oligo: AAGAATTCCATCCAAGTCAGAGTTCGCA, RVS Oligo:
AGTCTAGAGTTCTCAGTGCTCCTCCAGC
Hairpin ID: SH00690.N; FWD Oligo:
ctagcagtCAAGCTGAAGATCACCGTCAAtagttatattcaagcataTTGACGGTGATCTTCAGCTTGgcg, RVS
Oligo: aattcgcCAAGCTGAAGATCACCGTCAAtatgcttgaatataactaTTGACGGTGATCTTCAGCTTGactg
Hairpin ID: TR01923P.1; FWD Oligo: CACCGAATTCGCTTCTGCTAAACCGACCAG, RVS Oligo:
GAGTCTAGCGCCTAACACGG
Hairpin ID: SH00663.N; FWD Oligo:
ctagcagtCAGCTCGAATGTGGACAGCAAtagttatattcaagcataTTGCTGTCCACATTCGAGCTGgcg, RVS
Oligo: aattcgcCAGCTCGAATGTGGACAGCAAtatgcttgaatataactaTTGCTGTCCACATTCGAGCTGactg
Hairpin ID: TR02016P.1; FWD Oligo: CACCGAATTCGAGAAGATTGCGCCAAAGAG, RVS Oligo:
CGTTTCTGTAGCCAAATCGC
Hairpin ID: TR02017P.1; FWD Oligo: CACCGAATTCCCGGAACCAGTATCCTTCAA, RVS Oligo:
TGGTGCTGGCTTCTTTCTTT
Hairpin ID: TR02017P.1hm; FWD Oligo: CACCGAATTCCCGGAACCAGTATCCTTCAA, RVS Oligo:
TGGTGCTGGCTTCTTTCTTT
Hairpin ID: TR00145A.1; FWD Oligo: GTCTAGAAGCGTCTTGGAATGCTGAAT, RVS Oligo:
AGAATTCACTGGGTTTTAGCACGAACG
Hairpin ID: TR01260P.1; FWD Oligo: AGTCTAGACATCAACACCGCAACTCAAC, RVS Oligo:
AAGAATTCGGCCTTGAAGTAGGGGAATC
Hairpin ID: SH01862.N; FWD Oligo:
ctagcagtCCGAGAGTCTATCGTCGCAAAtagttatattcaagcataTTTGCGACGATAGACTCTCGGgcg, RVS
Oligo: aattcgcCCGAGAGTCTATCGTCGCAAAtatgcttgaatataactaTTTGCGACGATAGACTCTCGGactg
Hairpin ID: TR04634P.1; FWD Oligo: AAGAATTCCAACAAACTGACCACCATGC, RVS Oligo:
AGTCTAGATGGTTTAAACGGAAATTCGC
Hairpin ID: TR02254P.1; FWD Oligo: CACCGAATTCCTGGCTATTCGGAGACCGTA, RVS Oligo:
TCGACGTTTTTCGAGTCCTT
Hairpin ID: TR01924P.1; FWD Oligo: CACCGAATTCGTCGTGTGGATAACTGCCCT, RVS Oligo:
ACTTGGAGCACTTGACGGAC
Hairpin ID: TR01135P.1; FWD Oligo: AGTCTAGAGATGCACTGCTGAAGACCAA, RVS Oligo:
AAGAATTCCCCAGCTCCTGATCACTCTC
Hairpin ID: SH01992.N; FWD Oligo:
ctagcagtCAGGAAGAGGCTCCTGATCAAtagttatattcaagcataTTGATCAGGAGCCTCTTCCTGgcg, RVS
Oligo: aattcgcCAGGAAGAGGCTCCTGATCAAtatgcttgaatataactaTTGATCAGGAGCCTCTTCCTGactg
Hairpin ID: TR02018P.1; FWD Oligo: CACCGAATTCTCGGCACGCTTGTTGTAATA, RVS Oligo:
TGAATCCATTGGCTAGTCGC
Hairpin ID: TR00646A.1; FWD Oligo: GTCTAGACATTCATCCTGCGGATTTCT, RVS Oligo:
AGAATTCCTTTGTCGCCCAATACCATT
Hairpin ID: TR00647A.1; FWD Oligo: GTCTAGACTTGACGTGTTTCGGAGTGA, RVS Oligo:
AGAATTCGACCGAGGTATTGTCCCAGA
Hairpin ID: TR02821P.1; FWD Oligo: AAGAATTCAGTTTGGAAGCTCAGCGAAA, RVS Oligo:
AGTCTAGACTCAGTCCCAGTTCACCCAT
Hairpin ID: TR02588P.1; FWD Oligo: AAGAATTCCTCACTGCCATTAGCAACCA, RVS Oligo:
AGTCTAGAGTGAACAACCCACCCATTTC
Hairpin ID: TR02589P.1; FWD Oligo: AAGAATTCGGGCTTAGGGTATGCCTTTC, RVS Oligo:
AGTCTAGACTTGGTTTAAATCCAGGCGA
Hairpin ID: TR01769P.1; FWD Oligo: CACCGAATTCCAGCAAAAACGAGTCAACGA, RVS Oligo:
TCTCATCGTCAATGGAGCAG
Hairpin ID: TR01218P.1; FWD Oligo: AGTCTAGATAGGCGCCCTAACTTCAAGA, RVS Oligo:
AAGAATTCTTGGCAGATTCCCACACATA
Hairpin ID: TR01368P.1; FWD Oligo: AGTCTAGACATCGGATACATGACGACGA, RVS Oligo:
AAGAATTCACCTCATTATCCTTCGACCG
Hairpin ID: TR00675A.1; FWD Oligo: GTCTAGAGCCATACTGCAAGCAGACAA, RVS Oligo:
AGAATTCCACGTCCTTGGTGAAATCCT
Hairpin ID: TR00676A.1; FWD Oligo: GTCTAGACTGTTTGTCGGTGGTCTGAG, RVS Oligo:
AGAATTCTTAACATCGACCTCCTTGCC
Hairpin ID: TR04623P.1; FWD Oligo: AAGAATTCCTACTGACGGACAAGTGGCA, RVS Oligo:
AGTCTAGAGCGAGGAGTTTTGCAGGTAG
Hairpin ID: TR02019P.1; FWD Oligo: CACCGAATTCAACTACCAAAAACGATGCCG, RVS Oligo:
GGGGCTATATCCTTGGGAAA
Hairpin ID: SH00998.N; FWD Oligo:
ctagcagtCAGAAGCTCAAGGACGAAGAAtagttatattcaagcataTTCTTCGTCCTTGAGCTTCTGgcg, RVS
Oligo: aattcgcCAGAAGCTCAAGGACGAAGAAtatgcttgaatataactaTTCTTCGTCCTTGAGCTTCTGactg
Hairpin ID: SH00999.N; FWD Oligo:
ctagcagtTCGAGGACCAATTCAAGACAAtagttatattcaagcataTTGTCTTGAATTGGTCCTCGAgcg, RVS
Oligo: aattcgcTCGAGGACCAATTCAAGACAAtatgcttgaatataactaTTGTCTTGAATTGGTCCTCGAactg
Hairpin ID: SH00195.N; FWD Oligo:
ctagcagtCAGCAAGAGCTTCTCAAGCAAtagttatattcaagcataTTGCTTGAGAAGCTCTTGCTGgcg, RVS
Oligo: aattcgcCAGCAAGAGCTTCTCAAGCAAtatgcttgaatataactaTTGCTTGAGAAGCTCTTGCTGactg
Hairpin ID: TR01637A.1; FWD Oligo: AGTCTAGACTGATACTGGCAAGGGTGGT, RVS Oligo:
AACAATTGTCGTACAACACAAGCACGAA
Hairpin ID: TR01636A.1; FWD Oligo: AGTCTAGATGATCTGCAACCAACACCTC, RVS Oligo:
AAGAATTCTTCGGAGGCGAAAGAATCTA
Hairpin ID: TR00236A.1; FWD Oligo: GTCTAGATTTCCGCCCTTGAATTACAC, RVS Oligo:
AGAATTCTCCACCTCCTTATGTGCCTT
Hairpin ID: TR02704P.1; FWD Oligo: AAGAATTCTCGCATTACGGATCAATCAA, RVS Oligo:
AGTCTAGAAGGAAAACAAGTGACGGGTG
Hairpin ID: SH00675.N; FWD Oligo:
ctagcagtACGATTGAAGATCCAATAATAtagttatattcaagcataTATTATTGGATCTTCAATCGTgcg, RVS Oligo:
aattcgcACGATTGAAGATCCAATAATAtatgcttgaatataactaTATTATTGGATCTTCAATCGTactg
Hairpin ID: SH00524.N; FWD Oligo:
ctagcagtCAGGTTGTTCAGATATATGAAtagttatattcaagcataTTCATATATCTGAACAACCTGgcg, RVS Oligo:
aattcgcCAGGTTGTTCAGATATATGAAtatgcttgaatataactaTTCATATATCTGAACAACCTGactg
Hairpin ID: TR04475P.1; FWD Oligo: AACAATTGAAAATGCCCAGCATCAAGTT, RVS Oligo:
AGTCTAGAATTTCCTCGGGAGTCTTTCC
Hairpin ID: SH00739.N; FWD Oligo:
ctagcagtCTCGATTTAAATTGTGTATAAtagttatattcaagcataTTATACACAATTTAAATCGAGgcg, RVS Oligo:
aattcgcCTCGATTTAAATTGTGTATAAtatgcttgaatataactaTTATACACAATTTAAATCGAGactg
Hairpin ID: SH00974.N; FWD Oligo:
ctagcagtACGCAAGACCTTCAACATTAAtagttatattcaagcataTTAATGTTGAAGGTCTTGCGTgcg, RVS
Oligo: aattcgcACGCAAGACCTTCAACATTAAtatgcttgaatataactaTTAATGTTGAAGGTCTTGCGTactg
Hairpin ID: SH01873.N; FWD Oligo:
ctagcagtCAAGAAGTTCATACTGCTCAAtagttatattcaagcataTTGAGCAGTATGAACTTCTTGgcg, RVS
Oligo: aattcgcCAAGAAGTTCATACTGCTCAAtatgcttgaatataactaTTGAGCAGTATGAACTTCTTGactg
Hairpin ID: TR00835A.1; FWD Oligo: GTCTAGAAGGTTGAGGAGACGGAGGAC, RVS Oligo:
AGAATTCTGCCAGCAAACAGCTATCAC
Hairpin ID: SH00804.N; FWD Oligo:
ctagcagtTAGACATTTCTAGAATGTCTAtagttatattcaagcataTAGACATTCTAGAAATGTCTAgcg, RVS Oligo:
aattcgcTAGACATTTCTAGAATGTCTAtatgcttgaatataactaTAGACATTCTAGAAATGTCTAactg
Hairpin ID: SH00370.N; FWD Oligo:
ctagcagtCAAGAGGTGCTTGTACAAGTAtagttatattcaagcataTACTTGTACAAGCACCTCTTGgcg, RVS
Oligo: aattcgcCAAGAGGTGCTTGTACAAGTAtatgcttgaatataactaTACTTGTACAAGCACCTCTTGactg
Hairpin ID: TR02510P.1; FWD Oligo: AAGAATTCAGCAACCAGAGCCTGAATGT, RVS Oligo:
AGTCTAGACAGAAGGGCATTGGTGAACT
Hairpin ID: TR00937P.1; FWD Oligo: AGTCTAGACAACAGTGACTACGGCGAGA, RVS Oligo:
AAGAATTCCATTGACCACACTCACCGAC
Hairpin ID: TR02020P.1; FWD Oligo: CACCGAATTCTGAACATGGCATTCGGTTTA, RVS Oligo:
ATCCATCGTTCGGAGTTTTG
Hairpin ID: TR02021P.1; FWD Oligo: CACCGAATTCGAAACAGTACTTCGGCGAGC, RVS Oligo:
CGGAAATACCTGGTGAGCAT
Hairpin ID: SH00418.N; FWD Oligo:
ctagcagtAGCGACAGTCACGAAAGCGAAtagttatattcaagcataTTCGCTTTCGTGACTGTCGCTgcg, RVS
Oligo: aattcgcAGCGACAGTCACGAAAGCGAAtatgcttgaatataactaTTCGCTTTCGTGACTGTCGCTactg
Hairpin ID: TR01243P.1; FWD Oligo: AGTCTAGACAGGATCACCAGAGTCAGCA, RVS Oligo:
AAGAATTCTAGCTTGAACTCCCAGCCAT
Hairpin ID: TR02022P.1; FWD Oligo: CACCGAATTCGTCAAGAAGATCTGCGAGGG, RVS Oligo:
ATCGATCAATGCCTGAAAGG
Hairpin ID: SH00371.N; FWD Oligo:
ctagcagtAAGCTCGAAACTGTTAAGCAAtagttatattcaagcataTTGCTTAACAGTTTCGAGCTTgcg, RVS
Oligo: aattcgcAAGCTCGAAACTGTTAAGCAAtatgcttgaatataactaTTGCTTAACAGTTTCGAGCTTactg
Hairpin ID: TR00885P.1; FWD Oligo: AGTCTAGAACATCAAGGAGCGGTTTGTC, RVS Oligo:
AAGAATTCGAAGGGCACCAGTGCATTAT
Hairpin ID: TR00886P.1; FWD Oligo: AAGAATTCCGAACAGACGTTTGGGAAAT, RVS Oligo:
AGTCTAGAGAACAATTCCTCCTCGTTCG
Hairpin ID: SH00196.N; FWD Oligo:
ctagcagtTCCGCTGACAGACCTACTAAAtagttatattcaagcataTTTAGTAGGTCTGTCAGCGGAgcg, RVS
Oligo: aattcgcTCCGCTGACAGACCTACTAAAtatgcttgaatataactaTTTAGTAGGTCTGTCAGCGGAactg
Hairpin ID: TR01084P.1; FWD Oligo: AGTCTAGATTATACCGCAGATCCCGAAG, RVS Oligo:
AAGAATTCGTTATTCGCTCGATTGGCAT
Hairpin ID: SH02001.N; FWD Oligo:
ctagcagtATCGGTATATATCGTGTTTAAtagttatattcaagcataTTAAACACGATATATACCGATgcg, RVS Oligo:
aattcgcATCGGTATATATCGTGTTTAAtatgcttgaatataactaTTAAACACGATATATACCGATactg
Hairpin ID: SH00335.N; FWD Oligo:
ctagcagtCAGCTTGTGGTTCAACAACAAtagttatattcaagcataTTGTTGTTGAACCACAAGCTGgcg, RVS
Oligo: aattcgcCAGCTTGTGGTTCAACAACAAtatgcttgaatataactaTTGTTGTTGAACCACAAGCTGactg
Hairpin ID: TR01770P.1; FWD Oligo: CACCGAATTCATTTTCGGCTAATCGAGGCT, RVS Oligo:
TTTGATCCCGGCTGAAACT
Hairpin ID: TR01771P.1; FWD Oligo: CACCGAATTCTTTATATGGCACAATGCCCA, RVS Oligo:
AGTCTCCATCCGACAACCAG
Hairpin ID: TR00659A.1; FWD Oligo: GTCTAGATCACGCTTGGAAAGCCTATT, RVS Oligo:
AGAATTCGCGCTTAGGACATTAGCCTG
Hairpin ID: SH00584.N; FWD Oligo:
ctagcagtTCCAATGACGATCCTCAGCAAtagttatattcaagcataTTGCTGAGGATCGTCATTGGAgcg, RVS
Oligo: aattcgcTCCAATGACGATCCTCAGCAAtatgcttgaatataactaTTGCTGAGGATCGTCATTGGAactg
Hairpin ID: SH00957.N; FWD Oligo:
ctagcagtCCAGCGATGAGCGACGCACAAtagttatattcaagcataTTGTGCGTCGCTCATCGCTGGgcg, RVS
Oligo: aattcgcCCAGCGATGAGCGACGCACAAtatgcttgaatataactaTTGTGCGTCGCTCATCGCTGGactg
Hairpin ID: TR01282P.1; FWD Oligo: AGTCTAGAAGTACCGGCTACTACGACGC, RVS Oligo:
AAGAATTCATCTCCGTGAACGTGAAACC
Hairpin ID: TR02306P.1; FWD Oligo: CACCGAATTCCCAGCAGATCGAGAAGAACC, RVS Oligo:
CGAACCCTGTTTGTTGGTCT
Hairpin ID: TR00775A.1; FWD Oligo: GTCTAGAAGTGCAACAATCAAAAGGGG, RVS Oligo:
AGAATTCGAGATCACTGACGGTGCAGA
Hairpin ID: SH00829.N; FWD Oligo:
ctagcagtAAGCAAGAATTTGTCATTAAAtagttatattcaagcataTTTAATGACAAATTCTTGCTTgcg, RVS Oligo:
aattcgcAAGCAAGAATTTGTCATTAAAtatgcttgaatataactaTTTAATGACAAATTCTTGCTTactg
Hairpin ID: TR01772P.1; FWD Oligo: CACCGAATTCGATGGTCAAAACTGCCACCT, RVS Oligo:
TAAAGAATTCGGGCATGGAG
Hairpin ID: TR01291P.1; FWD Oligo: AAGAATTCACAGCTGCCCAAGGACTCTA, RVS Oligo:
AGTCTAGATTCTGTGGCTCCTAGCACAA
Hairpin ID: TR01371P.1; FWD Oligo: AGTCTAGAAAGGTGTACGTTTCGATGCC, RVS Oligo:
AAGAATTCGAGATGGTGCCGCTTGTTAC
Hairpin ID: TR01372P.1; FWD Oligo: AGTCTAGAACGGAAGACATCCTGACCAC, RVS Oligo:
AAGAATTCCTATCATTTCAAAGCCGGGA
Hairpin ID: TR02316P.1; FWD Oligo: CACCGAATTCGCCACTACGGTGGACTCACT, RVS Oligo:
GGCTTGAAGTTCTCGTCCAG
Hairpin ID: TR02590P.1; FWD Oligo: AAGAATTCCCAGAGGCCGTTAAAAATGA, RVS Oligo:
AGTCTAGAATATACCCAGCAATCCGCAG
Hairpin ID: TR01036P.1; FWD Oligo: AGTCTAGAGAGAACATCGTGTCGGGAAT, RVS Oligo:
AAGAATTCCTAACGTCACCATCTCCGGT
Hairpin ID: SH00410.N; FWD Oligo:
ctagcagtTAGACGAGCTGCTGAAGACAAtagttatattcaagcataTTGTCTTCAGCAGCTCGTCTAgcg, RVS
Oligo: aattcgcTAGACGAGCTGCTGAAGACAAtatgcttgaatataactaTTGTCTTCAGCAGCTCGTCTAactg
Hairpin ID: TR04517P.1; FWD Oligo: AAGAATTCGCCGGTTATGTAACACGCTT, RVS Oligo:
AGTCTAGAATGTTACCGAGCGAACCAAC
Hairpin ID: TR01773P.1; FWD Oligo: AACAATTGACTGAGAGCGCAACCCTCTA, RVS Oligo:
AGACTAGTTGTGTGGTTGCTTCTGTGGT
Hairpin ID: SH00014.D; FWD Oligo:
ctagcagtCTGGTTATACCAGGACATTGAtagttatattcaagcataTGAATGTCCTCGTATAACCAGgcg, RVS
Oligo: aattcgcCTGGTTATACGAGGACATTCAtatgcttgaatataactaTCAATGTCCTGGTATAACCAGactg
Hairpin ID: SH00014.N; FWD Oligo:
ctagcagtCTGGTTATACGAGGACATTCAtagttatattcaagcataTGAATGTCCTCGTATAACCAGgcg, RVS
Oligo: aattcgcCTGGTTATACGAGGACATTCAtatgcttgaatataactaTGAATGTCCTCGTATAACCAGactg
Hairpin ID: SH00637.N; FWD Oligo:
ctagcagtTAAGCTGCATGTGAAGCGAAAtagttatattcaagcataTTTCGCTTCACATGCAGCTTAgcg, RVS
Oligo: aattcgcTAAGCTGCATGTGAAGCGAAAtatgcttgaatataactaTTTCGCTTCACATGCAGCTTAactg
Hairpin ID: TR04481P.1; FWD Oligo: AAGAATTCGCCTCTGCTTCTTGTTACCG, RVS Oligo:
AGTCTAGAGGAACTACGACCGATGAGGA
Hairpin ID: TR01426P.1; FWD Oligo: AGTCTAGACTCTGAACTCAAAGACCGCC, RVS Oligo:
AAGAATTCATCTCGCAGATATTGGGCTG
Hairpin ID: SH00572.N; FWD Oligo:
ctagcagtACGAGTTTGCAAGTTATTATAtagttatattcaagcataTATAATAACTTGCAAACTCGTgcg, RVS Oligo:
aattcgcACGAGTTTGCAAGTTATTATAtatgcttgaatataactaTATAATAACTTGCAAACTCGTactg
Hairpin ID: SH01659.N; FWD Oligo:
ctagcagtCACCAAGATGTACAAGTCAAAtagttatattcaagcataTTTGACTTGTACATCTTGGTGgcg, RVS
Oligo: aattcgcCACCAAGATGTACAAGTCAAAtatgcttgaatataactaTTTGACTTGTACATCTTGGTGactg
Hairpin ID: TR01646A.1; FWD Oligo: AGTCTAGAAACGAGATCTGCTGGGAGAA, RVS Oligo:
AAGAATTCTGAGTTGCGCTACCGAATTA
Hairpin ID: TR02674P.1; FWD Oligo: AAGAATTCTTGATCTGCAAAAGGCTGTG, RVS Oligo:
AGTCTAGATGACAGTTGCTGGATACCGA
Hairpin ID: SH00198.N; FWD Oligo:
ctagcagtCACGGTGAACTCGAAGAAGTAtagttatattcaagcataTACTTCTTCGAGTTCACCGTGgcg, RVS
Oligo: aattcgcCACGGTGAACTCGAAGAAGTAtatgcttgaatataactaTACTTCTTCGAGTTCACCGTGactg
Hairpin ID: TR04558P.1; FWD Oligo: AAGAATTCAATCTGACAAAATGCCAGCC, RVS Oligo:
AGTCTAGAGCAAAGGTGCTCAACTCCTC
Hairpin ID: TR02591P.1; FWD Oligo: AAGAATTCAGGAATTGGGTATGCTGCTG, RVS Oligo:
AGTCTAGAAATGTAATTCCGCGAACCAG
Hairpin ID: TR02592P.1; FWD Oligo: AAGAATTCAGCATTGGGTCACACACAAA, RVS Oligo:
AGTCTAGACAAATGGGCGTAGATCAGGT
Hairpin ID: TR04578P.1; FWD Oligo: AAGAATTCGCGCACCAGAAGATTCATTT, RVS Oligo:
AGTCTAGAGTGATGCGACATAGGTGGTG
Hairpin ID: SH00199.N; FWD Oligo:
ctagcagtCCGATCCATTATAGTGATGAAtagttatattcaagcataTTCATCACTATAATGGATCGGgcg, RVS
Oligo: aattcgcCCGATCCATTATAGTGATGAAtatgcttgaatataactaTTCATCACTATAATGGATCGGactg
Hairpin ID: TR01002P.1; FWD Oligo: AGTCTAGAAACCCAAGAAGTCAGCATGG, RVS Oligo:
AACAATTGGTGGCTTTGGGTCACATTCT
Hairpin ID: TR01925P.1; FWD Oligo: CACCGAATTCGCGATGTGGTCATGTACTGG, RVS Oligo:
TGCCTGGACAACATTCTTTG
Hairpin ID: SH00590.N; FWD Oligo:
ctagcagtTAGTTTAAGATCAAAGTGTTAtagttatattcaagcataTAACACTTTGATCTTAAACTAgcg, RVS Oligo:
aattcgcTAGTTTAAGATCAAAGTGTTAtatgcttgaatataactaTAACACTTTGATCTTAAACTAactg
Hairpin ID: TR01373P.1; FWD Oligo: AGTCTAGAAACAGCTGCGTCTGATGATG, RVS Oligo:
AAGAATTCTGCGCATGTGAATCTCTAGG
Hairpin ID: TR01162P.1; FWD Oligo: AGTCTAGACAAAACCAGCCGGAGTACAT, RVS Oligo:
AAGAATTCGATCTTCCACCCCGGTTACT
Hairpin ID: SH00200.N; FWD Oligo:
ctagcagtCAGCTGGTTAACCTCAAGAAAtagttatattcaagcataTTTCTTGAGGTTAACCAGCTGgcg, RVS
Oligo: aattcgcCAGCTGGTTAACCTCAAGAAAtatgcttgaatataactaTTTCTTGAGGTTAACCAGCTGactg
Hairpin ID: TR01374P.1; FWD Oligo: AGTCTAGAGAAGAGCTTCTGCAATTCGG, RVS Oligo:
AAGAATTCGGTTTCTGCTCCGACTCAAG
Hairpin ID: TR02027P.1; FWD Oligo: CACCGAATTCCGCTACTACAACGATGCCAA, RVS Oligo:
TCGTGACATCGAAGGATTGA
Hairpin ID: TR01862P.1; FWD Oligo: CACCGAATTCCAAGCCCAGACTCCACTAGC, RVS Oligo:
CAGCGGAGTAGCTTGGTTTC
Hairpin ID: TR02525P.1; FWD Oligo: AAGAATTCCGGATCGGATTTCCCATAAT, RVS Oligo:
AGTCTAGAGTTGATCAGAACTCCGCCAT
Hairpin ID: SH00614.N; FWD Oligo:
ctagcagtCAGCGAGGACAACATGGTCTAtagttatattcaagcataTAGACCATGTTGTCCTCGCTGgcg, RVS
Oligo: aattcgcCAGCGAGGACAACATGGTCTAtatgcttgaatataactaTAGACCATGTTGTCCTCGCTGactg
Hairpin ID: TR00610A.1; FWD Oligo: GTCTAGAGAGCGACACCAGTTTCCATT, RVS Oligo:
AGAATTCTGTTCATTTCGTCCACTCCA
Hairpin ID: TR00609A.1; FWD Oligo: GTCTAGAATCCCAGATGATGCCTTCAC, RVS Oligo:
AGAATTCTGGGAGATATCTAGGGTGCG
Hairpin ID: SH00515.N; FWD Oligo:
ctagcagtCCGACTAGTCATTCAAAGTTAtagttatattcaagcataTAACTTTGAATGACTAGTCGGgcg, RVS
Oligo: aattcgcCCGACTAGTCATTCAAAGTTAtatgcttgaatataactaTAACTTTGAATGACTAGTCGGactg
Hairpin ID: SH00529.N; FWD Oligo:
ctagcagtGCGACAATTGGTAGTAATTAAtagttatattcaagcataTTAATTACTACCAATTGTCGCgcg, RVS Oligo:
aattcgcGCGACAATTGGTAGTAATTAAtatgcttgaatataactaTTAATTACTACCAATTGTCGCactg
Hairpin ID: SH00201.N; FWD Oligo:
ctagcagtCACGCTCAAGATAGAGCGCTAtagttatattcaagcataTAGCGCTCTATCTTGAGCGTGgcg, RVS
Oligo: aattcgcCACGCTCAAGATAGAGCGCTAtatgcttgaatataactaTAGCGCTCTATCTTGAGCGTGactg
Hairpin ID: TR02028P.1; FWD Oligo: CACCGAATTCGCCTTAATAATCGTCGGCAA, RVS Oligo:
GGGCAAGAAAATCGAATGAA
Hairpin ID: TR01270P.1; FWD Oligo: AGTCTAGATGCAAAAATAAGCCGTACCC, RVS Oligo:
AAGAATTCCTCTGGGCGGTATTTCACAT
Hairpin ID: TR01774P.1; FWD Oligo: CACCGAATTCAACAACACCGAAGTGCACAA, RVS Oligo:
TCCAATCATCTTCCCAAAGC
Hairpin ID: SH00360.N; FWD Oligo:
ctagcagtCTGAGAAAGAAGCGAAATTAAtagttatattcaagcataTTAATTTCGCTTCTTTCTCAGgcg, RVS Oligo:
aattcgcCTGAGAAAGAAGCGAAATTAAtatgcttgaatataactaTTAATTTCGCTTCTTTCTCAGactg
Hairpin ID: TR01375P.1; FWD Oligo: AGTCTAGACTGAAGCTCCACAAAGAGGG, RVS Oligo:
AAGAATTCATTGGCATTACAGGCAAAGG
Hairpin ID: TR02695P.1; FWD Oligo: AAGAATTCAGGTTCAAACGTTTTGTGGC, RVS Oligo:
AGTCTAGATGAGTTGGTTCAGTTCGCTG
Hairpin ID: TR00960P.1; FWD Oligo: AAGAATTCGTGTCCTGTATGGCTCCCA, RVS Oligo:
AGTCTAGACCCTGCATGCTCTTGATGTA
Hairpin ID: TR01682P.1; FWD Oligo: AACAATTGTTGGGAATACCGAATTGCAT, RVS Oligo:
AGTCTAGACTCATCGTCATCCTCGACAA
Hairpin ID: TR02700P.1; FWD Oligo: AAGAATTCGAATCCGTACGCTATGGGAA, RVS Oligo:
AGTCTAGAGGGCTTGCGTAAACAAAACT
Hairpin ID: SH00793.N; FWD Oligo:
ctagcagtTAGCACAAAGAAGAAAGCGAAtagttatattcaagcataTTCGCTTTCTTCTTTGTGCTAgcg, RVS
Oligo: aattcgcTAGCACAAAGAAGAAAGCGAAtatgcttgaatataactaTTCGCTTTCTTCTTTGTGCTAactg
Hairpin ID: SH00517.N; FWD Oligo:
ctagcagtAACGATGTCGATATCGATAAAtagttatattcaagcataTTTATCGATATCGACATCGTTgcg, RVS Oligo:
aattcgcAACGATGTCGATATCGATAAAtatgcttgaatataactaTTTATCGATATCGACATCGTTactg
Hairpin ID: TR02898P.1; FWD Oligo: AAGAATTCTGTCACCAGCAATGAAGCTC, RVS Oligo:
AGTCTAGACCATGTTTGTTCACCAGTCG
Hairpin ID: TR01775P.1; FWD Oligo: CACCGAATTCCGGTGATGTTCTCCGTTTTT, RVS Oligo:
AGCTAACATCGAATCGGTCG
Hairpin ID: TR01439P.1; FWD Oligo: AGTCTAGAACATAGGGGAAATGGGGAAG, RVS Oligo:
AAGAATTCTGTTCACGCCCTACTGTCTG
Hairpin ID: TR02312P.1; FWD Oligo: CACCGAATTCCGCTGTACAAACACATTGCC, RVS Oligo:
CTGGTCAAAGGGATCCTCAA
Hairpin ID: TR01867P.1; FWD Oligo: CACCGAATTCTCACAACAGTTCTTGCCGAG, RVS Oligo:
AGGTGATCAGGAACTCCACG
Hairpin ID: TR00237A.1; FWD Oligo: GTCTAGAAGCGTCTGCGTTTGAAGAGT, RVS Oligo:
AGAATTCGCATCTATGCAACGCAGTGT
Hairpin ID: TR04559P.1; FWD Oligo: AAGAATTCGCGAGGGTATGAGACAAAGC, RVS Oligo:
AGTCTAGAAGCATTTTCGTCGTTTTTGC
Hairpin ID: TR01699P.1; FWD Oligo: CACCGAATTCATTCTTGGTTCTCGTTTGCG, RVS Oligo:
CATTTTGGTGGGTGGGTTTA
Hairpin ID: TR01530A.1; FWD Oligo: AGTCTAGATGTGGGGAGTGTTTGACGTA, RVS Oligo:
AAGAATTCCTTGTAGCGCTGCTCCAGTT
Hairpin ID: TR04624P.1; FWD Oligo: AAGAATTCCAGCATAGTGTGGTGCTGCT, RVS Oligo:
AGTCTAGATTCAGCACATCGAAGCAATC
Hairpin ID: SH00325.N; FWD Oligo:
ctagcagtACGACGATCTGTCGCATGTTAtagttatattcaagcataTAACATGCGACAGATCGTCGTgcg, RVS
Oligo: aattcgcACGACGATCTGTCGCATGTTAtatgcttgaatataactaTAACATGCGACAGATCGTCGTactg
Hairpin ID: SH01256.N2; FWD Oligo:
ctagcagtCAGATTGGGTATCAAATATTAtagttatattcaagcataTAATATTTGATACCCAATCTGgcg, RVS Oligo:
aattcgcCAGATTGGGTATCAAATATTAtatgcttgaatataactaTAATATTTGATACCCAATCTGactg
Hairpin ID: SH01257.N2; FWD Oligo:
ctagcagtCTGCAAGAGCCGATAAGATTAtagttatattcaagcataTAATCTTATCGGCTCTTGCAGgcg, RVS
Oligo: aattcgcCTGCAAGAGCCGATAAGATTAtatgcttgaatataactaTAATCTTATCGGCTCTTGCAGactg
Hairpin ID: TR00689A.1; FWD Oligo: GTCTAGATCGACTCCGTGTTTGTTCAG, RVS Oligo:
ACAATTGTCCCACGAAACACTTAACACC
Hairpin ID: TR00688A.1; FWD Oligo: GTCTAGAAGAGATCGAGAAAAAGCCCC, RVS Oligo:
AGAATTCGATTCGCACAGAGATCGACA
Hairpin ID: TR03844P.1; FWD Oligo: AAGAATTCTGAGCACACTATACGCCAGC, RVS Oligo:
AGTCTAGAAAATCGATAACACAACCGGC
Hairpin ID: SH00373.N; FWD Oligo:
ctagcagtAACGATAACGATGTTCAACAAtagttatattcaagcataTTGTTGAACATCGTTATCGTTgcg, RVS Oligo:
aattcgcAACGATAACGATGTTCAACAAtatgcttgaatataactaTTGTTGAACATCGTTATCGTTactg
Hairpin ID: TR00738P.1; FWD Oligo: GTCTAGAGCTAAGGTCTGAAGGATGCG, RVS Oligo:
AGAATTCAAGTGCTCCCAAGCAAGAAA
Hairpin ID: TR02298P.1; FWD Oligo: CACCGAATTCTTGGCATCTCTATATCCGGC, RVS Oligo:
TCATCGCCACAGTCTTTCTG
Hairpin ID: SH00241.N; FWD Oligo:
ctagcagtCAGAGCAGCGAGGACGAGATAtagttatattcaagcataTATCTCGTCCTCGCTGCTCTGgcg, RVS
Oligo: aattcgcCAGAGCAGCGAGGACGAGATAtatgcttgaatataactaTATCTCGTCCTCGCTGCTCTGactg
Hairpin ID: TR02593P.1; FWD Oligo: AAGAATTCTGCATGAGACCAAGATTTGC, RVS Oligo:
AGTCTAGATATCACAACGATCCGACCAA
Hairpin ID: TR00491A.1; FWD Oligo: GTCTAGACATCCGGGATATCAGACGAT, RVS Oligo:
AGAATTCTACGAAATGGCACTGAGCTG
Hairpin ID: SH01359.N2; FWD Oligo:
ctagcagtCAGATTTAATGTAGTACATAAtagttatattcaagcataTTATGTACTACATTAAATCTGgcg, RVS Oligo:
aattcgcCAGATTTAATGTAGTACATAAtatgcttgaatataactaTTATGTACTACATTAAATCTGactg
Hairpin ID: SH00202.N; FWD Oligo:
ctagcagtCAGGCGACTAACAATGATCAAtagttatattcaagcataTTGATCATTGTTAGTCGCCTGgcg, RVS
Oligo: aattcgcCAGGCGACTAACAATGATCAAtatgcttgaatataactaTTGATCATTGTTAGTCGCCTGactg
Hairpin ID: TR01193P.1; FWD Oligo: AGTCTAGAACGCCAGTCCATCAAAGAAA, RVS Oligo:
AAGAATTCGGCAGGAAATGGACAACAAA
Hairpin ID: TR00593A.1; FWD Oligo: GTCTAGAGGATCGTTCGATGTGGTCTT, RVS Oligo:
ACAATTGGTAGCAGTTTAAGCTCGCGG
Hairpin ID: SH00032.O; FWD Oligo:
ctagcagtTAACTAGATTTATAGACGCTTtagttatattcaagcataAAGCGTCTATAAATCTAGTTAgcg, RVS Oligo:
aattcgcTAACTAGATTTATAGACGCTTtatgcttgaatataactaAAGCGTCTATAAATCTAGTTAactg
Hairpin ID: SH00031.O; FWD Oligo:
ctagcagtTTGTAGTTTCGATTGGTGCATtagttatattcaagcataATGCACCAATCGAAACTACAAgcg, RVS
Oligo: aattcgcTTGTAGTTTCGATTGGTGCATtatgcttgaatataactaATGCACCAATCGAAACTACAAactg
Hairpin ID: TR02031P.1; FWD Oligo: CACCGAATTCGCACTGGCTCCTCTGTCTTC, RVS Oligo:
GTTGCTCCTGAATCTCCTGC
Hairpin ID: TR02636P.1; FWD Oligo: AAGAATTCAGATCCTTTCCACCGGAGTT, RVS Oligo:
AGTCTAGAGGTCTGGTTCACGGGTTCTA
Hairpin ID: TR01378P.1; FWD Oligo: AGTCTAGACGGGTGAAATCAAAGGAAGA, RVS Oligo:
AAGAATTCATTTGGCTGCATTGGTGTTT
Hairpin ID: TR01379P.1; FWD Oligo: AGTCTAGACCCCAAGTCATGAAGGAAGA, RVS Oligo:
AAGAATTCAGAGCCGTCGAAGTCTTGAA
Hairpin ID: TR02032P.1; FWD Oligo: CACCGAATTCGATTTCGCAAAGCTGGACTC, RVS Oligo:
TAGGCTTCTGCACATCATGC
Hairpin ID: SH00203.N; FWD Oligo:
ctagcagtCTAGACGACGACTTTCTACAAtagttatattcaagcataTTGTAGAAAGTCGTCGTCTAGgcg, RVS
Oligo: aattcgcCTAGACGACGACTTTCTACAAtatgcttgaatataactaTTGTAGAAAGTCGTCGTCTAGactg
Hairpin ID: SH00204.N; FWD Oligo:
ctagcagtCAGACCCTTAGTGTTAAATAAtagttatattcaagcataTTATTTAACACTAAGGGTCTGgcg, RVS Oligo:
aattcgcCAGACCCTTAGTGTTAAATAAtatgcttgaatataactaTTATTTAACACTAAGGGTCTGactg
Hairpin ID: TR02033P.1; FWD Oligo: CACCGAATTCGATTCGGCTACTCAAGACGC, RVS Oligo:
GGATTACCGCTCCAAGAACA
Hairpin ID: TR00196A.1; FWD Oligo: GTCTAGAGGGACAACCTGACTCTCTGG, RVS Oligo:
AGAATTCCGGAAAAATCATGCCAAACT
Hairpin ID: TR00196P.1; FWD Oligo: AAGAATTCGGGACAACCTGACTCTCTGG, RVS Oligo:
AGTCTAGACGGAAAAATCATGCCAAACT
Hairpin ID: TR00980P.1; FWD Oligo: AGTCTAGAAACTTACCGACCGAGAGCAA, RVS Oligo:
AAGAATTCCGATTTCGGTTACGGCTTTA
Hairpin ID: TR00971P.1; FWD Oligo: AGTCTAGACTTGCTAGAGCGTCCCGTTA, RVS Oligo:
AAGAATTCACAGGGATTGGTCAAAGGTG
Hairpin ID: SH00718.N; FWD Oligo:
ctagcagtCAGCTACAGATACGATATCAAtagttatattcaagcataTTGATATCGTATCTGTAGCTGgcg, RVS
Oligo: aattcgcCAGCTACAGATACGATATCAAtatgcttgaatataactaTTGATATCGTATCTGTAGCTGactg
Hairpin ID: TR02034P.1; FWD Oligo: CACCGAATTCGCGATGCCTTTTAGCTTCAG, RVS Oligo:
CTCGGTCGCTCACTACATGA
Hairpin ID: TR01284P.1; FWD Oligo: AGTCTAGATCACTCTGACTGGCTCTCCA, RVS Oligo:
AAGAATTCGCCACCATTCTTCTGACGTT
Hairpin ID: TR01381P.1; FWD Oligo: AGTCTAGAGAATCCTTCGCAGTTGGTGT, RVS Oligo:
AAGAATTCGTAGGTTGCCTCGCAGTAGC
Hairpin ID: TR01022P.1; FWD Oligo: AGTCTAGACAATGGGCAACGTTTTTCTG, RVS Oligo:
AAGAATTCACTTGACGCGATCGAAAGTT
Hairpin ID: TR01776P.1; FWD Oligo: CACCGAATTCGCTTTACAGCCAGAGCCAAC, RVS Oligo:
CACCCAGAATCCCTCAAAAA
Hairpin ID: TR00197A.1; FWD Oligo: GTCTAGATGAACCCTAGTTCGACTGCC, RVS Oligo:
AGAATTCAAGGACAACCGCAACGTATC
Hairpin ID: TR02307P.1; FWD Oligo: CACCGAATTCAAGAAGGCCGATCAGGAGAT, RVS Oligo:
CTGCTCGAGCTCCTTCTTGT
Hairpin ID: TR04124P.1; FWD Oligo: AAGAATTCTGCTTAGCAAGGCAAAGGTT, RVS Oligo:
AGTCTAGATTGGCACGTGGTTTTCATTA
Hairpin ID: TR00825A.1; FWD Oligo: GTCTAGAGTCGGGAGTGGGCTACAATA, RVS Oligo:
AGAATTCACTTCGCAAAGCTCCTTGAA
Hairpin ID: TR01599P.1; FWD Oligo: AAGAATTCAACAGCTATGTGGACCCCAG, RVS Oligo:
AGTCTAGACGTGATACAAGTGCATTGGG
Hairpin ID: SH00702.N; FWD Oligo:
ctagcagtCAGGATGTAAATGACAATCAAtagttatattcaagcataTTGATTGTCATTTACATCCTGgcg, RVS Oligo:
aattcgcCAGGATGTAAATGACAATCAAtatgcttgaatataactaTTGATTGTCATTTACATCCTGactg
Hairpin ID: TR02437P.1; FWD Oligo: AAGAATTCCCTACGGCATGAAGTTCGTT, RVS Oligo:
AGTCTAGAAGAGGGAGGGAGAGGGTACA
Hairpin ID: SH00111.N; FWD Oligo:
ctagcagtCAGCATCGATATTGACTGTTAtagttatattcaagcataTAACAGTCAATATCGATGCTGgcg, RVS
Oligo: aattcgcCAGCATCGATATTGACTGTTAtatgcttgaatataactaTAACAGTCAATATCGATGCTGactg
Hairpin ID: TR00760A.1; FWD Oligo: GTCTAGAACCACATCCAAACATCAGCA, RVS Oligo:
AGAATTCACGAAAAGACCTGAGCGAAA
Hairpin ID: SH00616.N; FWD Oligo:
ctagcagtCAGTTATTATGTCGTCGACAAtagttatattcaagcataTTGTCGACGACATAATAACTGgcg, RVS
Oligo: aattcgcCAGTTATTATGTCGTCGACAAtatgcttgaatataactaTTGTCGACGACATAATAACTGactg
Hairpin ID: TR00607A.1; FWD Oligo: GTCTAGACCAGGCCAAAAATCTCATTG, RVS Oligo:
AGAATTCCGATGTCCTGACAACTGTGC
Hairpin ID: TR00608A.1; FWD Oligo: GTCTAGAGGCATCATCCATCACAACTG, RVS Oligo:
AGAATTCGACGAGGAGCTGCTTATTGG
Hairpin ID: SH00462.N; FWD Oligo:
ctagcagtACGGTCAACGAGAATACCCAAtagttatattcaagcataTTGGGTATTCTCGTTGACCGTgcg, RVS
Oligo: aattcgcACGGTCAACGAGAATACCCAAtatgcttgaatataactaTTGGGTATTCTCGTTGACCGTactg
Hairpin ID: TR02035P.1; FWD Oligo: CACCGAATTCACTTGAATTGCGCAGCTTTT, RVS Oligo:
CTTCGTCGAGAACCTGGAAC
Hairpin ID: TR04518P.1; FWD Oligo: AAGAATTCGCAAATCGCAGCAGCTAATC, RVS Oligo:
AGCCTAGGGGGGTCTGTGTGTTCGAGTT
Hairpin ID: TR01443P.1; FWD Oligo: AGTCTAGACTTGCTGAACTTTGCCAACA, RVS Oligo:
AAGAATTCTCTGTTCTTGTTGCGGTTTG
Hairpin ID: TR01443P.1hm; FWD Oligo: AGTCTAGACTTGCTGAACTTTGCCAACA, RVS Oligo:
AAGAATTCTCTGTTCTTGTTGCGGTTTG
Hairpin ID: TR01031P.1; FWD Oligo: AGTCTAGACGTCGGGTTTTAGCAACAAT, RVS Oligo:
AAGAATTCTGCCTTTCATATCCGATTCC
Hairpin ID: SH00635.N; FWD Oligo:
ctagcagtTAGGTTTATAGCGACATCATAtagttatattcaagcataTATGATGTCGCTATAAACCTAgcg, RVS Oligo:
aattcgcTAGGTTTATAGCGACATCATAtatgcttgaatataactaTATGATGTCGCTATAAACCTAactg
Hairpin ID: TR01777P.1; FWD Oligo: CACCGAATTCCACACAGCCTCCCATCTTTT, RVS Oligo:
CTCGTTCATGATTCCCACCT
Hairpin ID: TR00457P.1; FWD Oligo: GTCTAGACCACTCTGGAGAACTCTGGC, RVS Oligo:
AGAATTCTCAGAGATAATGCGCGACAC
Hairpin ID: TR01700P.1; FWD Oligo: CACCGAATTCCGTATAAAAAGGAAGCGCCA, RVS Oligo:
TCAAACCGCTTAGCTTTCGT
Hairpin ID: SH00595.N; FWD Oligo:
ctagcagtCAGATAGAACTCAACTACAAAtagttatattcaagcataTTTGTAGTTGAGTTCTATCTGgcg, RVS Oligo:
aattcgcCAGATAGAACTCAACTACAAAtatgcttgaatataactaTTTGTAGTTGAGTTCTATCTGactg
Hairpin ID: SH00437.N; FWD Oligo:
ctagcagtCTGGTGCGACTGGAAGAAGAAtagttatattcaagcataTTCTTCTTCCAGTCGCACCAGgcg, RVS
Oligo: aattcgcCTGGTGCGACTGGAAGAAGAAtatgcttgaatataactaTTCTTCTTCCAGTCGCACCAGactg
Hairpin ID: TR02036P.1; FWD Oligo: CACCGAATTCGCTCAGCTTTGGTGAACACA, RVS Oligo:
TTCCAAGGTTCTGGATGACC
Hairpin ID: TR01701P.1; FWD Oligo: CACCGAATTCGCTATGGGATTTGGAAACGA, RVS Oligo:
GGACCATTTTCAAGGTTCCG
Hairpin ID: TR02648P.1; FWD Oligo: AAGAATTCCGATTGCTTGTGCATTTAGC, RVS Oligo:
AGTCTAGAATGGTGCTTTGGATTTGAGG
Hairpin ID: TR01778P.1; FWD Oligo: CACCGAATTCTCCTCGGAGCGGTACTTCTA, RVS Oligo:
CGCTATATGATCCGCATGAA
Hairpin ID: SH00355.N; FWD Oligo:
ctagcagtCCGCTTCAAGATTGTCATCAAtagttatattcaagcataTTGATGACAATCTTGAAGCGGgcg, RVS
Oligo: aattcgcCCGCTTCAAGATTGTCATCAAtatgcttgaatataactaTTGATGACAATCTTGAAGCGGactg
Hairpin ID: TR04573P.1; FWD Oligo: AAGAATTCAGAGAAGGCGAACCCAAAGT, RVS Oligo:
AGTCTAGAGAATAAGTTCCGATGCCCAA
Hairpin ID: TR02062P.1; FWD Oligo: GCCAATTTGTGTGGAGGACT, RVS Oligo:
AAGTGAATTCAATATCCATTCTCGCAACCG
Hairpin ID: SH01661.N; FWD Oligo:
ctagcagtCACGTCGTTGACAAAGACCAAtagttatattcaagcataTTGGTCTTTGTCAACGACGTGgcg, RVS
Oligo: aattcgcCACGTCGTTGACAAAGACCAAtatgcttgaatataactaTTGGTCTTTGTCAACGACGTGactg
Hairpin ID: SH00530.N; FWD Oligo:
ctagcagtCCGATCACAGAGTGTCTACAAtagttatattcaagcataTTGTAGACACTCTGTGATCGGgcg, RVS
Oligo: aattcgcCCGATCACAGAGTGTCTACAAtatgcttgaatataactaTTGTAGACACTCTGTGATCGGactg
Hairpin ID: TR00291A.1; FWD Oligo: GTCTAGACACCTTCAACGAGAGCTTCC, RVS Oligo:
AGAATTCATCATGTCCGAAATCTTGGC
Hairpin ID: TR00291P.1; FWD Oligo: AAGAATTCCACCTTCAACGAGAGCTTCC, RVS Oligo:
AGTCTAGAATCATGTCCGAAATCTTGGC
Hairpin ID: SH00205.N; FWD Oligo:
ctagcagtTAGAGTGTAGTTAATGTTTGAtagttatattcaagcataTCAAACATTAACTACACTCTAgcg, RVS Oligo:
aattcgcTAGAGTGTAGTTAATGTTTGAtatgcttgaatataactaTCAAACATTAACTACACTCTAactg
Hairpin ID: TR00462P.1; FWD Oligo: GTCTAGAAAGGCAGGAAGCTTAAAGGC, RVS Oligo:
AGAATTCCTCTGCGTTCAATGCGAATA
Hairpin ID: TR02395P.1; FWD Oligo: AAGAATTCACCGGTGAGGATCTGAGCTA, RVS Oligo:
AGTCTAGAGCTGATTCTCTGGCTGTTCC
Hairpin ID: TR04561P.1; FWD Oligo: AAGAATTCGAGAACTTCCGCTTCACCTG, RVS Oligo:
AGTCTAGATCGGAAAGTCTATTGTGGGC
Hairpin ID: TR04562P.1; FWD Oligo: AAGAATTCTGTTACTCAATGGCAACCCA, RVS Oligo:
AGTCTAGACTTCAGAACCGACAGGCTTC
Hairpin ID: SH00416.N; FWD Oligo:
ctagcagtCTCGATGTGCAGAGCGACGAAtagttatattcaagcataTTCGTCGCTCTGCACATCGAGgcg, RVS
Oligo: aattcgcCTCGATGTGCAGAGCGACGAAtatgcttgaatataactaTTCGTCGCTCTGCACATCGAGactg
Hairpin ID: SH00438.N; FWD Oligo:
ctagcagtACGCAACAAATTGAACGACTAtagttatattcaagcataTAGTCGTTCAATTTGTTGCGTgcg, RVS
Oligo: aattcgcACGCAACAAATTGAACGACTAtatgcttgaatataactaTAGTCGTTCAATTTGTTGCGTactg
Hairpin ID: SH01753.N; FWD Oligo:
ctagcagtATGGATTATGATTATACGATAtagttatattcaagcataTATCGTATAATCATAATCCATgcg, RVS Oligo:
aattcgcATGGATTATGATTATACGATAtatgcttgaatataactaTATCGTATAATCATAATCCATactg
Hairpin ID: SH00206.N; FWD Oligo:
ctagcagtCACGAAGGACATGCTCTTCCAtagttatattcaagcataTGGAAGAGCATGTCCTTCGTGgcg, RVS
Oligo: aattcgcCACGAAGGACATGCTCTTCCAtatgcttgaatataactaTGGAAGAGCATGTCCTTCGTGactg
Hairpin ID: TR04577P.1; FWD Oligo: AAGAATTCCAATGTCTCACCACCCACAG, RVS Oligo:
AGTCTAGACTGAAGGGACACAGTGAGCA
Hairpin ID: CG18721shmi-1; FWD Oligo:
ctagcagtCTGAGCGACGACATTGATGTAtagttatattcaagcataTACATCAATGTCGTCGCTCAGgcg, RVS
Oligo: aattcgcCTGAGCGACGACATTGATGTAtatgcttgaatataactaTACATCAATGTCGTCGCTCAGactg
Hairpin ID: CG18721shmi-2; FWD Oligo:
ctagcagtCAGGGAGACGTTCTTTGACTAtagttatattcaagcataTAGTCAAAGAACGTCTCCCTGgcg, RVS
Oligo: aattcgcCAGGGAGACGTTCTTTGACTAtatgcttgaatataactaTAGTCAAAGAACGTCTCCCTGactg
Hairpin ID: TR04539P.1; FWD Oligo: AAGAATTCCAACGAAACCATCAACACCA, RVS Oligo:
AGTCTAGACAGGATTAAAGGTGGCCAGA
Hairpin ID: TR04540P.1; FWD Oligo: AAGAATTCAAATTTAGGGCCCAATGGAG, RVS Oligo:
AGTCTAGAATCGATTGTGACAGTGCGTC
Hairpin ID: SH01360.N2; FWD Oligo:
ctagcagtCAAGGTGGACATCTTGTACAAtagttatattcaagcataTTGTACAAGATGTCCACCTTGgcg, RVS
Oligo: aattcgcCAAGGTGGACATCTTGTACAAtatgcttgaatataactaTTGTACAAGATGTCCACCTTGactg
Hairpin ID: TR02416P.1; FWD Oligo: AAGAATTCATTGCGGCTTGTCTTGTTCT, RVS Oligo:
AGTCTAGAGTTTCCCACTCGAGGATCAA
Hairpin ID: TR01779P.1; FWD Oligo: CACCGAATTCGTTGCCAGTGTACCACATCG, RVS Oligo:
GCTCAGCTTGTGGGGATAGA
Hairpin ID: TR02632P.1; FWD Oligo: AACAATTGCCATCGAGAACAACATGACG, RVS Oligo:
AGTCTAGAGTCCAACCCGATTAGCTCTG
Hairpin ID: TR02355P.1; FWD Oligo: AAGAATTCCAGATCCGGACCATATTGCT, RVS Oligo:
AGTCTAGATATGTATATCCCGCCCCAGA
Hairpin ID: TR01383P.1; FWD Oligo: AGTCTAGAGGTGTTTGCGACAAAGGATT, RVS Oligo:
AAGAATTCGCTAGCATAGGTGGAGGCAG
Hairpin ID: TR01383P.1hm; FWD Oligo: AGTCTAGAGGTGTTTGCGACAAAGGATT, RVS Oligo:
AAGAATTCGCTAGCATAGGTGGAGGCAG
Hairpin ID: SH00317.N; FWD Oligo:
ctagcagtAACACAAGTAGTCTAAGTCAAtagttatattcaagcataTTGACTTAGACTACTTGTGTTgcg, RVS Oligo:
aattcgcAACACAAGTAGTCTAAGTCAAtatgcttgaatataactaTTGACTTAGACTACTTGTGTTactg
Hairpin ID: SH00312.N; FWD Oligo:
ctagcagtCTCACCGGAGATGTTCCTCAAtagttatattcaagcataTTGAGGAACATCTCCGGTGAGgcg, RVS
Oligo: aattcgcCTCACCGGAGATGTTCCTCAAtatgcttgaatataactaTTGAGGAACATCTCCGGTGAGactg
Hairpin ID: TR01780P.1; FWD Oligo: CACCGAATTCTTGATTCTGGTGTCTCAGCG, RVS Oligo:
AGTTGGTTCAGTCCACAGGC
Hairpin ID: SH00961.N; FWD Oligo:
ctagcagtCAGAATCATGCGAGACTATAAtagttatattcaagcataTTATAGTCTCGCATGATTCTGgcg, RVS
Oligo: aattcgcCAGAATCATGCGAGACTATAAtatgcttgaatataactaTTATAGTCTCGCATGATTCTGactg
Hairpin ID: TR00682A.1; FWD Oligo: GTCTAGACTCTCCAGCGATCTGGACTC, RVS Oligo:
AGAATTCTTCTCTCAGCACACGTACCG
Hairpin ID: TR00683A.1; FWD Oligo: GTCTAGAGGAGATCGTTAAGGCGATGA, RVS Oligo:
AGAATTCTCAGCACATCGCTGCTACTC
Hairpin ID: TR00928P.1; FWD Oligo: AGTCTAGACTTGCCTCCAGTTCCAGAAG, RVS Oligo:
AAGAATTCGCCTTGTCATAATTGTGGGG
Hairpin ID: TR00736A.1; FWD Oligo: GTCTAGATTCTTCTTCAATATCGGCGG, RVS Oligo:
AGAATTCAGCATCATCTCCCTGCATTT
Hairpin ID: TR00735A.1; FWD Oligo: GTCTAGAAAAATCATGCTGGCCAACTC, RVS Oligo:
AGAATTCATCATCCGCCGATATTGAAG
Hairpin ID: TR00799A.1; FWD Oligo: GTCTAGAGTCACCAAAACGCAAAACCT, RVS Oligo:
AGAATTCGCACCAGGACAAATCCAACT
Hairpin ID: SH00593.N; FWD Oligo:
ctagcagtAAGGACGATGATTCACCTCAAtagttatattcaagcataTTGAGGTGAATCATCGTCCTTgcg, RVS
Oligo: aattcgcAAGGACGATGATTCACCTCAAtatgcttgaatataactaTTGAGGTGAATCATCGTCCTTactg
Hairpin ID: TR02702P.1; FWD Oligo: AAGAATTCGTTGCTCCGGTTGGAAAATA, RVS Oligo:
AGTCTAGAGTACCGGTTCTTCATGCGAT
Hairpin ID: TR04519P.1; FWD Oligo: AAGAATTCTACAACTTCCAGGCCCAGTC, RVS Oligo:
AGTCTAGAACTTCTCCAGCACATGGACC
Hairpin ID: TR00490A.1; FWD Oligo: GTCTAGATAGCGTGCCCTTCTCAGTTT, RVS Oligo:
AGAATTCAGCCGTGCTTAAGAGAACCA
Hairpin ID: SH01361.N2; FWD Oligo:
ctagcagtAAGCATAAGTTTATAGTCTAAtagttatattcaagcataTTAGACTATAAACTTATGCTTgcg, RVS Oligo:
aattcgcAAGCATAAGTTTATAGTCTAAtatgcttgaatataactaTTAGACTATAAACTTATGCTTactg
Hairpin ID: SH00473.N; FWD Oligo:
ctagcagtTGCGTGTTTGTTAATGTACAAtagttatattcaagcataTTGTACATTAACAAACACGCAgcg, RVS Oligo:
aattcgcTGCGTGTTTGTTAATGTACAAtatgcttgaatataactaTTGTACATTAACAAACACGCAactg
Hairpin ID: SH00207.N; FWD Oligo:
ctagcagtTAGATCGAGTGTAACTGTTAAtagttatattcaagcataTTAACAGTTACACTCGATCTAgcg, RVS Oligo:
aattcgcTAGATCGAGTGTAACTGTTAAtatgcttgaatataactaTTAACAGTTACACTCGATCTAactg
Hairpin ID: TR01385P.1; FWD Oligo: AGTCTAGATTCGACGCAGTGGAATACTG, RVS Oligo:
AAGAATTCTCCCGTCCAAGTTAAACGTC
Hairpin ID: TR01106P.1; FWD Oligo: AGTCTAGACCGAAGCTGAGGATCAACTC, RVS Oligo:
AAGAATTCTAGGAAACAGTTCCGGTTCG
Hairpin ID: TR01387P.1; FWD Oligo: AGTCTAGAATGAGCTGGCAGAGCTGTTT, RVS Oligo:
AAGAATTCAAATCGCTTTTGTGCATTCC
Hairpin ID: TR04563P.1; FWD Oligo: AAGAATTCGGATGTGATTGAAAGTGGGG, RVS Oligo:
AGTCTAGATATCGTTTGGGGGCTAAGTG
Hairpin ID: TR02689P.1; FWD Oligo: AAGAATTCCCATCCGTATAACTTTGCCG, RVS Oligo:
AGTCTAGATATAATTTTTGCCCGCTTGC
Hairpin ID: SH00573.N; FWD Oligo:
ctagcagtCCGGATGATTGTCCAAATGTAtagttatattcaagcataTACATTTGGACAATCATCCGGgcg, RVS
Oligo: aattcgcCCGGATGATTGTCCAAATGTAtatgcttgaatataactaTACATTTGGACAATCATCCGGactg
Hairpin ID: TR02040P.1; FWD Oligo: CACCGAATTCAGAAAGTGCCGAGCAATGAC, RVS Oligo:
TCAAATTAAGGATGGCCAGG
Hairpin ID: TR00876P.1; FWD Oligo: AGTCTAGAGATGTGCCCTACTCGGACAT, RVS Oligo:
AAGAATTCTCATGTTCTCGCGATCAAAG
Hairpin ID: SH00208.N; FWD Oligo:
ctagcagtCTGAAGACGAATGTTGAAATAtagttatattcaagcataTATTTCAACATTCGTCTTCAGgcg, RVS Oligo:
aattcgcCTGAAGACGAATGTTGAAATAtatgcttgaatataactaTATTTCAACATTCGTCTTCAGactg
Hairpin ID: SH00679.N; FWD Oligo:
ctagcagtAACGACCTGCCTCAAGCTAAAtagttatattcaagcataTTTAGCTTGAGGCAGGTCGTTgcg, RVS
Oligo: aattcgcAACGACCTGCCTCAAGCTAAAtatgcttgaatataactaTTTAGCTTGAGGCAGGTCGTTactg
Hairpin ID: TR00967P.1; FWD Oligo: AGTCTAGAGGAGGAAACACAAGTGACGC, RVS Oligo:
AAGAATTCTTGAGGATTCCGAGTTCCTG
Hairpin ID: TR02041P.1; FWD Oligo: CACCGAATTCGAAAACATTGCTGGCGGTAT, RVS Oligo:
TTACCAACAAAATGCCGTGA
Hairpin ID: TR01451P.1; FWD Oligo: AGTCTAGAGATGAGCGAGGCAGATAAGG, RVS Oligo:
AAGAATTCCATTGTAGGTGACGTGGTCG
Hairpin ID: TR01452P.1; FWD Oligo: AGTCTAGATACAGCTCAACTCGGCACC, RVS Oligo:
AAGAATTCCGACTGCTCCTCATAGTGGC
Hairpin ID: TR00637A.1; FWD Oligo: GTCTAGAGTCACGGGATCTGGACTCAT, RVS Oligo:
AGAATTCCTTTGCACTCATTGGCTTCC
Hairpin ID: TR00636A.1; FWD Oligo: GTCTAGACAGCGATATTGCGAGTACCA, RVS Oligo:
AGAATTCATGAGTCCAGATCCCGTGAC
Hairpin ID: TR01887P.1; FWD Oligo: CACCGAATTCAACTCGACCACCACGAAAAC, RVS Oligo:
GATCAGCACCAGCAAACTGA
Hairpin ID: SH00454.N; FWD Oligo:
ctagcagtAAGCGAGATAATATTCACCAAtagttatattcaagcataTTGGTGAATATTATCTCGCTTgcg, RVS Oligo:
aattcgcAAGCGAGATAATATTCACCAAtatgcttgaatataactaTTGGTGAATATTATCTCGCTTactg
Hairpin ID: TR04070P.1; FWD Oligo: AAGAATTCGAGCACGAGAAGTCCCTCAC, RVS Oligo:
AGTCTAGAAGCTCCACGTAGCACTCGAT
Hairpin ID: SH01723.N; FWD Oligo:
ctagcagtCACGTTCTCGATCATCGACAAtagttatattcaagcataTTGTCGATGATCGAGAACGTGgcg, RVS
Oligo: aattcgcCACGTTCTCGATCATCGACAAtatgcttgaatataactaTTGTCGATGATCGAGAACGTGactg
Hairpin ID: TR02356P.1; FWD Oligo: AAGAATTCAAATGGTTGTGCTACTGCCC, RVS Oligo:
AGTCTAGACAATTAAGCCCACACCGTCT
Hairpin ID: TR02043P.1; FWD Oligo: CACCGAATTCGCTGTCAATCTCCAGGCTTC, RVS Oligo:
ATGCGATAGCAACGCTTCTT
Hairpin ID: TR00239P.1; FWD Oligo: AAGAATTCCATTGCGGACAAGGGATACT, RVS Oligo:
AGTCTAGAAAGCCACTTTTCCAGCTTCA
Hairpin ID: TR02044P.1; FWD Oligo: CACCGAATTCCTGCATCTGGGTGTCCTTTT, RVS Oligo:
TGAGGACAAGTGTCGCATTC
Hairpin ID: TR01647A.1; FWD Oligo: AGTCTAGAGATATCGACGACATGGGCTT, RVS Oligo:
AAGAATTCTGCAGAAAGCATTTGGTCAG
Hairpin ID: TR00125A.1; FWD Oligo: GTCTAGAAGTTCATAGGCGAACGCAGT, RVS Oligo:
AGAATTCAATTGCCATCAGGAATTTGC
Hairpin ID: TR02045P.1; FWD Oligo: CACCGAATTCTACATAAGCTGGCTTCCGCT, RVS Oligo:
CAAGTCAGTTGGTGGTGTGG
Hairpin ID: TR01071P.1; FWD Oligo: AGTCTAGAGTACTTCCATCCGAGCCTGA, RVS Oligo:
AAGAATTCTGGTTATGCGAAACAAACGA
Hairpin ID: TR02046P.1; FWD Oligo: GGATCCGCACGATCATTCGCTCCTAT, RVS Oligo:
CACCTCTTGGAGCTCTGGGTCAGT
Hairpin ID: SH01874.N; FWD Oligo:
ctagcagtCAACGATGTTGTAGAAATCAAtagttatattcaagcataTTGATTTCTACAACATCGTTGgcg, RVS Oligo:
aattcgcCAACGATGTTGTAGAAATCAAtatgcttgaatataactaTTGATTTCTACAACATCGTTGactg
Hairpin ID: TR00566A.1; FWD Oligo: GTCTAGACACAGCACACAGCATGTTCA, RVS Oligo:
ACAATTGCGATGTACACTTGCGTGAGG
Hairpin ID: TR00242A.1; FWD Oligo: GTCTAGAGGAGATGCTTATTCGCAAGC, RVS Oligo:
AGAATTCTTCTTGTTGCGATCGTTCTG
Hairpin ID: TR02047P.1; FWD Oligo: AAGAATTCGCCAAATATGAGAGCCGAGA, RVS Oligo:
AGTCTAGATTGTGCATCTCCAAGCTCAC
Hairpin ID: TR00720A.1; FWD Oligo: GTCTAGACACTTGGGCGATCCTTTTTA, RVS Oligo:
AGAATTCTAAAGTCCTCCTCGGCTACG
Hairpin ID: TR00721A.1; FWD Oligo: GTCTAGAGATCAAGCGCTTTAACCAGG, RVS Oligo:
AGAATTCCGAGCTCTTGTCTTCCAACC
Hairpin ID: TR02498P.1; FWD Oligo: AAGAATTCTGCTCTACAAGGTGGACGTG, RVS Oligo:
AGTCTAGATTCAAACCGATCAGGAAAGG
Hairpin ID: TR00049A.1; FWD Oligo: GTCTAGACCAACCTGAACCGTCTGATT, RVS Oligo:
AGAATTCGCTGGTAGTTGATGCCAACC
Hairpin ID: TR02735P.1hm; FWD Oligo: AAGAATTCCTCGGCTCTTTAATTGCGTC, RVS Oligo:
AGTCTAGACGACGATCGAATACCGAAAT
Hairpin ID: TR02735P.1; FWD Oligo: AAGAATTCCTCGGCTCTTTAATTGCGTC, RVS Oligo:
AGTCTAGACGACGATCGAATACCGAAAT
Hairpin ID: TR00024A.1; FWD Oligo: GTCTAGAGTCTGAACCAGCCCATCATC, RVS Oligo:
AGAATTCATGGGCCAGTAGAACCACAG
Hairpin ID: TR00025A.1; FWD Oligo: GTCTAGAGCAGCTGTCTGAATCTGCAA, RVS Oligo:
AGAATTCAAGGTCAGGTGGTGGATCTG
Hairpin ID: TR01104P.1; FWD Oligo: AGTCTAGACCTATTCGAAATGGCTTGGA, RVS Oligo:
AAGAATTCGACGAAATGCTGGAAAGAGC
Hairpin ID: SH01284.N2; FWD Oligo:
ctagcagtCAACGAGGTTATTGTGGTCAAtagttatattcaagcataTTGACCACAATAACCTCGTTGgcg, RVS
Oligo: aattcgcCAACGAGGTTATTGTGGTCAAtatgcttgaatataactaTTGACCACAATAACCTCGTTGactg
Hairpin ID: TR02678P.1; FWD Oligo: AAGAATTCTTCGTTTTTGAGCCGTTTTT, RVS Oligo:
AGTCTAGATTGATGCAACTGATCGTGGT
Hairpin ID: TR00751A.1; FWD Oligo: GTCTAGACGCGTTGAAAACGAATGTAA, RVS Oligo:
AGAATTCAAAAGTGCCTCTTGGCGTAA
Hairpin ID: SH01362.N2; FWD Oligo:
ctagcagtTAGGTGCTACAGGAAATATTAtagttatattcaagcataTAATATTTCCTGTAGCACCTAgcg, RVS Oligo:
aattcgcTAGGTGCTACAGGAAATATTAtatgcttgaatataactaTAATATTTCCTGTAGCACCTAactg
Hairpin ID: TR04625P.1; FWD Oligo: AAGAATTCGGACGAAGTGGAGGATGTGT, RVS Oligo:
AGTCTAGACTAGCATGTGCTGCTTTCCA
Hairpin ID: SH00514.N; FWD Oligo:
ctagcagtTTCGATATATGTAAAGATTAAtagttatattcaagcataTTAATCTTTACATATATCGAAgcg, RVS Oligo:
aattcgcTTCGATATATGTAAAGATTAAtatgcttgaatataactaTTAATCTTTACATATATCGAAactg
Hairpin ID: TR01574A.1; FWD Oligo: AGTCTAGAGCTCCAAAAGAAGTTCGACG, RVS Oligo:
AAGAATTCATCTCCTTCTGCTTGGCGTA
Hairpin ID: TR00874P.1; FWD Oligo: AGTCTAGATAAACCCGCAATTGACAACA, RVS Oligo:
AAGAATTCAGCCTGAGTGTTCGTCTGGT
Hairpin ID: SH01662.N; FWD Oligo:
ctagcagtCTCGATGTAGCTAAAGAGCTAtagttatattcaagcataTAGCTCTTTAGCTACATCGAGgcg, RVS
Oligo: aattcgcCTCGATGTAGCTAAAGAGCTAtatgcttgaatataactaTAGCTCTTTAGCTACATCGAGactg
Hairpin ID: TR00816A.1; FWD Oligo: GTCTAGAATCAACGTGCACAAGCTCAA, RVS Oligo:
AGAATTCATCCACTGCTTGAGAACGCT
Hairpin ID: TR02594P.1; FWD Oligo: AAGAATTCGTACCGGTCCACAGGTGTTC, RVS Oligo:
AGTCTAGAGCGGAACTGTGTGCAATAAA
Hairpin ID: SH01663.N; FWD Oligo:
ctagcagtATGGATAGTTCCAATGACATAtagttatattcaagcataTATGTCATTGGAACTATCCATgcg, RVS Oligo:
aattcgcATGGATAGTTCCAATGACATAtatgcttgaatataactaTATGTCATTGGAACTATCCATactg
Hairpin ID: TR01588P.1; FWD Oligo: AAGAATTCTCAACGAGCTTGTGGAAGTG, RVS Oligo:
AGTCTAGAGGCGGTGGTAAGTGAGGTAA
Hairpin ID: TR04482P.1; FWD Oligo: AAGAATTCCAGTCTCCATCATTACGGCA, RVS Oligo:
AGTCTAGATAATGTTGGCCAAATCCAGG
Hairpin ID: SH01665.N; FWD Oligo:
ctagcagtCCGCTTCGATGTGCCCATCAAtagttatattcaagcataTTGATGGGCACATCGAAGCGGgcg, RVS
Oligo: aattcgcCCGCTTCGATGTGCCCATCAAtatgcttgaatataactaTTGATGGGCACATCGAAGCGGactg
Hairpin ID: SH00313.N; FWD Oligo:
ctagcagtTTGCATCGAAATGCAGATTAAtagttatattcaagcataTTAATCTGCATTTCGATGCAAgcg, RVS Oligo:
aattcgcTTGCATCGAAATGCAGATTAAtatgcttgaatataactaTTAATCTGCATTTCGATGCAAactg
Hairpin ID: TR02410P.1; FWD Oligo: AAGAATTCATCTACCTGCCGGAGGACTT, RVS Oligo:
AGTCTAGACTTGTGCAGCTTCGATTTCA
Hairpin ID: SH00407.N; FWD Oligo:
ctagcagtAAGCAAGTTGGTCCTGGACAAtagttatattcaagcataTTGTCCAGGACCAACTTGCTTgcg, RVS
Oligo: aattcgcAAGCAAGTTGGTCCTGGACAAtatgcttgaatataactaTTGTCCAGGACCAACTTGCTTactg
Hairpin ID: SH01849.N; FWD Oligo:
ctagcagtCAGAGTTAGAGAAGAAATCTAtagttatattcaagcataTAGATTTCTTCTCTAACTCTGgcg, RVS Oligo:
aattcgcCAGAGTTAGAGAAGAAATCTAtatgcttgaatataactaTAGATTTCTTCTCTAACTCTGactg
Hairpin ID: TR02511P.1; FWD Oligo: AAGAATTCATGCTACTGAAGCCGACCTG, RVS Oligo:
AGTCTAGAGCTGTGGCCGTATTTATGGT
Hairpin ID: TR01389P.1; FWD Oligo: AGTCTAGAGCCGTAACTCCTACCAACCA, RVS Oligo:
AAGAATTCTGCCGAAATTGACGGTAGAT
Hairpin ID: SH00752.N; FWD Oligo:
ctagcagtAAGCTGGAAGCTAATAACTAAtagttatattcaagcataTTAGTTATTAGCTTCCAGCTTgcg, RVS Oligo:
aattcgcAAGCTGGAAGCTAATAACTAAtatgcttgaatataactaTTAGTTATTAGCTTCCAGCTTactg
Hairpin ID: SH01754.N; FWD Oligo:
ctagcagtCAAGATCTATACTGTATCCAAtagttatattcaagcataTTGGATACAGTATAGATCTTGgcg, RVS Oligo:
aattcgcCAAGATCTATACTGTATCCAAtatgcttgaatataactaTTGGATACAGTATAGATCTTGactg
Hairpin ID: SH00443.N; FWD Oligo:
ctagcagtCAGAGTGTTGTCAGCCGACTAtagttatattcaagcataTAGTCGGCTGACAACACTCTGgcg, RVS
Oligo: aattcgcCAGAGTGTTGTCAGCCGACTAtatgcttgaatataactaTAGTCGGCTGACAACACTCTGactg
Hairpin ID: TR00553A.1; FWD Oligo: GTCTAGATATTAAGCGGAATTGGGCAG, RVS Oligo:
AGAATTCGCAAATCTTGGGAGTTGAGC
Hairpin ID: TR00856P.1; FWD Oligo: AGTCTAGACATTACCGCTGGCGTTTTAT, RVS Oligo:
AAGAATTCAGCACAGCACTGGGATTTCT
Hairpin ID: SH00470.N; FWD Oligo:
ctagcagtCAGAGAGTATCTTTACCTTAAtagttatattcaagcataTTAAGGTAAAGATACTCTCTGgcg, RVS Oligo:
aattcgcCAGAGAGTATCTTTACCTTAAtatgcttgaatataactaTTAAGGTAAAGATACTCTCTGactg
Hairpin ID: TR02049P.1; FWD Oligo: AAGAATTCGCAACCACAGCCATTCACTA, RVS Oligo:
AGTCTAGACAGATCGGGTGCTATGGTTT
Hairpin ID: TR01927P.1; FWD Oligo: CACCGAATTCACGTCCACGATTCGATAAGG, RVS Oligo:
CTGTGGTCGGGAGAGGATTA
Hairpin ID: TR01392P.1; FWD Oligo: AGTCTAGACCCGTCATCGTAAGGAGATG, RVS Oligo:
AAGAATTCTCATCTAAATCCTCACCGCC
Hairpin ID: TR00709A.2; FWD Oligo: AAGAATTCGAGCTCTTTGGGTGAACTGC, RVS Oligo:
AGTCTAGATGTTGTGGTGTCATCGGATT
Hairpin ID: TR00709A.1; FWD Oligo: GTCTAGAGAGCTCTTTGGGTGAACTGC, RVS Oligo:
AGAATTCTGTTGTGGTGTCATCGGATT
Hairpin ID: TR00710A.1; FWD Oligo: GTCTAGAAGCAGCCTTCATCGACATCT, RVS Oligo:
AGAATTCGTGTGGCTTTTCACCGGTAT
Hairpin ID: TR00709P.1; FWD Oligo: CACCGAGCTCTTTGGGTGAACTGC, RVS Oligo:
TGTTGTGGTGTCATCGGATT
Hairpin ID: TR00539A.1; FWD Oligo: GTCTAGAACCTTACGGACCGAGTGATG, RVS Oligo:
AGAATTCTAATACTCGGTGGCGGGTAG
Hairpin ID: SH00372.N; FWD Oligo:
ctagcagtCAGAAAGTTAGTATTGGATAAtagttatattcaagcataTTATCCAATACTAACTTTCTGgcg, RVS Oligo:
aattcgcCAGAAAGTTAGTATTGGATAAtatgcttgaatataactaTTATCCAATACTAACTTTCTGactg
Hairpin ID: TR02483P.1; FWD Oligo: AAGAATTCGTTATCCTGCCGCTCTTCTG, RVS Oligo:
AGTCTAGATGAGGCCTCCAGTCTTCAGT
Hairpin ID: SH00938.N; FWD Oligo:
ctagcagtCAGCGATCGATGAGTTCAATAtagttatattcaagcataTATTGAACTCATCGATCGCTGgcg, RVS
Oligo: aattcgcCAGCGATCGATGAGTTCAATAtatgcttgaatataactaTATTGAACTCATCGATCGCTGactg
Hairpin ID: SH00776.N; FWD Oligo:
ctagcagtCTGGTACAATATTATAACAAAtagttatattcaagcataTTTGTTATAATATTGTACCAGgcg, RVS Oligo:
aattcgcCTGGTACAATATTATAACAAAtatgcttgaatataactaTTTGTTATAATATTGTACCAGactg
Hairpin ID: SH01755.N; FWD Oligo:
ctagcagtCAAGTAGAGGATAGACAACTAtagttatattcaagcataTAGTTGTCTATCCTCTACTTGgcg, RVS
Oligo: aattcgcCAAGTAGAGGATAGACAACTAtatgcttgaatataactaTAGTTGTCTATCCTCTACTTGactg
Hairpin ID: SH00723.N; FWD Oligo:
ctagcagtATAGTTGTAAATATTAGTAAAtagttatattcaagcataTTTACTAATATTTACAACTATgcg, RVS Oligo:
aattcgcATAGTTGTAAATATTAGTAAAtatgcttgaatataactaTTTACTAATATTTACAACTATactg
Hairpin ID: TR02317P.1; FWD Oligo: CACCGAATTCGGAGGCAACTGGAAGATGAA, RVS Oligo:
CTTGATCTTCTGGGCGTAGG
Hairpin ID: SH00543.N; FWD Oligo:
ctagcagtCAAGGTGTTCGTCAACAACAAtagttatattcaagcataTTGTTGTTGACGAACACCTTGgcg, RVS
Oligo: aattcgcCAAGGTGTTCGTCAACAACAAtatgcttgaatataactaTTGTTGTTGACGAACACCTTGactg
Hairpin ID: TR00068A.1; FWD Oligo: GTCTAGAGCTGTATTCGTTAGCCCTGC, RVS Oligo:
AGAATTCTTTGTTCGTTTGGGTGGTTT
Hairpin ID: TR00069A.1; FWD Oligo: GTCTAGACCGATCAACTTCACCCAGTT, RVS Oligo:
AGAATTCCGCTACCAAATGTTGCTGAA
Hairpin ID: SH01756.N; FWD Oligo:
ctagcagtCACGATTGATAAGAATATTTAtagttatattcaagcataTAAATATTCTTATCAATCGTGgcg, RVS Oligo:
aattcgcCACGATTGATAAGAATATTTAtatgcttgaatataactaTAAATATTCTTATCAATCGTGactg
Hairpin ID: TR01067P.1; FWD Oligo: AGTCTAGATTATGAAGACAACGGGAGCC, RVS Oligo:
AAGAATTCTGCGGTCATCGAATAGTGTC
Hairpin ID: SH00657.N; FWD Oligo:
ctagcagtCACGGAGAAGGTGACCAAGAAtagttatattcaagcataTTCTTGGTCACCTTCTCCGTGgcg, RVS
Oligo: aattcgcCACGGAGAAGGTGACCAAGAAtatgcttgaatataactaTTCTTGGTCACCTTCTCCGTGactg
Hairpin ID: TR01393P.1; FWD Oligo: AGTCTAGAAAAGAGGCTAAGTCAGGGGC, RVS Oligo:
AAGAATTCTCTTCATGTGCTCCTGCATC
Hairpin ID: TR01395P.1; FWD Oligo: AGTCTAGAGTTCCTACTGCTCGCTGGTC, RVS Oligo:
AAGAATTCTGGGATTCGTATTGCACTGA
Hairpin ID: TR01606P.1; FWD Oligo: AGTCTAGAGACGATTTGGATCGGTTAGG, RVS Oligo:
AAGAATTCTGTATTCGGGGAAGCAAATC
Hairpin ID: SH02047.N; FWD Oligo:
ctagcagtCAGGCTCAATTTGAAGCGAAAtagttatattcaagcataTTTCGCTTCAAATTGAGCCTGgcg, RVS
Oligo: aattcgcCAGGCTCAATTTGAAGCGAAAtatgcttgaatataactaTTTCGCTTCAAATTGAGCCTGactg
Hairpin ID: TR02721P.1; FWD Oligo: AAGAATTCAAACACAAACCGGTCAGGAG, RVS Oligo:
AGTCTAGAGCGAAGGAGTCTCAATTTCG
Hairpin ID: SH00743.N; FWD Oligo:
ctagcagtCTGCTCAATAACAACAAGAAAtagttatattcaagcataTTTCTTGTTGTTATTGAGCAGgcg, RVS Oligo:
aattcgcCTGCTCAATAACAACAAGAAAtatgcttgaatataactaTTTCTTGTTGTTATTGAGCAGactg
Hairpin ID: SH00967.N; FWD Oligo:
ctagcagtATGGTGCGACAAATACCTCAAtagttatattcaagcataTTGAGGTATTTGTCGCACCATgcg, RVS
Oligo: aattcgcATGGTGCGACAAATACCTCAAtatgcttgaatataactaTTGAGGTATTTGTCGCACCATactg
Hairpin ID: TR02595P.1; FWD Oligo: AAGAATTCATACCAAAGCCACCACGTTC, RVS Oligo:
AGTCTAGACATACAACTCGTAGCTGCCG
Hairpin ID: SH01733.N; FWD Oligo:
ctagcagtAAGCACGAGTACTCTATTGAAtagttatattcaagcataTTCAATAGAGTACTCGTGCTTgcg, RVS
Oligo: aattcgcAAGCACGAGTACTCTATTGAAtatgcttgaatataactaTTCAATAGAGTACTCGTGCTTactg
Hairpin ID: TR00805A.1; FWD Oligo: GTCTAGAGATACCACCAAGAAGCAGGC, RVS Oligo:
AGAATTCTTTCCAGTGACCGTTAAGGC
Hairpin ID: TR00450P.1; FWD Oligo: GTCTAGACGGTCACACTGCAGTACACA, RVS Oligo:
AGAATTCAAAGGCATTGGTCGTGTAGC
Hairpin ID: TR00564A.1; FWD Oligo: GTCTAGACCACAGCAACTTCTCGATCA, RVS Oligo:
AGAATTCCTGTCTCAAATCGGGCAAAT
Hairpin ID: TR01197P.1; FWD Oligo: AGTCTAGAGAGTGTGCTTAGTGTGGGCA, RVS Oligo:
AAGAATTCGGGCTCTGTACGAAAATGGA
Hairpin ID: TR00327A.1; FWD Oligo: GTCTAGAACTCACCGGATCTGTCATCC, RVS Oligo:
AGAATTCCTAGCCAGGTCGACGTTCTC
Hairpin ID: SH01026.N; FWD Oligo:
ctagcagtCTGATCTAAACTAATAACTAAtagttatattcaagcataTTAGTTATTAGTTTAGATCAGgcg, RVS Oligo:
aattcgcCTGATCTAAACTAATAACTAAtatgcttgaatataactaTTAGTTATTAGTTTAGATCAGactg
Hairpin ID: TR02357P.1; FWD Oligo: AAGAATTCGCACCTACGTGGAGAAGCTC, RVS Oligo:
AGTCTAGAAATACCGGCAATCTGTCCAC
Hairpin ID: SH01027.N; FWD Oligo:
ctagcagtCAAGGTGCTGTTCCTGTTGAAtagttatattcaagcataTTCAACAGGAACAGCACCTTGgcg, RVS
Oligo: aattcgcCAAGGTGCTGTTCCTGTTGAAtatgcttgaatataactaTTCAACAGGAACAGCACCTTGactg
Hairpin ID: TR02670P.1; FWD Oligo: AAGAATTCCCTCTGCCTCCGACTACAAG, RVS Oligo:
AGACTAGTATTTCAACTCGAAAATGCCG
Hairpin ID: TR01928P.1; FWD Oligo: CACCGAATTCGCTGAACATTCACTTCCGGT, RVS Oligo:
GTGGTCGAGGTCTGTTGGTT
Hairpin ID: TR02446P.1; FWD Oligo: AAGAATTCCTCATATGCATCATCCGCAC, RVS Oligo:
AGTCTAGAGGCTTACGCCTCAGTCTTGT
Hairpin ID: SH00736.N; FWD Oligo:
ctagcagtTCCGATATATGAGTTTCTATAtagttatattcaagcataTATAGAAACTCATATATCGGAgcg, RVS Oligo:
aattcgcTCCGATATATGAGTTTCTATAtatgcttgaatataactaTATAGAAACTCATATATCGGAactg
Hairpin ID: TR02724P.1; FWD Oligo: AAGAATTCCTTCTTCGACGAGCTGGACT, RVS Oligo:
AGTCTAGACATCGCGGAGTTCTGATTTT
Hairpin ID: TR01702P.1; FWD Oligo: CACCGAATTCATCGATACGCCCAACTATGC, RVS Oligo:
AAGTCCTGCTTTGGATCCCT
Hairpin ID: TR00758P.1; FWD Oligo: GACTAGTAAGCGCAAGAAAGCCAATAA, RVS Oligo:
AGAATTCGGTCGCGAGACCAAAATAAA
Hairpin ID: TR02051P.1; FWD Oligo: CACCGAATTCGTCTTCCTGCTGATCTTGGC, RVS Oligo:
TGACTGTCCTTTGCATTTGG
Hairpin ID: TR01195P.1; FWD Oligo: AGTCTAGACTCTCAAACCCCGATCAAAA, RVS Oligo:
AAGAATTCAAGAAAACACGCCAGTTGCT
Hairpin ID: TR02052P.1; FWD Oligo: CACCGAATTCCCTGGAGATGGGACTACGAA, RVS Oligo:
AAAATTGAGTTCGACGGGTG
Hairpin ID: TR02675P.1; FWD Oligo: AAGAATTCACCGAATACGTGAGTCGTCC, RVS Oligo:
AGTCTAGAGGAGATGTGCAGATGGGAGT
Hairpin ID: SH00209.N; FWD Oligo:
ctagcagtCTGCATGAAGAAGTTCTACAAtagttatattcaagcataTTGTAGAACTTCTTCATGCAGgcg, RVS
Oligo: aattcgcCTGCATGAAGAAGTTCTACAAtatgcttgaatataactaTTGTAGAACTTCTTCATGCAGactg
Hairpin ID: TR01625A.1; FWD Oligo: AGTCTAGACTTTCCAGTGGGTGCAAAAT, RVS Oligo:
AAGAATTCGTGGCGCTCTCATTGGTAAT
Hairpin ID: TR00243A.1; FWD Oligo: GTCTAGACACGAGTTCATGGAGCTGAA, RVS Oligo:
AGAATTCTTGTAAGCGTAATAGGCGGC
Hairpin ID: TR02053P.1; FWD Oligo: CACCGAATTCCCAAGTGCTTGCACACCTTA, RVS Oligo:
CGCGCTGTAGGAAAACTTCT
Hairpin ID: TR00309A.1; FWD Oligo: GTCTAGAGGCTACATTTGCCAGGACAT, RVS Oligo:
AGAATTCATCTCCTCATCGCAGACGTT
Hairpin ID: TR00309P.1; FWD Oligo: AAGAATTCGGCTACATTTGCCAGGACAT, RVS Oligo:
AGTCTAGAATCTCCTCATCGCAGACGTT
Hairpin ID: TR02526P.1; FWD Oligo: AAGAATTCTCAAGCACTTTTGCTGTTGG, RVS Oligo:
AGTCTAGAACAATCGGCACCTCAAAGTC
Hairpin ID: TR00624A.1; FWD Oligo: GTCTAGACTATCCGTCACCATTGTCCC, RVS Oligo:
AGAATTCATCACGCAGAAGGTGCTCTT
Hairpin ID: TR00625A.1; FWD Oligo: GTCTAGAAAGATATCGGAGGAGGCACA, RVS Oligo:
AGAATTCTATGTTACTGGCGGTGGTGA
Hairpin ID: TR00916P.1; FWD Oligo: AGTCTAGAAAATGGAGCCGAACAACAAC, RVS Oligo:
AAGAATTCCTTATTCTACGTCCTGCGCC
Hairpin ID: SH01835.N; FWD Oligo:
ctagcagtCAGATGCAGAATCAATAGTTAtagttatattcaagcataTAACTATTGATTCTGCATCTGgcg, RVS Oligo:
aattcgcCAGATGCAGAATCAATAGTTAtatgcttgaatataactaTAACTATTGATTCTGCATCTGactg
Hairpin ID: TR01649A.1; FWD Oligo: AGTCTAGATGCCAAGTTCACGCTAGTTG, RVS Oligo:
AAGAATTCACCAGCAGCTGATTAAGCGT
Hairpin ID: TR01650A.1; FWD Oligo: AGTCTAGAAAGGAAACGCTGGACTACGA, RVS Oligo:
AAGAATTCCATAACAATTTGTGTGCCGC
Hairpin ID: TR00028A.1; FWD Oligo: GTCTAGATCGGTTTTCCTTCTGCATTT, RVS Oligo:
AGAATTCTGAACGCGTGGACTTAGTTG
Hairpin ID: TR00027A.1; FWD Oligo: GTCTAGAAAATTTTGGGACTGCACTGG, RVS Oligo:
AGAATTCACGTTCCGTCGTAGGAATTG
Hairpin ID: TR02495P.1; FWD Oligo: AAGAATTCTGCCAACTCTTATGGGCTTT, RVS Oligo:
AGTCTAGATCTGCGCATACCGGTAAAAT
Hairpin ID: TR02512P.1; FWD Oligo: AAGAATTCCCAGCGAAACGGGATTATTA, RVS Oligo:
AGTCTAGAATCGCTTTTGAGCTGCATTT
Hairpin ID: TR02640P.1; FWD Oligo: AAGAATTCAAGGTGTTGAACGTAACGGG, RVS Oligo:
AGTCTAGATGCATGTAACGGAACCTCTG
Hairpin ID: TR02488P.1; FWD Oligo: AAGAATTCTCCAACTCAGCTTCGCCTAT, RVS Oligo:
AGTCTAGAATCAGAGGTCCCACAGATGG
Hairpin ID: TR02402P.1; FWD Oligo: AAGAATTCAGCTCAATGACTATGCCGCT, RVS Oligo:
AGTCTAGACCCCGATGTACTAGGCTGAA
Hairpin ID: SH01254.N2; FWD Oligo:
ctagcagtCAGCTGCGATAAGATCTTCAAtagttatattcaagcataTTGAAGATCTTATCGCAGCTGgcg, RVS
Oligo: aattcgcCAGCTGCGATAAGATCTTCAAtatgcttgaatataactaTTGAAGATCTTATCGCAGCTGactg
Hairpin ID: SH01255.N2; FWD Oligo:
ctagcagtAAGGAGCAAGAGATAAATTTAtagttatattcaagcataTAAATTTATCTCTTGCTCCTTgcg, RVS Oligo:
aattcgcAAGGAGCAAGAGATAAATTTAtatgcttgaatataactaTAAATTTATCTCTTGCTCCTTactg
Hairpin ID: TR00480A.1; FWD Oligo: GTCTAGACGAAGATGAGGACTTCCTGG, RVS Oligo:
AGAATTCTGTGGCTTATCTTGTGCTGG
Hairpin ID: TR00749A.1; FWD Oligo: GTCTAGACTGGATCCCTCAATGTGCTT, RVS Oligo:
AGAATTCCCAAAGAACCGGTTACAGGA
Hairpin ID: TR00640A.1; FWD Oligo: GTCTAGAGCTTTGATAGCAGGTTTCGC, RVS Oligo:
ACAATTGTCATCCACATTCGAGCCATA
Hairpin ID: TR00641A.1; FWD Oligo: GTCTAGACGAGATGGATGAGCTTCACA, RVS Oligo:
AGAATTCTCTGCTCCATTACCAGGGTC
Hairpin ID: SH00862.N; FWD Oligo:
ctagcagtCACGGATATCACGTTCTATAAtagttatattcaagcataTTATAGAACGTGATATCCGTGgcg, RVS
Oligo: aattcgcCACGGATATCACGTTCTATAAtatgcttgaatataactaTTATAGAACGTGATATCCGTGactg
Hairpin ID: SH00863.N; FWD Oligo:
ctagcagtAACGACGATAACTACCATTAAtagttatattcaagcataTTAATGGTAGTTATCGTCGTTgcg, RVS Oligo:
aattcgcAACGACGATAACTACCATTAAtatgcttgaatataactaTTAATGGTAGTTATCGTCGTTactg
Hairpin ID: TR00778P.1; FWD Oligo: AAGAATTCATGTCAGGTTTCCTTCGTGG, RVS Oligo:
AGTCTAGAACCAATACGGCACAGGTAGC
Hairpin ID: TR01674P.1; FWD Oligo: CACCGCTGCCAGTTTTTATGAGGG, RVS Oligo:
GTTCGACGATGTGCAGCTAA
Hairpin ID: TR01674A.1; FWD Oligo: AGTCTAGAGCTGCCAGTTTTTATGAGGG, RVS Oligo:
AAGAATTCGTTCGACGATGTGCAGCTAA
Hairpin ID: TR01675A.1; FWD Oligo: AGTCTAGAATGTCCAGCAGGATGACCTC, RVS Oligo:
AAGAATTCAAGAAAGCTACCCTGCCCTC
Hairpin ID: TR01675P.1; FWD Oligo: CACCATGTCCAGCAGGATGACCTC, RVS Oligo:
AAGAAAGCTACCCTGCCCTC
Hairpin ID: SH00017.N; FWD Oligo:
ctagcagtCAGGAGCTTTCGCTCAGCAAAtagttatattcaagcataTTTGCTGAGCGAAAGCTCCTGgcg, RVS
Oligo: aattcgcCAGGAGCTTTCGCTCAGCAAAtatgcttgaatataactaTTTGCTGAGCGAAAGCTCCTGactg
Hairpin ID: SH00018.B; FWD Oligo:
ctagcagtCAGCGTCGTCCAGGTGCTGTAtagttatattcaagcataTTCAGCACCTGGACGACGCTGgcg, RVS
Oligo: aattcgcCAGCGTCGTCCAGGTGCTGAAtatgcttgaatataactaTACAGCACCTGGACGACGCTGactg
Hairpin ID: SH00018.N; FWD Oligo:
ctagcagtCAGCGTCGTCCAGGTGCTGAAtagttatattcaagcataTTCAGCACCTGGACGACGCTGgcg, RVS
Oligo: aattcgcCAGCGTCGTCCAGGTGCTGAAtatgcttgaatataactaTTCAGCACCTGGACGACGCTGactg
Hairpin ID: SH00017.P; FWD Oligo:
ctagcagtTTTGCTGAGCgAAAGCTCCGGtagttatattcaagcataCAGGAGCTTTCGCTCAGCAAAgcg, RVS
Oligo: aattcgcTTTGCTGAGCGAAAGCTCCTGtatgcttgaatataactaCCGGAGCTTTcGCTCAGCAAAactg
Hairpin ID: SH00017.Vp; FWD Oligo:
ctagcagtCAGGAGCTTTCGCTCAGCAAAtagttatattcaagcataTTTGCTGAGCGAAAGCTCCTGgcg, RVS
Oligo: aattcgcCAGGAGCTTTCGCTCAGCAAAtatgcttgaatataactaTTTGCTGAGCGAAAGCTCCTGactg
Hairpin ID: SH00017.N2; FWD Oligo:
ctagcagtCAGGAGCTTTCGCTCAGCAAAtagttatattcaagcataTTTGCTGAGCGAAAGCTCCTGgcg, RVS
Oligo: aattcgcCAGGAGCTTTCGCTCAGCAAAtatgcttgaatataactaTTTGCTGAGCGAAAGCTCCTGactg
Hairpin ID: TR04626P.1; FWD Oligo: AAGAATTCACACTTCCCTGGACAACCTG, RVS Oligo:
AGTCTAGAAGTTGTGGTAGATGCCCCTG
Hairpin ID: SH00608.N; FWD Oligo:
ctagcagtATCGATAGAAGTAGATATATAtagttatattcaagcataTATATATCTACTTCTATCGATgcg, RVS Oligo:
aattcgcATCGATAGAAGTAGATATATAtatgcttgaatataactaTATATATCTACTTCTATCGATactg
Hairpin ID: TR04484P.1; FWD Oligo: AAGAATTCTATGGCGGTTGAACAACAAA, RVS Oligo:
AGTCTAGAGGCAATGTAGCCAAAGGTGT
Hairpin ID: SH00211.N; FWD Oligo:
ctagcagtCACGACGTGCTTGCTACACTAtagttatattcaagcataTAGTGTAGCAAGCACGTCGTGgcg, RVS
Oligo: aattcgcCACGACGTGCTTGCTACACTAtatgcttgaatataactaTAGTGTAGCAAGCACGTCGTGactg
Hairpin ID: TR01110P.1; FWD Oligo: AGTCTAGACTGACATCGCTTAGCCATCA, RVS Oligo:
AAGAATTCCTTCATTGTGCCTTTGTCCA
Hairpin ID: TR01781P.1; FWD Oligo: CACCGAATTCAACTCCCCGGAAAGAAAGAA, RVS Oligo:
CCTGTTTTCCGAGTCCATGT
Hairpin ID: SH00380.N; FWD Oligo:
ctagcagtAACGAAGAATATTACATGAAAtagttatattcaagcataTTTCATGTAATATTCTTCGTTgcg, RVS Oligo:
aattcgcAACGAAGAATATTACATGAAAtatgcttgaatataactaTTTCATGTAATATTCTTCGTTactg
Hairpin ID: TR01900P.1; FWD Oligo: CACCGAATTCCTGAGATCGGAGATCGGAGA, RVS Oligo:
TCCGAGTCAGAAAATCCGTC
Hairpin ID: TR00984P.1; FWD Oligo: AGTCTAGATGGTGAGAAAGCAAGCAATG, RVS Oligo:
AAGAATTCAGTGCAGCTGAAAGACGGAT
Hairpin ID: TR02054P.1; FWD Oligo: AACAATTGATCATGAGCAAGAAGCCGAC, RVS Oligo:
AGTCTAGATGCGCTTATCATTCAGATCG
Hairpin ID: SH01363.N2; FWD Oligo:
ctagcagtTAGATTTAGTTAAGCTCTAAAtagttatattcaagcataTTTAGAGCTTAACTAAATCTAgcg, RVS Oligo:
aattcgcTAGATTTAGTTAAGCTCTAAAtatgcttgaatataactaTTTAGAGCTTAACTAAATCTAactg
Hairpin ID: TR00483A.1; FWD Oligo: GTCTAGAGGTAACCTTTGTTCGTCGGA, RVS Oligo:
AGAATTCATTGATGATGTGACTGGGCA
Hairpin ID: TR01929P.1; FWD Oligo: CACCGAATTCCTTTTGTTGGCCACGCTAAT, RVS Oligo:
TGGCACGTAACCACAATCAT
Hairpin ID: TR00992P.1; FWD Oligo: AGTCTAGAGCAGTGTTCGGTTGCTGTAA, RVS Oligo:
AAGAATTCTTTGACGATGCAGTTTCTCG
Hairpin ID: SH00503.N; FWD Oligo:
ctagcagtAACGATGGGCATAGATGTCAAtagttatattcaagcataTTGACATCTATGCCCATCGTTgcg, RVS
Oligo: aattcgcAACGATGGGCATAGATGTCAAtatgcttgaatataactaTTGACATCTATGCCCATCGTTactg
Hairpin ID: TR02056P.1; FWD Oligo: CACCGAATTCGGAAGAGGTCGTCGAGTCTG, RVS Oligo:
CTTCTCGACTGACTCCTGGG
Hairpin ID: TR01782P.1; FWD Oligo: AAGAATTCTAACAAAGAGCAGGCCAAGG, RVS Oligo:
AGTCTAGAAAGCGATCCGATCCAAACTA
Hairpin ID: TR01930P.1; FWD Oligo: CACCGAATTCAGTACAACGTGGGGCTGAAC, RVS Oligo:
ATAACAGGACCAACGACGGA
Hairpin ID: TR02057P.1hm; FWD Oligo: CACCGAATTCGCTCCACCTTTCCCCTACAT, RVS Oligo:
GGACTTGATTGTTGGCGATT
Hairpin ID: TR02057P.1 ; FWD Oligo: CACCGAATTCGCTCCACCTTTCCCCTACAT, RVS Oligo:
GGACTTGATTGTTGGCGATT
Hairpin ID: SH00996.N; FWD Oligo:
ctagcagtTGCGATGAAATCAACCAGAAAtagttatattcaagcataTTTCTGGTTGATTTCATCGCAgcg, RVS
Oligo: aattcgcTGCGATGAAATCAACCAGAAAtatgcttgaatataactaTTTCTGGTTGATTTCATCGCAactg
Hairpin ID: SH00997.N; FWD Oligo:
ctagcagtTGCGATGAAATCAACCAGAAAtagttatattcaagcataTTTCTGGTTGATTTCATCGCAgcg, RVS
Oligo: aattcgcTGCGATGAAATCAACCAGAAAtatgcttgaatataactaTTTCTGGTTGATTTCATCGCAactg
Hairpin ID: SH00451.N; FWD Oligo:
ctagcagtCCGCGACTTAATAGTAAACTAtagttatattcaagcataTAGTTTACTATTAAGTCGCGGgcg, RVS
Oligo: aattcgcCCGCGACTTAATAGTAAACTAtatgcttgaatataactaTAGTTTACTATTAAGTCGCGGactg
Hairpin ID: TR02742P.1; FWD Oligo: AAGAATTCACGTTGTGGAATAAGGCGAC, RVS Oligo:
AGTCTAGACACTGAAGTGCGACCAGTGT
Hairpin ID: TR01541A.1; FWD Oligo: AGTCTAGAAGAGCTCAAGATCCAGCGAG, RVS Oligo:
AAGAATTCCTCGTTTTCTATGTGCACCG
Hairpin ID: SH00460.N; FWD Oligo:
ctagcagtCTGGAACAAGCAAATATGCAAtagttatattcaagcataTTGCATATTTGCTTGTTCCAGgcg, RVS
Oligo: aattcgcCTGGAACAAGCAAATATGCAAtatgcttgaatataactaTTGCATATTTGCTTGTTCCAGactg
Hairpin ID: TR01726P.1; FWD Oligo: CACCGAATTCGACTTTTTCCCACCGAACAA, RVS Oligo:
CTTGTACCAGCGCAAGATGA
Hairpin ID: SH00453.N; FWD Oligo:
ctagcagtACGATTCATGATTAGAATCAAtagttatattcaagcataTTGATTCTAATCATGAATCGTgcg, RVS Oligo:
aattcgcACGATTCATGATTAGAATCAAtatgcttgaatataactaTTGATTCTAATCATGAATCGTactg
Hairpin ID: SH00212.N; FWD Oligo:
ctagcagtCAGGAGCAGATGTAAGAGCAAtagttatattcaagcataTTGCTCTTACATCTGCTCCTGgcg, RVS
Oligo: aattcgcCAGGAGCAGATGTAAGAGCAAtatgcttgaatataactaTTGCTCTTACATCTGCTCCTGactg
Hairpin ID: TR01294P.1; FWD Oligo: AGTCTAGAGGCATCATCACATTGGACAG, RVS Oligo:
AAGAATTCGCTTGGCGTAGATCTTTTCG
Hairpin ID: SH01863.N; FWD Oligo:
ctagcagtCCCGTCCAATATCGAACTATAtagttatattcaagcataTATAGTTCGATATTGGACGGGgcg, RVS
Oligo: aattcgcCCCGTCCAATATCGAACTATAtatgcttgaatataactaTATAGTTCGATATTGGACGGGactg
Hairpin ID: SH01757.N; FWD Oligo:
ctagcagtCGGCGAGATACTATTGATATAtagttatattcaagcataTATATCAATAGTATCTCGCCGgcg, RVS
Oligo: aattcgcCGGCGAGATACTATTGATATAtatgcttgaatataactaTATATCAATAGTATCTCGCCGactg
Hairpin ID: TR02058P.1hm; FWD Oligo: CACCGAATTCGAATGCCCACAACTCTCCAT, RVS Oligo:
CATCCTTGATGGAAGCCCTA
Hairpin ID: TR02058P.1; FWD Oligo: CACCGAATTCGAATGCCCACAACTCTCCAT, RVS Oligo:
CATCCTTGATGGAAGCCCTA
Hairpin ID: SH00641.N; FWD Oligo:
ctagcagtCAGAAGTTGGACAGACATATAtagttatattcaagcataTATATGTCTGTCCAACTTCTGgcg, RVS
Oligo: aattcgcCAGAAGTTGGACAGACATATAtatgcttgaatataactaTATATGTCTGTCCAACTTCTGactg
Hairpin ID: SH00866.N; FWD Oligo:
ctagcagtAAAGAAGTTAACAACCAATTAtagttatattcaagcataTAATTGGTTGTTAACTTCTTTgcg, RVS Oligo:
aattcgcAAAGAAGTTAACAACCAATTAtatgcttgaatataactaTAATTGGTTGTTAACTTCTTTactg
Hairpin ID: SH00867.N; FWD Oligo:
ctagcagtTGCGGTGAAGAAGATGGACTAtagttatattcaagcataTAGTCCATCTTCTTCACCGCAgcg, RVS
Oligo: aattcgcTGCGGTGAAGAAGATGGACTAtatgcttgaatataactaTAGTCCATCTTCTTCACCGCAactg
Hairpin ID: TR00957P.1; FWD Oligo: AGTCTAGACCCAGATGCACTTCCAAAAC, RVS Oligo:
AAGAATTCTTTGAGGGTCTGGATCTTGC
Hairpin ID: TR02527P.1; FWD Oligo: AAGAATTCGCAGATTGTCAAGGTGGTGA, RVS Oligo:
AGTCTAGACAGGTAGGAAGCGACTGGAG
Hairpin ID: TR02059P.1; FWD Oligo: CACCGAATTCTTGTCCTGTTCTTCCAGGCT, RVS Oligo:
GCACTTGGTAATCTTCGGGA
Hairpin ID: TR02303P.1; FWD Oligo: CACCGAATTCTCCACAGAAGACACATAGCCC, RVS Oligo:
AGCCATCATAGCTTCAGCGT
Hairpin ID: SH00824.N; FWD Oligo:
ctagcagtAAGCGAGTTGCTGTTGATAATtagttatattcaagcataATTATCAACAGCAACTCGCTTgcg, RVS
Oligo: aattcgcAAGCGAGTTGCTGTTGATAATtatgcttgaatataactaATTATCAACAGCAACTCGCTTactg
Hairpin ID: TR01545A.1; FWD Oligo: AGTCTAGAGTGTTCGGAACCGAGATGAT, RVS Oligo:
AAGAATTCGAGGTGCTTCCTGAAGTTCG
Hairpin ID: TR02421P.1; FWD Oligo: AAGAATTCCACAAGTCTTGACAACCCGA, RVS Oligo:
AGTCTAGACCTGGGATCAAGGTGAGTGT
Hairpin ID: TR00532A.1; FWD Oligo: GTCTAGACCCAAGCGTTCAAAAAGAAG, RVS Oligo:
AGAATTCTGCTTCAGGTGCTTTTCCTT
Hairpin ID: TR00862P.1; FWD Oligo: AGTCTAGACGAACCACATACAAAATGCG, RVS Oligo:
AAGAATTCCAGCTAATGTCGCTGCTCCT
Hairpin ID: SH00359.N; FWD Oligo:
ctagcagtACAGTTAATTGTAGACAGCTAtagttatattcaagcataTAGCTGTCTACAATTAACTGTgcg, RVS Oligo:
aattcgcACAGTTAATTGTAGACAGCTAtatgcttgaatataactaTAGCTGTCTACAATTAACTGTactg
Hairpin ID: SH00536.N; FWD Oligo:
ctagcagtCTGCATATTCGTTATAAACAAtagttatattcaagcataTTGTTTATAACGAATATGCAGgcg, RVS Oligo:
aattcgcCTGCATATTCGTTATAAACAAtatgcttgaatataactaTTGTTTATAACGAATATGCAGactg
Hairpin ID: TR02060P.1; FWD Oligo: CACCGAATTCTACAGCTGGTACCCCAGGAC, RVS Oligo:
GACCGCATTAAGGTTCGTGT
Hairpin ID: TR01003P.1; FWD Oligo: AGTCTAGAAGTGCAAGCCAGAGCAAAAT, RVS Oligo:
AAGAATTCCTGAATTGGTTAGCCCGTGT
Hairpin ID: TR01397P.1; FWD Oligo: AGTCTAGACGTGATAAATTCTGGCGCTT, RVS Oligo:
AAGAATTCCATAGTTTCCGGCACAGGAT
Hairpin ID: TR01635A.1; FWD Oligo: AGTCTAGAGGTACCTGAGCTCGTTTGGA, RVS Oligo:
AAGAATTCCCGGTAAAGACACAACCCTG
Hairpin ID: TR01634A.1; FWD Oligo: AGTCTAGATGTGCCGTGATGTTTTCATT, RVS Oligo:
AAGAATTCCCGGATGTTACTGACCAAGG
Hairpin ID: TR02074P.1; FWD Oligo: CACCGAATTCAGATTGAACACCTTCGGACG, RVS Oligo:
ATGTCCAGGCTGATGATTCC
Hairpin ID: TR02596P.1; FWD Oligo: AAGAATTCAGTTGGAGCGACTGCTCTTC, RVS Oligo:
AGTCTAGAGGACTATCCATGTCGGTGCT
Hairpin ID: TR04628P.1; FWD Oligo: AAGAATTCCAACGAAACCATCAACACCA, RVS Oligo:
AGTCTAGACAGGATTAAAGGTGGCCAGA
Hairpin ID: TR04541P.1; FWD Oligo: AAGAATTCGATATCGACATCAAACCGGG, RVS Oligo:
AGTCTAGACCGAGACGAGGTATGTTGGT
Hairpin ID: SH01667.N; FWD Oligo:
ctagcagtCAGCTCGGTTCTGCAGGGAAAtagttatattcaagcataTTTCCCTGCAGAACCGAGCTGgcg, RVS
Oligo: aattcgcCAGCTCGGTTCTGCAGGGAAAtatgcttgaatataactaTTTCCCTGCAGAACCGAGCTGactg
Hairpin ID: TR00097A.1; FWD Oligo: GTCTAGACAATCTGCGTCACAAGGATG, RVS Oligo:
AGAATTCGCAGGAACTTCAGAACCTCG
Hairpin ID: TR02534P.1; FWD Oligo: AAGAATTCCTTCGTTTCCCCCGTTTAGT, RVS Oligo:
AGTCTAGAGCAGCCTTGGATTCAGTCTC
Hairpin ID: TR01517A.1; FWD Oligo: AGTCTAGACGCACGGTGACAATCTGATA, RVS Oligo:
AAGAATTCGGATTACTCGCCATACGGAA
Hairpin ID: TR00166A.1; FWD Oligo: GTCTAGACATCAAATTCAATGGCGAAA, RVS Oligo:
AGAATTCTTGGCCGAAATCGTTATCTC
Hairpin ID: TR01868P.1; FWD Oligo: CACCGAATTCGATCGGTACTTTGCCATCGT, RVS Oligo:
CGAAGTATAGGGCCACAGGA
Hairpin ID: TR01569A.1; FWD Oligo: AGTCTAGAAGGTGGCATAGCCCTAAGGT, RVS Oligo:
AAGAATTCTTCCGGTGAACAAACACAAA
Hairpin ID: TR02597P.1; FWD Oligo: AAGAATTCTATACCGTCTCGCGTTCAGA, RVS Oligo:
AGTCTAGATTTGCAGAAATGTGGTCAGC
Hairpin ID: TR00476A.1; FWD Oligo: GTCTAGAGACTGCTAGCGGAAATCCAG, RVS Oligo:
AGAATTCAGCAGGATTTGCTTGATGGT
Hairpin ID: TR02598P.1; FWD Oligo: AAGAATTCCATGGGCAAAACCACTTCTT, RVS Oligo:
AGTCTAGAGATCACAGTTGTCCGTGGTG
Hairpin ID: TR01931P.1; FWD Oligo: CACCGAATTCACGGTAACCAGTGGCATCTC, RVS Oligo:
TCTGAGGGAATGGAATCCTG
Hairpin ID: TR00526A.1; FWD Oligo: GTCTAGAGACGGTCATCACAACAGGTG, RVS Oligo:
AGAATTCTGCGGTCGCTGTAGTCATAG
Hairpin ID: SH00813.N; FWD Oligo:
ctagcagtAAGGTTCAATGTAATACTTAAtagttatattcaagcataTTAAGTATTACATTGAACCTTgcg, RVS Oligo:
aattcgcAAGGTTCAATGTAATACTTAAtatgcttgaatataactaTTAAGTATTACATTGAACCTTactg
Hairpin ID: SH01668.N; FWD Oligo:
ctagcagtTACGATTGACTTTGTTGATTAtagttatattcaagcataTAATCAACAAAGTCAATCGTAgcg, RVS Oligo:
aattcgcTACGATTGACTTTGTTGATTAtatgcttgaatataactaTAATCAACAAAGTCAATCGTAactg
Hairpin ID: TR02076P.1; FWD Oligo: CACCGAATTCGACGGTAAGGGCACACAACT, RVS Oligo:
GCTCATCCACAACATCGACA
Hairpin ID: TR01783P.1; FWD Oligo: CACCGAATTCGAAAAAGCAAAACAGCTGGC, RVS Oligo:
GCGTGGAATATCAGGTCCAG
Hairpin ID: SH01717.N; FWD Oligo:
ctagcagtACAGAGCGAGTGCGACAAGAAtagttatattcaagcataTTCTTGTCGCACTCGCTCTGTgcg, RVS
Oligo: aattcgcACAGAGCGAGTGCGACAAGAAtatgcttgaatataactaTTCTTGTCGCACTCGCTCTGTactg
Hairpin ID: TR02599P.1; FWD Oligo: AAGAATTCATGTGATAGCCACCAACCGT, RVS Oligo:
AGTCTAGACAGTACTTGGGCAGCACAGA
Hairpin ID: SH01669.N; FWD Oligo:
ctagcagtCTGGTTGTTCTTACTCAAATAtagttatattcaagcataTATTTGAGTAAGAACAACCAGgcg, RVS Oligo:
aattcgcCTGGTTGTTCTTACTCAAATAtatgcttgaatataactaTATTTGAGTAAGAACAACCAGactg
Hairpin ID: TR02077P.1; FWD Oligo: CACCGAATTCGAATACTTCCTTGACGCCCA, RVS Oligo:
GCCTCGTTGTTGGTGTACCT
Hairpin ID: SH00916.N
; FWD Oligo:
ctagcagtCTCGACCTGGATCACAATCAAtagttatattcaagcataTTGATTGTGATCCAGGTCGAGgcg, RVS
Oligo: aattcgcCTCGACCTGGATCACAATCAAtatgcttgaatataactaTTGATTGTGATCCAGGTCGAGactg
Hairpin ID: SH00917.N; FWD Oligo:
ctagcagtTCAGTGGACATTCGATGCTAAtagttatattcaagcataTTAGCATCGAATGTCCACTGAgcg, RVS
Oligo: aattcgcTCAGTGGACATTCGATGCTAAtatgcttgaatataactaTTAGCATCGAATGTCCACTGAactg
Hairpin ID: SH00643.N; FWD Oligo:
ctagcagtCAGCTAGTTAGAACAATTACAtagttatattcaagcataTGTAATTGTTCTAACTAGCTGgcg, RVS Oligo:
aattcgcCAGCTAGTTAGAACAATTACAtatgcttgaatataactaTGTAATTGTTCTAACTAGCTGactg
Hairpin ID: TR01582A.1; FWD Oligo: AGTCTAGAGATTTTATCCGCGCCAAGTA, RVS Oligo:
AAGAATTCTGTCCCATTTCTTTGGCAAT
Hairpin ID: TR02297P.1; FWD Oligo: CACCGAATTCCAACCCACCAAGGACTTCAT, RVS Oligo:
TATTCCTCGGGATCCAACTG
Hairpin ID: TR00245P.1; FWD Oligo: GTCTAGAATTGCCCAGGAGAACATCAC, RVS Oligo:
AGAATTCTAGCTGTTGGCCTCCAGAGT
Hairpin ID: TR02079P.1; FWD Oligo: CACCGAATTCATCGGTGACTGGTGGCTAAT, RVS Oligo:
TGATAGCTTTTGGCTTGGGT
Hairpin ID: TR02119P.1; FWD Oligo: CACCGAATTCAGACGCAGGCCTATTCTCAA, RVS Oligo:
GAAGTGGAGGTCGGTGTTGT
Hairpin ID: TR00963P.1; FWD Oligo: AGTCTAGATTTGACATTGGATTCCAGCA, RVS Oligo:
AAGAATTCGGGTTGCAACTGACCAAAAT
Hairpin ID: TR00772A.1; FWD Oligo: GTCTAGACGGTTTTGGTAGCTGTGGAT, RVS Oligo:
AGAATTCGGAACTGCTGCTTGGAAGAC
Hairpin ID: SH00343.N; FWD Oligo:
ctagcagtCTGCTCTAAGTTCTAGCTTAAtagttatattcaagcataTTAAGCTAGAACTTAGAGCAGgcg, RVS
Oligo: aattcgcCTGCTCTAAGTTCTAGCTTAAtatgcttgaatataactaTTAAGCTAGAACTTAGAGCAGactg
Hairpin ID: SH00952.N; FWD Oligo:
ctagcagtCAAGAAGTCTGTGGTATACAAtagttatattcaagcataTTGTATACCACAGACTTCTTGgcg, RVS
Oligo: aattcgcCAAGAAGTCTGTGGTATACAAtatgcttgaatataactaTTGTATACCACAGACTTCTTGactg
Hairpin ID: TR01570A.1; FWD Oligo: AGTCTAGAGCAAGCAAAGCAAACCTTTC, RVS Oligo:
AAGAATTCGCAATCTTCTTCTGAACCGC
Hairpin ID: TR01703P.1; FWD Oligo: CACCGAATTCATCAGCGAGCTAAAGGGTCA, RVS Oligo:
TCAAGTGCTCGTGTCGTAGG
Hairpin ID: TR01704P.1; FWD Oligo: CACCGAATTCTCCGACAAGCTGAATGAGAA, RVS Oligo:
GTTGTGGTCCACCGAACTCT
Hairpin ID: TR01571A.1; FWD Oligo: AGTCTAGAAGAATCCACACCGGAGTCAC, RVS Oligo:
AAGAATTCTGGACTGATCTGCGCTAATG
Hairpin ID: TR00828A.1; FWD Oligo: GTCTAGAGGAAATGATGGTGTGGTTCC, RVS Oligo:
AGAATTCTTCTCCCAGTTTCTTCGCAT
Hairpin ID: TR02080P.1; FWD Oligo: CACCGAATTCTGCTCAGTATCTGCCCAGTG, RVS Oligo:
TGGTCATCATGGTGGCATAC
Hairpin ID: SH00214.N; FWD Oligo:
ctagcagtCCGCGACTACTACATCAACAAtagttatattcaagcataTTGTTGATGTAGTAGTCGCGGgcg, RVS
Oligo: aattcgcCCGCGACTACTACATCAACAAtatgcttgaatataactaTTGTTGATGTAGTAGTCGCGGactg
Hairpin ID: TR02081P.1; FWD Oligo: CACCGAATTCGCCAAAAAGGATATACGCGA, RVS Oligo:
CCTTTTTCGCATTGACACCT
Hairpin ID: TR00917P.1; FWD Oligo: AGTCTAGAACTCAAATACCGAACGGCAC, RVS Oligo:
AAGAATTCTTAGCAAATCGGCAAAATCC
Hairpin ID: TR01027P.1; FWD Oligo: AGTCTAGACAAATGAAACAGCCCGATCT, RVS Oligo:
AAGAATTCATAGCTGCCTGGCTTTGTGT
Hairpin ID: TR03859P.1; FWD Oligo: AAGAATTCCTGCTGCTCGCCCTTATTAC, RVS Oligo:
AGTCTAGAAAGCTCACGACCCTAAGCAA
Hairpin ID: TR02082P.1; FWD Oligo: CACCGAATTCACACCTTCAGATCCATTGGC, RVS Oligo:
TGCAATGCAGGTTTCTTACG
Hairpin ID: TR02244P.1; FWD Oligo: CACCGAATTCGTACCAGGTGGACATACGGG, RVS Oligo:
GAAGTAGCGATGCGATGTCA
Hairpin ID: TR02083P.1; FWD Oligo: CACCGAATTCGTACCAGGTGGACATACGGG, RVS Oligo:
GAAGTAGCGATGCGATGTCA
Hairpin ID: TR01536A.1; FWD Oligo: AGTCTAGACCTCTAGTGGTCGCTATGCC, RVS Oligo:
AAGAATTCGGCCATTGTGCATCTGTATG
Hairpin ID: SH00771.N; FWD Oligo:
ctagcagtTAGCTGTATCCTAGACTCGTAtagttatattcaagcataTACGAGTCTAGGATACAGCTAgcg, RVS
Oligo: aattcgcTAGCTGTATCCTAGACTCGTAtatgcttgaatataactaTACGAGTCTAGGATACAGCTAactg
Hairpin ID: SH00973.N; FWD Oligo:
ctagcagtCACGGCGAGTTCGCCATCTAAtagttatattcaagcataTTAGATGGCGAACTCGCCGTGgcg, RVS
Oligo: aattcgcCACGGCGAGTTCGCCATCTAAtatgcttgaatataactaTTAGATGGCGAACTCGCCGTGactg
Hairpin ID: TR02600P.1; FWD Oligo: AAGAATTCGGATCTAGTGCACGGTGGTT, RVS Oligo:
AGTCTAGATCACCAGCCCATAAATTGGT
Hairpin ID: TR04629P.1; FWD Oligo: AAGAATTCCTTCTGGCGCTGATGAAAAT, RVS Oligo:
AGTCTAGAGCTTCTATGTGGGGTGGTTG
Hairpin ID: TR01784P.1; FWD Oligo: CACCGAATTCGAGCGACAGGGAATCTACGA, RVS Oligo:
AGGCGGATGTGTTGAAGAAC
Hairpin ID: TR01585A.1; FWD Oligo: AGTCTAGACCAACTTTCCTTTCACGTCC, RVS Oligo:
AAGAATTCACAGGAACCAAAAATTGCCA
Hairpin ID: TR01603P.1; FWD Oligo: AAGAATTCAGGTCAGTGCGTTCCACTCT, RVS Oligo:
AGTCTAGATTCCATGTGGTCGAGTGCTA
Hairpin ID: TR02651P.1; FWD Oligo: AACAATTGCGATTCACATCAGCAGCAGT, RVS Oligo:
AGTCTAGAATACTCGTTGCGGTAGCGAT
Hairpin ID: TR02085P.1; FWD Oligo: CACCGAATTCAAGCTGTGGCTTGGATCAGT, RVS Oligo:
TACGTTTTTACGGCCCAAAG
Hairpin ID: TR01785P.1; FWD Oligo: AAGAATTCGGACTTGACCTTGGGACAAA, RVS Oligo:
AGACTAGTGAAAGGCATCCTTGCTGAAG
Hairpin ID: TR02086P.1; FWD Oligo: AACAATTGCCTTATGCTCCACCGTCATT, RVS Oligo:
AGTCTAGACGCTGACTTGGATATGAGCA
Hairpin ID: TR02601P.1; FWD Oligo: AAGAATTCAGTCCAAGTTCCCACAGCAC, RVS Oligo:
AGTCTAGATGATGGTCGGCATGACTAAA
Hairpin ID: TR01623P.1; FWD Oligo: AGTCTAGAAACATTGACCACGGCGTACT, RVS Oligo:
AAGAATTCAGCCCAGTCCCTTAACTGGT
Hairpin ID: SH00805.N; FWD Oligo:
ctagcagtTAAGACGATAATATCGTCAAAtagttatattcaagcataTTTGACGATATTATCGTCTTAgcg, RVS Oligo:
aattcgcTAAGACGATAATATCGTCAAAtatgcttgaatataactaTTTGACGATATTATCGTCTTAactg
Hairpin ID: TR01786P.1; FWD Oligo: CACCGAATTCTATTAACCAAAACGCCAGCC, RVS Oligo:
TGGGGAGTTTCGAATTTCTG
Hairpin ID: SH00876.N; FWD Oligo:
ctagcagtCCAGACGATGATGCTTAGCAAtagttatattcaagcataTTGCTAAGCATCATCGTCTGGgcg, RVS
Oligo: aattcgcCCAGACGATGATGCTTAGCAAtatgcttgaatataactaTTGCTAAGCATCATCGTCTGGactg
Hairpin ID: SH00877.N; FWD Oligo:
ctagcagtTACGACAAACTTTGATTTCTAtagttatattcaagcataTAGAAATCAAAGTTTGTCGTAgcg, RVS Oligo:
aattcgcTACGACAAACTTTGATTTCTAtatgcttgaatataactaTAGAAATCAAAGTTTGTCGTAactg
Hairpin ID: TR01663A.1; FWD Oligo: AGTCTAGAATCGGAAGCAGAAAGGTTCA, RVS Oligo:
AAGAATTCGCCACATCATCATTCACTGG
Hairpin ID: TR01662A.1; FWD Oligo: AGTCTAGAAAAAGCGAAAGAGACCCCAT, RVS Oligo:
AAGAATTCCTTCCCTCGTCCCGTAGAAT
Hairpin ID: TR01895P.1; FWD Oligo: CACCGAATTCGCTTCAAGATACGTCGCCAG, RVS Oligo:
ATGATGTCGCGGTACTCCTT
Hairpin ID: SH00926.N; FWD Oligo:
ctagcagtCAAGATAGAAACGAACGATTAtagttatattcaagcataTAATCGTTCGTTTCTATCTTGgcg, RVS Oligo:
aattcgcCAAGATAGAAACGAACGATTAtatgcttgaatataactaTAATCGTTCGTTTCTATCTTGactg
Hairpin ID: SH00927.N; FWD Oligo:
ctagcagtTAGCTCAAAGTTTGAGAATTAtagttatattcaagcataTAATTCTCAAACTTTGAGCTAgcg, RVS Oligo:
aattcgcTAGCTCAAAGTTTGAGAATTAtatgcttgaatataactaTAATTCTCAAACTTTGAGCTAactg
Hairpin ID: TR00195A.1; FWD Oligo: GTCTAGAATTTTACCACCATCGCTTGC, RVS Oligo:
AGAATTCCAGCTCCTTCTCCACCTGTC
Hairpin ID: TR01932P.1; FWD Oligo: CACCGAATTCGTGACGCTCTCAAGGAGGAG, RVS Oligo:
TAAGCACGAAAATGCAAACG
Hairpin ID: SH00836.N; FWD Oligo:
ctagcagtTACGTGATAATTGTTTGTAAAtagttatattcaagcataTTTACAAACAATTATCACGTAgcg, RVS Oligo:
aattcgcTACGTGATAATTGTTTGTAAAtatgcttgaatataactaTTTACAAACAATTATCACGTAactg
Hairpin ID: SH00215.N; FWD Oligo:
ctagcagtAAGGATTGTTTCAATGGTTTAtagttatattcaagcataTAAACCATTGAAACAATCCTTgcg, RVS Oligo:
aattcgcAAGGATTGTTTCAATGGTTTAtatgcttgaatataactaTAAACCATTGAAACAATCCTTactg
Hairpin ID: TR02602P.1; FWD Oligo: AACAATTGAATCAAGGAGCAAATCGTGG, RVS Oligo:
AGTCTAGAAGAGCTTGGAGTGGGCAAAT
Hairpin ID: TR01112P.1; FWD Oligo: AGTCTAGAACTATCATCCGCTCAATGGC, RVS Oligo:
AAGAATTCCCTTCTTCTTGCTGCTGCTT
Hairpin ID: TR02088P.1; FWD Oligo: CACCGAATTCCAACTGCAACTGCAACACCT, RVS Oligo:
GTGCGAGATCTGGTGTGTGT
Hairpin ID: TR00512P.1; FWD Oligo: GTCTAGAGGCATAAGCTCGCATTTAGC, RVS Oligo:
AGAATTCTGATGCTGACTTGCTGAACC
Hairpin ID: TR00863P.1; FWD Oligo: AGTCTAGAGGGCCTACGACGTACCTACA, RVS Oligo:
AAGAATTCTCCCACCTGAAGGAGCTAGA
Hairpin ID: TR02089P.1; FWD Oligo: CACCGAATTCGATACGAAGGGTCGCAAAAA, RVS Oligo:
GGCACTTCCTGAATGAGAGC
Hairpin ID: TR00650A.1; FWD Oligo: GTCTAGAGCTGGTGATGATGATTGGTG, RVS Oligo:
AGAATTCTGGCGCCATTATTGTTGTTA
Hairpin ID: TR00651A.1; FWD Oligo: GTCTAGATCAATCTGCAGTCCAAGTGC, RVS Oligo:
AGAATTCAACTTCGCATCAGCACCTTT
Hairpin ID: TR01613P.1; FWD Oligo: AAGAATTCATACGTCGCTTCGTGGAGAA, RVS Oligo:
AGTCTAGAAACACATCGCTGACGAACTG
Hairpin ID: TR02545P.1; FWD Oligo: AAGAATTCCGATACGGTACGGTCCATCT, RVS Oligo:
AGTCTAGAGGCCGGCCATATTTTCTATT
Hairpin ID: TR00247P.1; FWD Oligo: AAGAATTCACCCAGAACCGACAGACATC, RVS Oligo:
AGTCTAGATCTTACCATCGGCGTACACA
Hairpin ID: SH00882.N; FWD Oligo:
ctagcagtCTGCTCAAACATACAACTTAAtagttatattcaagcataTTAAGTTGTATGTTTGAGCAGgcg, RVS Oligo:
aattcgcCTGCTCAAACATACAACTTAAtatgcttgaatataactaTTAAGTTGTATGTTTGAGCAGactg
Hairpin ID: SH00883.N; FWD Oligo:
ctagcagtCTCAAGTGTTAGTCTACCTAAtagttatattcaagcataTTAGGTAGACTAACACTTGAGgcg, RVS
Oligo: aattcgcCTCAAGTGTTAGTCTACCTAAtatgcttgaatataactaTTAGGTAGACTAACACTTGAGactg
Hairpin ID: TR02603P.1; FWD Oligo: AAGAATTCCCAAAGGTTCGATGAACTCG, RVS Oligo:
AGTCTAGACTGGTGGTACATGTGCTGCT
Hairpin ID: SH00362.N; FWD Oligo:
ctagcagtGACGACGACGGTTTCTATCTAtagttatattcaagcataTAGATAGAAACCGTCGTCGTCgcg, RVS
Oligo: aattcgcGACGACGACGGTTTCTATCTAtatgcttgaatataactaTAGATAGAAACCGTCGTCGTCactg
Hairpin ID: SH01036.N; FWD Oligo:
ctagcagtCGGACTGGACAAGAATCTCAAtagttatattcaagcataTTGAGATTCTTGTCCAGTCCGgcg, RVS
Oligo: aattcgcCGGACTGGACAAGAATCTCAAtatgcttgaatataactaTTGAGATTCTTGTCCAGTCCGactg
Hairpin ID: SH01037.N; FWD Oligo:
ctagcagtCTGGACAAGAATCTCAAGGATtagttatattcaagcataATCCTTGAGATTCTTGTCCAGgcg, RVS
Oligo: aattcgcCTGGACAAGAATCTCAAGGATtatgcttgaatataactaATCCTTGAGATTCTTGTCCAGactg
Hairpin ID: SH01022.N; FWD Oligo:
ctagcagtCTGCAGTAAAGTGCAAGTTAAtagttatattcaagcataTTAACTTGCACTTTACTGCAGgcg, RVS
Oligo: aattcgcCTGCAGTAAAGTGCAAGTTAAtatgcttgaatataactaTTAACTTGCACTTTACTGCAGactg
Hairpin ID: SH01023.N; FWD Oligo:
ctagcagtCAGTTCGATGGTGCTGACCAAtagttatattcaagcataTTGGTCAGCACCATCGAACTGgcg, RVS
Oligo: aattcgcCAGTTCGATGGTGCTGACCAAtatgcttgaatataactaTTGGTCAGCACCATCGAACTGactg
Hairpin ID: TR00968P.1; FWD Oligo: AGTCTAGAGGCAAACAGAAAGAACCGTC, RVS Oligo:
AAGAATTCCCCGGATTTTCTAAGGGAAG
Hairpin ID: TR00073A.1; FWD Oligo: GTCTAGACGAGAAGCTCAGGACTCGAC, RVS Oligo:
AGAATTCGGACATAGCCGATACGATGC
Hairpin ID: TR00074A.1; FWD Oligo: GTCTAGAGGACGACATCGACAAGATCC, RVS Oligo:
AGAATTCGCGGTCTGTTAGTGCTTGGT
Hairpin ID: TR00643A.1; FWD Oligo: GTCTAGAATCCCTCGGTTAGCTTTGAA, RVS Oligo:
ACAATTGTAATGGAATGCTCGGCTCTC
Hairpin ID: TR00642A.1; FWD Oligo: GTCTAGAAAGCAAAGCGAAGTGAAAGC, RVS Oligo:
ACAATTGTCCCTTCCGTCCTCATGTTA
Hairpin ID: SH01670.N; FWD Oligo:
ctagcagtACCGATGTCAAGGCAAGCGAAtagttatattcaagcataTTCGCTTGCCTTGACATCGGTgcg, RVS
Oligo: aattcgcACCGATGTCAAGGCAAGCGAAtatgcttgaatataactaTTCGCTTGCCTTGACATCGGTactg
Hairpin ID: TR01257P.1; FWD Oligo: AGTCTAGATTCGATATCTTTTGGGCTGG, RVS Oligo:
AAGAATTCGTGTCAATCGTTTGTCGGTG
Hairpin ID: TR01256P.1; FWD Oligo: AGTCTAGATGAGTGGCAGAGAGCTGAGA, RVS Oligo:
AAGAATTCAAGCCGAGCTGATTTGATGT
Hairpin ID: SH00781.N; FWD Oligo:
ctagcagtCCGACGAGTTGGACAGTACAAtagttatattcaagcataTTGTACTGTCCAACTCGTCGGgcg, RVS
Oligo: aattcgcCCGACGAGTTGGACAGTACAAtatgcttgaatataactaTTGTACTGTCCAACTCGTCGGactg
Hairpin ID: SH00983.N; FWD Oligo:
ctagcagtTAACTAGATTGTACAATTCAAtagttatattcaagcataTTGAATTGTACAATCTAGTTAgcg, RVS Oligo:
aattcgcTAACTAGATTGTACAATTCAAtatgcttgaatataactaTTGAATTGTACAATCTAGTTAactg
Hairpin ID: SH00774.N; FWD Oligo:
ctagcagtTTGGACCAGAAGATCAGTCTAtagttatattcaagcataTAGACTGATCTTCTGGTCCAAgcg, RVS
Oligo: aattcgcTTGGACCAGAAGATCAGTCTAtatgcttgaatataactaTAGACTGATCTTCTGGTCCAAactg
Hairpin ID: TR00865P.1; FWD Oligo: AGTCTAGAGAGCAGTAAGAGCACCGTGG, RVS Oligo:
AAGAATTCGAACTTCTTTCCGCCCTTTC
Hairpin ID: TR02338P.1; FWD Oligo: AAGAATTCCCATTGCGAAAATGAAGGTT, RVS Oligo:
AGTCTAGAGTTCGCAGCTTTCCAGAATC
Hairpin ID: TR02391P.1; FWD Oligo: AAGAATTCACATGCATCACCTGGGAAAT, RVS Oligo:
AGTCTAGATAGTATTCCGGCGCAAAATC
Hairpin ID: TR02680P.1; FWD Oligo: AAGAATTCTCATCAGTCCATTTCACGGA, RVS Oligo:
AGTCTAGATGCCTTCTCATTCTGCATTG
Hairpin ID: TR01583A.1; FWD Oligo: AGTCTAGACGCCCAGAAAACTTGAGAAG, RVS Oligo:
AAGAATTCGAAGGAGTGCTGAGGGAGTG
Hairpin ID: SH00307.N; FWD Oligo:
ctagcagtCCCGCTGTCGATACTGATGAAtagttatattcaagcataTTCATCAGTATCGACAGCGGGgcg, RVS
Oligo: aattcgcCCCGCTGTCGATACTGATGAAtatgcttgaatataactaTTCATCAGTATCGACAGCGGGactg
Hairpin ID: TR01533A.1; FWD Oligo: AGTCTAGATATCCAGGTAGCCCTTTCCC, RVS Oligo:
AAGAATTCTTTCGAATCCCATCGTCATT
Hairpin ID: TR00504A.1; FWD Oligo: GTCTAGATGCCCCAATACATTTTGGAT, RVS Oligo:
AGAATTCCTGGTGTCCCACATCTTCCT
Hairpin ID: SH00574.N; FWD Oligo:
ctagcagtCTCGAAGAAGCTATTATTATAtagttatattcaagcataTATAATAATAGCTTCTTCGAGgcg, RVS Oligo:
aattcgcCTCGAAGAAGCTATTATTATAtatgcttgaatataactaTATAATAATAGCTTCTTCGAGactg
Hairpin ID: SH01273.N2; FWD Oligo:
ctagcagtCCGACGAAGATTATATGTCTAtagttatattcaagcataTAGACATATAATCTTCGTCGGgcg, RVS
Oligo: aattcgcCCGACGAAGATTATATGTCTAtatgcttgaatataactaTAGACATATAATCTTCGTCGGactg
Hairpin ID: SH01350.N2; FWD Oligo:
ctagcagtCCGCAACGACGAGGAGTTAAAtagttatattcaagcataTTTAACTCCTCGTCGTTGCGGgcg, RVS
Oligo: aattcgcCCGCAACGACGAGGAGTTAAAtatgcttgaatataactaTTTAACTCCTCGTCGTTGCGGactg
Hairpin ID: TR02091P.1; FWD Oligo: CACCGAATTCCAGATCATGGCTCTGGGATT, RVS Oligo:
CCCTTGTTCAGGTTCGTGTT
Hairpin ID: TR01787P.1; FWD Oligo: CACCGAATTCATTGGAAAAGTTGGTTCCCC, RVS Oligo:
TGTCGTCTTCGGACTCTGTG
Hairpin ID: TR02092P.1; FWD Oligo: CACCGAATTCGCTTGAAACCGAACTCCAAA, RVS Oligo:
TCGCGCGTTCTAATTCTTTT
Hairpin ID: TR02604P.1; FWD Oligo: AAGAATTCATTGCGGAAAATCGAAAGTG, RVS Oligo:
AGTCTAGAGATGAAGTCCTGGTGCTGGT
Hairpin ID: TR01232P.1; FWD Oligo: AGTCTAGAACTCATTCGCAACGCTGAC, RVS Oligo:
AAGAATTCGTTTTCCGTTTCGATTGCAT
Hairpin ID: TR02605P.1; FWD Oligo: AAGAATTCCACCATTTGTCACTGCAAGG, RVS Oligo:
AGTCTAGAGTGTTTGCATTAGCCGGAAT
Hairpin ID: TR01399P.1; FWD Oligo: AGTCTAGAGCAACCACAAGTACCTGCAA, RVS Oligo:
AAGAATTCTTGAGGCCTAAACTGGAAGG
Hairpin ID: TR00249A.1; FWD Oligo: GTCTAGAAGCGTAAGGAACAGCCTGAG, RVS Oligo:
AGAATTCTGCGGACTATAGCCCTCTTG
Hairpin ID: SH00049.N; FWD Oligo:
ctagcagtAGCGCGAATATCGTTGACAGAtagttatattcaagcataTCTGTCAACGATATTCGCGCTgcg, RVS
Oligo: aattcgcAGCGCGAATATCGTTGACAGAtatgcttgaatataactaTCTGTCAACGATATTCGCGCTactg
Hairpin ID: TR01400P.1; FWD Oligo: AGTCTAGAGAGCTGCTCTCGCAGTATCC, RVS Oligo:
AAGAATTCGTGAGGTTGTAGTGGGCGTT
Hairpin ID: TR04598P.1; FWD Oligo: AAGAATTCCAACGATCATGTTGGCTACG, RVS Oligo:
AGTCTAGAATGGAGAGGTGGGTGACAAC
Hairpin ID: TR02093P.1; FWD Oligo: CACCGAATTCGAGCAATGGCAATGTGAAGA, RVS Oligo:
ACCGGCGATTAGGAAGAACT
Hairpin ID: SH01364.N2; FWD Oligo:
ctagcagtCTGCTGCAAAGTGGAAGCATAtagttatattcaagcataTATGCTTCCACTTTGCAGCAGgcg, RVS
Oligo: aattcgcCTGCTGCAAAGTGGAAGCATAtatgcttgaatataactaTATGCTTCCACTTTGCAGCAGactg
Hairpin ID: TR00250A.1; FWD Oligo: GTCTAGAGTTCCCACTACTATGGCGGA, RVS Oligo:
AGAATTCATCCCAAGCCTGATGATGAC
Hairpin ID: TR01933P.1; FWD Oligo: CACCGAATTCCCAGAATCGGCTGGTTGTAT, RVS Oligo:
GCTTAGCGAAATGACGAAGG
Hairpin ID: SH00894.N; FWD Oligo:
ctagcagtCAGAAGAATAGTATTAACCAAtagttatattcaagcataTTGGTTAATACTATTCTTCTGgcg, RVS Oligo:
aattcgcCAGAAGAATAGTATTAACCAAtatgcttgaatataactaTTGGTTAATACTATTCTTCTGactg
Hairpin ID: SH00895.N; FWD Oligo:
ctagcagtTCGGTTAGTTAAGTTGGCTTAtagttatattcaagcataTAAGCCAACTTAACTAACCGAgcg, RVS
Oligo: aattcgcTCGGTTAGTTAAGTTGGCTTAtatgcttgaatataactaTAAGCCAACTTAACTAACCGAactg
Hairpin ID: SH00216.N; FWD Oligo:
ctagcagtCACGACGACGGCGAATGTGAAtagttatattcaagcataTTCACATTCGCCGTCGTCGTGgcg, RVS
Oligo: aattcgcCACGACGACGGCGAATGTGAAtatgcttgaatataactaTTCACATTCGCCGTCGTCGTGactg
Hairpin ID: TR02606P.1; FWD Oligo: AAGAATTCTGGATCGGGTACAAATGGTT, RVS Oligo:
AGTCTAGATGTCCTTCGCTATTTTCGCT
Hairpin ID: TR01869P.1; FWD Oligo: CACCGAATTCGGTGAACGCACCTTGAATTT, RVS Oligo:
AATCGGTTCCATCGATCTTG
Hairpin ID: TR01896P.1; FWD Oligo: CACCGAATTCTTCGATCCAAGTGCAAGTGT, RVS Oligo:
TATCACGGATGTCCAGCTCA
Hairpin ID: SH00650.N; FWD Oligo:
ctagcagtTAGCGACGATCAGTCCGTCAAtagttatattcaagcataTTGACGGACTGATCGTCGCTAgcg, RVS
Oligo: aattcgcTAGCGACGATCAGTCCGTCAAtatgcttgaatataactaTTGACGGACTGATCGTCGCTAactg
Hairpin ID: SH00217.N; FWD Oligo:
ctagcagtACGATCCTTTCTGTTCTTCAAtagttatattcaagcataTTGAAGAACAGAAAGGATCGTgcg, RVS
Oligo: aattcgcACGATCCTTTCTGTTCTTCAAtatgcttgaatataactaTTGAAGAACAGAAAGGATCGTactg
Hairpin ID: TR00785P.1; FWD Oligo: AAGAATTCATCTCACCCAGACGATCGAG, RVS Oligo:
AGTCTAGAGGGGCAAACATCTCGAAGTA
Hairpin ID: SH00656.N; FWD Oligo:
ctagcagtCCGAAGGACTCGACTATGTAAtagttatattcaagcataTTACATAGTCGAGTCCTTCGGgcg, RVS
Oligo: aattcgcCCGAAGGACTCGACTATGTAAtatgcttgaatataactaTTACATAGTCGAGTCCTTCGGactg
Hairpin ID: TR02607P.1; FWD Oligo: AAGAATTCGTGGGTTCTCTTAGCATCGC, RVS Oligo:
AGTCTAGATGGTGACTGCAATCAGCTTT
Hairpin ID: TR01544A.1; FWD Oligo: AGTCTAGACACCAAATACAATCCCGGAG, RVS Oligo:
AAGAATTCGAGCGCACTGTTCGTGATTA
Hairpin ID: TR00251A.1; FWD Oligo: GTCTAGAATACCAACGCCTATGCGAAC, RVS Oligo:
AGAATTCGTCCCACTTCGTCCTCGTTA
Hairpin ID: TR00669A.1; FWD Oligo: GTCTAGACCTAAAGCTGAAGGCTGGTG, RVS Oligo:
AGAATTCGTCGTAGGAGTTCCCCATCA
Hairpin ID: TR00670A.1; FWD Oligo: GTCTAGATGCTTGGGGAACAGGATTAC, RVS Oligo:
AGAATTCGAATTGAGCCAACCGATGTT
Hairpin ID: TR00549A.1; FWD Oligo: GTCTAGAGGCTATGTGGTCAAGTGCCT, RVS Oligo:
AGAATTCCTTGATATCCGCCAGGTGAT
Hairpin ID: SH00808.N; FWD Oligo:
ctagcagtCCGCGTTGTCCTGCAGACCAAtagttatattcaagcataTTGGTCTGCAGGACAACGCGGgcg, RVS
Oligo: aattcgcCCGCGTTGTCCTGCAGACCAAtatgcttgaatataactaTTGGTCTGCAGGACAACGCGGactg
Hairpin ID: TR04485P.1; FWD Oligo: AAGAATTCTCTGGAGATTCAGTTGCGTG, RVS Oligo:
AGTCTAGACGGCATCTTGTCCATTACCT
Hairpin ID: TR01219P.1; FWD Oligo: AAGAATTCGTAGACATCAGTCGAGCGCA, RVS Oligo:
AGACTAGTTCTCACGTGTTCCTTTGCTG
Hairpin ID: TR00116A.1; FWD Oligo: GTCTAGAGGATGAATTGTCTGTTGAAGAGC, RVS Oligo:
AGAATTCTTTAGAATGGGCGTGGTCAT
Hairpin ID: SH00369.N; FWD Oligo:
ctagcagtCTGGTTCAAAGAGTAGTGCAAtagttatattcaagcataTTGCACTACTCTTTGAACCAGgcg, RVS
Oligo: aattcgcCTGGTTCAAAGAGTAGTGCAAtatgcttgaatataactaTTGCACTACTCTTTGAACCAGactg
Hairpin ID: TR00157A.1; FWD Oligo: GTCTAGAAATCGACATAGCCCCAACAA, RVS Oligo:
AGAATTCCATCGCCGGTAAGAACAATA
Hairpin ID: TR00158A.1; FWD Oligo: GTCTAGACGTGTATGTCCATTGAACGC, RVS Oligo:
AGAATTCCCGGCCAGTACAAACTTGAT
Hairpin ID: TR04630P.1; FWD Oligo: AAGAATTCCCAAAACTCCTCTACCGTCG, RVS Oligo:
AGTCTAGAGTCTTTAGCCGCTTTTGTGC
Hairpin ID: TR02322P.1; FWD Oligo: CACCGAATTCTCGACCCTGTGTTGCAGATA, RVS Oligo:
TATTCGCAATAGGGTTTGCC
Hairpin ID: SH00218.N; FWD Oligo:
ctagcagtTTGGTAGAAACAAATGAATTAtagttatattcaagcataTAATTCATTTGTTTCTACCAAgcg, RVS Oligo:
aattcgcTTGGTAGAAACAAATGAATTAtatgcttgaatataactaTAATTCATTTGTTTCTACCAAactg
Hairpin ID: TR01529A.1; FWD Oligo: AGTCTAGATACCCGCTACCATTCAAACC, RVS Oligo:
AAGAATTCGGGCTGATGGATCTGATGTT
Hairpin ID: TR01615P.1; FWD Oligo: AAGAATTCGCACTTGCACAACCCCTAAT, RVS Oligo:
AGTCTAGAGCTGGCTGACTTCCTTTCAC
Hairpin ID: TR02411P.1; FWD Oligo: AAGAATTCATGCATGAGAAATTCCTGCC, RVS Oligo:
AGTCTAGATGTCCGATTTGCTAGCACTG
Hairpin ID: TR02095P.1; FWD Oligo: CACCGAATTCTACGGTCAACTTGGTGGTCA, RVS Oligo:
ATCAAGCCGAAGAGCTGGTA
Hairpin ID: TR02096P.1; FWD Oligo: CACCGAATTCCATTGGACCAGTTCCTGGAT, RVS Oligo:
ATAGAACTGCGTTTAGCGGC
Hairpin ID: SH00782.N; FWD Oligo:
ctagcagtTAAGTAGAAGTTACAACTAAAtagttatattcaagcataTTTAGTTGTAACTTCTACTTAgcg, RVS Oligo:
aattcgcTAAGTAGAAGTTACAACTAAAtatgcttgaatataactaTTTAGTTGTAACTTCTACTTAactg
Hairpin ID: TR01576A.1; FWD Oligo: AGTCTAGATTTAAGGGGCTCAATTGGTG, RVS Oligo:
AAGAATTCGCTGCCATAAAGCTGGGATA
Hairpin ID: TR00819A.1; FWD Oligo: GTCTAGAAACAACTGCCCAATCCTCAC, RVS Oligo:
AGAATTCGTCAAGCAGGGTCTCCAGTC
Hairpin ID: TR02097P.1; FWD Oligo: CACCGAATTCACCTAACGCTGGTGGATCTG, RVS Oligo:
AGAGTGGGATACTTGCGCTG
Hairpin ID: TR01059P.1; FWD Oligo: AGTCTAGATTTGACCAGTTGGATGACGA, RVS Oligo:
AAGAATTCAACAAAAAGATGTGCTGCCC
Hairpin ID: SH00775.N; FWD Oligo:
ctagcagtTCCCAAGACGTTAGCGAAGAAtagttatattcaagcataTTCTTCGCTAACGTCTTGGGAgcg, RVS
Oligo: aattcgcTCCCAAGACGTTAGCGAAGAAtatgcttgaatataactaTTCTTCGCTAACGTCTTGGGAactg
Hairpin ID: TR01897P.1; FWD Oligo: CACCGAATTCTAAGACCCATCGAAGATCCG, RVS Oligo:
CCTGCTCCTGATAGTCCTGC
Hairpin ID: TR00252A.1; FWD Oligo: GTCTAGACAACGGCTACTTCTGCCCT, RVS Oligo:
AGAATTCAGTTGCTGTGCGATTTGTTG
Hairpin ID: SH01365.N2; FWD Oligo:
ctagcagtCAGCAGCAAGTTGTTCAGCAAtagttatattcaagcataTTGCTGAACAACTTGCTGCTGgcg, RVS
Oligo: aattcgcCAGCAGCAAGTTGTTCAGCAAtatgcttgaatataactaTTGCTGAACAACTTGCTGCTGactg
Hairpin ID: SH00219.N; FWD Oligo:
ctagcagtCTGGATAGCACTAAAGCCTAAtagttatattcaagcataTTAGGCTTTAGTGCTATCCAGgcg, RVS
Oligo: aattcgcCTGGATAGCACTAAAGCCTAAtatgcttgaatataactaTTAGGCTTTAGTGCTATCCAGactg
Hairpin ID: SH00421.N; FWD Oligo:
ctagcagtCTCAAGCAGAAGGACGATGAAtagttatattcaagcataTTCATCGTCCTTCTGCTTGAGgcg, RVS
Oligo: aattcgcCTCAAGCAGAAGGACGATGAAtatgcttgaatataactaTTCATCGTCCTTCTGCTTGAGactg
Hairpin ID: TR00559P.1; FWD Oligo: AAGAATTCAGTCAGCGCATCCAAGCTAT, RVS Oligo:
AGTCTAGAACAGAATGGCCTCCTCCTTT
Hairpin ID: TR02653P.1; FWD Oligo: AAGAATTCAGTGGCACGAGAATTGCTTC, RVS Oligo:
AGTCTAGATTGCAGACGCCTTACATCAG
Hairpin ID: SH00452.N; FWD Oligo:
ctagcagtTAGCCGAAGTTACGATTGCAAtagttatattcaagcataTTGCAATCGTAACTTCGGCTAgcg, RVS
Oligo: aattcgcTAGCCGAAGTTACGATTGCAAtatgcttgaatataactaTTGCAATCGTAACTTCGGCTAactg
Hairpin ID: SH00087.N; FWD Oligo:
ctagcagtCGAGAAGAGTTACAAGTATTTtagttatattcaagcataAAATACTTGTAACTCTTCTCGgcg, RVS Oligo:
aattcgcCGAGAAGAGTTACAAGTATTTtatgcttgaatataactaAAATACTTGTAACTCTTCTCGactg
Hairpin ID: SH00087.Nb; FWD Oligo:
ctagcagtCGAGAAGAGTTACAAGTATTTtagttatattcaagcataAAATACTTGTAACTCTTCTCGgcg, RVS Oligo:
aattcgcCGAGAAGAGTTACAAGTATTTtatgcttgaatataactaAAATACTTGTAACTCTTCTCGactg
Hairpin ID: TR01233P.1; FWD Oligo: AGTCTAGACGAACCCCTATAGCTGCAAG, RVS Oligo:
AAGAATTCACTGCTTAAACGAGGGCTCA
Hairpin ID: TR00218A.1; FWD Oligo: GTCTAGACACAGGCCGGAAATTAAAAA, RVS Oligo:
AGAATTCTTTTCGGGGATATGTGTGGT
Hairpin ID: TR02480P.1; FWD Oligo: AAGAATTCGTCTGGATACGGAGGACGAA, RVS Oligo:
AGTCTAGACCACCGCTATTTGTTCCACT
Hairpin ID: SH01366.N2; FWD Oligo:
ctagcagtCTCGATTGACCGATAAGTCTAtagttatattcaagcataTAGACTTATCGGTCAATCGAGgcg, RVS
Oligo: aattcgcCTCGATTGACCGATAAGTCTAtatgcttgaatataactaTAGACTTATCGGTCAATCGAGactg
Hairpin ID: SH00582.N; FWD Oligo:
ctagcagtTAGCTACAATGTGCTGGACAAtagttatattcaagcataTTGTCCAGCACATTGTAGCTAgcg, RVS
Oligo: aattcgcTAGCTACAATGTGCTGGACAAtatgcttgaatataactaTTGTCCAGCACATTGTAGCTAactg
Hairpin ID: TR00820A.1; FWD Oligo: GTCTAGACACCTGGAGAAGCTGACGTT, RVS Oligo:
AGAATTCCCCAGGCAATAGCAAATGTT
Hairpin ID: TR01526A.1; FWD Oligo: AGTCTAGATGCGTGTTACCATTTGCATT, RVS Oligo:
AAGAATTCTTTGCATATCGCTGGGTACA
Hairpin ID: SH00791.N; FWD Oligo:
ctagcagtCAGCAAGAGACTAATGCGAAAtagttatattcaagcataTTTCGCATTAGTCTCTTGCTGgcg, RVS
Oligo: aattcgcCAGCAAGAGACTAATGCGAAAtatgcttgaatataactaTTTCGCATTAGTCTCTTGCTGactg
Hairpin ID: SH00746.N; FWD Oligo:
ctagcagtTTGGACCGAGAGTCAGGATAAtagttatattcaagcataTTATCCTGACTCTCGGTCCAAgcg, RVS
Oligo: aattcgcTTGGACCGAGAGTCAGGATAAtatgcttgaatataactaTTATCCTGACTCTCGGTCCAAactg
Hairpin ID: SH00969.N; FWD Oligo:
ctagcagtCAGCTAGGGCATTAAGTTAAAtagttatattcaagcataTTTAACTTAATGCCCTAGCTGgcg, RVS
Oligo: aattcgcCAGCTAGGGCATTAAGTTAAAtatgcttgaatataactaTTTAACTTAATGCCCTAGCTGactg
Hairpin ID: TR01214P.1; FWD Oligo: AGTCTAGACGGGGTCAACATCTGCTATC, RVS Oligo:
AAGAATTCAGGAACTGCATTTGGTTTGG
Hairpin ID: TR01216P.1; FWD Oligo: AGTCTAGAGCAGCAACTTGAGATGGACA, RVS Oligo:
AAGAATTCATCGCCACTAGCATTGAAGG
Hairpin ID: SH00618.N; FWD Oligo:
ctagcagtCAAGCTCAAGATGGACATTAAtagttatattcaagcataTTAATGTCCATCTTGAGCTTGgcg, RVS
Oligo: aattcgcCAAGCTCAAGATGGACATTAAtatgcttgaatataactaTTAATGTCCATCTTGAGCTTGactg
Hairpin ID: TR02098P.1; FWD Oligo: CACCGAATTCGCAGGAAATCAAAAGCGAAG, RVS Oligo:
GTGTCCATAGCGAAGGGTGT
Hairpin ID: TR02099P.1; FWD Oligo: CACCGAATTCACTACCAACCCAACGTCCAG, RVS Oligo:
TTTTGTCCATTGGCGACATA
Hairpin ID: TR01664A.1; FWD Oligo: AGTCTAGAGAATCACACAGCCAGAACGA, RVS Oligo:
AAGAATTCCGTCCTCTCCAAAATCCAAG
Hairpin ID: TR01665A.1; FWD Oligo: AGTCTAGAATAGGCCTTCACTCGTCCCT, RVS Oligo:
AAGAATTCGACCAAGGTGACATCTGCCT
Hairpin ID: TR00536A.1; FWD Oligo: GTCTAGATGGATGATTCTGAAGAGGGG, RVS Oligo:
AGAATTCACCGGACGTGCAGTAATAGG
Hairpin ID: SH01367.N2; FWD Oligo:
ctagcagtCAGATAGTAGTTGGCGGTCAAtagttatattcaagcataTTGACCGCCAACTACTATCTGgcg, RVS
Oligo: aattcgcCAGATAGTAGTTGGCGGTCAAtatgcttgaatataactaTTGACCGCCAACTACTATCTGactg
Hairpin ID: TR04564P.1; FWD Oligo: AAGAATTCAATGCAACGTGTCCTGGTCT, RVS Oligo:
AGTCTAGACATTTCCAGGTCGTCGAGTT
Hairpin ID: TR02100P.1; FWD Oligo: CACCGAATTCATCGATCTACACCGCTGGAC, RVS Oligo:
CGCCGTTAATGTTGTTACGA
Hairpin ID: SH01671.N; FWD Oligo:
ctagcagtCGCGAAATGTTTGACAAGCTAtagttatattcaagcataTAGCTTGTCAAACATTTCGCGgcg, RVS
Oligo: aattcgcCGCGAAATGTTTGACAAGCTAtatgcttgaatataactaTAGCTTGTCAAACATTTCGCGactg
Hairpin ID: SH00327.N; FWD Oligo:
ctagcagtCAGGTCATCCTCAGCAATCTAtagttatattcaagcataTAGATTGCTGAGGATGACCTGgcg, RVS
Oligo: aattcgcCAGGTCATCCTCAGCAATCTAtatgcttgaatataactaTAGATTGCTGAGGATGACCTGactg
Hairpin ID: TR02101P.1; FWD Oligo: CACCGAATTCTGCAACAAAGGAAGTGCAAG, RVS Oligo:
TGGAACTTGGTCATTCGACA
Hairpin ID: TR02102P.1; FWD Oligo: CACCGAATTCCAAGTGATCAGCGATCTGGA, RVS Oligo:
GTAGCTTGACCAAGCGGTTC
Hairpin ID: TR02103P.1; FWD Oligo: AAGAATTCAAGTCGATTCACCCCATCAG, RVS Oligo:
AGACTAGTAAGGGGCTGGCTCTCATAAT
Hairpin ID: TR00525A.1; FWD Oligo: GTCTAGATTGCTCCGACTTCAAGACCT, RVS Oligo:
AGAATTCGCATCACGTAGGAGACAGCA
Hairpin ID: SH01865.N; FWD Oligo:
ctagcagtAACGTTAGATATTAAGTTAAAtagttatattcaagcataTTTAACTTAATATCTAACGTTgcg, RVS Oligo:
aattcgcAACGTTAGATATTAAGTTAAAtatgcttgaatataactaTTTAACTTAATATCTAACGTTactg
Hairpin ID: SH01672.N; FWD Oligo:
ctagcagtTAGAGAATAGTTATACACTAAtagttatattcaagcataTTAGTGTATAACTATTCTCTAgcg, RVS Oligo:
aattcgcTAGAGAATAGTTATACACTAAtatgcttgaatataactaTTAGTGTATAACTATTCTCTAactg
Hairpin ID: TR02608P.1; FWD Oligo: AAGAATTCCGAAGTTCAATTCGTGGACA, RVS Oligo:
AGTCTAGAGTTCAAGTCCTTGCAAACGG
Hairpin ID: TR00486A.1; FWD Oligo: GTCTAGACGAGTTGGCTATCCCAATGT, RVS Oligo:
AGAATTCCGCTTTGAATTGCTGTTTTG
Hairpin ID: SH00043.N; FWD Oligo:
ctagcagtCCCAATGTTGTAATTGTTTAAtagttatattcaagcataTTAAACAATTACAACATTGGGgcg, RVS Oligo:
aattcgcCCCAATGTTGTAATTGTTTAAtatgcttgaatataactaTTAAACAATTACAACATTGGGactg
Hairpin ID: SH00463.N; FWD Oligo:
ctagcagtCAGAAGTTAATTGCAAATAAAtagttatattcaagcataTTTATTTGCAATTAACTTCTGgcg, RVS Oligo:
aattcgcCAGAAGTTAATTGCAAATAAAtatgcttgaatataactaTTTATTTGCAATTAACTTCTGactg
Hairpin ID: TR01888P.1; FWD Oligo: AAGAATTCTGCCATCCTAATTGTGGTCA, RVS Oligo:
AGACTAGTCTCTGCCTGCATCATTTTGA
Hairpin ID: TR00899P.1; FWD Oligo: AGTCTAGAGGAGTCTATCATGCGAAGGC, RVS Oligo:
AAGAATTCCGTGGGAGGATCCAAAACTA
Hairpin ID: SH01014.N; FWD Oligo:
ctagcagtCTGGAACAACTTCAACACGAAtagttatattcaagcataTTCGTGTTGAAGTTGTTCCAGgcg, RVS
Oligo: aattcgcCTGGAACAACTTCAACACGAAtatgcttgaatataactaTTCGTGTTGAAGTTGTTCCAGactg
Hairpin ID: SH01015.N; FWD Oligo:
ctagcagtACGCTGGTGTCGACAAACAAAtagttatattcaagcataTTTGTTTGTCGACACCAGCGTgcg, RVS
Oligo: aattcgcACGCTGGTGTCGACAAACAAAtatgcttgaatataactaTTTGTTTGTCGACACCAGCGTactg
Hairpin ID: TR01788P.1; FWD Oligo: CACCGAATTCACAGGAGTTCGACTTGCCAT, RVS Oligo:
AGTGCTTTGTGTCACATCGG
Hairpin ID: TR00353P.1; FWD Oligo: GTCTAGAACGACTAACAACGCTGTCCC, RVS Oligo:
AGAATTCGCACTCATCGTAAAAGCCGT
Hairpin ID: TR02609P.1; FWD Oligo: AAGAATTCATGAAGACCAGCACGGATTC, RVS Oligo:
AGTCTAGATCACTGCATCTTCATCGTCC
Hairpin ID: SH00220.N; FWD Oligo:
ctagcagtAAGGACATTACTAAGTATATAtagttatattcaagcataTATATACTTAGTAATGTCCTTgcg, RVS Oligo:
aattcgcAAGGACATTACTAAGTATATAtatgcttgaatataactaTATATACTTAGTAATGTCCTTactg
Hairpin ID: TR01061P.1; FWD Oligo: AGTCTAGACAGTTCAACATCTTTCCGGC, RVS Oligo:
AAGAATTCAGATCGTGTGATCGGAGAGG
Hairpin ID: TR01879P.1; FWD Oligo: CACCGAATTCTCCCACACCTGTCTGACATC, RVS Oligo:
GCTTAGATTCGGGCTGTTGA
Hairpin ID: TR00398P.1; FWD Oligo: GTCTAGATCACGCCTACAAGATCATCG, RVS Oligo:
AGAATTCGGTCTCGTTGTCAAGGTGGT
Hairpin ID: TR02484P.1; FWD Oligo: AAGAATTCGTTCCCGCCTATCAGTACCA, RVS Oligo:
AGTCTAGATGTTCTCCCTGAAATCGAGC
Hairpin ID: TR01484A.1; FWD Oligo: AGTCTAGAGCCAGCGAAAGGACTACAAG, RVS Oligo:
AAGAATTCCAGATAGTTCCTGGCGCACT
Hairpin ID: TR02460P.1; FWD Oligo: AAGAATTCGAGAGGACTACTGTTCGGCG, RVS Oligo:
AGTCTAGAGGTTTTTGGGTTTACGGGTT
Hairpin ID: TR00879P.1; FWD Oligo: AGTCTAGATGGCTCGAGTTGATCAGATG, RVS Oligo:
AAGAATTCATTCCTGGATTGGGGTTTTC
Hairpin ID: TR02106P.1; FWD Oligo: CACCGAATTCACCAGTTGGAGTCCTTGTCG, RVS Oligo:
GGTCTGGTCGGCTTATTCAA
Hairpin ID: TR02491P.1; FWD Oligo: AAGAATTCTCTGCAGGAGTTGGAGGAGT, RVS Oligo:
AGTCTAGATTTGGAGCCCAATCTTGTTC
Hairpin ID: TR02309P.1; FWD Oligo: CACCGAATTCTCGATCTGGAGGAGTCCAAG, RVS Oligo:
TTGTTCAGCACCGTCATGTT
Hairpin ID: SH00221.N; FWD Oligo:
ctagcagtCAGCGTGTCCAAGATGATCAAtagttatattcaagcataTTGATCATCTTGGACACGCTGgcg, RVS
Oligo: aattcgcCAGCGTGTCCAAGATGATCAAtatgcttgaatataactaTTGATCATCTTGGACACGCTGactg
Hairpin ID: TR04522P.1; FWD Oligo: AAGAATTCAAGAAGCATGATGAAGGGGA, RVS Oligo:
AGTCTAGAGTTGGTTCGGCTCTTGTGAT
Hairpin ID: TR02722P.1; FWD Oligo: AAGAATTCCCATGTACATTGCTGATGGC, RVS Oligo:
AGTCTAGAGGAATTGACCCTCCTCGAAT
Hairpin ID: TR02359P.1; FWD Oligo: AAGAATTCAGCCACAGCAGTTAGCGAGT, RVS Oligo:
AGTCTAGAGGCACACGGTCTGGATATTT
Hairpin ID: TR00324P.1; FWD Oligo: GTCTAGAGCCAAGAGGATCAGTTCTGC, RVS Oligo:
AGAATTCCGCCATTTTGTCAGCCTATT
Hairpin ID: TR01537P.1; FWD Oligo: AAGAATTCGTGAATGTCGTGCGTGATTT, RVS Oligo:
AGTCTAGATGATCATTGAATCGCAGCAT
Hairpin ID: SH00400.N; FWD Oligo:
ctagcagtCAAGCTATAGTTGTATAGCAAtagttatattcaagcataTTGCTATACAACTATAGCTTGgcg, RVS Oligo:
aattcgcCAAGCTATAGTTGTATAGCAAtatgcttgaatataactaTTGCTATACAACTATAGCTTGactg
Hairpin ID: TR01654A.1; FWD Oligo: AGTCTAGAACACCTCTGACCGTTGATCC, RVS Oligo:
AAGAATTCTTCACTTCGTGCATAGGCTG
Hairpin ID: TR01655A.1; FWD Oligo: AGTCTAGAACACCAGCGCATCTACAGTG, RVS Oligo:
AAGAATTCGAAGCCTCCTTTGCTTCCTT
Hairpin ID: TR01589P.1; FWD Oligo: AAGAATTCGCTTTAGCCACGAGATGAGG, RVS Oligo:
AGTCTAGAGATATTCGAAAGCCACGGAA
Hairpin ID: TR01789P.1; FWD Oligo: CACCGAATTCTCCAGGATCAATTCCAAAGC, RVS Oligo:
CTATGCTCAGCCAGACCTCC
Hairpin ID: SH01019.N; FWD Oligo:
ctagcagtCGGCAAGATCTGTGTGCTCAAtagttatattcaagcataTTGAGCACACAGATCTTGCCGgcg, RVS
Oligo: aattcgcCGGCAAGATCTGTGTGCTCAAtatgcttgaatataactaTTGAGCACACAGATCTTGCCGactg
Hairpin ID: SH01018.N; FWD Oligo:
ctagcagtCAGATGCAAGTGTTGCAATTAtagttatattcaagcataTAATTGCAACACTTGCATCTGgcg, RVS
Oligo: aattcgcCAGATGCAAGTGTTGCAATTAtatgcttgaatataactaTAATTGCAACACTTGCATCTGactg
Hairpin ID: TR00849P.1; FWD Oligo: AGTCTAGAGAAGTGGCGTCTGAGGAAAG, RVS Oligo:
AAGAATTCCCAGACGCTTATTCTGCTCC
Hairpin ID: TR01790P.1; FWD Oligo: CACCGAATTCAGGGATGTCTTTCATGCCAC, RVS Oligo:
TAAACTCCACCACAATGCGA
Hairpin ID: SH00629.N; FWD Oligo:
ctagcagtTACTAGTTGTATAATGCTCAAtagttatattcaagcataTTGAGCATTATACAACTAGTAgcg, RVS Oligo:
aattcgcTACTAGTTGTATAATGCTCAAtatgcttgaatataactaTTGAGCATTATACAACTAGTAactg
Hairpin ID: TR01423P.1; FWD Oligo: AGTCTAGAAATGCGTTATGCCCAAAGTC, RVS Oligo:
AAGAATTCCGGCCATCTTAACCGATAGA
Hairpin ID: TR01791P.1; FWD Oligo: CACCGAATTCGCGGATGCCTACTACTGCTC, RVS Oligo:
CTCGGAATGTTGGGTCCTTA
Hairpin ID: TR02386P.1; FWD Oligo: AAGAATTCACAAAAAGAACCAGCCGATG, RVS Oligo:
AGTCTAGAAGCTCTGATCCTGATCCCAA
Hairpin ID: TR01792P.1; FWD Oligo: CACCGAATTCGGTAGGAGCGTACGTGTGGT, RVS Oligo:
TGCTAAGTGCCAGACACTGC
Hairpin ID: TR01870P.1; FWD Oligo: CACCGAATTCCCAAGCATATCCAAAGCCAT, RVS Oligo:
GCGATGCAGTGACTTTTCCT
Hairpin ID: TR02109P.1; FWD Oligo: CACCGAATTCTGAAGCAAAGCAAGGATGTG, RVS Oligo:
GACACATATCGCACGTCCAC
Hairpin ID: TR00084A.1; FWD Oligo: GTCTAGACAGGGAGAGCATTATCAACGA, RVS Oligo:
AGAATTCCCCAAAACACATTACAGCAGC
Hairpin ID: TR02110P.1; FWD Oligo: CACCGAATTCTGATGGAGAGCATGGATGAG, RVS Oligo:
ACTCCACAAAGACGTGACCC
Hairpin ID: TR01934P.1; FWD Oligo: CACCGAATTCACATGAAAACGTTGCGAACA, RVS Oligo:
CGCTAATCTTACTGCCAGCC
Hairpin ID: TR02326P.1; FWD Oligo: CACCGAATTCAACAGCTCCGACGACAAGAT, RVS Oligo:
GGTCTTCACTTGCTCCAAGC
Hairpin ID: TR01185P.1; FWD Oligo: AGTCTAGAGATCTACGTCCGGCAATGAT, RVS Oligo:
AAGAATTCACTTTACGGAACCTGGGCTT
Hairpin ID: TR01705P.1; FWD Oligo: CACCGAATTCTTCCTCTTCACGCTCTCCAT, RVS Oligo:
TGTTTTCCAAACACATTGGG
Hairpin ID: SH01370.N2; FWD Oligo:
ctagcagtCTAGACTATACAGATTGTAAAtagttatattcaagcataTTTACAATCTGTATAGTCTAGgcg, RVS Oligo:
aattcgcCTAGACTATACAGATTGTAAAtatgcttgaatataactaTTTACAATCTGTATAGTCTAGactg
Hairpin ID: TR01586A.1; FWD Oligo: AGTCTAGAGGTTCTCCAGACAGAGCAGG, RVS Oligo:
AAGAATTCTTTGTCATCCTCCCGAAGAC
Hairpin ID: TR02111P.1; FWD Oligo: CACCGAATTCGGACTGTATCCGGCCAACTA, RVS Oligo:
CGGCTGACCACATAAAAGGT
Hairpin ID: SH00223.N; FWD Oligo:
ctagcagtCCGAATGTTCAAGCAAGATTAtagttatattcaagcataTAATCTTGCTTGAACATTCGGgcg, RVS
Oligo: aattcgcCCGAATGTTCAAGCAAGATTAtatgcttgaatataactaTAATCTTGCTTGAACATTCGGactg
Hairpin ID: SH00224.N; FWD Oligo:
ctagcagtGACGACGAGGTTATCAAGATAtagttatattcaagcataTATCTTGATAACCTCGTCGTCgcg, RVS
Oligo: aattcgcGACGACGAGGTTATCAAGATAtatgcttgaatataactaTATCTTGATAACCTCGTCGTCactg
Hairpin ID: TR02112P.1; FWD Oligo: CACCGAATTCGATTTCACGGAGGAGGTCAA, RVS Oligo:
CCGAGTCTTCGGTAGGGAAT
Hairpin ID: TR00126A.1; FWD Oligo: GTCTAGACATTCCTGATCAAGGAGGGA, RVS Oligo:
AGAATTCGATAGCGGAAAAGCAGTTCG
Hairpin ID: SH01715.N; FWD Oligo:
ctagcagtTTGGACAAGACTATCGAAATAtagttatattcaagcataTATTTCGATAGTCTTGTCCAAgcg, RVS Oligo:
aattcgcTTGGACAAGACTATCGAAATAtatgcttgaatataactaTATTTCGATAGTCTTGTCCAAactg
Hairpin ID: SH01758.N; FWD Oligo:
ctagcagtCCGGAGCTCTGTACTACGATAtagttatattcaagcataTATCGTAGTACAGAGCTCCGGgcg, RVS
Oligo: aattcgcCCGGAGCTCTGTACTACGATAtatgcttgaatataactaTATCGTAGTACAGAGCTCCGGactg
Hairpin ID: TR00109A.1; FWD Oligo: GTCTAGAATGGTGGTTTTCTACCGCTG, RVS Oligo:
AGAATTCTAAAACCCCAGTCGATTTGC
Hairpin ID: TR01407P.1; FWD Oligo: AGTCTAGAGGCTCTTCTTTGTGCGTTTC, RVS Oligo:
AAGAATTCATTGGCCGTGTAGATCTCGT
Hairpin ID: TR01793P.1; FWD Oligo: CACCGAATTCGATTTTCCGAGAACTCAGCG, RVS Oligo:
CGAGGTGCCCATTCCTAATA
Hairpin ID: TR02435P.1; FWD Oligo: AAGAATTCCCGCAGACAAAGTACCCAAT, RVS Oligo:
AGTCTAGATGTTCTGTGTTCGTTTTGGC
Hairpin ID: TR02476P.1; FWD Oligo: AAGAATTCGGCCATAAATCTGCTGTTGG, RVS Oligo:
AGTCTAGACCCATTCATGCACACACATT
Hairpin ID: TR02658P.1; FWD Oligo: AAGAATTCGAGACACACACACGCACTCA, RVS Oligo:
AGTCTAGAGTATTTGCGACCATGGCAGT
Hairpin ID: TR01794P.1; FWD Oligo: CACCGAATTCCCGTATTGAACCGTCCACTT, RVS Oligo:
CACAGATGCTGACCAAGGAA
Hairpin ID: TR01082P.1; FWD Oligo: AGTCTAGAAGTCGGTGGTTGTTGATCGT, RVS Oligo:
AAGAATTCGACAGGACTCTCCTGAACGG
Hairpin ID: TR02321P.1; FWD Oligo: CACCGAATTCTCCGTACCTGGTTTACCTGC, RVS Oligo:
GGAGACAATGCCACAAACCT
Hairpin ID: SH01674.N; FWD Oligo:
ctagcagtCAAGTGCTTGGAGCTATATAAtagttatattcaagcataTTATATAGCTCCAAGCACTTGgcg, RVS
Oligo: aattcgcCAAGTGCTTGGAGCTATATAAtatgcttgaatataactaTTATATAGCTCCAAGCACTTGactg
Hairpin ID: TR02434P.1; FWD Oligo: AAGAATTCCCCCAAAAACAACTGCAAAT, RVS Oligo:
AGTCTAGAACTTTTACAACCGGCAATCG
Hairpin ID: TR01706P.1; FWD Oligo: CACCGAATTCGAAGATCCTCTCGCTGATGG, RVS Oligo:
ACACTACGCTGAATCGAACG
Hairpin ID: TR01455P.1; FWD Oligo: AGTCTAGAGAGGAACTCTGGCTGGACTG, RVS Oligo:
AAGAATTCAACTTGCTCAGCGATTCCAT
Hairpin ID: TR01456P.1; FWD Oligo: AGTCTAGAAGCGAAATTCTCTACACCGC, RVS Oligo:
AAGAATTCTTCATTCGATTTCTCGCTCA
Hairpin ID: TR01593P.1; FWD Oligo: AAGAATTCCTAACGATCCTGCTGTGCAA, RVS Oligo:
AGTCTAGATCTGCATCGTAGCTGTCACC
Hairpin ID: SH00704.N; FWD Oligo:
ctagcagtCAGCATAAATTTAGCTCGAAAtagttatattcaagcataTTTCGAGCTAAATTTATGCTGgcg, RVS Oligo:
aattcgcCAGCATAAATTTAGCTCGAAAtatgcttgaatataactaTTTCGAGCTAAATTTATGCTGactg
Hairpin ID: TR02113P.1; FWD Oligo: CACCGAATTCAGCCTGCCTGAAAAACTCAA, RVS Oligo:
CTTTTACGCCGATGGTGAAT
Hairpin ID: TR02114P.1; FWD Oligo: CACCGAATTCCCGGAAACAGATTCGAAAAC, RVS Oligo:
ATGCACTGCCTAGGGGTATG
Hairpin ID: TR02115P.1; FWD Oligo: CACCGAATTCGTGTAGCCCTGGTTGGAAGA, RVS Oligo:
GCAAATCGCAACAGAAGACA
Hairpin ID: TR00096A.1; FWD Oligo: GTCTAGAAACGAAAATCTCCATGCACC, RVS Oligo:
AGAATTCGCAAAAAGCATGCAAACTCA
Hairpin ID: TR01573A.1; FWD Oligo: AGTCTAGACGACCTGGAAAACATCGTCT, RVS Oligo:
AAGAATTCTTAAGCAGCCGGTAGATGCT
Hairpin ID: TR02610P.1; FWD Oligo: AACAATTGAAGTCTATCCCTTTGCCCGT, RVS Oligo:
AGTCTAGAATGCCGTTGGGAAATATGAA
Hairpin ID: TR00136A.1; FWD Oligo: GTCTAGACAAACGGAGTGCATATGGTG, RVS Oligo:
AGAATTCAGGCTGTGCACTCATCTCCT
Hairpin ID: SH00225.N; FWD Oligo:
ctagcagtCTCGGTGTTCATCTGCTTCAAtagttatattcaagcataTTGAAGCAGATGAACACCGAGgcg, RVS
Oligo: aattcgcCTCGGTGTTCATCTGCTTCAAtatgcttgaatataactaTTGAAGCAGATGAACACCGAGactg
Hairpin ID: TR01795P.1; FWD Oligo: CACCGAATTCCCATAACCAGGTCAGCGTTT, RVS Oligo:
GCCAGTCCGATAGTTTGGAA
Hairpin ID: TR00840A.1; FWD Oligo: GTCTAGACGTGATCCCAGTTCTCCTGT, RVS Oligo:
AGAATTCTTAGGAGTCGCAGTATGCCC
Hairpin ID: SH00714.N; FWD Oligo:
ctagcagtGTCCCAATGGATTCAATTCAAtagttatattcaagcataTTGAATTGAATCCATTGGGACgcg, RVS
Oligo: aattcgcGTCCCAATGGATTCAATTCAAtatgcttgaatataactaTTGAATTGAATCCATTGGGACactg
Hairpin ID: TR01562A.1; FWD Oligo: AGTCTAGAAGATCTTGGTGCCGAGTGAC, RVS Oligo:
AAGAATTCCCTGATCAGTGTGATGGTGG
Hairpin ID: TR01796P.1; FWD Oligo: CACCGAATTCGGACGAAACGCCAGTGTATT, RVS Oligo:
TGGGTCCGGTATACGAAGTC
Hairpin ID: TR02462P.1; FWD Oligo: AAGAATTCGATTGGTCACCACACTGCTG, RVS Oligo:
AGTCTAGATTATAACGCTCCAACAGGGC
Hairpin ID: TR00253A.1; FWD Oligo: GTCTAGAACCACTCGATGGATCTGGAC, RVS Oligo:
AGAATTCCCTTGGCCTTGTACGTGATT
Hairpin ID: TR01797P.1; FWD Oligo: CACCGAATTCACCGAGCTGGACATAGATGG, RVS Oligo:
TTCAAAGCAAACGTCTGTCG
Hairpin ID: TR01798P.1; FWD Oligo: CACCGAATTCACACTTGGGCAACGGACTAC, RVS Oligo:
TGATGGTCGTCGCACATTAT
Hairpin ID: TR00904P.1; FWD Oligo: AGTCTAGAGTCAGAGAGTTCGCAACACG, RVS Oligo:
AAGAATTCCGCTTCTGTTTGTGTGCCTA
Hairpin ID: TR01206P.1; FWD Oligo: AGTCTAGAAATATGTACGTGCCCCAAGC, RVS Oligo:
AAGAATTCTGCCAAAAGGGGAATATCAC
Hairpin ID: TR00826A.1; FWD Oligo: GTCTAGAGCATGGGTAAAGCCAAATGT, RVS Oligo:
AGAATTCTTGGTTTAAGATGCTTGGGC
Hairpin ID: SH00847.N; FWD Oligo:
ctagcagtTTGGACAAAGATGGCTTGTTAtagttatattcaagcataTAACAAGCCATCTTTGTCCAAgcg, RVS
Oligo: aattcgcTTGGACAAAGATGGCTTGTTAtatgcttgaatataactaTAACAAGCCATCTTTGTCCAAactg
Hairpin ID: TR01800P.1; FWD Oligo: CACCGAATTCCGCCTCTTTTGGACATTCAT, RVS Oligo:
TCCGTATCGGTTTAACTGGC
Hairpin ID: TR01801P.1; FWD Oligo: CACCGAATTCGTTGCTGGAGGACCCTGATA, RVS Oligo:
TAACGACCCCTGAGAGTTGC
Hairpin ID: TR01802P.1; FWD Oligo: CACCGAATTCAGTTCCTGGGCCACAGACTA, RVS Oligo:
GTATGAGATCGAAGGGCTCG
Hairpin ID: TR01679P.1; FWD Oligo: CACCGTGTCGGTGTCTCCAAGGAT, RVS Oligo:
TGGATGCCACACTTGTGATT
Hairpin ID: SH01856.N; FWD Oligo:
ctagcagtTTGTTGCTGCTTCAAATATAAtagttatattcaagcataTTATATTTGAAGCAGCAACAAgcg, RVS Oligo:
aattcgcTTGTTGCTGCTTCAAATATAAtatgcttgaatataactaTTATATTTGAAGCAGCAACAAactg
Hairpin ID: TR04631P.1; FWD Oligo: AAGAATTCAAATTTAGGGCCCAATGGAG, RVS Oligo:
AGTCTAGAATCGATTGTGACAGTGCGTC
Hairpin ID: TR01415P.1; FWD Oligo: AGTCTAGACGAGCGTTTGCAGAGTGTAG, RVS Oligo:
AAGAATTCACGAGTAGTAGCCGGTGGTG
Hairpin ID: SH00628.N; FWD Oligo:
ctagcagtCAGATAAATGTTCAAACGAAAtagttatattcaagcataTTTCGTTTGAACATTTATCTGgcg, RVS Oligo:
aattcgcCAGATAAATGTTCAAACGAAAtatgcttgaatataactaTTTCGTTTGAACATTTATCTGactg
Hairpin ID: TR00883P.1; FWD Oligo: AGTCTAGAGCAGTTGACGATGAGCGATA, RVS Oligo:
AAGAATTCCGTCCTCCTGCTTGAGTTTC
Hairpin ID: TR01803P.1; FWD Oligo: CACCGAATTCGCGACATTGAGAACGATGAA, RVS Oligo:
TATGAGGCCCACTTCGATTC
Hairpin ID: TR01935P.1; FWD Oligo: CACCGAATTCGGGAGACACAGAAGCTGGAC, RVS Oligo:
GCTCAGAGAAATCGACGACC
Hairpin ID: TR01722P.1; FWD Oligo: CACCGAATTCACGCCAAGCACAAAAATAGC, RVS Oligo:
ACTCGGTGGACTTGTCGTTC
Hairpin ID: TR01598P.1; FWD Oligo: AAGAATTCTATCCAGGGTCAGAGATCGG, RVS Oligo:
AGTCTAGACAACTGGAACCACCGAAGAT
Hairpin ID: SH00701.N; FWD Oligo:
ctagcagtCTGGCTAAGTGTGGACAGAAAtagttatattcaagcataTTTCTGTCCACACTTAGCCAGgcg, RVS
Oligo: aattcgcCTGGCTAAGTGTGGACAGAAAtatgcttgaatataactaTTTCTGTCCACACTTAGCCAGactg
Hairpin ID: TR01962P.1; FWD Oligo: CACCGAATTCAGTTGGCATTCACCCAGAAC, RVS Oligo:
CCGTAGTTGCTTCCCAGGTA
Hairpin ID: TR04494P.1; FWD Oligo: AAGAATTCGCAGTGGCTGAAGATTGTGA, RVS Oligo:
AGTCTAGACCTCCCCAGACTTAACCTCC
Hairpin ID: TR02647P.1; FWD Oligo: AAGAATTCGCAAGATGGCTCTTCGATTC, RVS Oligo:
AGTCTAGACGAGATCAGTTCTTGGAGGC
Hairpin ID: TR00573A.1; FWD Oligo: GTCTAGATGGTGGACCAAGAAAACACA, RVS Oligo:
AGAATTCCACTGTGGTCAGCAGCATGT
Hairpin ID: TR02455P.1; FWD Oligo: AAGAATTCGAAGGACGAGGTGATCTTCG, RVS Oligo:
AGTCTAGATCACAATCAGCGACTGGAAG
Hairpin ID: SH00439.N; FWD Oligo:
ctagcagtAGCGGTTGTACTGTTTAGAAAtagttatattcaagcataTTTCTAAACAGTACAACCGCTgcg, RVS
Oligo: aattcgcAGCGGTTGTACTGTTTAGAAAtatgcttgaatataactaTTTCTAAACAGTACAACCGCTactg
Hairpin ID: TR02361P.1; FWD Oligo: AAGAATTCCAACATCAAGTTGCACTGGG, RVS Oligo:
AGTCTAGATGCACAGACTCTTACGCTGG
Hairpin ID: SH00707.N; FWD Oligo:
ctagcagtCCGGTGGTCACCTACAAGATAtagttatattcaagcataTATCTTGTAGGTGACCACCGGgcg, RVS
Oligo: aattcgcCCGGTGGTCACCTACAAGATAtatgcttgaatataactaTATCTTGTAGGTGACCACCGGactg
Hairpin ID: TR02117P.1; FWD Oligo: CACCGAATTCCACTGCCAGAATGGAAGTCA, RVS Oligo:
GTCCTTCGTGAAAGAGTCGC
Hairpin ID: TR00832A.1; FWD Oligo: GTCTAGACTGGACACTTGCCTGCTACA, RVS Oligo:
AGAATTCGTGGCCTGTTTCTACACCGT
Hairpin ID: TR02472P.1; FWD Oligo: AAGAATTCGGACACGGCTATTTGAAGGA, RVS Oligo:
AGTCTAGAGTTCTGCGGGTGTGAGAGTC
Hairpin ID: TR01889P.1; FWD Oligo: CACCGAATTCATGATGGCGGTGGATATGAT, RVS Oligo:
TTCCGACAGCCAATTACACA
Hairpin ID: TR02295P.1; FWD Oligo: CACCGAATTCCTTACTCGTGACCACGCTGA, RVS Oligo:
CGAACTCGTTTTTGTGGGTT
Hairpin ID: TR04488P.1; FWD Oligo: AAGAATTCTAAGATATCCCAAGGGCGTG, RVS Oligo:
AGTCTAGAGGCGCTAGATTGAGTATGGC
Hairpin ID: TR04597P.1; FWD Oligo: AAGAATTCTAAGATATCCCAAGGGCGTG, RVS Oligo:
AGTCTAGAGGCGCTAGATTGAGTATGGC
Hairpin ID: TR02428P.1; FWD Oligo: AAGAATTCCAGTTCATCTTTGGGCGAAT, RVS Oligo:
AGTCTAGATGGATAGATGACGGCAATGA
Hairpin ID: TR02420P.1; FWD Oligo: AAGAATTCCAAGCCCTCACTAAGCGAAC, RVS Oligo:
AGTCTAGATCTTGGTCCAGTTCCGATTC
Hairpin ID: SH00648.N; FWD Oligo:
ctagcagtACGCAACAAATTGAACGACTAtagttatattcaagcataTAGTCGTTCAATTTGTTGCGTgcg, RVS
Oligo: aattcgcACGCAACAAATTGAACGACTAtatgcttgaatataactaTAGTCGTTCAATTTGTTGCGTactg
Hairpin ID: SH00378.N; FWD Oligo:
ctagcagtCACAATATACGGACTAAATAAtagttatattcaagcataTTATTTAGTCCGTATATTGTGgcg, RVS Oligo:
aattcgcCACAATATACGGACTAAATAAtatgcttgaatataactaTTATTTAGTCCGTATATTGTGactg
Hairpin ID: TR01672A.1; FWD Oligo: AGTCTAGATCGTTTCGTTGACCATTCTG, RVS Oligo:
AAGAATTCGGAAGTCGCATAACATCCGT
Hairpin ID: TR02489P.1; FWD Oligo: AAGAATTCTCCAATTCTCCCAGGAACTG, RVS Oligo:
AGTCTAGAATACCCCGTATTCCCCGTAG
Hairpin ID: SH01352.N2; FWD Oligo:
ctagcagtTTGGTACATGTTCGCAATTAAtagttatattcaagcataTTAATTGCGAACATGTACCAAgcg, RVS Oligo:
aattcgcTTGGTACATGTTCGCAATTAAtatgcttgaatataactaTTAATTGCGAACATGTACCAAactg
Hairpin ID: SH01351.N2b; FWD Oligo:
ctagcagtTACCTGGTTGGTCTCTTCGAAtagttatattcaagcataTTCGAAGAGACCAACCAGGTAgcg, RVS
Oligo: aattcgcTACCTGGTTGGTCTCTTCGAAtatgcttgaatataactaTTCGAAGAGACCAACCAGGTAactg
Hairpin ID: TR02436P.1; FWD Oligo: AAGAATTCCCGTGTCCAAGTTTGGTTCT, RVS Oligo:
AGTCTAGAAAAAAGGAACCCGCAAAGTT
Hairpin ID: TR02118P.1; FWD Oligo: CACCGAATTCTTAATCCGCACACAGGCATA, RVS Oligo:
CTCCCTGGCGAATATCGTAA
Hairpin ID: TR00831A.1; FWD Oligo: GTCTAGATAAGCTAGCAACGTCCAGCA, RVS Oligo:
AGAATTCGAGTTGGTTGCTTGGTTGGT
Hairpin ID: SH00540.N; FWD Oligo:
ctagcagtCTCGGTCTTCTCGAAGACCTAtagttatattcaagcataTAGGTCTTCGAGAAGACCGAGgcg, RVS
Oligo: aattcgcCTCGGTCTTCTCGAAGACCTAtatgcttgaatataactaTAGGTCTTCGAGAAGACCGAGactg
Hairpin ID: TR02726P.1; FWD Oligo: AAGAATTCAACAACAGGGTGAGCATTCC, RVS Oligo:
AGTCTAGAGAGTAGGTGCCATCCACGTT
Hairpin ID: TR00021A.1; FWD Oligo: GTCTAGACACGTGCTATTGTGTACCCG, RVS Oligo:
AGAATTCTGCTATGGCTACCGCTTTCT
Hairpin ID: TR00022A.1; FWD Oligo: GTCTAGAGTTCTTCGGAGGAATCTCCC, RVS Oligo:
AGAATTCACCTCTGTCCAAAGGTGGTG
Hairpin ID: TR00712A.1; FWD Oligo: GTCTAGAGTACCGAACAGCTCCTCCAC, RVS Oligo:
AGAATTCATCCTGCAAATCTACACGCC
Hairpin ID: TR00329A.1; FWD Oligo: GTCTAGAGCAACGCGAATACCTCAAAT, RVS Oligo:
AGAATTCGCTTGAGATCCAAGGGTGAA
Hairpin ID: TR00329P.1; FWD Oligo: AAGAATTCGCAACGCGAATACCTCAAAT, RVS Oligo:
AGTCTAGAGCTTGAGATCCAAGGGTGAA
Hairpin ID: SH00394.N; FWD Oligo:
ctagcagtACGAATGTGTTGTTTCGTTAAtagttatattcaagcataTTAACGAAACAACACATTCGTgcg, RVS Oligo:
aattcgcACGAATGTGTTGTTTCGTTAAtatgcttgaatataactaTTAACGAAACAACACATTCGTactg
Hairpin ID: TR04527P.1; FWD Oligo: AAGAATTCTAACCATCGCCACTGACTTG, RVS Oligo:
AGTCTAGATGGCAATATTCTGGCATTCA
Hairpin ID: TR04523P.1; FWD Oligo: AAGAATTCGAGTTCACCAAAGCGGATTC, RVS Oligo:
AGTCTAGACGTATTCGTTGTGAACGTGG
Hairpin ID: TR00272A.1; FWD Oligo: GTCTAGAATGAAGTACAATGCGGGAGC, RVS Oligo:
AGAATTCGACTTGTGCCAGCTCCTTTC
Hairpin ID: TR01805P.1; FWD Oligo: CACCGAATTCGGACATGGTGCTGAATGAGA, RVS Oligo:
GGGATACCGATGAGGAAGGT
Hairpin ID: TR01063P.1; FWD Oligo: AGTCTAGAAGGCACGACTCCTGAACAAC, RVS Oligo:
AAGAATTCTTTACACCTTGAAGCAGCCA
Hairpin ID: TR00845A.1; FWD Oligo: GTCTAGAAACAAGTGCAGAATCGGAGC, RVS Oligo:
AGAATTCCCGCTATTGGTATCCTCGAA
Hairpin ID: TR00846A.1; FWD Oligo: GTCTAGACAAGCGTTAGTTGTTGCTGC, RVS Oligo:
AGAATTCGAAGCGCAACAGTTGGATCT
Hairpin ID: TR00777P.1; FWD Oligo: AAGAATTCGTTTGGCAGAGGAGCAGAAG, RVS Oligo:
AGTCTAGAGATGCAGCTCCTCCAGTCTT
Hairpin ID: TR01806P.1; FWD Oligo: CACCGAATTCAGTGGGGATTGTGCTACCTG, RVS Oligo:
CCTGCATTCTTGCTGACAAA
Hairpin ID: TR01807P.1; FWD Oligo: CACCGAATTCATGATGGCCTATGTAAGCGG, RVS Oligo:
GAGTCCAAATGGGTTGCAGT
Hairpin ID: TR01808P.1; FWD Oligo: CACCGAATTCATGTTCAGGCCCAACAGATG, RVS Oligo:
TGGTCCAACAAGCTAAGTGCT
Hairpin ID: TR01354P.1; FWD Oligo: AAGAATTCTGGTTAGAAAGGAGCCGCTA, RVS Oligo:
AGTCTAGACACTAGATCAGCCTCAGCCC
Hairpin ID: TR01549A.1; FWD Oligo: AGTCTAGAATATGCAACAGCAACCACCA, RVS Oligo:
AAGAATTCGACTGCCATAGGGATAGCCA
Hairpin ID: SH00226.N; FWD Oligo:
ctagcagtTAGGTTGTTATTTCGTTGTTAtagttatattcaagcataTAACAACGAAATAACAACCTAgcg, RVS Oligo:
aattcgcTAGGTTGTTATTTCGTTGTTAtatgcttgaatataactaTAACAACGAAATAACAACCTAactg
Hairpin ID: TR01189P.1; FWD Oligo: AGTCTAGAAGCCCTTGACCATCAAACAG, RVS Oligo:
AAGAATTCAAGCAACATGATCTCTGCGA
Hairpin ID: TR00787A.1; FWD Oligo: GTCTAGAGTGGTTTCGCAGTCCGTATT, RVS Oligo:
AGAATTCGCTCACTGCCAGAGTTTTCC
Hairpin ID: SH00990.N; FWD Oligo:
ctagcagtAACGATGTTGAACCCAAGATAtagttatattcaagcataTATCTTGGGTTCAACATCGTTgcg, RVS
Oligo: aattcgcAACGATGTTGAACCCAAGATAtatgcttgaatataactaTATCTTGGGTTCAACATCGTTactg
Hairpin ID: SH00991.N; FWD Oligo:
ctagcagtTCGATGAGTTCCAGATTGTTAtagttatattcaagcataTAACAATCTGGAACTCATCGAgcg, RVS
Oligo: aattcgcTCGATGAGTTCCAGATTGTTAtatgcttgaatataactaTAACAATCTGGAACTCATCGAactg
Hairpin ID: SH01112.Nb; FWD Oligo:
ctagcagtCTCCGTGATCGATGTGGTCAAtagttatattcaagcataTTGACCACATCGATCACGGAGgcg, RVS
Oligo: aattcgcCTCCGTGATCGATGTGGTCAAtatgcttgaatataactaTTGACCACATCGATCACGGAGactg
Hairpin ID: TR04565P.1; FWD Oligo: AAGAATTCCAAGAAGCCCTACGAGAACG, RVS Oligo:
AGTCTAGAGGCTAGCTCAAATCAGTGGC
Hairpin ID: SH00227.N; FWD Oligo:
ctagcagtCACCTACAACAAGGCGATCAAtagttatattcaagcataTTGATCGCCTTGTTGTAGGTGgcg, RVS
Oligo: aattcgcCACCTACAACAAGGCGATCAAtatgcttgaatataactaTTGATCGCCTTGTTGTAGGTGactg
Hairpin ID: TR00081A.1; FWD Oligo: GTCTAGATGATCGCTCAGTATTGCCAG, RVS Oligo:
AGAATTCGGTCTGGAGGGTATTGGGTT
Hairpin ID: TR00112A.1; FWD Oligo: GTCTAGAGGACCACGACTACCTGGAGA, RVS Oligo:
AGAATTCCTTCACATACATTGTGCCCG
Hairpin ID: SH00913.N; FWD Oligo:
ctagcagtCCGTTCGATAGTGGATTTGAAtagttatattcaagcataTTCAAATCCACTATCGAACGGgcg, RVS
Oligo: aattcgcCCGTTCGATAGTGGATTTGAAtatgcttgaatataactaTTCAAATCCACTATCGAACGGactg
Hairpin ID: SH00912.N; FWD Oligo:
ctagcagtCAGGTCAGAGAGGAACTGAAAtagttatattcaagcataTTTCAGTTCCTCTCTGACCTGgcg, RVS
Oligo: aattcgcCAGGTCAGAGAGGAACTGAAAtatgcttgaatataactaTTTCAGTTCCTCTCTGACCTGactg
Hairpin ID: TR01581A.1; FWD Oligo: AGTCTAGACGTGGCCAATCTGGTCTAAT, RVS Oligo:
AAGAATTCTTTGCTTCGCATTGTTTGAG
Hairpin ID: SH00547.N; FWD Oligo:
ctagcagtAACGAGTTCAACTACAAGCTAtagttatattcaagcataTAGCTTGTAGTTGAACTCGTTgcg, RVS
Oligo: aattcgcAACGAGTTCAACTACAAGCTAtatgcttgaatataactaTAGCTTGTAGTTGAACTCGTTactg
Hairpin ID: TR02152P.1; FWD Oligo: CACCGAATTCATTTTTGTGGGCGATCTGAG, RVS Oligo:
CGAATGCGTATCCTTTGTCC
Hairpin ID: SH00666.N; FWD Oligo:
ctagcagtAAGAATAACTGTAACACTATAtagttatattcaagcataTATAGTGTTACAGTTATTCTTgcg, RVS Oligo:
aattcgcAAGAATAACTGTAACACTATAtatgcttgaatataactaTATAGTGTTACAGTTATTCTTactg
Hairpin ID: TR02105P.1; FWD Oligo: CACCGAATTCAAAAGAAAGCACAGCCAGGA, RVS Oligo:
TTGAGCGTGTAGGTGGACTG
Hairpin ID: TR02104P.1; FWD Oligo: CACCGAATTCGGAGCAGAGGAGGTGACAAG, RVS Oligo:
CGTTTTGGCTGGACAATCTT
Hairpin ID: TR01811P.1; FWD Oligo: CACCGAATTCCACGCACCAGCTGATGTACT, RVS Oligo:
CACTCGGACCATTGTTGATG
Hairpin ID: TR03684P.1; FWD Oligo: AAGAATTCCTCCTCGAACAGAAACTCCG, RVS Oligo:
AGTCTAGATAGCGCTCCAGTTCCAGTTT
Hairpin ID: TR01812P.1; FWD Oligo: CACCGAATTCGGCAAGGACACTGACATCCT, RVS Oligo:
CCTTTAACCAAACAGGCAGG
Hairpin ID: TR02425P.1; FWD Oligo: AAGAATTCCAGGGATTTGCCTATCCTGA, RVS Oligo:
AGTCTAGAAAGGACGAGCTTCTGCACAT
Hairpin ID: TR00516A.1; FWD Oligo: GTCTAGATTGGAAACTCTGCGACACTG, RVS Oligo:
AGAATTCAGATGTCGGTGTTACCCTGC
Hairpin ID: TR01502A.1; FWD Oligo: AGTCTAGAATACGGCCAAGTGCTACAGG, RVS Oligo:
AAGAATTCTCGAAAGCTGGTGATGTCTG
Hairpin ID: TR02633P.1; FWD Oligo: AAGAATTCAAATGGCGACTCAAAATTGG, RVS Oligo:
AGTCTAGACGGGAGTCGACGTAGTTGAT
Hairpin ID: TR00304P.1; FWD Oligo: AAGAATTCTTCGGTTTGAATCTCTGCCT, RVS Oligo:
AGTCTAGACTCCATATTGCGGCTTTGTT
Hairpin ID: TR01813P.1; FWD Oligo: CACCGAATTCTGTTCTTCAGCAACTCTGCG, RVS Oligo:
GCTGGCCATTTTGAAGTGAT
Hairpin ID: TR01878P.1; FWD Oligo: CACCGAATTCATGGTCGATTAGTTCCGCAC, RVS Oligo:
GCTTAACCACCACACTGGCT
Hairpin ID: TR01023P.1; FWD Oligo: AGTCTAGAAATCGGTTCAGTCACTTGGG, RVS Oligo:
AAGAATTCTCCATGGCGATCAGTTATGA
Hairpin ID: TR01814P.1; FWD Oligo: CACCGAATTCCTTGGCATCGTACAGCAAGA, RVS Oligo:
TCGTCCACTACCCCAGAGTC
Hairpin ID: TR00102A.1; FWD Oligo: GTCTAGAACATTCTGCCAGGAACAACC, RVS Oligo:
AGAATTCTGAGTGTCTTACGCACCTGG
Hairpin ID: TR01707P.1; FWD Oligo: CACCGAATTCTCCTTAACGCTCCGAAGAGA, RVS Oligo:
TGGGGTACCACCAGTAGCTC
Hairpin ID: TR01528A.1; FWD Oligo: AGTCTAGAGCAATATTTTCGACGAGGGA, RVS Oligo:
AAGAATTCTGGCACGTTTTTCTGAATGA
Hairpin ID: TR02611P.1; FWD Oligo: AAGAATTCTTTACTCTCGCCATCCTGCT, RVS Oligo:
AGTCTAGATTATCGTGTCTCCCGAATGG
Hairpin ID: TR02712P.1; FWD Oligo: AAGAATTCGTGCCGTTTATTGCCAAGTT, RVS Oligo:
AGTCTAGAACATTGAGGTCCTGTAGGCG
Hairpin ID: SH00647.N; FWD Oligo:
ctagcagtTTGCATGAACATTGTCATCTAtagttatattcaagcataTAGATGACAATGTTCATGCAAgcg, RVS Oligo:
aattcgcTTGCATGAACATTGTCATCTAtatgcttgaatataactaTAGATGACAATGTTCATGCAAactg
Hairpin ID: TR02066P.1; FWD Oligo: AAGAATTCAGACATTCCTGTCCAATGCC, RVS Oligo:
AGTCTAGAATATGGCACCGTACTCCTCG
Hairpin ID: TR01229P.1; FWD Oligo: AGTCTAGAAATACCAGACGAGTGCCACC, RVS Oligo:
AAGAATTCGAGCAATAGATGCCCAGCTC
Hairpin ID: TR00271A.1; FWD Oligo: GTCTAGAACTGGATCTGTGCAGCAGTG, RVS Oligo:
AGAATTCTGGCCGTATTAGTTTGACCC
Hairpin ID: TR04430P.1; FWD Oligo: AAGAATTCCAGCATCAGCTTGACCGATA, RVS Oligo:
AGTCTAGATAATCCTTGGACCGAGAACG
Hairpin ID: TR01708P.1; FWD Oligo: CACCGAATTCGGGCTATATGCGCCAGTTAC, RVS Oligo:
AGGATGTCGCTCATGGAATC
Hairpin ID: SH00745.N; FWD Oligo:
ctagcagtCTCGGCGATTGTCGACAAGTAtagttatattcaagcataTACTTGTCGACAATCGCCGAGgcg, RVS
Oligo: aattcgcCTCGGCGATTGTCGACAAGTAtatgcttgaatataactaTACTTGTCGACAATCGCCGAGactg
Hairpin ID: TR00722A.1; FWD Oligo: GTCTAGACTGGCGTGTCTACGAGTTCA, RVS Oligo:
AGAATTCGTTCCGGATCGATCTTCTGA
Hairpin ID: TR00723A.1; FWD Oligo: GTCTAGACGATCAGGTGACATACCGTG, RVS Oligo:
AGAATTCGCCTTCTTGTGCTCCTTGAC
Hairpin ID: TR01815P.1; FWD Oligo: CACCGAATTCCGCAGGAAGCACAAGATACA, RVS Oligo:
TCGGGGTCTCGAAATCTATG
Hairpin ID: SH00430.N; FWD Oligo:
ctagcagtCTGCGAAGTGAGCGAGGTTAAtagttatattcaagcataTTAACCTCGCTCACTTCGCAGgcg, RVS
Oligo: aattcgcCTGCGAAGTGAGCGAGGTTAAtatgcttgaatataactaTTAACCTCGCTCACTTCGCAGactg
Hairpin ID: TR02505P.1; FWD Oligo: AAGAATTCAGGCAATCAATCCAAAGGTG, RVS Oligo:
AGTCTAGAGGTTCAGCTCGATAGCCTTG
Hairpin ID: TR02340P.1; FWD Oligo: AAGAATTCTCCGGACAAGTACCACATGA, RVS Oligo:
AGTCTAGAATCGATAGAATCTGGTGGCG
Hairpin ID: TR02340P.1hm; FWD Oligo: AAGAATTCTCCGGACAAGTACCACATGA, RVS Oligo:
AGTCTAGAATCGATAGAATCTGGTGGCG
Hairpin ID: TR04490P.1; FWD Oligo: AAGAATTCTGTCTCCACCCGTTACCTTC, RVS Oligo:
AGTCTAGAGTCGGTGGATATGATGGTCC
Hairpin ID: TR04491P.1; FWD Oligo: AAGAATTCCAACATTTTACGAGCGCTGA, RVS Oligo:
AGTCTAGAGATAAAGGTCCGATCCACGA
Hairpin ID: SH00890.N; FWD Oligo:
ctagcagtATGGACATAGATTTCAAATAAtagttatattcaagcataTTATTTGAAATCTATGTCCATgcg, RVS Oligo:
aattcgcATGGACATAGATTTCAAATAAtatgcttgaatataactaTTATTTGAAATCTATGTCCATactg
Hairpin ID: SH00891.N; FWD Oligo:
ctagcagtAGCGATGTTCCACAACCTATAtagttatattcaagcataTATAGGTTGTGGAACATCGCTgcg, RVS
Oligo: aattcgcAGCGATGTTCCACAACCTATAtatgcttgaatataactaTATAGGTTGTGGAACATCGCTactg
Hairpin ID: SH00842.N; FWD Oligo:
ctagcagtATCGATTTGTAGATAAATAAAtagttatattcaagcataTTTATTTATCTACAAATCGATgcg, RVS Oligo:
aattcgcATCGATTTGTAGATAAATAAAtatgcttgaatataactaTTTATTTATCTACAAATCGATactg
Hairpin ID: SH01114.Nb; FWD Oligo:
ctagcagtTACATGTGAAACTTTGTTTAAtagttatattcaagcataTTAAACAAAGTTTCACATGTAgcg, RVS Oligo:
aattcgcTACATGTGAAACTTTGTTTAAtatgcttgaatataactaTTAAACAAAGTTTCACATGTAactg
Hairpin ID: SH00633.Nb; FWD Oligo:
ctagcagtCCGACCAAGACCACTGTAGAAtagttatattcaagcataTTCTACAGTGGTCTTGGTCGGgcg, RVS
Oligo: aattcgcCCGACCAAGACCACTGTAGAAtatgcttgaatataactaTTCTACAGTGGTCTTGGTCGGactg
Hairpin ID: TR04492P.1; FWD Oligo: AAGAATTCGCTGGAGTCAGCCTAATTGC, RVS Oligo:
AGTCTAGATCGGGGAAATGAAGAAGATG
Hairpin ID: TR02072P.1; FWD Oligo: CGACAGGATCTCCGCTACTC, RVS Oligo:
AAGTGAATTCGTCCGTGTTGGAATTCGTCT
Hairpin ID: TR02730P.1; FWD Oligo: AAGAATTCCTTTTGGGCACAAACTGGAT, RVS Oligo:
AGTCTAGATTTCCGTGCTTATAGTGGGC
Hairpin ID: SH00844.N; FWD Oligo:
ctagcagtCTCAATAAGTTTCAATGTATAtagttatattcaagcataTATACATTGAAACTTATTGAGgcg, RVS Oligo:
aattcgcCTCAATAAGTTTCAATGTATAtatgcttgaatataactaTATACATTGAAACTTATTGAGactg
Hairpin ID: SH00612.N; FWD Oligo:
ctagcagtAGCAGTGTTTGTTACAAGCTAtagttatattcaagcataTAGCTTGTAACAAACACTGCTgcg, RVS
Oligo: aattcgcAGCAGTGTTTGTTACAAGCTAtatgcttgaatataactaTAGCTTGTAACAAACACTGCTactg
Hairpin ID: TR01087P.1; FWD Oligo: AGTCTAGATTTCTGGATATCGCCCGTAG, RVS Oligo:
AAGAATTCCTTGCGTTTCACATCGAAGA
Hairpin ID: TR01220P.1; FWD Oligo: AGTCTAGATGAGCAATGGATGCAGAAAG, RVS Oligo:
AAGAATTCGATTAAACCAGGCAGCCAGA
Hairpin ID: TR02120P.1; FWD Oligo: CACCGAATTCGACGTGTTCGTAGAGTGCGA, RVS Oligo:
AAGTAGTTTCCTCCGCCGAC
Hairpin ID: TR00067A.1; FWD Oligo: GTCTAGAACTAGTGCCACCAGCTCCAT, RVS Oligo:
AGAATTCCCCATATTCTCCTCGTCGAA
Hairpin ID: SH00906.N; FWD Oligo:
ctagcagtTCCCGAGGATGTGATCAAGAAtagttatattcaagcataTTCTTGATCACATCCTCGGGAgcg, RVS
Oligo: aattcgcTCCCGAGGATGTGATCAAGAAtatgcttgaatataactaTTCTTGATCACATCCTCGGGAactg
Hairpin ID: SH00907.N; FWD Oligo:
ctagcagtCAGCGATTGTTATGTACGACAtagttatattcaagcataTGTCGTACATAACAATCGCTGgcg, RVS
Oligo: aattcgcCAGCGATTGTTATGTACGACAtatgcttgaatataactaTGTCGTACATAACAATCGCTGactg
Hairpin ID: SH00230.N; FWD Oligo:
ctagcagtAAGGATCGTAGTGATGAGAAAtagttatattcaagcataTTTCTCATCACTACGATCCTTgcg, RVS
Oligo: aattcgcAAGGATCGTAGTGATGAGAAAtatgcttgaatataactaTTTCTCATCACTACGATCCTTactg
Hairpin ID: SH00140.N; FWD Oligo:
ctagcagtCAGCAAGGACAGCTACAACAAtagttatattcaagcataTTGTTGTAGCTGTCCTTGCTGgcg, RVS
Oligo: aattcgcCAGCAAGGACAGCTACAACAAtatgcttgaatataactaTTGTTGTAGCTGTCCTTGCTGactg
Hairpin ID: SH00972.N; FWD Oligo:
ctagcagtTACGACGACACCAATGCTGCAtagttatattcaagcataTGCAGCATTGGTGTCGTCGTAgcg, RVS
Oligo: aattcgcTACGACGACACCAATGCTGCAtatgcttgaatataactaTGCAGCATTGGTGTCGTCGTAactg
Hairpin ID: TR02362P.1; FWD Oligo: AAGAATTCTGTGTTCTACCTGCATTCGC, RVS Oligo:
AGTCTAGACACGTACTGACCCTGCTTGA
Hairpin ID: TR02343P.1; FWD Oligo: AAGAATTCGAACGGTTGACCTTGACGTT, RVS Oligo:
AGTCTAGAAAAGGCAAGTAGCCAGACGA
Hairpin ID: TR02457P.1; FWD Oligo: AAGAATTCGAATCCGACGAGGAAATTGA, RVS Oligo:
AGTCTAGAGAGCAGGCTGCCTATGAAAC
Hairpin ID: TR02121P.1; FWD Oligo: AAGAATTCATGTGCGAGGAGAAAGTGCT, RVS Oligo:
AGTCTAGACTGAAACCATTGGCACACAC
Hairpin ID: TR00596A.1; FWD Oligo: GTCTAGACCACAACATGTCCTCGTTTG, RVS Oligo:
AGAATTCAAGTCCGGAAGGACCACTTT
Hairpin ID: TR00597A.1; FWD Oligo: GTCTAGAAACAGATGAAGGCACTTGGC, RVS Oligo:
ACAATTGCTGAACGGTGAGCATCAGTG
Hairpin ID: TR01069P.1; FWD Oligo: AGTCTAGATTTGATTGATTCGCAAAACG, RVS Oligo:
AAGAATTCTCCCTAGGTCCGTGAAATTG
Hairpin ID: SH00740.N; FWD Oligo:
ctagcagtAAAGACGGATCTAATGTTGAAtagttatattcaagcataTTCAACATTAGATCCGTCTTTgcg, RVS Oligo:
aattcgcAAAGACGGATCTAATGTTGAAtatgcttgaatataactaTTCAACATTAGATCCGTCTTTactg
Hairpin ID: SH00126.N; FWD Oligo:
ctagcagtACAGATGTATCTATAGATATAtagttatattcaagcataTATATCTATAGATACATCTGTgcg, RVS Oligo:
aattcgcACAGATGTATCTATAGATATAtatgcttgaatataactaTATATCTATAGATACATCTGTactg
Hairpin ID: TR00851P.1; FWD Oligo: AGTCTAGAACATCGGGAACCACAGCTAC, RVS Oligo:
AAGAATTCCGTCATGTTAACCTTGGCCT
Hairpin ID: SH00817.N; FWD Oligo:
ctagcagtCAGGCGATTGCGATTACGTAAtagttatattcaagcataTTACGTAATCGCAATCGCCTGgcg, RVS
Oligo: aattcgcCAGGCGATTGCGATTACGTAAtatgcttgaatataactaTTACGTAATCGCAATCGCCTGactg
Hairpin ID: TR01612P.1; FWD Oligo: AGTCTAGATCAGGACAGTTTTCAGCGTG, RVS Oligo:
AAGAATTCATCGGGTGTGGGAATTTGTA
Hairpin ID: SH00502.N; FWD Oligo:
ctagcagtACGTGTGATAGTTGCAATTTAtagttatattcaagcataTAAATTGCAACTATCACACGTgcg, RVS Oligo:
aattcgcACGTGTGATAGTTGCAATTTAtatgcttgaatataactaTAAATTGCAACTATCACACGTactg
Hairpin ID: TR02407P.1; FWD Oligo: AAGAATTCAGTGTATTGCCCGGAACAAG, RVS Oligo:
AGTCTAGATCGGAAGCTGTACTCCGTCT
Hairpin ID: SH01808.N; FWD Oligo:
ctagcagtCTGGAGATTTATCCCAAACAAtagttatattcaagcataTTGTTTGGGATAAATCTCCAGgcg, RVS
Oligo: aattcgcCTGGAGATTTATCCCAAACAAtatgcttgaatataactaTTGTTTGGGATAAATCTCCAGactg
Hairpin ID: TR01251P.1; FWD Oligo: AGTCTAGAAGAGGGCTGGGAATGAGATT, RVS Oligo:
AAGAATTCAAGCCTCTCTTTCTAGCGGG
Hairpin ID: SH00763.N; FWD Oligo:
ctagcagtACCAACGATAGCGCTACCTAAtagttatattcaagcataTTAGGTAGCGCTATCGTTGGTgcg, RVS
Oligo: aattcgcACCAACGATAGCGCTACCTAAtatgcttgaatataactaTTAGGTAGCGCTATCGTTGGTactg
Hairpin ID: TR02122P.1; FWD Oligo: CACCGAATTCTCCTGGTAAACTTGGTTGGC, RVS Oligo:
CTTTTTCCGCGTTAGCAATC
Hairpin ID: TR01902P.1; FWD Oligo: CACCGAATTCATCTGGTGCCGGTAGAGATG, RVS Oligo:
AGTTCGCTGCTTCCACTACG
Hairpin ID: TR02393P.1; FWD Oligo: AAGAATTCACCATGGTCCTGATAGCCAG, RVS Oligo:
AGTCTAGAAACTCCGTGCTGTCTGCTTT
Hairpin ID: TR02770P.1; FWD Oligo: AAGAATTCTGAGGGATTTCATCCAGGAG, RVS Oligo:
AGTCTAGAACGTATCTCACTGCCCCATC
Hairpin ID: SH01800.N; FWD Oligo:
ctagcagtCACGGATATGAAGTACAAGAAtagttatattcaagcataTTCTTGTACTTCATATCCGTGgcg, RVS
Oligo: aattcgcCACGGATATGAAGTACAAGAAtatgcttgaatataactaTTCTTGTACTTCATATCCGTGactg
Hairpin ID: SH00231.N; FWD Oligo:
ctagcagtTCCCTTCATGTTATACTAATAtagttatattcaagcataTATTAGTATAACATGAAGGGAgcg, RVS Oligo:
aattcgcTCCCTTCATGTTATACTAATAtatgcttgaatataactaTATTAGTATAACATGAAGGGAactg
Hairpin ID: TR02123P.1; FWD Oligo: CACCGAATTCCGAAAGAGAGGAGGCAACAG, RVS Oligo:
GGACATACTCTCTAGCGGCG
Hairpin ID: SH00798.N; FWD Oligo:
ctagcagtTTCGTTGTAAGTCGACAATAAtagttatattcaagcataTTATTGTCGACTTACAACGAAgcg, RVS Oligo:
aattcgcTTCGTTGTAAGTCGACAATAAtatgcttgaatataactaTTATTGTCGACTTACAACGAAactg
Hairpin ID: SH00887.N; FWD Oligo:
ctagcagtAAGAGTGCAAATAGAATAGAAtagttatattcaagcataTTCTATTCTATTTGCACTCTTgcg, RVS Oligo:
aattcgcAAGAGTGCAAATAGAATAGAAtatgcttgaatataactaTTCTATTCTATTTGCACTCTTactg
Hairpin ID: TR01890P.1; FWD Oligo: CACCGAATTCACGGAAATGACCTTGGACAG, RVS Oligo:
CCTCAAGGAGTACGAGCCTG
Hairpin ID: TR00425P.1; FWD Oligo: GTCTAGATGGGAGACTATTCGGTTTCG, RVS Oligo:
AGAATTCCTATACGTACGGGTCGCGTT
Hairpin ID: SH01372.N2; FWD Oligo:
ctagcagtCCGACTGTCGATTGTACATAAtagttatattcaagcataTTATGTACAATCGACAGTCGGgcg, RVS
Oligo: aattcgcCCGACTGTCGATTGTACATAAtatgcttgaatataactaTTATGTACAATCGACAGTCGGactg
Hairpin ID: TR00730A.1; FWD Oligo: GTCTAGAGGGCCAGAATACTGACTCCA, RVS Oligo:
AGAATTCAACCTTCGATCGCTTCTTGA
Hairpin ID: TR00729A.1; FWD Oligo: GTCTAGAGCGAGTATGAGTTGGCCATT, RVS Oligo:
AGAATTCAGAAGTGTCCAGACCAGCGT
Hairpin ID: SH00835.N; FWD Oligo:
ctagcagtAAGGTTGTTGACCGATTCAATtagttatattcaagcataATTGAATCGGTCAACAACCTTgcg, RVS
Oligo: aattcgcAAGGTTGTTGACCGATTCAATtatgcttgaatataactaATTGAATCGGTCAACAACCTTactg
Hairpin ID: SH00977.N; FWD Oligo:
ctagcagtCAGACAGAGAGATAAATCAAAtagttatattcaagcataTTTGATTTATCTCTCTGTCTGgcg, RVS Oligo:
aattcgcCAGACAGAGAGATAAATCAAAtatgcttgaatataactaTTTGATTTATCTCTCTGTCTGactg
Hairpin ID: SH00440.N; FWD Oligo:
ctagcagtCTGCAAGTGCGATCAGACAAAtagttatattcaagcataTTTGTCTGATCGCACTTGCAGgcg, RVS
Oligo: aattcgcCTGCAAGTGCGATCAGACAAAtatgcttgaatataactaTTTGTCTGATCGCACTTGCAGactg
Hairpin ID: SH00838.N; FWD Oligo:
ctagcagtAAGGTCATACTTCACCTTAAAtagttatattcaagcataTTTAAGGTGAAGTATGACCTTgcg, RVS Oligo:
aattcgcAAGGTCATACTTCACCTTAAAtatgcttgaatataactaTTTAAGGTGAAGTATGACCTTactg
Hairpin ID: TR02124P.1; FWD Oligo: CACCGAATTCACTTCCACATGTCGCCCTAC, RVS Oligo:
TGGTTCTTGTCCTTCTTGGC
Hairpin ID: SH00051.N; FWD Oligo:
ctagcagtCAGGATTTGTGCGTAAAGAAAtagttatattcaagcataTTTCTTTACGCACAAATCCTGgcg, RVS
Oligo: aattcgcCAGGATTTGTGCGTAAAGAAAtatgcttgaatataactaTTTCTTTACGCACAAATCCTGactg
Hairpin ID: SH00467.N; FWD Oligo:
ctagcagtCTGGTAGTTCATGGAAATCGAtagttatattcaagcataTCGATTTCCATGAACTACCAGgcg, RVS
Oligo: aattcgcCTGGTAGTTCATGGAAATCGAtatgcttgaatataactaTCGATTTCCATGAACTACCAGactg
Hairpin ID: SH01760.N; FWD Oligo:
ctagcagtCAAGCACAAGATGATTGTGAAtagttatattcaagcataTTCACAATCATCTTGTGCTTGgcg, RVS
Oligo: aattcgcCAAGCACAAGATGATTGTGAAtatgcttgaatataactaTTCACAATCATCTTGTGCTTGactg
Hairpin ID: TR01936P.1; FWD Oligo: CACCGAATTCCTCGACTAGAAGACGCCACC, RVS Oligo:
CCTCCATGCGATCGTAGTTT
Hairpin ID: TR00036A.1; FWD Oligo: GTCTAGAATATCAGACGCTCCATTCGC, RVS Oligo:
AGAATTCTTCAAGCGAACCACACTTTG
Hairpin ID: TR02125P.1; FWD Oligo: CACCGAATTCCAAGGAGCATCGTCACACAA, RVS Oligo:
GCAAGCGCCGTATGTACTCT
Hairpin ID: TR02126P.1; FWD Oligo: CACCGAATTCACCCTATGCACAAGGAGGTG, RVS Oligo:
TATTTGGTTGCGGAAACTCC
Hairpin ID: TR01630A.1; FWD Oligo: AGTCTAGAGCTGCCTTCGTCCTGTACTC, RVS Oligo:
AAGAATTCTTCAACAGTCGAACCTCGTG
Hairpin ID: TR01631A.1; FWD Oligo: AGTCTAGATCCCAGTGATAAAGCCCATC, RVS Oligo:
AAGAATTCGAGTACAGGACGAAGGCAGC
Hairpin ID: TR02363P.1; FWD Oligo: AAGAATTCAAAAATCCGGCACTGTTTTG, RVS Oligo:
AGTCTAGATGATTACCACCCAGCATCAA
Hairpin ID: SH00232.N; FWD Oligo:
ctagcagtCAAGACGACTAACTAATCCAAtagttatattcaagcataTTGGATTAGTTAGTCGTCTTGgcg, RVS
Oligo: aattcgcCAAGACGACTAACTAATCCAAtatgcttgaatataactaTTGGATTAGTTAGTCGTCTTGactg
Hairpin ID: SH00989.N; FWD Oligo:
ctagcagtAACGACTGACAAGACTACAAAtagttatattcaagcataTTTGTAGTCTTGTCAGTCGTTgcg, RVS
Oligo: aattcgcAACGACTGACAAGACTACAAAtatgcttgaatataactaTTTGTAGTCTTGTCAGTCGTTactg
Hairpin ID: TR01817P.1; FWD Oligo: CACCGAATTCGCTACGGCGGCACTAATATC, RVS Oligo:
CTCGATCTCCTGCTGCTTCT
Hairpin ID: SH00233.N; FWD Oligo:
ctagcagtTAGAACGATTACAGCATTAAAtagttatattcaagcataTTTAATGCTGTAATCGTTCTAgcg, RVS Oligo:
aattcgcTAGAACGATTACAGCATTAAAtatgcttgaatataactaTTTAATGCTGTAATCGTTCTAactg
Hairpin ID: TR00940P.1; FWD Oligo: AGTCTAGATGGCACAATGCCAATTAAGA, RVS Oligo:
AAGAATTCTCGAACTGTGACTGCTGGAC
Hairpin ID: TR02732P.1; FWD Oligo: AAGAATTCTGTGGCATCGTTAGTTGGAA, RVS Oligo:
AGTCTAGAAATGAGATGGAGAACGGCAC
Hairpin ID: TR01164P.1; FWD Oligo: AGTCTAGATCTCACTCCACAGCAACGTC, RVS Oligo:
AAGAATTCAATTCGCGGACTTGAAAGAA
Hairpin ID: TR00926P.1; FWD Oligo: AGTCTAGAAATGGATTCGTCAATCTCCG, RVS Oligo:
AAGAATTCGTAGCTCCTCGTCATCTGGC
Hairpin ID: TR02127P.1; FWD Oligo: CACCGAATTCACCAACAGCCTAGAGCGAAA, RVS Oligo:
CGAATTGCTTGGTTCCTTGT
Hairpin ID: SH00445.N; FWD Oligo:
ctagcagtCAGCTACAATCGATCAATAAAtagttatattcaagcataTTTATTGATCGATTGTAGCTGgcg, RVS Oligo:
aattcgcCAGCTACAATCGATCAATAAAtatgcttgaatataactaTTTATTGATCGATTGTAGCTGactg
Hairpin ID: TR00763P.1; FWD Oligo: AAGAATTCTGCAGATTGTGTCGAAGGAG, RVS Oligo:
AGTCTAGACTTTTCGTCCAGTTGTGGGT
Hairpin ID: SH00826.Nb; FWD Oligo:
ctagcagtCACCACAAAGATACCGTTCAAtagttatattcaagcataTTGAACGGTATCTTTGTGGTGgcg, RVS
Oligo: aattcgcCACCACAAAGATACCGTTCAAtatgcttgaatataactaTTGAACGGTATCTTTGTGGTGactg
Hairpin ID: TR02319P.1; FWD Oligo: CACCGAATTCGGATTGTCGCGTTATTTCGT, RVS Oligo:
CCGATCGGATCTGAATAGGA
Hairpin ID: TR01421P.1; FWD Oligo: AGTCTAGAGTTTTCGACACCTTGGATGC, RVS Oligo:
AAGAATTCTGCTTGAAGGTCTTGACGTG
Hairpin ID: TR02419P.1; FWD Oligo: AAGAATTCCAAGAGTCACCTCCAGAGCC, RVS Oligo:
AGTCTAGAATAGAACCGATTGCACGGAG
Hairpin ID: TR01669A.1; FWD Oligo: AGTCTAGACATCAACGTTCTGGTCATCG, RVS Oligo:
AAGAATTCCCTAGTTGACCATCCTCCGA
Hairpin ID: TR01668A.1; FWD Oligo: AGTCTAGAGCGGTTATACAGCCGACCTA, RVS Oligo:
AAGAATTCGGGCGGAGTACAGGACATAA
Hairpin ID: TR03737P.1; FWD Oligo: AAGAATTCTTCGACGAGTTCAACGAGTG, RVS Oligo:
AGTCTAGAGACTTCTTGGCGACTGATCC
Hairpin ID: SH01115.Nb; FWD Oligo:
ctagcagtTGGCGGTAGACTAGAGATTAAtagttatattcaagcataTTAATCTCTAGTCTACCGCCAgcg, RVS
Oligo: aattcgcTGGCGGTAGACTAGAGATTAAtatgcttgaatataactaTTAATCTCTAGTCTACCGCCAactg
Hairpin ID: SH00939.N; FWD Oligo:
ctagcagtCACCTTCGTGTTCCTCAAGAAtagttatattcaagcataTTCTTGAGGAACACGAAGGTGgcg, RVS
Oligo: aattcgcCACCTTCGTGTTCCTCAAGAAtatgcttgaatataactaTTCTTGAGGAACACGAAGGTGactg
Hairpin ID: SH00940.N; FWD Oligo:
ctagcagtTGCGAAGACATTGCAATGGAAtagttatattcaagcataTTCCATTGCAATGTCTTCGCAgcg, RVS
Oligo: aattcgcTGCGAAGACATTGCAATGGAAtatgcttgaatataactaTTCCATTGCAATGTCTTCGCAactg
Hairpin ID: TR01518A.1; FWD Oligo: AGTCTAGATGAGCAAATACCCCCAAAAG, RVS Oligo:
AAGAATTCGATCTGGAGCGGTGATTTGT
Hairpin ID: TR02128P.1; FWD Oligo: CACCGAATTCGCCATTCTGGTGTTCGATCT, RVS Oligo:
AATGTCCACGTAGGGCAGAC
Hairpin ID: TR04601P.1; FWD Oligo: AAGAATTCATATCCAATCTCACAGCCGC, RVS Oligo:
AGTCTAGATTGGGCAGGGGATACTTCTT
Hairpin ID: SH00422.N; FWD Oligo:
ctagcagtAGCGAGTATAGAGATACTTTAtagttatattcaagcataTAAAGTATCTCTATACTCGCTgcg, RVS Oligo:
aattcgcAGCGAGTATAGAGATACTTTAtatgcttgaatataactaTAAAGTATCTCTATACTCGCTactg
Hairpin ID: TR00493A.1; FWD Oligo: GTCTAGACGTGTGAGCCACTTGAAGAA, RVS Oligo:
AGAATTCTGTTCTGCTTGGACAGATCG
Hairpin ID: SH01373.N2; FWD Oligo:
ctagcagtCAGAGTGAAGCGACCACTATAtagttatattcaagcataTATAGTGGTCGCTTCACTCTGgcg, RVS
Oligo: aattcgcCAGAGTGAAGCGACCACTATAtatgcttgaatataactaTATAGTGGTCGCTTCACTCTGactg
Hairpin ID: TR02129P.1; FWD Oligo: CACCGAATTCACAACGAGGAGCAGCAGATT, RVS Oligo:
GCCCGAGAATAGCACTTCAG
Hairpin ID: TR00994P.1; FWD Oligo: AGTCTAGAAACGAATACGAACAGCGAGG, RVS Oligo:
AAGAATTCACAGAGCGACTGGCTTAGGA
Hairpin ID: TR00489A.1; FWD Oligo: GTCTAGACCGAAAGTGAATCAGCAACA, RVS Oligo:
AGAATTCAATGGCGTAGGGATTGTTTG
Hairpin ID: SH00880.N; FWD Oligo:
ctagcagtAAGGAGCTGCACGATGTTATAtagttatattcaagcataTATAACATCGTGCAGCTCCTTgcg, RVS
Oligo: aattcgcAAGGAGCTGCACGATGTTATAtatgcttgaatataactaTATAACATCGTGCAGCTCCTTactg
Hairpin ID: SH00881.N; FWD Oligo:
ctagcagtCTGGATGCAAGTGCTGATGAAtagttatattcaagcataTTCATCAGCACTTGCATCCAGgcg, RVS
Oligo: aattcgcCTGGATGCAAGTGCTGATGAAtatgcttgaatataactaTTCATCAGCACTTGCATCCAGactg
Hairpin ID: TR03756P.1; FWD Oligo: AAGAATTCACCACAACTTTACGTTGCCC, RVS Oligo:
AGTCTAGATTTTGGGAAAGAACTCGGTG
Hairpin ID: TR00745A.1; FWD Oligo: GTCTAGAGATTACGCCGTGTCCAAAGT, RVS Oligo:
AGAATTCCGAGGCATTGGGACTGTATT
Hairpin ID: SH00587.N; FWD Oligo:
ctagcagtCAGATGCGATCCTATGGTCTAtagttatattcaagcataTAGACCATAGGATCGCATCTGgcg, RVS
Oligo: aattcgcCAGATGCGATCCTATGGTCTAtatgcttgaatataactaTAGACCATAGGATCGCATCTGactg
Hairpin ID: TR02335P.1; FWD Oligo: AAGAATTCGGGCCAACTATAGCACCAAA, RVS Oligo:
AGTCTAGAGGGCACATCACTCAGGAGAT
Hairpin ID: SH00368.N; FWD Oligo:
ctagcagtCAAGAACAAAGTATTAGATAAtagttatattcaagcataTTATCTAATACTTTGTTCTTGgcg, RVS Oligo:
aattcgcCAAGAACAAAGTATTAGATAAtatgcttgaatataactaTTATCTAATACTTTGTTCTTGactg
Hairpin ID: SH00235.N; FWD Oligo:
ctagcagtTACGACCTGCTTGGCGAGATAtagttatattcaagcataTATCTCGCCAAGCAGGTCGTAgcg, RVS
Oligo: aattcgcTACGACCTGCTTGGCGAGATAtatgcttgaatataactaTATCTCGCCAAGCAGGTCGTAactg
Hairpin ID: SH00350.N; FWD Oligo:
ctagcagtTTGCATGTATATAAAGTACTAtagttatattcaagcataTAGTACTTTATATACATGCAAgcg, RVS Oligo:
aattcgcTTGCATGTATATAAAGTACTAtatgcttgaatataactaTAGTACTTTATATACATGCAAactg
Hairpin ID: TR00739A.1; FWD Oligo: GTCTAGACACCAACTCCACCCTCAACT, RVS Oligo:
AGAATTCTATATTCGCGTTGTTCTGCG
Hairpin ID: TR02130P.1; FWD Oligo: CACCGAATTCACGGATAACGGATCAACTGC, RVS Oligo:
CTGGACGTGCATGTTGTAGG
Hairpin ID: TR01043P.1; FWD Oligo: AGTCTAGATCCACTTGGAAAACCTCCTG, RVS Oligo:
AAGAATTCTTCTGACGCAACAGTTCCAG
Hairpin ID: TR00002A.3; FWD Oligo: AAGAATTCATCGGATCTATTGGCACAGG, RVS Oligo:
AGTCTAGAGTTCACCGCTTCGGTATTGT
Hairpin ID: TR00002A.1; FWD Oligo: GTCTAGAATCGGATCTATTGGCACAGG, RVS Oligo:
AGAATTCGTTCACCGCTTCGGTATTGT
Hairpin ID: TR00001A.1; FWD Oligo: GTCTAGAATTGTCCCAGTGGCTTTACG, RVS Oligo:
AGAATTCCGCAATTCTGACCCTGAAAT
Hairpin ID: TR00003A.1; FWD Oligo: GTCTAGATGTCGGCGACTACTGTGAAC, RVS Oligo:
AGAATTCACTGGTAAGATCCGTGGGTG
Hairpin ID: TR00002P.1; FWD Oligo: CACCATCGGATCTATTGGCACAGG, RVS Oligo:
GTTCACCGCTTCGGTATTGT
Hairpin ID: TR00002P.2; FWD Oligo: CACCATCGGATCTATTGGCACAGG, RVS Oligo:
GTTCACCGCTTCGGTATTGT
Hairpin ID: SH00002.B; FWD Oligo:
ctagcagtGCGGCGGTTAACAATACCGTAtagttatattcaagcataTTCGGTATTGTTAACCGCCGCgcg, RVS
Oligo: aattcgcGCGGCGGTTAACAATACCGAAtatgcttgaatataactaTACGGTATTGTTAACCGCCGCactg
Hairpin ID: SH00002.D; FWD Oligo:
ctagcagtGCGGCGGTTATCAATACCGTAtagttatattcaagcataTTCGGTATTGTTAACCGCCGCgcg, RVS
Oligo: aattcgcGCGGCGGTTAACAATACCGAAtatgcttgaatataactaTACGGTATTGATAACCGCCGCactg
Hairpin ID: SH00002.Vp; FWD Oligo:
ctagcagtGCGGCGGTTAACAATACCGAAtagttatattcaagcataTTCGGTATTGTTAACCGCCGCgcg, RVS
Oligo: aattcgcGCGGCGGTTAACAATACCGAAtatgcttgaatataactaTTCGGTATTGTTAACCGCCGCactg
Hairpin ID: SH00002.N ; FWD Oligo:
ctagcagtGCGGCGGTTAACAATACCGAAtagttatattcaagcataTTCGGTATTGTTAACCGCCGCgcg, RVS
Oligo: aattcgcGCGGCGGTTAACAATACCGAAtatgcttgaatataactaTTCGGTATTGTTAACCGCCGCactg
Hairpin ID: SH00002.N2; FWD Oligo:
ctagcagtGCGGCGGTTAACAATACCGAAtagttatattcaagcataTTCGGTATTGTTAACCGCCGCgcg, RVS
Oligo: aattcgcGCGGCGGTTAACAATACCGAAtatgcttgaatataactaTTCGGTATTGTTAACCGCCGCactg
Hairpin ID: TR02324P.1; FWD Oligo: CACCGAATTCAGCAAGGCTGACATCGAGTT, RVS Oligo:
CTCAACCTCTGTGCAGTCCA
Hairpin ID: TR00287P.1; FWD Oligo: AAGAATTCCATAAGGTGCAGAAGACGCA, RVS Oligo:
AGTCTAGAGCCAGCACCGAGTAGGAATA
Hairpin ID: SH00316.N; FWD Oligo:
ctagcagtCTCGCTCAGCTTAATATTTAAtagttatattcaagcataTTAAATATTAAGCTGAGCGAGgcg, RVS Oligo:
aattcgcCTCGCTCAGCTTAATATTTAAtatgcttgaatataactaTTAAATATTAAGCTGAGCGAGactg
Hairpin ID: TR01871P.1; FWD Oligo: CACCGAATTCACGATAGCATGAACAAGCCC, RVS Oligo:
TGTCTGGTCTGACGTTGCTC
Hairpin ID: TR04572P.1; FWD Oligo: GAATTCGATATCGTCGAGGTTCCCAA, RVS Oligo:
TCTAGACGTAGCGTGTGGTACGTCTG
Hairpin ID: TR04493P.1; FWD Oligo: AAGAATTCGGATATCATCAAGGGCATGTG, RVS Oligo:
AGTCTAGAAGATCTCGTCAAATGCCAGC
Hairpin ID: TR00283A.1; FWD Oligo: GTCTAGAGGCCTGCTGAAGAGACACTC, RVS Oligo:
AGAATTCTTGCAGGAAGTTGAGCACAC
Hairpin ID: SH00041.N; FWD Oligo:
ctagcagtGCGCGAGATGTTTAAGACCTAtagttatattcaagcataTAGGTCTTAAACATCTCGCGCgcg, RVS
Oligo: aattcgcGCGCGAGATGTTTAAGACCTAtatgcttgaatataactaTAGGTCTTAAACATCTCGCGCactg
Hairpin ID: SH00041.Vp; FWD Oligo:
ctagcagtGCGCGAGATGTTTAAGACCTAtagttatattcaagcataTAGGTCTTAAACATCTCGCGCgcg, RVS
Oligo: aattcgcGCGCGAGATGTTTAAGACCTAtatgcttgaatataactaTAGGTCTTAAACATCTCGCGCactg
Hairpin ID: SH00041.N2; FWD Oligo:
ctagcagtGCGCGAGATGTTTAAGACCTAtagttatattcaagcataTAGGTCTTAAACATCTCGCGCgcg, RVS
Oligo: aattcgcGCGCGAGATGTTTAAGACCTAtatgcttgaatataactaTAGGTCTTAAACATCTCGCGCactg
Hairpin ID: TR02708P.1; FWD Oligo: AAGAATTCTCCATATGCGTGGACTAACG, RVS Oligo:
AGTCTAGAGCGGTAGTTTTTGGCATGAT
Hairpin ID: TR02612P.1; FWD Oligo: AAGAATTCGCTTCGATATTAAGCCGCTG, RVS Oligo:
AGTCTAGAAGCATGACCGTTACCACCTC
Hairpin ID: SH01369.N2; FWD Oligo:
ctagcagtCTGGACATGGGTGTTCTACTAtagttatattcaagcataTAGTAGAACACCCATGTCCAGgcg, RVS
Oligo: aattcgcCTGGACATGGGTGTTCTACTAtatgcttgaatataactaTAGTAGAACACCCATGTCCAGactg
Hairpin ID: TR04476P.1; FWD Oligo: AAGAATTCGCGTAAAGACAGAGGCGAGT, RVS Oligo:
AGTCTAGAATTTGCGACCCAAAATTCAA
Hairpin ID: SH00796.N; FWD Oligo:
ctagcagtTAGCTTAGTTCTAGCTAACTAtagttatattcaagcataTAGTTAGCTAGAACTAAGCTAgcg, RVS Oligo:
aattcgcTAGCTTAGTTCTAGCTAACTAtatgcttgaatataactaTAGTTAGCTAGAACTAAGCTAactg
Hairpin ID: SH01726.N; FWD Oligo:
ctagcagtTTAGTCCTATGTAGAAGTCTAtagttatattcaagcataTAGACTTCTACATAGGACTAAgcg, RVS Oligo:
aattcgcTTAGTCCTATGTAGAAGTCTAtatgcttgaatataactaTAGACTTCTACATAGGACTAAactg
Hairpin ID: TR02613P.1; FWD Oligo: AACAATTGCGCGAACAGAACAAGTTCAA, RVS Oligo:
AGTCTAGAATAAGCAACTCAGCGCCAAT
Hairpin ID: TR02131P.1; FWD Oligo: CACCGAATTCGACCATTTCTTCGTCGGTGT, RVS Oligo:
AGGGATTGACCCTCTCCTGT
Hairpin ID: TR01818P.1; FWD Oligo: AAGAATTCAGGAATACGCCAACAAATCG, RVS Oligo:
AGACTAGTTCCTAGCAGCTAACTCGGGA
Hairpin ID: TR04586P.1; FWD Oligo: AAGAATTCTCTTGGGTCAACATGAGCAG, RVS Oligo:
AGTCTAGATCGATTTTATGCTGTTGGCA
Hairpin ID: SH01730.N; FWD Oligo:
ctagcagtCTGGTTCGATCCGTTAAGCTAtagttatattcaagcataTAGCTTAACGGATCGAACCAGgcg, RVS
Oligo: aattcgcCTGGTTCGATCCGTTAAGCTAtatgcttgaatataactaTAGCTTAACGGATCGAACCAGactg
Hairpin ID: TR01285P.1; FWD Oligo: AGTCTAGAACGAGCCTGTTTCCTTTTCC, RVS Oligo:
AACAATTGGTGGCTATATCTTTTCGCGG
Hairpin ID: SH00081.N; FWD Oligo:
ctagcagtTTCGCCGATCAAGTCCAACAAtagttatattcaagcataTTGTTGGACTTGATCGGCGAAgcg, RVS
Oligo: aattcgcTTCGCCGATCAAGTCCAACAAtatgcttgaatataactaTTGTTGGACTTGATCGGCGAAactg
Hairpin ID: TR01595P.1; FWD Oligo: AAGAATTCCCTGATCGAGAAGGAGATCG, RVS Oligo:
AGTCTAGAGCGCACATTGTAGTTCTGCT
Hairpin ID: SH01000.N; FWD Oligo:
ctagcagtAAGGTTGACAATGAGATCAAAtagttatattcaagcataTTTGATCTCATTGTCAACCTTgcg, RVS Oligo:
aattcgcAAGGTTGACAATGAGATCAAAtatgcttgaatataactaTTTGATCTCATTGTCAACCTTactg
Hairpin ID: TR01204P.1; FWD Oligo: AGTCTAGAACATTGCCCAGCGATAGTTC, RVS Oligo:
AAGAATTCCTGATGCTGGCGTATTAGCA
Hairpin ID: TR01204P.1hm; FWD Oligo: AGTCTAGAACATTGCCCAGCGATAGTTC, RVS Oligo:
AAGAATTCCTGATGCTGGCGTATTAGCA
Hairpin ID: SH01001.N; FWD Oligo:
ctagcagtCAGGGTCAGACTCCAGGTCAAtagttatattcaagcataTTGACCTGGAGTCTGACCCTGgcg, RVS
Oligo: aattcgcCAGGGTCAGACTCCAGGTCAAtatgcttgaatataactaTTGACCTGGAGTCTGACCCTGactg
Hairpin ID: SH00450.N; FWD Oligo:
ctagcagtTTGGTTGTTTCACGAAATCAAtagttatattcaagcataTTGATTTCGTGAAACAACCAAgcg, RVS Oligo:
aattcgcTTGGTTGTTTCACGAAATCAAtatgcttgaatataactaTTGATTTCGTGAAACAACCAAactg
Hairpin ID: SH00108.N; FWD Oligo:
ctagcagtCTGGTTGATCTTTATCAGCAAtagttatattcaagcataTTGCTGATAAAGATCAACCAGgcg, RVS
Oligo: aattcgcCTGGTTGATCTTTATCAGCAAtatgcttgaatataactaTTGCTGATAAAGATCAACCAGactg
Hairpin ID: SH01276.N2; FWD Oligo:
ctagcagtTTGGTTGGAAATATTGTCTTAtagttatattcaagcataTAAGACAATATTTCCAACCAAgcg, RVS Oligo:
aattcgcTTGGTTGGAAATATTGTCTTAtatgcttgaatataactaTAAGACAATATTTCCAACCAAactg
Hairpin ID: SH01676.N; FWD Oligo:
ctagcagtAAGACCGATCTGGATAACCTAtagttatattcaagcataTAGGTTATCCAGATCGGTCTTgcg, RVS
Oligo: aattcgcAAGACCGATCTGGATAACCTAtatgcttgaatataactaTAGGTTATCCAGATCGGTCTTactg
Hairpin ID: SH00827.N; FWD Oligo:
ctagcagtAAGGTGCAGAGTATAAGAGTAtagttatattcaagcataTACTCTTATACTCTGCACCTTgcg, RVS
Oligo: aattcgcAAGGTGCAGAGTATAAGAGTAtatgcttgaatataactaTACTCTTATACTCTGCACCTTactg
Hairpin ID: SH01677.N; FWD Oligo:
ctagcagtCAGTATCAGATCCTAATCAAAtagttatattcaagcataTTTGATTAGGATCTGATACTGgcg, RVS Oligo:
aattcgcCAGTATCAGATCCTAATCAAAtatgcttgaatataactaTTTGATTAGGATCTGATACTGactg
Hairpin ID: TR00477A.1; FWD Oligo: GTCTAGACAAAACTAATGGTTGGGGGA, RVS Oligo:
AGAATTCGAAAGGGTGGTCATTTGGAA
Hairpin ID: SH01374.N2; FWD Oligo:
ctagcagtCAGATCCTACTAAGAGCTATAtagttatattcaagcataTATAGCTCTTAGTAGGATCTGgcg, RVS
Oligo: aattcgcCAGATCCTACTAAGAGCTATAtatgcttgaatataactaTATAGCTCTTAGTAGGATCTGactg
Hairpin ID: SH00486.N; FWD Oligo:
ctagcagtCCGACGAATACGATAAGGATAtagttatattcaagcataTATCCTTATCGTATTCGTCGGgcg, RVS
Oligo: aattcgcCCGACGAATACGATAAGGATAtatgcttgaatataactaTATCCTTATCGTATTCGTCGGactg
Hairpin ID: TR02133P.1; FWD Oligo: CACCGAATTCCATGCACACGATTTGCAGTA, RVS Oligo:
GCGACAATCAGCAAAGAACA
Hairpin ID: SH00433.N; FWD Oligo:
ctagcagtCAAGAACTACATAGACACAAAtagttatattcaagcataTTTGTGTCTATGTAGTTCTTGgcg, RVS Oligo:
aattcgcCAAGAACTACATAGACACAAAtatgcttgaatataactaTTTGTGTCTATGTAGTTCTTGactg
Hairpin ID: SH00834.N; FWD Oligo:
ctagcagtTACGATGTTAACCAAAGACTAtagttatattcaagcataTAGTCTTTGGTTAACATCGTAgcg, RVS Oligo:
aattcgcTACGATGTTAACCAAAGACTAtatgcttgaatataactaTAGTCTTTGGTTAACATCGTAactg
Hairpin ID: TR03615P.1; FWD Oligo: AAGAATTCGGCCAAGAACGAGAGCATAG, RVS Oligo:
AGTCTAGAACCTCGTTGGGTTTGATCTG
Hairpin ID: TR01448P.1; FWD Oligo: AGTCTAGAAGGATCTCTGCAGAACACGG, RVS Oligo:
AAGAATTCTTGTTCAGTTGCGTCTCGTC
Hairpin ID: SH00061.N; FWD Oligo:
ctagcagtCACGGAATACTTAATCATTTAtagttatattcaagcataTAAATGATTAAGTATTCCGTGgcg, RVS Oligo:
aattcgcCACGGAATACTTAATCATTTAtatgcttgaatataactaTAAATGATTAAGTATTCCGTGactg
Hairpin ID: SH00787.N; FWD Oligo:
ctagcagtACGGATGTTTATTACTATTAAtagttatattcaagcataTTAATAGTAATAAACATCCGTgcg, RVS Oligo:
aattcgcACGGATGTTTATTACTATTAAtatgcttgaatataactaTTAATAGTAATAAACATCCGTactg
Hairpin ID: SH00404.N; FWD Oligo:
ctagcagtAAGGATTATCAGAGTACAGAAtagttatattcaagcataTTCTGTACTCTGATAATCCTTgcg, RVS Oligo:
aattcgcAAGGATTATCAGAGTACAGAAtatgcttgaatataactaTTCTGTACTCTGATAATCCTTactg
Hairpin ID: SH00682.N; FWD Oligo:
ctagcagtACGTTCAAGGATTGTCTGCAAtagttatattcaagcataTTGCAGACAATCCTTGAACGTgcg, RVS
Oligo: aattcgcACGTTCAAGGATTGTCTGCAAtatgcttgaatataactaTTGCAGACAATCCTTGAACGTactg
Hairpin ID: SH00889.N; FWD Oligo:
ctagcagtCGGATCGGTGTATACGATGTAtagttatattcaagcataTACATCGTATACACCGATCCGgcg, RVS
Oligo: aattcgcCGGATCGGTGTATACGATGTAtatgcttgaatataactaTACATCGTATACACCGATCCGactg
Hairpin ID: TR01727P.1; FWD Oligo: CACCGAATTCACAAAAATGGCGCTACGAGA, RVS Oligo:
AAAACCAATGTCTCAACGGC
Hairpin ID: SH00488.N; FWD Oligo:
ctagcagtCGGCGACTCTGTGCTGATCAAtagttatattcaagcataTTGATCAGCACAGAGTCGCCGgcg, RVS
Oligo: aattcgcCGGCGACTCTGTGCTGATCAAtatgcttgaatataactaTTGATCAGCACAGAGTCGCCGactg
Hairpin ID: SH01678.N; FWD Oligo:
ctagcagtCTGGTAGAAACTAGACTGAAAtagttatattcaagcataTTTCAGTCTAGTTTCTACCAGgcg, RVS
Oligo: aattcgcCTGGTAGAAACTAGACTGAAAtatgcttgaatataactaTTTCAGTCTAGTTTCTACCAGactg
Hairpin ID: SH00464.N; FWD Oligo:
ctagcagtCTCGTTGGTCTTCTACAAGTAtagttatattcaagcataTACTTGTAGAAGACCAACGAGgcg, RVS
Oligo: aattcgcCTCGTTGGTCTTCTACAAGTAtatgcttgaatataactaTACTTGTAGAAGACCAACGAGactg
Hairpin ID: TR04633P.1; FWD Oligo: AAGAATTCATTCAGAAGGGCAACATGGA, RVS Oligo:
AGTCTAGACAGGTCTTCGAACTGCGATT
Hairpin ID: SH00302.N; FWD Oligo:
ctagcagtTCGGTTTGAGTTGCAAACCAAtagttatattcaagcataTTGGTTTGCAACTCAAACCGAgcg, RVS
Oligo: aattcgcTCGGTTTGAGTTGCAAACCAAtatgcttgaatataactaTTGGTTTGCAACTCAAACCGAactg
Hairpin ID: TR01819P.1; FWD Oligo: CACCGAATTCATCAGCTGTTGCTCGGCTAT, RVS Oligo:
GCATCTCGGTCTTTTTCTGC
Hairpin ID: TR01596P.1; FWD Oligo: AAGAATTCGTCTTCCTTGCTGGACTTGC, RVS Oligo:
AGTCTAGAGAAGACTGCATGCCTGTTGA
Hairpin ID: SH00703.N; FWD Oligo:
ctagcagtCAGCTAGACTCGACAAGCTAAtagttatattcaagcataTTAGCTTGTCGAGTCTAGCTGgcg, RVS
Oligo: aattcgcCAGCTAGACTCGACAAGCTAAtatgcttgaatataactaTTAGCTTGTCGAGTCTAGCTGactg
Hairpin ID: SH00922.N; FWD Oligo:
ctagcagtCAGAAGAATGCTGATCACGAAtagttatattcaagcataTTCGTGATCAGCATTCTTCTGgcg, RVS
Oligo: aattcgcCAGAAGAATGCTGATCACGAAtatgcttgaatataactaTTCGTGATCAGCATTCTTCTGactg
Hairpin ID: SH00923.N; FWD Oligo:
ctagcagtCTGGTACTTCACGGAAATAAAtagttatattcaagcataTTTATTTCCGTGAAGTACCAGgcg, RVS
Oligo: aattcgcCTGGTACTTCACGGAAATAAAtatgcttgaatataactaTTTATTTCCGTGAAGTACCAGactg
Hairpin ID: TR02688P.1; FWD Oligo: AAGAATTCCTAACCTGCGAGGTGGACAG, RVS Oligo:
AGTCTAGATGTCCCTAATGATGAGCGTG
Hairpin ID: TR01938P.1; FWD Oligo: CACCGAATTCAAAGCGTCCCATGAAATCTG, RVS Oligo:
TCAACAGGACAAACAGCGAC
Hairpin ID: TR02389P.1; FWD Oligo: AAGAATTCACAGCGTCACTACAACACGC, RVS Oligo:
AGTCTAGAAAAAATCCAACTTTTGGGGC
Hairpin ID: TR04101P.1; FWD Oligo: AAGAATTCGGCTGGAGAACCAAATCAAA, RVS Oligo:
AGTCTAGATGTACGGCTGATTGGGTGTA
Hairpin ID: SH00386.N; FWD Oligo:
ctagcagtCAGACAAATGTTATATGTATAtagttatattcaagcataTATACATATAACATTTGTCTGgcg, RVS Oligo:
aattcgcCAGACAAATGTTATATGTATAtatgcttgaatataactaTATACATATAACATTTGTCTGactg
Hairpin ID: TR04524P.1; FWD Oligo: AAGAATTCATGCCGCGTTACTGTCTCTT, RVS Oligo:
AGTCTAGAAAATGCTGGATGATGAAGCC
Hairpin ID: SH01679.N; FWD Oligo:
ctagcagtAAGCTTCAATATACCAATCTAtagttatattcaagcataTAGATTGGTATATTGAAGCTTgcg, RVS Oligo:
aattcgcAAGCTTCAATATACCAATCTAtatgcttgaatataactaTAGATTGGTATATTGAAGCTTactg
Hairpin ID: TR02415P.1; FWD Oligo: AAGAATTCATTGACCAGATCTTCACGGG, RVS Oligo:
AGTCTAGAACTTGACCCACGTGTCCTTC
Hairpin ID: SH01266.N2; FWD Oligo:
ctagcagtTAGCAACAAGAAGAAGGAGAAtagttatattcaagcataTTCTCCTTCTTCTTGTTGCTAgcg, RVS
Oligo: aattcgcTAGCAACAAGAAGAAGGAGAAtatgcttgaatataactaTTCTCCTTCTTCTTGTTGCTAactg
Hairpin ID: SH01267.N2; FWD Oligo:
ctagcagtTACGTATATCACAGACAACAAtagttatattcaagcataTTGTTGTCTGTGATATACGTAgcg, RVS Oligo:
aattcgcTACGTATATCACAGACAACAAtatgcttgaatataactaTTGTTGTCTGTGATATACGTAactg
Hairpin ID: TR01512P.1; FWD Oligo: AGTCTAGACTACGGCGATCAGATCAACA, RVS Oligo:
AAGAATTCTAATAAACTCCGTGCTGCCC
Hairpin ID: TR02135P.1; FWD Oligo: CACCGAATTCTGAAGCGCATTCACAACATC, RVS Oligo:
GACCAGGTCGAAGTAGGTGG
Hairpin ID: SH00423.N; FWD Oligo:
ctagcagtTAGGCTCGATACCAAGTTTAAtagttatattcaagcataTTAAACTTGGTATCGAGCCTAgcg, RVS
Oligo: aattcgcTAGGCTCGATACCAAGTTTAAtatgcttgaatataactaTTAAACTTGGTATCGAGCCTAactg
Hairpin ID: TR04033P.1; FWD Oligo: AAGAATTCAGAACTCAGCACAAGCCGAT, RVS Oligo:
AGTCTAGATTTCTAGCACAACAATGGCG
Hairpin ID: SH00797.N; FWD Oligo:
ctagcagtATGCTTGATTCATATTGTTTAtagttatattcaagcataTAAACAATATGAATCAAGCATgcg, RVS Oligo:
aattcgcATGCTTGATTCATATTGTTTAtatgcttgaatataactaTAAACAATATGAATCAAGCATactg
Hairpin ID: SH00904.N; FWD Oligo:
ctagcagtAACCACGATTGTTGTAGCTAAtagttatattcaagcataTTAGCTACAACAATCGTGGTTgcg, RVS
Oligo: aattcgcAACCACGATTGTTGTAGCTAAtatgcttgaatataactaTTAGCTACAACAATCGTGGTTactg
Hairpin ID: SH00905.N; FWD Oligo:
ctagcagtCACAATCAATCGAAAGATCAAtagttatattcaagcataTTGATCTTTCGATTGATTGTGgcg, RVS Oligo:
aattcgcCACAATCAATCGAAAGATCAAtatgcttgaatataactaTTGATCTTTCGATTGATTGTGactg
Hairpin ID: TR02136P.1; FWD Oligo: CACCGAATTCCAGCATGGGTAACGAGACCT, RVS Oligo:
AATATCGGTATTGCCCACCA
Hairpin ID: TR02137P.1; FWD Oligo: CACCGAATTCAATCTCACCAATCCCAGCAC, RVS Oligo:
GTTGGCTCACACATTGATGC
Hairpin ID: SH02052.N; FWD Oligo:
ctagcagtACCAATGTATGTAGTTAAATAtagttatattcaagcataTATTTAACTACATACATTGGTgcg, RVS Oligo:
aattcgcACCAATGTATGTAGTTAAATAtatgcttgaatataactaTATTTAACTACATACATTGGTactg
Hairpin ID: TR00386P.1; FWD Oligo: GTCTAGAAATGAGATGCAAACCCGAAG, RVS Oligo:
AGAATTCATCGCGTATATTCACTGCCC
Hairpin ID: TR01035P.1; FWD Oligo: AGTCTAGAAAAGAAACCGCTGACTCCCT, RVS Oligo:
AAGAATTCGTGGTCTTTTGGTGCCACTC
Hairpin ID: TR00821A.1; FWD Oligo: GTCTAGAATCTGAACGCTCGAGGATGT, RVS Oligo:
AGAATTCCCAAAAGTCCGTGTATGGCT
Hairpin ID: TR01058P.1; FWD Oligo: AGTCTAGAAATCCTGATTTGAGCGATGC, RVS Oligo:
AAGAATTCGCTTGGCCTCTTGGATACTG
Hairpin ID: TR01728P.1; FWD Oligo: CACCGAATTCTAGTGGCAGCTCCTCCAGAT, RVS Oligo:
GTGCTCGCACTGATCCATTA
Hairpin ID: TR01673A.1; FWD Oligo: AGTCTAGACTGCAACATTAACAGGCCAC, RVS Oligo:
AAGAATTCCGCTGCACTGAAATGATGAC
Hairpin ID: TR02087P.1; FWD Oligo: CACCGAATTCCCGTCTACTTCCAAGGCAAA, RVS Oligo:
GCCTGCCAGGAGATCTGTAG
Hairpin ID: SH00237.N; FWD Oligo:
ctagcagtATGCTTAGTTATAGTCTACAAtagttatattcaagcataTTGTAGACTATAACTAAGCATgcg, RVS Oligo:
aattcgcATGCTTAGTTATAGTCTACAAtatgcttgaatataactaTTGTAGACTATAACTAAGCATactg
Hairpin ID: TR01939P.1; FWD Oligo: CACCGAATTCAATCTCCTGGCTGACTCCAA, RVS Oligo:
AAAACTCCGTAATGCCGATG
Hairpin ID: TR01816P.1; FWD Oligo: CACCGAATTCTCTACATCGACTGCCTGTGC, RVS Oligo:
TGCACTCACTGACGTCACAA
Hairpin ID: TR02450P.1; FWD Oligo: AAGAATTCCTGGTCAGCTCCTTGATGCT, RVS Oligo:
AGTCTAGACCGCAAGTAGTTGTCCCAGT
Hairpin ID: TR01578A.1; FWD Oligo: AGTCTAGACTCCCGTGTGCTTCAATTCT, RVS Oligo:
AAGAATTCACACACTCGAAATCTGCACG
Hairpin ID: TR00833A.1; FWD Oligo: GTCTAGAATGTCGTCCTTCCTTGATGG, RVS Oligo:
AGAATTCCTCGATGGCCTTGATCAGTT
Hairpin ID: TR02211P.1; FWD Oligo: CACCGAATTCGCCTTCTACCACTACCTGCG, RVS Oligo:
TGAGCAGAAAAACGTTCGTG
Hairpin ID: TR01005P.1; FWD Oligo: AGTCTAGATCGTTCTACTGCAACGAGGA, RVS Oligo:
AAGAATTCTTACGCTTATGGGCTTACGG
Hairpin ID: TR00122A.1; FWD Oligo: GTCTAGAGACATGAGGGCACTTTGGAG, RVS Oligo:
AGAATTCCATTGCTATCACGAATACGCC
Hairpin ID: SH01596.N2; FWD Oligo:
ctagcagtTCAGCAATTGTTGTCAGCAAAtagttatattcaagcataTTTGCTGACAACAATTGCTGAgcg, RVS
Oligo: aattcgcTCAGCAATTGTTGTCAGCAAAtatgcttgaatataactaTTTGCTGACAACAATTGCTGAactg
Hairpin ID: TR04538P.1; FWD Oligo: AAGAATTCGGAAAACGGCAACATGATCT, RVS Oligo:
AGTCTAGACCTTGTCGAAAGTCTGGCTC
Hairpin ID: SH00238.N; FWD Oligo:
ctagcagtCCCGACCAATGTGACAGATAAtagttatattcaagcataTTATCTGTCACATTGGTCGGGgcg, RVS
Oligo: aattcgcCCCGACCAATGTGACAGATAAtatgcttgaatataactaTTATCTGTCACATTGGTCGGGactg
Hairpin ID: TR01483A.1; FWD Oligo: AGTCTAGAAATGCAAAAGTGACTGTGCG, RVS Oligo:
AAGAATTCTAGCAGCAACATCGTTTTCG
Hairpin ID: TR01137P.1; FWD Oligo: AAGAATTCGATGAAACGGACGATGTGT, RVS Oligo:
AGTCTAGAATGGTGGACAGGCGATTTAG
Hairpin ID: TR02075P.1; FWD Oligo: CACCGAATTCATCGAGGCTCTTCACCACAG, RVS Oligo:
TCGTACTTAACGCGCAAATG
Hairpin ID: TR01804P.1; FWD Oligo: CACCGAATTCCTCACCCAGTGTTCCCATCT, RVS Oligo:
AACTGTACTGCGTCAGCGTG
Hairpin ID: TR02107P.1; FWD Oligo: CACCGAATTCGTTAAGAAGGTGGTGCCCAA, RVS Oligo:
CCTGCTTGACAATCGTCTCA
Hairpin ID: TR02350P.1; FWD Oligo: AAGAATTCGATGATCACGAACATCGGC, RVS Oligo:
AGTCTAGATCCAACTTACTTCGCGTTCC
Hairpin ID: TR01809P.1; FWD Oligo: CACCGAATTCGGACAACCAGGTGGATATGG, RVS Oligo:
CTCGTTCTCCAGCTCCAGTC
Hairpin ID: TR04635P.1; FWD Oligo: AAGAATTCTGGCAACCTGCTACTCTCCT, RVS Oligo:
AGTCTAGACCAGCTGGTTAAAGCTCAGG
Hairpin ID: TR04486P.1; FWD Oligo: AAGAATTCACCACATCTTGGCTGCTCTT, RVS Oligo:
AGTCTAGAGAGCATCGACAGTTAAGCCC
Hairpin ID: SH00914.N; FWD Oligo:
ctagcagtAAGGACATTTGTTTCCTTAAAtagttatattcaagcataTTTAAGGAAACAAATGTCCTTgcg, RVS Oligo:
aattcgcAAGGACATTTGTTTCCTTAAAtatgcttgaatataactaTTTAAGGAAACAAATGTCCTTactg
Hairpin ID: SH00915.N; FWD Oligo:
ctagcagtATGCAATGTGATGCAGAACAAtagttatattcaagcataTTGTTCTGCATCACATTGCATgcg, RVS
Oligo: aattcgcATGCAATGTGATGCAGAACAAtatgcttgaatataactaTTGTTCTGCATCACATTGCATactg
Hairpin ID: TR00216A.1; FWD Oligo: GTCTAGACCGTTCCTGTACGATCTGGT, RVS Oligo:
AGAATTCTGAGGTTGGGATTCCAAGAG
Hairpin ID: SH00136.N; FWD Oligo:
ctagcagtTCGATGGTTCGCACTACGATAtagttatattcaagcataTATCGTAGTGCGAACCATCGAgcg, RVS
Oligo: aattcgcTCGATGGTTCGCACTACGATAtatgcttgaatataactaTATCGTAGTGCGAACCATCGAactg
Hairpin ID: TR00139A.1; FWD Oligo: GTCTAGACCTTATTTGGCGTTCTTCCA, RVS Oligo:
AGAATTCTCGTTTGACGCGACACTATC
Hairpin ID: TR00140A.1; FWD Oligo: GTCTAGAATGCGGAGGTGCTTTACAAC, RVS Oligo:
AGAATTCGCGTATGATCGTGCTGTGAT
Hairpin ID: SH00677.N; FWD Oligo:
ctagcagtAAGGAGCTTAATAGCAAGAAAtagttatattcaagcataTTTCTTGCTATTAAGCTCCTTgcg, RVS Oligo:
aattcgcAAGGAGCTTAATAGCAAGAAAtatgcttgaatataactaTTTCTTGCTATTAAGCTCCTTactg
Hairpin ID: SH00314.N; FWD Oligo:
ctagcagtCGCGAAGAGCTGTTCAAACTAtagttatattcaagcataTAGTTTGAACAGCTCTTCGCGgcg, RVS
Oligo: aattcgcCGCGAAGAGCTGTTCAAACTAtatgcttgaatataactaTAGTTTGAACAGCTCTTCGCGactg
Hairpin ID: TR00012A.1; FWD Oligo: GTCTAGAGAGGACTCCTGCGAAAACTG, RVS Oligo:
AGAATTCGTGCTTCCTCGGAAGACTTG
Hairpin ID: TR00013A.1; FWD Oligo: GTCTAGAATCGGAACTCACGAGGATTG, RVS Oligo:
AGAATTCCGCCTTCGAATCTCAATGTT
Hairpin ID: SH00600.N; FWD Oligo:
ctagcagtCTGAGAGTTCAAAGAAGCAAAtagttatattcaagcataTTTGCTTCTTTGAACTCTCAGgcg, RVS
Oligo: aattcgcCTGAGAGTTCAAAGAAGCAAAtatgcttgaatataactaTTTGCTTCTTTGAACTCTCAGactg
Hairpin ID: TR00701A.1; FWD Oligo: GTCTAGAAAGCTGCTTGCCCAAAACTA, RVS Oligo:
AGAATTCGTCGACGATAAAGGCAGAGC
Hairpin ID: TR00702A.1; FWD Oligo: GTCTAGATACGCGCAATACACAGATGG, RVS Oligo:
AGAATTCATCAATGGTCAGAGAACGCC
Hairpin ID: SH00045.N; FWD Oligo:
ctagcagtTCGCAGCTTTATGTACTACGAtagttatattcaagcataTCGTAGTACATAAAGCTGCGAgcg, RVS
Oligo: aattcgcTCGCAGCTTTATGTACTACGAtatgcttgaatataactaTCGTAGTACATAAAGCTGCGAactg
Hairpin ID: TR02424P.1; FWD Oligo: AAGAATTCCAGACCGATAAGGAGACCCA, RVS Oligo:
AGTCTAGATTTGCTTGGCGTACACACAT
Hairpin ID: SH01638.N; FWD Oligo:
ctagcagtTTCGAGGAGCAAGAAGTGAAAtagttatattcaagcataTTTCACTTCTTGCTCCTCGAAgcg, RVS
Oligo: aattcgcTTCGAGGAGCAAGAAGTGAAAtatgcttgaatataactaTTTCACTTCTTGCTCCTCGAAactg
Hairpin ID: TR02360P.1; FWD Oligo: AAGAATTCATCCAGTGGCGAGTTTGTTT, RVS Oligo:
AGTCTAGAAGAATGTTGAGCGAGACGGT
Hairpin ID: SH00730.N; FWD Oligo:
ctagcagtCAGCAGAAGTTCAGCATTAAAtagttatattcaagcataTTTAATGCTGAACTTCTGCTGgcg, RVS
Oligo: aattcgcCAGCAGAAGTTCAGCATTAAAtatgcttgaatataactaTTTAATGCTGAACTTCTGCTGactg
Hairpin ID: SH00837.N; FWD Oligo:
ctagcagtAAGATCCTTACTCTAGATCAAtagttatattcaagcataTTGATCTAGAGTAAGGATCTTgcg, RVS Oligo:
aattcgcAAGATCCTTACTCTAGATCAAtatgcttgaatataactaTTGATCTAGAGTAAGGATCTTactg
Hairpin ID: SH00959.N; FWD Oligo:
ctagcagtTAGGCGAATTTCATTGTTCAAtagttatattcaagcataTTGAACAATGAAATTCGCCTAgcg, RVS Oligo:
aattcgcTAGGCGAATTTCATTGTTCAAtatgcttgaatataactaTTGAACAATGAAATTCGCCTAactg
Hairpin ID: TR00786P.1; FWD Oligo: GTCTAGATTCGAGCTGAGTGGTCAATG, RVS Oligo:
AGAATTCGATACTCTGGGCTGGCTGAG
Hairpin ID: TR02390P.1; FWD Oligo: AAGAATTCACATCGATCCTCTCAATCCG, RVS Oligo:
AGTCTAGAAGTCCATTGGGCAGCATTAC
Hairpin ID: TR00238A.1; FWD Oligo: GTCTAGACCATCACTGCAAGCAGTTTC, RVS Oligo:
AGAATTCTTCTTCATCGATTTGGAGGG
Hairpin ID: TR02139P.1; FWD Oligo: CACCGAATTCGGCTGACAAGGAGGAGTACG, RVS Oligo:
TGGAGCAGTGTGTTTGGTTT
Hairpin ID: SH00387.N; FWD Oligo:
ctagcagtCCCGATCATTACCAAGCTATAtagttatattcaagcataTATAGCTTGGTAATGATCGGGgcg, RVS
Oligo: aattcgcCCCGATCATTACCAAGCTATAtatgcttgaatataactaTATAGCTTGGTAATGATCGGGactg
Hairpin ID: SH01680.N; FWD Oligo:
ctagcagtCAGCTCTGTTAACCAACTAAAtagttatattcaagcataTTTAGTTGGTTAACAGAGCTGgcg, RVS
Oligo: aattcgcCAGCTCTGTTAACCAACTAAAtatgcttgaatataactaTTTAGTTGGTTAACAGAGCTGactg
Hairpin ID: TR04466P.1; FWD Oligo: AAGAATTCACCCTTGATCTGATTGGTGC, RVS Oligo:
AGTCTAGACCGTATTGGGATACCACGTC
Hairpin ID: SH00349.N; FWD Oligo:
ctagcagtATCGATGTTAGTATTGATTAAtagttatattcaagcataTTAATCAATACTAACATCGATgcg, RVS Oligo:
aattcgcATCGATGTTAGTATTGATTAAtatgcttgaatataactaTTAATCAATACTAACATCGATactg
Hairpin ID: SH01761.N; FWD Oligo:
ctagcagtCAGGAACTTCAAGCTGTTGTAtagttatattcaagcataTACAACAGCTTGAAGTTCCTGgcg, RVS
Oligo: aattcgcCAGGAACTTCAAGCTGTTGTAtatgcttgaatataactaTACAACAGCTTGAAGTTCCTGactg
Hairpin ID: TR04487P.1; FWD Oligo: AAGAATTCGTATGGGACGCGGTTTAATG, RVS Oligo:
AGTCTAGAGCGCTGTTCTTGATTATGGC
Hairpin ID: SH00242.N; FWD Oligo:
ctagcagtCTGGAGCAAGACTTCCACGAAtagttatattcaagcataTTCGTGGAAGTCTTGCTCCAGgcg, RVS
Oligo: aattcgcCTGGAGCAAGACTTCCACGAAtatgcttgaatataactaTTCGTGGAAGTCTTGCTCCAGactg
Hairpin ID: SH00655.N; FWD Oligo:
ctagcagtCGGCATCAATTTGTCCATCAAtagttatattcaagcataTTGATGGACAAATTGATGCCGgcg, RVS
Oligo: aattcgcCGGCATCAATTTGTCCATCAAtatgcttgaatataactaTTGATGGACAAATTGATGCCGactg
Hairpin ID: TR00246A.1; FWD Oligo: GTCTAGACGGCTGGTGCCTACATAAAT, RVS Oligo:
AGAATTCTTTCTCCAGCTTTGTTGGCT
Hairpin ID: TR01580A.1; FWD Oligo: AGTCTAGAGCGTGAGCTTGATACGTGAA, RVS Oligo:
AAGAATTCAACAATGGGCAGCCAGTAAG
Hairpin ID: SH00239.N; FWD Oligo:
ctagcagtCACAACAGTTACAATATACAAtagttatattcaagcataTTGTATATTGTAACTGTTGTGgcg, RVS Oligo:
aattcgcCACAACAGTTACAATATACAAtatgcttgaatataactaTTGTATATTGTAACTGTTGTGactg
Hairpin ID: TR00254A.1; FWD Oligo: GTCTAGAAACGAGAAGACCACCACAGC, RVS Oligo:
AGAATTCCTTGTCCTCGATGGTCCACT
Hairpin ID: SH00236.Nb; FWD Oligo:
ctagcagtTCGAAACAAAGTGGCGGTCAAtagttatattcaagcataTTGACCGCCACTTTGTTTCGAgcg, RVS
Oligo: aattcgcTCGAAACAAAGTGGCGGTCAAtatgcttgaatataactaTTGACCGCCACTTTGTTTCGAactg
Hairpin ID: TR01810P.1; FWD Oligo: CACCGAATTCGAAGTGGGCAATAAGACGGA, RVS Oligo:
TCGTGAAGACCAAACACAGC
Hairpin ID: TR00312A.1; FWD Oligo: GTCTAGATGTTGCATCTCGAAATCTGG, RVS Oligo:
AGAATTCAACTCAAAGTTGGTAGCCGC
Hairpin ID: SH00780.N; FWD Oligo:
ctagcagtCCGACGATATATGAATAATTAtagttatattcaagcataTAATTATTCATATATCGTCGGgcg, RVS Oligo:
aattcgcCCGACGATATATGAATAATTAtatgcttgaatataactaTAATTATTCATATATCGTCGGactg
Hairpin ID: SH01215.N2; FWD Oligo:
ctagcagtCAAGCTGTTGGTGCACAAGAAtagttatattcaagcataTTCTTGTGCACCAACAGCTTGgcg, RVS
Oligo: aattcgcCAAGCTGTTGGTGCACAAGAAtatgcttgaatataactaTTCTTGTGCACCAACAGCTTGactg
Hairpin ID: SH00785.N; FWD Oligo:
ctagcagtCGGCGAGAAGTTGTTCATTAAtagttatattcaagcataTTAATGAACAACTTCTCGCCGgcg, RVS
Oligo: aattcgcCGGCGAGAAGTTGTTCATTAAtatgcttgaatataactaTTAATGAACAACTTCTCGCCGactg
Hairpin ID: TR00087A.1; FWD Oligo: GTCTAGAAAAACGACCACATACGAGGC, RVS Oligo:
AGAATTCCGTTAACGCAGACACTCTCG
Hairpin ID: TR04495P.1; FWD Oligo: AAGAATTCCACCTCCTGGAAGAGGTTGA, RVS Oligo:
AGTCTAGACCTCGTTGATTATGTTGGCA
Hairpin ID: TR00866P.1; FWD Oligo: AGTCTAGAAGACGGACCCTGACTTCTCA, RVS Oligo:
AAGAATTCCAGGATTCCAGTGGACGAGT
Hairpin ID: TR02140P.1; FWD Oligo: CACCGAATTCATTGGAAGCACTGCCATTCT, RVS Oligo:
AGGGTGTAGAAGCCCCAGTT
Hairpin ID: SH00243.N; FWD Oligo:
ctagcagtTAGGTTGTACCTTGTTTGTTAtagttatattcaagcataTAACAAACAAGGTACAACCTAgcg, RVS Oligo:
aattcgcTAGGTTGTACCTTGTTTGTTAtatgcttgaatataactaTAACAAACAAGGTACAACCTAactg
Hairpin ID: TR00747A.1; FWD Oligo: GTCTAGAACTCACACCACCCAGGAGAC, RVS Oligo:
AGAATTCAGCGTATCATCCACCTCCAC
Hairpin ID: SH00122.N; FWD Oligo:
ctagcagtTTGGACTTAACTGTAAGCTAAtagttatattcaagcataTTAGCTTACAGTTAAGTCCAAgcg, RVS Oligo:
aattcgcTTGGACTTAACTGTAAGCTAAtatgcttgaatataactaTTAGCTTACAGTTAAGTCCAAactg
Hairpin ID: SH00981.N; FWD Oligo:
ctagcagtTTGACGCGTTGTTGTATTGAAtagttatattcaagcataTTCAATACAACAACGCGTCAAgcg, RVS
Oligo: aattcgcTTGACGCGTTGTTGTATTGAAtatgcttgaatataactaTTCAATACAACAACGCGTCAAactg
Hairpin ID: SH00689.N; FWD Oligo:
ctagcagtCCGCGCGATGTTCCCACCAAAtagttatattcaagcataTTTGGTGGGAACATCGCGCGGgcg, RVS
Oligo: aattcgcCCGCGCGATGTTCCCACCAAAtatgcttgaatataactaTTTGGTGGGAACATCGCGCGGactg
Hairpin ID: TR00044A.1; FWD Oligo: GTCTAGATCAGGTTCCGGATCATCTTC, RVS Oligo:
AGAATTCTTCAGTTCCCTTTCCACGTC
Hairpin ID: TR00045A.1; FWD Oligo: GTCTAGAACAAGAAGTGCAACGATCCC, RVS Oligo:
AGAATTCGGAAGAATCTCGTTTGCAGC
Hairpin ID: SH00505.N; FWD Oligo:
ctagcagtTCGGAGAAATGCAGCAGTCTAtagttatattcaagcataTAGACTGCTGCATTTCTCCGAgcg, RVS
Oligo: aattcgcTCGGAGAAATGCAGCAGTCTAtatgcttgaatataactaTAGACTGCTGCATTTCTCCGAactg
Hairpin ID: TR01065P.1; FWD Oligo: AGTCTAGAGCCATAAACAAGCAACCGAT, RVS Oligo:
AAGAATTCGTAGAGTTTGCCCTCCCTCG
Hairpin ID: SH01681.N; FWD Oligo:
ctagcagtCTGGCGATACAAATACAATAAtagttatattcaagcataTTATTGTATTTGTATCGCCAGgcg, RVS Oligo:
aattcgcCTGGCGATACAAATACAATAAtatgcttgaatataactaTTATTGTATTTGTATCGCCAGactg
Hairpin ID: SH00546.N; FWD Oligo:
ctagcagtCTAGACCGGACAGATATTTAAtagttatattcaagcataTTAAATATCTGTCCGGTCTAGgcg, RVS
Oligo: aattcgcCTAGACCGGACAGATATTTAAtatgcttgaatataactaTTAAATATCTGTCCGGTCTAGactg
Hairpin ID: TR00129A.1; FWD Oligo: GTCTAGAAAGTTTCCTGGCCTTGTCCT, RVS Oligo:
AGAATTCGTGGGATAGAAGTCGCGAAG
Hairpin ID: TR02142P.1; FWD Oligo: CACCGAATTCCGAGAGTACTAGCCAACGGC, RVS Oligo:
GAGGCTCCTTCTTGAGGTCC
Hairpin ID: TR00255P.1; FWD Oligo: AAGAATTCAGATCCTGGTTCTTTCCGGT, RVS Oligo:
AGTCTAGAGCCACTTAAACCGTTCCTGA
Hairpin ID: TR01820P.1; FWD Oligo: CACCGAATTCCGTAATTTGCCAACGTGATG, RVS Oligo:
GGAGTGTCCACCTGAGTGGT
Hairpin ID: SH00104.N; FWD Oligo:
ctagcagtCTGCAAGGTGCTCAAGGTCAAtagttatattcaagcataTTGACCTTGAGCACCTTGCAGgcg, RVS
Oligo: aattcgcCTGCAAGGTGCTCAAGGTCAAtatgcttgaatataactaTTGACCTTGAGCACCTTGCAGactg
Hairpin ID: TR01465P.1; FWD Oligo: AGTCTAGAGAACGAGCAAGAAGAAACCG, RVS Oligo:
AAGAATTCTTCCTCTGCCGCTTGTCTAT
Hairpin ID: SH00744.N; FWD Oligo:
ctagcagtCACCGACTTTGTGAAGAACAAtagttatattcaagcataTTGTTCTTCACAAAGTCGGTGgcg, RVS
Oligo: aattcgcCACCGACTTTGTGAAGAACAAtatgcttgaatataactaTTGTTCTTCACAAAGTCGGTGactg
Hairpin ID: TR02614P.1; FWD Oligo: AAGAATTCCCTCTTCAGATTCGGAGTCG, RVS Oligo:
AGTCTAGACACGCAGTTGGTGTAATTGG
Hairpin ID: TR02639P.1; FWD Oligo: AAGAATTCCCGGATTTCAGAACCACAAT, RVS Oligo:
AGTCTAGAGATTTTTCGGAAGACCCGAT
Hairpin ID: SH00340.N; FWD Oligo:
ctagcagtCTGGACGAGAGCAACGATGAAtagttatattcaagcataTTCATCGTTGCTCTCGTCCAGgcg, RVS
Oligo: aattcgcCTGGACGAGAGCAACGATGAAtatgcttgaatataactaTTCATCGTTGCTCTCGTCCAGactg
Hairpin ID: TR01166P.1; FWD Oligo: AGTCTAGAACATCAAGGAGATGAACGGC, RVS Oligo:
AAGAATTCAATAAATGGGCACTGTTGGC
Hairpin ID: TR02143P.1; FWD Oligo: CACCGAATTCTGTGAGCTCCACTCATCAGG, RVS Oligo:
CACGACGCTGAGACGATCTA
Hairpin ID: TR02364P.1; FWD Oligo: AAGAATTCCAGCTACGTCACTGCGTTGT, RVS Oligo:
AGTCTAGATGGCGTTGTACTTCTTTCCC
Hairpin ID: SH00471.N; FWD Oligo:
ctagcagtTCGGAAAGACGTTGAACCAAAtagttatattcaagcataTTTGGTTCAACGTCTTTCCGAgcg, RVS
Oligo: aattcgcTCGGAAAGACGTTGAACCAAAtatgcttgaatataactaTTTGGTTCAACGTCTTTCCGAactg
Hairpin ID: TR01500A.1; FWD Oligo: AGTCTAGAAAGATCAACGGATGCTCCAC, RVS Oligo:
AAGAATTCGGGTTACTGCTGGTTTGGAA
Hairpin ID: SH00613.N; FWD Oligo:
ctagcagtCAGCAGTTTGCTGTCAACAAAtagttatattcaagcataTTTGTTGACAGCAAACTGCTGgcg, RVS
Oligo: aattcgcCAGCAGTTTGCTGTCAACAAAtatgcttgaatataactaTTTGTTGACAGCAAACTGCTGactg
Hairpin ID: TR04496P.1; FWD Oligo: AAGAATTCCCTCAACCTGTGGGTCAGTT, RVS Oligo:
AGTCTAGAGGCTCTTCCACTTTGCTCAC
Hairpin ID: SH00457.N; FWD Oligo:
ctagcagtACCGAAAGAGTTATAATTGTAtagttatattcaagcataTACAATTATAACTCTTTCGGTgcg, RVS Oligo:
aattcgcACCGAAAGAGTTATAATTGTAtatgcttgaatataactaTACAATTATAACTCTTTCGGTactg
Hairpin ID: SH01060.N; FWD Oligo:
ctagcagtACGAGAGAAAGAAGAATTTAAtagttatattcaagcataTTAAATTCTTCTTTCTCTCGTgcg, RVS Oligo:
aattcgcACGAGAGAAAGAAGAATTTAAtatgcttgaatataactaTTAAATTCTTCTTTCTCTCGTactg
Hairpin ID: SH01061.N; FWD Oligo:
ctagcagtCACGAGAGAAAGAAGAATTTAtagttatattcaagcataTAAATTCTTCTTTCTCTCGTGgcg, RVS Oligo:
aattcgcCACGAGAGAAAGAAGAATTTAtatgcttgaatataactaTAAATTCTTCTTTCTCTCGTGactg
Hairpin ID: TR01940P.1; FWD Oligo: CACCGAATTCCGTGGATGTGATCAATACGG, RVS Oligo:
TGGCCATGCTGACATTAGAG
Hairpin ID: TR02659P.1; FWD Oligo: AAGAATTCGATTCCCATTGGAAACTGGA, RVS Oligo:
AGTCTAGAAGCACCATCCGAAATGAAAC
Hairpin ID: TR01417P.1; FWD Oligo: AGTCTAGAATTTTGACTTCGCAGCGTTC, RVS Oligo:
AAGAATTCCCGGTTGAAGGTACTGGTTG
Hairpin ID: TR02144P.1; FWD Oligo: CACCGAATTCCAGCTTCAACAAGCAACCAA, RVS Oligo:
ATCGATTCTTAGGGCCTGGT
Hairpin ID: TR02546P.1; FWD Oligo: AAGAATTCGTCAGGATGCCGTCAAGATT, RVS Oligo:
AGTCTAGAATCTTGTCCATTTGCTTGGC
Hairpin ID: TR02090P.1; FWD Oligo: CACCGAATTCTGGCTCACGACTTTTCTCCT, RVS Oligo:
CTACGGAATAAGCTGGCTGC
Hairpin ID: SH01682.N; FWD Oligo:
ctagcagtCAGAAGCGACGCGAATCTAAAtagttatattcaagcataTTTAGATTCGCGTCGCTTCTGgcg, RVS
Oligo: aattcgcCAGAAGCGACGCGAATCTAAAtatgcttgaatataactaTTTAGATTCGCGTCGCTTCTGactg
Hairpin ID: SH00564.Nb; FWD Oligo:
ctagcagtCACCACCGAGTTGCAGAGCAAtagttatattcaagcataTTGCTCTGCAACTCGGTGGTGgcg, RVS
Oligo: aattcgcCACCACCGAGTTGCAGAGCAAtatgcttgaatataactaTTGCTCTGCAACTCGGTGGTGactg
Hairpin ID: TR02441P.1; FWD Oligo: AAGAATTCCGATATGTGCGCAGTTTGTT, RVS Oligo:
AGTCTAGAAGCCTTTGCGCAATTTCTAA
Hairpin ID: TR01548A.1; FWD Oligo: AGTCTAGACAACAGCAAGGTGCTCGATA, RVS Oligo:
AAGAATTCGGACATAGGAGAACCGGTGA
Hairpin ID: TR01821P.1; FWD Oligo: CACCGAATTCATACGGTCTTTCCAACGTGC, RVS Oligo:
TGGTTGGGACTCAAATCCTC
Hairpin ID: TR01683P.1; FWD Oligo: CACCGAATTCCATGTACAACGATGGCAAGG, RVS Oligo:
CGTGGCAGAAAGAAGCTACC
Hairpin ID: TR00531A.1; FWD Oligo: GTCTAGACGGCTTAAGGATCAGATTCG, RVS Oligo:
AGAATTCATACGCTTCTGGCATACGCT
Hairpin ID: TR04638P.1; FWD Oligo: AAGAATTCTCTCTCTCTTTCCGCTGCTC, RVS Oligo:
AGTCTAGAGTGACCAATTGCGGATTTCT
Hairpin ID: TR02741P.1; FWD Oligo: AAGAATTCGCGTAAGCACATACGCAAGA, RVS Oligo:
AGTCTAGACGTACTCAGTGGCGAGATGA
Hairpin ID: SH00833.N; FWD Oligo:
ctagcagtAAGGTATACGAGATCGACTAAtagttatattcaagcataTTAGTCGATCTCGTATACCTTgcg, RVS
Oligo: aattcgcAAGGTATACGAGATCGACTAAtatgcttgaatataactaTTAGTCGATCTCGTATACCTTactg
Hairpin ID: TR00589A.1; FWD Oligo: GTCTAGAATCAGCCCGTACTGGAACC, RVS Oligo:
AGAATTCCACCAAATGCTCGACATGAA
Hairpin ID: TR00590A.1; FWD Oligo: GTCTAGAACTGGAACCCACGCTCATAC, RVS Oligo:
AGAATTCAAAGACGCAGCAAGGACACT
Hairpin ID: TR02145P.1; FWD Oligo: CACCGAATTCCCTCAAGAAGCTCAATCGCT, RVS Oligo:
CAGGTCCAGCCAGACTCTTC
Hairpin ID: SH00244.N; FWD Oligo:
ctagcagtCACGGACAACACGTTGGATAAtagttatattcaagcataTTATCCAACGTGTTGTCCGTGgcg, RVS
Oligo: aattcgcCACGGACAACACGTTGGATAAtatgcttgaatataactaTTATCCAACGTGTTGTCCGTGactg
Hairpin ID: TR00534A.1; FWD Oligo: GTCTAGAGAATTCAAATTCTTGGCGGA, RVS Oligo:
ACAATTGTCACCTGTTGCTTCTTGTCG
Hairpin ID: SH00831.N; FWD Oligo:
ctagcagtATGCCAAATACTGAAATAGAAtagttatattcaagcataTTCTATTTCAGTATTTGGCATgcg, RVS Oligo:
aattcgcATGCCAAATACTGAAATAGAAtatgcttgaatataactaTTCTATTTCAGTATTTGGCATactg
Hairpin ID: TR00594A.1; FWD Oligo: GTCTAGACACTGCTAAGGGGAATCCAA, RVS Oligo:
AGAATTCGCCTAGACTTGTGCTTTGGC
Hairpin ID: TR00595A.1; FWD Oligo: GTCTAGACTTAAGCCGGAGTTTATGCG, RVS Oligo:
AGAATTCCGCGCTTCTCTAGCTCACTT
Hairpin ID: SH00900.N; FWD Oligo:
ctagcagtCAAGATTATAATCAAGAACAAtagttatattcaagcataTTGTTCTTGATTATAATCTTGgcg, RVS Oligo:
aattcgcCAAGATTATAATCAAGAACAAtatgcttgaatataactaTTGTTCTTGATTATAATCTTGactg
Hairpin ID: SH00901.N; FWD Oligo:
ctagcagtCCGCAAGATTATAATCAAGAAtagttatattcaagcataTTCTTGATTATAATCTTGCGGgcg, RVS Oligo:
aattcgcCCGCAAGATTATAATCAAGAAtatgcttgaatataactaTTCTTGATTATAATCTTGCGGactg
Hairpin ID: TR02615P.1; FWD Oligo: AAGAATTCCGCGATACGGAAGAATATGG, RVS Oligo:
AGTCTAGATTAGGCGGTGGTAACTTTGG
Hairpin ID: SH00737.Nb; FWD Oligo:
ctagcagtTACGTCTATACGAATAAAGAAtagttatattcaagcataTTCTTTATTCGTATAGACGTAgcg, RVS Oligo:
aattcgcTACGTCTATACGAATAAAGAAtatgcttgaatataactaTTCTTTATTCGTATAGACGTAactg
Hairpin ID: TR04497P.1; FWD Oligo: AAGAATTCACCAACCACTACCTGTTCGC, RVS Oligo:
AGTCTAGAGGCCTTCATCTTCGGTATCA
Hairpin ID: TR01822P.1; FWD Oligo: CACCGAATTCCTTCGGACAATTTGGATTGC, RVS Oligo:
CATCCATTTCCTGATCCACC
Hairpin ID: TR02146P.1; FWD Oligo: CACCGAATTCTCCAGGCCATCCTGTTCTAC, RVS Oligo:
GCCACAACAGCGATTCTGTA
Hairpin ID: TR02146P.1hm; FWD Oligo: CACCGAATTCTCCAGGCCATCCTGTTCTAC, RVS Oligo:
GCCACAACAGCGATTCTGTA
Hairpin ID: TR04542P.1; FWD Oligo: AAGAATTCCATGGACAAACTGATGGACG, RVS Oligo:
AGTCTAGAGTTTTGCAAGTCGGAGTCGT
Hairpin ID: TR02475P.1; FWD Oligo: AAGAATTCGGCCAAATTTGTTCCTTTCA, RVS Oligo:
AGTCTAGAAACTGCGCATTAAGTTGGCT
Hairpin ID: TR04498P.1; FWD Oligo: AAGAATTCCTGCGAACAGACCAGCATTA, RVS Oligo:
AGTCTAGACTTGAGGAGCGAGAGTGCTT
Hairpin ID: SH01716.N; FWD Oligo:
ctagcagtCTGTTTAGTAATAGTTATCTAtagttatattcaagcataTAGATAACTATTACTAAACAGgcg, RVS Oligo:
aattcgcCTGTTTAGTAATAGTTATCTAtatgcttgaatataactaTAGATAACTATTACTAAACAGactg
Hairpin ID: SH00728.N; FWD Oligo:
ctagcagtCAGCGAGATGCTCGACTGCAAtagttatattcaagcataTTGCAGTCGAGCATCTCGCTGgcg, RVS
Oligo: aattcgcCAGCGAGATGCTCGACTGCAAtatgcttgaatataactaTTGCAGTCGAGCATCTCGCTGactg
Hairpin ID: TR01010P.1; FWD Oligo: AGTCTAGAACTGGCACCAACACACAGC, RVS Oligo:
AAGAATTCTAGTCCGGGCATTACGTAGG
Hairpin ID: TR04525P.1; FWD Oligo: AAGAATTCACGAGATGATCAACGACACG, RVS Oligo:
AGTCTAGAACTAAGAGGAGCGCAGCTTG
Hairpin ID: TR01271P.1; FWD Oligo: AGTCTAGAAGAAATCACGTCCCACCAAG, RVS Oligo:
AAGAATTCGACGATTCTCCTTGACCAGC
Hairpin ID: TR00752A.1; FWD Oligo: GTCTAGAATCTGGAACTACGGAGCCCT, RVS Oligo:
AGAATTCCTGCCAGAACTTGTGGGTCT
Hairpin ID: TR01501A.1; FWD Oligo: AGTCTAGAAGATAATTGTCAATCGCGCC, RVS Oligo:
AAGAATTCGTCTGTTCAGCTTCTTGCCC
Hairpin ID: TR00707P.1; FWD Oligo: AAGAATTCGCATCGAGGAGAAGAACCAG, RVS Oligo:
AGTCTAGAGATCAGGATCGCTCTTCCAG
Hairpin ID: SH00856.N; FWD Oligo:
ctagcagtTCGATCGATACTATTTATTTAtagttatattcaagcataTAAATAAATAGTATCGATCGAgcg, RVS Oligo:
aattcgcTCGATCGATACTATTTATTTAtatgcttgaatataactaTAAATAAATAGTATCGATCGAactg
Hairpin ID: TR00708A.1; FWD Oligo: GTCTAGAGGCCTAGGGTTCTTGAAAGC, RVS Oligo:
AGAATTCTCCAGGGAGAGACAGGTGAC
Hairpin ID: TR00707A.1; FWD Oligo: GTCTAGAGCATCGAGGAGAAGAACCAG, RVS Oligo:
AGAATTCGATCAGGATCGCTCTTCCAG
Hairpin ID: TR00806A.1; FWD Oligo: GTCTAGAGTTACCCGCTGCTGAACAAT, RVS Oligo:
AGAATTCTGTGAGATAGTGCCGAGGTG
Hairpin ID: TR01266P.1; FWD Oligo: AGTCTAGAAGGACAATGAGTTCAACGGG, RVS Oligo:
AAGAATTCTACCGAATCTTTCTCGTCGC
Hairpin ID: TR00295A.1; FWD Oligo: GTCTAGAGTATGCGAAAAGGTGGAGGA, RVS Oligo:
AGAATTCGCTTGAGCACCTCAATGTCA
Hairpin ID: SH00330.N; FWD Oligo:
ctagcagtCAGACTAATGTTCACTCTCTAtagttatattcaagcataTAGAGAGTGAACATTAGTCTGgcg, RVS
Oligo: aattcgcCAGACTAATGTTCACTCTCTAtatgcttgaatataactaTAGAGAGTGAACATTAGTCTGactg
Hairpin ID: TR02148P.1; FWD Oligo: CACCGAATTCGGAATCCCTTTGGGGTAAAA, RVS Oligo:
GCCAGCTGTAAATGCTCACA
Hairpin ID: TR01594P.1; FWD Oligo: AAGAATTCCCTTCGACTCCTGTAGCCTG, RVS Oligo:
AGTCTAGAGTGTTTGTTGATGCCGATTG
Hairpin ID: TR02149P.1; FWD Oligo: CACCGAATTCGCGGAGCATTAGTCGAGTTC, RVS Oligo:
ACGCCGTAATTTCACCTTTG
Hairpin ID: TR01709P.1; FWD Oligo: CACCGAATTCGTAATGGCCGAGCTTCTGTC, RVS Oligo:
ACATCTGGTTTTCGGTTTGC
Hairpin ID: TR02396P.1; FWD Oligo: AAGAATTCACGCAGAATAGCTTCGGAAA, RVS Oligo:
AGTCTAGAGTCTCCTCCTTGTCGCTGTC
Hairpin ID: SH00436.N; FWD Oligo:
ctagcagtCACAATGATATTCCTCACCAAtagttatattcaagcataTTGGTGAGGAATATCATTGTGgcg, RVS
Oligo: aattcgcCACAATGATATTCCTCACCAAtatgcttgaatataactaTTGGTGAGGAATATCATTGTGactg
Hairpin ID: TR01516A.1; FWD Oligo: AGTCTAGAATGGCGGTCAAGTTTTATGC, RVS Oligo:
AAGAATTCTTGGCGAAAGCTGAAAGAAT
Hairpin ID: TR02736P.1; FWD Oligo: AAGAATTCGACCCTGCAGATACATGCCT, RVS Oligo:
AGTCTAGACATGTCGCAATATCTCGCTG
Hairpin ID: TR04463P.1; FWD Oligo: AAGAATTCCCGTAAGCCCAATGTCTGAT, RVS Oligo:
AGTCTAGATATGAATGTGCGATTCTGCG
Hairpin ID: SH01271.N2; FWD Oligo:
ctagcagtATGGAGAACATACAGAAGATAtagttatattcaagcataTATCTTCTGTATGTTCTCCATgcg, RVS Oligo:
aattcgcATGGAGAACATACAGAAGATAtatgcttgaatataactaTATCTTCTGTATGTTCTCCATactg
Hairpin ID: TR02150P.1; FWD Oligo: CACCGAATTCAGAGGAGGCAGAGGAAGAGG, RVS Oligo:
GCAGTGCAGCAGCTTTGTAG
Hairpin ID: TR01461P.1; FWD Oligo: AGTCTAGAGAAGCTAGGTGGTGCAGAGG, RVS Oligo:
AAGAATTCCAATAGCATTTGAGGGTGGG
Hairpin ID: TR02151P.1; FWD Oligo: AAGAATTCCTCGACTCGGTTATTCGCTC, RVS Oligo:
AGTCTAGAACATGAAGGAGGCCAGACAC
Hairpin ID: SH00245.N; FWD Oligo:
ctagcagtAAGAAGAAGTTCAAAGATATAtagttatattcaagcataTATATCTTTGAACTTCTTCTTgcg, RVS Oligo:
aattcgcAAGAAGAAGTTCAAAGATATAtatgcttgaatataactaTATATCTTTGAACTTCTTCTTactg
Hairpin ID: SH00605.N; FWD Oligo:
ctagcagtTACGTCATTGGTGCTACTTAAtagttatattcaagcataTTAAGTAGCACCAATGACGTAgcg, RVS
Oligo: aattcgcTACGTCATTGGTGCTACTTAAtatgcttgaatataactaTTAAGTAGCACCAATGACGTAactg
Hairpin ID: SH00773.N; FWD Oligo:
ctagcagtCAGAACGACAGAACCGACAAAtagttatattcaagcataTTTGTCGGTTCTGTCGTTCTGgcg, RVS
Oligo: aattcgcCAGAACGACAGAACCGACAAAtatgcttgaatataactaTTTGTCGGTTCTGTCGTTCTGactg
Hairpin ID: SH00519.N; FWD Oligo:
ctagcagtCAAGAAGAACAGTCACTACAAtagttatattcaagcataTTGTAGTGACTGTTCTTCTTGgcg, RVS
Oligo: aattcgcCAAGAAGAACAGTCACTACAAtatgcttgaatataactaTTGTAGTGACTGTTCTTCTTGactg
Hairpin ID: SH01763.N; FWD Oligo:
ctagcagtAAGGAGAAGTAGAATGTTTGAtagttatattcaagcataTCAAACATTCTACTTCTCCTTgcg, RVS Oligo:
aattcgcAAGGAGAAGTAGAATGTTTGAtatgcttgaatataactaTCAAACATTCTACTTCTCCTTactg
Hairpin ID: TR00120A.1; FWD Oligo: GTCTAGACCTCTGGAAAGCCCTAATCC, RVS Oligo:
AGAATTCTTCTCCAGTTTGCTGGGACT
Hairpin ID: SH00246.N; FWD Oligo:
ctagcagtAAGACTGTGTTTACTTTGTAAtagttatattcaagcataTTACAAAGTAAACACAGTCTTgcg, RVS Oligo:
aattcgcAAGACTGTGTTTACTTTGTAAtatgcttgaatataactaTTACAAAGTAAACACAGTCTTactg
Hairpin ID: TR04543P.1; FWD Oligo: AAGAATTCCGGAACACGATTATTTGCCT, RVS Oligo:
AGTCTAGACGCAACACGGTGACAATATC
Hairpin ID: SH00321.N; FWD Oligo:
ctagcagtCCCGAAGTGTTCAGTAAACAAtagttatattcaagcataTTGTTTACTGAACACTTCGGGgcg, RVS
Oligo: aattcgcCCCGAAGTGTTCAGTAAACAAtatgcttgaatataactaTTGTTTACTGAACACTTCGGGactg
Hairpin ID: TR01891P.1; FWD Oligo: CACCGAATTCGCTGCTCCCATCGTTTCTAC, RVS Oligo:
ATTACGACAGGTGCCTCCAC
Hairpin ID: TR02153P.1; FWD Oligo: CACCGAATTCGCTCTGCTCCAGTCCAAGTC, RVS Oligo:
ACAATAATGCTCGGCTCGTC
Hairpin ID: SH00968.N; FWD Oligo:
ctagcagtCGAGATGTTTGCCGACACCTAtagttatattcaagcataTAGGTGTCGGCAAACATCTCGgcg, RVS
Oligo: aattcgcCGAGATGTTTGCCGACACCTAtatgcttgaatataactaTAGGTGTCGGCAAACATCTCGactg
Hairpin ID: TR01823P.1; FWD Oligo: CACCGAATTCGTAAAGTGGAGTGCTTCGCC, RVS Oligo:
GTGCGCGGAAAGTAGAACTC
Hairpin ID: TR02394P.1; FWD Oligo: AAGAATTCACCCATCCTGCATGAAAAAG, RVS Oligo:
AGTCTAGATTTCTTGTTTGCTGATCCCC
Hairpin ID: SH00652.N; FWD Oligo:
ctagcagtAACCACGAATATGAACATGAAtagttatattcaagcataTTCATGTTCATATTCGTGGTTgcg, RVS Oligo:
aattcgcAACCACGAATATGAACATGAAtatgcttgaatataactaTTCATGTTCATATTCGTGGTTactg
Hairpin ID: TR01033P.1; FWD Oligo: AGTCTAGACGGTCGCTATGACATCAAGA, RVS Oligo:
AAGAATTCCGCTCCAGGGGATACAGATA
Hairpin ID: TR01824P.1; FWD Oligo: CACCGAATTCCACCAGCTACATTTGGCCTC, RVS Oligo:
CTACTCAAAGTTTTGGCCGC
Hairpin ID: TR01511A.1; FWD Oligo: AGTCTAGAAAGCAGTTGCAGACGGAAGT, RVS Oligo:
AAGAATTCCTTGGAAAGATCCAAGCTGC
Hairpin ID: TR00057A.1; FWD Oligo: GTCTAGAGCTTGAGAAGGATAACGCCA, RVS Oligo:
AGAATTCCCTCCTTCAACTGGTTGGTC
Hairpin ID: TR02155P.1; FWD Oligo: CACCGAATTCATCCATTGTTCCCCACAAAA, RVS Oligo:
ATGCAAGAAGCTAGTGCCGT
Hairpin ID: TR01497A.1; FWD Oligo: AGTCTAGAATTTAACAACCATCGCAGCC, RVS Oligo:
AAGAATTCGCCAGATCTCTTTCTGGTGC
Hairpin ID: TR00824A.1; FWD Oligo: GTCTAGACTTCTATCGCGGCTTTGAAC, RVS Oligo:
AGAATTCAACTTGCTGCCCTTGAAGAA
Hairpin ID: TR02469P.1; FWD Oligo: AAGAATTCGCTGCTGTTCGACAATCAAA, RVS Oligo:
AGTCTAGAAATATGAACAGCCCGTTTGG
Hairpin ID: SH00247.N; FWD Oligo:
ctagcagtTAGGACATCAGCATTACTAAAtagttatattcaagcataTTTAGTAATGCTGATGTCCTAgcg, RVS Oligo:
aattcgcTAGGACATCAGCATTACTAAAtatgcttgaatataactaTTTAGTAATGCTGATGTCCTAactg
Hairpin ID: SH00758.N; FWD Oligo:
ctagcagtTAGATCGTTACTCAAAGTTGAtagttatattcaagcataTCAACTTTGAGTAACGATCTAgcg, RVS Oligo:
aattcgcTAGATCGTTACTCAAAGTTGAtatgcttgaatataactaTCAACTTTGAGTAACGATCTAactg
Hairpin ID: SH00506.N; FWD Oligo:
ctagcagtCTGGTCAGAGTCACTCATCAAtagttatattcaagcataTTGATGAGTGACTCTGACCAGgcg, RVS
Oligo: aattcgcCTGGTCAGAGTCACTCATCAAtatgcttgaatataactaTTGATGAGTGACTCTGACCAGactg
Hairpin ID: TR02693P.1; FWD Oligo: AAGAATTCGAGCACTTGCACATAGCCAA, RVS Oligo:
AGTCTAGATTGATCTTCGATACCCAGCC
Hairpin ID: TR00687A.1; FWD Oligo: GTCTAGAGATGCGACAGGAGTGCAAAT, RVS Oligo:
ACAATTGATTATGCTTGCGTCCCTGAC
Hairpin ID: TR00686A.1; FWD Oligo: GTCTAGAAGATACGACTAACCGCCCCT, RVS Oligo:
AGAATTCTGTTTTCCAGCCCTGGTTAC
Hairpin ID: SH01004.N; FWD Oligo:
ctagcagtACGAATAGATTTCAAGAAGAAtagttatattcaagcataTTCTTCTTGAAATCTATTCGTgcg, RVS Oligo:
aattcgcACGAATAGATTTCAAGAAGAAtatgcttgaatataactaTTCTTCTTGAAATCTATTCGTactg
Hairpin ID: SH01005.N; FWD Oligo:
ctagcagtTAGCTCGATATGAATATAATAtagttatattcaagcataTATTATATTCATATCGAGCTAgcg, RVS Oligo:
aattcgcTAGCTCGATATGAATATAATAtatgcttgaatataactaTATTATATTCATATCGAGCTAactg
Hairpin ID: TR01892P.1; FWD Oligo: CACCGAATTCGGTTATCCTGGGTGCCTTCT, RVS Oligo:
AAGTTGGCCATAATGTTCCG
Hairpin ID: SH00646.N; FWD Oligo:
ctagcagtCACCTACAAGCTAGACTTCAAtagttatattcaagcataTTGAAGTCTAGCTTGTAGGTGgcg, RVS
Oligo: aattcgcCACCTACAAGCTAGACTTCAAtatgcttgaatataactaTTGAAGTCTAGCTTGTAGGTGactg
Hairpin ID: SH01683.N; FWD Oligo:
ctagcagtAAGCTGAAGTTCAGCAAGAAAtagttatattcaagcataTTTCTTGCTGAACTTCAGCTTgcg, RVS
Oligo: aattcgcAAGCTGAAGTTCAGCAAGAAAtatgcttgaatataactaTTTCTTGCTGAACTTCAGCTTactg
Hairpin ID: SH00490.N; FWD Oligo:
ctagcagtTTGGACAGTTCCAAAGATGAAtagttatattcaagcataTTCATCTTTGGAACTGTCCAAgcg, RVS
Oligo: aattcgcTTGGACAGTTCCAAAGATGAAtatgcttgaatataactaTTCATCTTTGGAACTGTCCAAactg
Hairpin ID: TR02156P.1; FWD Oligo: CACCGAATTCTACATGATTGTCCGCTTGGA, RVS Oligo:
TCAATTTTCGTTAAACCGCC
Hairpin ID: TR01632A.1; FWD Oligo: AGTCTAGAACAAGATGACTTTGCCCGAT, RVS Oligo:
AAGAATTCGGAACACCCATGTGAAGGTC
Hairpin ID: TR01633A.1; FWD Oligo: AGTCTAGATTGGGAGACAGTGACGCTTA, RVS Oligo:
AAGAATTCTTTCTGCTGCGGAGTAGCTT
Hairpin ID: TR01710P.1; FWD Oligo: GGATCCTACGTATCCCTCGTATCCGC, RVS Oligo:
CACCGCCAGTGCTGTGGAATTCTT
Hairpin ID: TR00814A.1; FWD Oligo: GTCTAGAGAGCATTGAGTTGGTGCTGA, RVS Oligo:
AGAATTCGTAGGCGTTCAGCAAAGGAG
Hairpin ID: TR02513P.1; FWD Oligo: AAGAATTCTTTGACTGCCACAGTGAAGC, RVS Oligo:
AGTCTAGAACACATTTGTAATGCGGCAA
Hairpin ID: TR02380P.1; FWD Oligo: AAGAATTCAACCCAAGCGCATTGTTTAC, RVS Oligo:
AGTCTAGACCTCGTGAAACACACCCTTT
Hairpin ID: SH00339.N; FWD Oligo:
ctagcagtCCGGTTCAGAGAAGTCATCAAtagttatattcaagcataTTGATGACTTCTCTGAACCGGgcg, RVS
Oligo: aattcgcCCGGTTCAGAGAAGTCATCAAtatgcttgaatataactaTTGATGACTTCTCTGAACCGGactg
Hairpin ID: TR04115P.1; FWD Oligo: AAGAATTCTTACGCGAGCCTTACGAGAT, RVS Oligo:
AGTCTAGAAATGACCGAAACGTCCTGAG
Hairpin ID: SH00667.N; FWD Oligo:
ctagcagtTTGGATATTGCTGTTACTATAtagttatattcaagcataTATAGTAACAGCAATATCCAAgcg, RVS Oligo:
aattcgcTTGGATATTGCTGTTACTATAtatgcttgaatataactaTATAGTAACAGCAATATCCAAactg
Hairpin ID: TR00823A.1; FWD Oligo: GTCTAGACGTTACGTGGCTGCTTACCT, RVS Oligo:
AGAATTCTGTATGAATGGCTGCTCCAG
Hairpin ID: SH01818.N; FWD Oligo:
ctagcagtAACAAACAAAGAAGACAACTAtagttatattcaagcataTAGTTGTCTTCTTTGTTTGTTgcg, RVS Oligo:
aattcgcAACAAACAAAGAAGACAACTAtatgcttgaatataactaTAGTTGTCTTCTTTGTTTGTTactg
Hairpin ID: SH01058.N; FWD Oligo:
ctagcagtAAGGAATGTAATGCTATAGTTtagttatattcaagcataAACTATAGCATTACATTCCTTgcg, RVS Oligo:
aattcgcAAGGAATGTAATGCTATAGTTtatgcttgaatataactaAACTATAGCATTACATTCCTTactg
Hairpin ID: SH01059.N; FWD Oligo:
ctagcagtATGTAATGCTATAGTTCTCTAtagttatattcaagcataTAGAGAACTATAGCATTACATgcg, RVS Oligo:
aattcgcATGTAATGCTATAGTTCTCTAtatgcttgaatataactaTAGAGAACTATAGCATTACATactg
Hairpin ID: TR01550A.1; FWD Oligo: AGTCTAGAGCGAGACAAAGATCTGGAGG, RVS Oligo:
AAGAATTCGACCCACGATTCGACGTAGT
Hairpin ID: TR04567P.1; FWD Oligo: AAGAATTCAACTTCCAGCTGACGGAGAA, RVS Oligo:
AGTCTAGAGATAGGAGCAGTTGAAGCGG
Hairpin ID: TR01227P.1; FWD Oligo: AGTCTAGAGGTGGCGAGGATTTATTTGA, RVS Oligo:
AAGAATTCAGCGGCCCGTAAGATTTATT
Hairpin ID: SH00248.N; FWD Oligo:
ctagcagtAAGTGCGAAATTCTTGTTAAAtagttatattcaagcataTTTAACAAGAATTTCGCACTTgcg, RVS Oligo:
aattcgcAAGTGCGAAATTCTTGTTAAAtatgcttgaatataactaTTTAACAAGAATTTCGCACTTactg
Hairpin ID: SH00602.N; FWD Oligo:
ctagcagtCAGGGCGAGTTTGATGAACAAtagttatattcaagcataTTGTTCATCAAACTCGCCCTGgcg, RVS
Oligo: aattcgcCAGGGCGAGTTTGATGAACAAtatgcttgaatataactaTTGTTCATCAAACTCGCCCTGactg
Hairpin ID: TR02738P.1hm; FWD Oligo: AAGAATTCACATTAAGTTTCCCGAGGGG, RVS Oligo:
AGTCTAGAGGAGTTGGGTGTGCAAAAGT
Hairpin ID: TR02738P.1; FWD Oligo: AAGAATTCACATTAAGTTTCCCGAGGGG, RVS Oligo:
AGTCTAGAGGAGTTGGGTGTGCAAAAGT
Hairpin ID: TR02734P.1; FWD Oligo: AAGAATTCGTGGAGCTCTGCTACAAGGC, RVS Oligo:
AGTCTAGATTGGAGCGCTCGTACTTCTT
Hairpin ID: TR02497P.1; FWD Oligo: AAGAATTCTGCCATATAAATGCGTTGGA, RVS Oligo:
AGTCTAGATGCATTTCGCATTTCGATTA
Hairpin ID: SH00778.N; FWD Oligo:
ctagcagtTAAGTTGTTACAAGTAATTTAtagttatattcaagcataTAAATTACTTGTAACAACTTAgcg, RVS Oligo:
aattcgcTAAGTTGTTACAAGTAATTTAtatgcttgaatataactaTAAATTACTTGTAACAACTTAactg
Hairpin ID: SH01779.N; FWD Oligo:
ctagcagtCAGGTTAGATATAGTTAATAAtagttatattcaagcataTTATTAACTATATCTAACCTGgcg, RVS Oligo:
aattcgcCAGGTTAGATATAGTTAATAAtatgcttgaatataactaTTATTAACTATATCTAACCTGactg
Hairpin ID: TR03941P.1; FWD Oligo: AAGAATTCAGGCTGATCACCAAAACCAC, RVS Oligo:
AGTCTAGAACGCAAAGAGTCCAGAGGAA
Hairpin ID: SH00733.N; FWD Oligo:
ctagcagtCACGAAGATCACATTCATGTAtagttatattcaagcataTACATGAATGTGATCTTCGTGgcg, RVS
Oligo: aattcgcCACGAAGATCACATTCATGTAtatgcttgaatataactaTACATGAATGTGATCTTCGTGactg
Hairpin ID: TR01542A.1; FWD Oligo: AGTCTAGATTCCAATGCTAAGATTGCCC, RVS Oligo:
AAGAATTCGGCTTCTGTTTGTCCAGAGC
Hairpin ID: SH00249.N; FWD Oligo:
ctagcagtCACGGCGAGACTGACGCTCAAtagttatattcaagcataTTGAGCGTCAGTCTCGCCGTGgcg, RVS
Oligo: aattcgcCACGGCGAGACTGACGCTCAAtatgcttgaatataactaTTGAGCGTCAGTCTCGCCGTGactg
Hairpin ID: TR00811A.1; FWD Oligo: GTCTAGATCATCCACCTCAGGGTCTTC, RVS Oligo:
AGAATTCCAGCTCGGCCAAAGCTATAC
Hairpin ID: TR00918P.1; FWD Oligo: AGTCTAGACCCTTTGAGTTCCACCAGAG, RVS Oligo:
AAGAATTCAGGCTTGCACATACGGAAAC
Hairpin ID: TR02158P.1; FWD Oligo: CACCGAATTCTTGGCAGAAGAAACAAACCA, RVS Oligo:
TGTGAGGGATTTCATAGGGC
Hairpin ID: TR00581A.1; FWD Oligo: GTCTAGAGCGACAGAAAAAGTTCGAGG, RVS Oligo:
AGAATTCGCCAAAGATTCTCCTTGCAG
Hairpin ID: SH00250.N; FWD Oligo:
ctagcagtCTCGATGACTCCGATGTCCTAtagttatattcaagcataTAGGACATCGGAGTCATCGAGgcg, RVS
Oligo: aattcgcCTCGATGACTCCGATGTCCTAtatgcttgaatataactaTAGGACATCGGAGTCATCGAGactg
Hairpin ID: TR02467P.1; FWD Oligo: AAGAATTCGCGATGAGCTGGTGGATTAT, RVS Oligo:
AGTCTAGATGTACCACAGCCAAAACCAA
Hairpin ID: SH01054.N; FWD Oligo:
ctagcagtCAGCACGAGTTCGACAGCGAAtagttatattcaagcataTTCGCTGTCGAACTCGTGCTGgcg, RVS
Oligo: aattcgcCAGCACGAGTTCGACAGCGAAtatgcttgaatataactaTTCGCTGTCGAACTCGTGCTGactg
Hairpin ID: SH01055.N; FWD Oligo:
ctagcagtCCGCTATTTGTTAATTGTTAAtagttatattcaagcataTTAACAATTAACAAATAGCGGgcg, RVS Oligo:
aattcgcCCGCTATTTGTTAATTGTTAAtatgcttgaatataactaTTAACAATTAACAAATAGCGGactg
Hairpin ID: SH01738.N; FWD Oligo:
ctagcagtAAGAACGATTACTCTAATCAAtagttatattcaagcataTTGATTAGAGTAATCGTTCTTgcg, RVS Oligo:
aattcgcAAGAACGATTACTCTAATCAAtatgcttgaatataactaTTGATTAGAGTAATCGTTCTTactg
Hairpin ID: SH01739.N; FWD Oligo:
ctagcagtAAGCACGTTCTCTAAAGTTAAtagttatattcaagcataTTAACTTTAGAGAACGTGCTTgcg, RVS Oligo:
aattcgcAAGCACGTTCTCTAAAGTTAAtatgcttgaatataactaTTAACTTTAGAGAACGTGCTTactg
Hairpin ID: TR01628A.1; FWD Oligo: AGTCTAGAAGTTCCTTTCGATTCGCAGA, RVS Oligo:
AAGAATTCATAGCCACCGAATATCGCAG
Hairpin ID: TR01629A.1; FWD Oligo: AGTCTAGATTATTCAAAGGAATTCGGCG, RVS Oligo:
AACAATTGTCTGCGAATCGAAAGGAACT
Hairpin ID: TR02540P.1; FWD Oligo: AAGAATTCCAGCTGGTCAACGAGATGAA, RVS Oligo:
AGTCTAGAAGGGCATGTGAATATGGGAC
Hairpin ID: TR00033A.1; FWD Oligo: GTCTAGAATCATGCTGGTCATGGTCAA, RVS Oligo:
AGAATTCCTCGGCCACCTTAGAGTCAC
Hairpin ID: TR00034A.1; FWD Oligo: GTCTAGACAGTGCTAATCCATCGCAGA, RVS Oligo:
AGAATTCATTGCTGCTGCGTCTCTCTT
Hairpin ID: SH01724.N; FWD Oligo:
ctagcagtAAGAAGAAGAGTTGCGAAGAAtagttatattcaagcataTTCTTCGCAACTCTTCTTCTTgcg, RVS
Oligo: aattcgcAAGAAGAAGAGTTGCGAAGAAtatgcttgaatataactaTTCTTCGCAACTCTTCTTCTTactg
Hairpin ID: TR01015P.1; FWD Oligo: AGTCTAGACCACCAAAGCCACTGAATCT, RVS Oligo:
AAGAATTCTTTGTTGGTTGCAGTTTTGC
Hairpin ID: TR01249P.1; FWD Oligo: AGTCTAGAAAAAAGGAGCCCCTAATGGA, RVS Oligo:
AAGAATTCGTTTCCGGGGTATACCAACC
Hairpin ID: SH01844.N; FWD Oligo:
ctagcagtCTCCTACAACATGTTCGACAAtagttatattcaagcataTTGTCGAACATGTTGTAGGAGgcg, RVS
Oligo: aattcgcCTCCTACAACATGTTCGACAAtatgcttgaatataactaTTGTCGAACATGTTGTAGGAGactg
Hairpin ID: SH00138.N; FWD Oligo:
ctagcagtAGCAATCATAATTGTATTTAAtagttatattcaagcataTTAAATACAATTATGATTGCTgcg, RVS Oligo:
aattcgcAGCAATCATAATTGTATTTAAtatgcttgaatataactaTTAAATACAATTATGATTGCTactg
Hairpin ID: TR01826P.1; FWD Oligo: CACCGAATTCTTCAATCGCAAATCAAACCA, RVS Oligo:
GCGGCAACTCTTGTCTTTTC
Hairpin ID: SH00807.N; FWD Oligo:
ctagcagtCAGCAGCTAATTACAAGTGAAtagttatattcaagcataTTCACTTGTAATTAGCTGCTGgcg, RVS
Oligo: aattcgcCAGCAGCTAATTACAAGTGAAtatgcttgaatataactaTTCACTTGTAATTAGCTGCTGactg
Hairpin ID: TR00495A.1; FWD Oligo: GTCTAGAAGTACGAGCTGCCACATCCT, RVS Oligo:
AGAATTCCAGATCGCAATCCTGGAAAT
Hairpin ID: TR01222P.1; FWD Oligo: AGTCTAGAAAGATCAATGACTCGCCACC, RVS Oligo:
AAGAATTCTGGACGAGCTGGTTCCTAAT
Hairpin ID: TR00890P.1; FWD Oligo: AGTCTAGAACGTTAATGTGAATCCCCCA, RVS Oligo:
AAGAATTCGCTGGACACAGGAACCATTT
Hairpin ID: TR00891P.1; FWD Oligo: AAGAATTCGATGACGCACGAAGAGAACA, RVS Oligo:
AGTCTAGATGCAATTCCTTTTGTTGCAG
Hairpin ID: TR01538A.1; FWD Oligo: AGTCTAGAGAAGGAGCAGCGGAAGTATG, RVS Oligo:
AAGAATTCACGTGGCTGAATACCCTCAC
Hairpin ID: SH01011.N; FWD Oligo:
ctagcagtACGATTCGAAACACACTTAAAtagttatattcaagcataTTTAAGTGTGTTTCGAATCGTgcg, RVS Oligo:
aattcgcACGATTCGAAACACACTTAAAtatgcttgaatataactaTTTAAGTGTGTTTCGAATCGTactg
Hairpin ID: TR00487A.1; FWD Oligo: GTCTAGAGCCGATAGCCGAATCAATAA, RVS Oligo:
AGAATTCTGGATGATCGTGTTGCAAGT
Hairpin ID: SH01010.N; FWD Oligo:
ctagcagtTTCGCTGGTGTTAAAGATGAAtagttatattcaagcataTTCATCTTTAACACCAGCGAAgcg, RVS
Oligo: aattcgcTTCGCTGGTGTTAAAGATGAAtatgcttgaatataactaTTCATCTTTAACACCAGCGAAactg
Hairpin ID: TR00348P.1; FWD Oligo: GTCTAGATGCATTCGAGACAACAGAGG, RVS Oligo:
AGAATTCCGTTGGGCTGGTAGATCTGT
Hairpin ID: SH00425.N; FWD Oligo:
ctagcagtTAGACCTGGATTAGTTAAATAtagttatattcaagcataTATTTAACTAATCCAGGTCTAgcg, RVS Oligo:
aattcgcTAGACCTGGATTAGTTAAATAtatgcttgaatataactaTATTTAACTAATCCAGGTCTAactg
Hairpin ID: TR01221P.1; FWD Oligo: AGTCTAGAATCGATAACAATCCGTTCGC, RVS Oligo:
AAGAATTCGTTGAAGGCCTTGGTGATGT
Hairpin ID: SH00681.N; FWD Oligo:
ctagcagtTTCAGTAATTAACTTGTTTAAtagttatattcaagcataTTAAACAAGTTAATTACTGAAgcg, RVS Oligo:
aattcgcTTCAGTAATTAACTTGTTTAAtatgcttgaatataactaTTAAACAAGTTAATTACTGAAactg
Hairpin ID: TR00114A.1; FWD Oligo: GTCTAGACGTCTACGGATGAGGAGGAA, RVS Oligo:
AGAATTCGATGTCGATGAGATCCACCA
Hairpin ID: TR01492P.1; FWD Oligo: AGTCTAGAAGCGCGACTCGTGAAACTAT, RVS Oligo:
AAGAATTCGGAACTTTAGGCGACTGCAC
Hairpin ID: SH00742.N; FWD Oligo:
ctagcagtAACGTTGATTGTATTGTACAAtagttatattcaagcataTTGTACAATACAATCAACGTTgcg, RVS Oligo:
aattcgcAACGTTGATTGTATTGTACAAtatgcttgaatataactaTTGTACAATACAATCAACGTTactg
Hairpin ID: TR02470P.1; FWD Oligo: AAGAATTCGCTGGAGCTGAATGTGTGAA, RVS Oligo:
AGTCTAGATGGATCTCCACTGGATCCTC
Hairpin ID: SH00759.N; FWD Oligo:
ctagcagtCCGCGTTGAGGAAGAGATCAAtagttatattcaagcataTTGATCTCTTCCTCAACGCGGgcg, RVS
Oligo: aattcgcCCGCGTTGAGGAAGAGATCAAtatgcttgaatataactaTTGATCTCTTCCTCAACGCGGactg
Hairpin ID: SH00966.N; FWD Oligo:
ctagcagtTGCCTCCGATCTCAAGCGCAAtagttatattcaagcataTTGCGCTTGAGATCGGAGGCAgcg, RVS
Oligo: aattcgcTGCCTCCGATCTCAAGCGCAAtatgcttgaatataactaTTGCGCTTGAGATCGGAGGCAactg
Hairpin ID: TR02514P.1; FWD Oligo: AAGAATTCGAGGTTGATGTGGAGGAGGA, RVS Oligo:
AGTCTAGAACTCGGCGAAAAGACTTTCA
Hairpin ID: SH00790.N; FWD Oligo:
ctagcagtTAGCTTAATAAGACATGTTTAtagttatattcaagcataTAAACATGTCTTATTAAGCTAgcg, RVS Oligo:
aattcgcTAGCTTAATAAGACATGTTTAtatgcttgaatataactaTAAACATGTCTTATTAAGCTAactg
Hairpin ID: TR02706P.1; FWD Oligo: AAGAATTCGGAGTATCCTGCTCCAACGA, RVS Oligo:
AGTCTAGATTTGGATAGCCTCTGTTGCC
Hairpin ID: TR01191P.1; FWD Oligo: AGTCTAGATGTAGGACGTACCGATGCAA, RVS Oligo:
AAGAATTCTGGAAATGCAAACGAAGTTG
Hairpin ID: SH01846.N; FWD Oligo:
ctagcagtACGAGTGATACGAGAAGTATAtagttatattcaagcataTATACTTCTCGTATCACTCGTgcg, RVS
Oligo: aattcgcACGAGTGATACGAGAAGTATAtatgcttgaatataactaTATACTTCTCGTATCACTCGTactg
Hairpin ID: SH00864.N; FWD Oligo:
ctagcagtAACCAGATAAGTGATAATAAAtagttatattcaagcataTTTATTATCACTTATCTGGTTgcg, RVS Oligo:
aattcgcAACCAGATAAGTGATAATAAAtatgcttgaatataactaTTTATTATCACTTATCTGGTTactg
Hairpin ID: SH00865.N; FWD Oligo:
ctagcagtACGCAATAAATTGCTACTCAAtagttatattcaagcataTTGAGTAGCAATTTATTGCGTgcg, RVS Oligo:
aattcgcACGCAATAAATTGCTACTCAAtatgcttgaatataactaTTGAGTAGCAATTTATTGCGTactg
Hairpin ID: TR00546A.1; FWD Oligo: GTCTAGAAGGATGAGGACTCCAGCTCA, RVS Oligo:
AGAATTCTATATCTCGCGGGCAAACTT
Hairpin ID: SH00806.N; FWD Oligo:
ctagcagtAAGAGGAAAGATCACACAATAtagttatattcaagcataTATTGTGTGATCTTTCCTCTTgcg, RVS Oligo:
aattcgcAAGAGGAAAGATCACACAATAtatgcttgaatataactaTATTGTGTGATCTTTCCTCTTactg
Hairpin ID: TR02381P.1; FWD Oligo: AAGAATTCAACGGGTTGCAAATGGTTTA, RVS Oligo:
AGTCTAGAATTGAGTGGACGACTTTGGG
Hairpin ID: SH00639.N; FWD Oligo:
ctagcagtCAAGTTCATCTAGTTAAGTAAtagttatattcaagcataTTACTTAACTAGATGAACTTGgcg, RVS Oligo:
aattcgcCAAGTTCATCTAGTTAAGTAAtatgcttgaatataactaTTACTTAACTAGATGAACTTGactg
Hairpin ID: TR01424P.1; FWD Oligo: AGTCTAGAAATTCCGGAAATGCACAGAG, RVS Oligo:
AAGAATTCTCACTTCCCTCAGACTCGCT
Hairpin ID: SH00812.N; FWD Oligo:
ctagcagtAAGGATCGAAGACGAACTCAAtagttatattcaagcataTTGAGTTCGTCTTCGATCCTTgcg, RVS
Oligo: aattcgcAAGGATCGAAGACGAACTCAAtatgcttgaatataactaTTGAGTTCGTCTTCGATCCTTactg
Hairpin ID: TR02162P.1; FWD Oligo: CACCGAATTCGCGCGAATTACTTGCAAACT, RVS Oligo:
GTCCCATTTTGTTTGCCATC
Hairpin ID: SH01050.N; FWD Oligo:
ctagcagtCTGTTCGACATCATTGTCAAAtagttatattcaagcataTTTGACAATGATGTCGAACAGgcg, RVS
Oligo: aattcgcCTGTTCGACATCATTGTCAAAtatgcttgaatataactaTTTGACAATGATGTCGAACAGactg
Hairpin ID: SH01051.N; FWD Oligo:
ctagcagtCAGGAGCTGCTTCCACGGAAAtagttatattcaagcataTTTCCGTGGAAGCAGCTCCTGgcg, RVS
Oligo: aattcgcCAGGAGCTGCTTCCACGGAAAtatgcttgaatataactaTTTCCGTGGAAGCAGCTCCTGactg
Hairpin ID: TR01827P.1; FWD Oligo: CACCGAATTCCATCTGGTATGTGCTGTGGG, RVS Oligo:
ACGAAAAAGAGCACGGAATG
Hairpin ID: SH00489.N; FWD Oligo:
ctagcagtAAGCAGCAAGCACCAAGACAAtagttatattcaagcataTTGTCTTGGTGCTTGCTGCTTgcg, RVS
Oligo: aattcgcAAGCAGCAAGCACCAAGACAAtatgcttgaatataactaTTGTCTTGGTGCTTGCTGCTTactg
Hairpin ID: SH00948.N; FWD Oligo:
ctagcagtTTCGACGATTTCTGTATATGAtagttatattcaagcataTCATATACAGAAATCGTCGAAgcg, RVS Oligo:
aattcgcTTCGACGATTTCTGTATATGAtatgcttgaatataactaTCATATACAGAAATCGTCGAAactg
Hairpin ID: SH00947.N; FWD Oligo:
ctagcagtAAAGTAGTTAGAATACATAAAtagttatattcaagcataTTTATGTATTCTAACTACTTTgcg, RVS Oligo:
aattcgcAAAGTAGTTAGAATACATAAAtatgcttgaatataactaTTTATGTATTCTAACTACTTTactg
Hairpin ID: TR01872P.1; FWD Oligo: CACCGAATTCGTCCCTTCAGTCCCTCCTTC, RVS Oligo:
ATCAGATTGTTGCGATGCAG
Hairpin ID: TR02635P.1; FWD Oligo: AAGAATTCTGCTCGTGATCATGGGATTA, RVS Oligo:
AGTCTAGAAAACGATCTTGAGCACCCAC
Hairpin ID: TR01659A.1; FWD Oligo: AGTCTAGATTGAATCCATTTCGGAGGAG, RVS Oligo:
AAGAATTCAATCCTGGAGGCCTGAATCT
Hairpin ID: TR01658A.1; FWD Oligo: AGTCTAGAGATAAAAGTCTCGCCGTTGC, RVS Oligo:
AAGAATTCTCGGTGTTGAATGAGTTCCA
Hairpin ID: TR02981P.1; FWD Oligo: AAGAATTCACACATTTGCCCTGGAGTTC, RVS Oligo:
AGTCTAGAAGTTTGAGCAATGGTCCTGC
Hairpin ID: SH00252.N; FWD Oligo:
ctagcagtCAGATCGAGAACAGCAATATAtagttatattcaagcataTATATTGCTGTTCTCGATCTGgcg, RVS
Oligo: aattcgcCAGATCGAGAACAGCAATATAtatgcttgaatataactaTATATTGCTGTTCTCGATCTGactg
Hairpin ID: TR02163P.1; FWD Oligo: CACCGAATTCCCCTAAAGCGTCACTTCGAG, RVS Oligo:
ATTCGCCGAAAATGTCGTAG
Hairpin ID: TR04499P.1; FWD Oligo: AAGAATTCGTGCTGGGCTTTGTATTGCT, RVS Oligo:
AGTCTAGAACTTAATAGCCACCCCTGCC
Hairpin ID: TR00767A.1; FWD Oligo: GTCTAGACATTCTCTCCTTCTTTGCCG, RVS Oligo:
AGAATTCTCGTTGAGAAAGTCGCACAC
Hairpin ID: SH01046.N; FWD Oligo:
ctagcagtCTCGATCAATTTATACAGCAAtagttatattcaagcataTTGCTGTATAAATTGATCGAGgcg, RVS Oligo:
aattcgcCTCGATCAATTTATACAGCAAtatgcttgaatataactaTTGCTGTATAAATTGATCGAGactg
Hairpin ID: SH01047.N; FWD Oligo:
ctagcagtCAGATCGACTTGAAAGAGTTAtagttatattcaagcataTAACTCTTTCAAGTCGATCTGgcg, RVS
Oligo: aattcgcCAGATCGACTTGAAAGAGTTAtatgcttgaatataactaTAACTCTTTCAAGTCGATCTGactg
Hairpin ID: TR04640P.1; FWD Oligo: AAGAATTCGACCTGCTCACCCTGCTTAC, RVS Oligo:
AGTCTAGATCTATTGGCAAGGTCTCGCT
Hairpin ID: SH00588.N; FWD Oligo:
ctagcagtTTGATTGTAACAACAATTTAAtagttatattcaagcataTTAAATTGTTGTTACAATCAAgcg, RVS Oligo:
aattcgcTTGATTGTAACAACAATTTAAtatgcttgaatataactaTTAAATTGTTGTTACAATCAAactg
Hairpin ID: SH00532.N; FWD Oligo:
ctagcagtCTCATACGAACTGATGGACTAtagttatattcaagcataTAGTCCATCAGTTCGTATGAGgcg, RVS
Oligo: aattcgcCTCATACGAACTGATGGACTAtatgcttgaatataactaTAGTCCATCAGTTCGTATGAGactg
Hairpin ID: SH00819.N; FWD Oligo:
ctagcagtTAGCGTCAAGATGAAGATGAAtagttatattcaagcataTTCATCTTCATCTTGACGCTAgcg, RVS
Oligo: aattcgcTAGCGTCAAGATGAAGATGAAtatgcttgaatataactaTTCATCTTCATCTTGACGCTAactg
Hairpin ID: TR01198P.1; FWD Oligo: AGTCTAGATGGGAACCACTCTCTCCAAG, RVS Oligo:
AAGAATTCACGACAACTGAAGCCGAGTT
Hairpin ID: TR01711P.1; FWD Oligo: CACCGAATTCCGAGTTATCCAAAAAGCCCA, RVS Oligo:
AGGCCATAAAAGCACACACC
Hairpin ID: TR00853P.1; FWD Oligo: AGTCTAGATCAAGGATGTGGACAGGACA, RVS Oligo:
AAGAATTCAAAAGCCTTGCAGCCTAACA
Hairpin ID: TR02720P.1; FWD Oligo: AAGAATTCATGAACTTGTGTTCCTCGGG, RVS Oligo:
AGTCTAGAGATGGGCTTGCTTTTCTTTG
Hairpin ID: TR02165P.1; FWD Oligo: CACCGAATTCCTACTGCCATCCCCATCACT, RVS Oligo:
ATCCGATCCAAAGTGTCGTC
Hairpin ID: TR02166P.1; FWD Oligo: CACCGAATTCCAAGCCAAGCCGAGAGTAAG, RVS Oligo:
TGATTTTGCAGCTTTTGACG
Hairpin ID: SH00669.N; FWD Oligo:
ctagcagtCAAGTAGTGTACACCAAGAAAtagttatattcaagcataTTTCTTGGTGTACACTACTTGgcg, RVS
Oligo: aattcgcCAAGTAGTGTACACCAAGAAAtatgcttgaatataactaTTTCTTGGTGTACACTACTTGactg
Hairpin ID: TR00452P.1; FWD Oligo: GTCTAGAAACCCTACCCATCAAGTCCC, RVS Oligo:
AGAATTCCCGTAATGGGTTCCGATATG
Hairpin ID: TR02368P.1; FWD Oligo: AAGAATTCGATCGCCTACTCGAAACAGC, RVS Oligo:
AGTCTAGAATAGGAATTTCCCGTGGAGG
Hairpin ID: SH00724.N; FWD Oligo:
ctagcagtCACGGTCACAACCACTCTAAAtagttatattcaagcataTTTAGAGTGGTTGTGACCGTGgcg, RVS
Oligo: aattcgcCACGGTCACAACCACTCTAAAtatgcttgaatataactaTTTAGAGTGGTTGTGACCGTGactg
Hairpin ID: SH00253.N; FWD Oligo:
ctagcagtCAGACGCTACAGCGAGTTCTAtagttatattcaagcataTAGAACTCGCTGTAGCGTCTGgcg, RVS
Oligo: aattcgcCAGACGCTACAGCGAGTTCTAtatgcttgaatataactaTAGAACTCGCTGTAGCGTCTGactg
Hairpin ID: TR00892P.1; FWD Oligo: AGTCTAGACACAACTACGCCGATCTGAA, RVS Oligo:
AAGAATTCTTCGCTTCCAAGTCCACTCT
Hairpin ID: SH00324.N; FWD Oligo:
ctagcagtCTGGCTGACTTTCAACTAGAAtagttatattcaagcataTTCTAGTTGAAAGTCAGCCAGgcg, RVS
Oligo: aattcgcCTGGCTGACTTTCAACTAGAAtatgcttgaatataactaTTCTAGTTGAAAGTCAGCCAGactg
Hairpin ID: SH00254.N; FWD Oligo:
ctagcagtCAGGTTCTCACATTCATTTAAtagttatattcaagcataTTAAATGAATGTGAGAACCTGgcg, RVS Oligo:
aattcgcCAGGTTCTCACATTCATTTAAtatgcttgaatataactaTTAAATGAATGTGAGAACCTGactg
Hairpin ID: SH01685.N; FWD Oligo:
ctagcagtCAGCTGTTCCGACAAATCAAAtagttatattcaagcataTTTGATTTGTCGGAACAGCTGgcg, RVS
Oligo: aattcgcCAGCTGTTCCGACAAATCAAAtatgcttgaatataactaTTTGATTTGTCGGAACAGCTGactg
Hairpin ID: TR00257A.1; FWD Oligo: GTCTAGATACGGTCATACGACTGCGAA, RVS Oligo:
AGAATTCAGCACTCCATCTGTGCTGTG
Hairpin ID: SH00567.N; FWD Oligo:
ctagcagtTCGCGACAATGTAAAGTTCTAtagttatattcaagcataTAGAACTTTACATTGTCGCGAgcg, RVS
Oligo: aattcgcTCGCGACAATGTAAAGTTCTAtatgcttgaatataactaTAGAACTTTACATTGTCGCGAactg
Hairpin ID: TR02167P.1; FWD Oligo: CACCGAATTCGCGGCATATCTAAGGAGCTG, RVS Oligo:
CGCCGTTTAGATCACCATTT
Hairpin ID: TR02537P.1; FWD Oligo: AAGAATTCCCAATGGTCCCATGTCCTAA, RVS Oligo:
AGTCTAGATGGCCTAATACTTTCGCTGC
Hairpin ID: TR02699P.1; FWD Oligo: AAGAATTCGTCCTGGGACTCAACGACAT, RVS Oligo:
AGTCTAGATGCAATCGATTCTGATCCAA
Hairpin ID: SH01675.N; FWD Oligo:
ctagcagtCCGGTGATGCTGCAAAGTCTAtagttatattcaagcataTAGACTTTGCAGCATCACCGGgcg, RVS
Oligo: aattcgcCCGGTGATGCTGCAAAGTCTAtatgcttgaatataactaTAGACTTTGCAGCATCACCGGactg
Hairpin ID: SH01815.N; FWD Oligo:
ctagcagtCAGATGCTAGCGAATAACTAAtagttatattcaagcataTTAGTTATTCGCTAGCATCTGgcg, RVS
Oligo: aattcgcCAGATGCTAGCGAATAACTAAtatgcttgaatataactaTTAGTTATTCGCTAGCATCTGactg
Hairpin ID: SH00120.N; FWD Oligo:
ctagcagtAAAGATGTGTGTGGTAAACTAtagttatattcaagcataTAGTTTACCACACACATCTTTgcg, RVS Oligo:
aattcgcAAAGATGTGTGTGGTAAACTAtatgcttgaatataactaTAGTTTACCACACACATCTTTactg
Hairpin ID: TR02345P.1; FWD Oligo: AAGAATTCTATAAAGTTCGTGGGCTGGG, RVS Oligo:
AGTCTAGAAATCTCCAGCACATAACCCG
Hairpin ID: TR00716A.1; FWD Oligo: GTCTAGATCCATAAGCCGCAGTATTCC, RVS Oligo:
AGAATTCCTGGGTGAAGAGGAGTAGCG
Hairpin ID: TR00715A.1; FWD Oligo: GTCTAGATTCACGATAATGGCATCGAA, RVS Oligo:
AGAATTCAGACGCAGATCCGTCAGATT
Hairpin ID: TR03862P.1; FWD Oligo: AAGAATTCAACGTATCACTCCTCGCCAC, RVS Oligo:
AGTCTAGAATACTCAACCTCGCCAAGGA
Hairpin ID: SH00376.N; FWD Oligo:
ctagcagtATCGAAGGACTTGAAAGTGAAtagttatattcaagcataTTCACTTTCAAGTCCTTCGATgcg, RVS
Oligo: aattcgcATCGAAGGACTTGAAAGTGAAtatgcttgaatataactaTTCACTTTCAAGTCCTTCGATactg
Hairpin ID: TR04026P.1; FWD Oligo: AAGAATTCGAGGCCTACGAAGTGCTCAG, RVS Oligo:
AGTCTAGATTGCAGTACTGACAGCGACC
Hairpin ID: TR00258P.1; FWD Oligo: AAGAATTCAACCACCACAATCATCAGCA, RVS Oligo:
AGTCTAGACGTAATGGACACATGGTTGC
Hairpin ID: SH00609.N; FWD Oligo:
ctagcagtAAGCTATAAGCTAGAACATAAtagttatattcaagcataTTATGTTCTAGCTTATAGCTTgcg, RVS Oligo:
aattcgcAAGCTATAAGCTAGAACATAAtatgcttgaatataactaTTATGTTCTAGCTTATAGCTTactg
Hairpin ID: SH00255.N; FWD Oligo:
ctagcagtCAGCTTCACTTCGACATCAAAtagttatattcaagcataTTTGATGTCGAAGTGAAGCTGgcg, RVS
Oligo: aattcgcCAGCTTCACTTCGACATCAAAtatgcttgaatataactaTTTGATGTCGAAGTGAAGCTGactg
Hairpin ID: SH00727.N; FWD Oligo:
ctagcagtAAGGATCTGTGCTTCGACCAAtagttatattcaagcataTTGGTCGAAGCACAGATCCTTgcg, RVS
Oligo: aattcgcAAGGATCTGTGCTTCGACCAAtatgcttgaatataactaTTGGTCGAAGCACAGATCCTTactg
Hairpin ID: TR01558A.1; FWD Oligo: AGTCTAGACGATTGCGATTTGATGTCAC, RVS Oligo:
AAGAATTCGGAATGTTCTGTGGTTGCCT
Hairpin ID: SH01686.N; FWD Oligo:
ctagcagtCTCTAGATGTTCAACTACAAAtagttatattcaagcataTTTGTAGTTGAACATCTAGAGgcg, RVS Oligo:
aattcgcCTCTAGATGTTCAACTACAAAtatgcttgaatataactaTTTGTAGTTGAACATCTAGAGactg
Hairpin ID: TR04568P.1; FWD Oligo: AAGAATTCATCGCAAGCTATGGCAGAGT, RVS Oligo:
AGTCTAGAATATCGTAGACGGCACTGGG
Hairpin ID: SH00598.N; FWD Oligo:
ctagcagtAAGATGCAGACTGCTCCTATAtagttatattcaagcataTATAGGAGCAGTCTGCATCTTgcg, RVS
Oligo: aattcgcAAGATGCAGACTGCTCCTATAtatgcttgaatataactaTATAGGAGCAGTCTGCATCTTactg
Hairpin ID: TR00213A.1; FWD Oligo: GTCTAGATTGTGTGCGTGTGCTAATCA, RVS Oligo:
AGAATTCCCATTCAAATTTTCGGTTCC
Hairpin ID: TR04569P.1; FWD Oligo: AAGAATTCTCGTTCGTATCAGTTGAGCG, RVS Oligo:
AGTCTAGATCCCAGAAGAACACTACCCG
Hairpin ID: TR00935P.1; FWD Oligo: AGTCTAGATCTTCGTCCCCTTCGTACAC, RVS Oligo:
AAGAATTCCTCGTATGCTCAGCTGTTCG
Hairpin ID: TR00259P.1; FWD Oligo: AAGAATTCGACCAGAAAAGAGTCAGCCG, RVS Oligo:
AGTCTAGAGGAAGAAGCTCCTTTCCACC
Hairpin ID: SH00843.N; FWD Oligo:
ctagcagtTAGGGTCAGTATTTCAATTAAtagttatattcaagcataTTAATTGAAATACTGACCCTAgcg, RVS Oligo:
aattcgcTAGGGTCAGTATTTCAATTAAtatgcttgaatataactaTTAATTGAAATACTGACCCTAactg
Hairpin ID: TR04639P.1; FWD Oligo: AACAATTGGGGGCAGGAAGAAGAAGAAC, RVS Oligo:
AGTCTAGAACTCGCAGGTGAGGTACTCG
Hairpin ID: TR02170P.1; FWD Oligo: CACCGAATTCCCGGAGTAATTGACAAGCGT, RVS Oligo:
AAAGTCTCCTTGGCCACATC
Hairpin ID: TR04526P.1; FWD Oligo: AAGAATTCTTTCCCAAGATGATGAAGGC, RVS Oligo:
AGTCTAGAAACTTGGGCAGGTACACGTC
Hairpin ID: TR02171P.1; FWD Oligo: CACCGAATTCGGTGGTTCATCCTCCATGTC, RVS Oligo:
CGGAGATTTGGTATCGTCGT
Hairpin ID: TR01239P.1; FWD Oligo: AGTCTAGATATCCCCACAGTGCCTATCC, RVS Oligo:
AAGAATTCGAGCCAGAGGCTTCAGATTG
Hairpin ID: TR02485P.1; FWD Oligo: AAGAATTCTAGAGATTCCTCGGAAGCGA, RVS Oligo:
AGTCTAGACGTGATATGCGAAACCAATG
Hairpin ID: SH00256.N; FWD Oligo:
ctagcagtAAGAAGCTAGGCAATATTAAAtagttatattcaagcataTTTAATATTGCCTAGCTTCTTgcg, RVS Oligo:
aattcgcAAGAAGCTAGGCAATATTAAAtatgcttgaatataactaTTTAATATTGCCTAGCTTCTTactg
Hairpin ID: TR01011P.1; FWD Oligo: AGTCTAGACGAGGAGCACTAACTCCCTG, RVS Oligo:
AAGAATTCCTTCTTGAGACCTCGGTTGC
Hairpin ID: SH01764.N; FWD Oligo:
ctagcagtCCGAGAAGTTATAACAATTTAtagttatattcaagcataTAAATTGTTATAACTTCTCGGgcg, RVS Oligo:
aattcgcCCGAGAAGTTATAACAATTTAtatgcttgaatataactaTAAATTGTTATAACTTCTCGGactg
Hairpin ID: TR00494A.1; FWD Oligo: GTCTAGACGACACAGCCTCCAATGATA, RVS Oligo:
AGAATTCTGTAGCGCACACAGTTCTCC
Hairpin ID: TR02308P.1; FWD Oligo: CACCGAATTCAGCTCATCCGCGATACAGTT, RVS Oligo:
CTGCTCGTCATCCAAGCTCT
Hairpin ID: SH00747.N; FWD Oligo:
ctagcagtCCGATAGTTCAGCAAGCGAAAtagttatattcaagcataTTTCGCTTGCTGAACTATCGGgcg, RVS
Oligo: aattcgcCCGATAGTTCAGCAAGCGAAAtatgcttgaatataactaTTTCGCTTGCTGAACTATCGGactg
Hairpin ID: SH01687.N; FWD Oligo:
ctagcagtCGCGACGACAAGAATAGCGAAtagttatattcaagcataTTCGCTATTCTTGTCGTCGCGgcg, RVS
Oligo: aattcgcCGCGACGACAAGAATAGCGAAtatgcttgaatataactaTTCGCTATTCTTGTCGTCGCGactg
Hairpin ID: TR00344P.1; FWD Oligo: GTCTAGAGGACTTGAGGCACTTGAAGC, RVS Oligo:
AGAATTCGCATCATGGTGAAGAGCAGA
Hairpin ID: TR02172P.1; FWD Oligo: CACCGAATTCCAAGCGTGGAGGTGTATGTG, RVS Oligo:
GGCTGCAAAAAGGGGACTAT
Hairpin ID: TR01828P.1; FWD Oligo: CACCGAATTCAAATCTGGTGGCAGTTTTCG, RVS Oligo:
TGGGCTTGCTTGAAGAACTC
Hairpin ID: TR00449P.1; FWD Oligo: GTCTAGAGCCCTCAATCCATTCGTTTA, RVS Oligo:
AGAATTCCTGGCACTCGAGTTGTTTCA
Hairpin ID: TR00449P.1hm; FWD Oligo: GTCTAGAGCCCTCAATCCATTCGTTTA, RVS Oligo:
AGAATTCCTGGCACTCGAGTTGTTTCA
Hairpin ID: TR02616P.1; FWD Oligo: AAGAATTCAGTTCCCCTGGAGCACAATA, RVS Oligo:
AGTCTAGATAGAAATCGGATACGGCTGC
Hairpin ID: TR02443P.1; FWD Oligo: AAGAATTCCGATTTTAACCCAAAAGCGA, RVS Oligo:
AGTCTAGAGCTGCATAAGGAGCGAATTG
Hairpin ID: SH00670.N; FWD Oligo:
ctagcagtTAGATAGATAGTAACGTTTAAtagttatattcaagcataTTAAACGTTACTATCTATCTAgcg, RVS Oligo:
aattcgcTAGATAGATAGTAACGTTTAAtatgcttgaatataactaTTAAACGTTACTATCTATCTAactg
Hairpin ID: SH00956.N; FWD Oligo:
ctagcagtCAGTTGTTTCAAGTTGTCTAAtagttatattcaagcataTTAGACAACTTGAAACAACTGgcg, RVS Oligo:
aattcgcCAGTTGTTTCAAGTTGTCTAAtatgcttgaatataactaTTAGACAACTTGAAACAACTGactg
Hairpin ID: SH00818.N; FWD Oligo:
ctagcagtAAGGTTCATGATGCTTTCCTAtagttatattcaagcataTAGGAAAGCATCATGAACCTTgcg, RVS
Oligo: aattcgcAAGGTTCATGATGCTTTCCTAtatgcttgaatataactaTAGGAAAGCATCATGAACCTTactg
Hairpin ID: TR02173P.1hm; FWD Oligo: CACCGAATTCCTGTGGAAGAAACTGCACGA, RVS Oligo:
GCTTGGTTGGTGTCTTGTCA
Hairpin ID: TR02173P.1; FWD Oligo: CACCGAATTCCTGTGGAAGAAACTGCACGA, RVS Oligo:
GCTTGGTTGGTGTCTTGTCA
Hairpin ID: TR02482P.1; FWD Oligo: AAGAATTCGTGTGATCTGCCATGGTGAC, RVS Oligo:
AGTCTAGACTTGCCCGTGAGATTCTGTT
Hairpin ID: SH00257.N; FWD Oligo:
ctagcagtCAGCACTAACAAATAGCTTTAtagttatattcaagcataTAAAGCTATTTGTTAGTGCTGgcg, RVS Oligo:
aattcgcCAGCACTAACAAATAGCTTTAtatgcttgaatataactaTAAAGCTATTTGTTAGTGCTGactg
Hairpin ID: SH00485.N; FWD Oligo:
ctagcagtCGGATTCTACGACGAATGCAAtagttatattcaagcataTTGCATTCGTCGTAGAATCCGgcg, RVS
Oligo: aattcgcCGGATTCTACGACGAATGCAAtatgcttgaatataactaTTGCATTCGTCGTAGAATCCGactg
Hairpin ID: TR00482A.1; FWD Oligo: GTCTAGAAGCACGATTTGTCTGTGCTG, RVS Oligo:
AGAATTCTATCGTGCAATAAATGGCGA
Hairpin ID: TR04500P.1; FWD Oligo: AAGAATTCCGTCAACCACGACAGAACTT, RVS Oligo:
AGTCTAGAATTTGGTTTCCTCTGGCGAC
Hairpin ID: TR04607P.1; FWD Oligo: AAGAATTCTACCACATGGACGACAGCAT, RVS Oligo:
AGTCTAGATGGAAAAGTCCAGGTTACGG
Hairpin ID: TR02697P.1; FWD Oligo: AAGAATTCCGAGGTGGATTTGGTGAAGT, RVS Oligo:
AGTCTAGACTGCGTGGAGTTGATGAGAA
Hairpin ID: TR02506P.1; FWD Oligo: AAGAATTCTGCGAAGAGTGCGAAATATG, RVS Oligo:
AGTCTAGACACCTGGGACACTCTTTGGT
Hairpin ID: TR02703P.1; FWD Oligo: AAGAATTCTTTGGATCAGCTGTTTGTGC, RVS Oligo:
AGTCTAGAAACTTGACTGCGACACATGG
Hairpin ID: TR02385P.1; FWD Oligo: AAGAATTCAATGCCTACATGGAACTCGG, RVS Oligo:
AGTCTAGACGTTGACACCATCACCAGTC
Hairpin ID: SH00047.N; FWD Oligo:
ctagcagtTCCCAACGGCTTTAAGTTCAAtagttatattcaagcataTTGAACTTAAAGCCGTTGGGAgcg, RVS
Oligo: aattcgcTCCCAACGGCTTTAAGTTCAAtatgcttgaatataactaTTGAACTTAAAGCCGTTGGGAactg
Hairpin ID: SH00976.N; FWD Oligo:
ctagcagtCAGCAAGAACATATTACAATAtagttatattcaagcataTATTGTAATATGTTCTTGCTGgcg, RVS Oligo:
aattcgcCAGCAAGAACATATTACAATAtatgcttgaatataactaTATTGTAATATGTTCTTGCTGactg
Hairpin ID: TR00354P.1; FWD Oligo: GTCTAGAAGGGCCTATTCAGAAACCGT, RVS Oligo:
AGAATTCTTGCATTTTCTGTGGCTGAG
Hairpin ID: TR02328P.1; FWD Oligo: CACCGAATTCCTCAGCCACAGAAAATGCAA, RVS Oligo:
CGGCATAGCAGTTTGGAGAC
Hairpin ID: SH00069.N; FWD Oligo:
ctagcagtTAGGCATGGTAGAATGTTCAAtagttatattcaagcataTTGAACATTCTACCATGCCTAgcg, RVS
Oligo: aattcgcTAGGCATGGTAGAATGTTCAAtatgcttgaatataactaTTGAACATTCTACCATGCCTAactg
Hairpin ID: TR02174P.1; FWD Oligo: CACCGAATTCGTGTGACAAGCAGCAATCGT, RVS Oligo:
GTCGGTGTCTGGTTCCTCAT
Hairpin ID: TR01289P.1; FWD Oligo: AGTCTAGAAGCCAGAAGTGAGCCATGTT, RVS Oligo:
AAGAATTCAAGATGGCGAAAAACGTCAC
Hairpin ID: TR04501P.1; FWD Oligo: AACAATTGATGGACGACGATGGAAAGAC, RVS Oligo:
AGTCTAGACATTTTGAAGAAGGCCATGC
Hairpin ID: TR02468P.1; FWD Oligo: AAGAATTCGCGGCTTTGTTTACTTCGTC, RVS Oligo:
AGTCTAGATGACCCGGTAGTTCTTGTCC
Hairpin ID: TR00279P.1; FWD Oligo: AAGAATTCCACAAGTGCTCCACTCCTCA, RVS Oligo:
AGTCTAGAGCACACTTTCTCGCAATCAA
Hairpin ID: TR02175P.1; FWD Oligo: CACCGAATTCGACAAAAAGGCGAGACTTCG, RVS Oligo:
CCTTGGCGTGGTAGACATTT
Hairpin ID: TR02376P.1; FWD Oligo: AAGAATTCAAACTTTTACATCGGCGTGC, RVS Oligo:
AGTCTAGATCTCAATGAACTGCTCCGTG
Hairpin ID: SH00513.N; FWD Oligo:
ctagcagtCCGGATGTTCCCGTCATTCTAtagttatattcaagcataTAGAATGACGGGAACATCCGGgcg, RVS
Oligo: aattcgcCCGGATGTTCCCGTCATTCTAtatgcttgaatataactaTAGAATGACGGGAACATCCGGactg
Hairpin ID: TR02723P.1; FWD Oligo: AAGAATTCCAACCGGAACTAAACTGGGA, RVS Oligo:
AGTCTAGAATCCGTATCGTAGGCAGTGG
Hairpin ID: SH00258.N; FWD Oligo:
ctagcagtACGAGTAGTCTTATATAGATAtagttatattcaagcataTATCTATATAAGACTACTCGTgcg, RVS Oligo:
aattcgcACGAGTAGTCTTATATAGATAtatgcttgaatataactaTATCTATATAAGACTACTCGTactg
Hairpin ID: TR02515P.1; FWD Oligo: AAGAATTCTATATCCCGGGCATACAGGA, RVS Oligo:
AGTCTAGAGAGTGAAACTTCTGCAGGGC
Hairpin ID: TR02176P.1; FWD Oligo: CACCGAATTCCTGCAGCATGGCGATATAGA, RVS Oligo:
CTCCCGTTGTATTTGCACCT
Hairpin ID: TR01428P.1; FWD Oligo: AGTCTAGATTCAAGTGGTGAACCTGCTG, RVS Oligo:
AAGAATTCTCTCCACCTGATCATCCTCC
Hairpin ID: TR00538A.1; FWD Oligo: GTCTAGAAGAACCCATCGAAGCATCC, RVS Oligo:
AGAATTCAGATGTGAATGAGCGGGTGT
Hairpin ID: TR02177P.1; FWD Oligo: CACCGAATTCAGGGAGCCACAACAAGAGAA, RVS Oligo:
CTGCAGTTTTTCGTCCAGGT
Hairpin ID: SH00259.N; FWD Oligo:
ctagcagtATGGATAACAATGTAGAGCAAtagttatattcaagcataTTGCTCTACATTGTTATCCATgcg, RVS Oligo:
aattcgcATGGATAACAATGTAGAGCAAtatgcttgaatataactaTTGCTCTACATTGTTATCCATactg
Hairpin ID: TR01241P.1; FWD Oligo: AGTCTAGAGACAATGGCGGACTACGTTT, RVS Oligo:
AAGAATTCCTCTCGCTCTCGGTCTCACT
Hairpin ID: TR00005A.1; FWD Oligo: GTCTAGACTGACCATGAATCTCTCGCA, RVS Oligo:
AGAATTCTAGAAAGCCAGACCAAAGGC
Hairpin ID: TR00004A.1; FWD Oligo: GTCTAGATCGGCGATATTGAGTCAGTG, RVS Oligo:
AGAATTCGACAATGAGCCGAACCAGAT
Hairpin ID: SH00019.O; FWD Oligo:
ctagcagtTTGTCAACTCGCTGCAGCCAGtagttatattcaagcataCTGGCTGCAGCGAGTTGACAAgcg, RVS
Oligo: aattcgcTTGTCAACTCGCTGCAGCCAGtatgcttgaatataactaCTGGCTGCAGCGAGTTGACAAactg
Hairpin ID: TR01477A.1; FWD Oligo: AGTCTAGATTTGGCGGCTAGTAAGGCTA, RVS Oligo:
AAGAATTCGTACATGAGCTCCGAGAGGC
Hairpin ID: TR00448P.1; FWD Oligo: GTCTAGATTCATAGAAACCTCGGCCCT, RVS Oligo:
AGAATTCGGCGGCTCAGATTTGAATTA
Hairpin ID: SH00417.N; FWD Oligo:
ctagcagtAAGAGAAAGCATGATGGTTAAtagttatattcaagcataTTAACCATCATGCTTTCTCTTgcg, RVS Oligo:
aattcgcAAGAGAAAGCATGATGGTTAAtatgcttgaatataactaTTAACCATCATGCTTTCTCTTactg
Hairpin ID: TR01073P.1; FWD Oligo: AGTCTAGAGATTTGCCCAGGAGCATCTA, RVS Oligo:
AAGAATTCGGAGGGGCTCTCAAATAAGG
Hairpin ID: SH00260.N; FWD Oligo:
ctagcagtCTGGTTGTGCAGAATACACTAtagttatattcaagcataTAGTGTATTCTGCACAACCAGgcg, RVS
Oligo: aattcgcCTGGTTGTGCAGAATACACTAtatgcttgaatataactaTAGTGTATTCTGCACAACCAGactg
Hairpin ID: TR01941P.1; FWD Oligo: CACCGAATTCGCTGTGATTTTCGCACAGAA, RVS Oligo:
CAGGATGAACAGCGAGATGA
Hairpin ID: SH00301.N; FWD Oligo:
ctagcagtCACGAAGACGAATACGAACAAtagttatattcaagcataTTGTTCGTATTCGTCTTCGTGgcg, RVS
Oligo: aattcgcCACGAAGACGAATACGAACAAtatgcttgaatataactaTTGTTCGTATTCGTCTTCGTGactg
Hairpin ID: TR04570P.1; FWD Oligo: AAGAATTCACGGACTGCAACTGGACTCT, RVS Oligo:
AGTCTAGAGCCGCACTGAAGTAGTCCTC
Hairpin ID: SH00365.N; FWD Oligo:
ctagcagtTACCGACGATAGCGAATACTAtagttatattcaagcataTAGTATTCGCTATCGTCGGTAgcg, RVS
Oligo: aattcgcTACCGACGATAGCGAATACTAtatgcttgaatataactaTAGTATTCGCTATCGTCGGTAactg
Hairpin ID: TR00260A.1; FWD Oligo: GTCTAGAGGTTTGTCGCATAAATGGCT, RVS Oligo:
AGAATTCCGCACTTGATAATAGGGGGA
Hairpin ID: SH01688.N; FWD Oligo:
ctagcagtAAGCAAGTAAATTATACATAAtagttatattcaagcataTTATGTATAATTTACTTGCTTgcg, RVS Oligo:
aattcgcAAGCAAGTAAATTATACATAAtatgcttgaatataactaTTATGTATAATTTACTTGCTTactg
Hairpin ID: TR02646P.1; FWD Oligo: AAGAATTCTCCATCCAGGTGTATGAGGG, RVS Oligo:
AGACTAGTCACGGACTGCTTTACGTTGA
Hairpin ID: TR02178P.1; FWD Oligo: CACCGAATTCACGCTCAAGGCTATGGAGAA, RVS Oligo:
GTCTTAGCAGAAGCGGATGG
Hairpin ID: TR02392P.1; FWD Oligo: AAGAATTCACATGTGCTTGGAGTTTCCC, RVS Oligo:
AGTCTAGAACATCACCATGCCAACAAGA
Hairpin ID: TR01287P.1; FWD Oligo: AGTCTAGAATTGCCTTATCGATTGACGG, RVS Oligo:
AAGAATTCATGAACTCCAGTTTGACCCG
Hairpin ID: TR02179P.1; FWD Oligo: CACCGAATTCAACAGCTGCCAACTATCGCT, RVS Oligo:
ATCCAACGCGGTACAGATTC
Hairpin ID: TR00655A.1; FWD Oligo: GTCTAGAACATTCAGAATCTCACGCCC, RVS Oligo:
AGAATTCGCTTGCTGTGCAGATGGTAA
Hairpin ID: TR00654A.1; FWD Oligo: GTCTAGATCAATAGCCACCAATGGACA, RVS Oligo:
AGAATTCCATGGATGTTGAAATCGTCG
Hairpin ID: TR00261A.1; FWD Oligo: GTCTAGAATTAGCACCGACGAGAAGGA, RVS Oligo:
AGAATTCGAACCATTTGATGCCGTTCT
Hairpin ID: TR00215A.1; FWD Oligo: GTCTAGAAAACGAAACCAGTGATTCGG, RVS Oligo:
AGAATTCTCCCAGGCGTTCATGATATT
Hairpin ID: SH00135.N; FWD Oligo:
ctagcagtTACGACAGTAGCGATATCGAAtagttatattcaagcataTTCGATATCGCTACTGTCGTAgcg, RVS
Oligo: aattcgcTACGACAGTAGCGATATCGAAtatgcttgaatataactaTTCGATATCGCTACTGTCGTAactg
Hairpin ID: TR01829P.1; FWD Oligo: CACCGAATTCTCCGATGTACCACAATCCAG, RVS Oligo:
ATGGTGCATCAGTATGGCAA
Hairpin ID: SH00261.N; FWD Oligo:
ctagcagtTACGATGTTATGCACCTAATAtagttatattcaagcataTATTAGGTGCATAACATCGTAgcg, RVS Oligo:
aattcgcTACGATGTTATGCACCTAATAtatgcttgaatataactaTATTAGGTGCATAACATCGTAactg
Hairpin ID: SH00841.N; FWD Oligo:
ctagcagtTAGCTGTACAGTTGTTTAGAAtagttatattcaagcataTTCTAAACAACTGTACAGCTAgcg, RVS Oligo:
aattcgcTAGCTGTACAGTTGTTTAGAAtatgcttgaatataactaTTCTAAACAACTGTACAGCTAactg
Hairpin ID: TR02181P.1; FWD Oligo: CACCGAATTCGGAACACACACGAGTGCCTA, RVS Oligo:
CATTTGCAGCGATCGAGTTA
Hairpin ID: TR01017P.1; FWD Oligo: AGTCTAGAGCGTGTTTCCATGTCCTTTT, RVS Oligo:
AAGAATTCTCGGTTATAGTTGTTCGCCC
Hairpin ID: SH00832.N; FWD Oligo:
ctagcagtTAGCATGCGAATATTCACAAAtagttatattcaagcataTTTGTGAATATTCGCATGCTAgcg, RVS Oligo:
aattcgcTAGCATGCGAATATTCACAAAtatgcttgaatataactaTTTGTGAATATTCGCATGCTAactg
Hairpin ID: TR02182P.1; FWD Oligo: AACAATTGATCCGCCAAAGAGGAAAAGT, RVS Oligo:
AGTCTAGAACGTCGTACAAACGGAAAGC
Hairpin ID: TR02638P.1; FWD Oligo: AAGAATTCCGTGAAGTTTGACATCGGAA, RVS Oligo:
AGTCTAGATGGAAATCACAGGGACAACA
Hairpin ID: TR00691A.1; FWD Oligo: GTCTAGATTGATGGGCCTAAAGGTGAC, RVS Oligo:
AGAATTCCCATCTAGGCGAGCAACTTC
Hairpin ID: TR00692A.1; FWD Oligo: GTCTAGAAAAGAATCGCATTGAGGTGG, RVS Oligo:
AGAATTCTCATAAGGCTGGAGTGAGGG
Hairpin ID: TR02183P.1; FWD Oligo: CACCGAATTCGTCCTGGCAATCCTGACAAC, RVS Oligo:
AGTAGCCAATTCGATGGTGC
Hairpin ID: TR01640A.1; FWD Oligo: AGTCTAGACCAATTGCGACGTAAAAACC, RVS Oligo:
AAGAATTCCAATGTTCTGTGTGGCAAGG
Hairpin ID: TR01641A.1; FWD Oligo: AGTCTAGATCAGCGAGTTGCAAAACATC, RVS Oligo:
AAGAATTCAAGAACTTGTCGCCTCGAAA
Hairpin ID: TR00911P.1; FWD Oligo: AGTCTAGACATGTTGGAGCAAAGTCACG, RVS Oligo:
AAGAATTCATTTGGCTTGGATTTGGATG
Hairpin ID: SH01689.N; FWD Oligo:
ctagcagtCAGAATTGCTACGATGTCCAAtagttatattcaagcataTTGGACATCGTAGCAATTCTGgcg, RVS
Oligo: aattcgcCAGAATTGCTACGATGTCCAAtatgcttgaatataactaTTGGACATCGTAGCAATTCTGactg
Hairpin ID: TR00130A.1; FWD Oligo: GTCTAGACAGTACGATTTCGAGCGGAT, RVS Oligo:
AGAATTCCAAACTGAACATTGATGCCG
Hairpin ID: TR00870P.1; FWD Oligo: AGTCTAGAGCTAACAAAGCGGCAGAAAC, RVS Oligo:
AAGAATTCCGATTTTGGCTTGGACTCAT
Hairpin ID: TR00075A.1; FWD Oligo: GTCTAGACATCGATCTGCAGAAGGTGA, RVS Oligo:
AGAATTCGGTCTCCAGCTTAACGATGC
Hairpin ID: TR00076A.1; FWD Oligo: GTCTAGAAAGATTCTGCGCAAGAAGGA, RVS Oligo:
AGAATTCCACTCTGAACTCTGCCCTCC
Hairpin ID: TR00285P.1; FWD Oligo: AAGAATTCATCCGTTGAGATGAGCAAGG, RVS Oligo:
AGTCTAGACGAAGTTCTTACTGCTCCCG
Hairpin ID: TR00285A.1; FWD Oligo: GTCTAGAATCCGTTGAGATGAGCAAGG, RVS Oligo:
AGAATTCCGAAGTTCTTACTGCTCCCG
Hairpin ID: TR00214A.1; FWD Oligo: GTCTAGAGCGGAGAGTACATTGGCATT, RVS Oligo:
AGAATTCGCGAAATGGTTTGAATGGTT
Hairpin ID: SH01379.N2; FWD Oligo:
ctagcagtTCGATTAAGTTTCCTATTCAAtagttatattcaagcataTTGAATAGGAAACTTAATCGAgcg, RVS Oligo:
aattcgcTCGATTAAGTTTCCTATTCAAtatgcttgaatataactaTTGAATAGGAAACTTAATCGAactg
Hairpin ID: SH00130.N; FWD Oligo:
ctagcagtTACGACGAGGATACCATTCTAtagttatattcaagcataTAGAATGGTATCCTCGTCGTAgcg, RVS
Oligo: aattcgcTACGACGAGGATACCATTCTAtatgcttgaatataactaTAGAATGGTATCCTCGTCGTAactg
Hairpin ID: TR00906P.1; FWD Oligo: AGTCTAGAACCCTTAATGTGCAACAGCC, RVS Oligo:
AAGAATTCGGTTCGCCTACCAGGATGTA
Hairpin ID: TR02399P.1; FWD Oligo: AAGAATTCAGAAAACAAAGCGTGCCTGT, RVS Oligo:
AGTCTAGACAGGGAGTAGAGCTTCACGG
Hairpin ID: TR00818A.1; FWD Oligo: GTCTAGAAGCTGCAGGAACACACAACA, RVS Oligo:
AGAATTCTGGATGCTATCATCTTGCCA
Hairpin ID: TR00602A.1; FWD Oligo: GTCTAGAAACGCCTATCCGTTCACCTT, RVS Oligo:
AGAATTCCCATGGTGATCTCAGTGTGC
Hairpin ID: TR00603A.1; FWD Oligo: GTCTAGAGGATGTCAACCTGGCTTCAT, RVS Oligo:
AGAATTCCGAGAGACTGCTGCAACAAA
Hairpin ID: SH00037.O; FWD Oligo:
ctagcagtTAGATCTCCCTGTCCAGCGTAtagttatattcaagcataTACGCTGGACAGGGAGATCTAgcg, RVS
Oligo: aattcgcTAGATCTCCCTGTCCAGCGTAtatgcttgaatataactaTACGCTGGACAGGGAGATCTAactg
Hairpin ID: SH00038.O; FWD Oligo:
ctagcagtTTGATCACCAGACTGACCATGtagttatattcaagcataCATGGTCAGTCTGGTGATCAAgcg, RVS
Oligo: aattcgcTTGATCACCAGACTGACCATGtatgcttgaatataactaCATGGTCAGTCTGGTGATCAAactg
Hairpin ID: TR00877P.1; FWD Oligo: AGTCTAGAGCAAGAAGTTCCTGGTCGAG, RVS Oligo:
AAGAATTCTATGGAGCTCACCTCCTGCT
Hairpin ID: SH00685.N; FWD Oligo:
ctagcagtTTGCTCATGTCTAATGATTAAtagttatattcaagcataTTAATCATTAGACATGAGCAAgcg, RVS Oligo:
aattcgcTTGCTCATGTCTAATGATTAAtatgcttgaatataactaTTAATCATTAGACATGAGCAAactg
Hairpin ID: TR01521A.1; FWD Oligo: AGTCTAGAAGATACAACAAACCGCAGGC, RVS Oligo:
AAGAATTCGCCAGTTTCATTTCGCTGAT
Hairpin ID: TR00381P.1; FWD Oligo: GTCTAGAGTGCCACCTTCCTGAACATT, RVS Oligo:
AGAATTCTGCTCCACATTCAACTCTCG
Hairpin ID: SH01034.N; FWD Oligo:
ctagcagtATGAGCGAATACCAAGATATAtagttatattcaagcataTATATCTTGGTATTCGCTCATgcg, RVS Oligo:
aattcgcATGAGCGAATACCAAGATATAtatgcttgaatataactaTATATCTTGGTATTCGCTCATactg
Hairpin ID: SH01035.N; FWD Oligo:
ctagcagtCGAGATCGAGTTGACCATAAAtagttatattcaagcataTTTATGGTCAACTCGATCTCGgcg, RVS
Oligo: aattcgcCGAGATCGAGTTGACCATAAAtatgcttgaatataactaTTTATGGTCAACTCGATCTCGactg
Hairpin ID: TR02370P.1; FWD Oligo: AAGAATTCACTTCGACGAGAACACCACC, RVS Oligo:
AGTCTAGATCAAACGCTTGTTCATCTCG
Hairpin ID: SH00706.N; FWD Oligo:
ctagcagtATCGATAGTAGCTTAAGTAAAtagttatattcaagcataTTTACTTAAGCTACTATCGATgcg, RVS Oligo:
aattcgcATCGATAGTAGCTTAAGTAAAtatgcttgaatataactaTTTACTTAAGCTACTATCGATactg
Hairpin ID: SH00448.N; FWD Oligo:
ctagcagtTCGATAGATTTCGATAGTAAAtagttatattcaagcataTTTACTATCGAAATCTATCGAgcg, RVS Oligo:
aattcgcTCGATAGATTTCGATAGTAAAtatgcttgaatataactaTTTACTATCGAAATCTATCGAactg
Hairpin ID: TR00660A.1; FWD Oligo: GTCTAGATCAAGATCCTCTTGGATCGG, RVS Oligo:
AGAATTCGCAGTTTAATGGCCAGCTTC
Hairpin ID: TR00661A.1; FWD Oligo: GTCTAGAGGATTGAGACCTTCATCGGA, RVS Oligo:
AGAATTCCTCGAGATCGGCGTAGTACC
Hairpin ID: SH01690.N; FWD Oligo:
ctagcagtCTGGAAGACGACGAAGATGTAtagttatattcaagcataTACATCTTCGTCGTCTTCCAGgcg, RVS
Oligo: aattcgcCTGGAAGACGACGAAGATGTAtatgcttgaatataactaTACATCTTCGTCGTCTTCCAGactg
Hairpin ID: TR00169P.1; FWD Oligo: AAGAATTCCCCGCCATGGTTGATTATAC, RVS Oligo:
AGTCTAGACTTTGCCGATCGTATGGAAT
Hairpin ID: TR00168A.1; FWD Oligo: GTCTAGAGTGTGAATCACGTTTGGACG, RVS Oligo:
AGAATTCGTGTATGCAGGAGCAACCCT
Hairpin ID: TR02500P.1; FWD Oligo: AAGAATTCTTAATCTCCGATGAGGCGAC, RVS Oligo:
AGTCTAGAGTGTTTACTCTTCTCGGCGG
Hairpin ID: TR02184P.1; FWD Oligo: CACCGAATTCATCTATGTGGTGGACTCGGC, RVS Oligo:
TCTTTCGGTTCGTGGATTTT
Hairpin ID: SH01691.N; FWD Oligo:
ctagcagtCAAGACCAAGTCGGACATCTAtagttatattcaagcataTAGATGTCCGACTTGGTCTTGgcg, RVS
Oligo: aattcgcCAAGACCAAGTCGGACATCTAtatgcttgaatataactaTAGATGTCCGACTTGGTCTTGactg
Hairpin ID: TR00296A.1; FWD Oligo: GTCTAGATGATGTTTTCAAGGAGTGCG, RVS Oligo:
AGAATTCCCCGTTTGCAAGATTCATT
Hairpin ID: TR00296P.1; FWD Oligo: AAGAATTCTGATGTTTTCAAGGAGTGCG, RVS Oligo:
AGTCTAGACCCGTTTGCAAGATTCATTT
Hairpin ID: TR02458P.1; FWD Oligo: AAGAATTCGACGAGCAGTTCTCCCTGAC, RVS Oligo:
AGTCTAGAAGTTCGCTTCCCTGGAAAAT
Hairpin ID: TR00737A.1; FWD Oligo: GTCTAGAAAGACGCAGGTCAAGCAGAT, RVS Oligo:
AGAATTCAGAATCAGTACGGACGCTGG
Hairpin ID: SH01380.N2; FWD Oligo:
ctagcagtCACCAACGAGCTTCAGATTTAtagttatattcaagcataTAAATCTGAAGCTCGTTGGTGgcg, RVS
Oligo: aattcgcCACCAACGAGCTTCAGATTTAtatgcttgaatataactaTAAATCTGAAGCTCGTTGGTGactg
Hairpin ID: SH00735.N; FWD Oligo:
ctagcagtCCAGGTGTACATCCTGTCCAAtagttatattcaagcataTTGGACAGGATGTACACCTGGgcg, RVS
Oligo: aattcgcCCAGGTGTACATCCTGTCCAAtatgcttgaatataactaTTGGACAGGATGTACACCTGGactg
Hairpin ID: TR04502P.1; FWD Oligo: AAGAATTCTTCGAGTTGACCTTTCGCTT, RVS Oligo:
AGTCTAGATCATCTGGCGATCCATGTTA
Hairpin ID: TR02313P.1; FWD Oligo: CACCGAATTCGCAAGAACACCCCATCCTAC, RVS Oligo:
GCAATGTTCTCCTTCTTGCC
Hairpin ID: SH00429.N; FWD Oligo:
ctagcagtTAGCACGACCATAGCGACCAAtagttatattcaagcataTTGGTCGCTATGGTCGTGCTAgcg, RVS
Oligo: aattcgcTAGCACGACCATAGCGACCAAtatgcttgaatataactaTTGGTCGCTATGGTCGTGCTAactg
Hairpin ID: TR04602P.1; FWD Oligo: AAGAATTCAGCCACAGTTAGCGAGAAGG, RVS Oligo:
AGTCTAGAACGAAAGCACGGACGATAAC
Hairpin ID: SH01692.N; FWD Oligo:
ctagcagtCCCGGCGGTAGTCTTAATCAAtagttatattcaagcataTTGATTAAGACTACCGCCGGGgcg, RVS
Oligo: aattcgcCCCGGCGGTAGTCTTAATCAAtatgcttgaatataactaTTGATTAAGACTACCGCCGGGactg
Hairpin ID: TR01729P.1; FWD Oligo: CACCGAATTCCACGCCATGGAGGAGTTATT, RVS Oligo:
TACTCAATCGAAGCCCCAAC
Hairpin ID: TR02186P.1; FWD Oligo: CACCGAATTCCAAATCCCTGGAGGATGAGA, RVS Oligo:
CTGCGTCAGGTCACAAAAGA
Hairpin ID: TR00921P.1; FWD Oligo: AGTCTAGACCTGCAAGCAGTTCAGATCA, RVS Oligo:
AAGAATTCGCCACATGGTTTCTTCGACT
Hairpin ID: TR04076P.1; FWD Oligo: AAGAATTCCCTCGCCATGAAGATTTTGT, RVS Oligo:
AGTCTAGAGCTGACATCCAGCTTTGTGA
Hairpin ID: TR02654P.1; FWD Oligo: AAGAATTCCCAACAACACCATGACCATC, RVS Oligo:
AGTCTAGATTGGAGGTGCTGCAGTAGAG
Hairpin ID: TR00977P.1; FWD Oligo: AGTCTAGATGCAGAAGGTGGTCTACGTG, RVS Oligo:
AAGAATTCCTTGAGCGACTTCAGCTCCT
Hairpin ID: TR04599P.1; FWD Oligo: AAGAATTCCATCTGCGACGAGACCACTA, RVS Oligo:
AGTCTAGAGCATTCGATCCCACAAAAGT
Hairpin ID: TR04503P.1; FWD Oligo: AAGAATTCCCCTTCAGAAACGCATCAAT, RVS Oligo:
AGTCTAGAGAAAGAGTTTGGCAAGCAGG
Hairpin ID: SH01397.N2; FWD Oligo:
ctagcagtACGGTTGTGCTTAATATGTTAtagttatattcaagcataTAACATATTAAGCACAACCGTgcg, RVS Oligo:
aattcgcACGGTTGTGCTTAATATGTTAtatgcttgaatataactaTAACATATTAAGCACAACCGTactg
Hairpin ID: TR00492A.1; FWD Oligo: GTCTAGACGTGGGGTGACCAATATGAT, RVS Oligo:
AGAATTCTAGCTCGGGGATCAAAGAGA
Hairpin ID: SH00477.N; FWD Oligo:
ctagcagtCCGAGACGATCTACGACATAAtagttatattcaagcataTTATGTCGTAGATCGTCTCGGgcg, RVS
Oligo: aattcgcCCGAGACGATCTACGACATAAtatgcttgaatataactaTTATGTCGTAGATCGTCTCGGactg
Hairpin ID: SH00951.N; FWD Oligo:
ctagcagtCCCGGTCATGCTGCAGACGAAtagttatattcaagcataTTCGTCTGCAGCATGACCGGGgcg, RVS
Oligo: aattcgcCCCGGTCATGCTGCAGACGAAtatgcttgaatataactaTTCGTCTGCAGCATGACCGGGactg
Hairpin ID: TR02061P.1; FWD Oligo: ACAAGCTGAATCCAACCACC, RVS Oligo:
AAGTGAATTCTTGCAAACAGGAGTGCAGAC
Hairpin ID: TR02188P.1; FWD Oligo: AAGAATTCCAAAACATCAGCGCCTATCA, RVS Oligo:
AGACTAGTCGCCGAAAATGTTTCCTAAA
Hairpin ID: TR04641P.1; FWD Oligo: AAGAATTCAAAACGGTTCCACTAAAGCG, RVS Oligo:
AGTCTAGAGTCTGCGTCGGGGATTAGTA
Hairpin ID: TR00485A.1; FWD Oligo: GTCTAGATGGTGTATTCACGTCCTCCA, RVS Oligo:
AGAATTCAGTAGTAGCGCGAGACCAGC
Hairpin ID: SH00119.N; FWD Oligo:
ctagcagtCGCGACAGTGACGATTATCAAtagttatattcaagcataTTGATAATCGTCACTGTCGCGgcg, RVS
Oligo: aattcgcCGCGACAGTGACGATTATCAAtatgcttgaatataactaTTGATAATCGTCACTGTCGCGactg
Hairpin ID: SH01275.N2; FWD Oligo:
ctagcagtTCGCACCTGTTCGATGTTTAAtagttatattcaagcataTTAAACATCGAACAGGTGCGAgcg, RVS
Oligo: aattcgcTCGCACCTGTTCGATGTTTAAtatgcttgaatataactaTTAAACATCGAACAGGTGCGAactg
Hairpin ID: SH00469.N; FWD Oligo:
ctagcagtTTGAAGTTTATCAACGAGAAAtagttatattcaagcataTTTCTCGTTGATAAACTTCAAgcg, RVS Oligo:
aattcgcTTGAAGTTTATCAACGAGAAAtatgcttgaatataactaTTTCTCGTTGATAAACTTCAAactg
Hairpin ID: TR00696A.1; FWD Oligo: GTCTAGACGTAAGCCAGCCTTCTTCAC, RVS Oligo:
AGAATTCCTCCAACTTGCCTTCTTTGC
Hairpin ID: TR00695A.1; FWD Oligo: GTCTAGAATCTGTTTGAGGTGTTCGGG, RVS Oligo:
AGAATTCGGTCGTGGCAATCTCGTTAT
Hairpin ID: SH01159.N2; FWD Oligo:
ctagcagtAAGCTGCAGAATAGCAATAAAtagttatattcaagcataTTTATTGCTATTCTGCAGCTTgcg, RVS Oligo:
aattcgcAAGCTGCAGAATAGCAATAAAtatgcttgaatataactaTTTATTGCTATTCTGCAGCTTactg
Hairpin ID: SH00732.N; FWD Oligo:
ctagcagtATGATTGATCACCAACAGTTAtagttatattcaagcataTAACTGTTGGTGATCAATCATgcg, RVS Oligo:
aattcgcATGATTGATCACCAACAGTTAtatgcttgaatataactaTAACTGTTGGTGATCAATCATactg
Hairpin ID: TR02189P.1; FWD Oligo: CACCGAATTCGCAGCAGAACGCAAAGTACA, RVS Oligo:
AAAGCACAGAATAATGGGCG
Hairpin ID: TR02190P.1; FWD Oligo: CACCGAATTCCGAACGGCTAGAGGAGTCAC, RVS Oligo:
CACTGTACGGTTGCATTTGG
Hairpin ID: TR00574A.1; FWD Oligo: GTCTAGATCACCCAAATATCGGTCCAT, RVS Oligo:
AGAATTCGTCCACTTCGATGGGAAAGA
Hairpin ID: SH00320.N; FWD Oligo:
ctagcagtCTGACACTATATAGACAACTAtagttatattcaagcataTAGTTGTCTATATAGTGTCAGgcg, RVS Oligo:
aattcgcCTGACACTATATAGACAACTAtatgcttgaatataactaTAGTTGTCTATATAGTGTCAGactg
Hairpin ID: TR00756A.1; FWD Oligo: GTCTAGAGGATAATCGTTTGCCTGGAA, RVS Oligo:
AGAATTCTCGCTGAGCGTTTTTACCTT
Hairpin ID: SH00374.N; FWD Oligo:
ctagcagtAAGGTGCTCTACATCAGCTTAtagttatattcaagcataTAAGCTGATGTAGAGCACCTTgcg, RVS
Oligo: aattcgcAAGGTGCTCTACATCAGCTTAtatgcttgaatataactaTAAGCTGATGTAGAGCACCTTactg
Hairpin ID: TR00463P.1; FWD Oligo: GTCTAGAAGAAGGGCTACGAGGGTCAT, RVS Oligo:
AGAATTCTGACTATCCACCTATCCGCC
Hairpin ID: TR04528P.1; FWD Oligo: AAGAATTCGGATCAACGCTCTTCAAAGG, RVS Oligo:
AGTCTAGATTTTCTAGGCTGGGAAAGCA
Hairpin ID: TR01513A.1; FWD Oligo: AGTCTAGATGCCAGGATTTTTCTCCATC, RVS Oligo:
AAGAATTCTTCCATGGTACCGACCATTT
Hairpin ID: TR04642P.1; FWD Oligo: AAGAATTCGCTCTTCCTTTCTGCCATTG, RVS Oligo:
AGTCTAGATCGTATCTCCGATGTAGCCC
Hairpin ID: SH00361.N; FWD Oligo:
ctagcagtTCCGTGTTGATTGGTGTTCAAtagttatattcaagcataTTGAACACCAATCAACACGGAgcg, RVS
Oligo: aattcgcTCCGTGTTGATTGGTGTTCAAtatgcttgaatataactaTTGAACACCAATCAACACGGAactg
Hairpin ID: TR02191P.1; FWD Oligo: CACCGAATTCACCTCAGCCAGTACCACCAC, RVS Oligo:
TGTTCGTCCACCTGTTGTGT
Hairpin ID: TR02842P.1; FWD Oligo: AAGAATTCCGAAATTGTGACACCCACTG, RVS Oligo:
AGTCTAGAGAGTTTTTGGCGGCATACAT
Hairpin ID: SH00115.N; FWD Oligo:
ctagcagtAAGATGGTTATTGCAACAAGAtagttatattcaagcataTCTTGTTGCAATAACCATCTTgcg, RVS Oligo:
aattcgcAAGATGGTTATTGCAACAAGAtatgcttgaatataactaTCTTGTTGCAATAACCATCTTactg
Hairpin ID: TR02192P.1; FWD Oligo: CACCGAATTCCGTGCCCGAGAGTATGAAAT, RVS Oligo:
ACTGGCTCGCTTCTGAGTGT
Hairpin ID: SH00354.N; FWD Oligo:
ctagcagtCAGGGACTATCAGCACCACAAtagttatattcaagcataTTGTGGTGCTGATAGTCCCTGgcg, RVS
Oligo: aattcgcCAGGGACTATCAGCACCACAAtatgcttgaatataactaTTGTGGTGCTGATAGTCCCTGactg
Hairpin ID: SH01274.N2; FWD Oligo:
ctagcagtTTGAGACGTCCTACACCGAAAtagttatattcaagcataTTTCGGTGTAGGACGTCTCAAgcg, RVS
Oligo: aattcgcTTGAGACGTCCTACACCGAAAtatgcttgaatataactaTTTCGGTGTAGGACGTCTCAAactg
Hairpin ID: TR00908P.1; FWD Oligo: AGTCTAGACTCTATCCTCACACGGGCAT, RVS Oligo:
AAGAATTCAAATTCCTGGCCACATTGAG
Hairpin ID: SH00581.N; FWD Oligo:
ctagcagtCACGAGCAGCTGTGCGACCAAtagttatattcaagcataTTGGTCGCACAGCTGCTCGTGgcg, RVS
Oligo: aattcgcCACGAGCAGCTGTGCGACCAAtatgcttgaatataactaTTGGTCGCACAGCTGCTCGTGactg
Hairpin ID: TR00211A.1; FWD Oligo: GTCTAGACATGACCATCATACGCTTCG, RVS Oligo:
AGAATTCCGCATGCAGTAGCATAAGGA
Hairpin ID: SH01693.N; FWD Oligo:
ctagcagtCACGAATGTGGTGGTCCTCAAtagttatattcaagcataTTGAGGACCACCACATTCGTGgcg, RVS
Oligo: aattcgcCACGAATGTGGTGGTCCTCAAtatgcttgaatataactaTTGAGGACCACCACATTCGTGactg
Hairpin ID: SH00352.N; FWD Oligo:
ctagcagtTAGACTTGTAATCCTAAGTAAtagttatattcaagcataTTACTTAGGATTACAAGTCTAgcg, RVS Oligo:
aattcgcTAGACTTGTAATCCTAAGTAAtatgcttgaatataactaTTACTTAGGATTACAAGTCTAactg
Hairpin ID: TR02193P.1; FWD Oligo: CACCGAATTCTATTCGACATTCCAATCGCA, RVS Oligo:
CTGGTTGACCACCTCCAAGT
Hairpin ID: TR01098P.1; FWD Oligo: AGTCTAGAGCAGACAGAGGCAGTCATCA, RVS Oligo:
AACAATTGCACTGGTTGGTGTGGATTTG
Hairpin ID: SH00262.N; FWD Oligo:
ctagcagtACGATCCAGCGTACAAAGAAAtagttatattcaagcataTTTCTTTGTACGCTGGATCGTgcg, RVS
Oligo: aattcgcACGATCCAGCGTACAAAGAAAtatgcttgaatataactaTTTCTTTGTACGCTGGATCGTactg
Hairpin ID: TR00970P.1; FWD Oligo: AAGAATTCCCATTAAGTCCGCACACAGA, RVS Oligo:
AGTCTAGACAATTGCACCATTTTAATCGAA
Hairpin ID: TR01168P.1; FWD Oligo: AGTCTAGACCAGGAACTGCTGGCTTATC, RVS Oligo:
AAGAATTCCTTTGTTCTTGCACAGCGAA
Hairpin ID: SH00263.N; FWD Oligo:
ctagcagtTAGAAACTCAATAAACTTCAAtagttatattcaagcataTTGAAGTTTATTGAGTTTCTAgcg, RVS Oligo:
aattcgcTAGAAACTCAATAAACTTCAAtatgcttgaatataactaTTGAAGTTTATTGAGTTTCTAactg
Hairpin ID: TR00550A.1; FWD Oligo: GTCTAGAATTGCACGGCAACATTTACA, RVS Oligo:
AGAATTCTTGCTTGTGGGTATTGTCCA
Hairpin ID: SH00809.Nb; FWD Oligo:
ctagcagtCAAGTCTTCAATGGATAGCAAtagttatattcaagcataTTGCTATCCATTGAAGACTTGgcg, RVS
Oligo: aattcgcCAAGTCTTCAATGGATAGCAAtatgcttgaatataactaTTGCTATCCATTGAAGACTTGactg
Hairpin ID: TR04530P.1; FWD Oligo: AAGAATTCATCAACGAACAATTGTGGCA, RVS Oligo:
AGTCTAGAGCTTTCAAAACAGAGGGCTG
Hairpin ID: TR01264P.1; FWD Oligo: AGTCTAGAATGGAGCGGCATATTCGTAG, RVS Oligo:
AAGAATTCGCGGTCAACAAGCTAAGACC
Hairpin ID: TR02430P.1; FWD Oligo: AAGAATTCCATCTACTGCTCCTGCACCA, RVS Oligo:
AGTCTAGATTACTGCCCCCAAGAGAGTG
Hairpin ID: TR01237P.1; FWD Oligo: AAGAATTCCCGGGAATAATGGACAAGTG, RVS Oligo:
AGTCTAGATCCAGAGTATGTCGGGTTCC
Hairpin ID: TR02684P.1; FWD Oligo: AAGAATTCGGCACATCCTCAAACGAAAT, RVS Oligo:
AGTCTAGAATAGTCCTTGGCGTGACCAT
Hairpin ID: TR01102P.1; FWD Oligo: AGTCTAGAGCTACAGGACAAGGGATTGG, RVS Oligo:
AAGAATTCGCTTAGCTAACCACCCGAAA
Hairpin ID: TR00733A.1; FWD Oligo: GTCTAGACAATGATTCGCTTCCTGACA, RVS Oligo:
AGAATTCTCCTTAAGACCGCCTACGAA
Hairpin ID: TR00734A.1; FWD Oligo: GTCTAGAAACCAGTGGGGTTGTCCTC, RVS Oligo:
AGAATTCCTAGCGGCGATATTTGCTGT
Hairpin ID: TR02493P.1; FWD Oligo: AAGAATTCTGATAATGCTGCGCTTTACG, RVS Oligo:
AGTCTAGATGTCATCACTGTTTCTCGGC
Hairpin ID: SH01381.N2; FWD Oligo:
ctagcagtTACGTGCGAAATGCACAGTAAtagttatattcaagcataTTACTGTGCATTTCGCACGTAgcg, RVS
Oligo: aattcgcTACGTGCGAAATGCACAGTAAtatgcttgaatataactaTTACTGTGCATTTCGCACGTAactg
Hairpin ID: SH01765.N; FWD Oligo:
ctagcagtCACCCAGACACTGCAGTTCAAtagttatattcaagcataTTGAACTGCAGTGTCTGGGTGgcg, RVS
Oligo: aattcgcCACCCAGACACTGCAGTTCAAtatgcttgaatataactaTTGAACTGCAGTGTCTGGGTGactg
Hairpin ID: TR01712P.1; FWD Oligo: CACCGAATTCATGCCGCCACTGACCTATTA, RVS Oligo:
CGAATTCAGCTGGCCATTAT
Hairpin ID: TR00300A.1; FWD Oligo: GTCTAGAGAACTGGACGAGGATGTGGT, RVS Oligo:
AGAATTCAGATCGATGGCCTTGTTCAG
Hairpin ID: TR00300P.1; FWD Oligo: AAGAATTCGAACTGGACGAGGATGTGGT, RVS Oligo:
AGTCTAGAAGATCGATGGCCTTGTTCAG
Hairpin ID: TR02194P.1; FWD Oligo: CACCGAATTCGGACCAGGTCTGCAATTTGT, RVS Oligo:
CAGCTTCCGTTGTTCTGACA
Hairpin ID: SH01006.N; FWD Oligo:
ctagcagtCAGGAGAAGGACATTGTTCAAtagttatattcaagcataTTGAACAATGTCCTTCTCCTGgcg, RVS
Oligo: aattcgcCAGGAGAAGGACATTGTTCAAtatgcttgaatataactaTTGAACAATGTCCTTCTCCTGactg
Hairpin ID: SH01007.N; FWD Oligo:
ctagcagtAAGGACATTGTTCAATCTGAAtagttatattcaagcataTTCAGATTGAACAATGTCCTTgcg, RVS Oligo:
aattcgcAAGGACATTGTTCAATCTGAAtatgcttgaatataactaTTCAGATTGAACAATGTCCTTactg
Hairpin ID: SH00057.N; FWD Oligo:
ctagcagtTCGGTTCAGTTCCATCTCTAAtagttatattcaagcataTTAGAGATGGAACTGAACCGAgcg, RVS
Oligo: aattcgcTCGGTTCAGTTCCATCTCTAAtatgcttgaatataactaTTAGAGATGGAACTGAACCGAactg
Hairpin ID: TR00644A.1; FWD Oligo: GTCTAGAGAGTCGCTCACCAGAAAAGG, RVS Oligo:
AGAATTCCAGTGAAAGTCTGTGCCTGC
Hairpin ID: TR00645A.1; FWD Oligo: GTCTAGATGAAGGGCGATCCAATTAAC, RVS Oligo:
AGAATTCCGGCTTCTTCGTGTTAGACC
Hairpin ID: SH00131.N; FWD Oligo:
ctagcagtCACGACGAGGATCATGAGGAAtagttatattcaagcataTTCCTCATGATCCTCGTCGTGgcg, RVS
Oligo: aattcgcCACGACGAGGATCATGAGGAAtatgcttgaatataactaTTCCTCATGATCCTCGTCGTGactg
Hairpin ID: TR02737P.1hm; FWD Oligo: AAGAATTCGAGCCTGATGAACTTGCACA, RVS Oligo:
AGTCTAGATGCTCCTCGAGTACCTTCGT
Hairpin ID: TR02737P.1; FWD Oligo: AAGAATTCGAGCCTGATGAACTTGCACA, RVS Oligo:
AGTCTAGATGCTCCTCGAGTACCTTCGT
Hairpin ID: SH01825.N; FWD Oligo:
ctagcagtTACGAAGAACATTATAGTTAAtagttatattcaagcataTTAACTATAATGTTCTTCGTAgcg, RVS Oligo:
aattcgcTACGAAGAACATTATAGTTAAtatgcttgaatataactaTTAACTATAATGTTCTTCGTAactg
Hairpin ID: TR00827A.1; FWD Oligo: GTCTAGAACGCTTACCAGTCGTTCACC, RVS Oligo:
AGAATTCTCGTTGTTGTGCTTCTCCAG
Hairpin ID: SH00920.N; FWD Oligo:
ctagcagtTTGCTTGGATTTGTAGCACAAtagttatattcaagcataTTGTGCTACAAATCCAAGCAAgcg, RVS
Oligo: aattcgcTTGCTTGGATTTGTAGCACAAtatgcttgaatataactaTTGTGCTACAAATCCAAGCAAactg
Hairpin ID: SH00921.N; FWD Oligo:
ctagcagtCAAGGTCATCACTCAGTTTAAtagttatattcaagcataTTAAACTGAGTGATGACCTTGgcg, RVS
Oligo: aattcgcCAAGGTCATCACTCAGTTTAAtatgcttgaatataactaTTAAACTGAGTGATGACCTTGactg
Hairpin ID: TR02828P.1; FWD Oligo: AAGAATTCGTCCAGATAAACATCCGCGT, RVS Oligo:
AGTCTAGACTATTCCCCGCCTCCTAGTC
Hairpin ID: TR01713P.1; FWD Oligo: CACCGAATTCAGCATGTCCTTCGCTCAGTT, RVS Oligo:
TGTTGTGCTTTTTGGGTGAA
Hairpin ID: TR02195P.1; FWD Oligo: CACCGAATTCTGATCGACATCCAGGATCAA, RVS Oligo:
TTCCATTTGCCAGATTCTCC
Hairpin ID: TR04531P.1; FWD Oligo: AAGAATTCGCAAAAACTCCACGGAACAT, RVS Oligo:
AGTCTAGATACACATAAGGGGCGACACA
Hairpin ID: TR01714P.1; FWD Oligo: CACCGAATTCGAAGAGCATGAACGTCGCTT, RVS Oligo:
AATACTGGATGATCGAGGCG
Hairpin ID: SH01766.N; FWD Oligo:
ctagcagtTTCATACATGTTTCAGATAAAtagttatattcaagcataTTTATCTGAAACATGTATGAAgcg, RVS Oligo:
aattcgcTTCATACATGTTTCAGATAAAtatgcttgaatataactaTTTATCTGAAACATGTATGAAactg
Hairpin ID: SH00852.N; FWD Oligo:
ctagcagtTTGATTGTTGTTCCAAGCGAAtagttatattcaagcataTTCGCTTGGAACAACAATCAAgcg, RVS
Oligo: aattcgcTTGATTGTTGTTCCAAGCGAAtatgcttgaatataactaTTCGCTTGGAACAACAATCAAactg
Hairpin ID: SH00336.N; FWD Oligo:
ctagcagtCAAGATCAGTGCCCAAATCAAtagttatattcaagcataTTGATTTGGGCACTGATCTTGgcg, RVS
Oligo: aattcgcCAAGATCAGTGCCCAAATCAAtatgcttgaatataactaTTGATTTGGGCACTGATCTTGactg
Hairpin ID: TR00502A.1; FWD Oligo: GTCTAGACGATCTGATCAAGGAGAGCC, RVS Oligo:
AGAATTCGCGTACTGCAGCTCATTCTG
Hairpin ID: SH00585.N; FWD Oligo:
ctagcagtCTCCCGACAGGCGACCATCAAtagttatattcaagcataTTGATGGTCGCCTGTCGGGAGgcg, RVS
Oligo: aattcgcCTCCCGACAGGCGACCATCAAtatgcttgaatataactaTTGATGGTCGCCTGTCGGGAGactg
Hairpin ID: SH00979.N; FWD Oligo:
ctagcagtCGGCAAATCCACGGTGGTCAAtagttatattcaagcataTTGACCACCGTGGATTTGCCGgcg, RVS
Oligo: aattcgcCGGCAAATCCACGGTGGTCAAtatgcttgaatataactaTTGACCACCGTGGATTTGCCGactg
Hairpin ID: TR01560A.1; FWD Oligo: AGTCTAGAGTGTCCCGACAAAACGAACT, RVS Oligo:
AAGAATTCATGCTGGACATTTTCTTGGC
Hairpin ID: TR02196P.1; FWD Oligo: CACCGAATTCAAGAGCAAGTGCTCACGGTT, RVS Oligo:
ACTTTCGGGGTGGAGAAGTT
Hairpin ID: SH00322.N; FWD Oligo:
ctagcagtCTGCAGCGATATCAACTACAAtagttatattcaagcataTTGTAGTTGATATCGCTGCAGgcg, RVS
Oligo: aattcgcCTGCAGCGATATCAACTACAAtatgcttgaatataactaTTGTAGTTGATATCGCTGCAGactg
Hairpin ID: TR00910P.1; FWD Oligo: AGTCTAGACAACATGACCAACGTTCTGG, RVS Oligo:
AAGAATTCTCTTAACGCCATTGATGCAG
Hairpin ID: TR02456P.1; FWD Oligo: AAGAATTCGAAGGTCAAGACGAAGACGG, RVS Oligo:
AGTCTAGAACGTGGAACAACACAACGAA
Hairpin ID: TR01715P.1; FWD Oligo: CACCGAATTCGTGTTCCGTGCTCAGTTCCT, RVS Oligo:
TCTGCGGATTTTCATTTTCC
Hairpin ID: SH01694.N; FWD Oligo:
ctagcagtCAGACCAGAACTAGAAACAAAtagttatattcaagcataTTTGTTTCTAGTTCTGGTCTGgcg, RVS
Oligo: aattcgcCAGACCAGAACTAGAAACAAAtatgcttgaatataactaTTTGTTTCTAGTTCTGGTCTGactg
Hairpin ID: TR02549P.1; FWD Oligo: AAGAATTCGCAAGCGCTACCAAAGAAAG, RVS Oligo:
AGTCTAGAGGATCCCGCTAATACGTCAA
Hairpin ID: TR00500A.1; FWD Oligo: GTCTAGATACCCTATATGGGCGACGAG, RVS Oligo:
AGAATTCGGCAGCTTGTCCTTGACTTC
Hairpin ID: TR01202P.1; FWD Oligo: AGTCTAGAGCTCCTGCATTCAGACACAA, RVS Oligo:
AAGAATTCTGACCATCATAACCTTGGCA
Hairpin ID: SH00338.N; FWD Oligo:
ctagcagtCAGAGACGTTGGCGAAATCAAtagttatattcaagcataTTGATTTCGCCAACGTCTCTGgcg, RVS
Oligo: aattcgcCAGAGACGTTGGCGAAATCAAtatgcttgaatataactaTTGATTTCGCCAACGTCTCTGactg
Hairpin ID: TR00657A.1; FWD Oligo: GTCTAGACTTCGGTCACTGTTGGCTTT, RVS Oligo:
AGAATTCGCCTGAATGCTATCCGAATC
Hairpin ID: TR00656A.1; FWD Oligo: GTCTAGAAGTGAGAGACACCGGTCCAT, RVS Oligo:
AGAATTCCGTACCTCCTCATCGGTTGT
Hairpin ID: TR01942P.1; FWD Oligo: CACCGAATTCGCCACATGCAGTGTTAAACG, RVS Oligo:
CTGACCACCTCGGTTCTGTT
Hairpin ID: TR01114P.1; FWD Oligo: AGTCTAGATATTGACTTGCCACAGGCAC, RVS Oligo:
AAGAATTCGGTTCGAGTTGGGACTCATC
Hairpin ID: SH00626.N; FWD Oligo:
ctagcagtAAGGATCTAAAGAACAAGTTAtagttatattcaagcataTAACTTGTTCTTTAGATCCTTgcg, RVS Oligo:
aattcgcAAGGATCTAAAGAACAAGTTAtatgcttgaatataactaTAACTTGTTCTTTAGATCCTTactg
Hairpin ID: TR02403P.1; FWD Oligo: AAGAATTCAGGACTACTTCCATCCGCTG, RVS Oligo:
AGTCTAGAAACTGGCGATGGTAGTCCAG
Hairpin ID: TR00210A.1; FWD Oligo: GTCTAGATACCATCCCGTGCTCTTTTC, RVS Oligo:
AGAATTCGGCTATCTTGAACCGCTCAG
Hairpin ID: TR00262A.1; FWD Oligo: GTCTAGATCTTTCCGTAATCGGTGTCC, RVS Oligo:
AGAATTCGGTGGATTGGTCATGCCTAC
Hairpin ID: TR00766A.1; FWD Oligo: GTCTAGACAGATAGGGGCACGCTGTAT, RVS Oligo:
AGAATTCGAAGTCCAGGTCACGGTTGT
Hairpin ID: TR00281A.1; FWD Oligo: GTCTAGACATCTGTACAGGCGCAAGAA, RVS Oligo:
AGAATTCGTGGTGTTCCGCCAGATAGT
Hairpin ID: SH00306.N; FWD Oligo:
ctagcagtCAGGACGATAGCTACTCTAAAtagttatattcaagcataTTTAGAGTAGCTATCGTCCTGgcg, RVS
Oligo: aattcgcCAGGACGATAGCTACTCTAAAtatgcttgaatataactaTTTAGAGTAGCTATCGTCCTGactg
Hairpin ID: TR02199P.1; FWD Oligo: CACCGAATTCCGCTGTTGCGTAAACTGAGA, RVS Oligo:
GTACAGGCCTTGATCTCCCA
Hairpin ID: TR02200P.1; FWD Oligo: CACCGAATTCCTCGGGCACCTTCTACTTTG, RVS Oligo:
TGATAGCTTCACCTTGTGCG
Hairpin ID: SH00592.N; FWD Oligo:
ctagcagtCAAGATCACGTTTCAAGCAAAtagttatattcaagcataTTTGCTTGAAACGTGATCTTGgcg, RVS
Oligo: aattcgcCAAGATCACGTTTCAAGCAAAtatgcttgaatataactaTTTGCTTGAAACGTGATCTTGactg
Hairpin ID: TR02201P.1; FWD Oligo: CACCGAATTCGCCGCAATTGAGTCTTTAGC, RVS Oligo:
GTCTGGTGGAACGAGTTGGT
Hairpin ID: SH01695.N; FWD Oligo:
ctagcagtCAGGACTAGCAGAGAATACAAtagttatattcaagcataTTGTATTCTCTGCTAGTCCTGgcg, RVS
Oligo: aattcgcCAGGACTAGCAGAGAATACAAtatgcttgaatataactaTTGTATTCTCTGCTAGTCCTGactg
Hairpin ID: TR02908P.1; FWD Oligo: AAGAATTCAACTGGATGGCCACTTGAAC, RVS Oligo:
AGTCTAGAGCTGCTCCAGTTCATCCTTC
Hairpin ID: TR00263A.1; FWD Oligo: GTCTAGAACACCAGCAAGGGATACAGG, RVS Oligo:
AGAATTCTGACTTAAGGAGTGTGGGGG
Hairpin ID: TR04504P.1; FWD Oligo: AAGAATTCAAAAGTTTTTAGCGCAATTCCA, RVS Oligo:
AGTCTAGAAATGGAACCTTGCTACTCCG
Hairpin ID: TR01546A.1; FWD Oligo: AGTCTAGAGTCGAGGACCACGAAAATGT, RVS Oligo:
AAGAATTCGTC