In order to amplify and sequence the � 1 by bnWs0X

VIEWS: 4 PAGES: 3

									                               ‫ل‬            ‫او‬
                       ‫مقاالت ّلين همايش م ّي حبوبات‬
      ‫29 و30 آبان 1304- مشهد مقدس- پژوهشكدة علوم گياهي دانشگاه فردوسي مشهد‬
‫516‬

    ‫جداسازی، کلون کردن و تعيين توالي ژن‪β-1,3 glucanase‬‬
‫قارچ‪ Trichoderma virens‬در راستای ايجاد مقاومت در گياه نخود‬
      ‫عليه قارچهای ‪ Fusarium oxysporum‬و ‪Ascochyta rabiei‬‬
  ‫2‬
      ‫مصطفی مطلبي1 و علی بيدمشکی پور‬             ‫محمدرضا زماني1،‬        ‫رضا محمدزاده1و2،‬
                  ‫1پژوهشگاه ملي مهندسي ژنتيك و زيست فناوری، تهران‬
                                                                                  ‫2‬
              ‫گروه زيست شناسی، دانشکده علوم، دانشگاه رازی، کرمانشاه‬
                                                                                         ‫چكيده‬
       ‫قارچ ‪ Trichoderma virens‬بدليل توليد آنزيمهاي گلوکانازی بعنوان يک عامل‬
       ‫در كنترل بيولوژيك بيماريهاي قارچي گياهی مورد استفاده قرار مي گيرد.‬
        ‫لذا جهت تكثير و مطالعه ژن ‪ ،β-1,3 glucanase‬استتررا ‪ DNA‬ژنتومي از ايت‬
       ‫قارچ صورت گرفت. سپس تکثير ژن ‪( β-1,3 glucanase‬بطول حتدود ‪ )9033 bp‬بتا‬
       ‫استفاده از پرايمرهای 1‪ Fbgn‬و 1.1‪ Rbgn‬صتورت گرفتت. محصتول‪Pfu- polymerase‬‬
       ‫تکثير شده پس از هضم آنزيمی، در سايت ‪ XbaI‬وکتتور 81‪ pUC‬کلتون گرديتد.‬
       ‫پالسميدهای نوترکيب از باکتری های ‪ E.coli DH5‬ترانسفورم شده استتررا و‬
       ‫در دو جهت تعيي توالی گرديدند. مقايسه حدود ‪ 4033bp‬از اي توالی با‬
       ‫توالی ثبت شده اي ژن در بانک ژنی نشان داد که قطعه کلون شده، مربوط‬
       ‫به ژن سنتز کننده آنزيم ‪ β-1,3 glucanase‬می باشد. ژن کلون شتده از 81‪،pUC‬‬
       ‫جايگزي ژن ‪ GusA‬در وکتور بيانی گياهی 121‪ pBI‬گرديد. ايت ‪ construct‬متی‬
       ‫توا ند ج هت انت قال ژن مذکور به ن رود ج هت اي جاد مقاو مت عل يه قارچ های‬
       ‫بيماريزا (‪ Fusarium oxysporum‬و ‪ )Ascochyta rabiei‬که در ديواره خود گلوکتان‬
                                                    ‫دارند مورد استفاده قرار گيرد.‬
       ‫واژه هاي كليدي: ‪ ،β-1,3 glucanase ،Trichoderma virens‬نرتود، ‪،Fusarium oxysporum‬‬
                                                                           ‫‪Ascochyta rabiei‬‬

                                                                ‫مقدمه‬
‫ه مواره آ سيبهای قارچی به ا نواع مح صوالت ک شاورزی از جم له ن رود،‬
‫خسارات فراوانی وارد کرده است. بدي منظور استراتژی های متفاوتی‬
‫ج هت م بارزه با قارچ های بي ماريزا ات راذ گرد يده ا ست. ا ستفاده از‬
‫قارچهای ‪ Trichoderma‬بعنوان يک ‪ mycoparasite‬قوی متی توانتد بعنتوان يتک‬
‫ا ستراتژی م هم مح سوب گردد. آنزيم های ه يدروالزی مت فاوتی نظ ير‬
‫کيتي نازی، گلوکاناز ها و پروتئاز ها تو سط ا ي قارچ تول يد می شوند.‬
‫آنزيم های گلوکا نازی در تجز يه پ لی ساکاريد ساختمانی گلو کان ن قش‬
‫دار ند. گلو کان ب رش قا بل توجهی از ترک يب د يواره سلولی قارچ ها را‬
‫به خود اخت صاص داده ا ست. ا ي پ لی ساکاريد پلي مری از وا حدهای‬
‫گلوکز است که با پيوندهای گليکوزيدی بتا 4 و 0 در زنجيتره اصتلی و‬
‫بتا 4 و 0 در انشتعابات بهتم متصتل شتده انتد. آنتزيم بتتا 4 و 0‬
‫گلوکا ناز با تجز يه پيو ند بي گلوکز های زنج يره ا صلی گلو کان، من جر‬
                                 ‫به آزاد شدن اي منو ساکاريد می شود.‬
‫قارچ ‪ F. oxysporum‬بعنوان يکی از عوامل بيماريزا در نرود محسوب شده و‬
‫بي ماری بو ته زردی را اي جاد می نما يد. همچ ني بي ماری برق زد گی‬
‫توسط قارچ ‪ A. rabiei‬بعنوان يکی از علل کتاهش شتديد محصتول نرتود متی‬
‫باشد. بديهی است که انتقال ژن کد کننده گلوکانازی قارچ ‪Trichoderma‬‬
‫می توا ند مو جب اي جاد ن رود م قاوم به قارچ های پاتوژن فوق گردد. در‬
  ‫اي تحقيق تكثير، کلون و تعيتي تتوالي ژن ‪ β-1,3 glucanase‬از جدايته‬
                                                ‫‪ T.virens‬گزارش مي گردد.‬
                                                           ‫مواد و روشها‬
‫بمنظور استررا ‪ DNA‬از قارچ ‪ ،Trichoderma virens‬قارچ مورد نظر در محيط‬
‫كشت ‪( MY‬حاوي ‪KH2PO4 ,Maltose ,Yeast extract‬و ‪ )NaCl‬كشت داده شتد، پتس از‬
‫جدا سازي ميسليوم ها از محيط كشت، استتررا ‪ DNA‬از آنهتا بته روش‬
‫‪ CTAB‬صورت گرفت, كيفيت و كميت ‪ DNA‬با استفاده از استپكتروفوتومتر‬
‫تعيي گرديد. پرايمرهاي اختصاصي با توجه بته تتوالي ژن ‪β-1,3 glucanase‬‬
‫ثبت شده در ‪ Genebank‬انتراب و سنتز شدند (دو پرايمر اختصاصتي 1‪Fbgn‬‬
                      ‫و 1.1‪ Rbgn‬حاوي جايگاه برش آنزيمی ‪ XbaI‬مي باشند):‬
                             ‫1‪Fbgn‬‬          ‫´3 ‪5´ GCTCTAGAATGTTGAAGTCACTGGCCTTTG‬‬
                         ‫1.1‪Rbgn‬‬         ‫´3 ‪5´ CGTCTAGACTAGGTTGTGTAGCGGCCAACATC‬‬

            ‫ت‬         ‫ت‬                  ‫ت‬     ‫ت‬        ‫ت‬      ‫ت‬
‫محل تول واك تنش ‪ PCR‬ب تا اس تتفاده از ‪ DNA‬ژن تومي, و آن تزيم ‪Pfu DNA‬‬
‫‪ ,polymerase‬در شرايط دما و تعداد سيکلهای ‪ PCR‬طبق برنامه ذيل انجتام‬
‫گرديد: تعداد 30 سيکل با ‪ denaturation‬در دمای 12 درجه سانتيگراد بمدت‬
‫30 ثانيته، ‪ annealing‬در دمتای 53 درجته ستانتيگراد بمتدت 30 ثانيته و‬
    ‫ت‬                          ‫ت‬
                                   ‫ل‬            ‫او‬
                           ‫مقاالت ّلين همايش م ّي حبوبات‬
          ‫29 و30 آبان 1304- مشهد مقدس- پژوهشكدة علوم گياهي دانشگاه فردوسي مشهد‬
    ‫616‬

    ‫‪ extention‬در دمای 95 درجه سانتيگراد بمدت 394 ثانيه. قطعه مورد نظتر‬
    ‫پس از خالص ستازي از ژل بته كمتك ‪( high pure PCR product purification kit‬شتركت‬
    ‫‪ )ROCHE‬در پالسميد 81‪ pUC‬كلون گرديد و سپس قطعه مورد نظر جايگزي ژن‬
    ‫‪ GusA‬در وکتور بيتانی 121‪ pBI‬گرديتد. كليته مراحتل كلونينتط مطتابق‬
    ‫روشهای استاندارد انجام گرديد. جهت تعيي توالي قطعات‪ PCR‬بته روش‬
         ‫‪ ،automated sequencing‬نمونه ها به شركت‪ SEQLAB‬آلمان فرستاده شدند.‬
                                                                    ‫نتايج و بحث‬
    ‫از آنجا که در مطالعتات قبلتی نشتان داده شتد کته قتارچ ‪ T.virens‬از‬
    ‫پتان سيل منا سب ميکو پارازيتی بر خودار می با شد، در ا ي تحق يق ج هت‬
    ‫جداسازی و کلون کردن ژن ‪ β-1,3 glucanase‬از اي قتارچ استتفاده گرديتد.‬
    ‫بدي منظور قارچ مذکور در محيط کشت ‪ MY‬رشد داده شد و با استتفاده‬
          ‫پت‬
    ‫تد. تس از‬              ‫جت‬
                 ‫تنش ‪ PCR‬ان تام گرديت‬   ‫تده واكت‬  ‫تتررا شت‬   ‫تومي است‬‫از ‪ DNA‬ژنت‬
    ‫الكتروفورز محصول ‪ PCR‬روي ژل آگارزيک درصد، باند تکثير شده بطتول‬
      ‫حدود ‪ 9033 bp‬مشاهده گرديد(شكل4). قطعه تکثير شده با استتفاده از‬
    ‫‪ high pure PCR product purification kit‬از ژل استررا و خالص سازي گرديتد. جهتت‬
    ‫بررسي بيشتر، واكنش هضم آنزيمي با آنزيمهتاي ‪ SalI ،SacI ،HindIII‬و ‪PstI‬‬
    ‫الگوي مورد انتظار را ايجاد نمي نمود(شكل9). قطعه ‪ DNA‬تکثير شده‬
    ‫در وكتور 81‪ pUC‬كلون گرديده و با استفاده از هضم آنزيمی مورد تائيد‬
    ‫قرار گرفته و پالسميد نوتركيب به نام 1‪ pUCRM‬نامگذاري گرديد(شكل0).‬
    ‫در ادامه جهت بررسي بيشتر قطعه تکثير شده، وكتور نوتركيتب 1‪pUCRM‬‬
    ‫تعيي توالي گرديد. مقايسه حدود ‪ 4033bp‬از اي تتوالی بتا تتوالی‬
    ‫ثبت شده اي ژن در بانک ژنی نشان داد که قطعه کلون شده، مربوط به‬
                                   ‫ژن سنتز کننده آنزيم ‪ β-1,3 glucanase‬می باشد.‬
    ‫ژن ‪ β-1,3 glucanase‬کلون شده، توسط آنزيم ‪ XbaI‬از پالسميد 1‪ pUCRM‬ختار و‬
    ‫جايگزي ژن ‪ Gus A‬در وکتور بيانی گياهی 121‪ pBI‬گرديد. صحت ژن کلون‬
    ‫شده و جهت مناسب آن در وکتور توسط الگتوی ‪ PCR‬و نيتز هضتم آنزيمتی‬
    ‫مورد تأييد قرار گرفت (شکل 1). در ادامه با انتقال اي ژن به ‪cell‬‬
    ‫‪ suspenssion‬گياهی و بيان آنزيم می توان اثر آنزيم بيتان شتده را بتر‬
    ‫قارچ های بي ماريزای ن رود مورد مطال عه قرار داد. همچ ني می توان‬
    ‫‪ construct‬مذکور را جهت انتقتال بته نرتود جهتت مبتارزه بتا قارچهتای‬
                                     ‫بيماريزای آنها مورد استفاده قرار داد.‬

‫7‬    ‫6‬    ‫5‬   ‫4‬   ‫3‬   ‫2‬   ‫1‬   ‫‪M‬‬   ‫1‬    ‫2‬     ‫‪M‬‬        ‫1‬   ‫2‬   ‫3‬   ‫4‬   ‫‪M‬‬    ‫1‬     ‫‪M‬‬




    ‫ش تتتتتتتتتتکل 9‬
                 ‫ت‬                                          ‫ش تتتتتتتتتتکل 4‬  ‫ت‬
                            ‫شکل 1‬                                               ‫شکل 0‬
    ‫شكل4) محصول ‪ PCR‬بدست آمده از ‪ DNA‬ژنومی از ‪ T. virens‬با استتفاده از‬
                                   ‫دو پرايمر 1‪ Fbgn‬و 1‪ ،)4( Rbgn‬ماركر‪)M( 1kb‬‬
      ‫شکل 9) هضم آنزيمی محصول ‪PstI )1( ،SalI )0( ،SacI )9( ،HindII )4( ،PCR‬‬
    ‫(9) آنتزيم ‪ )4( XbaI‬محصتول ‪PCR‬‬           ‫شكل9) هضم آنزيمتي قطعته ‪~9033bp‬‬
                               ‫بدست آمده از پالسميد نوترکيب، (‪ )M‬ماركر‪.1kb‬‬
    ‫شکل1) تأييد کلون شدن ژن در 121‪ pBI‬با پرايمرهتای (4) 1‪)9( ،35sF/Fbgn‬‬
    ‫1.1‪)0( ،35sF/Rbgn1.1 )3( ،Fbgn1/35sF )1( ،Fbgn1.1/Rbgn1.1 )0( ،35sF/Rbgn‬‬
                                                   ‫1.1‪Negative control )5( ،Fbgn1/Rbgn‬‬
                               ‫ل‬            ‫او‬
                       ‫مقاالت ّلين همايش م ّي حبوبات‬
      ‫29 و30 آبان 1304- مشهد مقدس- پژوهشكدة علوم گياهي دانشگاه فردوسي مشهد‬
617



           Isolation, cloning and sequencing of β-1,3 glucanase of Trichoderma virens
                                  1           1            1                   2
               Mohammadzadeh R. , Zamani M.R. , Motallebi M. , and Bidmeshkipour A.
                1
                   National Istitiute for Genetic Engineering & Biotechnology (NIGEB), Tehran, Iran.
                          2
                            Biology Dept., Faculty of Science, Razi Univ., Kermanshah, Iran.


Abstract
      Trichoderma virens produces a variety of glucanase enzymes that degrade glucan and play an
      important role in biological control of fungal diseases. In order to amplify and sequence the β-1,3
      glucanase, the extraction of genomic DNA was done by CTAB method using T.virens. The β-1,3
      glucanase gene was amplified with Fbgn1.1/Rbgn1 primers which contains XbaI site at their 5
      ends. The PCR product was confirmed by apropriate restriction enzymes. Pfu DNA polymerase-
      PCR product was cloned in XbaI site of pUC18 vector and sequenced. Comparisson of about 1600
      bp nucleotide sequence of this gene with the Genbank data confirmed this amplified gene as β-1,3
      glucanase. GusA from pBI121 plant expression vector was replaced with the cloned β-1,3
      glucanase. This constrauct could be used to transforme chickpea plant with β-1,3 glucanase
      against the phytopathogenic fungi such as Fusarium oxysporum and Ascochyta rabiei.
      Key words: Trichoderma virens , β-1,3 glucanase, Fusarium oxysporum, Ascochyta rabiei

								
To top